National Library of Energy BETA

Sample records for kp moran rt

  1. John A. Moran Eye Center

    E-Print Network [OSTI]

    Marc, Robert E.

    Normann Professor of Biomedical Engineering Adjunct Professor of Ophthalmology Artificial Vision Bradley#12;The John A. Moran Eye Center 2011 Visualizing Vision #12;John A. Moran Eye Center Research Profile · The Vision Institute · 21 NIH grants (18 JMEC, Vision Core) · 20 research

  2. Robert E. Marc Moran Eye Center

    E-Print Network [OSTI]

    Marc, Robert E.

    #12;Robert E. Marc Moran Eye Center University of Utah Disclosure REM is a principal of Signature IN RETINAL NEUROANATOMY Marc RE 2010 Synaptic Organization of the retina. Adler's Physiology of the Eye 7(3): e1000074 Marc RE 2009 Functional Anatomy of the Retina. Duane's Foundations of Clinical

  3. KP solitons in shallow water

    E-Print Network [OSTI]

    Yuji Kodama

    2010-04-26

    The main purpose of the paper is to provide a survey of our recent studies on soliton solutions of the Kadomtsev-Petviashvili (KP) equation. The classification is based on the far-field patterns of the solutions which consist of a finite number of line-solitons. Each soliton solution is then defined by a point of the totally non-negative Grassmann variety which can be parametrized by a unique derangement of the symmetric group of permutations. Our study also includes certain numerical stability problems of those soliton solutions. Numerical simulations of the initial value problems indicate that certain class of initial waves asymptotically approach to these exact solutions of the KP equation. We then discuss an application of our theory to the Mach reflection problem in shallow water. This problem describes the resonant interaction of solitary waves appearing in the reflection of an obliquely incident wave onto a vertical wall, and it predicts an extra-ordinary four-fold amplification of the wave at the wall. There are several numerical studies confirming the prediction, but all indicate disagreements with the KP theory. Contrary to those previous numerical studies, we find that the KP theory actually provides an excellent model to describe the Mach reflection phenomena when the higher order corrections are included to the quasi-two dimensional approximation. We also present laboratory experiments of the Mach reflection recently carried out by Yeh and his colleagues, and show how precisely the KP theory predicts this wave behavior.

  4. Public Data Structures: Counters as a Special Case Shlomo Moran

    E-Print Network [OSTI]

    Taubenfeld, Gadi

    Public Data Structures: Counters as a Special Case Hagit Brit Shlomo Moran Gadi Taubenfeld§ June 4, 2001 Abstract A public data structure is required to work correctly in a concurrent environment where many processes may try to access it, possibly at the same time. In implementing such a structure

  5. City of Moran, Kansas (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran, Kansas

  6. Identification of Local Clusters for Count Data: A Model-Based Moran's I Test

    E-Print Network [OSTI]

    Zhang, Tonglin

    in detecting local clusters by local association terms with an acceptable type I error probability. When usedIdentification of Local Clusters for Count Data: A Model-Based Moran's I Test Tonglin Zhang and Ge@wvu.edu 0 #12;Identification of Local Clusters for Count Data: A Model-Based Moran's I Test Abstract We set

  7. Construction of KP solitons from wave patterns

    E-Print Network [OSTI]

    Sarbarish Chakravarty; Yuji Kodama

    2013-09-10

    We often observe that waves on the surface of shallow water form complex web-like patterns. They are examples of nonlinear waves, and these patterns are generated by nonlinear interactions among several obliquely propagating waves. In this note, we discuss how to construct an exact soliton solution of the KP equation from such web-pattern of shallow water wave. This can be regarded as an "inverse problem" in the sense that by measuring certain metric data of the solitary waves in the given pattern, it is possible to construct an exact KP soliton solution which can describe the non-stationary dynamics of the pattern.

  8. On KP-integrable Hurwitz functions

    E-Print Network [OSTI]

    Alexandrov, A; Morozov, A; Natanzon, S

    2014-01-01

    There is now a renewed interest to the Hurwitz tau-function, counting the isomorphism classes of Belyi pairs, arising in the study of equilateral triangulations and Grothiendicks's dessins d'enfant. It is distinguished by belonging to a particular family of Hurwitz tau-functions, possessing conventional Toda/KP integrability properties. We explain how the variety of recent observations about this function fits into the general theory of matrix model tau-functions. All such quantities possess a number of different descriptions, related in a standard way: these include Toda/KP integrability, several kinds of W-representations (we describe four), two kinds of integral (multi-matrix model) descriptions (of Hermitian and Kontsevich types), Virasoro constraints, character expansion, embedding into generic set of Hurwitz tau-functions and relation to knot theory. When approached in this way, the family of models in the literature has a natural extension, and additional integrability with respect to associated new ti...

  9. KP Renewables Plc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgency (IRENA) Jump to: navigation,WindJust Wind LLC JumpKP

  10. Basing Cryptographic Protocols on Tamper-Evident Tal Moran,a,1,2

    E-Print Network [OSTI]

    Moran, Tal

    Basing Cryptographic Protocols on Tamper-Evident Seals$ Tal Moran,a,1,2 , Moni Naora,3 a are called "tamper-evident seals". Another physical object with this property is the "scratch-off card", of- ten used in lottery tickets. We consider three variations of tamper-evident seals, and show that under

  11. Anonymity and CSP for Voting Systems Murat Moran, James Heather, Steve Schneider

    E-Print Network [OSTI]

    Doran, Simon J.

    Anonymity and CSP for Voting Systems Murat Moran, James Heather, Steve Schneider Department Processes (CSP). In addition, we formalise conventional voting system with CSP and analyse whether our and the weak anonymity is more suitable specification for the voting processes. Keywords: anonymity, CSP

  12. Kaonic hydrogen versus the $K^{-}p$ low energy data

    E-Print Network [OSTI]

    A. Cieply; J. Smejkal

    2008-01-18

    We present an exact solution to the $K^{-}$-proton bound state problem formulated in the momentum space. The 1s level characteristics of the kaonic hydrogen are computed simultaneously with the available low energy $K^{-}p$ data. In the strong interaction sector the meson-baryon interactions are described by means of an effective (chirally motivated) separable potential and its parameters are fitted to the experimental data.

  13. Kaonic hydrogen versus the $K^{-}p$ low energy data

    E-Print Network [OSTI]

    Cieply, A

    2007-01-01

    We present an exact solution to the $K^{-}$-proton bound state problem formulated in the momentum space. The 1s level characteristics of the kaonic hydrogen are computed simultaneously with the available low energy $K^{-}p$ data. In the strong interaction sector the meson-baryon interactions are described by means of an effective (chirally motivated) separable potential and its parameters are fitted to the experimental data.

  14. Public Data Structures: Counters as a Special Case \\Lambda Hagit Brit y Shlomo Moran yz Gadi Taubenfeld x

    E-Print Network [OSTI]

    Moran, Shlomo

    Public Data Structures: Counters as a Special Case \\Lambda Hagit Brit y Shlomo Moran yz Gadi Taubenfeld x June 5, 2001 Abstract A public data structure is required to work correctly in a concurrent such a structure nothing can be assumed in advance about the number or the identities of the processes that might

  15. JV between KP Renewables and Living Buildings | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8,Open EnergyIssaquah,Energy InformationIncKP

  16. THEMATIC ISSUE ARTICLE: SYNTHESIS (rt9mheri1) Simulating a Model of Metabolic Closure

    E-Print Network [OSTI]

    -Bowden · Gabriel Piedrafita · Federico Mora´n · Mari´a Luz Ca´rdenas · Francisco Montero Received: 14 March 2012-Marseille Universite´, Marseille, France e-mail: acornish@imm.cnrs.fr G. Piedrafita Á F. Mora´n Á F. Montero Facultad

  17. MORAN, AMY CHRISTINE. A North Carolina Field Study to Evaluate Greenroof Runoff Quantity, Runoff Quality, and Plant Growth. (Under the direction of Gregory D. Jennings

    E-Print Network [OSTI]

    Hunt, William F.

    ABSTRACT MORAN, AMY CHRISTINE. A North Carolina Field Study to Evaluate Greenroof Runoff Quantity greenroofs were constructed for research and demonstration purposes in North Carolina; the first in North Carolina are Delosperma nubigenum, Sedum album, Sedum album murale, Sedum floriferum, Sedum

  18. DFTand k.p modellingof the phase transitions of lead and tin halideperovskites for photovoltaic cells

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    DFTand k.p modellingof the phase transitions of lead and tin halideperovskites for photovoltaic Rennes, UMR 6226, 35042 Rennes, France KeywordsPerovskite, photovoltaic, first-principles calculations, k these hybrid semiconductor photovoltaic cells(HSPC) maydiffer from the one of dye-sensitized solar cells (DSSC

  19. Session KP1.118 Stability of a Levitated Dipole Confined Plasma

    E-Print Network [OSTI]

    Session KP1.118 Stability of a Levitated Dipole Confined Plasma in Closed Line magnetic Fields J ON CONVECTIVE CELLS 1 #12;ABSTRACT The confinement of a plasma in a levitated dipole has been shown to possess is exceeded the initial value solutions indicate the formation of convective cells. By assuming a simple flow

  20. moran-98.pdf

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryMIII: TheJoint Statisticsmolybdenum |NERSC,77

  1. moran-99.PDF

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryMIII: TheJoint Statisticsmolybdenum

  2. MAGNETIC CONFINEMENT OF RADIOTHERAPY BEAM-DOSE F.D. Becchetti, D.W. Litzenberg, J.M. Moran, T.W. O'Donnell, D.A. Roberts, B.A. Fraass, D.L.

    E-Print Network [OSTI]

    Becchetti, Fred

    MAGNETIC CONFINEMENT OF RADIOTHERAPY BEAM-DOSE PROFILES F.D. Becchetti, D.W. Litzenberg, J.M. Moran the magnetic confinement of HE electron and photon beam-dose profiles for typical radiotherapy beams. The HE magnetic field can provide a substantial improvement and control of the dose profile of clinical electron

  3. Soliton solutions of the KP equation and application to shallow water waves

    E-Print Network [OSTI]

    Sarvarish Chakravarty; Yuji Kodama

    2009-04-17

    The main purpose of this paper is to give a survey of recent development on a classification of soliton solutions of the KP equation. The paper is self-contained, and we give a complete proof for the theorems needed for the classification. The classification is based on the Schubert decomposition of the real Grassmann manifold, Gr$(N,M)$, the set of $N$-dimensional subspaces in $\\mathbb{R}^M$. Each soliton solution defined on Gr$(N,M)$ asymptotically consists of the $N$ number of line-solitons for $y\\gg 0$ and the $M-N$ number of line-solitons for $y\\ll 0$. In particular, we give the detailed description of those soliton solutions associated with Gr$(2,4)$, which play a fundamental role of multi-soliton solutions. We then consider a physical application of some of those solutions related to the Mach reflection discussed by J. Miles in 1977.

  4. Bispectrality of $N$-Component KP Wave Functions: A Study in Non-Commutativity

    E-Print Network [OSTI]

    Alex Kasman

    2015-06-09

    A wave function of the $N$-component KP Hierarchy with continuous flows generated by $z$ times the powers of an invertible matrix $H$ is constructed from the choice an $MN$-dimensional space of finitely-supported vector distributions. This wave function is shown to be an eigenfunction for a ring of matrix differential operators in $x$ having eigenvalues that are matrix functions of the spectral parameter $z$. If the space of distributions is invariant under left multiplication by $H$, then a matrix coefficient differential-translation operator in $z$ is shown to share this eigenfunction and have an eigenvalue that is a matrix function of $x$. This paper not only generates new examples of bispectral operators, it also explores the consequences of non-commutativity for techniques and objects used in previous investigations.

  5. Parallel Picoliter RT-PCR Assays Using Microfluidics

    E-Print Network [OSTI]

    Quake, Stephen R.

    Parallel Picoliter RT-PCR Assays Using Microfluidics Joshua S. Marcus,, W. French Anderson The development of microfluidic tools for high-throughput nucleic acid analysis has become a burgeoning area of research in the post-genome era. Here, we have developed a microfluidic chip to perform 72 parallel 450-p

  6. RT-PCR cloning of expressed VSGs Harvesting cells

    E-Print Network [OSTI]

    Cross, George

    RT-PCR cloning of expressed VSGs Harvesting cells Starting material: 5­10x107 cells (BF) Centrifuge for at least 1 month). RNA extraction STAT-60 according to manufacturer's instructions. Resuspend RNA in 50 µl of DEPC-treated water. Measuring the A260 will suggest a yield of ~ 100 µg RNA from 108 cells

  7. Instruments of RT-2 Experiment onboard CORONASPHOTON and their test and evaluation II: RT-2/CZT payload

    E-Print Network [OSTI]

    Kotoch, Tilak B; Debnath, D; Malkar, J P; Rao, A R; Hingar, M K; Madhav, Vaibhav P; Sreekumar, S; Chakrabarti, Sandip K; 10.1007/s10686-010-9189-y

    2010-01-01

    Cadmium Zinc Telluride (CZT) detectors are high sensitivity and high resolution devices for hard X-ray imaging and spectroscopic studies. The new series of CZT detector modules (OMS40G256) manufactured by Orbotech Medical Solutions (OMS), Israel, are used in the RT-2/CZT payload onboard the CORONAS-PHOTON satellite. The CZT detectors, sensitive in the energy range of 20 keV to 150 keV, are used to image solar flares in hard X-rays. Since these modules are essentially manufactured for commercial applications, we have carried out a series of comprehensive tests on these modules so that they can be confidently used in space-borne systems. These tests lead us to select the best three pieces of the 'Gold' modules for the RT-2/CZT payload. This paper presents the characterization of CZT modules and the criteria followed for selecting the ones for the RT-2/CZT payload. The RT-2/CZT payload carries, along with three CZT modules, a high spatial resolution CMOS detector for high resolution imaging of transient X-ray ev...

  8. Cooling Neutron Stars and Super uidity in Their Interiors D.G. Yakovlev, K.P. Leven sh, Yu.A. Shibanov

    E-Print Network [OSTI]

    Cooling Neutron Stars and Super uidity in Their Interiors D.G. Yakovlev, K.P. Leven#12;sh, Yu). The results are used for cooling simulations of isolated neutron stars. Both, the standard cooling and the cooling enhanced by the direct Urca process, are strongly a#11;ected by nucleon super uidity. Comparison

  9. Vapor deposition of platinum alloyed nickel aluminide coatings Z. Yu , K.P. Dharmasena, D.D. Hass, H.N.G. Wadley

    E-Print Network [OSTI]

    Wadley, Haydn

    for the thermal and oxidation protection of high temperature components used in advanced gas turbine and dieselVapor deposition of platinum alloyed nickel aluminide coatings Z. Yu , K.P. Dharmasena, D.D. Hass, H.N.G. Wadley Department of Materials Science and Engineering University of Virginia Charlottesville

  10. Energy dependence of K?, p? and Kp fluctuations in Au+Au collisions from ?sNN=7.7 to 200 GeV

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Adamczyk, L.

    2015-08-07

    A search for the quantum chromodynamics (QCD) critical point was performed by the STAR experiment at the Relativistic Heavy Ion Collider, using dynamical fluctuations of unlike particle pairs. Heavy ion collisions were studied over a large range of collision energies with homogeneous acceptance and excellent particle identification, covering a significant range in the QCD phase diagram where a critical point may be located. Dynamical K?, p?, and Kp fluctuations as measured by the STAR experiment in central 0–5% Au+Au collisions from center-of-mass collision energies ?sNN=7.7 to 200 GeV are presented. The observable ?dyn was used to quantify the magnitude ofmore »the dynamical fluctuations in event-by-event measurements of the K?, p?, and Kp pairs. The energy dependences of these fluctuations from central 0–5% Au+Au collisions all demonstrate a smooth evolution with collision energy.« less

  11. CAMELEON-RT: a Software Architecture Reference Model for Distributed, Migratable, and Plastic User

    E-Print Network [OSTI]

    CAMELEON-RT: a Software Architecture Reference Model for Distributed, Migratable, and Plastic User the problem space of distributed, migratable and plastic user interfaces, and presents CAMELEON-RT1 for distributed, migratable, and plastic user inter- faces. We have developed an early implementation of a run

  12. GreenRT: A Framework for the Design of Power-Aware Soft Real-Time Applications

    E-Print Network [OSTI]

    Mori, Greg

    and energy consumption. We experiment with GreenRT in the context of a pedestrian detection applica- tion. We show that using the GreenRT framework, appli- cations use less energy while meeting deadlines. EnergyGreenRT: A Framework for the Design of Power-Aware Soft Real-Time Applications Bo Chen, William Pak

  13. Test of universal rise of hadronic total cross sections based on {pi}p, Kp and pp, pp scatterings

    SciTech Connect (OSTI)

    Ishida, Muneyuki; Igi, Keiji [Department of Physics, School of Science and Engineering, Meisei University, Hino, Tokyo 191-8506 (Japan); Theoretical Physics Laboratory, RIKEN, Wako, Saitama 351-0198 (Japan)

    2009-05-01

    Recently, there have been several evidences that the hadronic total cross section {sigma}{sub tot} is proportional to Blog{sup 2}s, which is consistent with the Froissart unitarity bound. The COMPETE Collaboration has further assumed {sigma}{sub tot}{approx_equal}Blog{sup 2}(s/s{sub 0})+Z to extend its universal rise with the common values of B and s{sub 0} for all hadronic scatterings to reduce the number of adjustable parameters. It was suggested that the coefficient B was universal in the arguments of the color glass condensate of QCD in recent years. However, there has been no rigorous proof yet based only on QCD. We attempt to investigate the value of B for {pi}{sup {+-}}p, K{sup {+-}}p and pp, pp scatterings, respectively, through the search for the simultaneous best fit to the experimental {sigma}{sub tot} and {rho} ratios at high energies. The {sigma}{sub tot} at the resonance- and intermediate-energy regions has also been exploited as a duality constraint based on the special form of the finite-energy sum rule. We estimate the values of B, s{sub 0}, and Z individually for {pi}{sup {+-}}p, K{sup {+-}}p and pp, pp scatterings without using the universality hypothesis. It turns out that the values of B are mutually consistent within 1 standard deviation. It has to be stressed that we cannot obtain such a definite conclusion without the duality constraint. It is also interesting to note that the values of Z for {pi}p, Kp, and p(p)p approximately satisfy the ratio 2 ratio 2 ratio 3 predicted by the quark model. The obtained value of B for p(p)p is B{sub pp}=0.280{+-}0.015 mb, which predicts {sigma}{sub tot}{sup pp}=108.0{+-}1.9 mb and {rho}{sup pp}=0.131{+-}0.0025 at the LHC energy {radical}(s)=14 TeV.

  14. Intra-arterial administration of recombinant tissue-type plasminogen activator (rt-PA) causes more intracranial bleeding than does intravenous rt-PA in a transient rat middle cerebral artery occlusion model

    E-Print Network [OSTI]

    2011-01-01

    Access Intra-arterial administration of recombinant tissue-Intra-arterial (IA) administration of rt-PA for ischemicwith IA or intravenous (IV) administration especially as the

  15. Full band structure LDA and kp calculations of optical spin-injection F. Nastos,1 J. Rioux,1 M. Strimas-Mackey,1 Bernardo S. Mendoza,2 and J. E. Sipe1

    E-Print Network [OSTI]

    Sipe,J. E.

    Full band structure LDA and k·p calculations of optical spin-injection F. Nastos,1 J. Rioux,1 M; published 20 November 2007 We present a study of optical electron spin-injection optical orientation in the bulk semiconductors GaAs, Si, and CdSe from direct optical excitation with circularly polarized light

  16. LIVE CARS FOR USE IN CATFISH INDUSTRY Donald C. ,r nland, Rob rt L. ..rill,

    E-Print Network [OSTI]

    LIVE CARS FOR USE IN CATFISH INDUSTRY Donald C. ,r nland, Rob rt L. ..rill, & Jam's . IIall Live cars - -m sh "fish -holdmg bags "- -hav a vari tyof applications in th produ tion of pond - rai d chann fish to mov into th liv car . Information on holding capaciti and a m thod to accu- rat ly m t l' fish

  17. Power Minimization Techniques at the RT-Level and Afshin Abdollahi and Massoud Pedram

    E-Print Network [OSTI]

    Pedram, Massoud

    1 Power Minimization Techniques at the RT-Level and Below Afshin Abdollahi and Massoud Pedram Dept. of Electrical Engineering University of Southern California Los Angeles, CA 90089 U.S.A. Abstract ­ Power consumption and power-related issues have become a first-order concern for most designs and loom

  18. Modeling benzene plume elongation mechanisms exerted by ethanol using RT3D with a general

    E-Print Network [OSTI]

    Alvarez, Pedro J.

    Modeling benzene plume elongation mechanisms exerted by ethanol using RT3D with a general substrate ethanol on benzene fate and transport in fuel-contaminated groundwater and to discern the most influential benzene plume elongation mechanisms. The model, developed as a module for the Reactive Transport in 3

  19. RT-Based Administrative Models for Community Cyber Security Information Sharing

    E-Print Network [OSTI]

    Sandhu, Ravi

    RT-Based Administrative Models for Community Cyber Security Information Sharing Ravi Sandhu, Khalid Zaman Bijon Institute for Cyber Security World-Leading Research with Real Ravi Sandhu, Khalid Zaman Bijon Institute for Cyber Security University of Texas at San Antonio Oct. 15, 2011 International

  20. RT-Based Administrative Models for Community Cyber Security Information Sharing

    E-Print Network [OSTI]

    Sandhu, Ravi

    RT-Based Administrative Models for Community Cyber Security Information Sharing Ravi Sandhu, Khalid Zaman Bijon, Xin Jin, and Ram Krishnan Institute for Cyber Security & Department of Computer Science Institute for Cyber Security & Department of Electrical and Computer Engineering University of Texas at San

  1. Development of one-step SYBR Green real-time RT-PCR for quantifying bovine viral diarrhea virus type-1 and its comparison with conventional RT-PCR

    E-Print Network [OSTI]

    Zhang, Ni; Liu, Zhengwen; Han, Qunying; Qiu, Jianming; Chen, Jinghong; Zhang, Guoyu; Li, Zhu; Lou, Sai; Li, Na

    2011-07-29

    Background Bovine viral diarrhea virus (BVDV) is a worldwide pathogen in cattle and acts as a surrogate model for hepatitis C virus (HCV). One-step real-time fluorogenic quantitative reverse transcription polymerase chain reaction (RT-PCR) assay...

  2. Frog fence along Vermont Rt. 2 in sandbar wildlife management area collaboration between Vermont Agency of Transportation and Vermont Agency of Natural Resources

    E-Print Network [OSTI]

    Hoffman, Nelson

    2003-01-01

    FROG FENCE ALONG VERMONT RT. 2MANAGEMENT AREA COLLABORATION BETWEEN VERMONT AGENCY OFTRANSPORTATION AND VERMONT AGENCY OF NATURAL RESOURCES

  3. SU-E-J-42: Customized Deformable Image Registration Using Open-Source Software SlicerRT

    SciTech Connect (OSTI)

    Gaitan, J Cifuentes; Chin, L; Pignol, J; Kirby, N; Pouliot, J; Lasso, A; Pinter, C; Fichtinger, G

    2014-06-01

    Purpose: SlicerRT is a flexible platform that allows the user to incorporate the necessary images registration and processing tools to improve clinical workflow. This work validates the accuracy and the versatility of the deformable image registration algorithm of the free open-source software SlicerRT using a deformable physical pelvic phantom versus available commercial image fusion algorithms. Methods: Optical camera images of nonradiopaque markers implanted in an anatomical pelvic phantom were used to measure the ground-truth deformation and evaluate the theoretical deformations for several DIR algorithms. To perform the registration, full and empty bladder computed tomography (CT) images of the phantom were obtained and used as fixed and moving images, respectively. The DIR module, found in SlicerRT, used a B-spline deformable image registration with multiple optimization parameters that allowed customization of the registration including a regularization term that controlled the amount of local voxel displacement. The virtual deformation field at the center of the phantom was obtained and compared to the experimental ground-truth values. The parameters of SlicerRT were then varied to improve spatial accuracy. To quantify image similarity, the mean absolute difference (MAD) parameter using Hounsfield units was calculated. In addition, the Dice coefficient of the contoured rectum was evaluated to validate the strength of the algorithm to transfer anatomical contours. Results: Overall, SlicerRT achieved one of the lowest MAD values across the algorithm spectrum, but slightly smaller mean spatial errors in comparison to MIM software (MIM). On the other hand, SlicerRT created higher mean spatial errors than Velocity Medical Solutions (VEL), although obtaining an improvement on the DICE to 0.91. The large spatial errors were attributed to the poor contrast in the prostate bladder interface of the phantom. Conclusion: Based phantom validation, SlicerRT is capable of achieving comparable DIR accuracy to commercial programs such as MIM and VEL.

  4. Implementation and commissioning of an integrated micro-CT/RT system with computerized independent jaw collimation

    SciTech Connect (OSTI)

    Jensen, Michael D.; Hrinivich, W. Thomas; Jung, Jongho A.; Holdsworth, David W.; Department of Medical Biophysics, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Surgery, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7 ; Drangova, Maria; Chen, Jeff; Department of Medical Biophysics, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Oncology, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7 ; Wong, Eugene; Department of Medical Biophysics, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Oncology, The University of Western Ontario, 1151 Richmond Street, London, Ontario N6A 3K7; Department of Physics and Engineering, London Regional Cancer Program, London Health Sciences Centre, 800 Commissioners Road East, London, Ontario N6A 5W9

    2013-08-15

    Purpose: To design, construct, and commission a set of computer-controlled motorized jaws for a micro-CT/RT system to perform conformal image-guided small animal radiotherapy.Methods: The authors designed and evaluated a system of custom-built motorized orthogonal jaws, which allows the delivery of off-axis rectangular fields on a GE eXplore CT 120 preclinical imaging system. The jaws in the x direction are independently driven, while the y-direction jaws are symmetric. All motors have backup encoders, verifying jaw positions. Mechanical performance of the jaws was characterized. Square beam profiles ranging from 2 × 2 to 60 × 60 mm{sup 2} were measured using EBT2 film in the center of a 70 × 70 × 22 mm{sup 3} solid water block. Similarly, absolute depth dose was measured in a solid water and EBT2 film stack 50 × 50 × 50 mm{sup 3}. A calibrated Farmer ion chamber in a 70 × 70 × 20 mm{sup 3} solid water block was used to measure the output of three field sizes: 50 × 50, 40 × 40, and 30 × 30 mm{sup 2}. Elliptical target plans were delivered to films to assess overall system performance. Respiratory-gated treatment was implemented on the system and initially proved using a simple sinusoidal motion phantom. All films were scanned on a flatbed scanner (Epson 1000XL) and converted to dose using a fitted calibration curve. A Monte Carlo beam model of the micro-CT with the jaws has been created using BEAMnrc for comparison with the measurements. An example image-guided partial lung irradiation in a rat is demonstrated.Results: The averaged random error of positioning each jaw is less than 0.1 mm. Relative output factors measured with the ion chamber agree with Monte Carlo simulations within 2%. Beam profiles and absolute depth dose curves measured from the films agree with simulations within measurement uncertainty. Respiratory-gated treatments applied to a phantom moving with a peak-to-peak amplitude of 5 mm showed improved beam penumbra (80%–20%) from 3.9 to 0.8 mm.Conclusions: A set of computer-controlled motorized jaws for a micro-CT/RT system were constructed with position reliably better than a tenth of a millimeter. The hardware system is ready for image-guided conformal radiotherapy for small animals with capability of respiratory-gated delivery.

  5. Automatic Systole-Diastole Classification of Mitral Valve Complex from RT-3D Echocardiography based on Multiresolution Processing

    E-Print Network [OSTI]

    Wong, Kenneth K.Y.

    Automatic Systole-Diastole Classification of Mitral Valve Complex from RT-3D Echocardiography based, The Chinese University of Hong Kong, Hong Kong ABSTRACT Mitral valve repair is one of the most prevalent operations for various mitral valve conditions. Echocardiography, being famous for its low-cost, non

  6. Oceanography Vol.21, No.392 W o r k s h o p r e p o rt

    E-Print Network [OSTI]

    Buesseler, Ken

    Oceanography Vol.21, No.392 W o r k s h o p r e p o rt Controls on organic Carbon exportUroCeANs Workshop Vrije Universiteit Brussel · May 28­30, 2008 ThisarticlehasbeenpublishedinOceanography,Volume21,Number3,aquarterlyjournalofTheOceanographySociety.Copyright2008byTheOceanography

  7. Diagnostic evaluation of a multiplexed RT-PCR microsphere array assay for the detection of foot-and-mouth disease virus and look-alike disease viruses

    SciTech Connect (OSTI)

    Hindson, B J; Reid, S M; Baker, B R; Ebert, K; Ferris, N P; Bentley Tammero, L F; Lenhoff, R J; Naraghi-Arani, P; Vitalis, E A; Slezak, T R; Hullinger, P J; King, D P

    2007-07-26

    A high-throughput multiplexed assay was developed for the differential laboratory diagnosis of foot-and-mouth disease virus (FMDV) from viruses which cause clinically similar diseases of livestock. This assay simultaneously screens for five RNA and two DNA viruses using multiplexed reverse transcription PCR (mRT-PCR) amplification coupled with a microsphere hybridization array and flow-cytometric detection. Two of the seventeen primer-probe sets included in this multiplex assay were adopted from previously characterized real-time RT-PCR (rRT-PCR) assays for FMDV. The diagnostic accuracy of the mRT-PCR was evaluated using 287 field samples, including 248 (true positive n= 213, true negative n=34) from suspect cases of foot-and-mouth disease collected from 65 countries between 1965 and 2006 and 39 true negative samples collected from healthy animals. The mRT-PCR assay results were compared with two singleplex rRT-PCR assays, using virus isolation with antigen-ELISA as the reference method. The diagnostic sensitivity of the mRT-PCR assay for FMDV was 93.9% [95% C.I. 89.8-96.4%], compared to 98.1% [95% C.I. 95.3-99.3%] for the two singleplex rRT-PCR assays used in combination. In addition, the assay could reliably differentiate between FMDV and other vesicular viruses such as swine vesicular disease virus and vesicular exanthema of swine virus. Interestingly, the mRT-PCR detected parapoxvirus (n=2) and bovine viral diarrhea virus (n=2) in clinical samples, demonstrating the screening potential of this mRT-PCR assay to identify viruses in FMDV-negative material not previously recognized using focused single-target rRT-PCR assays.

  8. Reduced Toxicity With Intensity Modulated Radiation Therapy (IMRT) for Desmoplastic Small Round Cell Tumor (DSRCT): An Update on the Whole Abdominopelvic Radiation Therapy (WAP-RT) Experience

    SciTech Connect (OSTI)

    Desai, Neil B.; Stein, Nicholas F.; LaQuaglia, Michael P.; Alektiar, Kaled M.; Kushner, Brian H.; Modak, Shakeel; Magnan, Heather M.; Goodman, Karyn; Wolden, Suzanne L.

    2013-01-01

    Purpose: Desmoplastic small round cell tumor (DSRCT) is a rare malignancy typically involving the peritoneum in young men. Whole abdominopelvic radiation therapy (WAP-RT) using conventional 2-dimensional (2D) radiation therapy (RT) is used to address local recurrence but has been limited by toxicity. Our objectives were to assess the benefit of intensity modulated radiation therapy (IMRT) on toxicity and to update the largest series on radiation for DSRCT. Methods and Materials: The records of 31 patients with DSRCT treated with WAP-RT (22 with 2D-RT and 9 with IMRT) between 1992 and 2011 were retrospectively reviewed. All received multi-agent chemotherapy and maximal surgical debulking followed by 30 Gy of WAP-RT. A further focal boost of 12 to 24 Gy was used in 12 cases. Boost RT and autologous stem cell transplantation were nearly exclusive to patients treated with 2D-RT. Toxicities were assessed with the Common Terminology Criteria for Adverse Events. Dosimetric analysis compared IMRT and simulated 2D-RT dose distributions. Results: Of 31 patients, 30 completed WAP-RT, with a median follow-up after RT of 19 months. Acute toxicity was reduced with IMRT versus 2D-RT: P=.04 for gastrointestinal toxicity of grade 2 or higher (33% vs 77%); P=.02 for grade 4 hematologic toxicity (33% vs 86%); P=.01 for rates of granulocyte colony-stimulating factor; and P=.04 for rates of platelet transfusion. Post treatment red blood cell and platelet transfusion rates were also reduced (P=.01). IMRT improved target homogeneity ([D05-D95]/D05 of 21% vs 46%) and resulted in a 21% mean bone dose reduction. Small bowel obstruction was the most common late toxicity (23% overall). Updated 3-year overall survival and progression-free survival rates were 50% and 24%, respectively. Overall survival was associated with distant metastasis at diagnosis on multivariate analysis. Most failures remained intraperitoneal (88%). Conclusions: IMRT for consolidative WAP-RT in DSRCT improves hematologic toxicity in particular. Although the long-term efficacy of current treatment options remains disappointing, the improved therapeutic index of IMRT may aid in generalizing its use and allowing the addition of novel approaches such as intraperitoneal immunotherapy.

  9. Cko.efer f. (i.f\\~f':tn\\ltt E'~~CS'\\'~ A~\\ !f~ \\fb a... 'T":~4.r.-t..

    E-Print Network [OSTI]

    Li, Kin-Yin

    QC~-®! Cko.efer f. (i.f\\~f':tn\\ltt E'~~CS'\\'~ A~\\ !f~ \\fb a... 'T":~4.r.-t.. ~c-l.;~. ~e...CA weo

  10. Eight-band k·p modeling of InAs/InGaAsSb type-II W-design quantum well structures for interband cascade lasers emitting in a broad range of mid infrared

    SciTech Connect (OSTI)

    Ryczko, K.; S?k, G.; Misiewicz, J. [Institute of Physics, Wroc?aw University of Technology, Wybrze?e Wyspia?skiego 27, 50-370 Wroc?aw (Poland)

    2013-12-14

    Band structure properties of the type-II W-design AlSb/InAs/GaIn(As)Sb/InAs/AlSb quantum wells have been investigated theoretically in a systematic manner and with respect to their use in the active region of interband cascade laser for a broad range of emission in mid infrared between below 3 to beyond 10??m. Eight-band k·p approach has been utilized to calculate the electronic subbands. The fundamental optical transition energy and the corresponding oscillator strength have been determined in function of the thickness of InAs and GaIn(As)Sb layers and the composition of the latter. There have been considered active structures on two types of relevant substrates, GaSb and InAs, introducing slightly modified strain conditions. Additionally, the effect of external electric field has been taken into account to simulate the conditions occurring in the operational devices. The results show that introducing arsenic as fourth element into the valence band well of the type-II W-design system, and then altering its composition, can efficiently enhance the transition oscillator strength and allow additionally increasing the emission wavelength, which makes this solution prospective for improved performance and long wavelength interband cascade lasers.

  11. CURRICULUM VITAE ROSALYN J MORAN PhD

    E-Print Network [OSTI]

    Moran, Rosalyn

    of Computational Neuroscience - Physica D - Biological Cybernetics - Frontiers in Human Neuroscience Ad, NOVA Technology Transfer Centre, University College Dublin. Nov 2005. Invited Speaker, Campus Company Development Program, NOVA Technology Transfer Centre, University College Dublin. Sept 2006. Student Award

  12. Metallicity Distribution in the Milky Way Disk Dana S. Balser, R.T. Rood, T.M. Bania, L.D. Anderson

    E-Print Network [OSTI]

    Balser, Dana S.

    al. (2006) Sun GC #12;Electron Temperature Radial Gradient K200)(T R)49257()4986406(T e galeMetallicity Distribution in the Milky Way Disk Dana S. Balser, R.T. Rood, T.M. Bania, L.D. Anderson Photo: Harry Morton #12;HII Region Electron Temperature and Metallicity Shaver et al. (1983) 1.15 e C L

  13. Assessing Terrain Stability in a GIS using SINMAP Pack, R.T. Research Associate Professor, Tarboton, D.G., Associate Professor1

    E-Print Network [OSTI]

    Tarboton, David

    Assessing Terrain Stability in a GIS using SINMAP Pack, R.T. Research Associate Professor, Tarboton State University, Logan, UT 84322-5230 Presented at the 15th annual GIS conference, GIS 2001, February 19-22, Vancouver, British Columbia Abstract SINMAP (Stability Index MAPping) is an ArcView GIS

  14. arXiv:1105.4207v1[math.RT]21May2011 Affine and degenerate affine BMW algebras: The center

    E-Print Network [OSTI]

    Ram, Arun

    arXiv:1105.4207v1[math.RT]21May2011 Affine and degenerate affine BMW algebras: The center Zajj of California, Davis One Shields Ave Davis, CA 95616 virk@math.ucdavis.edu Abstract The degenerate affine and affine BMW algebras arise naturally in the context of Schur- Weyl duality for orthogonal and symplectic

  15. The implementation of non pharmaceutical interventions(NPIs) in smaller to large communities and its relation to RO and R(t) during HIN1 pandemic 2009

    E-Print Network [OSTI]

    Hashmi, Sahar

    2011-01-01

    This thesis focuses on the use of non-pharmaceutical interventions (NPIs) during the time of the 2009 HINI pandemic and its possible relation to RO and R(t). RO is defined as the mean number of people that a newly infected ...

  16. Methanol Masers Observations in the 3-mm Bandwidth at the Radio Telescope RT-22 CrAO

    E-Print Network [OSTI]

    S. Yu. Zubrin; A. V. Antyufeyev; V. V. Myshenko; V. M. Shulga

    2007-12-10

    We report the beginning of the astronomical masers investigations in the 3-mm bandwidth at the radio telescope RT-22 (CrAO, Ukraine). For this purpose the special complex for maser lines investigation in 85...115 GHz frequency band is developed. It is made on the base of the low noise cryogenic Shottky-diode receiver and the high resolution Fourier-spectrometer. The cryogenic receiver has the DSB noise temperature less than 100K. The spectral channel separation of the Fourier-spectrometer is about 4kHz and the spectrometer bandwidth is 8 MHz. Results of maser observations of 8$^{0}-7^{1} $A$^{+}$ transition of methanol (95.169 GHz) towards DR-21(OH), DR-21W and NGC7538 are in good agreement with early obtained results by other authors. On the basis of the analysis of the location of masers in the NGC7538 direction we can assume that the origin of all known class I methanol masers in this region is connected with existing molecular outflows from young stars.

  17. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    version electronically. (b) Training Requirements. Any Contractor personnel who will enter a government site to perform work shall have completed all of the ES&H training...

  18. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    who require access must be U.S. citizens, or foreign nationals who are legal aliens or have the required authorization to perform work in the U.S. and must meet rules of...

  19. Austin(2)-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O O DBiomass andAtoms for PeaceAugustAugust,Stratus Sensing in

  20. RepoRt B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners *ReindustrializationEnergyWind Energy Wind FindBPA Profile The

  1. RepoRt B

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMassR&D100 Winners *ReindustrializationEnergyWind Energy Wind FindBPA Profile The1

  2. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The EnergyRyanPhysics6/14/11 Page 1 of6432-NIRT

  3. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The EnergyRyanPhysics6/14/11 Page 1 of6432-NIRTRT

  4. SF 6432-RT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The EnergyRyanPhysics6/14/11 Page 1 of6432-NIRTRTRT

  5. Application of real time transient temperature (RT{sup 3}) program on nuclear power plant HVAC analysis

    SciTech Connect (OSTI)

    Cai, Y.; Tomlins, V.A.; Haskell, N.L.; Giffels, F.W.

    1996-08-01

    A database oriented technical analysis program (RT) utilizing a lumped parameter model combined with a finite difference method was developed to concurrently simulate transient temperatures in single or multiple room(s)/area(s). Analyses can be seen for postulated design basis events, such as, 10CFR50 Appendix-R, Loss of Coolant Accident concurrent with Loss of Offsite Power (LOCA/LOOP), Station BlackOut (SBO), and normal station operating conditions. The rate of change of the air temperatures is calculated by explicitly solving a series of energy balance equations with heat sources and sinks that have been described. For building elements with heat absorbing capacity, an explicit Forward Time Central Space (FTCS) model of one dimensional transient heat conduction in a plane element is used to describe the element temperature profile. Heat migration among the rooms/areas is considered not only by means of conduction but also by means of natural convection induced by temperature differences through openings between rooms/areas. The program also provides a means to evaluate existing plant HVAC system performance. The performance and temperature control of local coolers/heaters can be also simulated. The program was used to calculate transient temperature profiles for several buildings and rooms housing safety-related electrical components in PWR and BWR nuclear power plants. Results for a turbine building and reactor building in a BWR nuclear power plant are provided here. Specific calculational areas were defined on the basis of elevation, physical barriers and components/systems. Transient temperature profiles were then determined for the bounding design basis events with winter and summer outdoor air temperatures.

  6. Preparation of genomic DNA for PCR 1. Centrifuge 5 mL of a saturated overnight culture of yeast cells at 5000 x g for 5 min at RT.

    E-Print Network [OSTI]

    Pace, Norman

    Preparation of genomic DNA for PCR 1. Centrifuge 5 mL of a saturated overnight culture of yeast water. 3. Transfer volume to screw-cap eppi tube and centrifuge at 5,000 x g for 5 min at RT. 4L of sterile glass beads and 200 µL of phenol-chloroform-isoamyl alcohol. 7. Vortex 15 min at RT. 8. Centrifuge

  7. TU-F-17A-06: Motion Stability and Dosimetric Impact of Spirometer-Based DIBH-RT of Left-Sided Breast Cancer

    SciTech Connect (OSTI)

    McKenzie, E; Yang, W; Burnison, M; Mirhadi, A; Hakimian, B; Stephen, S; Robert, R; Yue, Y; Sandler, H; Fraass, B

    2014-06-15

    Purpose: Patients undergoing radiotherapy (RT) for left-sided breast cancer have increased risk of coronary artery disease. Deep Inhalation Breath Hold assisted RT (DIBH-RT) is shown to increase the geometric separation of the target area and heart, reducing cardiac radiation dose. The purposes of this study are to use Cine MV portal images to determine the stability of spirometer-guided DIBH-RT and examine the dosimetric cardiopulmonary impact of this technique. Methods: Twenty consecutive patients with left-sided breast cancer were recruited to the IRB-approved study. Free-breathing (FB) and DIBH-CT's were acquired at simulation. Rigid registration of the FB-CT and DIBH-CT was performed using primarily breast tissue. Treatment plans were created for each FB-CT and DIBH-CT using identical paired tangent fields with field-in-field or electronic compensation techniques. Dosimetric evaluation included mean and maximum (Dmax) doses for the left anterior descending artery (LAD), mean heart dose, and left lung V20. Cine MV portal images were acquired for medial and lateral fields during treatment. Analysis of Cine images involved chest wall segmentation using an algorithm developed in-house. Intra- and inter-fractional chest wall motion were determined through affine registration to the first frame of each Cine. Results: Dose to each cardiac structure evaluated was significantly (p<0.001) reduced with the DIBH plans. Mean heart dose decreased from 2.9(0.9–6.6) to 1.6(0.6–5.3) Gy; mean LAD dose from 16.6(3–43.6) to 7.4(1.7–32.7) Gy; and LAD Dmax from 35.4 (6.1–53) to 18.4(2.5–51.2) Gy. No statistically significant reduction was found for the left lung V20. Average AP and SI median chest wall motion (intrafractional) was 0.1 (SD=0.9) and 0.5 (SD=1.1) mm, respectively. Average AP inter-fractional chest wall motion was 2.0 (SD=1.4) mm. Conclusion: Spirometer-based DIBH treatments of the left breast are reproducible both inter- and intra-fractionally, and provide a statistically and potentially clinically useful dosimetric advantage to cardiac structures.

  8. Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out

    SciTech Connect (OSTI)

    Smith, S M; Danganan, L; Tammero, L; Vitalis, B; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed candidate multiplexed assays that may potentially be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the ability to improve our nation's capability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect food and agricultural resources with a diagnostic test which could enhance the nation's capabilities for early detection of a foreign animal disease. In FY2005 with funding from the DHS, LLNL developed the first version (Version 1.0) of a multiplexed (MUX) nucleic-acid-based RT-PCR assay that included signatures for foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases (FADs) of swine, Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease Virus (SVDV), and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus [BPSV], Orf of sheep, and Pseudocowpox). In FY06, LLNL has developed Bovine and Porcine species-specific panel which included existing signatures from Version 1.0 panel as well as new signatures. The MUX RT-PCR porcine assay for detection of FMDV includes the FADs, VESV and SVD in addition to vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome (PRRS). LLNL has also developed a MUX RT-PCR bovine assay for detection of FMDV with rule out tests for the two bovine FADs malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses (which are of two bovine types) bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). A timeline for this development is presented in Table 1. The development of the Version 1.0 panel for FMDV rule-out and the most current efforts aimed to designed species specific panels has spanned over 2 1/2 years with multiple collaborative partnerships. This document provides a summary of the development, testing and performance data at OIE Stage 1 Feasibility into Stage 2 Assay Development and Standardization1 (see Table 2), gathered as of June 30th, 2007 for the porcine and bovine MUX assay panels. We present an overview of the identification and selection of candidate genetic signatures, the assay development process, and preliminary performance data for each of the individual signatures as characterized in the multiplexed format for the porcine and bovine panels. The Stage 1 Feasibility data of the multiplexed panels is presented in this report also includes relevant data acquired from the Version 1.0 panel as supporting information where appropriate. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must precede efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available. As a summary report, this document does not provide the details of signature generation, evaluation, and testing, nor does it provide spec

  9. Cloud Monitoring for Large Cosmic Ray Sites R.W. Clay, B.R. Dawson, R.T. Pace, D.S. Riordan, A.G.K. Smith, N.R. Wild

    E-Print Network [OSTI]

    OG 4.5.23 Cloud Monitoring for Large Cosmic Ray Sites R.W. Clay, B.R. Dawson, R.T. Pace, D monitoring of the cloud distribution in the night sky within the experimental fiducial volume. We have developed infra-red detectors which are capa- ble of responding to cloud in daytime or night-time. We

  10. NOAA Technical Rep_o_rt_N_M_F_S_l_2_4 o_c_to_b_er_I_99_5 Effects of the Cessation of

    E-Print Network [OSTI]

    NOAA Technical Rep_o_rt_N_M_F_S_l_2_4 o_c_to_b_er_I_99_5 Effects of the Cessation of Sewage Sludge Technical Report NMFS 124 A Technical Report of the Fishery Bulletin Effects of the Cessation of Sewage Sludge Dumping at the 12-Mile Site Proceedings ofthe 12-Mile Dumpsite Symposium Ocean Place Hilton Hotel

  11. KP solitons and Mach reflection in shallow water

    E-Print Network [OSTI]

    Yuji Kodama

    2012-10-01

    This gives a survey of our recent studies on soliton solutions of the Kadomtsev-Petviashvili equation with an emphasis on the Mach reflection problem in shallow water.

  12. MICRON MOUSE IMAGING SYSTEM The Micron Mouse Imaging System is a Core Resource for the Moran

    E-Print Network [OSTI]

    Marc, Robert E.

    light source/power supply (K) Micron camera base and mounting arm (E) Micron custom light guide (L, amplifier, light source, monitor power cables #12;3 SYSTEM PARTS LIGHT SOURCE CAMERA AMPLIFIER Quick keyB steps Press DISP to exit CAMERA NEUTRAL DENSITY KNOB LIGHT GUIDE DO NOT TOUCH LIGHT GUIDE CONNECTOR

  13. The link between Darwin and antioxidants from olives Moran Brouk (Dr. Ayelet Fishman-supervisor)

    E-Print Network [OSTI]

    as an antioxidant for either pharmaceutical or food preparations (i.e. functional foods). Despite the great-supervisor) Department of Biotechnology and Food Engineering, Technion-Israel Institute of Technology, Haifa, 32000

  14. Frequency and longitudinal trends of household care product use Rebecca E. Moran a

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    SUPERB Indoor environment d-limonene a b s t r a c t The use of household cleaning products and air infiltrating to the indoor environment to form potentially toxic secondary pollutants. Although realistic, frequencies of use of eight types of household cleaning products and air fresheners and the performance

  15. Comments from Congressman James P. Moran, 8th District of Virginia...

    Energy Savers [EERE]

    of Schnader Harrison Segal and Lewis LLP and City Attorney, Ignacio B. Pessoa, and offer my additional comments on the Tuesday, December 20th order governing future operations...

  16. Department of Energy Reply to Congressman James P. Moran | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electricLaboratory |EducationDepartment5-3:Washington, D.C.

  17. Comments from Congressman James P. Moran, 8th District of Virginia

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electric vehicle (PEV)Day-June 22, 2015 | DepartmentSupporting the

  18. STAT U S R E V I E W O F K I N G M AC K E R E L I N T H E G U L F O F M E X I C O F E AT U R E A RT I C L E 3

    E-Print Network [OSTI]

    and the Gulf of Mexico group. Both groups undergo long-distance migrations each year from the northern part they feed on large schools of baitfish.The Gulf of Mexico group splits during the winter migration with some A RT I C L E 3 Status Review of King Mackerel in the Gulf of Mexico Feature Article 3 CHRISTOPHER M

  19. Multiple Pedestrian Tracking using Colour and Motion Models Zhengqiang Jiang, Du Q. Huynh, William Moran, Subhash Challa and Nick Spadaccini

    E-Print Network [OSTI]

    Huynh, Du

    Multiple Pedestrian Tracking using Colour and Motion Models Zhengqiang Jiang, Du Q. Huynh, William information to track pedestrians in video sequences captured by a fixed camera. Pedestrians are firstly-based model, we extract a 4-dimensional colour histogram for each detected pedestrian window and compare

  20. SEMI-ANNUAL REPORTS FOR FREEPORT McMoran - FE DKT. NO. 13-26-LNG - ORDER

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterestedReplacement-2-AA-1 SECTION J APPENDIX A ADVANCE- FE DKT.3365NO. 3600LLC -3290 |

  1. Development and Characterization of a Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out Supplemental Materials

    SciTech Connect (OSTI)

    Smith, S; Danganan, L; Tammero, L; Lenhoff, R; Naraghi-arani, P; Hindson, B

    2007-08-06

    Lawrence Livermore National Laboratory (LLNL), in collaboration with the Department of Homeland Security (DHS) and the United States Department of Agriculture (USDA), Animal and Plant Health Inspection Services (APHIS) has developed advanced rapid diagnostics that may be used within the National Animal Health Laboratory Network (NAHLN), the National Veterinary Services Laboratory (Ames, Iowa) and the Plum Island Animal Disease Center (PIADC). This effort has the potential to improve our nation's ability to discriminate between foreign animal diseases and those that are endemic using a single assay, thereby increasing our ability to protect animal populations of high economic importance in the United States. Under 2005 DHS funding we have developed multiplexed (MUX) nucleic-acid-based PCR assays that combine foot-and-mouth disease virus (FMDV) detection with rule-out tests for two other foreign animal diseases Vesicular Exanthema of Swine (VESV) and Swine Vesicular Disease (SVD) and four other domestic viral diseases Bovine Viral Diarrhea Virus (BVDV), Bovine Herpes Virus 1 (BHV-1 or Infectious Bovine Rhinotracheitus IBR), Bluetongue virus (BTV) and Parapox virus complex (which includes Bovine Papular Stomatitis Virus BPSV, Orf of sheep, and Pseudocowpox). Under 2006 funding we have developed a Multiplexed PCR [MUX] porcine assay for detection of FMDV with rule out tests for VESV and SVD foreign animal diseases in addition to one other domestic vesicular animal disease vesicular stomatitis virus (VSV) and one domestic animal disease of swine porcine reproductive and respiratory syndrome (PRRS). We have also developed a MUX bovine assay for detection of FMDV with rule out tests for the two bovine foreign animal diseases malignant catarrhal fever (MCF), rinderpest virus (RPV) and the domestic diseases vesicular stomatitis virus (VSV), bovine viral diarrhea virus (BVDV), infectious bovine rhinotracheitus virus (BHV-1), bluetongue virus (BTV), and the Parapox viruses which are of two bovine types bovine papular stomatitis virus (BPSV) and psuedocowpox (PCP). This document provides details of signature generation, evaluation, and testing, as well as the specific methods and materials used. A condensed summary of the development, testing and performance of the multiplexed assay panel was presented in a 126 page separate document, entitled 'Development and Characterization of A Multiplexed RT-PCR Species Specific Assay for Bovine and one for Porcine Foot-and-Mouth Disease Virus Rule-Out'. This supplemental document provides additional details of large amount of data collected for signature generation, evaluation, and testing, as well as the specific methods and materials used for all steps in the assay development and utilization processes. In contrast to last years effort, the development of the bovine and porcine panels is pending additional work to complete analytical characterization of FMDV, VESV, VSV, SVD, RPV and MCF. The signature screening process and final panel composition impacts this effort. The unique challenge presented this year was having strict predecessor limitations in completing characterization, where efforts at LLNL must preceed efforts at PIADC, such challenges were alleviated in the 2006 reporting by having characterization data from the interlaboratory comparison and at Plum Island under AgDDAP project. We will present an addendum at a later date with additional data on the characterization of the porcine and bovine multiplex assays when that data is available.

  2. MMA Memo. No. 238 Precipitable Water at KP ---1993--1998

    E-Print Network [OSTI]

    Groppi, Christopher

    of each water molecule (mw = 18 amu), P 0 is the water vapor partial pressure at the surface, H is in K. Note that if you have a surface water vapor partial pressure measurement in hPa (a common is equal to the surface water vapor partial pressure in hPa (because T 0 is always ¸ 250­310 K

  3. Materials Data on KP(HO2)2 (SG:43) by Materials Project

    SciTech Connect (OSTI)

    Kristin Persson

    2014-11-02

    Computed materials data using density functional theory calculations. These calculations determine the electronic structure of bulk materials by solving approximations to the Schrodinger equation. For more information, see https://materialsproject.org/docs/calculations

  4. Spin generalization of the Calogero-Moser system and the Matrix KP equation

    E-Print Network [OSTI]

    I. Krichever; O. Babelon; E. Billey; M. Talon

    1994-11-22

    The complete solutions of the spin generalization of the elliptic Calogero Moser systems are constructed. They are expressed in terms of Riemann theta-functions. The analoguous constructions for the trigonometric and rational cases are also presented.

  5. 2010 AnnuAl RepoRt Whitehead Institute

    E-Print Network [OSTI]

    Sabatini, David M.

    5 Jacob Hanna (Jaenisch lab) PAGE 6 Adapted with permission, Development, Gutzman and Sive, Mar 1 with glucocorticoids to promote BFU-E progenitor self-renewal". Flygare J, Rayon Estrada V, Shin C, Gupta S, Lodish HF

  6. 20072008 Complete RepoRt Table of Contents LEHIGH UNIVERSITY

    E-Print Network [OSTI]

    Napier, Terrence

    . Balding '70 ++ W. Gregg Baldwin '74 Wendy and Gary Balter '11P Terry E. Banet '83 Jane Bannan '54 '05GP ++ Peter C. Bayer '60 '84P Theodore F. Bayer '70 Margaret Bearn William G. Beattie '59 '88P '93P ++ Blythe

  7. C tr ti N R rt Construction News Report

    E-Print Network [OSTI]

    floor. · Continued storm pipe on the 3rd floor. · Continued heating hot water lines on the 3rd floorg on the 2nd floor. St t d i t i ll f i th 2 d fl Continued heating hot water lines on the 3rd floor temporary routing out of the building. · Completed heating hot water mains on the 2nd floor. Bid Package 312

  8. La matire grise RAPPoRt 2008-2010

    E-Print Network [OSTI]

    Shoubridge, Eric

    Personnel infirmier: Notre centre névralgique 14 Initiatives du CECR: Idées brillantes 16 Séries de infirmiers, neuroscience Patricia O'Connor, IA, M. Sc. A., CHE1 Lucia Fabijan, B. Sc. Inf., M. Sc. A. 1 Directrice des soins infirmiers & infirmière en chef au Centre universitaire de santé McGill depuis octobre

  9. Kraft Rt Kraft Electronics Inc | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrderInformationKizildereTexas:Solar IncKrafla Geothermal

  10. NEAC-RT ComLtr 11.1.12

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department of EnergyNEW YORKFuel Cycle

  11. Error Probability Bounds for Balanced Binary Relay Trees Zhenliang Zhang, Ali Pezeshki, William Moran, Stephen D. Howard, and Edwin K. P. Chong

    E-Print Network [OSTI]

    Pezeshki, Ali

    as a star architecture [1]­[15],[31], in which all sensors directly connect to the fusion center. A typical and independent sensors. The root of the tree represents a fusion center that makes the overall detection decision the sensors is aggregated into the fusion center via the intermediate relay nodes. In this context, we

  12. [2] O. Biran, S. Moran, and S. Zaks. A combinatorial characterization of the distributed 1solvable tasks. Journal of Algorithm 11, pages 420--440, 1990.

    E-Print Network [OSTI]

    Moran, Shlomo

    . Information and Computation, 105(1):132--158, July 1993. [6] A. Fekete. Asynchronous approximate agreement event e(i), associated with processor P i . This mapping should guarantee that if s is fair for i, then the run M dm (c; s) is fair for p i . By varying the way in which e(i) depends on P i , various

  13. Hydrologic and Aquatic Species Implications of the Proposed Pebble Mine, Bristol Bay, Alaska

    E-Print Network [OSTI]

    Cundy, Fiona

    2012-01-01

    causing  acid  mine  drainage   (Moran  2007).     Problem  potential  for  acid  mine  drainage,  due  to  the   high  

  14. KLab Abstracts http://vision.rutgers.edu/ Authors: Bremmer F, Kubischik M, Hoffmann K-P, Krekelberg B

    E-Print Network [OSTI]

    Krekelberg, Bart

    of saccade-onset. This magnification of the responsive region could account for the behaviorally observed

  15. Observations of PKiKP///PcP amplitude ratios and implications for Earth structure at the boundaries of

    E-Print Network [OSTI]

    Koper, Keith D.

    ; published 2 March 2004. [1] Mining of the database produced by seismic array stations of the International by the presence of partial melt and increased iron content just above the CMB. INDEX TERMS: 7203 Seismology: Body number much lower than either iron or nickel [Birch, 1964]; however, a consensus has only recently been

  16. Characterization of Class A low-level radioactive waste 1986--1990. Volume 7: Appendices K--P

    SciTech Connect (OSTI)

    Dehmel, J.C.; Loomis, D.; Mauro, J.; Kaplan, M.

    1994-01-01

    Under contract to the US Nuclear Regulatory Commission, Office of Nuclear Regulatory Research, the firms of S. Cohen & Associates, Inc. (SC&A) and Eastern Research Group (ERG) have compiled a report that describes the physical, chemical, and radiological properties of Class-A low-level radioactive waste. The report also presents information characterizing various methods and facilities used to treat and dispose non-radioactive waste. A database management program was developed for use in accessing, sorting, analyzing, and displaying the electronic data provided by EG&G. The program was used to present and aggregate data characterizing the radiological, physical, and chemical properties of the waste from descriptions contained in shipping manifests. The data thus retrieved are summarized in tables, histograms, and cumulative distribution curves presenting radionuclide concentration distributions in Class-A waste as a function of waste streams, by category of waste generators, and regions of the United States. The report also provides information characterizing methods and facilities used to treat and dispose non-radioactive waste, including industrial, municipal, and hazardous waste regulated under Subparts C and D of the Resource Conservation and Recovery Act (RCRA). The information includes a list of disposal options, the geographical locations of the processing and disposal facilities, and a description of the characteristics of such processing and disposal facilities. Volume 1 contains the Executive Summary, Volume 2 presents the Class-A waste database, Volume 3 presents the information characterizing non-radioactive waste management practices and facilities, and Volumes 4 through 7 contain Appendices A through P with supporting information.

  17. CIRAAnnuAl RepoRt 2005-2006AnnuAl RepoRt 2005-2006 CIRA ANNUAL REPORT FY 05/06

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    State University Department of Economics/CIRA Mark DeMaria, Colorado State University NOAA RAMM BranchSat and National Park Service Air Quality Research Division activities) to allow the reader a more complete with the infrastructure and intellectual talent produced and used by both sides of the funded activities. For further

  18. EuropeanEuropean ControlControl ConferenceConference,, KosKos RT 2007RT 2007 Randomized Algorithms for Systems and

    E-Print Network [OSTI]

    Tempo, Roberto

    was invented by Metropolis, UlamUlam, von, von Neumann, Fermi,Neumann, Fermi, ...... (Manhattan project)(Manhattan project) Las Vegas first appeared in computer science in the lateLas Vegas first appeared in computer

  19. This list does not imply DOE endorsement of the individuals or...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    416-969-6413 Ontario, CANADA Moran, Milton milton.moran@phifer.com 205-750-3068 AL Morris, Nick Nick.Morris@Xyleminc.com UNITED KINGDOM Morrison, Stuart stuart.morrison@clydeun...

  20. This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research

    E-Print Network [OSTI]

    Wahlberg, Niklas

    et al., 2003), insects (Mardulyn and Whitfield, 1999; Jordal et al., 2000; Von Dohlen and Moran, 2000

  1. Phylogenetics of Coenonymphina (Nymphalidae: Satyrinae) and the problem of rooting rapid radiations

    E-Print Network [OSTI]

    Wahlberg, Niklas

    et al., 2003), insects (Mardulyn and Whitfield, 1999; Jordal et al., 2000; Von Dohlen and Moran, 2000

  2. The Role of Native Riparian Vegetation in Resisting Invasion by Giant Reed, Arundo donax

    E-Print Network [OSTI]

    Palenscar, Kai

    2012-01-01

    see Quinn & Holt 2004) or biocontrol agents (Moran & Goolsbyagent for giant reed, Arundo donax (Poales: Poaceae) in North America. Biocontrol

  3. nature immunology VOLUME 13 NUMBER 12 DECEMBER 2012 1155 A rt i c l e s

    E-Print Network [OSTI]

    Zhijie, Liu

    system provides a critical first line of defense against invading microorganisms, including pathogenic a wide variety of highly invariant molecular structures known as `pathogen-associated molecular pat bacterial pathogens use cyclic diguanosine monophosphate (c-di-GMP) or cyclic diadenosine monophosphate (c

  4. The Florida State University Foundation 20112012 AnnuAl RepoRt

    E-Print Network [OSTI]

    McQuade, D. Tyler

    assets giFt Commitment By PUrPose giving By individUals and organizations Planned giving Commitments total giFts By College/University Unit historiCal endowment totals Recognition 2 3 4 6 8 10 18 support of, and continued commitment to, Florida State University. Since its founding in 1960, the Florida

  5. Quantifying a bystander response following microbeam irradiation using single-cell RT-PCR analyses

    E-Print Network [OSTI]

    studies of radiation-induced bystander responses reported that exposure to very low doses of a for Radiological Research, Columbia University, New York, NY, USA Objective. There is growing recognition that the effects of ionizing radiation may extend to more than those cells that directly suffer damage to DNA

  6. Center for Power Electronics Systems 2012 CPES AnnuAl REPoRt

    E-Print Network [OSTI]

    Ha, Dong S.

    center dedicated to improving electrical power processing and distribution that impact systems of all for creating advanced electric power processing systems of the highest value to society. CPES, with annual and processes us- ing electrical power. This results in increased industrial productivity and product quality

  7. AN RT-UML MODEL FOR BUILDING FASTER-THAN-REAL-TIME SIMULATORS

    E-Print Network [OSTI]

    Katsaros, Panagiotis

    demanding, requiring a consistent specification for developing such systems. This paper presents guidelines, obtaining and storing system and the model data during the auditing interval, and auditing, that is, examining a) if the system has been #12;modified during the last auditing interval (system reformations), b

  8. National Aeronautics and Space Administration Student ReSeaRch RepoRt

    E-Print Network [OSTI]

    propulsion Laboratory (JpL) JpL has a long history of working with educational insti- tutions. We believe is the end-to-end implementation of unprecedented robotic space missions to study earth, the Solar System of the JPL campus. #12;1 Inside Welcome 3 Solar System Science 5 earth Science 8 astrophysics & Space Science

  9. Climate Change: A Catastrophe in Slow Motion R.T. Pierrehumbert*

    E-Print Network [OSTI]

    Pierrehumbert, Raymond

    as unique or even unusually impressive. When oxygen-generating photosynthetic algae evolved between one--the animals and plants we know and love). And when plants colonized land half a billion years ago, they vastly generations and of the biosphere at large.2 It is against this backdrop that the foundation of international

  10. Modeling benzene plume elongation mechanisms exerted by ethanol using RT3D with a general

    E-Print Network [OSTI]

    Alvarez, Pedro J.

    E10 gasoline (i.e., a blend with 10% vol/vol ethanol/ gasoline) showed that mean benzene plume of E10 gasoline (10% vol/vol ethanol), which compares favorably to field observations. For low benzene Act requirements. The widespread use of ethanol in gasoline has led to an increase in its potential

  11. Seattle Regulatory Pathways to Net Zero Water Phase 1 status RePoRt

    E-Print Network [OSTI]

    Department of Planning and Development City Green Building prepared by: Cascadia Green Building Council July are often wasteful and result in increased demands on publicly owned utilities for supply and treatment -- that is, projects seeking to operate within the water budget of their sites by utilizing closed loop

  12. 'ji<'rt-tt*: 1 'M'*"iV--'-*-'' The Wellcome Trust

    E-Print Network [OSTI]

    Rambaut, Andrew

    and future. © Closing the tube The genetics of spina bifida and anencephaly Andrew Copp © A rash pump and disease Medicine in the sixteenth and seventeenth centuries Andrew Wear The prion see-saw The two sides

  13. http://dsc.u fcg.edu .br/ s rt Desenvolvimento de Uma Ferramenta de

    E-Print Network [OSTI]

    Cirne, Walfredo

    energia elétrica necessário para o diagnóstico de falhas em linhas de transmissão. A ferramenta foi de supervisão e controle das modernas redes de transmissão e distribuição de energia elétrica têm raiz (7). Várias empresas e grupos de pesquisa têm pesquisado e desenvol

  14. RT: A Role-based Trust-management Framework Ninghui Li John C. Mitchell

    E-Print Network [OSTI]

    Mitchell, John C.

    resources. Supported in part by DARPA through SPAWAR contract N66001-00- C-8015. While sharing resources infrastructure and support for se- cure, trusted dynamic coalitions, with emphasis on the fol- lowing areas: 1

  15. Diffuse large B-cell lymphoma: sub-classification by massive parallel quantitative RT-PCR

    E-Print Network [OSTI]

    Xue, Xuemin; Zeng, Naiyan; Gao, Zifen; Du, Ming-Qing

    2014-11-24

    ;103:275-282. 7. Choi WW, Weisenburger DD, Greiner TC et al. A new immunostain algorithm classifies diffuse large B-cell lymphoma into molecular subtypes with high accuracy. Clin Cancer Res 2009;15:5494-5502. 8. Gutierrez-Garcia G, Cardesa-Salzmann T, Climent...

  16. L thnh vin ca Tp on Russell danh ting, Trng i hc Cardiff rt c

    E-Print Network [OSTI]

    Davies, Christopher

    t phng pháp ging dy, hng nghiên cu cng nh tn dng các c s vt cht tuyt vi ca trng. Thành ph Cardiff là mt hát và vin bo tàng, cng nh thng xuyên ng cai các s kin th thao ln, các chuyn lu din hoà nhc sân vn ng Khoa hc Sc kho và i sng. Sinh viên cng có th ng ký các khoá hc khác ti i hc Cardiff và s nhn c t vn và

  17. Trch rt t ng vn phm LTAG cho ting Vit L Hng Phng1

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Trích rút t ng vn phm LTAG cho ting Vit Lê Hng Phng1 , Nguyn Th Minh Huyn1 , Nguyn Phng Thái1 t ng LTAG t kho vn bn gán nhãn cú pháp (treebank). Chúng tôi trình bày kt qu trích rút mt vn phm LTAG cho ting Vit. Chng trình trích rút t ng các vn phm LTAG c lp vi ngôn ng và c phân phi di dng mã ngun m

  18. Preliminary ILAW Formulation Algorithm Description, 24590 LAW RPT-RT-04-0003, Rev. 1

    SciTech Connect (OSTI)

    Kruger, Albert A.; Kim, Dong-Sang; Vienna, John D.

    2013-12-03

    The U.S. Department of Energy (DOE), Office of River Protection (ORP), has contracted with Bechtel National, Inc. (BNI) to design, construct, and commission the Hanford Tank Waste Treatment and Immobilization Plant (WTP) at the Hanford Site (DOE 2000). This plant is designed to operate for 40 years and treat roughly 50 million gallons of mixed hazardous high-level waste (HLW) stored in 177 underground tanks at the Hanford Site. The process involves separating the hight-level and low-activity waste (LAW) fractions through filtration, leaching, Cs ion exchange, and precipitation. Each fraction will be separately vitrified into borosilicate waste glass. This report documents the initial algorithm for use by Hanford WTP in batching LAW and glass-forming chemicals (GFCs) in the LAW melter feed preparation vessel (MFPV). Algorithm inputs include the chemical analyses of the pretreated LAW in the concentrate receipt vessel (CRV), the volume of the MFPV heel, and the compositions of individual GFCs. In addition to these inputs, uncertainties in the LAW composition and processing parameters are included in the algorithm.

  19. 2012 EmploymEnt REpoRt RICE MBA Full TIME

    E-Print Network [OSTI]

    Aazhang, Behnaam

    Director of Product Management Cameron Guillermo Mezzatesta Project Manager Samuel Veselka Project Manager Magalhaes Global Accounts Manager Lloyd's Jeffrey Freedman Associate Marathon Oil Corporation Jesse Filipi Production Engineer McKinsey & Company Joseph Abdou Associate Justin Dahl Associate Mercer Rachel Mc

  20. V-190: ASUS RT-N66U Router AiCloud Security Bypass Security Issue |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyThe U.S.Lacledeutilities. The Economics ofConductMultiple vulnerabilities

  1. PWR FLECHT SEASET 21-rod bundle flow blockage task data and analysis report. NRC/EPRI/Westinghouse Report No. 11. Appendices K-P

    SciTech Connect (OSTI)

    Loftus, M.J.; Hochreiter, L.E.; Lee, N.; McGuire, M.F.; Wenzel, A.H.; Valkovic, M.M.

    1982-09-01

    This report presents data and limited analysis from the 21-Rod Bundle Flow Blockage Task of the Full-Length Emergency Cooling Heat Transfer Separate Effects and Systems Effects Test Program (FLECHT SEASET). The tests consisted of forced and gravity reflooding tests utilizing electrical heater rods with a cosine axial power profile to simulate PWR nuclear core fuel rod arrays. Steam cooling and hydraulic characteristics tests were also conducted. These tests were utilized to determine effects of various flow blockage configurations (shapes and distributions) on reflooding behavior, to aid in development/assessment of computational models in predicting reflooding behavior of flow blockage configurations, and to screen flow blockage configurations for future 163-rod flow blockage bundle tests.

  2. Vector k"p approach for photonic band structures Department of Physics, University of Toronto, 60 St. George Street, Toronto, Ontario, Canada M5S 1A7

    E-Print Network [OSTI]

    Sipe,J. E.

    of Toronto, 60 St. George Street, Toronto, Ontario, Canada M5S 1A7 Received 24 January 2000 We point out amplitude of stationary solutions of the Maxwell equations at frequency mk c mk. The asso- ciated electric. So an expansion of the form 4 cannot be possible. In the next section we identify the source

  3. Entropy and Energy: Toward a Definition of Physical Sustainability

    E-Print Network [OSTI]

    Hermanowicz, Slawomir W

    2005-01-01

    Perspective by Exergy Analysis. Environmental Science &Moran, M.J. (1999). Exergy Analysis, Costing and AssessmentSteward, F.R. (1988). Exergy Analysis of Thermal, Chemical,

  4. Ra p po Rt d 'act i v i te 2 0 1 0 Musum national d'Histoire naturelle

    E-Print Network [OSTI]

    même but : mieux connaître la nature afin de mieux la préserver. Un credo que le Muséum fait vivre dans

  5. Extraction of RNA-Trizol RNA extraction from M. tuberculosis (Mahenthiralingam 1998) is useful for RT-PCR

    E-Print Network [OSTI]

    L polypropylene tubes 9. Tabletop centrifuge 10. Vortex 11. 13 mL Sarstedt tube B. Protocol Steps 1. Grow 50 ml well. 5. Vortex for 1 minute then add 5X volume (5 ml) Trizol to each tube. 6. Vortex each sample tubes and centrifuge for at 2,000 x g for 10 minutes. 3. Discard supernatant and centrifuge tubes at 2

  6. nature structural & molecular biology VOLUME 19 NUMBER 7 JULY 2012 671 a rt i c l e s

    E-Print Network [OSTI]

    Dinner, Aaron

    )DNAadducts4,5. Knockout experiments in mice have further established mALKBH2 as the housekeeping enzyme as the initial step of its `passive' baseflipping process22­24. Despite different strategies used

  7. A RT I C L E S 36 NATURE CELL BIOLOGY VOLUME 9 | NUMBER 1 | JANUARY 2007

    E-Print Network [OSTI]

    Cai, Long

    on neutrophil chemotaxis. To study PtdIns(3,4,5)P3 metabolism in living primary cells, we generated a novel a chemoattractant gradient. TheamoebaDictyosteliumdiscoideumandmammalianneutrophilsare the best-studied chemotactic in a shallow anterior-to-posterior gradient that approximates receptor occupancy11 . Instead, the second

  8. Kline-DNA Quantification with RT-PCR March 30, 2004 SMART Meeting (Virginia Beach, VA) 1

    E-Print Network [OSTI]

    /280 : ·Is not Human Specific ·Does not satisfy FBI QA Document section 9.3 ·Requires at least 10 ng Green Assay ·Is not Human Specific ·Does not satisfy FBI QA Document section 9.3 ·Requires the sample Technologies Group, Human Identity Project Quantiblot Assay ·Is Human Specific ·Does satisfy FBI QA Document

  9. IUT de Villetaneuse, Universit Paris 13, Sorbonne Paris Cit Licence Pro R&T ASUR Travaux pratiques de cryptographie

    E-Print Network [OSTI]

    André, Étienne

    pratiques de cryptographie Cryptographie : GPG Étienne André Version du sujet : 1er décembre 2014 Ce TP s avec LibreOffice et exporté en PDF. Nom du fichier : crypto-TP-gpg-nom-prenom.pdf Adresse électronique : Etienne.Andre(arobase)univ-paris13.fr Objet du courriel : « TP crypto GPG : » Le compte

  10. Math 21C Final, Fall 02. 1. A particle moves with position vector given by r(t) = t2

    E-Print Network [OSTI]

    Ni, Lei

    of a rectangular box labeled so x is the smallest and z is the largest then in order that the package should) Find the absolute max and min of f(x, y) over the set D = {(x, y)|g(x, y) 4}. 6. If you send a package V (x, y, z) = xyz for a package that is not over sized. 7. (a) Write the iterated integral 1 0 1/y 1

  11. SU-E-T-99: Design and Development of Isocenter Parameter System for CT Simulation Laser Based On DICOM RT

    SciTech Connect (OSTI)

    Luo, G

    2014-06-01

    Purpose: In order to receive DICOM files from treatment planning system and generate patient isocenter positioning parameter file for CT laser system automatically, this paper presents a method for communication with treatment planning system and calculation of isocenter parameter for each radiation field. Methods: Coordinate transformation and laser positioning file formats were analyzed, isocenter parameter was calculated via data from DICOM CT Data and DICOM RTPLAN file. An in-house software-DicomGenie was developed based on the object-oriented program platform-Qt with DCMTK SDK (Germany OFFIS company DICOM SDK) . DicomGenie was tested for accuracy using Philips CT simulation plan system (Tumor LOC, Philips) and A2J CT positioning laser system (Thorigny Sur Marne, France). Results: DicomGenie successfully established DICOM communication between treatment planning system, DICOM files were received by DicomGenie and patient laser isocenter information was generated accurately. Patient laser parameter data files can be used for for CT laser system directly. Conclusion: In-house software DicomGenie received and extracted DICOM data, isocenter laser positioning data files were created by DicomGenie and can be use for A2J laser positioning system.

  12. p hys i csworl d. co m $rrp*:rt*xri*r:tivicy; Top five a lications Fantasticflve

    E-Print Network [OSTI]

    Washington at Seattle, University of - Department of Physics, Electroweak Interaction Research Group

    of super- conductivity in terms of their impact on society? This article lists a top five selected by Paul may be a beautiful phenomenon, but materials that can conduct with zero resistance have not quite, followed by magnets for medical imaging and for particle colliders in second and third, re- spectively

  13. Tritium Retention in TFTR C.H. Skinner, G Ascione, D. Mueller, A Nagy, R.T. Walters,

    E-Print Network [OSTI]

    Budny, Robert

    ° Boronization PDC NBvent various -4000 0 4000 8000 12000 curies T puff NB inj. NB pump turbo pump Short term level in any plasma operation #12;First in-vessel maintenance after extensive DT operations TFTR

  14. Opgave 1 20 Et bin rt tr med heltal i knuderne kan repr senteres som en v rdi af

    E-Print Network [OSTI]

    Brodal, Gerth Stølting

    Deltr s, t:Tree ! Bool der afg r, om s er et deltr af t. En naiv algoritme for dette problem er vil give en tidskompleksitet p Ojtjjsj. En smartere algoritme er kun at unders ge dette for de knuder lgende algoritme er gyldig og korrekt. Algoritme: Heltalskvadratrod Stimulans: n: n0 Respons: r: r2 n r

  15. Sub-RepoRt commiSSioned to aSSiSt the all-paRty

    E-Print Network [OSTI]

    Crawford, Ian

    Authority. Direct negotiations, brokered by the United States Secretary of State, John to the weaponry and manpower at the disposal of Hamas and its supporters in Gaza, were

  16. Observation of a new high-? and high-density state of a magnetospheric plasma in RT-1

    SciTech Connect (OSTI)

    Saitoh, H.; Yano, Y.; Yoshida, Z.; Nishiura, M.; Morikawa, J.; Kawazura, Y.; Nogami, T.; Yamasaki, M. [Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan)

    2014-08-15

    A new high-? and high-density state is reported for a plasma confined in a laboratory magnetosphere. In order to expand the parameter regime of an electron cyclotron resonance heating experiment, the 8.2?GHz microwave power of the Ring Trap 1 device has been upgraded with the installation of a new waveguide system. The rated input power launched from a klystron was increased from 25 to 50?kW, which enabled the more stable formation of a hot-electron high-? plasma. The diamagnetic signal (the averaged value of four magnetic loops signals) of a plasma reached 5.2 mWb. According to a two-dimensional Grad-Shafranov analysis, the corresponding local ? value is close to 100%.

  17. NATURE STRUCTURAL & MOLECULAR BIOLOGY VOLUME 16 NUMBER 12 DECEMBER 2009 1267 A RT I C L E S

    E-Print Network [OSTI]

    Chou, James

    of BM2 is also a coiled-coil tetramer, and its unusually large electrostatic dipole moment suggests-coil tetramer with a packing angle of about -37° (Fig. 1a). The tetramer has a well 1Department of Biological

  18. Magnetic properties of RT2Zn20; R = rare earth, T = Fe, Co, Ru, Os and Ir

    SciTech Connect (OSTI)

    Jia, Shuang

    2008-12-15

    It is well known that rare earth intermetallic compounds have versatile, magnetic properties associated with the 4f electrons: a local moment associated with the Hund's rule ground state is formed in general, but a strongly correlated, hybridized state may also appear for specific 4f electronic configuration (eg. for rare earth elements such as Ce or Yb). On the other hand, the conduction electrons in rare earth intermetallic compounds, certainly ones associated with non hybridizing rare earths, usually manifest non-magnetic behavior and can be treated as a normal, non-interacted Fermi liquid, except for some 3d-transition metal rich binary or ternary systems which often manifest strong, itinerant, d electron dominant magnetic behavior. Of particular interest are examples in which the band filling of the conduction electrons puts the system in the vicinity of a Stoner transition: such systems, characterized as nearly or weakly ferromagnet, manifest strongly correlated electronic properties [Moriya, 1985]. For rare earth intermetallic compounds, such systems provide an additional versatility and allow for the study of the behaviors of local moments and hybridized moments which are associated with 4f electron in a correlated conduction electron background.

  19. arXiv:math.RT/0411017v220Feb2005 STANDARD BASES FOR AFFINE SL(N)-MODULES

    E-Print Network [OSTI]

    Kreiman, Victor

    a basis of a given Demazure module of SLnC. The roof operator is more elementary (and much more efficient of a recursive but very simple algorithm, the roof operator, which is analogous to the left-key construction of Lascoux-Schutzenberger. The roof operator is in a sense orthogonal to the crystal operators. The most

  20. 1) EtOH, rt 2) K2CO3 (5 eq.), MeI (20 eq.)

    E-Print Network [OSTI]

    HHO H 19) Toluene, 180°C 20, 21, 22 20) NaH, CS2, MeI 21) AIBN, nBu3SnH, 110°C 22) BBr3 (10 eq), DCM

  1. arXiv:math/9910114v1[math.RT]21Oct1999 ON THE GHOST CENTRE OF LIE SUPERALGEBRAS

    E-Print Network [OSTI]

    Gorelik, Maria

    (g) is not easy to describe and, in general, it is not noetherian algebra. However, in the case when the top algebra can be easily described-- see Theorem 3.3. The above condition on top g1 holds for the simple ("anticentre"). We calculate the anticentre in the case when the top external degree of g1 is a trivial g0

  2. 2011NatureAmerica,Inc.Allrightsreserved. T e c h n i ca l R e p o RT s

    E-Print Network [OSTI]

    Sia, Samuel K.

    -to-use point-of-care (POC) assay that faithfully replicates all steps of ELISA, at a lower total material cost settings5,6, the device must also be low cost. A switch in the strategy by which microfluidics is normally performed will be needed before complex laboratory assays can be miniaturized at low cost for use in remote

  3. DOE/SC-ARM-10-032 ARM Climate Research Facility AnnuAl RepoRt - 2010

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE ProjectREMOTE-HANDLED TRU76

  4. DOE/SC-ARM-12-023 ARM Climate Research Facility AnnuAl RepoRt - 2012

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE ProjectREMOTE-HANDLED TRU764 The Arctic6

  5. Retinal Neurotransmitters Robert E. Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    Retinal Neurotransmitters Robert E. Marc John Moran Eye Center University of Utah School of References: 85 Abbreviated Title: Retinal Neurotransmitters *Correspondence to: Robert E. Marc, Moran Eye-6500. Facsimile (801) 581-3357 robert.marc@hsc.utah.edu #12;Rbert E. Marc Retinal Neurotransmitters Introduction

  6. Robert E. Marc: The Structure of Vertebrate Retinas In: J Toyoda (ed.) The Retinal Basis of Vision

    E-Print Network [OSTI]

    Marc, Robert E.

    Robert E. Marc: The Structure of Vertebrate Retinas In: J Toyoda (ed.) The Retinal Basis of Vision Elsevier, Amsterdam 1998 The Structure of Vertebrate Retinas Robert E. Marc John Moran Eye Center, retinal neurons, neuronal patterning, neuronal stratification Correspondence: Robert E. Marc John Moran

  7. COBIOT-854; NO. OF PAGES 8 Please cite this article in press as: Lovley DR, Nevin KP. A shift in the current: New applications and concepts for microbe-electrode electron exchange, Curr Opin Biotechnol (2011), doi:10.1016/

    E-Print Network [OSTI]

    Lovley, Derek

    2011-01-01

    - trical power with microbial fuel cells over the last decade, some of the early optimism for power in aquatic sediments with benthic microbial fuel cells continues to be a promising application [5­8]. However, after some of the rather obvious design flaws in early microbial fuel cells were rectified, there has

  8. Een iets geredigeerde versie is verschenen in Jaarboek Overheidsfinancin 2008: K.P. Goudswaard en H. Nijboer, 'Sociale zekerheid: van verzekeren naar sparen?', in: C.A. de Kam

    E-Print Network [OSTI]

    Galis, Frietson

    wordt de efficiencywinst gezien: door gebruik te maken van individuele spaartegoeden kunnen individuen

  9. Source: K. Caminada and K.P. Goudswaard (2010), `How well is social expenditure targeted to the poor?, in: P. Saunders and R. Sainsbury (eds.), Social Security, Poverty and Social Exclusion in Rich and

    E-Print Network [OSTI]

    Galis, Frietson

    2010-01-01

    to the poor?, in: P. Saunders and R. Sainsbury (eds.), Social Security, Poverty and Social Exclusion in Rich security ABSTRACT Some countries are more effective in poverty reduction than others. What can explain these variations in effectiveness? This paper analyzes the effectiveness of social transfers in alleviating poverty

  10. genomic DNA was isolated from these centrifuged cell pellets and used for am-

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    genomic DNA was isolated from these centrifuged cell pellets and used for am- plification of either changes in ruminal bacterial popula- tions. J Wood1, KP Scott,1, G Avguštin2,J Wood1 KP Scott, G

  11. DRIENERBEEKLAAN AUKEVLEERSTR

    E-Print Network [OSTI]

    Theune, Mariët

    Tennispark (TP) 65 Logica (LO) 66 BTC 68 KPMG-gebouw (KP) 72 Corridor (CO) 89 Langezijds A (LA) PLATTEGROND

  12. FYI: July 5, 1990 - Decentler 27, 1990

    E-Print Network [OSTI]

    1990-01-01

    CONTACT PERSQ"I Mike Ramirez (913) 296-3721 Depanment of Transportation Lynn George (913) 864-4942 University of Kansas Mike Ramirez (913) 296-3721 Department of Transportation Jo Ann Moran (913) 296-1290 Department of Health and Environment Jo... Ann Moran (913) 296-1290 Depanment of Health and Environment Jo Ann Moran \\913) 296-1290 Department oi Health and Environment Mike Ramirez (913) 296-3721 Dep~ntofTransportation Mike Ramirez (913) 296-3721 Dep~ntofTransponadon Mike Ramirez (913...

  13. Don't break the pipeline: Ensuring a workforce for the burning plasma era G.M. Olynyk, Z.S. Hartwig, and R.T. Mumgaard

    E-Print Network [OSTI]

    .S. fusion energy sci- ences is a fusion nuclear science facility ("FNSF") or a small-scale prototype power- sion scientists is in position by the late s, the recent trajectory is instead one of managed decline- dents to senior scientists and tenured faculty--such that the transmission of knowledge remains

  14. J. Electrochem. Soc., Vol. 142, No. 11, November 1995 9 The Electrochemical Society, Inc. 3815 Q = In [c~a+ ~ ~ ~ -in io -RT ~ [5

    E-Print Network [OSTI]

    Weidner, John W.

    to be attractive for treating low level nuclear wastes. The development of a simple divided electrochemical-cell model operating in a batch mode, used for the reduction of nitrates and nitrites from nuclear wastes to the above proce- dure is 1.49 mA/cm 2,which ismore than an order of magni- tude lower than that of copper

  15. 1350 VOLUME 46 | NUMBER 12 | DECEMBER 2014 Nature GeNetics t e c h n i c a l r e p o rt s

    E-Print Network [OSTI]

    Kaski, Samuel

    genome;however,callingvariantsintheremaining10%of thegenome. Accurate determination of an individual's genome is essential for understanding both human hereditary disease and cancer. Advances in genome sequencing have made it possible, at relatively low cost

  16. FRAMES-2.0 Software System: Linking to the Groundwater Modeling System (GMS) RT3D and MT3DMS Models

    SciTech Connect (OSTI)

    Whelan, Gene; Castleton, Karl J.; Pelton, Mitch A.

    2007-08-08

    Linkages to the Groundwater Modeling System have been developed at Pacific Northwest National Laboratory to enable the Nuclear Regulatory Commission (NRC) to more realistically assess the risk to the public of radioactive contaminants at NRC-licensed sites. Common software tools presently in use are limited in that they cannot assess contaminant migration through complex natural environments. The purpose of this initiative is to provide NRC with a licensing safety-analysis tool with sufficient power, flexibility, and utility that it can serve as the primary software platform for analyzing the hazards associated with licensing actions at those “complex” sites at which the traditional tools are inappropriate. As a tool designed to realistically approximate prospective doses to the public, this initiative addresses NRC’s safety-performance goal by confirming that licensing actions do not result in undue risk to the public.

  17. A N N U A L R E P O RT 2 0 0 6 -0 7 COLLEGE OF ARTS & SCIENCES

    E-Print Network [OSTI]

    Frantz, Kyle J.

    labora- tories to elementary, middle and high schools around the state.The Bio-Bus program, which won. · An international team of scientists working at Georgia State University's Center for High Angular Resolution instruments and techniques. McAlister and the CHARA Array Project Team ­ which he led ­ won the award

  18. Transactions, SMiRT 21, 6-11 November, 2011, New Delhi, India Div-VII: Paper ID# 804 DEVELOPMENT OF PARTIAL SAFETY FACTORS FOR ACCIDENTAL

    E-Print Network [OSTI]

    Bhattacharya, Baidurya

    were designed using the French RCC-G code. The raft of the PWHR at Tarapur was designed using the ASME code and checked against RCC-G [1]. There is yet no formal Indian design standard for containment structures. In 2007, the Atomic Energy Regulatory Board (AERB) of India released the CSE-3 codes [3] which

  19. Mechanistic Evaluation of the Pros and Cons of Digital RT-LAMP for HIV1 Viral Load Quantification on a Microfluidic Device and

    E-Print Network [OSTI]

    Ismagilov, Rustem F.

    on a Microfluidic Device and Improved Efficiency via a Two-Step Digital Protocol Bing Sun, Feng Shen, Stephanie E, California 91125, United States *S Supporting Information ABSTRACT: Here we used a SlipChip microfluidic by the yield of desired cDNA. We were able to overcome the limitations by developing a microfluidic protocol

  20. Analysis of genes regulated by the peroxide response regulator PerR in Borrelia burgdorferi using real-time RT-PCR 

    E-Print Network [OSTI]

    Swingle, Kristen Lynn

    2002-01-01

    are quite disparate and include differences in temperature, pH, and oxygen concentration. Although it has been shown that the aforementioned factors alter gene expression, few regulatory proteins have been identified in the B. burgdorferi genome. bb0647...

  1. 5/17/13 12:44 PMBronk Page 1 of 14http://firstmonday.org/ojs/index.php/fm/rt/printerFriendly/2192/2052

    E-Print Network [OSTI]

    Wallach, Dan

    terror tactics in pursuit of their political agendas. This paper argues that the language used to frame have constructed damning cases against organized crime and other nefarious actors through the use information technologies. Falling between the boundaries of the information, computer and political sciences

  2. 1.1 Basic ideas r(t) is the position of a particle; r = |r| is the distance to the origin.

    E-Print Network [OSTI]

    Rucklidge, Alastair

    speed of the particle is v = R. (11) #12;Chapter 2 Dynamics: Newton's laws of motion and gravitation 2 interacting though equal and opposite forces is constant. 3 #12;4 2.2 Newton's Law of Gravitation 2.2 Newton's Law of Gravitation Two particles of masses M and m a distance r apart exert a mutually attractive

  3. Opgave 1 (20%) Et bin#rt tr# med heltal i knuderne kan repr#senteres som en v#rdi af

    E-Print Network [OSTI]

    Brodal, Gerth Stølting

    #rdiprocedure: Proc Deltr#[s, t: Tree] ! (Bool) der afg#r, om s er et deltr# af t. En naiv algoritme for dette problem rod. Det vil give en tidskompleksitet p# O(jtjjsj). En smartere algoritme er kun at unders#ge dette, at f#lgende algoritme er gyldig og korrekt. Algoritme: Heltalskvadratrod Stimulans: n: nâ??0 Respons: r

  4. 2010-2011 ANNUAl REPoRt O F Y E S H I V A U N I V E R S I T Y

    E-Print Network [OSTI]

    Kenny, Paraic

    , Nigeria, Rwanda, South Africa and Uganda. ·Each year, Einstein faculty members and some 50 medical, Einstein's Jack and Pearl Resnick Campus pulses with energy. Our research centers are where our world

  5. Sulphate record from a northeast Greenland ice core over the last 1200 years based on continuous flow analysis

    E-Print Network [OSTI]

    Fischer, Hubertus

    distribution of heat, salt, and moisture, potentially driving climatic change on regional to global scales; Moran et al., 2006). In 2004, the first Integrated Ocean Drilling Program expedition to the Lomonosov

  6. Middletown Springs Town Plan Adopted September 10, 2002

    E-Print Network [OSTI]

    Brown, Gregory G.

    Middletown Springs Town Plan Adopted September 10, 2002 Select Board: Fred Bradley, Chair Robin Chesnut-Tangerman John Colvin Shirley Moyer, Secretary William Reed Planning Commission: Robert Moran.............................................................................. 11 Utilities, Facilities, and Services

  7. Mineralogy and Petrology (2007) 91: 1124 DOI 10.1007/s00710-007-0183-7

    E-Print Network [OSTI]

    Cartigny, Pierre

    2007-01-01

    to 90 km along a cold geothermal gradient (8 C=km). Unmetamor- phosed and HP metasediments show is available for mafic rocks and metasediments sub- ducted along warm geothermal gradients (Moran et al., 1992

  8. Systematic revision of Elaphoglossum (Dryopteridaceae) in French Polynesia, with the description of three new

    E-Print Network [OSTI]

    of three new species GERMINAL ROUHAN1 *, DAVID H. LORENCE2 , TIMOTHY J. MOTLEY3 , JUDITH GARRISON HANKS4 groups (sections and subsections) (Moran, Garrison-Hanks & Rouhan, 2007a). The main clades

  9. INTRODUCTION A common reproductive strategy among aquatic and marine

    E-Print Network [OSTI]

    and Strathmann, 1998; Moran and Woods, 2007; Woods and Podolsky, 2007) and on amphibian egg masses (Seymour, 1994; Seymour and Bradford, 1995; Mitchell and Seymour, 2003). For all egg masses, however, predicting transient

  10. Genealogical constructions of population models Alison M. Etheridge Thomas G. Kurtz

    E-Print Network [OSTI]

    Kurtz, Tom

    Genealogical constructions of population models Alison M. Etheridge Thomas G. Kurtz Department, Moran model, lookdown construction, genealogies, voter model, generators, stochastic equations, Lambda number of individuals in the population is used to infer the `genealogical trees' that relate those genes

  11. A Simple Self-Maintaining Metabolic System: Robustness, Autocatalysis, Bistability

    E-Print Network [OSTI]

    Piedrafita1 , Francisco Montero1 , Federico Mora´n1 , Mari´a Luz Ca´rdenas2 , Athel Cornish-Bowden2 * 1-maintaining mode, the entire network being necessary to maintain the two catalysts. Citation: Piedrafita G, Montero

  12. Max-Planck-Institut f ur Mathematik

    E-Print Network [OSTI]

    ­wave pulses in Bose­Einstein condensates, see e.g. [19, 23]. Notice that the KP equation has originally been

  13. New Environmental Science Division report provides comprehensive...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    solar research programs, visit the EVS website. Reference: Patton, T., L. Almer, H. Hartmann, and K.P. Smith, 2013, An Overview of Potential Environmental, Cultural, and...

  14. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    1471--2164; Other: KP1601050; ERKP695","Journal Article","AM",,"Journal Name: BMC Genomics; Journal Volume: 16; Journal Issue: 1","Oak Ridge National Laboratory (ORNL);...

  15. Bone Mineral Density, Bone Turnover, and Systemic Inflammation in Non-cirrhotics with Chronic Hepatitis C

    E-Print Network [OSTI]

    Lai, JC; Shoback, DM; Zipperstein, J; Lizaola, B; Tseng, S; Terrault, NA

    2015-01-01

    KP, Ludwig J. Chronic hepatitis. An update on terminologyet al. The prevalence of hepatitis C virus infection in thetransplantation for viral hepatitis in the United States.

  16. Striae: a potential precipitating factor for Koebner phenomenon in psoriasis?

    E-Print Network [OSTI]

    Morais, Paulo; Oliveira, Manuela; Matos, Jose

    2013-01-01

    The association between psoriasis and obesity: a systematicof vitiligo, lichen planus and psoriasis. Clin Exp Dermatol.potentially induce KP in psoriasis, vitiligo, and LP (Table

  17. .0/2 1434576+8,9 :,;=@?BAC1E D ;K;P?

    E-Print Network [OSTI]

    #19; a#14; `7q#rP_#4;`ba#6; c> ^#4;d d etsu^ta#18;ev l#19;p ^#4;w x+y{z} |}~â?¬,�tâ??*Æ?#16;â??â?¦~{ â? 

  18. Intellectual Property as Informaiton: A law and economics approach

    E-Print Network [OSTI]

    Barbosa, Cláudio R.

    2007-01-01

    A tutela jurídica da biotecnologia. São Paulo : RT, 1998.A tutela jurídica da biotecnologia. São Paulo : RT, 1998.

  19. Chapter 9. Chemical Equilibrium 9.1 The Nature of Chemical Equilibrium

    E-Print Network [OSTI]

    Ihee, Hyotcherl

    the equilibrium constant take a unique value for each individual che and KP: empirical equilibrium constant Law of mass action: 1) The numerical value of KC or KP of the equilibrium state or position of the reaction. #12;Law of Mass Action for Gas-Phase Reactions · A deeper study

  20. THE LATTICE OF COMPLETIONS OF AN ORDERED SET J. B. NATION AND ALEX POGEL

    E-Print Network [OSTI]

    Nation, James B.

    THE LATTICE OF COMPLETIONS OF AN ORDERED SET J. B. NATION AND ALEX POGEL Abstract. For any ordered set P, the join dense completions of P form a complete lattice KP with least element OP, the lattice of order ideals of P, and greatest element MP, the Dedekind-MacNeille completion of P. The lattice KP

  1. Appendix: Compressive Hyperspectral Imaging with Side Information

    E-Print Network [OSTI]

    Carin, Lawrence

    (k,n|-) GIG(2h0, -1 k,n, g0 - 1), (23) where GIG(x : a, b, p) is the generalized inverse Gaussian distribution: GIG(x; a, b, p) = (a/b) p 2 2Kp( ab) xp-1 exp - 1 2 (ax + b x ) , and Kp() is the modified Bessel

  2. Iterated and irreducible pion-photon exchange in nuclei Physik Department T39, Technische Universitt Mnchen, D-85747 Garching, Germany

    E-Print Network [OSTI]

    Weise, Wolfram

    calculate the contribution to the nuclear energy density functional which arises from iterated pion analytical results for the corresponding contributions to the nuclear en- ergy -interaction. The corresponding energy per proton reads E¯ p = 2 /15 2 2 -3+6 ln 2 App kp 2 with p=kp 3 /3 2 the proton density

  3. Fourier duality of quantum curves

    E-Print Network [OSTI]

    Martin Luu; Albert Schwarz

    2015-04-07

    There are two different ways to deform a quantum curve along the flows of the KP hierarchy. We clarify the relation between the two KP orbits: In the framework of suitable connections attached to the quantum curve they are related by a local Fourier duality. As an application we give a conceptual proof of duality results in 2D quantum gravity.

  4. F E AT U R E A RT I C L E 2 N E W E N G L A N D G R O U N D F I S H

    E-Print Network [OSTI]

    , its management, and prospects for long-term recovery and sustainability. BACKGROUND New England has by substantial losses of both ships and men to the vagaries of the North Atlan- tic. The catch from distant

  5. Thermodynamics Practice Problems of Unit I 1. a) For ideal gas, dU = nCvdT , delta(U) = 3R(T2 T1) = 124.7 J

    E-Print Network [OSTI]

    Wang, Ping

    ln(T2/T1) =0.422 J/K 2. a). Carnot Cycle provides the maximum thermal efficiency, eta = Ws/Qh = (QhJ/kg) = 144.5 kg/s 3. Rankine Cycle. eta = Ws/Qh = (H3 ­ H2)/(H2-H1) State properties State point T (o C) P

  6. Parallel Global Optimization with the Particle Swarm Algorithm J.F. Schutte1, J.A. Reinbolt2, B.J. Fregly1,2, R.T. Haftka1, A.D. George3

    E-Print Network [OSTI]

    Neumaier, Arnold

    , the Particle Swarm Optimization (PSO) algorithm. The parallel PSO algorithm's robustness and efficiency an almost linear increase in throughput for up to 30 nodes in a computational cluster. Parallel PSO provides of hours [1]. The Particle Swarm Optimization (PSO) algorithm is a recent addition to the list of global

  7. "Bond paths and van der Waals interactions in orpiment, As2S3", G.V. Gibbs, A.F. Wallace, R. Zallen, R.T. Downs. N.L.

    E-Print Network [OSTI]

    Zallen, Richard

    in Amorphous Chalcogenides", R. Zallen, in Amorphous Metals and Semiconductors, edited by P. Haasen and R. I., Phys. Rev. B 25, 781 (1982). · "Crystal Structures", R. Zallen, chapter one in Handbook on Semiconductors, Vol. 1 (North-Holland, Amsterdam, 1982), pp. 1-27. · "The Effect of Pressure on Optical

  8. T E C H N I C A L R E P O RT S I N C O M P U T E R S C I E N C E Technische Universitt Dortmund

    E-Print Network [OSTI]

    Morik, Katharina

    with the popularity of the Social Web. Recommenders can not only be used to sort and filter Web 2.0 and social network systems. Web 2.0 users explicitly provide personal information and implicitly express preferences through Recommender Systems & the Social Web Dietmar Jannach, Werner Geyer, Jill Freyne, Sarabjot Singh Anand, Casey

  9. Near and Sub-Barrier Fusion of Neutron-Rich Light Nuclei A. Elias, J. Lane, A. Liao, J. P. Schmidt, T. K. Steinbach, B. Wiggins, S. Hudan, R.T. de Souza

    E-Print Network [OSTI]

    de Souza, Romualdo T.

    of the neutron star crust is too low for fusion of 12C. Fusion of neutron rich light nuclei has been hypothesizedNear and Sub-Barrier Fusion of Neutron-Rich Light Nuclei A. Elias, J. Lane, A. Liao, J. P. Schmidt://nuchem.iucf.indiana.edu IU Dept of Chemistry: http://chem.indiana.edu Demonstrate the feasibility to measure the fusion cross

  10. Inelastic Neutron Study ofTHF+D, Clathrates K.T. Tait!.', F. R. Trouw', M.P. Hehlen', A. H. Shapiro', Y. Zhao' and R.T. Downs'

    E-Print Network [OSTI]

    Downs, Robert T.

    incorporated into hydrogen- bonded, cage-like ice host trameworks. Storage of hydrogen in molecular form within for hydrogen storage. Recent work has demonstrated that it is possible to obtain up to 4 wt% hydrogen ice were to be used as a hydrogen storage medium, it is possible that similar materials and engineering

  11. T E C H N I C A L R E P O RT S I N C O M P U T E R S C I E N C E Technische Universitt Dortmund

    E-Print Network [OSTI]

    Morik, Katharina

    , University of Torino, Italy Bettina Berendt, K.U.Leuven, Belgium Shlomo Berkovsky, University of Melbourne to mine this data for actionable knowledge, and to effectively use the discovered knowledge to enhance retrieval and filtering, databases, agent architectures, knowledge representation, data mining, text mining

  12. THIELE CENTRE for applied mathematics in natural science

    E-Print Network [OSTI]

    Schierup, Mikkel Heide

    ]), or a finite dam or fluid model (Asmussen [3] , Moran [23], Stadje [28]). Furthermore, they are used in models tends to infinity in the case where the L´evy process is light-tailed and the mean is either strictly is explicitly calculated. The case of negative mean and heavy tails case is treated in Andersen [1

  13. Types of Stations and Activities at Each: 1) Short Station

    E-Print Network [OSTI]

    ) from starboard A-Frame­ Hydro Team · Fe CTD cast (1) at some locations - Wu · VPR cast (1) from stern A camera deployed from ice-Cooper/Grebmier team · If necessary, small boat work to access ice- Gradinger small boat ­ Moran At 5-6 Open Water Stations: · Van Veen Grab sampling from stern A-frame, 3/8" wire, 3

  14. DNA BARCODING DNA barcoding exposes a case of mistaken identity

    E-Print Network [OSTI]

    Schuettpelz, Eric

    the Victorian era (Allen 1969; Moran 2004) and has recently enjoyed renewed popularity due, in part, and xeric-adapted members of the Pteridaceae (including the cryptogrammoids, adiantoids, and cheilanthoids high temperatures, bright light, and alkaline con- ditions, making them well adapted to many landscape

  15. IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE

    E-Print Network [OSTI]

    IDENTIFYING THE USAGE PATTERNS OF METHYL TERT-BUTYL ETHER (MTBE) AND OTHER OXYGENATES IN GASOLINE USING GASOLINE SURVEYS By Michael J. Moran, Rick M. Clawges, and John S. Zogorski U.S. Geological Survey 1608 Mt. View Rapid City, SD 57702 Methyl tert-butyl ether (MTBE) is commonly added to gasoline

  16. RELATIONS BETWEEN THE DETECTION OF METHYL TERT-BUTYL ETHER (MTBE) IN SURFACE AND GROUND WATER AND ITS CONTENT IN GASOLINE

    E-Print Network [OSTI]

    AND ITS CONTENT IN GASOLINE By Michael J. Moran, Mike J. Halde, Rick M. Clawges and John S. Zogorski U in the United States as an octane enhancer and oxygenate in gasoline. Octane enhancement began in the late 1970's with the phase-out of tetraethyl lead from gasoline. The use of oxygenates was expanded

  17. COLLEGE OF WILLIAM & MARY ATHLETIC DEPARTMENT ORGANIZATION CHART Athletic Director

    E-Print Network [OSTI]

    Lewis, Robert Michael

    Smith Claudette Canady Myrtle Cox Support Staff Jaime LaBianco- Business Managers Patricia Moran Kyle. of Compliance James Cullimore Shelfer Peace George Williams Derek J Melvin Vacant Tommy Bricker Derek Melvin Coach Maria Caro Assistant M/W Golf Coach Ed Teer Head Women's Gymnastics Coach Mary Lewis Assistant

  18. Fast Bayesian reconstruction of chaotic dynamical systems via extended Kalman filtering Renate Meyer1,

    E-Print Network [OSTI]

    Christensen, Nelson

    compare the new algorithm to the Gibbs sampler using the logistic, the tent, and the Moran-Ricker maps the parameters because they do not take into account that the values of the ``inde- pendent'' variable in 14 to generate a sample from the joint posterior distribution of unknown parameters and unknown

  19. ENERGY CONVERSION Spring 2011

    E-Print Network [OSTI]

    Bahrami, Majid

    , 5th Edition Michael J. Moran and Howard N. Shapiro, John Wiley and Sons Inc., New York, NY, 2004, John Willey 2010. 3) Alternative Energy Systems and Applications, by B.K. Hodge, John Willey 2010. 41 ENSC 461 ENERGY CONVERSION Spring 2011 Instructor: Dr. Majid Bahrami 4372 Email

  20. Microbial invasion of the Caribbean by an Indo-Pacific coral zooxanthella

    E-Print Network [OSTI]

    Microbial invasion of the Caribbean by an Indo-Pacific coral zooxanthella D. Tye Pettaya,b,1 , Drew Institutes of Energy and the Environment, University Park, PA 16802 Edited by Nancy A. Moran, University functions are poorly documented (6). Microbial invasions are difficult to detect, especially among free

  1. Basing Cryptographic Protocols on Tamper-Evident Seals In this paper we attempt to formally study two very intuitive physical models: sealed envelopes and

    E-Print Network [OSTI]

    Naor, Moni

    Basing Cryptographic Protocols on Tamper-Evident Seals Tal Moran Moni Naor Abstract In this paper are called "tamper-evident seals". Another physical object with this property is the "scratch-off card", often used in lottery tickets. We consider three variations of tamper-evident seals, and show that under

  2. Information Processing: Amacrine Cells Robert E. Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    Cover Information Processing: Amacrine Cells Robert E. Marc Department of Ophthalmology John A. Moran Eye Center 65 Mario Capecchi Dr University of Utah Salt Lake City, UT 84132 robert.marc@hsc.utah.edu Robert E. Marc :: Chapter 197 :: Information Processing: Amacrine Cells :: page 1 of 34 #12;Keywords

  3. Bryan William Jones, Ph.D. Marc Laboratory

    E-Print Network [OSTI]

    Marc, Robert E.

    Bryan William Jones, Ph.D. Marc Laboratory John A. Moran Eye Center Dept. Ophthalmology University (IgG) library has been produced by the Marc Lab at the University of Utah, targeting over 60 types;MC signature collapse & recovery in Retinal Detachment Cat Retina (Marc, Murray, Fisher, Lindberg

  4. Injury and Repair: Retinal Remodeling Robert E. Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    Injury and Repair: Retinal Remodeling Robert E. Marc Department of Ophthalmology John A. Moran Eye Center 65 Mario Capecchi Dr University of Utah Salt Lake City, UT 84132 robert.marc@hsc.utah.edu Keywords photoreceptors In press Elsevier Encyclopedia of the Eye Robert E. Marc :: Chapter 220 :: Injury and Repair

  5. Journal of Animal Ecology 2007

    E-Print Network [OSTI]

    Engen, Steinar

    on the dynamics of central European great and blue tit popula- tions. This generates synchronous fluctuations Ecological Society Blackwell Publishing Ltd The extended Moran effect and large-scale synchronous, Bauernstrasse 14, D-38162 Cremlingen, Germany Summary 1. Synchronous fluctuations of geographically separated

  6. GENERAL TECHNICAL REPORT PSW-GTR-245 Spatiotemporal Distribution Patterns of

    E-Print Network [OSTI]

    in Northern Mexico1 Gustavo Pérez-Verdin2 , M. A. Márquez-Linares3 , A. Cortes-Ortiz3 , and M. Salmerón of forest fires in Durango, one of the most affected States in Mexico, was conducted. The Moran's index, Mexico; Seasonality, Geographically Weighted Regression. Introduction In Mexico, most forest fires occur

  7. TOWARDS ESTIMATING TOTAL ECONOMIC VALUE

    E-Print Network [OSTI]

    Bateman, Ian J.

    TOWARDS ESTIMATING TOTAL ECONOMIC VALUE OF FORESTS IN MEXICO by Neil Adger Katrina Brown Raffaello OF FORESTS IN MEXICO by Neil Adger Katrina Brown Raffaello Cervigni Dominic Moran Centre for Social and SEDESOL for their assistance whilst in Mexico, and David Pearce and Kerry Turner for comments on earlier

  8. Fall 2015 BOSTONIA airway and sends it to a lab

    E-Print Network [OSTI]

    Spence, Harlan Ernest

    / BY BARBARA MORAN most cancer deaths in the United States. According to the National Cancer Institute it in a limited number of medical centers in the United States to gather feedback on how the test is used and its inter- est to NASA since many astronauts have lost bone mass, at a rate of about one percent per month

  9. Postdoctoral position in microfluidics for life and medical sciences at Technion -Israel Institute of Technology

    E-Print Network [OSTI]

    Rimon, Elon

    Postdoctoral position in microfluidics for life and medical sciences at Technion - Israel Institute of Technology The Microfluidic Technologies Laboratory at Technion, led by Prof. Moran Bercovici, is seeking of novel bio-microfluidic tools and assays. The Microfluidic Technologies Laboratory (microfluidics

  10. Computer Science Department Technion, IIT Algorithms in Computational Biology 236522

    E-Print Network [OSTI]

    Beimel, Amos

    Computer Science Department Technion, IIT Algorithms in Computational Biology ­ 236522 Moed A Exam Spring 2007, 24.9.07 Lecturer: Shlomo Moran TA: Ilan Gronau - Exam Duraion: 3 hours - The Exam has 3 structure can be used to answer the desired queries. 2. (23 pts) Denote by Si the sequence S after deletion

  11. Journal of Animal Ecology 2005

    E-Print Network [OSTI]

    Trexler, Joel C.

    Journal of Animal Ecology 2005 © 2005 British Ecological Society Blackwell Publishing, Ltd Everglades, Moran effect, spatial synchrony. Journal of Animal Ecology (2005) doi: 10.1111/j.1365-mail: cruetz@sigmaxi.org #12;2 C. R. Ruetz et al. © 2005 British Ecological Society, Journal of Animal Ecology

  12. A compact proton spectrometer for measurement of the absolute DD proton spectrum from which yield and R are determined in thin-shell inertial-confinement-fusion

    E-Print Network [OSTI]

    . Landen,3 M. J. Moran,3 R. A. Zacharias,3 J. D. Kilkenny,4 and A. Nikroo4 1 Plasma Science and Fusion Energetics, University of Rochester, Rochester, New York 14623, USA 3 Lawrence Livermore National Laboratory and implemented using a linear accelerator and applied to experiments at the OMEGA laser facility and the National

  13. C h d Heterogeneity of A d h h Deficiency Lucia Morandi, MD,* Rita Barresi, PhD,* Claudia Di Blasi, PhD,* Daniel Jung, PhD,?

    E-Print Network [OSTI]

    Campbell, Kevin P.

    ,* Renato Mantegazza, MD,* Carlo Antozzi, MD,* Laura Jarre, MD,$ Antonella Pini, MD,S Giuseppe Gobbi, MD, Mantegazza R, Antozzi C, Jarre L, Pini A, Gobbi G, Bianchi C, Cornelio F, Campbell KP, Mora M. Clinical

  14. Algebraic K-Theory and Topological Spaces Michael Paluch (mike@math.ist.utl.pt)

    E-Print Network [OSTI]

    -p-q(X) and Hp(X; Kp) CHp(X), where CHp(X) is the Chow group of codimension p-cycles on X. For p = 1 the sheaf K1

  15. Climate Change 2001: The Scientific Basis

    Office of Scientific and Technical Information (OSTI)

    Rotstayn, T.L. Schneider, U. Schumann, S.E. Schwartz, M.D. Schwarzkopf, K.P. Shine, S. Smith, D.S. Stevenson, F. Stordal, I. Tegen, Y. Zhang Review Editors F. Joos, J. Srinivasan...

  16. Appendix E References | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    P.J.W.; Davis, L.R.; Keyes, J.; Baumgartner, D.J.; and George, K.P. 2003. Dilution Models for Effluent Discharges. 4th Edition (Visual Plumes). EPA600R-03025. March....

  17. Algorithmic Construction of Efficient Fractional Factorial Designs With Large Run Sizes

    E-Print Network [OSTI]

    Xu, H Q

    2007-01-01

    M. (2003), Theory and Construction Methods for Large Regular238. Chen, C. L. (1991), “Construction of Some Binary LinearMitchell, T. J. (1967), “The Construction of Saturated 2 k?p

  18. Quasilinear dynamics of KdV-type equations

    E-Print Network [OSTI]

    Harrop-Griffiths, Benjamin Hilton

    2015-01-01

    We first use Bernstein’s inequality at the low frequency N ,using the Cauchy-Schwarz inequality, kP N (u &N u &N )k l p> p 2 ? 1 in the last inequality. The estimate then follows

  19. Accurately specifying storm-time ULF wave radial diffusion in the radiation belts

    E-Print Network [OSTI]

    Dimitrakoudis, Stavros; Balasis, Georgios; Papadimitriou, Constantinos; Anastasiadis, Anastasios; Daglis, Ioannis A

    2015-01-01

    Ultra-low frequency (ULF) waves can contribute to the transport, acceleration and loss of electrons in the radiation belts through inward and outward diffusion. However, the most appropriate parameters to use to specify the ULF wave diffusion rates are unknown. Empirical representations of diffusion coefficients often use Kp; however, specifications using ULF wave power offer an improved physics-based approach. We use 11 years of ground-based magnetometer array measurements to statistically parameterise the ULF wave power with Kp, solar wind speed, solar wind dynamic pressure and Dst. We find Kp is the best single parameter to specify the statistical ULF wave power driving radial diffusion. Significantly, remarkable high energy tails exist in the ULF wave power distributions when expressed as a function of Dst. Two parameter ULF wave power specifications using Dst as well as Kp provide a better statistical representation of storm-time radial diffusion than any single variable alone.

  20. Office of the Chief Financial Officer Annual Report 2009

    E-Print Network [OSTI]

    Fernandez, Jeffrey

    2010-01-01

    KJ05 KP15 Advanced Technology R&D Nuclear Theory MaterialsAdvanced Technology R&D Heavy-Ion Physics Nuclear Theory LowTechnology Life Sciences Materials Sciences Nuclear Sciences

  1. The dynamics of Kerguelen Plateau magma evolution: New insights from major element, trace element and Sr isotope microanalysis of plagioclase hosted in Elan

    E-Print Network [OSTI]

    Sciences, University of Durham, Durham DH1 3LE, UK c Chemistry Division, Nuclear and Radiochemistry, Los geologically short spans of time (Coffn and Eldholm, 1994; Duncan, 2002). The submarine Kerguelen Plateau (KP

  2. Köebner phenomenon induced by cupping therapy in a psoriasis patient

    E-Print Network [OSTI]

    Yu, Rui-xing; Hui, Yun; Li, Cheng-rang

    2013-01-01

    The pathogenesis of KP in psoriasis and other diseases isto cupping therapy in a psoriasis patient. To our knowledge,R K. The biology of psoriasis. An experimental study of the

  3. Scientific Discovery through Advanced Computing (SciDAC-3) Partnership...

    Office of Scientific and Technical Information (OSTI)

    (United States) Publication Date: 2014-01-15 OSTI Identifier: 1147164 Report Number(s): ORNLTM--201421 R&D Project: KP1703020 DOE Contract Number: AC05-00OR22725 Resource Type:...

  4. Biodiversity and Extinction Patterns of Chondrichthyes at the Cretaceous-Paleogene Boundary, Central Texas 

    E-Print Network [OSTI]

    Janus, Tracey

    2011-08-04

    The Cretaceous-Paleogene (KP) mass extinction is the second largest mass extinction in the history of the world with over 70% of known marine and terrestrial species suffering extinction in that event. One of the most ...

  5. Higher Spin Lifshitz Theories and the KdV-Hierarchy

    E-Print Network [OSTI]

    Beccaria, M; Gutperle, M; Li, Y; Macorini, G

    2015-01-01

    and Higher Spin Algebra,” Commun. Math. Phys. 128 (1990)the nonlinear W(KP) algebra,” Commun. Math. Phys. 158 (1993)algebras and equations of Korteweg-de Vries type,” J. Sov. Math.

  6. Fire Behavior Modeling - Experiment on Surface Fire Transition to the Elevated Live Fuel

    E-Print Network [OSTI]

    Omodan, Sunday

    2015-01-01

    of FDS to recognize two fuels of different materials in theFire Behavior Prediction and Fuel Modeling System, BURN -K.P. Combustion of forest fuels in Forest Fire: Control and

  7. Evaluating the Predictive Validity of DIBELS Literacy Measures with Third Grade Spanish-Speaking English Language Learners

    E-Print Network [OSTI]

    Kim, Jennifer Sun

    2012-01-01

    Intervention (RtI)………………………………………………… .. 5 Curriculum BasedResponse to Intervention (RtI) is a three-tiered preventionResearch conducted on RtI with EL learners has resulted in

  8. Goal Setting: Enhancing Academic Attitudes and Achievement in High School Gifted Underachievers

    E-Print Network [OSTI]

    Sivaraman, Rhonda Czapla

    2012-01-01

    C. E. , & Rollins, K. (2009). RtI for nuturing giftedness:Implications for the RtI school- based team. Gifted Child

  9. An Examination of the Predictive Validity of Early Literacy Measures for Korean English Language Learners

    E-Print Network [OSTI]

    Nam, Jeanie Eunjoo

    2011-01-01

    learners: support for an RTI model. The California Schoolto Intervention (RtI)………………………………………….. Standards forResponse to Intervention (RtI) Given the benefits of early

  10. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    (RT) (54 Gy locally advanced and 45 Gy postsurgery) and concomitant continuous-infusion 5-fluorouracil (5FU) (200 mgmsup 2d throughout RT). After 4 weeks, patients...

  11. Spinal epidural empyema in seven dogs

    E-Print Network [OSTI]

    Lavely, J A; Vernau, karen M; Vernau, W; Herrgesell, E J; Lecouteur, R A

    2006-01-01

    the spinal cord and vertebral column. With greater access toneurologic examination, vertebral column radiographs, my-Rt femur, Lt tibia, Rt ulna Vertebral column: no significant

  12. Using a theory of planned behavior approach to assess principals' Professional intentions to promote diversity awareness beyond the level recommended by their district 

    E-Print Network [OSTI]

    Landeck, Edith Suzanne

    2009-05-15

    Paola and Tschannen-Moran (2003) state ?as the nation seeks significant reforms in education through standards and accountability, it increasingly looks to principals? as there is a general belief that good 11 school principals are the cornerstones of good... principal; persons seeking the principalship must couple mastery of these elements with an additional quality for the school to be successful. These authors define this additional quality as purpose; other authors refer to this extra element as: ?care...

  13. Clinical and Experimental Optometry 88.5 September 2005 Retinal remodelling Jones, Watt and Marc

    E-Print Network [OSTI]

    Marc, Robert E.

    and Marc OPTOMETRY C L I N I C A L A N D E X P E R I M E N T A L Clin Exp Optom 2005; 88: 5: 282D Robert E Marc PhD Moran Eye Center, School of Medicine, University of Utah, Salt Lake City, USA Submitted and Experimental Optometry 88.5 September 2005 283 Retinal remodelling Jones, Watt and Marc dystrophies

  14. Essays in econometrics

    E-Print Network [OSTI]

    Oryshchenko, Vitaliy

    2011-03-15

    businesses via learning, imitation and other routes, with empirical results on spillovers being quite mixed (Blomstro¨m and Kokko, 1998; Go¨rg and Greenaway, 2001; Moran, Graham, and Blomstro¨m, 2005; Hu, 2004; Singh, 2004). The possibility of knowledge... spillovers from multinationals to indigenous enterprises is tightly linked to the type of training offered to employees of those firms. Local enter- prises may benefit from knowledge spillovers as trained employees move from foreign to local firms...

  15. Mathematical formula books and statistical tables are to be provided THE UNIVERSITY OF MANCHESTER

    E-Print Network [OSTI]

    Lionheart, Bill

    MATH38191 Two Hours Mathematical formula books and statistical tables are to be provided of the three questions A1. (a) Define (net) return Rt and log return rt at time t in terms of the price Pt > 0 at time t and the price Pt-1 > 0 at time t - 1. Show that rt = log(1 + Rt). [2+2 marks] (b) Consider

  16. Individualized Estimates of Second Cancer Risks After Contemporary Radiation Therapy for

    E-Print Network [OSTI]

    Brenner, David Jonathan

    are largely based on radiation therapy (RT) fields and doses no longer in use, and these estimates do and low-dose (20 Gy) RT for mediastinal Hodgkin lymphoma. METHODS. Three RT plans were constructed for 37 tissue doses with the omission of axillary RT. Low-dose (20 Gy) IFRT was associated with a 77% and 57

  17. APPUNTI DALLE LEZIONI DI ISTITUZIONI DI FISICA MATEMATICA

    E-Print Network [OSTI]

    Bologna, Università di

    seicento. Dunque questo modello meccanico rende conto di una legge termodinamica macroscopica (pV = RT

  18. Reminder:! homework grades and comments are on OAK!

    E-Print Network [OSTI]

    Palmeri, Thomas

    ? #12;RTj = 1 n rti i=1 n mean RT - overall mean RT in a given condition function (CDF) RTj = 1 n rti i=1 n mean RT F! j (t) = #elements in sample t n #12;cumulative distribution function (CDF) RTj = 1 n rti i=1 n mean RT F! j (t) = #elements in sample t n probability

  19. CHP - New Technologies that Work 

    E-Print Network [OSTI]

    Herweck, R.

    2012-01-01

    heat ? Cooling and refrigeration ? Steam production ?Dehumidification DE Packaged System at Site CHP: It?s time for Reliability Combined Heat & Power provides significantly greater reliability than central generation and T&D that could prevent... of appreciation for the amount of energy that can be saved ? General lack of necessary measurements such as flow rates and temperatures on cooling loops and other heat exchangers Nominal Capacity: 5 RT 10 RT 20 RT 30 RT 50 RT Model WFC-SC/SH Water...

  20. Detection of the Transverse Proximity Effect: Radiative Feedback from Bright QSOs

    E-Print Network [OSTI]

    T. S. Goncalves; C. C. Steidel; M. Pettini

    2007-11-26

    Measuring the response of the intergalactic medium to a blast of ionizing radiation allows one to infer the physical properties of the medium and, in principle, the lifetime and isotropy of the radiating source. The most sensitive such measurements can be made if the source of radiation is near the line of sight to a bright background QSO. We present results based on deep Keck/HIRES observations of the QSO triplet KP76, KP77 and KP78 at z ~2.5, with separations of 2-3 arcmin on the plane of the sky. Using accurate systemic redshifts of the QSOs from near-IR spectroscopy, we quantify the state of the IGM gas in the proximity regions where the expected ionizing flux from the foreground QSOs exceeds that of the metagalactic background by factors of 10-200, assuming constant and isotropic emission. Based on the unusual ionization properties of the absorption systems with detected HI, CIV, and OVI, we conclude that the gas has been significantly affected by the UV radiation from the nearby QSOs. Aided by observations of the galaxy density near the foreground QSOs, we discuss several effects that may explain why the transverse proximity effect has eluded most previous attempts to detect it. Our observations suggest that the luminosities of KP76 and KP77 have remained comparable to current values over timescales of, respectively, Delta t > 25 Myr and 16 Myr radiation from either QSO was significantly anisotropic during these intervals.

  1. C O L L E G E O F A RT S & S C I E N C EV A N D E R B I L T U N I V E R S I T Y n a remote jungle of Guatemala, Professor

    E-Print Network [OSTI]

    Wikswo, John

    of Guatemala, Professor Arthur Demarest and his team of Vanderbilt and Guatemalan archeologists have uncov in Guatemala (please see sidebar, page 4). The Cancuén research might cause scholars to revise their views

  2. 4.7 A G R I C U LT U R E : A N I M P O RT A N T NO N -P O I N T S O U R C E O F P O L LU T I O N by Hans Schreier, Kenneth J. Hall, Sandra J. Brown,

    E-Print Network [OSTI]

    transformation into urban use. However, the newest concern about agricultural sustainability clearly comes from nutrient applications to the land (Summary Report Steer- ing Committee 1997). As urban development) and spotted frog (Rana pretiosa) (Orchard 1992; 1994). Amphibians are dependent on wetlands for reproduc- tion

  3. V A N D E R B I L T U N I V E R S I T Y C O L L E G E O F A RT S & S C I E N C E Vanderbilt Institute of

    E-Print Network [OSTI]

    Wikswo, John

    Keith Wood, Designer Anthony J. Spence, E'80, Director of Advancement Communications Vanderbilt," says Richard McCarty, A&S dean. "This expanded commitment to Jewish Stud- ies advances Vanderbilt

  4. V A N D E R B I L T U N I V E R S I T Y C O L L E G E O F A RT S & S C I E N C E S U M M E R 2 0 0 5

    E-Print Network [OSTI]

    Wikswo, John

    of poverty, or a solution to it? What do churches think about genetics, and how will their political clout how poverty relates to reli- gion. Does organized religion reinforce the politics that keep people

  5. W I N T E R 2 0 0 2 V A N D E R B I L T U N I V E R S I T Y C O L L E G E O F A RT S & S C I E N C E

    E-Print Network [OSTI]

    Wikswo, John

    produced by the detector in a new high- energy physics experiment, called BTeV. Not only must the system manufacturers begin offering guidance systems that allow your car to drive you automatically to and from work, you may have an ambitious new computer science project at the Fermi National Accel- erator Laboratory

  6. Dynamical mass generation in unquenched QED using the Dyson-Schwinger equations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    K?z?lersü, Ayse; Sizer, Tom; Pennington, Michael R.; Williams, Anthony G.; Williams, Richard

    2015-03-13

    We present a comprehensive numerical study of dynamical mass generation for unquenched QED in four dimensions, in the absence of four-fermion interactions, using the Dyson-Schwinger approach. We begin with an overview of previous investigations of criticality in the quenched approximation. To this we add an analysis using a new fermion-antifermion-boson interaction ansatz, the Kizilersu-Pennington (KP) vertex, developed for an unquenched treatment. After surveying criticality in previous unquenched studies, we investigate the performance of the KP vertex in dynamical mass generation using a renormalized fully unquenched system of equations. This we compare with the results for two hybrid vertices incorporating themore »Curtis-Pennington vertex in the fermion equation. We conclude that the KP vertex is as yet incomplete, and its relative gauge-variance is due to its lack of massive transverse components in its design.« less

  7. Dynamical mass generation in unquenched QED using the Dyson-Schwinger equations

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Kizilersu, Ayse; Sizer, Tom; Pennington, Michael R.; Williams, Anthony G.; Williams, Richard

    2015-03-01

    We present a comprehensive numerical study of dynamical mass generation for unquenched QED in four dimensions, in the absence of four-fermion interactions, using the Dyson-Schwinger approach. We begin with an overview of previous investigations of criticality in the quenched approximation. To this we add an analysis using a new fermion-antifermion-boson interaction ansatz, the Kizilersu-Pennington (KP) vertex, developed for an unquenched treatment. After surveying criticality in previous unquenched studies, we investigate the performance of the KP vertex in dynamical mass generation using a renormalized fully unquenched system of equations. This we compare with the results for two hybrid vertices incorporating the Curtis-Pennington vertex in the fermion equation. We conclude that the KP vertex is as yet incomplete, and its relative gauge-variance is due to its lack of massive transverse components in its design.

  8. Production of K?K? pairs in proton-proton collisions below the ? meson threshold

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ye, Q. J.; Hartmann, M.; Chiladze, D.; Dymov, S.; Dzyuba, A.; Gao, H.; Gebel, R.; Hejny, V.; Kacharava, A.; Lorentz, B.; Mchedlishvili, D.; Merzliakov, S.; Mielke, M.; Mikirtytchiants, S.; Ohm, H.; Papenbrock, M.; Polyanskiy, A.; Serdyuk, V.; Stein, H. J.; Ströher, H.; Trusov, S.; Valdau, Yu.; Wilkin, C.; Wüstner, P.

    2013-06-01

    The pp?ppK?K? reaction was measured below the ? threshold at a beam energy of 2.568 GeV using the COSY-ANKE magnetic spectrometer. By assuming that the four-body phase space is distorted only by the product of two-body final-state interactions, fits to a variety of one-dimensional distributions permit the evaluation of differential and total cross sections. The shapes of the distributions in the Kp and Kpp invariant masses are reproduced only if the K?p interaction is even stronger than that found at higher energy. The cusp effect in the K?K? distribution at the K?K¯¯¯? threshold is much more clear and some evidence is also found for coupling between the K?p and K¯¯¯?n channels. However, the energy dependence of the total cross section cannot be reproduced by considering only a simple product of such pairwise final-state interactions.

  9. On the acceleration potential in perfect fluid flow 

    E-Print Network [OSTI]

    Maestri, Raymond Rudolph

    1960-01-01

    number space. COMMENT: This theorem is tacitly understood. in this and similar discourses. It needs explicit formulation for the purposes of the following arguments. THEOREM ): If '7X U 0) V P 6. (0 U 3 )& then PROOF: ~8) Ug Uo ~P . V R 2 2 E... LEMMA 2& If $(3) ~ 0 as ( R Bp (Rp& Kp) then P ~ -; gR E' Kp 19 This lemma follows from the definition of p and from (12). 0 The conjoint of lemma 1, lemma 2, and theorem 2 states; (() - Uo ) )& Uo . VR c 0- 2 U~ Uo ? 2 ~P ) $ pP $b R Q. E. D...

  10. A Framework for Real-Time Service-Oriented Architecture

    E-Print Network [OSTI]

    Panahi, Mark; Nie, Weiran; Lin, Kwei-Jay

    2009-01-01

    in service-oriented architectures,” Journal of Service-the RT-Llama RT-SOA architecture. We present the performanceZ. Wang, and W. Weiss, An Architecture for Differentiated

  11. Stat 39000/FinMath 34500 Lecture 9 IT^O PROCESSES

    E-Print Network [OSTI]

    Mykland, Per A.

    C(St, t) = BtC St Bt , t = ert C(e-rt St, t) Hence: C(s, t) = ert C(e-rt s, t) = ert E [f(ST ) | St = e

  12. Numerical models of Rayleigh-Taylor instabilities superimposed upon convection

    E-Print Network [OSTI]

    Schmeling, Harro

    one R.T.-overturn to multiple convective with salt tectonics (R.T.), plutonism (R.T.), plate overturns. Secondly, how is the temperature field tectonics and mantle flows (convection) (see e.g. affected

  13. Early Response-to-Intervention Measures and Criteria as Predictors of Reading Disability in 3rd Grade

    E-Print Network [OSTI]

    Beach, Kristen Dawn

    2012-01-01

    among traditional and RTI-based definitions of readingResponse-to- Intervention ( RtI) framework for identifyingderived from a longitudinal RtI project executed in low-

  14. Response to Intervention Within Restrictive Settings: A Multi-Tiered Behavioral Intervention System for Addressing Behavior Problems Within the Top Tier

    E-Print Network [OSTI]

    Thornton, Sage

    2011-01-01

    Caption F igure 1. Recycled RtI model. Tier III: IntensifiedL. , & McGraw, K. (2009). RTI in the classroom: Guidelinessuch as Response to Intervention (RtI) and Positive Behavior

  15. Changing Places: How Communities Will Improve the Health of Boys of Color

    E-Print Network [OSTI]

    Edley, Christopher; Ruiz de Velasco, Jorge

    2010-01-01

    Response to Intervention (RtI) framework, available onlinea Response to Intervention (RtI) frame- work (see Cunha etsupport Ap s du In try rti ce Transitional jobs Community-

  16. School-Based Screening: A Population-Based Approach to Inform and Monitor Children’s Mental Health Needs

    E-Print Network [OSTI]

    Dowdy, Erin; Ritchey, Kristin; Kamphaus, R. W.

    2010-01-01

    a response to intervention (RTI) model on identi?cation ofresponse to intervention (RtI) movement of identifying andwithin a school as a part of a RtI program to determine risk

  17. Effect of a Targeted Early Literacy Intervention for English Learners

    E-Print Network [OSTI]

    Arellano, Elizabeth Michelle

    2013-01-01

    learners: Support for an RTI model. The California SchoolResponse to Intervention (RtI) framework, participants wereResponse to Intervention (RtI), phonological awareness (PA),

  18. 1) Introduction In order to relate neurophysiological data in the primary

    E-Print Network [OSTI]

    Yen, Shih-Cheng

    . Direct Saccade Task Fixation Stimulus Monitor RT In Window Reward Eye Pos (H) Eye Pos (V) Fixation Stimulus Monitor RT In Window Reward Eye Pos (H) Eye Pos (V) Putative Processes 1) Fixate 2) Perceive

  19. The calculus of vector valued functions is used

    E-Print Network [OSTI]

    r(t) = porn 0 ecur:es_r'() ( _ ) an. r1(s) — (3 — s, s — 2, s ) intersect? Find their angle of inter- r(t) = i — j + e'" k section correct to the nearest degree.

  20. http://pss.sagepub.com/ Psychological Science

    E-Print Network [OSTI]

    Oregon, University of

    performance using absolute reaction time (RT)--a measure that is not sensitive to search efficiency--they do

  1. A Clean Slate Design of Internet's Congestion Control Algorithm

    E-Print Network [OSTI]

    Duffy, Ken

    /N(t) R(t) #12;RCP: The Basic Mechanism !"# $%&'(%) *+,%-./012& !"# *+,%-3012& !"# *+,%-3012& !"#4 567 *+,%-3012& 89#4567 !%:)':;?,%(?,%(

  2. Dynamic behavior of ion acoustic waves in electron-positron-ion magnetoplasmas with superthermal electrons and positrons

    SciTech Connect (OSTI)

    Saha, Asit E-mail: prasantachatterjee1@rediffmail.com; Pal, Nikhil; Chatterjee, Prasanta E-mail: prasantachatterjee1@rediffmail.com

    2014-10-15

    The dynamic behavior of ion acoustic waves in electron-positron-ion magnetoplasmas with superthermal electrons and positrons has been investigated in the framework of perturbed and non-perturbed Kadomtsev-Petviashili (KP) equations. Applying the reductive perturbation technique, we have derived the KP equation in electron-positron-ion magnetoplasma with kappa distributed electrons and positrons. Bifurcations of ion acoustic traveling waves of the KP equation are presented. Using the bifurcation theory of planar dynamical systems, the existence of the solitary wave solutions and the periodic traveling wave solutions has been established. Two exact solutions of these waves have been derived depending on the system parameters. Then, using the Hirota's direct method, we have obtained two-soliton and three-soliton solutions of the KP equation. The effect of the spectral index ? on propagations of the two-soliton and the three-soliton has been shown. Considering an external periodic perturbation, we have presented the quasi periodic behavior of ion acoustic waves in electron-positron-ion magnetoplasmas.

  3. Dr. Munawar Saleem Ahmad Passport number: TP1158651

    E-Print Network [OSTI]

    Jurat-Fuentes, Juan Luis

    : October 28, 1979 Marital Status: Married NIC No.: 33202-4576865-1 Domicile: Jhang (Punjab, Pakistan University, Mansehra, KP, Pakistan. Research & Teaching (Life Sciences) Permanent Address Village and Post office LangShumali, Tehsile and District Jhang, Punjab, Pakistan. Experience Working as postdoc fellow

  4. Current Experiments in Elementary Particle Physics (September 1989)

    E-Print Network [OSTI]

    Wohl, C.G.

    2010-01-01

    LBL) CERN-NA-036 FOA, L. (Pisa U) CERN-NA-001 G U B L E R ,U) TRIUMF-182 FOA, L. (Pisa U & INFN) CERN-NA-029 GULMEZ,121 P R E T E , T.DEL (Pisa U) CERN-R-210 PRETZL, K.P. (

  5. the french LOFAR consortium M. Tagger, P. Zarka + 30 participants

    E-Print Network [OSTI]

    Meyer-Vernet, Nicole

    and exchange of data #12;solar physics · expertise in Nançay/LESIA (Meudon) in solar radio interferometry the existing DAM array · + local data center, training, etc. · modest additional cost / standard station with the Nançay Radio Heliograph · participation in the new solar KP #12;transients · planets and exoplanets (P

  6. Joule heating at high latitudes

    SciTech Connect (OSTI)

    Foster, J.C.; St.-Maurice, J.; Abreu, V.J.

    1983-06-01

    High latitude Joule heating has been calculated from simultaneous observations of the electric field magnitude and the Pedersen conductivity calculated from individual measurements of the ion drift velocity and particle precipitation observed over the lifetime of the AE-C satellite. The data were sorted by latitude, local time, hemisphere, season, and Kp index and separate averages of the electric field magnitude, Pedersen conductivity and Joule heating was prepared. Conductivities produced by an averaged seasonal solar illumination were included with those calculated from the particle precipitation. We found that high-latitude Joule heating occurs in a roughly oval pattern and consists of three distinct heating regions: the dayside cleft, the region of sunward convection at dawn and dusk, and the midnight sector. On the average, heating in the cleft and dawn-dusk regions contributes the largest heat input. There is no apparent difference between hemispheres for similar seasons. Hemisphere averaged Joule heating at equinox amounts to approximately 25 GW for Kp = 1 conditions, 85G GW for Kp = 4, and varies linearly as a function of Kp. The Joule heat input is 50% greater during the summer than during winter primarily due to the increased conductivity caused by solar production.

  7. A COST-EFFECTIVE DIGITAL FORENSICS INVESTIGATION MODEL

    E-Print Network [OSTI]

    Overill, Richard E.

    i #12;ii #12;Chapter 1 A COST-EFFECTIVE DIGITAL FORENSICS INVESTIGATION MODEL R.E. Overill, M. Kwan, K.P. Chow, P. Lai and F. Law Abstract Computers operate at discrete points in time and hence digital the perspective of a digital investigation, it is the duty of digital investigators or forensic examiners

  8. Research article Tele-operated climbing and mobile service

    E-Print Network [OSTI]

    Chen, Sheng

    and maintenance in nuclear industry B.L. Luk and K.P. Liu Department of Manufacturing Engineering and Engineering in the field of nuclear industry. Design/methodology/approach ­ Describes nuclear electric robot operator (NERO in a typical nuclear plant, though, given that they are primarily tailor-made, they are still too expensive

  9. IL/EBP EducatIon The team space clearly documents behaviors

    E-Print Network [OSTI]

    Kay, Mark A.

    Space was used as platform for teaching and discussion on rounds. Designed to improve Information Lit the Google groups platform by an attending and medical librarian (authors KP and LM) who lead Infor- mation compare to revascularization in terms of car- diovascular mortality? " attEndIng: "I am glad you posted

  10. Proceedings of ICRC 2001: 4056 c Copernicus Gesellschaft 2001 Geomagnetic cutoff Penumbra structure: Approach by

    E-Print Network [OSTI]

    Usoskin, Ilya G.

    for a particular neutron monitor by averaging these functions over local times and over the Kp indices latitude neutron monitor station Oulu (65.05o N 25.47o E) for different values of computation steps R on the subject can be found, e.g. in (Smart et al., 2000). Penumbra structure is usually described as a system

  11. HIGH-RESOLUTION LAND/ICE IMAGING USING SEASAT SCATTEROMETER MEASUREMENTS

    E-Print Network [OSTI]

    Long, David G.

    1, P. J. Hardin2 Electrical and Computer Engineering Department, 'Geography Department Brigham Young sensing systems because of their proven ability to make all-weather measurements of vector winds over on an ir- regular grid. The U' measurements were noisywith a normalized standard deviation (KP)of 4% to 50

  12. Predicting Forage Nutritive Value Using an In Vitro Gas Production Technique and Dry Matter Intake of Grazing Animals Using n-Alkanes 

    E-Print Network [OSTI]

    Aguiar, Andre D.

    2011-08-08

    of fermentation parameters of the forage and obtain fractional digestion rate (kd) values to predict total digestible nutrients (TDN). The best nonlinear model to describe the IVGP values of the forages was the two-pool logistic equation. The passage rate (kp...

  13. The George Washington University Washington, D.C.

    E-Print Network [OSTI]

    Everstine, Gordon C.

    ­ Main Campus References: Elasticity in Engineering Mechanics, third edition, by A.P. Boresi, K.P. Chong (Spring Break), April 30 (designated Monday) Final Exam: May 7 Description: Introduction to Cartesian elasticity problems; to apply the fundamental equations by solving elementary elasticity problems. Grading

  14. THE CLASSIFICATION OF DEHN SURGERIES ON 2-BRIDGE KNOTS

    E-Print Network [OSTI]

    Brittenham, Mark

    THE CLASSIFICATION OF DEHN SURGERIES ON 2-BRIDGE whether a given surgery on a 2-bridge knot is * *reducible, toroidal, Seifert fibered, or hyperbolic are non-hyperbolic. Let Kp=q be a 2-bridge* * knot associated to the rational number p=q. When p 1

  15. THE CLASSIFICATION OF DEHN SURGERIES ON 2-BRIDGE KNOTS

    E-Print Network [OSTI]

    Brittenham, Mark

    THE CLASSIFICATION OF DEHN SURGERIES ON 2-BRIDGE KNOTS Mark Brittenham and Ying-Qing Wu Abstract. We will determine whether a given surgery on a 2-bridge knot is reducible, toroidal, Seifert bered-hyperbolic. Let Kp=q be a 2-bridge knot associated to the rational number p=q. When p 1 mod q, K is a torus knot

  16. Confirmation of the genetic association of CTLA4 and PTPN22 with ANCA-associated vasculitis

    E-Print Network [OSTI]

    Carr, Edward J.; Niederer, Heather A.; Williams, Julie; Harper, Lorraine; Watts, Richard A.; Lyons, Paul A.; Smith, Kenneth G. C.

    2009-12-01

    JM, Timms E, Wakeham A, Shahinian A, Lee KP, Thompson CB, Griesser H, Mak TW: Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Sci- ence (New York, NY) 1995, 270(5238):985-988. 20. Tivol EA, Borriello F, Schweitzer AN...

  17. THE LATTICE OF COMPLETIONS OF AN ORDERED SET J. B. NATION AND ALEX POGEL

    E-Print Network [OSTI]

    Nation, James B.

    THE LATTICE OF COMPLETIONS OF AN ORDERED SET J. B. NATION AND ALEX POGEL Abstract. For any ordered set P, the join dense completions of P form a complete lattice K(P) with least element O(P), the lattice of order ideals of P, and greatest element M(P), the Dedekind­MacNeille completion of P

  18. PREPARED FOR THE U.S. DEPARTMENT OF ENERGY, UNDER CONTRACT DE-AC02-76CH03073

    E-Print Network [OSTI]

    nonlinear dependencies among observed plasma and electromagnetic field variables in the coupled solar wind the nonlinear dynamics underlying the time evolution of the Dst and Kp geomagnetic indices, given solar wind dependencies, the degree of nonlinearity, and the rate of information loss. We find a significant solar cycle

  19. [HW90] M. Herlihy and J. Wing. Linearizability: A correctness condition for concurrent objects. ACM Trans. on Programming Languages and Systems, 12(3):463--492,

    E-Print Network [OSTI]

    Moran, Shlomo

    [HW90] M. Herlihy and J. Wing. Linearizability: A correctness condition for concurrent objects. ACM of processors. In Proc. 3rd ACM Symp. on Principles of Distributed Computing, pages 199--207, 1984. [KP92] M. Klugerman and C. Plaxton. Small­depth counting networks. In Proc. 24rd ACM Symp. on Theory of Computing

  20. Exploring phosphatidylinositol 5-phosphate 4-kinase function

    E-Print Network [OSTI]

    Bulley, Simon J.; Clarke, Jonathan H.; Droubi, Alaa; Giudici, Maria-Luisa; Robin F., Irvine

    2014-10-02

    innate immune signaling. Cell host & microbe. 2013;14:148-58. Keune WJ, Jones DR, Bultsma Y, Sommer L, Zhou XZ, Lu KP, et al. Regulation of phosphatidylinositol-5-phosphate signaling by Pin1 determines sensitivity to oxidative stress. Science signaling...

  1. ORNL/CDIAC-64 Proceedings of RIHMI-WDC,

    E-Print Network [OSTI]

    -Russian Research Institute of Hydrometeorological Information-- World Data Center Obninsk, Kaluga Region, Russia Research U.S. Department of Energy Budget Activity Number KP 05 00 00 0 Prepared by the Carbon Dioxide MARIETTA ENERGY SYSTEMS, INC. for the U.S. DEPARTMENT OF ENERGY under Contract No. DE-AC05-84OR21400

  2. MAGNETIC ANISOTROPY AS AN AID TO IDENTIFYING CRM AND DRM IN RED SEDIMENTARY ROCKS

    E-Print Network [OSTI]

    Utrecht, Universiteit

    the remanence anisotropy of hematite-bearing sedimentary rocks. It also shows that very high magnetic fieldsMAGNETIC ANISOTROPY AS AN AID TO IDENTIFYING CRM AND DRM IN RED SEDIMENTARY ROCKS K.P. KODAMA1 June, 2004; Accepted: August 25, 2004 ABSTRACT To further evaluate the potential of magnetic anisotropy

  3. Biographical Sketch: Mark W. Meisel A. Professional Preparation

    E-Print Network [OSTI]

    Meisel, Mark W.

    .M. Brown, D.R. Talham, M.W. Meisel, K.P. Schmidt, G.S. Uhrig, S.E. Nagler, Phys. Rev. B 80, 094411 (2009 Chercheur Associé CNRS-CEA, 1985-86 B. Academic Appointments Colonel Allan R. and Margaret G. Crow Term. Hill, D. R. Talham, M. W. Meisel, Phys. Rev. B 82 (2010) 214405 [5 pages]. "Persistent photoinduced

  4. Can WAAS Availability Be Inferred From Geomagnetic Data? An Analysis Seebany Datta-Barua, Todd Walter, Juan Blanch, Per Enge

    E-Print Network [OSTI]

    Stanford University

    Can WAAS Availability Be Inferred From Geomagnetic Data? An Analysis Seebany Datta-Barua, Todd availability. As a result, a question of interest often arises: can we know in advance that WAAS availability alarm rate for WAAS availability. Kp has been known to reach its highest value on days for which

  5. Knowledge Provenance: An Approach to Modeling and Maintaining The Evolution and Validity of Knowledge

    E-Print Network [OSTI]

    Fox, Mark S.

    with information of unknown sources, and need to interact with "strangers". This makes trust and the validity of information in cyberspace arise as crucial issues. This thesis proposes knowledge provenance (KP) as a formal and maintaining the information sources, information dependencies, and trust structures. We conceptualize

  6. "Ceramics and high-temperature composites, silicides" Oxidation of Stainless Steel Powder

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    "Ceramics and high-temperature composites, silicides" CHTC9 Oxidation of Stainless Steel Powder. To understand the corrosion behavior of a model 304L(p)-ZrO2(s) composite, a 304L stainless steel powder has stainless steel particles. In this domain a mechanism is proposed and the kp value is calculated both due

  7. Quiet Time Precipitation Patterns of Energetic Particles

    E-Print Network [OSTI]

    Kallenrode, May-Britt

    in some of the most important parameters that de- pend on solar activity - Kp index, global average Solar Wind Speed and Particle Fluxes 9 4 Precipitation Patterns 11 4.1 Global Average Flux a potential hazard. This is evidenced by an especially strong solar storm on September 1-2, 1859, which

  8. An empirical model of magnetospheric chorus amplitude using solar wind and geomagnetic indices

    E-Print Network [OSTI]

    potential global models of magnetospheric chorus amplitude: one which uses only instantaneous AE* and Kp, for the first time, the global evolution of chorus amplitude as a function of solar wind and geomagnetic drivingAn empirical model of magnetospheric chorus amplitude using solar wind and geomagnetic indices D. I

  9. The Naked Truth about Hadronic Regge Trajectories

    E-Print Network [OSTI]

    A. E. Inopin

    2000-12-19

    We have reconstructed Regge trajectories (RT), using all existing data on masses and spin-parities of all currently known hadrons. In this resonance energy region meson and baryon RT are grossly nonlinear, and only 12% of all RT could be classified as a linear, with $\\sigma=0$, $\\alpha'\\simeq 0.9$ GeV${}^{-2}$.

  10. Specification and Analysis of Attribute-based Authorization Policy

    E-Print Network [OSTI]

    Sandhu, Ravi

    Policy The Big Goal Flexible, scalable authorization for decentralized, collaborative environments policy to support collaboration in open systems RT: A Role-based Trust-management* framework Need. Winsborough 6 Role-based Trust Management (RT) A family of credential / policy languages Simplest, RT0, has

  11. A CSP View on UMLRT structure diagrams Clemens Fischer, ErnstRudiger Olderog and Heike Wehrheim

    E-Print Network [OSTI]

    Habel, Annegret

    A CSP View on UML­RT structure diagrams Clemens Fischer, Ernst­R¨udiger Olderog and Heike Wehrheim UML­RT structure diagrams together with the formal method CSP­OZ combining CSP and Object­Z. While CSP­OZ is used for specifying the system components themselves (by CSP­OZ classes), UML­RT diagrams provide

  12. QER- Comment of E. Winkler

    Broader source: Energy.gov [DOE]

    I am one of many rejecting the idea of the proposed Kinder Moran pipeline. The people don't want to pay for a multibillionaire's expansion of his fossil fuel kingdom. Also, the methane pollution of this form of energy is not "clean energy." And most importantly it is destructive to the earth and the health of the people. As stewards of the planet, we must do better, and we are doing better, with cleaner and more economical forms of energy. Please, have a conscience and a vision. No fracked gas pipeline expansion.

  13. City of Moreno Valley,, California (Utility Company) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,

  14. City of Morgan City, Utah (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,Utah (Utility

  15. City of Morganton, North Carolina (Utility Company) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,Utah

  16. City of Morrill, Kansas (Utility Company) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler, Iowa (Utility Company)Menasha,Monroe City,Moran,UtahMorrill,

  17. Adatbzisok elmlete 10. eloads Katona Gyula Y.

    E-Print Network [OSTI]

    Katona, Gyula Y.

    SQL-ben Az SQL-ben az ismeretlen vagy nem létezo értéket a NULL érték jelképezi. A NULL használatakor;ADATBÁZISOK ELM�LETE 10. EL OADÁS 2/22 NULL érték az SQL-ben Az SQL-ben az ismeretlen vagy nem létezo értéket 10. EL OADÁS 2/22 NULL érték az SQL-ben Az SQL-ben az ismeretlen vagy nem létezo értéket a NULL érték

  18. A robust and efficient approach to detect 3D rectal tubes from CT colonography

    SciTech Connect (OSTI)

    Yang Xiaoyun; Slabaugh, Greg [Medicsight PLC, Kensington Centre, 66 Hammersmith Road, London (United Kingdom)

    2011-11-15

    Purpose: The rectal tube (RT) is a common source of false positives (FPs) in computer-aided detection (CAD) systems for CT colonography. A robust and efficient detection of RT can improve CAD performance by eliminating such ''obvious'' FPs and increase radiologists' confidence in CAD. Methods: In this paper, we present a novel and robust bottom-up approach to detect the RT. Probabilistic models, trained using kernel density estimation on simple low-level features, are employed to rank and select the most likely RT tube candidate on each axial slice. Then, a shape model, robustly estimated using random sample consensus (RANSAC), infers the global RT path from the selected local detections. Subimages around the RT path are projected into a subspace formed from training subimages of the RT. A quadratic discriminant analysis (QDA) provides a classification of a subimage as RT or non-RT based on the projection. Finally, a bottom-top clustering method is proposed to merge the classification predictions together to locate the tip position of the RT. Results: Our method is validated using a diverse database, including data from five hospitals. On a testing data with 21 patients (42 volumes), 99.5% of annotated RT paths have been successfully detected. Evaluated with CAD, 98.4% of FPs caused by the RT have been detected and removed without any loss of sensitivity. Conclusions: The proposed method demonstrates a high detection rate of the RT path, and when tested in a CAD system, reduces FPs caused by the RT without the loss of sensitivity.

  19. Physician Beliefs and Practices for Adjuvant and Salvage Radiation Therapy After Prostatectomy

    SciTech Connect (OSTI)

    Showalter, Timothy N.; Ohri, Nitin; Teti, Kristopher G.; Foley, Kathleen A.; Keith, Scott W.; Trabulsi, Edouard J.; Lallas, Costas D.; Dicker, Adam P.; Hoffman-Censits, Jean; Pizzi, Laura T.; Gomella, Leonard G.

    2012-02-01

    Purpose: Despite results of randomized trials that support adjuvant radiation therapy (RT) after radical prostatectomy (RP) for prostate cancer with adverse pathologic features (APF), many clinicians favor selective use of salvage RT. This survey was conducted to evaluate the beliefs and practices of radiation oncologists (RO) and urologists (U) regarding RT after RP. Methods and Materials: We designed a Web-based survey of post-RP RT beliefs and policies. Survey invitations were e-mailed to a list of 926 RO and 591 U. APF were defined as extracapsular extension, seminal vesicle invasion, or positive surgical margin. Differences between U and RO in adjuvant RT recommendations were evaluated by comparative statistics. Multivariate analyses were performed to evaluate factors predictive of adjuvant RT recommendation. Results: Analyzable surveys were completed by 218 RO and 92 U (overallresponse rate, 20%). Adjuvant RT was recommended based on APF by 68% of respondents (78% RO, 44% U, p <0.001). U were less likely than RO to agree that adjuvant RT improves survival and/or biochemical control (p < 0.0001). PSA thresholds for salvage RT were higher among U than RO (p < 0.001). Predicted rates of erectile dysfunction due to RT were higher among U than RO (p <0.001). On multivariate analysis, respondent specialty was the only predictor of adjuvant RT recommendations. Conclusions: U are less likely than RO to recommend adjuvant RT. Future research efforts should focus on defining the toxicities of post-RP RT and on identifying the subgroups of patients who will benefit from adjuvant vs. selective salvage RT.

  20. RADIO FREQUENCY IDENTIFICATION DEVICES: EFFECTIVENESS IN IMPROVING SAFEGUARDS AT GAS-CENTRIFUGE URANIUM-ENRICHMENT PLANTS.

    SciTech Connect (OSTI)

    JOE,J.

    2007-07-08

    Recent advances in radio frequency identification devices (RFIDs) have engendered a growing interest among international safeguards experts. Potentially, RFIDs could reduce inspection work, viz. the number of inspections, number of samples, and duration of the visits, and thus improve the efficiency and effectiveness of international safeguards. This study systematically examined the applications of RFIDs for IAEA safeguards at large gas-centrifuge enrichment plants (GCEPs). These analyses are expected to help identify the requirements and desirable properties for RFIDs, to provide insights into which vulnerabilities matter most, and help formulate the required assurance tests. This work, specifically assesses the application of RFIDs for the ''Option 4'' safeguards approach, proposed by Bruce Moran, U. S. Nuclear Regulatory Commission (NRC), for large gas-centrifuge uranium-enrichment plants. The features of ''Option 4'' safeguards include placing RFIDs on all feed, product and tails (F/P/T) cylinders, along with WID readers in all FP/T stations and accountability scales. Other features of Moran's ''Option 4'' are Mailbox declarations, monitoring of load-cell-based weighing systems at the F/P/T stations and accountability scales, and continuous enrichment monitors. Relevant diversion paths were explored to evaluate how RFIDs improve the efficiency and effectiveness of safeguards. Additionally, the analysis addresses the use of RFIDs in conjunction with video monitoring and neutron detectors in a perimeter-monitoring approach to show that RFIDs can help to detect unidentified cylinders.

  1. Population-Based Study of Trends and Variations in Radiotherapy as Part of Primary Treatment of Cancer in the Southern Netherlands Between 1988 and 2006, With an Emphasis on Breast and Rectal Cancer

    SciTech Connect (OSTI)

    Vulto, Johanna C.M. [Comprehensive Cancer Centre South (IKZ), Eindhoven Cancer Registry, Eindhoven (Netherlands)], E-mail: ansvulto@home.nl; Lybeert, Marnix L.M. [Department of Radiotherapy, Catharina Hospital, Eindhoven (Netherlands); Louwman, Marieke W.J. [Comprehensive Cancer Centre South (IKZ), Eindhoven Cancer Registry, Eindhoven (Netherlands); Poortmans, Philip M.P. [Dr. Bernard Verbeeten Institute, Tilburg (Netherlands); Coebergh, Jan Willem W. [Comprehensive Cancer Centre South (IKZ), Eindhoven Cancer Registry, Eindhoven (Netherlands); Department of Public Health, Erasmus University Medical Centre, Rotterdam (Netherlands)

    2009-06-01

    Purpose: To explore current variations in the use of primary radiotherapy (RT) in a region with two RT departments with adjacent referral areas, one in the eastern and one in the western sector of the southern region of the Netherlands. Methods and Materials: We calculated the proportion of 147,588 patients with newly diagnosed cancer between 1988 and 2006 in the southern Netherlands who received primary RT. Especially for breast and rectal cancer patients we studied primary RT use according to stage (breast cancer) and age and separately for the eastern and western sectors. Results: The number of patients with new diagnoses receiving primary RT increased from 1,668 patients in 1988 to 2,971 patients in 2006, with the proportion of the overall patients receiving RT remaining more or less unchanged ({+-}30%). However, only 20% of elderly patients (75+ years) received primary RT. Over time, more patients with prostate and rectal cancer, fewer patients with lung and bladder cancer or Hodgkin's lymphoma, and, recently, more patients with cervical or endometrial cancer received RT. The proportion of patients with most other tumor types treated with RT remained more or less unchanged. The total RT rate was slightly higher for patients in the eastern sector. Of particular note, patients with breast or rectal cancer in the eastern sector were significantly more likely to receive primary RT than were their counterparts in the western sector (odds ratio = 1.4, 95% confidence interval =1.4-1.5, and odds ratio = 1.4, 95% confidence interval = 1.3-1.6, respectively). Conclusions: Although the number of RT-treated patients increased substantially during 1988 to 2006, the proportion remained essentially unchanged. In addition, large variations were found in referral rates for RT, especially in later years, between the eastern and the western sectors of the region.

  2. Phase Measurement of Cognitive Impairment Specific to Radiotherapy

    SciTech Connect (OSTI)

    Armstrong, Carol L.; Shera, David M.; Lustig, Robert A.; Phillips, Peter C.

    2012-07-01

    Purpose: Memory impairment is an early-delayed effect of radiotherapy (RT). The prospective longitudinal measurement of the cognitive phase effects from RT was conducted on treated and untreated brain tumor patients. The study design investigated semantic vs. perceptual and visual vs. verbal memory to determine the most disease-specific measure of RT-related changes and understanding of the neurotoxicity from RT to the brain. Methods and Materials: Tests of memory that had previously shown RT-related phasic changes were compared with experimental tests of memory to test hypotheses about cognition targeted to the neural toxicity of RT. The results from 41 irradiated and 29 nonirradiated patients with low-grade, supratentorial tumors were analyzed. The methods controlled for comorbid white matter risk, recurrence, interval after treatment, and age (18-69 years). The effects were examined before RT and at three points after RT to 1 year using a mixed effects model that included interval, group, surgical status, medication use, practice, and individual random effects. Four new tests of memory and other candidate cognitive tests were investigated, and a post hoc analysis of a comprehensive battery of tests was performed to identify the cognitive processes most specific to RT. Results: The RT effects on memory were identified in the treated group only; among the new tests of memory and the complete neurocognitive battery, the RT effects were significant only for delayed recall (p < 0.009) and interval to recognize (p < 0.002). Tumor location was not related to the treatment effect. Memory decline was specific to retrieval of semantic memories; a double dissociation of semantic from perceptual visual memory was demonstrated in the RT group. Conclusions: These results implicate memory dependent on the semantic cortex and the hippocampal memory system. A cognitive measurement that is brief but specific to neural mechanisms is effective and feasible for studies of RT damage.

  3. External Beam Radiotherapy for Colon Cancer: Patterns of Care

    SciTech Connect (OSTI)

    Dunn, Emily F., E-mail: dunn@humonc.wisc.ed [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI (United States); Kozak, Kevin R. [Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI (United States); Moody, John S. [Division of Radiation Oncology, Moses Cone Regional Cancer Center, Greensboro, NC (United States)

    2010-04-15

    Purpose: Despite its common and well characterized use in other gastrointestinal malignancies, little is known about radiotherapy (RT) use in nonmetastatic colon cancer in the United States. To address the paucity of data regarding RT use in colon cancer management, we examined the RT patterns of care in this patient population. Methods and Materials: Patients with nonmetastatic colon cancer, diagnosed between 1988 and 2005, were identified in the Surveillance, Epidemiology, and End Results (SEER) database. Univariate and multivariate methods were used to identify factors associated with RT use. Results: On univariate analysis, tumor location, age, sex, race, T stage, N stage, and geographic location were each associated with differences in RT use (all p < 0.01). In general, younger patients, male patients, and patients with more advanced disease were more likely to receive RT. On multivariate analysis, tumor location, age, gender, T and N stage, time of diagnosis and geographic location were significantly associated with RT use (all p < 0.001). Race, however, was not associated with RT use. On multivariate analysis, patients diagnosed in 1988 were 2.5 times more likely to receive RT than those diagnosed in 2005 (p = 0.001). Temporal changes in RT use reflect a responsiveness to evolving evidence related to the therapeutic benefits of adjuvant RT. Conclusions: External beam RT is infrequently used for colon cancer, and its use varies according to patient and tumor characteristics. RT use has declined markedly since the late 1980s; however, it continues to be used for nonmetastatic disease in a highly individualized manner.

  4. Upfront Androgen Deprivation Therapy With Salvage Radiation May Improve Biochemical Outcomes in Prostate Cancer Patients With Post-Prostatectomy Rising PSA

    SciTech Connect (OSTI)

    Jang, Joanne W.; Hwang, Wei-Ting; Guzzo, Thomas J.; Wein, Alan J.; Haas, Naomi B.; Both, Stefan; Vapiwala, Neha

    2012-08-01

    Purpose: The addition of androgen deprivation therapy (ADT) to definitive external beam radiation therapy (RT) improves outcomes in higher-risk prostate cancer patients. However, the benefit of ADT with salvage RT in post-prostatectomy patients is not clearly established. Our study compares biochemical outcomes in post-prostatectomy patients who received salvage RT with or without concurrent ADT. Methods and Materials: Of nearly 2,000 post-prostatectomy patients, we reviewed the medical records of 191 patients who received salvage RT at University of Pennsylvania between 1987 and 2007. Follow-up data were obtained by chart review and electronic polling of the institutional laboratory database and Social Security Death Index. Biochemical failure after salvage RT was defined as a prostate-specific antigen of 2.0 ng/mL above the post-RT nadir or the initiation of ADT after completion of salvage RT. Results: One hundred twenty-nine patients received salvage RT alone, and 62 patients received combined ADT and salvage RT. Median follow-up was 5.4 years. Patients who received combined ADT and salvage RT were younger, had higher pathologic Gleason scores, and higher rates of seminal vesicle invasion, lymph node involvement, and pelvic nodal irradiation compared with patients who received salvage RT alone. Patients who received combined therapy had improved biochemical progression-free survival (bPFS) compared with patients who received RT alone (p = 0.048). For patients with pathologic Gleason scores {<=}7, combined RT and ADT resulted in significantly improved bPFS compared to RT alone (p = 0.013). Conclusions: These results suggest that initiating ADT during salvage RT in the post-prostatectomy setting may improve bPFS compared with salvage RT alone. However, prospective randomized data are necessary to definitively determine whether hormonal manipulation should be used with salvage RT. Furthermore, the optimal nature and duration of ADT and the patient subgroups in which ADT could provide the most benefit remain open questions.

  5. Homogenization limit for a multiband effective mass model in heterostructures

    SciTech Connect (OSTI)

    Morandi, O.

    2014-06-15

    We study the homogenization limit of a multiband model that describes the quantum mechanical motion of an electron in a quasi-periodic crystal. In this approach, the distance among the atoms that constitute the material (lattice parameter) is considered a small quantity. Our model include the description of materials with variable chemical composition, intergrowth compounds, and heterostructures. We derive the effective multiband evolution system in the framework of the kp approach. We study the well posedness of the mathematical problem. We compare the effective mass model with the standard kp models for uniform and non-uniforms crystals. We show that in the limit of vanishing lattice parameter, the particle density obtained by the effective mass model, converges to the exact probability density of the particle.

  6. Quantum curves

    E-Print Network [OSTI]

    Albert Schwarz

    2014-08-16

    One says that a pair (P,Q) of ordinary differential operators specify a quantum curve if [P,Q]=const. If a pair of difference operators (K,L) obey the relation KL=const LK we say that they specify a discrete quantum curve. This terminology is prompted by well known results about commuting differential and difference operators, relating pairs of such operators with pairs of meromorphic functions on algebraic curves obeying some conditions. The goal of this paper is to study the moduli spaces of quantum curves. We will show how to quantize a pair of commuting differential or difference operators (i.e. to construct the corresponding quantum curve or discrete quantum curve). The KP-hierarchy acts on the moduli space of quantum curves; we prove that similarly the discrete KP-hierarchy acts on the moduli space of discrete quantum curves.

  7. The development of a model system to monitor induction of an enzyme in Saccharomyces cerevisiae 

    E-Print Network [OSTI]

    Wilkerson, James Edward

    1979-01-01

    in 5 mls of 100 mM Iris-HC1 pH 8. 0 with 5 mM DTT and 10 mM KH PO and incubated at 30'C with 2 4 shaking for 15 minutes. Cells were washed once with 30 mls 10 mM KP pH 7. 5 and once with 3. 1! (w/v) KCI, 10 mM KP . at pH 7. 5 w'th 2 mg of Zymolase... of 50 KeV. Sections were stained with 0. 1/ Toludine Blue in 1X sodium borate for observation with light microscopy. Chemicals The three substrates, sodium a-napthyl phosphate, p-nitrophenol phosphate and 4-methylumbelliferyl phosphate and the DNase...

  8. Reactions at Polymer Interfaces: Transitions from Chemical to Diffusion-Control and Mixed Order Kinetics

    E-Print Network [OSTI]

    Ben O'Shaughnessy; Dimitrios Vavylonis

    1998-12-21

    We study reactions between end-functionalized chains at a polymer-polymer interface. For small chemical reactivities (the typical case) the number of diblocks formed, $R_t$, obeys 2nd order chemically controlled kinetics, $R_t \\sim t$, until interfacial saturation. For high reactivities (e.g. radicals) a transition occurs at short times to 2nd order diffusion-controlled kinetics, with $R_t \\sim t/\\ln t$ for unentangled chains while $t/\\ln t$ and $t^{1/2}$ regimes occur for entangled chains. Long time kinetics are 1st order and controlled by diffusion of the more dilute species to the interface: $R_t \\sim t^{1/4}$ for unentangled cases, while $R_t \\sim t^{1/4}$ and $t^{1/8}$ regimes arise for entangled systems. The final 1st order regime is governed by center of gravity diffusion, $R_t \\sim t^{1/2}$.

  9. Surjectivity of cycle maps Hel`ene Esnault and Marc Levine

    E-Print Network [OSTI]

    Levine, Marc

    for which the rational topological cycle maps CHp (X) Q H2p B (X, Q) #12;Surjectivity of cycle maps i cycle, and d = dim(X). One consequence of this decomposition is that the total cycle map d p=0 CHp) the Hodge numbers hp,q (X) all vanish for |p - q| > 1. (4) the maps CHp (X) C× Hp (X, Kp+1) are all

  10. WHEN IS THE MULTIPLICITY OF A WEIGHT EQUAL TO i? A. D. Berenshtein and A. V. Zelevinskii UDC 519.46

    E-Print Network [OSTI]

    Berenstein, Arkady

    no direct summands of type G 2. If K%,p = i, then PS(1) (~ - P) = i. 3) If S is a simple algebra of type G i e Z+ is even and (~ - I) = ~' imi + rmr/2; Scientific Council of the USSR Academy of Sciences-2663/90/2404-0259512.50 © 1991 Plenum Publishing Corporation 259 #12;3) type G2: I = ~m2, ~ = mini + m2~2, where ml, m 2 e Z

  11. Acoustic cloaking theory BY ANDREW N. NORRIS*

    E-Print Network [OSTI]

    Norris, Andrew

    composition of the cloak is not uniquely defined, but the phase speed and wave velocity of the pseudo-acoustic is for the infinitesimal pressure p(x, t) that satisfies the scalar wave equation in the surrounding fluid, V2 pKp Z 0: ð1 that the modified wave equation in u mimics the exterior equation (1.1) in the entire region U. This is achieved

  12. The control of drift in an analytical gamma ray spectrometer 

    E-Print Network [OSTI]

    Fite, Lloyd Emery

    1961-01-01

    Pulse &idth with Frequency 2 Variation of Photopeak Channel w1th High Voltage Helipot Adjustemnt 28 32 3 Variation of Photopesk Channel with Discriminstor Helipot Ad)ustment Hormslized Count Bate Dietribution for Peaks in Different Parts... Diagram of Proposed Drift Control System 13 7 Output Pulse from Preamplifier Using Radioactive Einco5 16 8 Preamplifier Output Using 2APl Cathode-Ray Tube 18 9 Preamplifier Output Using EE-2 Neon Lamp 10 Preampkifier Output Using 3KP16 Cathode...

  13. MR spectroscopic imaging Discussion/Conclusion: Adapted target-driven, overdiscretized reconstruc-

    E-Print Network [OSTI]

    of subcranial lipids of 1H MRSI. References: [1] KP Pruessmann et al., MRM 42(1999) 952 [2] T Kirchner et al., Proc. ISMRM 2012, #1734 [3] J Sánchez-González et al, MRM 55(2006) 287-295 [4] A Henning et al., NMR Biomed, 22(2009) 683 [5] I Tkac et al., MRM 41(1999) 649 [6] A Fillmer et al. Proc. ISMRM 2012, #2065 [7

  14. A 1.6Gbps Digital Clock and Data Recovery Circuit Pavan Kumar Hanumolu, Min Gyu Kim, Gu-Yeon Wei1, and Un-ku Moon

    E-Print Network [OSTI]

    Moon, Un-Ku

    . (1) to transform the analog loop filter to a digital loop filter (DLF) as follows: icpR + icp Cs icp Fig. 2. A digital CDR obtained by s-to-z transformation. by KP and KI and are equal to icpR and icpA 1.6Gbps Digital Clock and Data Recovery Circuit Pavan Kumar Hanumolu, Min Gyu Kim, Gu-Yeon Wei1

  15. Building Abbreviations Alumni Hall

    E-Print Network [OSTI]

    Johnson Jr.,, Ray

    20A/B 44 20A/B 44 20A/B 44 58 17 17 88 34 25 Building Abbreviations Alumni Hall Campbell Dome Colden FitzGerald Gym Frese Hall G Building Gertz Center Goldstein Theatre Honors Hall GC GB GT HH MU KY KG KS KP PH I Building Jefferson Hall Kiely Hall King Hall Kissena Hall Klapper Hall Music Building

  16. Reliable Computing 1 (3) (1995),pp. 239-249 An automatic and guaranteed determination

    E-Print Network [OSTI]

    Kearfott, R. Baker

    1995-01-01

    the number of roots of an analytic function, f(z), that lie inside a counterclockwise, simple dosed curve, C, the location of the roots relative m C, the number of subdivigons, and the arithmetic pre~ion used, uponHefiaHaa~T~eCKOfi C~yHKIII~, Ae.am~ BHyTpHIIp0CT0~ 3auKHyTOfl KpHBOfl B KOMnAeKCHOITI IIAOCKOCTH ~. X~'^OK~',~,~. H3

  17. Thesis Proposal Space Environment Impacts on Geostationary

    E-Print Network [OSTI]

    de Weck, Olivier L.

    Weather Phenomena 1.3.2.1. The Solar Cycle 1.3.2.2. Low Energy Electrons 1.3.2.3. Kp Index 1.3.2.4. High.4.1.7. SSPA Anomalies and Eclipse Data 2.4.2. Solar Array Degradation 2.5. Anomalous Component Detection), the Solar Influences Data Center, and Los Alamos National Labs (LANL) geostationary satellites. We

  18. Prediction of Liver Function by Using Magnetic Resonance-based Portal Venous Perfusion Imaging

    SciTech Connect (OSTI)

    Cao Yue; Wang Hesheng; Johnson, Timothy D.; Pan, Charlie; Hussain, Hero; Balter, James M.; Normolle, Daniel; Ben-Josef, Edgar; Ten Haken, Randall K.; Lawrence, Theodore S.; Feng, Mary

    2013-01-01

    Purpose: To evaluate whether liver function can be assessed globally and spatially by using volumetric dynamic contrast-enhanced magnetic resonance imaging MRI (DCE-MRI) to potentially aid in adaptive treatment planning. Methods and Materials: Seventeen patients with intrahepatic cancer undergoing focal radiation therapy (RT) were enrolled in institution review board-approved prospective studies to obtain DCE-MRI (to measure regional perfusion) and indocyanine green (ICG) clearance rates (to measure overall liver function) prior to, during, and at 1 and 2 months after treatment. The volumetric distribution of portal venous perfusion in the whole liver was estimated for each scan. We assessed the correlation between mean portal venous perfusion in the nontumor volume of the liver and overall liver function measured by ICG before, during, and after RT. The dose response for regional portal venous perfusion to RT was determined using a linear mixed effects model. Results: There was a significant correlation between the ICG clearance rate and mean portal venous perfusion in the functioning liver parenchyma, suggesting that portal venous perfusion could be used as a surrogate for function. Reduction in regional venous perfusion 1 month after RT was predicted by the locally accumulated biologically corrected dose at the end of RT (P<.0007). Regional portal venous perfusion measured during RT was a significant predictor for regional venous perfusion assessed 1 month after RT (P<.00001). Global hypovenous perfusion pre-RT was observed in 4 patients (3 patients with hepatocellular carcinoma and cirrhosis), 3 of whom had recovered from hypoperfusion, except in the highest dose regions, post-RT. In addition, 3 patients who had normal perfusion pre-RT had marked hypervenous perfusion or reperfusion in low-dose regions post-RT. Conclusions: This study suggests that MR-based volumetric hepatic perfusion imaging may be a biomarker for spatial distribution of liver function, which could aid in individualizing therapy, particularly for patients at risk for liver injury after RT.

  19. Historical Trends in the Use of Radiation Therapy for Pediatric Cancers: 1973-2008

    SciTech Connect (OSTI)

    Jairam, Vikram; Roberts, Kenneth B.; Yale Cancer Center, New Haven, Connecticut; Cancer Outcomes, Public Policy, and Effectiveness Research Center at Yale, New Haven, Connecticut ; Yu, James B.

    2013-03-01

    Purpose: This study was undertaken to assess historical trends in the use of radiation therapy (RT) for pediatric cancers over the past 4 decades. Methods: The National Cancer Institute's Surveillance, Epidemiology, and End Results database of the 9 original tumor registries (SEER-9) was queried to identify patients aged 0 to 19 years with acute lymphoblastic leukemia, acute myeloid leukemia, bone and joint cancer, cancer of the brain and nervous system, Hodgkin lymphoma, neuroblastoma, non-Hodgkin lymphoma, soft tissue cancer, Wilms tumor, or retinoblastoma from 1973 to 2008. Patients were grouped into 4-year time epochs. The number and percentage of patients who received RT as part of their initial treatment were calculated per epoch by each diagnosis group from 1973 to 2008. Results: RT use for acute lymphoblastic leukemia, non-Hodgkin lymphoma, and retinoblastoma declined sharply from 57%, 57%, and 30% in 1973 to 1976 to 11%, 15%, and 2%, respectively, in 2005 to 2008. Similarly, smaller declines in RT use were also seen in brain cancer (70%-39%), bone cancer (41%-21%), Wilms tumor (75%-53%), and neuroblastoma (60%-25%). RT use curves for Wilms tumor and neuroblastoma were nonlinear with nadirs in 1993 to 1996 at 39% and 19%, respectively. There were minimal changes in RT use for Hodgkin lymphoma, soft tissue cancer, or acute myeloid leukemia, roughly stable at 72%, 40%, and 11%, respectively. Almost all patients treated with RT were given external beam RT exclusively. However, from 1985 to 2008, treatments involving brachytherapy, radioisotopes, or combination therapy increased in frequency, comprising 1.8%, 4.6%, and 11.9% of RT treatments in brain cancer, soft tissue cancer, and retinoblastoma, respectively. Conclusions: The use of RT is declining over time in 7 of 10 pediatric cancer categories. A limitation of this study is a potential under-ascertainment of RT use in the SEER-9 database including the delayed use of RT.

  20. Plant Defense Signaling Mechanisms and Evolution 

    E-Print Network [OSTI]

    Jiang, Shan

    2015-08-13

    for two Salk lines. The positions of RT-PCR primers are labeled with arrows. (B) Genotyping and RT-PCR detection of ASR3 expression in Salk lines. PCR was carried out with genomic DNA or cDNA using either the full-length or RT-PCR primers as indicated... modifications and charge. 7 Supplemental Table 2. Primers used in this study. Cloning and mutation primers Gene Forward primer Reverse primer ASR3 CGGGATCCATGGCTCTGGAACAGTTAGG GAAGGCCTCATCTTATCCGCGATTT TTG ProASR3...

  1. Free Energy Calculation in MD Simulation

    E-Print Network [OSTI]

    Nielsen, Steven O.

    Free Energy Calculation in MD Simulation #12;Basic Thermodynamics Helmoholtz free energy A = U ­ TS + i Ni dA = wrev (reversible, const N V T) eq (22.9) McQuarrie & Simon Gibbs free energy G = U;Implication of Free Energy A B Keq = [A]/[B] Keq = exp (-G0 /RT) G0 = -RT ln Keq G = G0 + RT ln Q G > 0

  2. Some computational aspects of finite fields 

    E-Print Network [OSTI]

    Salmon, Ronald Dale

    1962-01-01

    . Hence gj ej. a+P=j 3+h=a 3+h+P=j 5) Distributive Law. Nor P(x), Q(x) and R(x) in 9[x], P(x)[Q(x) + R(x)] [P(x)Q(x)] + [P(x)R(x)]. n i m Proof. If P(x) Z ajx , Q(x) = E b x and R(x) E c x , then i~O j=o j~O n j m j s i P(x)[q(x) + R(x)] Z a x [ E b x...2=1 eKP MA(3)sa J2 IF(N 3&112 ~ 14m)4 112 CALL DI V &MMAX & GO TO 512 14 DO 513 J3=1+KP MA&4) =J3 1 IF(N-4)113@15 ~ 15 113 CALI DIV(MMAX& GO TO 513 15 DO 514 J4=)eKP MA(5) -J4 I I F ( N-5 ) 1 14 ~ I 6 ~ 1 6 ) & MA&33) ~ MB(33) s KT(15) e...

  3. Production of K?K? pairs in proton-proton collisions below the ? meson threshold

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Ye, Q. J.; Hartmann, M.; Chiladze, D.; Dymov, S.; Dzyuba, A.; Gao, H.; Gebel, R.; Hejny, V.; Kacharava, A.; Lorentz, B.; et al

    2013-06-12

    The pp?ppK?K? reaction was measured below the ? threshold at a beam energy of 2.568 GeV using the COSY-ANKE magnetic spectrometer. By assuming that the four-body phase space is distorted only by the product of two-body final-state interactions, fits to a variety of one-dimensional distributions permit the evaluation of differential and total cross sections. The shapes of the distributions in the Kp and Kpp invariant masses are reproduced only if the K?p interaction is even stronger than that found at higher energy. The cusp effect in the K?K? distribution at the K?K¯¯¯? threshold is much more clear and some evidencemore »is also found for coupling between the K?p and K¯¯¯?n channels. However, the energy dependence of the total cross section cannot be reproduced by considering only a simple product of such pairwise final-state interactions.« less

  4. A new bidirectional generalization of (2+1)-dimensional matrix k-constrained Kadomtsev-Petviashvili hierarchy

    SciTech Connect (OSTI)

    Chvartatskyi, O. I. Sydorenko, Yu. M.

    2013-11-15

    We introduce a new bidirectional generalization of (2+1)-dimensional k-constrained Kadomtsev-Petviashvili (KP) hierarchy ((2+1)-BDk-cKPH). This new hierarchy generalizes (2+1)-dimensional k-cKP hierarchy, (t{sub A}, ?{sub B}) and (?{sub A}, ?{sub B}) matrix hierarchies. (2+1)-BDk-cKPH contains a new matrix (1+1)-k-constrained KP hierarchy. Some members of (2+1)-BDk-cKPH are also listed. In particular, it contains matrix generalizations of Davey-Stewartson (DS) systems, (2+1)-dimensional modified Korteweg-de Vries equation and the Nizhnik equation. (2+1)-BDk-cKPH also includes new matrix (2+1)-dimensional generalizations of the Yajima-Oikawa and Melnikov systems. Binary Darboux Transformation Dressing Method is also proposed for construction of exact solutions for equations from (2+1)-BDk-cKPH. As an example the exact form of multi-soliton solutions for vector generalization of the DS system is given.

  5. Effects of Resistance Trainging and -hydroxy--methylbutyrate (HMB) on Muscle Fiber CSA and Lean Body Mass in Aged Rats: A DTI and DEXA Study

    E-Print Network [OSTI]

    McQuade, D. Tyler

    and volumetric measurements. In vivo and prior to sacrifice, pre- and post-RT LBM was assessed by dual energy X

  6. Cars and the City: An Investigation of Transportation and Residential Location Choices in New York City

    E-Print Network [OSTI]

    Salon, Deborah

    2006-01-01

    Weighted) . . . . . . . . . . . . . . .Car Ownership inof Private Car Riding Time . . . . . . . . . . . . . . . .109 4.11 Number of Cars Per Household from the RT-HIS Sample

  7. Is Androgen Deprivation Therapy Necessary in All Intermediate-Risk Prostate Cancer Patients Treated in the Dose Escalation Era?

    SciTech Connect (OSTI)

    Castle, Katherine O.; Hoffman, Karen E.; Levy, Lawrence B.; Lee, Andrew K.; Choi, Seungtaek; Nguyen, Quynh N.; Frank, Steven J.; Pugh, Thomas J.; McGuire, Sean E.; Kuban, Deborah A.

    2013-03-01

    Purpose: The benefit of adding androgen deprivation therapy (ADT) to dose-escalated radiation therapy (RT) for men with intermediate-risk prostate cancer is unclear; therefore, we assessed the impact of adding ADT to dose-escalated RT on freedom from failure (FFF). Methods: Three groups of men treated with intensity modulated RT or 3-dimensional conformal RT (75.6-78 Gy) from 1993-2008 for prostate cancer were categorized as (1) 326 intermediate-risk patients treated with RT alone, (2) 218 intermediate-risk patients treated with RT and ?6 months of ADT, and (3) 274 low-risk patients treated with definitive RT. Median follow-up was 58 months. Recursive partitioning analysis based on FFF using Gleason score (GS), T stage, and pretreatment PSA concentration was applied to the intermediate-risk patients treated with RT alone. The Kaplan-Meier method was used to estimate 5-year FFF. Results: Based on recursive partitioning analysis, intermediate-risk patients treated with RT alone were divided into 3 prognostic groups: (1) 188 favorable patients: GS 6, ?T2b or GS 3+4, ?T1c; (2) 71 marginal patients: GS 3+4, T2a-b; and (3) 68 unfavorable patients: GS 4+3 or T2c disease. Hazard ratios (HR) for recurrence in each group were 1.0, 2.1, and 4.6, respectively. When intermediate-risk patients treated with RT alone were compared to intermediate-risk patients treated with RT and ADT, the greatest benefit from ADT was seen for the unfavorable intermediate-risk patients (FFF, 74% vs 94%, respectively; P=.005). Favorable intermediate-risk patients had no significant benefit from the addition of ADT to RT (FFF, 94% vs 95%, respectively; P=.85), and FFF for favorable intermediate-risk patients treated with RT alone approached that of low-risk patients treated with RT alone (98%). Conclusions: Patients with favorable intermediate-risk prostate cancer did not benefit from the addition of ADT to dose-escalated RT, and their FFF was nearly as good as patients with low-risk disease. In patients with GS 4+3 or T2c disease, the addition of ADT to dose-escalated RT did improve FFF.

  8. Synthesis of the Furanosteroidal Antibiotic Viridin Anderson, E.; Alexanian, E.; Sorenson, E. Angew. Chemie Int. Ed. 2004, 43, 1998-2001.

    E-Print Network [OSTI]

    . Chemie Int. Ed. 2004, 43, 1998-2001. 1. LDA (1 equiv.) THF, -78 °C then TMSCl, -78 °C to rt 2. [Pd(PPh3

  9. OCT-based arterial elastography: robust estimation exploiting tissue

    E-Print Network [OSTI]

    Khalil, Ahmad S.

    and Anatomically-Realistic Models," Journal of Engineering Mathematics 47(3-4), 299-314 (2003). 4. R.T. Lee, F

  10. Distributed Energy Systems in California's Future: A Preliminary Report Volume 2

    E-Print Network [OSTI]

    Balderston, F.

    2010-01-01

    1976. R.T. Tamblyn, " Thermal Storage: June 1977. A Sleepinga flatplate collector and thermal storage system. With thethe collector and thermal storage and its exchange systems

  11. Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California

    E-Print Network [OSTI]

    Mills, Andrew

    2013-01-01

    RT deviations impose (i.e. wind forecast errors on averagerelative magnitude of wind forecast errors decreases betweenwith managing DA wind forecast errors steadily increases.

  12. Literacy Progress Monitoring: Efficiency Versus Stability

    E-Print Network [OSTI]

    Garcia, Melissa Jeanne

    2012-01-01

    2011). A systematic view of RTI research: Introduction toPyramid response to intervention: RTI, professional learningis Response to Intervention (RtI), or a Multitiered Systems

  13. A, E.K.Ris Ris-M-OHj Title and authors)

    E-Print Network [OSTI]

    or group Department of fee-«'tor Technology Group's own registration numbers) RT-^-*5 Abstract The work seven of the Department'a graduate

  14. Mobilization of Viable Tumor Cells Into the Circulation During Radiation Therapy

    SciTech Connect (OSTI)

    Martin, Olga A.; Anderson, Robin L.; Russell, Prudence A.; Ashley Cox, R.; Ivashkevich, Alesia; Swierczak, Agnieszka; Doherty, Judy P.; Jacobs, Daphne H.M.; Smith, Jai; Siva, Shankar; Daly, Patricia E.; Ball, David L.; and others

    2014-02-01

    Purpose: To determine whether radiation therapy (RT) could mobilize viable tumor cells into the circulation of non-small cell lung cancer (NSCLC) patients. Methods and Materials: We enumerated circulating tumor cells (CTCs) by fluorescence microscopy of blood samples immunostained with conventional CTC markers. We measured their DNA damage levels using ?-H2AX, a biomarker for radiation-induced DNA double-strand breaks, either by fluorescence-activated cell sorting or by immunofluorescence microscopy. Results: Twenty-seven RT-treated NSCLC patients had blood samples analyzed by 1 or more methods. We identified increased CTC numbers after commencement of RT in 7 of 9 patients treated with palliative RT, and in 4 of 8 patients treated with curative-intent RT. Circulating tumor cells were also identified, singly and in clumps in large numbers, during RT by cytopathologic examination (in all 5 cases studied). Elevated ?-H2AX signal in post-RT blood samples signified the presence of CTCs derived from irradiated tumors. Blood taken after the commencement of RT contained tumor cells that proliferated extensively in vitro (in all 6 cases studied). Circulating tumor cells formed ?-H2AX foci in response to ex vivo irradiation, providing further evidence of their viability. Conclusions: Our findings provide a rationale for the development of strategies to reduce the concentration of viable CTCs by modulating RT fractionation or by coadministering systemic therapies.

  15. Changes in the Economic Value of Variable Generation at High Penetration Levels: A Pilot Case Study of California

    E-Print Network [OSTI]

    Mills, Andrew

    2013-01-01

    System Operator Combined cycle gas turbine Continuousinclude natural gas combined cycle (CCGTs) and combustiona balance in RT. The combined-cycle vintage (CCGT) modeled

  16. Biochemical failure and the temporal kinetics of prostate-specific antigen after radiation therapy with androgen deprivation

    SciTech Connect (OSTI)

    Buyyounouski, Mark K. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Hanlon, Alexandra L. [Department of Biostatistics, Fox Chase Cancer Center, Philadelphia, PA (United States); Horwitz, Eric M. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Uzzo, Robert G. [Department of Surgical Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Pollack, Alan [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)]. E-mail: alan.pollack@fccc.edu

    2005-04-01

    Purpose: The accuracy of the American Society of Therapeutic Radiation Oncology consensus definition of biochemical failure (BF) after radiation therapy (RT) and androgen deprivation (AD) has been questioned, because posttreatment prostate-specific antigen (PSA) levels typically rise after release from AD, and misclassification of BF may be made. The temporal kinetics of posttreatment PSA levels was examined to define the error in the classification of BF. Methods and Materials: Between December 1, 1991 and April 30, 1998, 688 men with T1c-T3 NX/0 M0 prostate cancer received three-dimensional conformal RT alone (n = 586) or in combination with either short-term (STAD: 3 to 12 months, n = 82) or long-term (LTAD: 12 to 36 months, n = 20) AD. Follow-up, calculated from the end of all treatment, was {>=}48 months. The mean posttreatment PSA was calculated in 3-month intervals. Results: The median posttreatment clinical follow-up period was 76 months (range, 48-152 months). The posttreatment PSA values from the end of all treatment for the RT+STAD-BF group showed an initial period of rise followed by a period of decline at 30 months and then a continued rise again. The decline in the mean posttreatment PSA is explained in part by stabilization in PSA level after 3 consecutive rises. Nonbiochemical failures (NBF) after RT+STAD had a relatively constant mean PSA over time of approximately 0.5 ng/mL. Unlike the RT+STAD-NBF profile, the RT+LTAD-NBF profile rose continuously and steadily to a level approaching 1 ng/mL. The RT+LTAD-BF profile rose continuously but at a slower rate over time. Nine RT+STAD-NBF patients (22%) and 2 RT+LTAD-BF (29%) patients experienced 3 consecutive rises followed by a subsequent decline and stabilization of PSA compared to 10 RT-BF patients (5%). Redistributing these misclassified patients to their respective NBF groups changed the mean posttreatment PSA profiles as follows: The RT+LTAD-BF profile rose constantly and steadily with a doubling time of approximately 16 months, and the RT+LAD-NF initially rose to a value of approximately 0.5 ng/mL, then at 36 months began to decline. Conclusions: The temporal kinetics of posttreatment PSA after RT+AD and RT alone are different. The American Society of Therapeutic Radiation Oncology definition for biochemical failure overestimates BF in 20-30% after RT+AD compared to 5% after RT alone.

  17. Improving consumer value through enhanced performance around...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Improving consumer value through enhanced performance around the world LANL statistical tools have helped create Reliability Technology (RT), which increases the overall fraction...

  18. Published: August 02, 2011 r 2011 American Chemical Society 12910 dx.doi.org/10.1021/ja202277h |J. Am. Chem. Soc. 2011, 133, 1291012913

    E-Print Network [OSTI]

    Müller, Peter

    - (trifluoromethyl)phenyl isocyanate, CH2Cl2, rt, 12 h. (ii) Squaric acid, toluene/n-butanol (3:1), r

  19. Impaired angiogenesis in aging myocardial microvascular endothelial cells is associated with reduced importin alpha and decreased nuclear transport of HIF1 alpha: mechanistic implications.

    E-Print Network [OSTI]

    Ahluwalia, A; Narula, J; Jones, M K; Deng, X; Tarnawski, A S

    2010-01-01

    Exercise training improves aging-induced downregulation ofimpaired angiogenesis in aging human dermal microvascularby real time RT-PCR. In aging MMEC importin ?1 and importin

  20. Defining biochemical failure after radiotherapy with and without androgen deprivation for prostate cancer

    SciTech Connect (OSTI)

    Buyyounouski, Mark K. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)]. E-mail: mark.buyyounouski@fccc.edu; Hanlon, Alexandra L. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Eisenberg, Debra F. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Horwitz, Eric M. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Feigenberg, Steven J. [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Uzzo, Robert G. [Department of Surgical Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States); Pollack, Alan [Department of Radiation Oncology, Fox Chase Cancer Center, Philadelphia, PA (United States)

    2005-12-01

    Purpose: To compare several characteristics of alternative definitions of biochemical failure (BF) in men with extended follow-up after radiotherapy (RT) with or with androgen deprivation therapy (ADT) for prostate cancer. Methods and Materials: From December 1, 1991, to April 30, 1998, 688 men with Stage T1c-T3NX-N0M0 prostate cancer received RT alone (n = 586) or RT plus ADT (n = 102) with a minimal follow-up of 4 years and five or more 'ADT-free' posttreatment prostate-specific antigen levels. BF was defined by three methods: (1) the ASTRO definition (three consecutive rises in prostate-specific antigen level); (2) a modified American Society for Therapeutic Radiology Oncology (ASTRO) definition requiring two additional consecutive rises when a decline immediately subsequent to three consecutive rises occurred; and (3) the 'Houston' or nadir plus 2-ng/mL definition (a rise of at least 2 ng/mL greater than the nadir). The sensitivity, specificity, positive predictive value, negative predictive value, and overall accuracy were determined for each using clinical progression as the endpoint. Furthermore, the misclassification rates for a steadily rising prostate-specific antigen level, ability to satisfy the proportional hazards (RT with or without ADT), effects of short follow-up, and intervals to the diagnosis of BF were compared. Results: The misclassification rate for BF using the nadir plus 2-ng/mL definition was 2% for RT alone and 0% for RT plus ADT compared with 0% and 0% for the modified ASTRO definition, and 5% and 23% for the ASTRO definition, respectively. The hazard rates for RT alone and RT plus ADT were proportional only for the nadir plus 2 ng/mL definition and seemingly unaffected by the length of follow-up. For RT with or without ADT, the nadir plus 2 ng/mL definition was the most specific (RT, 80% vs. RT plus ADT, 75%) with the greatest positive predictive value (RT, 36% vs. RT plus ADT, 25%) and overall accuracy (RT, 81% vs. RT plus ADT, 77%). A greater proportion of BF was diagnosed in the first 2 years of follow-up with the nadir plus 2 ng/mL definition compared with the ASTRO definition (13% vs. 5%, p = 0.0138, chi-square test). Conclusion: The nadir plus 2 ng/mL definition was the best predictor of sustained, true, biochemical, and clinical failure, and was not affected by the use of ADT or follow-up length.

  1. A molecular line and continuum study of water maser sources

    E-Print Network [OSTI]

    Jenness, Timothy

    1996-12-10

    Bally J., Lada C. J., 1983, ApJ, 265, 824 Benson P. J., et al., 1990, ApJS, 74, 911 Burke B. F., Papa D. C., Papadopoulos G. D., Schwartz P. R., Knowles S. H., Sullivan W. T., Meeks M. L., Moran J. M., 1970, ApJ, 160, L63 Chapman J. M., Cohen R. J., 1986... , MNRAS, 220, 513 Cheung A. C., Rank D. M., Townes C. H., Thornton D. D., Welch W. J., 1969, Nature, 221, 626 Chini R., Elsa¨sser H., Neckel T., 1980, A&A, 91, 186 Cooke B., Elitzur M., 1985, ApJ, 295, 175 Elitzur M., Hollenbach D. J., McKee C. F., 1989...

  2. Magnetic Activity in Stars, Discs and Quasars

    E-Print Network [OSTI]

    Donald Lynden-Bell

    2000-07-14

    Although magnetic fields in interstellar matter were postulated almost fifty years ago, magnetohydrodynamic theory was then much hampered by our inability to see what the magnetic field configurations were like and, after a decade of innovative development, cynics, not without some justification, began to claim that anything can happen when magnetism and an imaginative theorist get together. Thus cosmic lightning in particular received a bad press. More recently great advances in observational techniques that we shall hear of from Title, Beck, Moran and Mirabel have enabled us to see not only the sun's magnetic field with unprecedented clarity but the fields in galaxies, quasars and microquasars are now measured and not merely figments of fertile imaginations.

  3. Comunidades de partidarios en redes sociales: estudio de las elecciones catalanas de 2010 y 2012

    E-Print Network [OSTI]

    Moro, Esteban

    diferentes tipos de comunicación (mención, MT, o retuit, RT), de las palabras utilizadas o de los hashtags, da indicación sobre la formación de grupos (partisanos) que comparten una misma ideología, flujos de populares en este tipo de estudios es el de utilizar el número de RT, MT o número de menciones de los

  4. Required Reading: FP Chapter 3 Suggested Reading: SP Chapter 3

    E-Print Network [OSTI]

    Toohey, Darin W.

    Average thermal energy of collisions: ~ RT = 8.3 J mol-1 K-1 x T RT = 2.5 kJ mol-1 @ 300 K Energy ­ Atmospheric photochemistry #12;2 Importance of Spectroscopy and Photochemistry I · Most chemical processes molecules directly influences the energy balance of the planet ­ Greenhouse effect (CO2, H2O, N2O, CFCs

  5. Surveillance of Craniopharyngioma Cyst Growth in Children Treated With Proton Radiotherapy

    SciTech Connect (OSTI)

    Winkfield, Karen M. [Harvard Radiation Oncology Program, Harvard Medical School, Boston, MA (United States)], E-mail: kwinkfield@partners.org; Linsenmeier, Claudia; Yock, Torunn I. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States); Grant, P. Ellen [Department of Radiology, Massachusetts General Hospital, Boston, MA (United States); Yeap, Beow Y. Sc.D. [Department of Medicine, Massachusetts General Hospital, Boston, MA (United States); Butler, William E. [Department of Neurosurgery, Massachusetts General Hospital, Boston, MA (United States); Tarbell, Nancy J. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States)

    2009-03-01

    Purpose: Craniopharyngiomas are benign, slow-growing tumors that frequently contain a cystic component. Even with gross total resection, the cyst can reform and cause symptoms. Fluctuations in cyst volume during radiotherapy (RT) can affect treatment planning and delivery. The aim of this study was to report our experience with cyst enlargement during conformal proton RT for children with craniopharyngioma and to make recommendations regarding mid-treatment surveillance. Methods and Materials: Between January 2001 and August 2007, 24 children (aged {<=}18 years) underwent proton RT at the Massachusetts General Hospital for craniopharyngioma. For all 24 patients, tumor size on magnetic resonance imaging and/or computed tomography was measured before and after RT. Surveillance imaging was available for review on 17 patients. During RT, cyst growth was assessed to determine whether the treatment fields needed to be altered. Results: Of the 17 children who underwent repeat imaging during RT, 6 required intervention because of changes in cyst dimensions. Four patients (24%) had cyst growth beyond the original treatment fields, requiring enlargement of the treatment plan. One patient's treatment field was reduced after a decreased in cyst size. Cyst drainage was performed in another patient to avoid enlargement of the treatment fields. Conclusion: In patients undergoing highly conformal RT for craniopharyngiomas with cysts, routine imaging during treatment is recommended. Surveillance imaging should be performed at least every 2 weeks during proton RT in an attempt to avoid marginal failure. Craniopharyngiomas with large cystic components or enlargement during treatment might require weekly imaging.

  6. Energy Efficient Computing with the Low Power, Energy Aware Processing (LEAP) Architecture

    E-Print Network [OSTI]

    McIntire, Dustin Hale

    2012-01-01

    and communications module PWR RT618+RT620 Power module andwith a power supply module (PWR module), and a high fidelityAUX_BUS_CHAIN_OUT EMAP2 +MAG_PWR V5BUS V33BUS V9BUS -V9BUS

  7. by Martin LaMonica 109 retweet Share 9

    E-Print Network [OSTI]

    crafty power-tracking start-up | Green Tech - CNET News James C. Frinak RT @cnet -"Belkin Buys Crafty Power-Tracking Start-up - Martin LaMonica | Green Tech | CNET News - #green MidwestBAS RT @cnet Belkin buys crafty power-tracking start-up | Green Tech - CNET News Auf #Belkin Buys Crafty Power

  8. Jeffrey Sprague, Ph.D. (jeffs@uoregon.edu)

    E-Print Network [OSTI]

    Jeffrey Sprague, Ph.D. (jeffs@uoregon.edu) 1 RTI for Behavior: Applying the RTI Logic Agenda · Welcome and introductions · Overview of RtI for Behavior Support · The challenge of problem students in what tier? · Building your RtI Intervention Menu for Behavior Support · Tier 1, 2, 3, and 4

  9. Real Time PCR for Gene Expression Analysis Isolate RNA using hot acid phenol protocol.

    E-Print Network [OSTI]

    Auble, David

    . Make cDNA Reagents: - DEPC water - Filter tips - Recombinant DNase I (ABgene, catalog # AB-1154/a) - 10M reverse primer - SuperScript II Reverse Transcriptase (Invitrogen, catalog # 18064-014) - 5X FS Buffer (included with RT) - 0.1M DTT (included with RT) - RNaseOUT (Invitrogen, catalog # 10777-019) - RNase H

  10. An Intelligent Battery Controller Using Bias-Corrected Q-learning

    E-Print Network [OSTI]

    Powell, Warren B.

    to renewables requires storage to help smooth short-term variations in energy from wind and solar sources is a fundamental control problem in energy systems, exacerbate the issue to a degree that has not been observed as a Markov decision process with state St = (rt, pt) where rt is the energy level in the battery (the

  11. Directions to the University of Connecticut Storrs Campus From Bradley International Airport

    E-Print Network [OSTI]

    Olshevsky, Vadim

    Directions to the University of Connecticut ­ Storrs Campus From Bradley International Airport on Connecticut Route 195 about 6 miles to the University. (You will come to the intersection of Rt. 195 and Rt of the exit ramp. Travel south on Connecticut Route 195 about 6 miles to the University. (You will come

  12. 2010-2011 Participating Products Products Worth 1 Point

    E-Print Network [OSTI]

    Palmeri, Thomas

    TM Velocity® Roller Triumph® 537R Triumph® 730R Z4+® Gel AITM ReAction® Triumph® 537RT Triumph® 730RT Velocity Kit BIC® EcolutionsTM Glue Stick Mailing Labels Mechanical Pencil ReAction® Ball Pen Round Stic® Ball & Peel BIC® Mechanical Pencils AITM BIC Atlantis® BIC Matic Grip® BIC® Pencil Clic Matic® Quantech® ReAction

  13. Short communication Smooth pursuit under stimulusresponse uncertainty

    E-Print Network [OSTI]

    Bar, Moshe

    reaction times (RTs) are typically faster than choice reaction times and increase with uncertainty­R) uncertainty and reaction times (RTs): RT = a + blog2(N), where a is simple RT, b is the slope of the increase an eye velocity criterion of 1.5j sÀ 1 which was equivalent to 25% of the stimulus velocity

  14. Sexual Function in Males After Radiotherapy for Rectal Cancer

    SciTech Connect (OSTI)

    Bruheim, Kjersti, E-mail: Kjersti.bruheim@medisin.uio.n [Oslo University Hospital, Ulleval Cancer Centre, Oslo (Norway); Guren, Marianne G. [Oslo University Hospital, Ulleval Cancer Centre, Oslo (Norway); Dahl, Alv A. [Oslo University Hospital, Department of Clinical Cancer Research, the Norwegian Radium Hospital, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway); Skovlund, Eva [School of Pharmacy, University of Oslo, Oslo (Norway); Balteskard, Lise [University Hospital of Northern Norway, Tromso (Norway); Carlsen, Erik [Oslo University Hospital, Department of Gastrointestinal Surgery, Ulleval, Oslo (Norway); Fossa, Sophie D. [Oslo University Hospital, Department of Clinical Cancer Research, the Norwegian Radium Hospital, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway); Tveit, Kjell Magne [Oslo University Hospital, Ulleval Cancer Centre, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway)

    2010-03-15

    Purpose: Knowledge of sexual problems after pre- or postoperative radiotherapy (RT) with 50 Gy for rectal cancer is limited. In this study, we aimed to compare self-rated sexual functioning in irradiated (RT+) and nonirradiated (RT-) male patients at least 2 years after surgery for rectal cancer. Methods and Materials: Patients diagnosed with rectal cancer from 1993 to 2003 were identified from the Norwegian Rectal Cancer Registry. Male patients without recurrence at the time of the study. The International Index of Erectile Function, a self-rated instrument, was used to assess sexual functioning, and serum levels of serum testosterone were measured. Results: Questionnaires were returned from 241 patients a median of 4.5 years after surgery. The median age was 67 years at survey. RT+ patients (n = 108) had significantly poorer scores for erectile function, orgasmic function, intercourse satisfaction, and overall satisfaction with sex life compared with RT- patients (n = 133). In multiple age-adjusted analysis, the odds ratio for moderate-severe erectile dysfunction in RT+ patients was 7.3 compared with RT- patients (p <0.001). Furthermore, erectile dysfunction of this degree was associated with low serum testosterone (p = 0.01). Conclusion: RT for rectal cancer is associated with significant long-term effects on sexual function in males.

  15. Phytologia (February 2013) 95(1)10 Chemosystematics of Juniperus: Effects of leaf drying on the essential oil composition of

    E-Print Network [OSTI]

    Adams, Robert P.

    on the essential oil composition of Juniperus pinchotii Robert P. Adams Biology Department, Baylor University, Box. at 22ºC (room temperature, RT). The oils were distilled and analyzed from fresh, 0.5, 1, 2, 4, 8, 16, and 24 mos. storage at RT. The oil yields showed a slight decline initially, but remained fairly constant

  16. Specification and Analysis of Attribute-based Authorization Policy

    E-Print Network [OSTI]

    Sandhu, Ravi

    Policy The Big Goal Flexible, scalable authorization for decentralized, collaborative environments policy to support collaboration in open systems RT: A Role-based Trust-management* framework Need © William H. Winsborough 6 Role-based Trust Management (RT) A family of credential / policy languages

  17. Epigenetic modifications and conserved, non-coding DNA play a role in regulation of type IV collagen gene expression 

    E-Print Network [OSTI]

    Moody, Jessica Ashley

    2009-05-15

    Summary of diseases involving the type IV collagens .............................. 2 2 Summary of histone post-translational modifications................................ 13 3 Primers for TaqMan? q...RT-PCR ............................................................... 22 4 Primers for Syber Green qRT-PCR............................................................ 23 5 Primers to amplify conserved, non-coding sequences ............................... 25 6 Primers for ChIP analysis...

  18. Introduction Initial analysis See you next Wednesday It'll be alright by Friday Rerouting model Conclusions and further work Empirical studies on road traffic response to

    E-Print Network [OSTI]

    Clegg, Richard G.

    ) the recurrence rate (churn) R(T1, T2) is defined below. Recurrence Rate R(T1, T2) = # vehicles seen in T1 and T2 and further work Recurrence rate definition Given two time periods T1 and T2, (eg Mon am peak and Tue am peak

  19. Three Dimensional Radiative Transfer

    E-Print Network [OSTI]

    Tom Abel

    2000-05-09

    Radiative Transfer (RT) effects play a crucial role in the thermal history of the intergalactic medium. Here I discuss recent advances in the development of numerical methods that introduce RT to cosmological hydrodynamics. These methods can also readily be applied to time dependent problems on interstellar and galactic scales.

  20. Impact of {sup 18}F-Fluorodeoxyglucose Positron Emission Tomography Before and After Definitive Radiation Therapy in Patients With Apparently Solitary Plasmacytoma

    SciTech Connect (OSTI)

    Kim, Paul J.; Hicks, Rodney J.; Wirth, Andrew; Ryan, Gail; Seymour, John F.; Prince, H. Miles

    2009-07-01

    Purpose: To evaluate the impact of {sup 18}F-fluorodeoxyglucose positron emission tomography (FDG-PET) on management of patients with apparently isolated plasmacytoma. Methods and Materials: Twenty-one patients with apparently solitary plasmacytoma who underwent FDG-PET for staging or restaging were identified from a central PET database. They were either candidates for or had received definitive radiation therapy (RT). Results: Seventeen patients had initial staging scans for bone (n = 11) or soft tissue (n = 6) plasmacytomas, and 11 had PET scans after RT. Only 1 of 14 known untreated sites of plasmacytoma was not identified on staging PET (lesion sensitivity = 93%). Three plasmacytomas were excised before PET. Staging PET influenced management in 6 of 17 patients (35%) by showing multiple myeloma (n = 1), discouraging RT after complete resection (n = 1), excluding plasmacytoma at a second site (n = 1), by increasing RT fields (n = 2), or by suggesting sarcoidosis (n = 1). Fifteen of 17 patients with initial staging PET scans received definitive RT. Restaging PET scans after RT showed complete metabolic response in 8 of 11 cases and progressive disease in 2. Two patients with either no response or partial metabolic response had late responses. Staging sestamibi and PET scans were concordant in five of six occasions (one sestamibi scan was false negative). Conclusions: FDG-PET has value for staging and RT planning in plasmacytoma and potentially could have a role in response-assessment after RT. Slow resolution of FDG uptake posttreatment does not necessarily imply an adverse prognosis.

  1. JOURNAL OF VIROLOGY, 0022-538X/00/$04.00 0

    E-Print Network [OSTI]

    Brown, Andrew Leigh

    Immunodeficiency Virus Type 1 (HIV-1) from Patients with Primary HIV Infection to Nonnucleoside Reverse% of such antiretroviral-naive individuals was shown to have a susceptibility to nonnucleoside reverse transcriptase (RT by these strains. We have analyzed by logistic regression 46 variable amino acid sites in RT for their effect

  2. The Influence of Radiation Modality and Lymph Node Dissection on Survival in Early-Stage Endometrial Cancer

    SciTech Connect (OSTI)

    Chino, Junzo P., E-mail: junzo.chino@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Jones, Ellen [Department of Radiation Oncology, University of North Caroline, Chapel Hill, NC (United States); Berchuck, Andrew; Secord, Angeles Alvarez; Havrilesky, Laura J. [Division of Gynecologic Oncology, Duke University Medical Center, Durham, NC (United States)

    2012-04-01

    Background: The appropriate uses of lymph node dissection (LND) and adjuvant radiation therapy (RT) for Stage I endometrial cancer are controversial. We explored the impact of specific RT modalities (whole pelvic RT [WPRT], vaginal brachytherapy [VB]) and LND status on survival. Materials and Methods: The Surveillance Epidemiology and End Results dataset was queried for all surgically treated International Federation of Gynecology and Obstetrics (FIGO) Stage I endometrial cancers; subjects were stratified into low, intermediate and high risk cohorts using modifications of Gynecologic Oncology Group (GOG) protocol 99 and PORTEC (Postoperative Radiation Therapy in Endometrial Cancer) trial criteria. Five-year overall survival was estimated, and comparisons were performed via the log-rank test. Results: A total of 56,360 patients were identified: 70.4% low, 26.2% intermediate, and 3.4% high risk. A total of 41.6% underwent LND and 17.6% adjuvant RT. In low-risk disease, LND was associated with higher survival (93.7 LND vs. 92.7% no LND, p < 0.001), whereas RT was not (91.6% RT vs. 92.9% no RT, p = 0.23). In intermediate-risk disease, LND (82.1% LND vs. 76.5% no LND, p < 0.001) and RT (80.6% RT vs. 74.9% no RT, p < 0.001) were associated with higher survival without differences between RT modalities. In high-risk disease, LND (68.8% LND vs. 54.1% no LND, p < 0.001) and RT (66.9% RT vs. 57.2% no RT, p < 0.001) were associated with increased survival; if LND was not performed, VB alone was inferior to WPRT (p = 0.01). Conclusion: Both WPRT and VB alone are associated with increased survival in the intermediate-risk group. In the high-risk group, in the absence of LND, only WPRT is associated with increased survival. LND was also associated with increased survival.

  3. The Rosenfeld-Tarazona expression for liquids' specific heat: A numerical investigation of eighteen systems

    E-Print Network [OSTI]

    Trond S. Ingebrigtsen; Arno A. Veldhorst; Thomas B. Schrøder; Jeppe C. Dyre

    2013-05-08

    We investigate the accuracy of the expression of Rosenfeld and Tarazona (RT) for the excess isochoric heat capacity, C_V^{ex} \\propto T^{-2/5}, for eighteen model liquids. Previous investigations have reported no unifying features of breakdown for the RT expression. Here liquids with different stoichiometric composition, molecular topology, chemical interactions, degree of undercooling, and environment are investigated. We find that the RT expression is a better approximation for liquids with strong correlations between equilibrium fluctuations of virial and potential energy, i.e., Roskilde simple liquids [Ingebrigtsen et al., Phys. Rev. X 2, 011011 (2012)]. This observation holds even for molecular liquids under severe nanoscale confinement, the physics of which is completely different from the original RT bulk hard-sphere fluid arguments. The density dependence of the specific heat is predicted from the isomorph theory for Roskilde simple liquids, which in combination with the RT expression provides a complete description of the specific heat's density and temperature dependence.

  4. Disparities in the Use of Radiation Therapy in Patients With Local-Regionally Advanced Breast Cancer

    SciTech Connect (OSTI)

    Martinez, Steve R., E-mail: steve.martinez@ucdmc.ucdavis.ed [Department of Surgery, Division of Surgical Oncology, University of California Davis, Sacramento, CA (United States); Beal, Shannon H.; Chen, Steven L.; Canter, Robert J.; Khatri, Vijay P. [Department of Surgery, Division of Surgical Oncology, University of California Davis, Sacramento, CA (United States); Chen, Allen [Department of Radiation Oncology, University of California Davis, Sacramento, CA (United States); Bold, Richard J. [Department of Surgery, Division of Surgical Oncology, University of California Davis, Sacramento, CA (United States)

    2010-11-01

    Background: Radiation therapy (RT) is indicated for the treatment of local-regionally advanced breast cancer (BCa). Hypothesis: We hypothesized that black and Hispanic patients with local-regionally advanced BCa would receive lower rates of RT than their white counterparts. Methods: The Surveillance Epidemiology and End Results database was used to identify white, black, Hispanic, and Asian patients with invasive BCa and {>=}10 metastatic lymph nodes diagnosed between 1988 and 2005. Univariate and multivariate logistic regression evaluated the relationship of race/ethnicity with use of RT. Multivariate models stratified for those undergoing mastectomy or lumpectomy. Results: Entry criteria were met by 12,653 patients. Approximately half of the patients did not receive RT. Most patients were white (72%); the remainder were Hispanic (10.4%), black (10.3%), and Asian (7.3%). On univariate analysis, Hispanics (odd ratio [OR] 0.89; 95% confidence interval [CI], 0.79-1.00) and blacks (OR 0.79; 95% CI, 0.70-0.89) were less likely to receive RT than whites. On multivariate analysis, blacks (OR 0.76; 95% CI, 0.67-0.86) and Hispanics (OR 0.80; 95% CI, 0.70-0.90) were less likely than whites to receive RT. Disparities persisted for blacks (OR 0.74; 95% CI, 0.64-0.85) and Hispanics (OR 0.77; 95% CI, 0.67-0.89) who received mastectomy, but not for those who received lumpectomy. Conclusions: Many patients with local-regionally advanced BCa do not receive RT. Blacks and Hispanics were less likely than whites to receive RT. This disparity was noted predominately in patients who received mastectomy. Future efforts at improving rates of RT are warranted. Efforts at eliminating racial/ethnic disparities should focus on black and Hispanic candidates for postmastectomy RT.

  5. Patterns of Practice in Palliative Radiotherapy for Painful Bone Metastases: A Survey in Japan

    SciTech Connect (OSTI)

    Nakamura, Naoki; Shikama, Naoto; Wada, Hitoshi; Harada, Hideyuki; Nozaki, Miwako; Nagakura, Hisayasu; Tago, Masao; Oguchi, Masahiko; Uchida, Nobue

    2012-05-01

    Purpose: To determine the current patterns of practice in Japan and to investigate factors that may make clinicians reluctant to use single-fraction radiotherapy (SF-RT). Methods and Materials: Members of the Japanese Radiation Oncology Study Group (JROSG) completed an Internet-based survey and described the radiotherapy dose fractionation they would recommend for four hypothetical cases describing patients with painful bone metastasis (BM). Case 1 described a patient with an uncomplicated painful BM in a non-weight-bearing site from non-small-cell lung cancer. Case 2 investigated whether management for a case of uncomplicated spinal BM would be different from that in Case 1. Case 3 was identical with Case 2 except for the presence of neuropathic pain. Case 4 investigated the prescription for an uncomplicated painful BM secondary to oligometastatic breast cancer. Radiation oncologists who recommended multifraction radiotherapy (MF-RT) for Case 2 were asked to explain why they considered MF-RT superior to SF-RT. Results: A total of 52 radiation oncologists from 50 institutions (36% of JROSG institutions) responded. In all four cases, the most commonly prescribed regimen was 30 Gy in 10 fractions. SF-RT was recommended by 13% of respondents for Case 1, 6% for Case 2, 0% for Case 3, and 2% for Case 4. For Case 4, 29% of respondents prescribed a high-dose MF-RT regimen (e.g., 50 Gy in 25 fractions). The following factors were most often cited as reasons for preferring MF-RT: 'time until first increase in pain' (85%), 'incidence of spinal cord compression' (50%), and 'incidence of pathologic fractures' (29%). Conclusions: Japanese radiation oncologists prefer a schedule of 30 Gy in 10 fractions and are less likely to recommend SF-RT. Most Japanese radiation oncologists regard MF-RT as superior to SF-RT, based primarily on the time until first increase in pain.

  6. Declining Use of Radiotherapy in Stage I and II Hodgkin's Disease and Its Effect on Survival and Secondary Malignancies

    SciTech Connect (OSTI)

    Koshy, Matthew, E-mail: mkoshy@radonc.uchicago.edu [Department of Radiation and Cellular Oncology, University of Chicago Pritzker School of Medicine, Chicago, IL (United States); Department of Radiation Oncology, University of Illinois at Chicago, Chicago, IL (United States); Rich, Shayna E. [Department of Epidemiology and Preventive Medicine, University of Maryland School of Medicine, Baltimore, MD (United States); Mahmood, Usama; Kwok, Young [Department of Radiation Oncology, University of Maryland School of Medicine, Baltimore, MD (United States)

    2012-02-01

    Purpose: Concerns regarding long-term toxicities have led some to withhold radiotherapy (RT) for the treatment of Stage I and II Hodgkin's disease (HD). The present study was undertaken to assess the use of RT for HD and its effect on overall survival and the development of secondary malignancies. Methods and Materials: The present study included data from the Surveillance, Epidemiology, and End Results database from patients aged {>=}20 years who had been diagnosed with Stage I or II HD between 1988 and 2006. Overall survival was estimated using the Kaplan-Meier method, and the Cox multivariate regression model was used to analyze trends. Results: A total of 12,247 patients were selected, and 51.5% had received RT. The median follow-up for the present cohort was 4.9 years, with 21% of the cohort having >10 years of follow-up. Between 1988 and 1991, 62.9% had undergone RT, but between 2004 and 2006, only 43.7% had undergone RT (p < .001). The 5-year overall survival rate was 76% for patients who had not received RT and 87% for those who had (p < .001). The hazard ratio adjusted for other variables in the regression model showed that patients who had not undergone RT (hazard ratio, 1.72; 95% confidence interval, 1.72-2.02) was associated with significantly worse survival compared with patients who had received RT. The actuarial rate of developing a second malignancy was 14.6% vs. 15.0% at 15 years for those who had and had not undergone RT, respectively (p = .089). Conclusions: The present study is one of the largest studies to examine the role of RT for Stage I and II HD. Our results revealed a survival benefit with the addition of RT with no increase in the development of secondary malignancies compared with patients who had not received RT. Furthermore, the present nationwide study revealed a >20% absolute decrease in the use of RT from 1988 to 2006.

  7. Sequencing of Local Therapy Affects the Pattern of Treatment Failure and Survival in Children With Atypical Teratoid Rhabdoid Tumors of the Central Nervous System

    SciTech Connect (OSTI)

    Pai Panandiker, Atmaram S., E-mail: atmaram.pai-panandiker@stjude.org [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Merchant, Thomas E.; Beltran, Chris [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Wu, Shengjie [Department of Biostatistics, St. Jude Children's Research Hospital, Memphis, TN (United States); Sharma, Shelly [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Boop, Frederick A. [Department of Surgery, St. Jude Children's Research Hospital, Memphis, TN (United States); Jenkins, Jesse J. [Department of Pathology, St. Jude Children's Research Hospital, Memphis, TN (United States); Helton, Kathleen J. [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Wright, Karen D.; Broniscer, Alberto [Department of Oncology, St. Jude Children's Research Hospital, Memphis, TN (United States); Kun, Larry E. [Department of Radiological Sciences, St. Jude Children's Research Hospital, Memphis, TN (United States); Gajjar, Amar [Department of Oncology, St. Jude Children's Research Hospital, Memphis, TN (United States)

    2012-04-01

    Purpose: To assess the pattern of treatment failure associated with current therapeutic paradigms for childhood atypical teratoid rhabdoid tumors (AT/RT). Methods and Materials: Pediatric patients with AT/RT of the central nervous system treated at our institution between 1987 and 2007 were retrospectively evaluated. Overall survival (OS), progression-free survival, and cumulative incidence of local failure were correlated with age, sex, tumor location, extent of disease, and extent of surgical resection. Radiotherapy (RT) sequencing, chemotherapy, dose, timing, and volume administered after resection were also evaluated. Results: Thirty-one patients at a median age of 2.3 years at diagnosis (range, 0.45-16.87 years) were enrolled into protocols that included risk- and age-stratified RT. Craniospinal irradiation with focal tumor bed boost (median dose, 54 Gy) was administered to 18 patients. Gross total resection was achieved in 16. Ten patients presented with metastases at diagnosis. RT was delayed more than 3 months in 20 patients and between 1 and 3 months in 4; 7 patients received immediate postoperative irradiation preceding high-dose alkylator-based chemotherapy. At a median follow-up of 48 months, the cumulative incidence of local treatment failure was 37.5% {+-} 9%; progression-free survival was 33.2% {+-} 10%; and OS was 53.5% {+-} 10%. Children receiving delayed RT ({>=}1 month postoperatively) were more likely to experience local failure (hazard ratio [HR] 1.23, p = 0.007); the development of distant metastases before RT increased the risk of progression (HR 3.49, p = 0.006); and any evidence of disease progressionbefore RT decreased OS (HR 20.78, p = 0.004). Disease progression occurred in 52% (11/21) of children with initially localized tumors who underwent gross total resection, and the progression rate increased proportionally with increasing delay from surgery to RT. Conclusions: Delayed RT is associated with a higher rate of local and metastatic disease progression in children with AT/RT. Current treatment regimens for pediatric patients with AT/RT are distinctly age stratified; novel protocols investigating RT volumes and sequencing are needed.

  8. Patterns of Practice of Palliative Radiotherapy in Africa, Part 1: Bone and Brain Metastases

    SciTech Connect (OSTI)

    Sharma, Vinay Gaye, Papa Macoumba M.Med.; Wahab, Sherif Abdel; Ndlovu, Ntokozo; Ngoma, Twalib; Vanderpuye, Verna; Sowunmi, Anthonia; Kigula-Mugambe, Joseph; Jeremic, Branislav

    2008-03-15

    Purpose: To provide data on the pattern of practice of palliative radiotherapy (RT) on the African continent. Methods and Materials: A questionnaire was distributed to participants in a regional training course of the International Atomic Energy Agency in palliative cancer care and sent by e-mail to other institutions in Africa. Requested information included both infrastructure and human resources available and the pattern of RT practice for metastatic and locally advanced cancers. Results: Of 35 centers contacted, 24 (68%) completed the questionnaire. Although RT is used by most centers for most metastatic cancers, liver and lung metastases are treated with chemotherapy. Of 23 centers, 14 (61%) had a single RT regimen as an institutional policy for treating painful bone metastases, but only 5 centers (23%) of 23 used 8 Gy in 1 fraction. Brain metastases were being treated by RT to the whole brain to 30 Gy in 10 fractions, either exclusively (n = 13, 56%) or in addition to the use of 20 Gy in 5 fractions (n = 3, 14%). Conclusion: Radiotherapy is a major component of treatment of cancer patients in African countries. There is consensus among few centers for treatment schedules for almost all sites regarding time and dose-fractionation characteristics of RT regimens used and/or indications for the use of RT in this setting.

  9. Reirradiation After Radical Radiation Therapy: A Survey of Patterns of Practice Among Canadian Radiation Oncologists

    SciTech Connect (OSTI)

    Joseph, Kurian Jones [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada)], E-mail: kurianjo@cancerboard.ab.ca; Al-Mandhari, Zahid; Pervez, Nadeem; Parliament, Matthew [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada); Wu, Jackson [Tom Baker Cancer Center and University of Calgary, Calgary, Alberta (Canada); Ghosh, Sunita [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada); Tai, Patricia [Allan Blair Cancer Centre and University of Saskatchewan, Saskatchewan (Canada); Lian Jidong [Cross Cancer Institute and University of Alberta, Edmonton, Alberta (Canada); Levin, Wilfred [University of Toronto and Princess Margaret Hospital, Toronto (Canada)

    2008-12-01

    Purpose: The objective of this study was to survey the use of reirradiation (Re-RT) for in-field failures after previous radical radiation treatment (RT) among Canadian radiation oncologists (ROs). Methods and Materials: An electronic survey was sent to 271 ROs in Canada. The completed surveys were received electronically via e-mail and the data were analyzed using SAS 9.1.3 software. Results: A total of 183 ROs (67.5%) completed and returned the survey. The majority of the respondents were involved in the practice of either breast (48%) or genitourinary (43%) tumor sites. A total of 49% of the participants were interested in using Re-RT for the management of in-field recurrences. The goals of the therapy would be improvement of quality of life (99%), locoregional control (80%), or cure (32%). Most of the physicians believed that patients should have a minimum Karnofsky performance status of 50 or Eastern Cooperative Oncology Group performance status of 3, a minimum life expectancy of 3 months, and a minimum interval from initial treatment of 3 months if Re-RT were to be given with curative intent. Conclusions: This survey showed that a wide variation existed among ROs in their approach to Re-RT. Newer technologies in RT planning and delivery would be employed to facilitate normal tissue avoidance. The results of this study suggested that a consensus meeting was needed to establish guidelines for the practice and prospective evaluation of Re-RT.

  10. Rayleigh-Taylor Unstable Flames -- Fast or Faster?

    E-Print Network [OSTI]

    Hicks, E P

    2015-01-01

    Rayleigh-Taylor (RT) unstable flames play a key role in the explosions of Type Ia supernovae. However, the dynamics of these flames is still not well-understood. RT unstable flames are affected by both the RT instability of the flame front and by RT-generated turbulence. The coexistence of these factors complicates the choice of flame speed subgrid models for full-star Type Ia simulations. Both processes can stretch and wrinkle the flame surface, increasing its area and, therefore, the burning rate. In past research, subgrid models have been based on either the RT instability or turbulence setting the flame speed. We evaluate both models, checking their assumptions and their ability to correctly predict the turbulent flame speed. Specifically, we analyze a large parameter study of 3D direct numerical simulations of RT unstable model flames. This study varies both the simulation domain width and the gravity in order to probe a wide range of flame behaviors. We show that RT unstable flames are different from tr...

  11. Risk of Cerebrovascular Events in Elderly Patients After Radiation Therapy Versus Surgery for Early-Stage Glottic Cancer

    SciTech Connect (OSTI)

    Hong, Julian C.; Kruser, Tim J.; Gondi, Vinai; Mohindra, Pranshu; Cannon, Donald M.; Harari, Paul M.; Bentzen, Søren M.

    2013-10-01

    Purpose: Comprehensive neck radiation therapy (RT) has been shown to increase cerebrovascular disease (CVD) risk in advanced-stage head-and-neck cancer. We assessed whether more limited neck RT used for early-stage (T1-T2 N0) glottic cancer is associated with increased CVD risk, using the Surveillance, Epidemiology, and End Results (SEER)-Medicare linked database. Methods and Materials: We identified patients ?66 years of age with early-stage glottic laryngeal cancer from SEER diagnosed from 1992 to 2007. Patients treated with combined surgery and RT were excluded. Medicare CPT codes for carotid interventions, Medicare ICD-9 codes for cerebrovascular events, and SEER data for stroke as the cause of death were collected. Similarly, Medicare CPT and ICD-9 codes for peripheral vascular disease (PVD) were assessed to serve as an internal control between treatment groups. Results: A total of 1413 assessable patients (RT, n=1055; surgery, n=358) were analyzed. The actuarial 10-year risk of CVD was 56.5% (95% confidence interval 51.5%-61.5%) for the RT cohort versus 48.7% (41.1%-56.3%) in the surgery cohort (P=.27). The actuarial 10-year risk of PVD did not differ between the RT (52.7% [48.1%-57.3%]) and surgery cohorts (52.6% [45.2%-60.0%]) (P=.89). Univariate analysis showed an increased association of CVD with more recent diagnosis (P=.001) and increasing age (P=.001). On multivariate Cox analysis, increasing age (P<.001) and recent diagnosis (P=.002) remained significantly associated with a higher CVD risk, whereas the association of RT and CVD remained not statistically significant (HR=1.11 [0.91-1.37,] P=.31). Conclusions: Elderly patients with early-stage laryngeal cancer have a high burden of cerebrovascular events after surgical management or RT. RT and surgery are associated with comparable risk for subsequent CVD development after treatment in elderly patients.

  12. Postoperative Radiation Therapy With or Without Concurrent Chemotherapy for Node-Positive Thoracic Esophageal Squamous Cell Carcinoma

    SciTech Connect (OSTI)

    Chen, Junqiang; Pan, Jianji; Liu, Jian; Li, Jiancheng; Zhu, Kunshou; Zheng, Xiongwei; Chen, Mingqiang; Chen, Ming; Liao, Zhongxing

    2013-07-15

    Purpose: To retrospectively compare the efficacy of radiation therapy (RT) and chemotherapy plus RT (CRT) for the postoperative treatment of node-positive thoracic esophageal squamous cell carcinoma (TESCC) and to determine the incidence and severity of toxic reactions. Methods and Materials: We retrospectively reviewed data from 304 patients who had undergone esophagectomy with 3-field lymph node dissection for TESCC and were determined by postoperative pathology to have lymph node metastasis without distant hematogenous metastasis. Of these patients, 164 underwent postoperative chemotherapy (cisplatin 80 mg/m{sup 2}, average days 1-3, plus paclitaxel 135 mg/m{sup 2}, day 1; 21-day cycle) plus RT (50 Gy), and 140 underwent postoperative RT alone. Results: The 5-year overall survival rates for the CRT and RT groups were 47.4% and 38.6%, respectively (P=.030). The distant metastasis rate, the mixed (regional lymph node and distant) metastasis rate, and the overall recurrence rate were significantly lower in the CRT group than in the RT group (P<.05). However, mild and severe early toxic reactions, including neutropenia, radiation esophagitis, and gastrointestinal reaction, were significantly more common in the CRT group than in the RT group (P<.05). No significant differences in incidence of late toxic reactions were found between the 2 groups. Conclusions: Our results show that in node-positive TESCC patients, postoperative CRT is significantly more effective than RT alone at increasing the overall survival and decreasing the rates of distant metastasis, mixed metastasis, and overall recurrence. Severe early toxic reactions were more common with CRT than with RT alone, but patients could tolerate CRT.

  13. Combination of Vessel-Targeting Agents and Fractionated Radiation Therapy: The Role of the SDF-1/CXCR4 Pathway

    SciTech Connect (OSTI)

    Chen, Fang-Hsin; Fu, Sheng-Yung [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China)] [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China); Yang, Ying-Chieh [Department of Radiation Oncology, National Taiwan University Hospital Hsin-Chu Branch, Taiwan (China)] [Department of Radiation Oncology, National Taiwan University Hospital Hsin-Chu Branch, Taiwan (China); Wang, Chun-Chieh [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China) [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China); Department of Medical Imaging and Radiological Science, Chang Gung University, Taiwan (China); Chiang, Chi-Shiun, E-mail: cschiang@mx.nthu.edu.tw [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China)] [Department of Biomedical Engineering and Environmental Sciences, National Tsing Hua University, Taiwan (China); Hong, Ji-Hong, E-mail: jihong@adm.cgmh.org.tw [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China) [Department of Radiation Oncology, Chang Gung Memorial Hospital-LinKou, Taiwan (China); Department of Medical Imaging and Radiological Science, Chang Gung University, Taiwan (China)

    2013-07-15

    Purpose: To investigate vascular responses during fractionated radiation therapy (F-RT) and the effects of targeting pericytes or bone marrow-derived cells (BMDCs) on the efficacy of F-RT. Methods and Materials: Murine prostate TRAMP-C1 tumors were grown in control mice or mice transplanted with green fluorescent protein-tagged bone marrow (GFP-BM), and irradiated with 60 Gy in 15 fractions. Mice were also treated with gefitinib (an epidermal growth factor receptor inhibitor) or AMD3100 (a CXCR4 antagonist) to examine the effects of combination treatment. The responses of tumor vasculatures to these treatments and changes of tumor microenvironment were assessed. Results: After F-RT, the tumor microvascular density (MVD) was reduced; however, the surviving vessels were dilated, incorporated with GFP-positive cells, tightly adhered to pericytes, and well perfused with Hoechst 33342, suggesting a more mature structure formed primarily via vasculogenesis. Although the gefitinib+F-RT combination affected the vascular structure by dissociating pericytes from the vascular wall, it did not further delay tumor growth. These tumors had higher MVD and better vascular perfusion function, leading to less hypoxia and tumor necrosis. By contrast, the AMD3100+F-RT combination significantly enhanced tumor growth delay more than F-RT alone, and these tumors had lower MVD and poorer vascular perfusion function, resulting in increased hypoxia. These tumor vessels were rarely covered by pericytes and free of GFP-positive cells. Conclusions: Vasculogenesis is a major mechanism for tumor vessel survival during F-RT. Complex interactions occur between vessel-targeting agents and F-RT, and a synergistic effect may not always exist. To enhance F-RT, using CXCR4 inhibitor to block BM cell influx and the vasculogenesis process is a better strategy than targeting pericytes by epidermal growth factor receptor inhibitor.

  14. Timing of Radiotherapy and Outcome in Patients Receiving Adjuvant Endocrine Therapy

    SciTech Connect (OSTI)

    Karlsson, Per, E-mail: per.karlsson@oncology.gu.s [Department of Oncology, Sahlgrenska University Hospital, Gothenburg (Sweden); Cole, Bernard F. [Department of Mathematics and Statistics, University of Vermont College of Engineering and Mathematical Sciences, Burlington, VT (United States); International Breast Cancer Study Group Statistical Center, Department of Biostatistics and Computational Biology, Dana-Farber Cancer Institute, Boston, MA (United States); Colleoni, Marco [Department of Medicine, Research Unit in Medical Senology, European Institute of Oncology, Milan (Italy); Roncadin, Mario [Department of Radiotherapy, Centro di Riferimento Oncologico, Aviano (Italy); Chua, Boon H. [Department of Radiation Oncology, Peter MacCallum Cancer Centre, Melbourne (Australia); Murray, Elizabeth [Department of Radiation Oncology, Groote Shuur Hospital and University of Cape Town, Cape Town (South Africa); Price, Karen N. [International Breast Cancer Study Group Statistical Center, Frontier Science and Technology Research Foundation, Boston, MA (United States); Castiglione-Gertsch, Monica [International Breast Cancer Study Group Coordinating Center, Bern (Switzerland); Goldhirsch, Aron [European Institute of Oncology, Milan (Italy); Oncology Institute of Southern Switzerland, Bellinzona (Switzerland); Gruber, Guenther [Institut fuer Radiotherapie, Klinik Hirslanden, Zuerich (Switzerland)

    2011-06-01

    Purpose: To evaluate the association between the interval from breast-conserving surgery (BCS) to radiotherapy (RT) and the clinical outcome among patients treated with adjuvant endocrine therapy. Patients and Methods: Patient information was obtained from three International Breast Cancer Study Group trials. The analysis was restricted to 964 patients treated with BCS and adjuvant endocrine therapy. The patients were divided into two groups according to the median number of days between BCS and RT and into four groups according to the quartile of time between BCS and RT. The endpoints were the interval to local recurrence, disease-free survival, and overall survival. Proportional hazards regression analysis was used to perform comparisons after adjustment for baseline factors. Results: The median interval between BCS and RT was 77 days. RT timing was significantly associated with age, menopausal status, and estrogen receptor status. After adjustment for these factors, no significant effect of a RT delay {<=}20 weeks was found. The adjusted hazard ratio for RT within 77 days vs. after 77 days was 0.94 (95% confidence interval [CI], 0.47-1.87) for the interval to local recurrence, 1.05 (95% CI, 0.82-1.34) for disease-free survival, and 1.07 (95% CI, 0.77-1.49) for overall survival. For the interval to local recurrence the adjusted hazard ratio for {<=}48, 49-77, and 78-112 days was 0.90 (95% CI, 0.34-2.37), 0.86 (95% CI, 0.33-2.25), and 0.89 (95% CI, 0.33-2.41), respectively, relative to {>=}113 days. Conclusion: A RT delay of {<=}20 weeks was significantly associated with baseline factors such as age, menopausal status, and estrogen-receptor status. After adjustment for these factors, the timing of RT was not significantly associated with the interval to local recurrence, disease-free survival, or overall survival.

  15. TU-C-17A-03: An Integrated Contour Evaluation Software Tool Using Supervised Pattern Recognition for Radiotherapy

    SciTech Connect (OSTI)

    Chen, H; Tan, J; Kavanaugh, J; Dolly, S; Gay, H; Thorstad, W; Anastasio, M; Altman, M; Mutic, S; Li, H

    2014-06-15

    Purpose: Radiotherapy (RT) contours delineated either manually or semiautomatically require verification before clinical usage. Manual evaluation is very time consuming. A new integrated software tool using supervised pattern contour recognition was thus developed to facilitate this process. Methods: The contouring tool was developed using an object-oriented programming language C# and application programming interfaces, e.g. visualization toolkit (VTK). The C# language served as the tool design basis. The Accord.Net scientific computing libraries were utilized for the required statistical data processing and pattern recognition, while the VTK was used to build and render 3-D mesh models from critical RT structures in real-time and 360° visualization. Principal component analysis (PCA) was used for system self-updating geometry variations of normal structures based on physician-approved RT contours as a training dataset. The inhouse design of supervised PCA-based contour recognition method was used for automatically evaluating contour normality/abnormality. The function for reporting the contour evaluation results was implemented by using C# and Windows Form Designer. Results: The software input was RT simulation images and RT structures from commercial clinical treatment planning systems. Several abilities were demonstrated: automatic assessment of RT contours, file loading/saving of various modality medical images and RT contours, and generation/visualization of 3-D images and anatomical models. Moreover, it supported the 360° rendering of the RT structures in a multi-slice view, which allows physicians to visually check and edit abnormally contoured structures. Conclusion: This new software integrates the supervised learning framework with image processing and graphical visualization modules for RT contour verification. This tool has great potential for facilitating treatment planning with the assistance of an automatic contour evaluation module in avoiding unnecessary manual verification for physicians/dosimetrists. In addition, its nature as a compact and stand-alone tool allows for future extensibility to include additional functions for physicians’ clinical needs.

  16. Can We Predict Plan Quality for External Beam Partial Breast Irradiation: Results of a Multicenter Feasibility Study (Trans Tasman Radiation Oncology Group Study 06.02)

    SciTech Connect (OSTI)

    Kron, Tomas; Willis, David; Link, Emma; Lehman, Margot; Campbell, Gillian; O'Brien, Peter; Chua, Boon

    2013-11-15

    Purpose: Partial breast irradiation (PBI) after lumpectomy may be an option for selected patients with early breast cancer. A feasibility study of accelerated PBI delivered using external beam 3-dimensional conformal radiation therapy (RT) was undertaken at 8 Australasian centers. The present study evaluated the impact of patient, tumor, and RT technique-related factors on the quality of RT plans as determined by the dose–volume parameters of organs at risk. Methods and Materials: Forty-eight patients were enrolled in the study. All RT plans were centrally reviewed using predefined dosimetric criteria before commencement and after completion of protocol therapy. The RT plans of 47 patients met the dose–volume constraints, and all 47 patients received PBI to a prescribed dose of 38.5 Gy in 10 fractions. The RT plan quality was determined by volumes of the ipsilateral whole breast, lung, and heart that received 50% and 95%; 30%; and 5% of the prescribed dose, respectively. Patient, tumor, and RT technique-related factors were investigated for association with the parameters of RT plan quality. Results: The ratio of the planning target volume to the ipsilateral whole-breast volume was significantly associated with the ipsilateral breast doses on multiple variable analyses. The distance of the postlumpectomy surgical cavity from the heart and lung were predictive for heart and lung doses, respectively. A distance between surgical cavity and heart of >4 cm typically resulted in <1% of the heart volume receiving 5 Gy or less. It was more difficult to meet the heart dose constraint for left-sided and medially located tumors. Conclusions: Partial breast irradiation using 3-dimensional conformal RT was feasible within the study constraints. The ratio of planning target volume to ipsilateral whole-breast volume and the distance of surgical cavity from the heart were significant predictors of the quality of treatment plan for external beam PBI.

  17. Valproic Acid Use During Radiation Therapy for Glioblastoma Associated With Improved Survival

    SciTech Connect (OSTI)

    Barker, Christopher A.; Bishop, Andrew J.; Chang, Maria; Beal, Kathryn; Chan, Timothy A.

    2013-07-01

    Purpose: Valproic acid (VA) is an antiepileptic drug (AED) and histone deacetylase (HDAC) inhibitor taken by patients with glioblastoma (GB) to manage seizures, and it can modulate the biologic effects of radiation therapy (RT). We investigated whether VA use during RT for GB was associated with overall survival (OS). Methods and Materials: Medical records of 544 adults with GB were retrospectively reviewed. Analyses were performed to determine the association of Radiation Therapy Oncology Group recursive partitioning analysis (RTOG RPA) class, seizure history, and concurrent temozolomide (TMZ) and AED use during RT with OS. Results: Seizures before the end of RT were noted in 217 (40%) patients, and 403 (74%) were taking an AED during RT; 29 (7%) were taking VA. Median OS in patients taking VA was 16.9 months (vs 13.6 months taking another AED, P=.16). Among patients taking an AED during RT, OS was associated with VA (P=.047; hazard ratio [HR], 0.67; 95% confidence interval [CI], 0.27-1.07), and RTOG RPA class (P<.0001; HR, 1.49; 95% CI, 1.37-1.61). Of the 5 most common AEDs, only VA was associated with OS. Median OS of patients receiving VA and TMZ during RT was 23.9 months (vs 15.2 months for patients taking another AED, P=.26). When the analysis was restricted to patients who received concurrent TMZ, VA use was marginally associated with OS (P=.057; HR, 0.54; 95% CI, ?0.09 to 1.17), independently of RTOG RPA class and seizure history. Conclusions: VA use during RT for GB was associated with improved OS, independently of RTOG RPA, seizure history, and concurrent TMZ use. Further studies of treatment that combines HDAC inhibitors and RT are warranted.

  18. Outdoor Cooking. 

    E-Print Network [OSTI]

    Douglas, Jenoyce; Reasonover, Frances

    1967-01-01

    can "breathe." If the fire box has a rounded bottom, use enough base to make a level bad to the edge of the box. After four or six uses, wash the base to remove drip- pings and ash. Be sure it is thoroughly dry before using, because gravel can... or wash and dry it to kp it bm. Poisonous bacteria require moisture, food and tern- peratures 50 to 110 degrees F. Heat destroys harmful bacteria, and cold rgards production of toxins. MEAT Equipment, number of guests to be served and time avail...

  19. Children Watching System Using a Small UAV -Position Estimation And Following Control of a Target Person-

    E-Print Network [OSTI]

    Ohya, Akihisa

    Abstract of AR.Drone control 5) 2 3 Fig. 2 Helmet (indoor) Fig. 3 Detected helmet (indoor) 2.3 3 1 d(t) (t (10) Kp Ti Td 3 3. Altug 2 [4] Azrad 1 [5] [6] 4. 4.1 AR.Drone 4 UAV Parrot AR.Drone[ 6] AR.Drone CMOS QVGA(320 240) UVLC(MJPEG-like) AR.Drone CPU Fig. 6 AR.Drone 1.0 4.2 PC AR.Drone ROS roscore 4.3 PC - AR.Drone

  20. Angular distribution of polarized spontaneous emissions and its effect on light extraction behavior in InGaN-based light emitting diodes

    SciTech Connect (OSTI)

    Yuan, Gangcheng; Chen, Xinjuan; Yu, Tongjun, E-mail: tongjun@pku.edu.cn; Lu, Huimin; Chen, Zhizhong; Kang, Xiangning; Wu, Jiejun; Zhang, Guoyi [State Key Laboratory for Artificial Microstructure and Mesoscopic Physics, School of Physics, Peking University, Beijing 100871 (China)

    2014-03-07

    Angular intensity distributions of differently polarized light sources in multiple quantum wells (MQWs) and their effects on extraction behavior of spontaneous emission from light emitting diode (LED) chips have been studied. Theoretical calculation based on k·p approximation, ray tracing simulation and angular electroluminescence measurement were applied in this work. It is found that the electron-hole recombination in the InGaN MQWs produces a spherical distribution of an s-polarized source and a dumbbell-shaped p-polarized source. Light rays from different polarized sources experience different extraction processes, determining the polarization degree of electro-luminescence and extraction efficiency of LEDs.

  1. The multicomponent 2D Toda hierarchy: dispersionless limit

    E-Print Network [OSTI]

    Manuel Manas; Luis Martinez Alonso

    2009-04-21

    The factorization problem of the multi-component 2D Toda hierarchy is used to analyze the dispersionless limit of this hierarchy. A dispersive version of the Whitham hierarchy defined in terms of scalar Lax and Orlov--Schulman operators is introduced and the corresponding additional symmetries and string equations are discussed. Then, it is shown how KP and Toda pictures of the dispersionless Whitham hierarchy emerge in the dispersionless limit. Moreover, the additional symmetries and string equations for the dispersive Whitham hierarchy are studied in this limit.

  2. Nonlinear Dynamics of Quantum Systems and Soliton Theory

    E-Print Network [OSTI]

    Eldad Bettelheim; Alexander G. Abanov; Paul Wiegmann

    2006-10-26

    We show that space-time evolution of one-dimensional fermionic systems is described by nonlinear equations of soliton theory. We identify a space-time dependence of a matrix element of fermionic systems related to the {\\it Orthogonality Catastrophe} or {boundary states} with the $\\tau$-function of the modified KP-hierarchy. The established relation allows to apply the apparatus of soliton theory to the study of non-linear aspects of quantum dynamics. We also describe a {\\it bosonization in momentum space} - a representation of a fermion operator by a Bose field in the presence of a boundary state.

  3. Dynamic Rank Factor Model for Text Streams Supplementary Material

    E-Print Network [OSTI]

    Carin, Lawrence

    (lp,k|-) = GIG(a - 1/2, 2up,k, (p,k)2 ), p(up,k|-) = G(a + b, up,k + k) (14) The Generalized Inverse Gaussian (GIG) distribution can be expressed as GIG(x; p, a, b) = (a/b) p 2 2Kp( ab) xP -1 exp - 1 2 (ax + b x(k,t|-) = GIG(e - 1/2, 2k,t, (sk,t - ksk,t-1)2 ), p(k,t|-) = G(e + f, k,t + ) (16) · Sampling , p(|-) = G(1

  4. "!#%$&('0)12(43 57698A@CBEDF8AGIHQPSRSTUGIVXWYBE`a`1WAVbDF8G#cdWA69TF`e6"fhgeiqpr`scdWYButvWYTUwx69TyBG#H69T`1DUHfGIB@`

    E-Print Network [OSTI]

    Nordlund, Kai

    kukuÿY§²o¤¦ÿ & ¦ j © g8@ ¢ o·g 1I¢ ouSo¦¥ jd g%§0 '& gu`(¤&ÿ¨du & ¢'¢ §0gu ¢ gug 1a¢ ou ¢ §d&©2§0g14r`§& ¢ õõ ötsvuýSw¤x¨ùúün÷åû y & g ¢ g &d j ¦ÿ¨gu j (pÿåå 5© g8@S k¤p© ¢ E½ ¢ ¢ ouh§gu§0 ¢ ¢ pgu g 1 ©u¦ £o¤¦è0£E§0p0£ 0 ¢ p (¤ ¦ÿ¨0 ¢ ¦p ¢ jXj &¦ÿågu j¡ © g8@ ¢ oEd¯p j

  5. Math 26, Second Midterm Exam Review April, 2006

    E-Print Network [OSTI]

    Goodman, Fred

    (x) 0. For a curve rotated around the y­axis, you have to reverse the roles of x and y. (3) The pressure) and the curve x = b(y), then x­moment = d c 1 2 b(y)2 dy. For the y­moment and ¯y, you have to reverse the roles the formulas that I gave you for exam 1. (2) The logistic DE is dP dt = kP(1 - P K ). This is separable

  6. Modeling direct interband tunneling. II. Lower-dimensional structures

    SciTech Connect (OSTI)

    Pan, Andrew; Chui, Chi On

    2014-08-07

    We investigate the applicability of the two-band Hamiltonian and the widely used Kane analytical formula to interband tunneling along unconfined directions in nanostructures. Through comparisons with k·p and tight-binding calculations and quantum transport simulations, we find that the primary correction is the change in effective band gap. For both constant fields and realistic tunnel field-effect transistors, dimensionally consistent band gap scaling of the Kane formula allows analytical and numerical device simulations to approximate non-equilibrium Green's function current characteristics without arbitrary fitting. This allows efficient first-order calibration of semiclassical models for interband tunneling in nanodevices.

  7. Adjuvant Radiation Therapy and Survival for Pure Tubular Breast Carcinoma-Experience From the SEER Database

    SciTech Connect (OSTI)

    Li Baoqing, E-mail: bal9018@med.cornell.edu [Department of Radiation Oncology, Weill Cornell Medical College, New York, New York (United States); Chen, Margaret [Department of Surgery, Weill Cornell Medical College, New York, New York (United States)] [Department of Surgery, Weill Cornell Medical College, New York, New York (United States); Nori, Dattatreyudu; Chao, K.S. Clifford [Department of Radiation Oncology, Weill Cornell Medical College, New York, New York (United States)] [Department of Radiation Oncology, Weill Cornell Medical College, New York, New York (United States); Chen, Allen M. [Department of Radiation Oncology, University of California Davis Cancer Center, Sacramento, California (United States)] [Department of Radiation Oncology, University of California Davis Cancer Center, Sacramento, California (United States); Chen, Steven L. [Department of Surgery, University of California Davis Cancer Center, Sacramento, California (United States)] [Department of Surgery, University of California Davis Cancer Center, Sacramento, California (United States)

    2012-09-01

    Purpose: Pure tubular carcinoma of the breast (PTCB) represents a distinct subtype of invasive ductal carcinoma (IDC) that is generally thought to be associated with better prognosis than even low-grade IDC. There has been controversy as to the role of adjuvant radiation therapy (RT) in this population. We hypothesized that adjuvant RT would demonstrate a survival improvement. Methods and Materials: We queried the Surveillance, Epidemiology and End Results database for the years 1992-2007 to identify patients with pure tubular carcinomas of the breast. Patient demographics, tumor characteristics, and surgical and RT treatments were collected. Survival analysis was performed using the Kaplan-Meier method for univariate comparisons and Cox proportional hazards modeling for multivariate comparisons, stratifying on the basis of age with a cutoff age of 65. Results: A total of 6465 patients were identified: 3624 (56.1%) patients underwent lumpectomy with RT (LUMP+RT), 1525 (23.6%) patients underwent lumpectomy alone (LUMP), 1266 (19.6%) patients received mastectomy alone (MAST), and 50 (0.8%) patients underwent mastectomy with RT (MAST+RT). When we compared the LUMP+RT and LUMP groups directly, those receiving adjuvant RT tended to be younger and were less likely to be hormone receptor-positive. Overall survival was 95% for LUMP+RT and 90% for LUMP patients at 5 years. For those 65 or younger, the absolute overall survival benefit of LUMP+RT over LUMP was 1% at 5 years and 3% at 10 years. On stratified multivariate analysis, adjuvant RT remained a significant predictor in both age groups (P=.003 in age {<=}65 and P=.04 in age >65 patients). Other significant unfavorable factors were older age and higher T stage (age >65 only). Conclusions: Since sufficiently powered large scale clinical trials are unlikely, we would recommend that adjuvant radiation be considered in PTCB patients age 65 or younger, although consideration of the small absolute survival benefit is important. Adjuvant radiation can be omitted for patients older than 65.

  8. Ultrastructural analysis of chemical synapses and gap junctions between Drosophila brain neurons in culture.

    E-Print Network [OSTI]

    Oh, Hyun-Woo; Campusano, Jorge M; Hilgenberg, Lutz G W; Sun, Xicui; Smith, Martin A; O'Dowd, Diane K

    2008-01-01

    h. Cells were contrasted in 1% uranyl acetate at RT for 1 h,were stained again in 2% uranyl acetate for 2 min, followedthe omission of the ?rst uranyl acetate staining. After thin

  9. Implementation and Validation of the BHR Turbulence Model in...

    Office of Scientific and Technical Information (OSTI)

    density mixing in the KH, RT, and RM cases in an Eulerian framework 7. The primary motivation of the present work is to implement the BHR-2 turbulence model in the Arbitrary...

  10. Your name Your TA's name MA 16500 EXAM I INSTRUCTIONS ...

    E-Print Network [OSTI]

    Sep 23, 2014 ... limxng m - sin (i) = [liming re] - [lime—m Si“ (in. Since limxngx : 0, the limit we want to compute is also equal to 0. . limmng a: - sin (i) = [limmqo rt] ...

  11. Grammar, Epistemics and Action: An epistemic analysis of talk about the self and others

    E-Print Network [OSTI]

    Turner, Patricia

    2012-01-01

    not -> with it all. ->> ?mh[hhh Is 'e: feeding alright? [Example 2.23 Heritage N: =°hhh Dz he ‘av ‘iz own apa:rt [r you workin’ for. 2 B: °hhh Well I’m working through the

  12. PHOTOVOLTAIC PROPERTIES OF METAL-MEROCYANINE-TiO2 SANDWICH CELLS

    E-Print Network [OSTI]

    Skotheim, Terje Asbjorn

    2011-01-01

    used in making the photovoltaic cells. Figure 3. Diagram ofused in making the photovoltaic cells. HO HO ,5 di -t rt.organic compounds in photovoltaic cells. It lies more in the

  13. WHO report on the global tobacco epidemic, 2015: Raising taxes on tobacco

    E-Print Network [OSTI]

    World Health Organization

    2015-01-01

    Estimates not available Comoros adveRtIsIng bans: bans onRepublic XOF Chad ** XAF Comoros KMF Congo ** XAF CôteAfrican Republic Chad Comoros Congo Côte d'Ivoire Democratic

  14. THE CIRCULATORY SYSTEM AND BLOOD General charectertllUCIL______ _ _______ 23ll

    E-Print Network [OSTI]

    ·system is compensated by thepulsa..ting vesaelsof the mantle and by the contractions of two aeeessery hea.rt8on from which the heart has been re- moved; after the material has l!8t, the plaster molds

  15. Rayleigh-Taylor Instability within Sediment Layers Due to Gas Retention: Preliminary Theory and Experiments

    SciTech Connect (OSTI)

    Gauglitz, Phillip A.; Wells, Beric E.; Buchmiller, William C.; Rassat, Scot D.

    2013-03-21

    In Hanford underground waste storage tanks, a typical waste configuration is settled beds of waste particles beneath liquid layers. The settled beds are typically composed of layers, and these layers can have different physical and chemical properties. One postulated configuration within the settled bed is a less-dense layer beneath a more-dense layer. The different densities can be a result of different gas retention in the layers or different degrees of settling and compaction in the layers. This configuration can experience a Rayleigh-Taylor (RT) instability where the less dense lower layer rises into the upper layer. Previous studies of gas retention and release have not considered potential buoyant motion within a settle bed of solids. The purpose of this report is to provide a review of RT instabilities, discuss predictions of RT behavior for sediment layers, and summarize preliminary experimental observations of RT instabilities in simulant experiments.

  16. PHOTOVOLTAIC PROPERTIES OF METAL-MEROCYANINE-TiO2 SANDWICH CELLS

    E-Print Network [OSTI]

    Skotheim, Terje Asbjorn

    2011-01-01

    67 3.6 Photovoltaic Action Spectrum . . . . 3.7dye used in making the photovoltaic cells. Figure 3. Diagramused in making the photovoltaic cells. HO HO ,5 di -t rt.

  17. Nanodiamond-rich layer across three continents consistent with major cosmic impact at 12,800 cal BP

    E-Print Network [OSTI]

    2014-01-01

    Nanodiamond-Rich Layer across Three Continents Consistent2010. Discovery of a nanodiamond-rich layer in the Greenlandand Conditions A RT I C L E S Nanodiamond-Rich Layer across

  18. Proteasome Inhibitors Block DNA Repair and Radiosensitize Non-Small Cell Lung Cancer

    E-Print Network [OSTI]

    Cron, Kyle R.

    Despite optimal radiation therapy (RT), chemotherapy and/or surgery, a majority of patients with locally advanced non-small cell lung cancer (NSCLC) fail treatment. To identify novel gene targets for improved tumor control, ...

  19. SECTION E

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    - NOC & Sanitary Sewer PI-24590-01-00153 A2 - Incomplete WTP Conceptual Design - SAP & CAR PI-24590-01-00153 B - Incomplete R&T WTP Conceptual Design work (5 Pis) 19...

  20. Monte Carlo radiative transfer simulation for the near-ocean-surface high-resolution downwelling irradiance statistics

    E-Print Network [OSTI]

    Xu, Zao

    We present a numerical study of the near-surface underwater solar light statistics using the state-of-the-art Monte Carlo radiative transfer (RT) simulations in the coupled atmosphere-ocean system. Advanced variance-reduction ...

  1. Microsoft Word - qa_plan1.doc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    SJ-RT Smith Jones Rapid Transit Software Quality Assurance Plan February 1997 U. S. DEPARTMENT OF ENERGY Replace with appropriate organization name qaplan1.doc ii 022707 Change...

  2. Ecology 2005 19, 166172

    E-Print Network [OSTI]

    , adopts a fundamentally different strategy, taking virtually the opposite tack. It begins they are just approxima- tions. Physicists still use Boyle's Law, PV = nRT (pres- sure P times volume V

  3. Effects of Single Mode Initial Conditions in Rayleigh-Taylor Turbulent Mixing 

    E-Print Network [OSTI]

    Doron, Yuval

    2011-02-22

    The effect of single mode initial conditions at the interface of Rayleigh-Taylor(RT) mixing are experimentally examined utilizing the low Atwood number water channel facility at Texas A&M. The water channel convects two separated stratified flows...

  4. PROCEEDINGS OF 1976 SUMMER WORKSHOP ON AN ENERGY EXTENSION SERVICE

    E-Print Network [OSTI]

    Authors, Various

    2010-01-01

    intensive fashion (on energy supply). Thus the net number ofx J rt ) minus the jobs lost in energy supply (glven by themoney dlverted from energy supply x J , where J is the labor

  5. Turbulence-Flame Interactions in Type Ia Supernovae

    E-Print Network [OSTI]

    Aspden, Andrew J; Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (Authors 1, 2 & 3); Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (Author 4); Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (Author 5)

    2008-01-01

    Interactions in Type Ia Supernovae A. J. Aspden 1 , J. B.involved in type Ia supernovae (SN Ia) requires the use of ?generated by RT in type Ia supernovae should obey Bolgiano-

  6. Abstract--In this work, we first introduced a reorganized form of the Novikov's inversion formula for the attenuated Radon

    E-Print Network [OSTI]

    for the attenuated Radon transform with parallel-beam geometry which utilizes the conventional filters (such the attenuated Radon transform (AtRT). A closed- form inversion formula for parallel-beam (PB) geometry

  7. The Revenger's Tragedy

    E-Print Network [OSTI]

    Grim, Elizabeth Lynn

    2010-04-27

    Prosc. Boom 6 306 26º S4 575W Side Light L026 SR Prosc. Boom 7 307 26º S4 575W L738 SR Prosc. Boom 8 308 26º S4 575W L218 SR Prosc. Boom 9 309 26º S4 575W Side Light L026 SR Prosc. Boom 10 310 26º S4 575W L738 SR Prosc. Boom 11 311 26º S4 575W L218 SR... Act I Scene 3 CL TO SCENESHOP TO DRESSING AND GREEN ROOMS SL Prosc. BoomSR Prosc. Boom Lft Box 4 Lft Box 3 Lft Box 2 Lft Bo x 1 Rt Bo x 1 Rt Box 2 Rt Box 3 Rt Box 4 US Storage Platform 50 40 35 30 20 15 10 5 4 1 GR. DRAPE Elec-7 18...

  8. Communicating Evolution as Science

    E-Print Network [OSTI]

    Thanukos, Anastasia

    2010-01-01

    thuringiensis toxins. Science. 1992;258(5087):1451–5. MillerRT, Ruse M. But is it science? Amherst, NY: Prometheusto the philosophy of science: theory and reality. Chicago:

  9. A. E. K. Ris Ris-M -CUE] Title and author(s)

    E-Print Network [OSTI]

    - tageous . Copies to Library 100 G.K. Kristiansen 1( RT 12 I Available on request from: Risø Library, are considered for 2-dimensional geometries xy, rz, and r6. There are 3 types of problems, 1) A » 1/K

  10. Space-frequency correlation of classical waves in disordered media: high-frequency and small scale asymptotics

    E-Print Network [OSTI]

    Albert C. Fannjiang

    2007-06-25

    Two-frequency radiative transfer (2f-RT) theory is developed for geometrical optics in random media. The space-frequency correlation is described by the two-frequency Wigner distribution (2f-WD) which satisfies a closed form equation, the two-frequency Wigner-Moyal equation. In the RT regime it is proved rigorously that 2f-WD satisfies a Fokker-Planck-like equation with complex-valued coefficients. By dimensional analysis 2f-RT equation yields the scaling behavior of three physical parameters: the spatial spread, the coherence length and the coherence bandwidth. The sub-transport-mean-free-path behavior is obtained in a closed form by analytically solving a paraxial 2f-RT equation.

  11. ATOC/CHEM 5151 Problem 2 Atmospheric Number Density at Sea Level

    E-Print Network [OSTI]

    Toohey, Darin W.

    of moles and A is Avogadro's number. Methodology: Use Ideal Gas Law, find "R" in units that are close in Avogadro's number for molecules cm-3) [M] = N/V = P/RT Source of information: Wikipedia ("Gas Constant") R

  12. ARPA-E Celebrates Five Years of Changing What's Possible | Department...

    Energy Savers [EERE]

    front). Image: Sarah Gerrity, Energy Department. AutoGrid 2 of 5 AutoGrid Known as the Demand Response Optimization and Management System - Real-Time (DROMS-RT), AutoGrid's...

  13. "Safety Concrete" A Material Designed to Fail

    E-Print Network [OSTI]

    High sand/binder ratio Introduces stress-concentrating defects Low-slump water/binder ratio Ideal for rapid molding and demolding, increases strength Controlled hydration time at RT or 60°C Balance

  14. An Investigation into the Historical Distribution, Prevalence, and Host Community of Monkeypox Virus (MPXV) Among Funisciurus Museum Skin Specimens from Central Africa

    E-Print Network [OSTI]

    Tiee, Madeline

    2015-01-01

    VERIFICATION RESULTS TO FLUORESCENCE LEVELS OF HRM PUTATIVEPCR, high-resolution melting (HRM) analysis was performed ons. The combination of RT-PCR and HRM analysis allows for the

  15. Uniform Quantifier Elimination and Constraint Query Processing

    E-Print Network [OSTI]

    2015-08-29

    tics. However, this is not always the case. Consider the. query,. Q= (9T1):R(T1): Clearly, the natural and active domain semantics give dif-. ferent interpretation to

  16. 1498 Biochemical Society Transactions (2014) Volume 42, part 6 Imaging tumour heterogeneity of the

    E-Print Network [OSTI]

    Coolen, ACC "Ton"

    2014-01-01

    , University of Oxford, Old Road Campus Research Building, Roosevelt Drive, Oxford OX3 7DQ, U.K. Biomaterials, Biomimetics and Biophotonics Division, King's College London Dental Institute, London SE1 9RT, U

  17. MSI | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Blog Home content Social Media MSI MSI RT @FrankKlotzNNSA: Many thanks to our outstanding MSI interns-the future leaders of our nuclear enterprise http:1.usa.govXNfDhk...

  18. Spectral residual method without gradient information for solving large-scale nonlinear systems of equations: Theory

    E-Print Network [OSTI]

    Martínez, José Mario

    Universidad Central de Venezuela Caracas, Venezuela. E-mail: wlacruz@elecrisc.ing.ucv.ve Jos´e Mario Mart Venezuela Apartado 47002, Caracas 1041-A, Venezuela E-mail: mraydan@reacciun.ve Technical Report RT-04

  19. 894 Volume 55, Number 7, 2001 APPLIED SPECTROSCOPY0003-7028 / 01 / 5507-0894$2.00 / 0 q 2001 Society for Applied Spectroscopy

    E-Print Network [OSTI]

    Hastings, Gary

    that has been stripped of the iron sulfur clusters FA and FB; RC, reaction center; RT, room temperature; S. INTRODUCTION The primary solar capture and conversion processes in oxygen-evolving organisms (OEOs) occur

  20. Lesson 19: The Fundamental Thoerem of Line Integrals

    E-Print Network [OSTI]

    2015-07-19

    Jul 20, 2015 ... Conservation of Energy. Suppose F is a force field moving an object along a curve C given by r(t), a ? t ? b. By Newton's Second Law of ...

  1. Prepaid Forward and Forward Prices.pdf

    E-Print Network [OSTI]

    jeffb_000

    2013-12-02

    December 2, 2013. Prepaid Forward. Forward. General Formula. 0,. 0. Present Value of Dividends. P. T. F. S. = -. 0,. 0,. 0, (1 ). P. rT. P. T. T. T. T. F. F e. F.

  2. WHO report on the global tobacco epidemic, 2015: Raising taxes on tobacco

    E-Print Network [OSTI]

    World Health Organization

    2015-01-01

    yugoslav Republic of Macedonia, and West Bank and Gazaformer Yugoslav Republic of Macedonia adveRtIsIng bans: bansYugoslav Republic of Macedonia ** ALL EUR AMD EUR AZN BYR

  3. Quantitation of RNA with RiboGreenTM Stain using the The quantitation of RNA samples is a prerequisite for many different techniques in

    E-Print Network [OSTI]

    Raizada, Manish N.

    as reverse transcriptase PCR (RT-PCR), and differential display PCR. Traditionally, quantitation of RNA RNA ranging from 0 to 10 µg/ml with a 4-parameter logistic best fit to describe the data. (B

  4. Shock convergence and mix dynamics in inertial confinement fusion

    E-Print Network [OSTI]

    Rygg, James Ryan

    2006-01-01

    Understanding the phenomena of shock propagation and of turbulent mix induced by Rayleigh-Taylor (RT) instability growth is of critical importance for ignition and high gain in inertial confinement fusion (ICF). Capsule ...

  5. Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States

    E-Print Network [OSTI]

    Stadler, Michael

    2009-01-01

    SOFC)..Viability PVPS R&D RT SCE SoCal SOFC tC TOU UL UPS VRB WACSolid-Oxide Fuel Cell (SOFC) SOFC is a promising technology

  6. Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States

    E-Print Network [OSTI]

    Stadler, Michael

    2009-01-01

    SOFC) .Viability PVPS R&D RT SCE SoCal SOFC tC TOU UL UPS VRB WACSolid-Oxide Fuel Cell (SOFC) SOFC is a promising technology

  7. Investigation into resistance to experimental Salmonella challenge in neonatal leghorn chickens 

    E-Print Network [OSTI]

    Farnell, Morgan Brian

    1999-01-01

    -immune lymphokine (SE-ILK) or recombinant turkey interferon gamma (rtIFN?), for efficacy in protecting neonatal Leghorn chickens from experimental Salmonella challenge. Additionally, our laboratories have observed a seasonal pattern of apparent maternal...

  8. Plasma kinetics, tissue distribution, and cerebrocortical sources of reverse triiodothyronine in the rat

    SciTech Connect (OSTI)

    Obregon, M.J.; Larsen, P.R.; Silva, J.E.

    1985-06-01

    Studies in vitro have shown that rT3 is a potent and competitive inhibitor of T4 5'-deiodination (5'D). Recent studies in vivo have shown that cerebrocortical (Cx) T4 5'D-type II (5'D-II) activity (propylthiouracil (PTU) insensitive pathway), is reduced by T4 and rT3, the latter being more potent than T3 in Cx 5'D-II suppression. Some other reports had described rT3 production in rat brain as a very active pathway of thyroid hormone metabolism. To examine the possibility that rT3 plays a physiological role in regulating Cx 5'D-II, we have explored rT3 plasma kinetics, plasma to tissue exchange, and uptake by tissues in the rat, as well as the metabolic routes of degradation and the sources of rT3 in cerebral cortex (Cx). Plasma and tissue levels were assessed with tracer (/sup 125/I)rT3. Two main compartments were defined by plasma disappearance curves in euthyroid rats (K/sub 1/ = -6.2 h-1 and K/sub 2/ = -0.75 h-1). In Cx of euthyroid rats, (/sup 125/I)rT3 peaked 10 min after iv injection, tissue to plasma ratio being 0.016 +/- 0.004 (SE). In thyroidectomized rats, plasma and tissue (/sup 125/I)rT3 concentrations were higher than in euthyroid rats, except for the Cx that did not change. PTU caused further increases in all the tissues studied, except for the Cx and the pituitaries of thyroidectomized rats. From the effect of blocking 5'D-I with PTU or reducing its activity by making the animals hypothyroid, we concluded that 5'D-I accounts for most of the rT3 clearance from plasma. In contrast, in Cx and pituitary the levels of rT3 seem largely affected by 5'D-II activity. Since the latter results suggest that plasma rT3 does not play a major role in determining rT3 levels in these tissues, we explored the sources of rT3 in Cx using (/sup 125/I)T4. The (/sup 125/I)rT3 (T4) to (/sup 125/I)T4 ratio remained constant at 0.03 from 1 up to 5 h after injection of (/sup 125/I)T4.

  9. Association Between White Blood Cell Count Following Radiation Therapy With Radiation Pneumonitis in Non-Small Cell Lung Cancer

    SciTech Connect (OSTI)

    Tang, Chad; Gomez, Daniel R. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Wang, Hongmei [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Radiation Oncology, Nanfang Hospital, Southern Medical University, Guangzhou (China); Levy, Lawrence B. [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Zhuang, Yan [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Department of Radiation Physics, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Xu, Ting; Nguyen, Quynh; Komaki, Ritsuko [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Liao, Zhongxing, E-mail: zliao@mdanderson.org [Department of Radiation Oncology, The University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2014-02-01

    Purpose: Radiation pneumonitis (RP) is an inflammatory response to radiation therapy (RT). We assessed the association between RP and white blood cell (WBC) count, an established metric of systemic inflammation, after RT for non-small cell lung cancer. Methods and Materials: We retrospectively analyzed 366 patients with non-small cell lung cancer who received ?60 Gy as definitive therapy. The primary endpoint was whether WBC count after RT (defined as 2 weeks through 3 months after RT completion) was associated with grade ?3 or grade ?2 RP. Median lung volume receiving ?20 Gy (V{sub 20}) was 31%, and post-RT WBC counts ranged from 1.7 to 21.2 × 10{sup 3} WBCs/?L. Odds ratios (ORs) associating clinical variables and post-RT WBC counts with RP were calculated via logistic regression. A recursive-partitioning algorithm was used to define optimal post-RT WBC count cut points. Results: Post-RT WBC counts were significantly higher in patients with grade ?3 RP than without (P<.05). Optimal cut points for post-RT WBC count were found to be 7.4 and 8.0 × 10{sup 3}/?L for grade ?3 and ?2 RP, respectively. Univariate analysis revealed significant associations between post-RT WBC count and grade ?3 (n=46, OR=2.6, 95% confidence interval [CI] 1.4?4.9, P=.003) and grade ?2 RP (n=164, OR=2.0, 95% CI 1.2?3.4, P=.01). This association held in a stepwise multivariate regression. Of note, V{sub 20} was found to be significantly associated with grade ?2 RP (OR=2.2, 95% CI 1.2?3.4, P=.01) and trended toward significance for grade ?3 RP (OR=1.9, 95% CI 1.0-3.5, P=.06). Conclusions: Post-RT WBC counts were significantly and independently associated with RP and have potential utility as a diagnostic or predictive marker for this toxicity.

  10. Physical Constants g = 9.80 m/s2

    E-Print Network [OSTI]

    Wysin, Gary

    , Heat Pumps: W = QH - QL, refrigerators: COP = QL W , heat pumps: COP = QH W , QL QH = TL TH for ideal, V = V0T. Ideal Gas Law: PV = nRT, or PV = NkT, R = 8.314 J/mol·K, k = R NA = 1.38 × 10-23 J Internal Energy: U = 3 2 NkT = 3 2 nRT, for ideal monatomic gases. Mechanical Equivalent of Heat, Specific

  11. Management of Pediatric Myxopapillary Ependymoma: The Role of Adjuvant Radiation

    SciTech Connect (OSTI)

    Agbahiwe, Harold C.; Wharam, Moody; Batra, Sachin; Cohen, Kenneth; Terezakis, Stephanie A.

    2013-02-01

    Introduction: Myxopapillary ependymoma (MPE) is a rare tumor in children. The primary treatment is gross total resection (GTR), with no clearly defined role for adjuvant radiation therapy (RT). Published reports, however, suggest that children with MPE present with a more aggressive disease course. The goal of this study was to assess the role of adjuvant RT in pediatric patients with MPE. Methods: Sixteen patients with MPE seen at Johns Hopkins Hospital (JHH) between November 1984 and December 2010 were retrospectively reviewed. Fifteen of the patients were evaluable with a mean age of 16.8 years (range, 12-21 years). Kaplan-Meier curves and descriptive statistics were used for analysis. Results: All patients received surgery as the initial treatment modality. Surgery consisted of either a GTR or a subtotal resection (STR). The median dose of adjuvant RT was 50.4 Gy (range, 45-54 Gy). All patients receiving RT were treated at the involved site. After a median follow-up of 7.2 years (range, 0.75-26.4 years), all patients were alive with stable disease. Local control at 5 and 10 years was 62.5% and 30%, respectively, for surgery alone versus 100% at both time points for surgery and adjuvant RT. Fifty percent of the patients receiving surgery alone had local failure. All patients receiving STR alone had local failure compared to 33% of patients receiving GTR alone. One patient in the surgery and adjuvant RT group developed a distant site of recurrence 1 year from diagnosis. No late toxicity was reported at last follow-up, and neurologic symptoms either improved or remained stable following surgery with or without RT. Conclusions: Adjuvant RT improved local control compared to surgery alone and should be considered after surgical resection in pediatric patients with MPE.

  12. Intern experience at the Texas Transportation Institute: an internship report 

    E-Print Network [OSTI]

    Andersen, Donald A.

    2013-03-13

    OIEX ADEC CTfA EUxRT& yOIEX ADEC yOIEX ADEC CTfA EUxRT yaMavav yaMaMav yaMa&a& yaMava& yaMaMa& Ppqs v qFGFqsq 19 Ppqs 8 iFGsm 2js c:h1s" pn srupm:"sm "s(:F"sq 2p u"smsc2...

  13. Acute Toxicity in High-Risk Prostate Cancer Patients Treated With Androgen Suppression and Hypofractionated Intensity-Modulated Radiotherapy

    SciTech Connect (OSTI)

    Pervez, Nadeem, E-mail: nadeempe@cancerboard.ab.c [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Small, Cormac [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); MacKenzie, Marc [Division of Medical Physics, Cross Cancer Institute, Edmonton, Alberta (Canada); Yee, Don; Parliament, Matthew [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Ghosh, Sunita [Division of Experimental Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Mihai, Alina; Amanie, John; Murtha, Albert [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Field, Colin [Division of Medical Physics, Cross Cancer Institute, Edmonton, Alberta (Canada); Murray, David [Division of Experimental Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada); Fallone, Gino [Division of Medical Physics, Cross Cancer Institute, Edmonton, Alberta (Canada); Pearcey, Robert, E-mail: robertpe@cancerboard.ab.c [Division of Radiation Oncology, Cross Cancer Institute, Edmonton, Alberta (Canada)

    2010-01-15

    Purpose: To report acute toxicity resulting from radiotherapy (RT) dose escalation and hypofractionation using intensity-modulated RT (IMRT) treatment combined with androgen suppression in high-risk prostate cancer patients. Methods and Materials: Sixty patients with a histological diagnosis of high-risk prostatic adenocarcinoma (having either a clinical Stage of >=T3a or an initial prostate-specific antigen [PSA] level of >=20 ng/ml or a Gleason score of 8 to 10 or a combination of a PSA concentration of >15 ng/ml and a Gleason score of 7) were enrolled. RT prescription was 68 Gy in 25 fractions (2.72 Gy/fraction) over 5 weeks to the prostate and proximal seminal vesicles. The pelvic lymph nodes and distal seminal vesicles concurrently received 45 Gy in 25 fractions. The patients were treated with helical TomoTherapy-based IMRT and underwent daily megavoltage CT image-guided verification prior to each treatment. Acute toxicity scores were recorded weekly during RT and at 3 months post-RT, using Radiation Therapy Oncology Group acute toxicity scales. Results: All patients completed RT and follow up for 3 months. The maximum acute toxicity scores were as follows: 21 (35%) patients had Grade 2 gastrointestinal (GI) toxicity; 4 (6.67%) patients had Grade 3 genitourinary (GU) toxicity; and 30 (33.33%) patients had Grade 2 GU toxicity. These toxicity scores were reduced after RT; there were only 8 (13.6%) patients with Grade 1 GI toxicity, 11 (18.97%) with Grade 1 GU toxicity, and 5 (8.62%) with Grade 2 GU toxicity at 3 months follow up. Only the V60 to the rectum correlated with the GI toxicity. Conclusion: Dose escalation using a hypofractionated schedule to the prostate with concurrent pelvic lymph node RT and long-term androgen suppression therapy is well tolerated acutely. Longer follow up for outcome and late toxicity is required.

  14. Effects of Heat Stress and Increased Protein Fed in Milk Replacers on the Health and Growth Parameters of Neonatal Holstein Bull Calves 

    E-Print Network [OSTI]

    Krenek, Andrew

    2012-10-19

    , respectively). CMR had a greater SI and FC (P < 0.05) than HPMR (0.942 vs. 0.437, and 1.99 vs. 1.78, respectively). HS had a higher RT AM, RT PM, RR AM, and RR PM (P<0.01) than NHS (38.87 vs. 38.77, 39.03 vs. 38.79, 35.79 vs. 32.77, and 55.73 vs. 38...

  15. Jo~ao A.C. Martins Antonio Pinto da Costa

    E-Print Network [OSTI]

    Kanno, Yoshihiro

    rn rtut 2 : µrn rt , n ut µrn rt n ut = 0 SOCCP ­ p.11/18 #12;2 Ku = r + f : : u, r : µrni rti , ni uti , (µrni, rti) · (ni, uti) = 0 : gi - uni 0, rni 0, (gi - uni)rni = 0 : SOCCP ­ p.12/18 #12 D SOCCP ­ p.17/18 #12; - stuck · - free : rni : rti/µ SOCCP ­ p.17/18 #12;, , Coulomb , 2 : , , 2 2

  16. Muddy Water? Variation in Reporting Receipt of Breast Cancer Radiation Therapy by Population-Based Tumor Registries

    SciTech Connect (OSTI)

    Walker, Gary V.; Giordano, Sharon H.; Williams, Melanie; Jiang, Jing; Niu, Jiangong; MacKinnon, Jill; Anderson, Patricia; Wohler, Brad; Sinclair, Amber H.; Boscoe, Francis P.; Schymura, Maria J.; Buchholz, Thomas A.; Smith, Benjamin D.

    2013-07-15

    Purpose: To evaluate, in the setting of breast cancer, the accuracy of registry radiation therapy (RT) coding compared with the gold standard of Medicare claims. Methods and Materials: Using Surveillance, Epidemiology, and End Results (SEER)–Medicare data, we identified 73,077 patients aged ?66 years diagnosed with breast cancer in the period 2001-2007. Underascertainment (1 - sensitivity), sensitivity, specificity, ?, and ?{sup 2} were calculated for RT receipt determined by registry data versus claims. Multivariate logistic regression characterized patient, treatment, and geographic factors associated with underascertainment of RT. Findings in the SEER–Medicare registries were compared with three non-SEER registries (Florida, New York, and Texas). Results: In the SEER–Medicare registries, 41.6% (n=30,386) of patients received RT according to registry coding, versus 49.3% (n=36,047) according to Medicare claims (P<.001). Underascertainment of RT was more likely if patients resided in a newer SEER registry (odds ratio [OR] 1.70, 95% confidence interval [CI] 1.60-1.80; P<.001), rural county (OR 1.34, 95% CI 1.21-1.48; P<.001), or if RT was delayed (OR 1.006/day, 95% CI 1.006-1.007; P<.001). Underascertainment of RT receipt in SEER registries was 18.7% (95% CI 18.6-18.8%), compared with 44.3% (95% CI 44.0-44.5%) in non-SEER registries. Conclusions: Population-based tumor registries are highly variable in ascertainment of RT receipt and should be augmented with other data sources when evaluating quality of breast cancer care. Future work should identify opportunities for the radiation oncology community to partner with registries to improve accuracy of treatment data.

  17. Management of Adenoid Cystic Carcinoma of the Breast: A Rare Cancer Network Study

    SciTech Connect (OSTI)

    Khanfir, Kaouthar, E-mail: kaouthar.khanfir@rsv-gnw.ch [Hopital de Sion, CHCVs, Sion (Switzerland); Kallel, Adel [Institut Gustave Roussy, Villejuif (France); Villette, Sylviane [Centre Rene Huguenin, Paris (France); Belkacemi, Yazid [CHU Henri Mondor, Centre Oscar Lambret, Lille (France); Vautravers, Claire [Centre George Francois Leclerc, Dijon (France); Nguyen, TanDat [Institut Jean Gaudinot, Reims (France); Miller, Robert [Mayo Clinic, Rochester, Minnesota (United States); Li Yexiong [Peking Union Medical College, Beijing (China); Taghian, Alphonse G. [Massachusetts General Hospital, Boston, Massachusetts (United States); Boersma, Liesbeth [Maastricht University Medical Center (MAASTRO clinic), Maastricht (Netherlands); Poortmans, Philip [Dr. Bernard Verbeeten Institute, Tilburg (Netherlands); Goldberg, Hadassah [Western Galilee Hospital-Nahariya, Nahariya (Israel); Vees, Hansjorg [Hopitaux Universitaires de Geneve, Geneva (Switzerland); Senkus, Elzbieta [Medical University of Gdansk, Gdansk (Poland); Igdem, Sefik; Ozsahin, Mahmut [Istanbul Bilim University, Istanbul (Turkey); Jeanneret Sozzi, Wendy [Centre Hospitalier Universitaire Vaudois, Lausanne (Switzerland)

    2012-04-01

    Background: Mammary adenoid cystic carcinoma (ACC) is a rare breast cancer. The aim of this retrospective study was to assess prognostic factors and patterns of failure, as well as the role of radiation therapy (RT), in ACC. Methods: Between January 1980 and December 2007, 61 women with breast ACC were treated at participating centers of the Rare Cancer Network. Surgery consisted of lumpectomy in 41 patients and mastectomy in 20 patients. There were 51(84%) stage pN0 and 10 stage cN0 (16%) patients. Postoperative RT was administered to 40 patients (35 after lumpectomy, 5 after mastectomy). Results: With a median follow-up of 79 months (range, 6-285), 5-year overall and disease-free survival rates were 94% (95% confidence interval [CI], 88%-100%) and 82% (95% CI, 71%-93%), respectively. The 5-year locoregional control (LRC) rate was 95% (95% CI, 89%-100%). Axillary lymph node dissection or sentinel node biopsy was performed in 84% of cases. All patients had stage pN0 disease. In univariate analysis, survival was not influenced by the type of surgery or the use of postoperative RT. The 5-year LRC rate was 100% in the mastectomy group versus 93% (95% CI, 83%-100%) in the breast-conserving surgery group, respectively (p = 0.16). For the breast-conserving surgery group, the use of RT significantly correlated with LRC (p = 0.03); the 5-year LRC rates were 95% (95% CI, 86%-100%) for the RT group versus 83% (95% CI, 54%-100%) for the group receiving no RT. No local failures occurred in patients with positive margins, all of whom received postoperative RT. Conclusion: Breast-conserving surgery is the treatment of choice for patients with ACC breast cancer. Axillary lymph node dissection or sentinel node biopsy might not be recommended. Postoperative RT should be proposed in the case of breast-conserving surgery.

  18. Radiotherapy Improves Survival in Unresected Stage I-III Bronchoalveolar Carcinoma

    SciTech Connect (OSTI)

    Urban, Damien [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel)] [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Mishra, Mark [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States)] [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Onn, Amir [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel)] [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Dicker, Adam P. [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States)] [Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Symon, Zvi; Pfeffer, M. Raphael [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel) [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Sackler School of Medicine, Tel Aviv University, Tel Aviv (Israel); Lawrence, Yaacov Richard, E-mail: yaacovla@gmail.com [Department of Oncology, Sheba Medical Center, Ramat Gan (Israel); Department of Radiation Oncology, Jefferson Medical College of Thomas Jefferson University, Philadelphia, Pennsylvania (United States); Sackler School of Medicine, Tel Aviv University, Tel Aviv (Israel)

    2012-11-01

    Purpose: To test the hypothesis that radiotherapy (RT) improves the outcome of patients with unresected, nonmetastatic bronchoalveolar carcinoma (BAC) by performing a population-based analysis within the Surveillance, Epidemiology, and End Results (SEER) registry. Methods and Materials: Inclusion criteria were as follows: patients diagnosed with BAC, Stage I-III, between 2001 and 2007. Exclusion criteria included unknown stage, unknown primary treatment modality, Stage IV disease, and those diagnosed at autopsy. Demographic data, treatment details, and overall survival were retrieved from the SEER database. Survival was analyzed using the Kaplan-Meier method and log-rank test. Results: A total of 6933 patients with Stage I-III BAC were included in the analysis. The median age at diagnosis was 70 years (range, 10-101 years). The majority of patients were diagnosed with Stage I (74.4%); 968 patients (14%) did not undergo surgical resection. Unresected patients were more likely to be older (p < 0.0001), male (p = 0.001), black (p < 0.0001), and Stage III (p < 0.0001). Within the cohort of unresected patients, 300 (31%) were treated with RT. The estimated 2-year overall survival for patients with unresected, nonmetastatic BAC was 58%, 44%, and 27% in Stage I, II, and III, respectively. Factors associated with improved survival included female sex, earlier stage at diagnosis, and use of RT. Median survival in those not receiving RT vs. receiving RT was as follows: Stage I, 28 months vs. 33 months (n = 364, p = 0.06); Stage II, 18 months vs. not reached (n = 31, nonsignificant); Stage III, 10 months vs. 17 months (n = 517, p < 0.003). Conclusions: The use of RT is associated with improved prognosis in unresected Stage I-III BAC. Less than a third of patients who could have potentially benefited from RT received it, suggesting that the medical specialists involved in the care of these patients underappreciate the importance of RT.

  19. Impact of Preoperative Radiotherapy on General and Disease-Specific Health Status of Rectal Cancer Survivors: A Population-Based Study

    SciTech Connect (OSTI)

    Thong, Melissa S.Y., E-mail: M.Thong@uvt.nl [Center of Research on Psychology in Somatic Diseases (CoRPS), Tilburg University (Netherlands); Comprehensive Cancer Centre South, Eindhoven (Netherlands); Mols, Floortje [Center of Research on Psychology in Somatic Diseases (CoRPS), Tilburg University (Netherlands); Comprehensive Cancer Centre South, Eindhoven (Netherlands); Lemmens, Valery E.P.P. [Comprehensive Cancer Centre South, Eindhoven (Netherlands); Department of Public Health, Erasmus University Medical Centre, Rotterdam (Netherlands); Rutten, Harm J.T. [Department of Surgery, Catharina Hospital, Eindhoven (Netherlands); Roukema, Jan A. [Department of Surgery, St. Elisabeth Hospital, Tilburg (Netherlands); Martijn, Hendrik [Department of Radiotherapy, Catharina Hospital, Eindhoven (Netherlands); Poll-Franse, Lonneke V. van de [Center of Research on Psychology in Somatic Diseases (CoRPS), Tilburg University (Netherlands); Comprehensive Cancer Centre South, Eindhoven (Netherlands)

    2011-11-01

    Purpose: To date, few studies have evaluated the impact of preoperative radiotherapy (pRT) on long-term health status of rectal cancer survivors. Using a population-based sample, we assessed the impact of pRT on general and disease-specific health status of rectal cancer survivors up to 10 years postdiagnosis. The health status of older ({>=}75 years old at diagnosis) pRT survivors was also compared with that of younger survivors. Methods and Materials: Survivors identified from the Eindhoven Cancer Registry treated with surgery only (SU) or with pRT between 1998 and 2007 were included. Survivors completed the Short Form-36 (SF-36) health survey questionnaire and the European Organization for Research and Treatment of Cancer Quality of Life Questionnaire-Colorectal 38 (EORTC QLQ-CR38) questionnaire. The SF-36 and EORTC QLQ-CR38 (sexuality subscale) scores of the survivors were compared to an age- and sex-matched Dutch normal population. Results: A total of 340 survivors (response, 85%; pRT survivors, 71%) were analyzed. Overall, survivors had similar general health status. Both short-term (<5 years) and long-term ({>=}5 years) pRT survivors had significantly poorer body image and more problems with gastrointestinal function, male sexual dysfunction, and defecation than SU survivors. Survivors had comparable general health status but greater sexual dysfunction than the normal population. Older pRT survivors had general and disease-specific health status comparable to that of younger pRT survivors. Conclusions: For better survivorship care, rectal cancer survivors could benefit from increased clinical and psychological focus on the possible long-term morbidity of treatment and its effects on health status.

  20. Dermatofibrosarcoma Protuberans: Long-term Outcomes of 53 Patients Treated With Conservative Surgery and Radiation Therapy

    SciTech Connect (OSTI)

    Castle, Katherine O. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Guadagnolo, B. Ashleigh, E-mail: aguadagn@mdanderson.org [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Tsai, C. Jillian [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Feig, Barry W. [Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Surgical Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States); Zagars, Gunar K. [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)] [Department of Radiation Oncology, University of Texas MD Anderson Cancer Center, Houston, Texas (United States)

    2013-07-01

    Purpose: To evaluate outcomes of conservative surgery and radiation therapy (RT) treatment in patients with dermatofibrosarcoma protuberans. Methods and Materials: We retrospectively reviewed the medical records of 53 consecutive dermatofibrosarcoma protuberans patients treated with surgery and preoperative or postoperative radiation therapy between 1972 and 2010. Median tumor size was 4 cm (range, 1-25 cm). Seven patients (13%) were treated with preoperative RT (50-50.4 Gy) and 46 patients (87%) with postoperative RT (60-66 Gy). Of the 46 patients receiving postoperative radiation, 3 (7%) had gross disease, 14 (30%) positive margins, 26 (57%) negative margins, and 3 (7%) uncertain margin status. Radiation dose ranged from 50 to 66 Gy (median dose, 60 Gy). Results: At a median follow-up time of 6.5 years (range, 0.5 months-23.5 years), 2 patients (4%) had disease recurrence, and 3 patients (6%) had died. Actuarial overall survival was 98% at both 5 and 10 years. Local control was 98% and 93% at 5 and 10 years, respectively. Disease-free survival was 98% and 93% at 5 and 10 years, respectively. The presence of fibrosarcomatous change was not associated with increased risk of local or distant relapse (P=.43). One of the patients with a local recurrence had gross residual disease at the time of RT and despite RT to 65 Gy developed both an in-field recurrence and a nodal and distant recurrence 3 months after RT. The other patient with local recurrence was found to have in-field recurrence 10 years after initial treatment. Thirteen percent of patients had an RT complication at 5 and 10 years, and 9% had a moderate or severe complication at 5 and 10 years. Conclusions: Dermatofibrosarcoma protuberans is a radioresponsive disease with excellent local control after conservative surgery and radiation therapy. Adjuvant RT should be considered for patients with large or recurrent tumors or when attempts at wide surgical margins would result in significant morbidity.

  1. The Efficacy of Radiation Therapy in the Treatment of Graves' Orbitopathy

    SciTech Connect (OSTI)

    Matthiesen, Chance, E-mail: chance-matthiesen@ouhsc.edu [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Thompson, J. Spencer [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Thompson, David [Department of Biostatistics and Epidemiology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States); Farris, Bradley; Wilkes, Byron [Dean A. McGee Eye Institute, Oklahoma City, OK (United States); Ahmad, Salahuddin; Herman, Terence; Bogardus, Carl [Department of Radiation Oncology, University of Oklahoma Health Sciences Center, Oklahoma City, OK (United States)

    2012-01-01

    Purpose: To review our institutional outcomes of patients treated with radiation therapy (RT) for Graves' orbitopathy (GO), assess the role of orbital reirradiation, and identify prognostic factors of complete response (CR). Methods and Materials: This is a retrospective review of 211 patients who presented with a diagnosis of GO and received RT between January 2000-2010. RT dose was 20 Gy in 10 fractions. Patient median age was 51 years (range, 15-84 years), median follow-up was 11 months (range, 1-88 months). Patient symptoms included any combination of proptosis (90.9%), extraocular muscle dysfunction (78.9%), soft tissue signs (68.4%), and diplopia (58.4%). Corticosteroids were used as first-line therapy in 20.6% of patients. Among those who achieved either CR or partial response (PR), prognostic factors were evaluated. Results: Stabilization of disease without recurrence was clinically achieved overall in 202 patients (96.7%). At the completion of RT, 176 patients (84.2%) reported a symptomatic improvement of pretreatment symptoms. CR of GO symptoms was achieved using multiple treatment modalities, including RT by 93 patients (44.5%), of which 32 patients received RT only. Corticosteroids were discontinued in 97.8% of patients who received them as initial therapy. Surgical intervention following radiotherapy was required for 144 (68.9%) of all patients. Fourteen patients received orbital reirradiation for persistent or recurrent symptoms. Five of these achieved a CR, and the other nine achieved disease stabilization but retained persistent ocular symptoms. Long-term side effects of RT included dry eyes (12%). Of the prognostic factors we investigated, only gender predicted CR, which was less common in men (33.9%) than in women (49.7%) p = 0.0471. Conclusions: Orbital radiation for GO is an established treatment modality for patients. Orbital reirradiation is beneficial for patients who do not respond to initial RT or experience symptom recurrence without an apparent risk of increased morbidity.

  2. Expression of Candidate Genes for Horn Growth in Early Bovine Development 

    E-Print Network [OSTI]

    Vitanza, Sarah M.

    2011-02-22

    .................................................................................... 3.4Primer Design.......................4 3.5 Polymerase Chain Reaction ................................................................ 14 6Reverse Transcriptase Polymerase Chain Reaction.............................18 3.7 Analysis of Real... Page 3.1 Gene specific primers used for qualitative RT-PCR.................................. 15 3.2 Gene specific PCR primers for real-time RT-.................................... 16 3.3 Primers for each exon of C21orf66...

  3. The World of Dark Shadows Issue 2 

    E-Print Network [OSTI]

    Multiple Contributors

    1976-01-01

    ~ll.'· ~~c W~. 1n thu .:r..:wint; r.,;.:..t. when tb61 vnt ...ru2 tbu OlJ Hc UKG • . _· :,,~·:.=::'uJ, aho quickly :..o~" thll li~n of thlJ oru... "Y... u'ru u:.:::.:'I" : _ .. ;::::18;;4.1'- .:lnu 8t~rt"J to.. run. Bomatca' 01". o~ue:t:t bvrs in :l l...

  4. The determination of compressibility factors of gaseous propane-nitrogen mixtures 

    E-Print Network [OSTI]

    Hodges, Don

    1952-01-01

    ??IxTURE AS CALO:LATM& "RO? PRE BEAT I. - ~RIl, ), El AN &', gi)ATIOR OR STATE (liters por ~rr I ) RT(1 - o/vT3) (Cr. mole atm ). er liter v Bo(1 - b) (liters per r oIe) Ao(1 - a) vs v (p 8rrrp at?sos tpr ur*, atmos (Pv RT 0 0900 0 1050...

  5. An empirical model of electron and ion fluxes derived from observations at geosynchronous orbit

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Denton, M. H.; Thomsen, M. F.; Jordanova, V. K.; Henderson, M. G.; Borovsky, J. E.; Denton, J. S.; Pitchford, D.; Hartley, D. P.

    2015-04-01

    Knowledge of the plasma fluxes at geosynchronous orbit is important to both scientific and operational investigations. We present a new empirical model of the ion flux and the electron flux at geosynchronous orbit (GEO) in the energy range ~1 eV to ~40 keV. The model is based on a total of 82 satellite-years of observations from the Magnetospheric Plasma Analyzer instruments on Los Alamos National Laboratory satellites at GEO. These data are assigned to a fixed grid of 24 local-times and 40 energies, at all possible values of Kp. Bi-linear interpolation is used between grid points to provide the ionmore »flux and the electron flux values at any energy and local-time, and for given values of geomagnetic activity (proxied by the 3-hour Kp index), and also for given values of solar activity (proxied by the daily F10.7 index). Initial comparison of the electron flux from the model with data from a Compact Environmental Anomaly Sensor II (CEASE-II), also located at geosynchronous orbit, indicate a good match during both quiet and disturbed periods. The model is available for distribution as a FORTRAN code that can be modified to suit user-requirements.« less

  6. Adaptive Optics Imaging of IRAS 18276-1431: a bipolar pre-planetary nebula with circumstellar "searchlight beams" and "arcs"

    E-Print Network [OSTI]

    Contreras, C S; Sahai, R; De Paz, A G; Morris, M

    2006-01-01

    We present high-angular resolution images of the post-AGB nebula IRAS18276-1431 (also known as OH17.7-2.0) obtained with the Keck II Adaptive Optics (AO) system in its Natural Guide Star (NGS) mode in the Kp, Lp, and Ms near-infrared bands. We also present supporting optical F606W and F814W HST images as well as interferometric observations of the 12CO(J=1-0), 13CO(J=1-0), and 2.6mm continuum emission with OVRO. The envelope of IRAS18276-1431 displays a clear bipolar morphology in our optical and NIR images with two lobes separated by a dark waist and surrounded by a faint 4.5"x3.4" halo. Our Kp-band image reveals two pairs of radial ``searchlight beams'' emerging from the nebula center and several intersecting, arc-like features. From our CO data we derive a mass of M>0.38[D/3kpc]^2 Msun and an expansion velocity v_exp=17km/s for the molecular envelope. The density in the halo follows a radial power-law proportional to r^-3, which is consistent with a mass-loss rate increasing with time. Analysis of the NIR ...

  7. Role of Adjuvant Radiotherapy in Granulosa Cell Tumors of the Ovary

    SciTech Connect (OSTI)

    Hauspy, Jan; Beiner, Mario E.; Harley, Ian; Rosen, Barry; Murphy, Joan; Chapman, William; Le, Lisa W.; Fyles, Anthony; Levin, Wilfred

    2011-03-01

    Purpose: To review the role of adjuvant radiotherapy (RT) in the outcome and recurrence patterns of granulosa cell tumors (GCTs) of the ovary. Methods and Materials: The records of all patients with GCTs referred to the Princess Margaret Hospital University Health Network between 1961 and 2006 were retrospectively reviewed. The patient, tumor, and treatment factors were assessed by univariate and multivariate analyses using disease-free survival (DFS) as the endpoint. Results: A total of 103 patients with histologically confirmed GCTs were included in the present study. The mean duration of follow-up was 100 months (range, 1-399). Of the 103 patients, 31 received adjuvant RT. A total of 39 patients developed tumor recurrence. The tumor size, incidence of intraoperative rupture, and presence of concurrent endometrial cancer were not significant risk factors for DFS. The median DFS was 251 months for patients who underwent adjuvant RT compared with 112 months for patients who did not (p = .02). On multivariate analysis, adjuvant RT remained a significant prognostic factor for DFS (p = .004). Of the 103 patients, 12 had died and 44 were lost to follow-up. Conclusion: Ovarian GCTs can be indolent, with patients achieving long-term survival. In our series, adjuvant RT resulted in a significantly longer DFS. Ideally, randomized trials with long-term follow-up are needed to define the role of adjuvant RT for ovarian GCTs.

  8. Salvage Treatment for Recurrent Intracranial Germinoma After Reduced-Volume Radiotherapy: A Single-Institution Experience and Review of the Literature

    SciTech Connect (OSTI)

    Hu, Yu-Wen [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China) [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China); Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Huang, Pin-I [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China) [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China); Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University, Taipei, Taiwan (China); Wong, Tai-Tong [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Division of Pediatric Neurosurgery, Neurological Institute, Taipei Veterans General Hospital, Taipei, Taiwan (China); Ho, Donald Ming-Tak [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Pathology, Taipei Veterans General Hospital, Taipei, Taiwan (China); Chang, Kai-Ping [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Pediatrics, Taipei Veterans General Hospital, Taipei, Taiwan (China); Guo, Wan-Yuo; Chang, Feng-Chi [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Department of Radiology, Taipei Veterans General Hospital, Taipei, Taiwan (China); Shiau, Cheng-Yin [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China) [Cancer Center, Taipei Veterans General Hospital, Taipei, Taiwan (China); Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Liang, Muh-Lii; Lee, Yi-Yen [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China) [Faculty of Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan (China); Institute of Clinical Medicine, National Yang-Ming University, Taipei, Taiwan (China); Division of Pediatric Neurosurgery, Neurological Institute, Taipei Veterans General Hospital, Taipei, Taiwan (China); and others

    2012-11-01

    Purpose: Intracranial germinomas (IGs) are highly curable with radiotherapy (RT). However, recurrence still occurs, especially when limited-field RT is applied, and the optimal salvage therapy remains controversial. Methods and Materials: Between January 1989 and December 2010, 14 patients with clinically or pathologically diagnosed recurrent IGs after RT were reviewed at our institution. Of these, 11 received focal-field RT, and the other 3 received whole-brain irradiation, whole-ventricle irradiation, and Gamma Knife radiosurgery as the respective first course of RT. In addition, we identified from the literature 88 patients with recurrent IGs after reduced-volume RT, in whom the details of salvage therapy were recorded. Results: The median time to recurrence was 30.3 months (range, 3.8-134.9 months). One patient did not receive further treatment and was lost during follow-up. Of the patients, 7 underwent salvage with craniospinal irradiation (CSI) plus chemotherapy (CT), 4 with CSI alone, 1 with whole-brain irradiation plus CT, and 1 with Gamma Knife radiosurgery. The median follow-up time was 105.1 months (range, 24.2-180.9 months). Three patients died without evidence of disease progression: two from second malignancies and one from unknown cause. The others remained disease free. The 3-year survival rate after recurrence was 83.3%. A total of 102 patients from our study and the literature review were analyzed to determine the factors affecting prognosis and outcomes. After recurrence, the 5-year survival rates were 71% and 92.9% for all patients and for those receiving salvage CSI, respectively. Univariate analysis showed that initial RT volume, initial RT dose, initial CT, and salvage RT type were significant prognostic predictors of survival. On multivariable analysis, salvage CSI was the most significant factor (p = 0.03). Conclusions: Protracted follow-up is recommended because late recurrence is not uncommon. CSI with or without CT is an effective salvage treatment for recurrence after reduced-volume RT.

  9. Predictors of Severe Acute and Late Toxicities in Patients With Localized Head-and-Neck Cancer Treated With Radiation Therapy

    SciTech Connect (OSTI)

    Meyer, Francois, E-mail: francois.meyer@chuq.qc.ca [Laval University Cancer Research Center, Centre hospitalier universitaire de Quebec - L'Hotel-Dieu de Quebec, Quebec (Canada); Fortin, Andre; Wang, Chang Shu [Radiation Therapy Department, Centre hospitalier universitaire de Quebec - L'Hotel-Dieu de Quebec, Quebec (Canada); Liu, Geoffrey [Applied Molecular Oncology, Ontario Cancer Institute/Princess Margaret Hospital, Toronto (Canada); Bairati, Isabelle [Laval University Cancer Research Center, Centre hospitalier universitaire de Quebec - L'Hotel-Dieu de Quebec, Quebec (Canada)

    2012-03-15

    Purpose: Radiation therapy (RT) causes acute and late toxicities that affect various organs and functions. In a large cohort of patients treated with RT for localized head and neck cancer (HNC), we prospectively assessed the occurrence of RT-induced acute and late toxicities and identified characteristics that predicted these toxicities. Methods and Materials: We conducted a randomized trial among 540 patients treated with RT for localized HNC to assess whether vitamin E supplementation could improve disease outcomes. Adverse effects of RT were assessed using the Radiation Therapy Oncology Group Acute Radiation Morbidity Criteria during RT and one month after RT, and the Radiation Therapy Oncology Group/European Organization for Research and Treatment of Cancer Late Radiation Morbidity Scoring Scheme at six and 12 months after RT. The most severe adverse effect among the organs/tissues was selected as an overall measure of either acute or late toxicity. Grade 3 and 4 toxicities were considered as severe. Stepwise multivariate logistic regression models were used to identify all independent predictors (p < 0.05) of acute or late toxicity and to estimate odds ratios (OR) for severe toxicity with their 95% confidence intervals (CI). Results: Grade 3 or 4 toxicity was observed in 23% and 4% of patients, respectively, for acute and late toxicity. Four independent predictors of severe acute toxicity were identified: sex (female vs. male: OR = 1.72, 95% confidence interval [CI]: 1.06-2.80), Karnofsky Performance Status (OR = 0.67 for a 10-point increment, 95% CI: 0.52-0.88), body mass index (above 25 vs. below: OR = 1.88, 95% CI: 1.22-2.90), TNM stage (Stage II vs. I: OR = 1.91, 95% CI: 1.25-2.92). Two independent predictors were found for severe late toxicity: female sex (OR = 3.96, 95% CI: 1.41-11.08) and weight loss during RT (OR = 1.26 for a 1 kg increment, 95% CI: 1.12-1.41). Conclusions: Knowledge of these predictors easily collected in a clinical setting could help tailoring therapies to reduce toxicities among patients treated with RT for HNC.

  10. Fulvestrant radiosensitizes human estrogen receptor-positive breast cancer cells

    SciTech Connect (OSTI)

    Wang, Jing; Department of Oncology, Affiliated Hospital of Qingdao University Medical College, Shandong Province ; Yang, Qifeng; Haffty, Bruce G.; Li, Xiaoyan; Moran, Meena S.

    2013-02-08

    Highlights: ? Fulvestrant radiosensitizes MCF-7 cells. ? Fulvestrant increases G1 arrest and decreases S phase in MCF-7 cells. ? Fulvestrant down-regulates DNA-PKcs and RAD51 in MCF-7 cells. -- Abstract: The optimal sequencing for hormonal therapy and radiation are yet to be determined. We utilized fulvestrant, which is showing promise as an alternative to other agents in the clinical setting of hormonal therapy, to assess the cellular effects of concomitant anti-estrogen therapy (fulvestrant) with radiation (F + RT). This study was conducted to assess the effects of fulvestrant alone vs. F + RT on hormone-receptor positive breast cancer to determine if any positive or negative combined effects exist. The effects of F + RT on human breast cancer cells were assessed using MCF-7 clonogenic and tetrazolium salt colorimetric (MTT) assays. The assays were irradiated with a dose of 0, 2, 4, 6 Gy ± fulvestrant. The effects of F + RT vs. single adjuvant treatment alone on cell-cycle distribution were assessed using flow cytometry; relative expression of repair proteins (Ku70, Ku80, DNA-PKcs, Rad51) was assessed using Western Blot analysis. Cell growth for radiation alone vs. F + RT was 0.885 ± 0.013 vs. 0.622 ± 0.029 @2 Gy, 0.599 ± 0.045 vs. 0.475 ± 0.054 @4 Gy, and 0.472 ± 0.021 vs. 0.380 ± 0.018 @6 Gy RT (p = 0.003). While irradiation alone induced G2/M cell cycle arrest, the combination of F + RT induced cell redistribution in the G1 phase and produced a significant decrease in the proportion of cells in G2 phase arrest and in the S phase in breast cancer cells (p < 0.01). Furthermore, levels of repair proteins DNA-PKcs and Rad51 were significantly decreased in the cells treated with F + RT compared with irradiation alone. F + RT leads to a decrease in the surviving fraction, increased cell cycle arrest, down regulating of nonhomologous repair protein DNA-PKcs and homologous recombination repair protein RAD51. Thus, our findings suggest that F + RT increases breast cancer cell radiosensitivity compared with radiation alone. These findings have salient implications for designing clinical trials using fulvestrant and radiation therapy.

  11. Self-Reported Cognitive Outcomes in Patients With Brain Metastases Before and After Radiation Therapy

    SciTech Connect (OSTI)

    Cole, Ansa Maer; Scherwath, Angela; Ernst, Gundula; Lanfermann, Heinrich; Bremer, Michael; Steinmann, Diana

    2013-11-15

    Purpose: Patients with brain metastases may experience treatment-related cognitive deficits. In this study, we prospectively assessed the self-reported cognitive abilities of patients with brain metastases from any solid primary cancer before and after irradiation of the brain. Methods and Materials: The treatment group (TG) consisted of adult patients (n=50) with brain metastases who received whole or partial irradiation of the brain without having received prior radiation therapy (RT). The control group (CG) consisted of breast cancer patients (n=27) without cranial involvement who were treated with adjuvant RT. Patients were recruited between May 2008 and December 2010. Self-reported cognitive abilities were acquired before RT and 6 weeks, 3 months, and 6 months after irradiation. The information regarding the neurocognitive status was collected by use of the German questionnaires for self-perceived deficits in attention (FEDA) and subjectively experienced everyday memory performance (FEAG). Results: The baseline data showed a high proportion of self-perceived neurocognitive deficits in both groups. A comparison between the TG and the CG regarding the course of self-reported outcomes after RT showed significant between-group differences for the FEDA scales 2 and 3: fatigue and retardation of daily living activities (P=.002) and decrease in motivation (P=.032) with an increase of attention deficits in the TG, but not in the CG. There was a trend towards significance in FEDA scale 1: distractibility and retardation of mental processes (P=.059) between the TG and the CG. The FEAG assessment presented no significant differences. An additional subgroup analysis within the TG was carried out. FEDA scale 3 showed significant differences in the time-related progress between patients with whole-brain RT and those receiving hypofractionated stereotactic RT (P=.025), with less decrease in motivation in the latter group. Conclusion: Self-reported attention declined in patients with brain metastases after RT to the brain, whereas it remained relatively stable in breast cancer patients.

  12. RTOG 0211: A Phase 1/2 Study of Radiation Therapy With Concurrent Gefitinib for Newly Diagnosed Glioblastoma Patients

    SciTech Connect (OSTI)

    Chakravarti, Arnab; Wang, Meihua; Robins, H. Ian; Lautenschlaeger, Tim; Curran, Walter J.; Brachman, David G.; Schultz, Christopher J.; Choucair, Ali; Dolled-Filhart, Marisa; Christiansen, Jason; Gustavson, Mark; Molinaro, Annette; Ludwig Institute for Cancer Research, University of California–San Diego, La Jolla, California ; Mischel, Paul; Dicker, Adam P.; and others

    2013-04-01

    Purpose: To determine the safety and efficacy of gefitinib, an epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor, in combination with radiation for newly diagnosed glioblastoma (GBM) patients. Methods and Materials: Between March 21, 2002, and May 3, 2004, Radiation Therapy Oncology Group (RTOG) 0211 enrolled 31 and 147 GBM patients in the phase 1 and 2 arms, respectively. Treatment consisted of daily oral gefinitnib started at the time of conventional cranial radiation therapy (RT) and continued post RT for 18 months or until progression. Tissue microarrays from 68 cases were analyzed for EGFR expression. Results: The maximum tolerated dose (MTD) of gefitinib was determined to be 500 mg in patients on non-enzyme-inducing anticonvulsant drugs (non-EIAEDs). All patients in the phase 2 component were treated at a gefitinib dose of 500 mg; patients receiving EIADSs could be escalated to 750 mg. The most common side effects of gefitinib in combination with radiation were dermatologic and gastrointestinal. Median survival was 11.5 months for patients treated per protocol. There was no overall survival benefit for patients treated with gefitinib + RT when compared with a historical cohort of patients treated with RT alone, matched by RTOG recursive partitioning analysis (RPA) class distribution. Younger age was significantly associated with better outcome. Per protocol stratification, EGFR expression was not found to be of prognostic value for gefitinib + RT-treated patients. Conclusions: The addition of gefitinib to RT is well tolerated. Median survival of RTOG 0211 patients treated with RT with concurrent and adjuvant gefitinib was similar to that in a historical control cohort treated with radiation alone.

  13. The mitigating effect of magnetic fields on Rayleigh-Taylor unstable inertial confinement fusion plasmas

    SciTech Connect (OSTI)

    Srinivasan, Bhuvana; Tang, Xian-Zhu

    2013-05-15

    Rayleigh-Taylor (RT) instabilities at interfaces of disparate mass densities have long been known to generate magnetic fields during inertial confinement fusion implosions. An externally applied magnetic field can also be efficiently amplified by RT instabilities. The focus here is on magnetic field generation and amplification at the gas-ice interface which is RT unstable during the deceleration phase of the implosion. RT instabilities lead to undesirable mix of hot and cold plasmas which enhances thermal energy loss and tends to produce a more massive warm-spot instead of a hot-spot. Two mechanisms are shown here to mitigate the thermal energy loss from the hot-spot. The first mechanism is the reduction of electron thermal conductivity with interface-aligned magnetic fields. This can occur through self-generated magnetic fields via the Biermann battery effect as well as through externally applied magnetic fields that undergo an exponential growth via the stretch-and-fold magnetohydrodynamic dynamo. Self-generated magnetic fields during RT evolution can result in a factor of 2?10 decrease in the electron thermal conductivity at the gas-ice interface, while externally applied magnetic fields that are compressed to 6–1000 T at the onset of deceleration (corresponding to pre-implosion external fields of 0.06–10 T) could result in a factor of 2–500 reduction in electron thermal conductivity at the gas-ice interface. The second mechanism to mitigate thermal energy loss from the hot-spot is to decrease the interface mixing area between the hot and cold plasmas. This is achieved through large external magnetic fields of 1000 T at the onset of deceleration which damp short-wavelength RT modes and long-wavelength Kelvin-Helmholtz modes thus significantly slowing the RT growth and reducing mix.

  14. Imaging Biomarker Dynamics in an Intracranial Murine Glioma Study of Radiation and Antiangiogenic Therapy

    SciTech Connect (OSTI)

    Chung, Caroline; Jalali, Shahrzad; Foltz, Warren; Burrell, Kelly; Wildgoose, Petra; Lindsay, Patricia; Graves, Christian; Camphausen, Kevin; Milosevic, Michael; Jaffray, David; Zadeh, Gelareh; Ménard, Cynthia

    2013-03-01

    Purpose: There is a growing need for noninvasive biomarkers to guide individualized spatiotemporal delivery of radiation therapy (RT) and antiangiogenic (AA) therapy for brain tumors. This study explored early biomarkers of response to RT and the AA agent sunitinib (SU), in a murine intracranial glioma model, using serial magnetic resonance imaging (MRI). Methods and Materials: Mice with MRI-visible tumors were stratified by tumor size into 4 therapy arms: control, RT, SU, and SU plus RT (SURT). Single-fraction conformal RT was delivered using MRI and on-line cone beam computed tomography (CT) guidance. Serial MR images (T2-weighted, diffusion, dynamic contrast-enhanced and gadolinium-enhanced T1-weighted scans) were acquired biweekly to evaluate tumor volume, apparent diffusion coefficient (ADC), and tumor perfusion and permeability responses (K{sub trans}, K{sub ep}). Results: Mice in all treatment arms survived longer than those in control, with a median survival of 35 days for SURT (P<.0001) and 30 days for RT (P=.009) and SU (P=.01) mice vs 26 days for control mice. At Day 3, ADC rise was greater with RT than without (P=.002). Sunitinib treatment reduced tumor perfusion/permeability values with mean K{sub trans} reduction of 27.6% for SU (P=.04) and 26.3% for SURT (P=.04) mice and mean K{sub ep} reduction of 38.1% for SU (P=.01) and 27.3% for SURT (P=.02) mice. The magnitude of individual mouse ADC responses at Days 3 and 7 correlated with subsequent tumor growth rate R values of ?0.878 (P=.002) and ?0.80 (P=.01), respectively. Conclusions: Early quantitative changes in diffusion and perfusion MRI measures reflect treatment responses soon after starting therapy and thereby raise the potential for these imaging biomarkers to guide adaptive and potentially individualized therapy approaches in the future.

  15. Aspirin and Statin Nonuse Associated With Early Biochemical Failure After Prostate Radiation Therapy

    SciTech Connect (OSTI)

    Zaorsky, Nicholas G.; Buyyounouski, Mark K.; Li, Tianyu; Horwitz, Eric M.

    2012-09-01

    Purpose: To present the largest retrospective series investigating the effect of aspirin and statins, which are hypothesized to have antineoplastic properties, on biochemical failure (nadir plus 2 ng/mL) after prostate radiation therapy (RT). Methods and Materials: Between 1989 and 2006, 2051 men with clinically localized prostate cancer received definitive RT alone (median dose, 76 Gy). The rates of aspirin use and statin use (defined as any use at the time of RT or during follow-up) were 36% and 34%, respectively. The primary endpoint of the study was an interval to biochemical failure (IBF) of less than 18 months, which has been shown to be the single strongest predictor of distant metastasis, prostate cancer survival, and overall survival after RT. Patient demographic characteristics and tumor staging factors were assessed with regard to associations with the endpoint. Univariate analysis was performed with the {chi}{sup 2} test for categorical variables and the Wilcoxon test for continuous variables. Multivariable analysis was performed with a multiple logistic regression. Results: The median follow-up was 75 months. Univariate analysis showed that an IBF of less than 18 months was associated with aspirin nonuse (P<.0001), statin nonuse (P<.0001), anticoagulant nonuse (P=.0006), cardiovascular disease (P=.0008), and prostate-specific antigen (continuous) (P=.008) but not with Gleason score, age, RT dose, or T stage. On multivariate analysis, only aspirin nonuse (P=.0012; odds ratio, 2.052 [95% confidence interval, 1.328-3.172]) and statin nonuse (P=.0002; odds ratio, 2.465 [95% confidence interval, 1.529-3.974]) were associated with an IBF of less than 18 months. Conclusions: In patients who received RT for prostate cancer, aspirin or statin nonuse was associated with early biochemical failure, a harbinger of distant metastasis and death. Further study is needed to confirm these findings and to determine the optimal dosing and schedule, as well as the relative benefits and risks, of both therapies in combination with RT.

  16. PSA Response to Neoadjuvant Androgen Deprivation Therapy Is a Strong Independent Predictor of Survival in High-Risk Prostate Cancer in the Dose-Escalated Radiation Therapy Era

    SciTech Connect (OSTI)

    McGuire, Sean E.; Lee, Andrew K.; Cerne, Jasmina Z.; Munsell, Mark F.; Levy, Lawrence B.; Kudchadker, Rajat J.; Choi, Seungtaek L.; Nguyen, Quynh N.; Hoffman, Karen E.; Pugh, Thomas J.; Frank, Steven J.; Corn, Paul G.; Logothetis, Christopher J.; Kuban, Deborah A.

    2013-01-01

    Purpose: The aim of the study was to evaluate the prognostic value of prostate-specific antigen (PSA) response to neoadjuvant androgen deprivation therapy (ADT) prior to dose-escalated radiation therapy (RT) and long-term ADT in high-risk prostate cancer. Methods and Materials: We reviewed the charts of all patients diagnosed with high-risk prostate cancer and treated with a combination of long-term ADT (median, 24 months) and dose-escalated (median, 75.6 Gy) RT between 1990 and 2007. The associations among patient, tumor, and treatment characteristics with biochemical response to neoadjuvant ADT and their effects on failure-free survival (FFS), time to distant metastasis (TDM), prostate cancer-specific mortality (PCSM) and overall survival (OS) were examined. Results: A total of 196 patients met criteria for inclusion. Median follow-up time for patients alive at last contact was 7.0 years (range, 0.5-18.1 years). Multivariate analysis identified the pre-RT PSA concentration (<0.5 vs {>=}0.5 ng/mL) as a significant independent predictor of FFS (P=.021), TDM (P=.009), PCSM (P=.039), and OS (P=.037). On multivariate analysis, pretreatment PSA (iPSA) and African-American race were significantly associated with failure to achieve a pre-RT PSA of <0.5 ng/mL. Conclusions: For high-risk prostate cancer patients treated with long-term ADT and dose-escalated RT, a pre-RT PSA level {>=}0.5 ng/mL after neoadjuvant ADT predicts for worse survival measures. Both elevated iPSA and African-American race are associated with increased risk of having a pre-RT PSA level {>=}0.5 ng/mL. These patients should be considered for clinical trials that test newer, more potent androgen-depleting therapies such as abiraterone and MDV3100 in combination with radiation.

  17. Extreme-Risk Prostate Adenocarcinoma Presenting With Prostate-Specific Antigen (PSA) >40 ng/ml: Prognostic Significance of the Preradiation PSA Nadir

    SciTech Connect (OSTI)

    Alexander, Abraham S. [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Mydin, Aminudin; Jones, Stuart O.; Christie, Jennifer [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); Lim, Jan T.W. [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Truong, Pauline T., E-mail: ptruong@bccancer.bc.ca [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada); Ludgate, Charles M. [British Columbia Cancer Agency, Vancouver Island Centre, Radiation Therapy Program, Victoria, British Columbia (Canada); University of British Columbia, Vancouver, British Columbia (Canada)

    2011-12-01

    Purpose: To examine the impact of patient, disease, and treatment characteristics on survival outcomes in patients treated with neoadjuvant androgen deprivation therapy (ADT) and radical external-beam radiotherapy (RT) for clinically localized, extreme-risk prostate adenocarcinoma with a presenting prostate-specific antigen (PSA) concentration of >40 ng/ml. Methods and Materials: A retrospective chart review was conducted of 64 patients treated at a single institution between 1991 and 2000 with ADT and RT for prostate cancer with a presenting PSA level of >40 ng/ml. The effects of patient age, tumor (presenting PSA level, Gleason score, and T stage), and treatment (total ADT duration and pre-RT PSA level) characteristics on rates of biochemical disease-free survival (bDFS), prostate cancer-specific survival (PCSS), and overall survival (OS) were examined. Results: Median follow-up time was 6.45 years (range, 0.09-15.19 years). Actuarial bDFS, PCSS, and OS rates at 5 years were 39%, 87%, and 78%, respectively, and 17%, 64%, and 45%, respectively, at 10 years. On multivariate analysis, the pre-RT PSA level ({<=}0.1 versus >0.1 ng/ml) was the single most significant prognostic factor for bDFS (p = 0.033) and OS (p = 0.018) rates, whereas age, T stage, Gleason score, and ADT duration ({<=}6 versus >6 months) were not predictive of outcomes. Conclusion: In prostate cancer patients with high presenting PSA levels, >40 ng/ml, treated with combined modality, neoadjuvant ADT, and RT, the pre-RT PSA nadir, rather than ADT duration, was significantly associated with improved survival. This observation supports the use of neoadjuvant ADT to drive PSA levels to below 0.1 ng/ml before initiation of RT, to optimize outcomes for patients with extreme-risk disease.

  18. Impact of Neoadjuvant Radiation on Survival in Stage III Non-Small-Cell Lung Cancer

    SciTech Connect (OSTI)

    Koshy, Matthew, E-mail: mkoshy@umm.ed [Department of Radiation Oncology, University of Maryland School of Medicine and University of Maryland Marlene and Stewart Greenebaum Cancer Center, Baltimore, MD (United States); Goloubeva, Olga; Suntharalingam, Mohan [Department of Radiation Oncology, University of Maryland School of Medicine and University of Maryland Marlene and Stewart Greenebaum Cancer Center, Baltimore, MD (United States)

    2011-04-01

    Purpose: The role of surgery in Stage III non-small-cell lung cancer (NSCLC) is controversial. This study was undertaken to assess the impact of neoadjuvant radiation therapy for Stage III NSCLC. Methods and Materials: This was a retrospective study from the Surveillance, Epidemiology, and End Results (SEER) database that included patients who were 18 years and older with NSCLC classified as Stage III and who underwent definitive therapy from 1988 to 2004. Patients were characterized by type of treatment received. Survival functions were estimated by the Kaplan-Meier method, and Cox regression model was used to analyze trends in overall (OS) and cause-specific survival (CSS). Results: A total of 48,131 patients were selected, with a median follow-up of 10 months (range, 0-203 months). By type of treatment, the 3-year OS was 10% with radiation therapy (RT), 37% with surgery (S), 34% with surgery and postoperative radiation (S-RT), and 45% with neoadjuvant radiation followed by surgery (Neo-RT) (p = 0.0001). Multivariable Cox model identified sex, race, laterality, T stage, N stage, and type of treatment as factors affecting survival. Estimated hazard ratios (HR) adjusted for other variables in regression model showed the types of treatment: S (HR, 1.3; 95% confidence interval [CI], 1.2-1.4), S-RT (HR, 1.2; 95% CI, 1.1-1.3), and RT (HR, 2.3; 95% CI, 2.15-2.53) were associated with significantly worse overall survival when compared with Neo-RT (p = 0.0001). Conclusion: This population based study demonstrates that patients with Stage III NSCLC receiving Neo-RT had significantly improved overall survival when compared with other treatment groups.

  19. Late Patient-Reported Toxicity After Preoperative Radiotherapy or Chemoradiotherapy in Nonresectable Rectal Cancer: Results From a Randomized Phase III Study

    SciTech Connect (OSTI)

    Braendengen, Morten, E-mail: mortbrae@medisin.uio.no [Oslo University Hospital, Ulleval, Cancer Centre, Oslo (Norway); Department of Oncology and Pathology, Karolinska Institutet, Stockholm (Sweden); Tveit, Kjell Magne [Oslo University Hospital, Ulleval, Cancer Centre, Oslo (Norway); Faculty of Medicine, University of Oslo, Oslo (Norway); Bruheim, Kjersti [Oslo University Hospital, Ulleval, Cancer Centre, Oslo (Norway); Cvancarova, Milada [Department of Clinical Cancer Research, Oslo University Hospital, Radiumhospitalet, Oslo (Norway); Berglund, Ake [Department of Oncology, Radiology and Clinical Immunology, University of Uppsala, Uppsala (Sweden); Glimelius, Bengt [Department of Oncology and Pathology, Karolinska Institutet, Stockholm (Sweden); Department of Oncology, Radiology and Clinical Immunology, University of Uppsala, Uppsala (Sweden)

    2011-11-15

    Purpose: Preoperative chemoradiotherapy (CRT) is superior to radiotherapy (RT) in locally advanced rectal cancer, but the survival gain is limited. Late toxicity is, therefore, important. The aim was to compare late bowel, urinary, and sexual functions after CRT or RT. Methods and Materials: Patients (N = 207) with nonresectable rectal cancer were randomized to preoperative CRT or RT (2 Gy Multiplication-Sign 25 {+-} 5-fluorouracil/leucovorin). Extended surgery was often required. Self-reported late toxicity was scored according to the LENT SOMA criteria in a structured telephone interview and with questionnaires European Organisation for Research and Treatment of Cancer (EORTC) Quality of Life Questionnaire (QLQ-C30), International Index of Erectile Function (IIEF), and sexual function -vaginal changes questionnaire (SVQ). Results: Of the 105 patients alive in Norway and Sweden after 4 to 12 years of follow-up, 78 (74%) responded. More patients in the CRT group had received a stoma (73% vs. 52%, p = 0.09). Most patients without a stoma (7 of 12 in CRT group and 9 of 16 in RT group) had incontinence for liquid stools or gas. No stoma and good anal function were seen in 5 patients (11%) in the CRT group and in 11 (30%) in the RT group (p = 0.046). Of 44 patients in the CRT group, 12 (28%) had had bowel obstruction compared with 5 of 33 (15%) in the RT group (p = 0.27). One-quarter of the patients reported urinary incontinence. The majority of men had severe erectile dysfunction. Few women reported sexual activity during the previous month. However, the majority did not have concerns about their sex life. Conclusions: Fecal incontinence and erectile dysfunction are frequent after combined treatment for locally advanced rectal cancer. There was a clear tendency for the problems to be more common after CRT than after RT.

  20. Hypofractionated Radiation Therapy for Breast Ductal Carcinoma In Situ

    SciTech Connect (OSTI)

    Hathout, Lara [Department of Radiation Oncology, Hôpital Maisonneuve-Rosemont, Centre affilié à l'Université de Montréal, Montreal, Quebec (Canada); Hijal, Tarek [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Théberge, Valérie [Department of Radiation Oncology, Centre hospitalier universitaire de Québec, L'Hôtel-Dieu de Québec, Quebec (Canada); Centre des maladies du sein Deschênes-Fabia, Quebec (Canada); Fortin, Bernard [Department of Radiation Oncology, Hôpital Maisonneuve-Rosemont, Centre affilié à l'Université de Montréal, Montreal, Quebec (Canada); Vulpe, Horia [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Hogue, Jean-Charles [Centre des maladies du sein Deschênes-Fabia, Quebec (Canada); Centre hospitalier universitaire de Québec, Hôpital St-Sacrement, Quebec (Canada); Lambert, Christine [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Bahig, Houda [Department of Radiation Oncology, Hôpital Maisonneuve-Rosemont, Centre affilié à l'Université de Montréal, Montreal, Quebec (Canada); and others

    2013-12-01

    Purpose: Conventional radiation therapy (RT) administered in 25 fractions after breast-conserving surgery (BCS) is the standard treatment for ductal carcinoma in situ (DCIS) of the breast. Although accelerated hypofractionated regimens in 16 fractions have been shown to be equivalent to conventional RT for invasive breast cancer, few studies have reported results of using hypofractionated RT in DCIS. Methods and Materials: In this multicenter collaborative effort, we retrospectively reviewed the records of all women with DCIS at 3 institutions treated with BCS followed by hypofractionated whole-breast RT (WBRT) delivered in 16 fractions. Results: Between 2003 and 2010, 440 patients with DCIS underwent BCS followed by hypofractionated WBRT in 16 fractions for a total dose of 42.5 Gy (2.66 Gy per fraction). Boost RT to the surgical bed was given to 125 patients (28%) at a median dose of 10 Gy in 4 fractions (2.5 Gy per fraction). After a median follow-up time of 4.4 years, 14 patients had an ipsilateral local relapse, resulting in a local recurrence-free survival of 97% at 5 years. Positive surgical margins, high nuclear grade, age less than 50 years, and a premenopausal status were all statistically associated with an increased occurrence of local recurrence. Tumor hormone receptor status, use of adjuvant hormonal therapy, and administration of additional boost RT did not have an impact on local control in our cohort. On multivariate analysis, positive margins, premenopausal status, and nuclear grade 3 tumors had a statistically significant worse local control rate. Conclusions: Hypofractionated RT using 42.5 Gy in 16 fractions provides excellent local control for patients with DCIS undergoing BCS.

  1. Spatial autocorrelation approaches to testing residuals from least squares regression

    E-Print Network [OSTI]

    Chen, Yanguang

    2015-01-01

    In statistics, the Durbin-Watson test is always employed to detect the presence of serial correlation of residuals from a least squares regression analysis. However, the Durbin-Watson statistic is only suitable for ordered time or spatial series. If the variables comprise cross-sectional data coming from spatial random sampling, the Durbin-Watson will be ineffectual because the value of Durbin-Watson's statistic depends on the sequences of data point arrangement. Based on the ideas from spatial autocorrelation, this paper presents two new statistics for testing serial correlation of residuals from least squares regression based on spatial samples. By analogy with the new form of Moran's index, an autocorrelation coefficient is defined with a standardized residual vector and a normalized spatial weight matrix. Then on the analogy of the Durbin-Watson statistic, a serial correlation index is constructed. As a case, the two statistics are applied to the spatial sample of 29 China's regions. These results show th...

  2. In-Born Radio Frequency Identification Devices for Safeguards Use at Gas-Centrifuge Enrichment Plants

    SciTech Connect (OSTI)

    Ward,R.; Rosenthal,M.

    2009-07-12

    Global expansion of nuclear power has made the need for improved safeguards measures at Gas Centrifuge Enrichment Plants (GCEPs) imperative. One technology under consideration for safeguards applications is Radio Frequency Identification Devices (RFIDs). RFIDs have the potential to increase IAEA inspector"s efficiency and effectiveness either by reducing the number of inspection visits necessary or by reducing inspection effort at those visits. This study assesses the use of RFIDs as an integral component of the "Option 4" safeguards approach developed by Bruce Moran, U.S. Nuclear Regulatory Commission (NRC), for a model GCEP [1]. A previous analysis of RFIDs was conducted by Jae Jo, Brookhaven National Laboratory (BNL), which evaluated the effectiveness of an RFID tag applied by the facility operator [2]. This paper presents a similar evaluation carried out in the framework of Jo’s paper, but it is predicated on the assumption that the RFID tag is applied by the manufacturer at the birth of the cylinder, rather than by the operator. Relevant diversion scenarios are examined to determine if RFIDs increase the effectiveness and/ or efficiency of safeguards in these scenarios. Conclusions on the benefits offered to inspectors by using in-born RFID tagging are presented.

  3. Prevention of Gynecomastia and Breast Pain Caused by Androgen Deprivation Therapy in Prostate Cancer: Tamoxifen or Radiotherapy?

    SciTech Connect (OSTI)

    Arruda Viani, Gustavo; Bernardes da Silva, Lucas Godoi; Stefano, Eduardo Jose

    2012-07-15

    Purpose: To determine, in a meta-analysis, whether gynecomastia and breast pain rates in men with prostate cancer treated with androgen deprivation therapy (ADT) are reduced if treated with prophylactic radiotherapy (RT) or tamoxifen (TMX). Methods and Materials: The MEDLINE, EMBASE, CANCERLIT, and Cochrane Library databases, as well as proceedings of annual meetings, were systematically searched to identify randomized, controlled studies comparing RT or TMX with observation for men with prostate cancer using ADT. Results: Six RCTs (three RT trials and three TMX trials, N = 777 patients total) were identified that met the study criteria. Pooled results from these RCTs comparing RT vs. observation showed a significant reduction in the incidence of gynecomastia and breast pain rates in patients treated with RT (odds ratio [OR] = 0.21, 95% confidence interval [CI] = 0.12-0.37, p < 0.0001, and OR = 0.34, 95% CI 0.20-0.57, p < 0.0001, respectively). Use of RT resulted in an absolute risk reduction (ARR) of 29.4% and 19.9%, with a number needed to treat (NNT) of 3.4 and 5 to avoid one case of gynecomastia and breast pain, respectively. Pooled results from trials comparing TMX vs. observation showed a statistical benefit for breast pain and gynecomastia in favor of TMX arms (OR = 0.04, 95% CI = 0.02-0.08, p < 0.0001 and OR = 0.07, 95% CI = 0.0-0.14, p < 0.00001). TMX resulted in an ARR = 64.1% and 47.6%, with an NNT of 1.56 and 2.1 to avoid one case of gynecomastia and breast pain, respectively. Considering adverse effects, TMX was 6 times more adverse effects than RT. Conclusions: Our data have shown that both TMX and RT prevented gynecomastia and breast pain in patients with prostate cancer receiving ADT for prostate cancer. Although TMX was two times more effective in preventing gynecomastia, RT should represent an effective and safe treatment option, to take into account mainly in patients with cardiovascular risk factors or thrombotic diathesis.

  4. Dentofacial development in long-term survivors of acute lymphoblastic leukemia. A comparison of three treatment modalities

    SciTech Connect (OSTI)

    Sonis, A.L.; Tarbell, N.; Valachovic, R.W.; Gelber, R.; Schwenn, M.; Sallan, S. (Children's Hospital, Boston, MA (USA))

    1990-12-15

    Ninety-seven children who were diagnosed with acute lymphoblastic leukemia before 10 years of age and treated with chemotherapy alone, chemotherapy plus 1800-cGy cranial irradiation (RT), or chemotherapy plus 2400-cGy RT were evaluated for effects of therapy on dentofacial development. All patients were seen at least 5 years postdiagnosis. Dental abnormalities were determined from panoramic radiographs, and craniofacial evaluations were made from lateral cephalometric radiographs. Ninety-one (94%) of all patients and 41 (100%) of patients younger than 5 years of age at diagnosis had abnormal dental development. The severity of these abnormalities was greater in children who received treatment before 5 years of age and in those who received RT. Observed dental abnormalities included tooth agenesis, arrested root development, microdontia, and enamel dysplasias. Craniofacial abnormalities occurred in 18 of 20 (90%) of those patients who received chemotherapy plus 2400-cGy RT before 5 years of age. Mean cephalometric values of this group showed significant deficient mandibular development. The results of this study suggest that the severity of dentofacial-developmental abnormalities secondary to antileukemia therapy are related to the age of the patient at the initiation of treatment and the use of cranial RT.

  5. A survey of methods concerning the effects of impurities on the thermophysical properties of pure components 

    E-Print Network [OSTI]

    Phillips, Tony Lee

    1980-01-01

    and the r esu' ts compared to measurements . Table 1. DOS Used to Determine the Dew-Rubble Gap. v d'I(1 P =R /! v-b) - a/ v a=?7R /(64P ) 2 2 b=RT /(8P ) C C P=R /( , v-b)-a/I v( v+b) ] a=O. 42747F, T P b=0. 08664RT /P C C SRK P=RT/( v ? b...)-a/[v( v+b) ] a=O. 42747R . s /P s=1+(0. 480+1 . 574w-0. 176~ ) (1 ? ' ) 2 1/2 b=0. 08664RT /P C C PR P=R /( v-b) ? a/[v( v ? b)+b( v-b) ] a=O. 45724(R T /. ) t C C t=1+(0. 37464+1. 54226m-0. 2699m ) (1- ?) 2 1/2 b=0. 07780RT /P C C I D '. A L S Y...

  6. An efficient atomistic quantum mechanical simulation on InAs band-to-band tunneling field-effect transistors

    SciTech Connect (OSTI)

    Wang, Zhi [State Key Laboratory for Superlattices and Microstructures, Institute of Semiconductors, Chinese Academy of Sciences, P.O. Box 912, Beijing 100083 (China); Jiang, Xiang-Wei; Li, Shu-Shen [State Key Laboratory for Superlattices and Microstructures, Institute of Semiconductors, Chinese Academy of Sciences, P.O. Box 912, Beijing 100083 (China); Synergetic Innovation Center of Quantum Information and Quantum Physics, University of Science and Technology of China, Hefei, Anhui 230026 (China); Wang, Lin-Wang, E-mail: lwwang@lbl.gov [Material Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

    2014-03-24

    We have presented a fully atomistic quantum mechanical simulation method on band-to-band tunneling (BTBT) field-effect transistors (FETs). Our simulation approach is based on the linear combination of bulk band method with empirical pseudopotentials, which is an atomist method beyond the effective-mass approximation or k.p perturbation method, and can be used to simulate real-size devices (?10{sup 5} atoms) efficiently (?5 h on a few computational cores). Using this approach, we studied the InAs dual-gate BTBT FETs. The I-V characteristics from our approach agree very well with the tight-binding non-equilibrium Green's function results, yet our method costs much less computationally. In addition, we have studied ways to increase the tunneling current and analyzed the effects of different mechanisms for that purpose.

  7. Mode propagation and attenuation in lined ducts

    E-Print Network [OSTI]

    BI, Wenping

    2014-01-01

    Optimal impedance for each mode is an important concept in an infinitely long duct lined with uniform absorption material. However it is not valid for finite length linings. This is because that the modes in lined ducts are not power-orthogonal; the total sound power is not equal to the sum of the sound power of each mode; cross-power terms may play important roles. In this paper, we study sound propagation and attenuation in an infinite rigid duct lined with a finite length of lining impedance. The lining impedance may be axial segments and circumferentially non-uniform. We propose two new physical quantities Kp and S to describe the self-overlap of the left eigenfunction and right eigenfunction of one mode and the normalized overlap between modes, respectively. The two new physical quantities describe totally the mode behaviors in lined ducts.

  8. Engineering of optical polarization based on electronic band structures of A-plane ZnO layers under biaxial strains

    SciTech Connect (OSTI)

    Matsui, Hiroaki, E-mail: hiroaki@ee.t.u-tokyo.ac.jp; Tabata, Hitoshi [Department of Bioengineering, The University of Tokyo, 1-3-7 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Department of Electrical Engineering and Information Systems, The University of Tokyo, 1-3-7 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Hasuike, Noriyuki; Harima, Hiroshi [Department of Electronics and Information Science, Kyoto Institute of Technology, Sakyo-ku, Kyoto 606-8585 (Japan)

    2014-09-21

    In-plane anisotropic strains in A-plane layers on the electronic band structure of ZnO were investigated from the viewpoint of optical polarization anisotropy. Investigations utilizing k·p perturbation theory revealed that energy transitions and associated oscillation strengths were dependent on in-plane strains. The theoretical correlation between optical polarizations and in-plane strains was experimentally demonstrated using A-plane ZnO layers with different in-plane strains. Finally, optical polarization anisotropy and its implications for in-plane optical properties are discussed in relation to the energy shift between two orthogonal directions. Higher polarization rotations were obtained in an A-plane ZnO layer with in-plane biaxially compressive strains as compared to strain-free ZnO. This study provides detailed information concerning the role played by in-plane strains in optically polarized applications based on nonpolar ZnO in the ultra-violet region.

  9. A critical analysis of the use of population data in allotting federal-grant funds for research and extension 

    E-Print Network [OSTI]

    Adkins, William Gray

    1953-01-01

    $9th IevBX' 9, st 69. 19+~~ HN egad 99sxegs ' ox' Oge Gx the fvzB mesn9xtg? 9g 9'eunQ 9n ether' acta ghieh IgevkCg g~4p hageg ef e92ggaNiny 89'Ce 19 lg base, yes get, -ee~!~MR@ beihcxoe, it vav38 Feve ie:xeeaei ~ sR"xva af g~w' gqN g~ PRgj @6@g... the phiieaegl~~a emr2 ~ ef stats sztsaaiea ss~ 8Kp8~t Btstienai a&'tietiea Qn ozpK43tn?88y 63?HQgssa ~M GQ~ eentsetai Msk a~~a ef re~ md sponsion seemgiiahxanhs, gl~shaQ tfntsrisis UR9eh QGGX %Jith ths Q~~catiev. Qf ~ fknKIs srs tad te anhgaet9va dicsvsaioaa...

  10. Self-similar radiation from numerical Rosenau-Hyman compactons

    SciTech Connect (OSTI)

    Rus, Francisco Villatoro, Francisco R.

    2007-11-10

    The numerical simulation of compactons, solitary waves with compact support, is characterized by the presence of spurious phenomena, as numerically induced radiation, which is illustrated here using four numerical methods applied to the Rosenau-Hyman K(p, p) equation. Both forward and backward radiations are emitted from the compacton presenting a self-similar shape which has been illustrated graphically by the proper scaling. A grid refinement study shows that the amplitude of the radiations decreases as the grid size does, confirming its numerical origin. The front velocity and the amplitude of both radiations have been studied as a function of both the compacton and the numerical parameters. The amplitude of the radiations decreases exponentially in time, being characterized by a nearly constant scaling exponent. An ansatz for both the backward and forward radiations corresponding to a self-similar function characterized by the scaling exponent is suggested by the present numerical results.

  11. A technique for separating dead and abnormal spermatozoa from normal bovine ejaculates and some resultant effects on the storage life of extended semen 

    E-Print Network [OSTI]

    Brown, Murray Allison

    1953-01-01

    ?1250& and 2s900 Oxf'ord mitS per' millilitez oP. diluted semen. The semen thus treated vis then shored a4 8+0 F. xor a period of vere no significant cU. i'gerenees in lixxahiii@ eZ the semen to vhich 9, 250& 509, and 950 units oZ penicillin throughout hhe...+;q I 1. :. L b. 7&&'iiiBJ. "!UT' FJ& BRP~Yi:~' X!C i~rAD age Pa&icORNPL BPBH&KP~Bl Fife!' IiOJJ, '. f~P . B)s'XHg ZP'C, J&~&~Lj'. ?'~ AND 33iiw QF~aLZA!&T:2'!, 'fr". '~-u's iQ ~~('03AL~& Lie 4 By EX~&DlilR~3 SEi'PN ' ' By g48TEEl OP 8GVMCE Nay...

  12. On the quark distribution in an on-shell heavy quark and its all-order relations with the perturbative fragmentation function.

    E-Print Network [OSTI]

    Gardi, Einan

    ? 4? e ?ixp+y? ? dDk (2?)D e iy?(p++k+) × [ k+ p+ + 2 + 2 p+ k+ (?k2)1+u((p + k)2 ?m2) ? (2m2 + k2)(1 + k+p+ ) (?k2)1+u((p + k)2 ?m2)2 ] , where the k + p+ part in the first term and the entire second term originate in the Feynman gauge part... ? integral, a factor of ?k + p+ in the numerator becomes (1?x) while the inverse factor becomes 1/(1?x). We therefore have to deal with just one type of integral: I(m2, x; a, b,D) ? p+ ? ? ?? dy? 2? e ?ixp+y? ? dDk (2?)D e iy?(p++k+) 1 (?k2)a((p + k)2 ?m2)b...

  13. Study of strange particle production in pp collisions with the ALICE detector

    E-Print Network [OSTI]

    H. Ricaud; A. Kalweit; A. Maire

    2010-03-24

    ALICE is well suited for strange particles production studies since it has very good reconstruction capabilities in the low transverse momentum ($p_{t}$) region and it also allows to extend the identification up to quite high $p_{t}$. Charged strange mesons ($\\kp$, $\\km$,) are reconstructed via energy loss measurements whereas neutral strange mesons ($\\ks$) and strange hyperons ($\\lam$, $\\Xi$, $\\Omega$) are identified via vertex reconstruction. All these particles carry important information: first, the measurement of production yields and the particle ratio within the statistical models can help to understand the medium created and secondly the dynamics at intermediate $p_{t}$ investigated via the baryon over meson ratio ($\\lam / \\ks$) allows a better understanding of the hadronization mechanisms and of the underlying event processes. We present these two aspects of the strange particles analysis in pp collisions using simulated data.

  14. The multicomponent 2D Toda hierarchy: Discrete flows and string equations

    E-Print Network [OSTI]

    Manuel Manas; Luis Martinez Alonso; Carlos Alvarez Fernandez

    2009-01-21

    The multicomponent 2D Toda hierarchy is analyzed through a factorization problem associated to an infinite-dimensional group. A new set of discrete flows is considered and the corresponding Lax and Zakharov--Shabat equations are characterized. Reductions of block Toeplitz and Hankel bi-infinite matrix types are proposed and studied. Orlov--Schulman operators, string equations and additional symmetries (discrete and continuous) are considered. The continuous-discrete Lax equations are shown to be equivalent to a factorization problem as well as to a set of string equations. A congruence method to derive site independent equations is presented and used to derive equations in the discrete multicomponent KP sector (and also for its modification) of the theory as well as dispersive Whitham equations.

  15. Energy dependence of $\\bar{K}N$ interaction in nuclear medium

    E-Print Network [OSTI]

    A. Cieply

    2011-12-05

    When the $\\bar{K}N$ system is submerged in nuclear medium the $\\bar{K}N$ scattering amplitude and the final state branching ratios exhibit a strong energy dependence when going to energies below the $\\bar{K}N$ threshold. A sharp increase of $\\bar{K}N$ attraction below the $\\bar{K}N$ threshold provides a link between shallow $\\bar{K}$-nuclear potentials based on the chiral $\\bar{K}N$ amplitude evaluated at threshold and the deep phenomenological optical potentials obtained in fits to kaonic atoms data. We show the energy dependence of the in-medium $K^{-}p$ amplitude and demonstrate the impact of energy dependent branching ratios on the $\\Lambda$-hypernuclear production rates. \\keywords{kaon-nucleon amplitude \\and nuclear medium \\and hypernuclei

  16. Anomalous Soft Photons in Hadron Production

    E-Print Network [OSTI]

    Cheuk-Yin Wong

    2010-05-17

    Anomalous soft photons in excess of what is expected from electromagnetic bremsstrahlung have been observed in association with the production of hadrons, mostly mesons, in high-energy (K+)p, (pi+)p, (pi-)p, pp, and (e+)(e-) collisions. We propose a model for the simultaneous production of anomalous soft photons and mesons in quantum field theory, in which the meson production arises from the oscillation of color charge densities of the quarks of the underlying vacuum in the flux tube. As a quark carries both a color charge and an electric charge, the oscillation of the color charge densities will be accompanied by the oscillation of electric charge densities, which will in turn lead to the simultaneous production of soft photons during the meson production process. How the production of these soft photons may explain the anomalous soft photon data will be discussed. Further experimental measurements to test the model will be proposed.

  17. Measurement of the inclusive semielectronic D(0) branching fraction

    E-Print Network [OSTI]

    Baringer, Philip S.

    1996-09-01

    is statisti p(p) ~MeV/c) N(D*1!D0p1, D0!K2p1) e(Kp) ~%! N 225–250 1129644 64.6 250–275 945640 64.3 275–300 741634 64.4 300–325 528630 65.1 325–350 393625 66.0 350–375 262619 66.4 375–400 153615 68.8 400–425 5769 63.1 Total 4208683 3000 Y. KUBO65.55 B ~ D0!K2e1...Farlane, P. M. Patel, and B. Spaan McGill University and the Institute of Particle Physics, Montre´al, Que´bec H3A 2T8, Canada A. J. Sadoff Ithaca College, Ithaca, New York 14850 R. Ammar, P. Baringer, A. Bean, D. Besson, D. Coppage, N. Copty, R. Davis, N...

  18. On the solutions to the string equation

    E-Print Network [OSTI]

    A. Schwarz

    1991-09-10

    The set of solutions to the string equation $[P,Q]=1$ where $P$ and $Q$ are differential operators is described.It is shown that there exists one-to-one correspondence between this set and the set of pairs of commuting differential operators.This fact permits us to describe the set of solutions to the string equation in terms of moduli spa- ces of algebraic curves,however the direct description is much simpler. Some results are obtained for the superanalog to the string equation where $P$ and $Q$ are considered as superdifferential operators. It is proved that this equation is invariant with respect to Manin-Radul, Mulase-Rabin and Kac-van de Leur KP-hierarchies.

  19. Training Hybrid Neuro-Fuzzy System to Infer Permeability in Wells on Maracaibo Lake, Venezuela

    E-Print Network [OSTI]

    Hurtado, Nuri; Torres, Julio

    2014-01-01

    The high accuracy on inferrring of rocks properties, such as permeability ($k$), is a very useful study in the analysis of wells. This has led to development and use of empirical equations like Tixier, Timur, among others. In order to improve the inference of permeability we used a hybrid Neuro-Fuzzy System (NFS). The NFS allowed us to infer permeability of well, from data of porosity ($\\phi$) and water saturation ($Sw$). The work was performed with data from wells VCL-1021 (P21) and VCL-950 (P50), Block III, Maracaibo Lake, Venezuela. We evaluated the NFS equations ($k_{P50,i}(\\phi_i,Sw_i)$) with neighboring well data ($P21$), in order to verify the validity of the equations in the area. We have used ANFIS in MatLab.

  20. Method of forming a ceramic to ceramic joint

    DOE Patents [OSTI]

    Cutler, Raymond Ashton; Hutchings, Kent Neal; Kleinlein, Brian Paul; Carolan, Michael Francis

    2010-04-13

    A method of joining at least two sintered bodies to form a composite structure, includes: providing a joint material between joining surfaces of first and second sintered bodies; applying pressure from 1 kP to less than 5 MPa to provide an assembly; heating the assembly to a conforming temperature sufficient to allow the joint material to conform to the joining surfaces; and further heating the assembly to a joining temperature below a minimum sintering temperature of the first and second sintered bodies. The joint material includes organic component(s) and ceramic particles. The ceramic particles constitute 40-75 vol. % of the joint material, and include at least one element of the first and/or second sintered bodies. Composite structures produced by the method are also disclosed.

  1. On the synthesis of fixed order stabilizing controllers 

    E-Print Network [OSTI]

    Kang, Sin Cheon

    2007-04-25

    ) is the transfer function relating the control input, u1(t) to the output, y(t) and the transfer function G2(s) relates how the disturbance u2(t) affects the output y(t). We assume G1(s),G2(s) to be proper rational transfer functions. If a controller, -C... > 0 2. For condition 2: NGT (s) = Dcl(s) + (1 + etas)betaNcl(s)) = s5 + 4s4 + 108s3 + (208 + 2kd)s2 + (2kp + 200)s + 2ki The real and imaginary parts of the NGT at jw are given by NGT (jw,K) = NGT,e(w,K) + jwNGT,o(w,K) NGT,e(w,K) = 4w4 -(208 + 2kd)w2...

  2. Probing the Room Temperature Spatial Distribution of Hydrogen in Nanoporous Carbon by Use of Small-Angle Neutron Scattering

    SciTech Connect (OSTI)

    Tsao, Cheng-Si [Massachusetts Institute of Technology (MIT); Li, Mingda [ORNL; Zhang, Yang [ORNL; Leao, Juscelino B [ORNL; Chiang, Wei-Shan [ORNL; Chung, Tsui-Yun [Institute of Nuclear Energy Research, Taiwan; Tzeng, Yi-Ren [Institute of Nuclear Energy Research, Taiwan; Chen, Sow-hsin H [ORNL

    2010-01-01

    The spatial distribution of hydrogen physically adsorbed in a nanoporous carbon at room temperature (RT) as a function of H2 gas pressure is investigated for the first time using small-angle neutron scattering (SANS). A hierarchical pore structure consisting of micropores and a fractal mesopore network of the used activated carbon is also studied to correlate the relationship between the spatial distribution of hydrogen and the pore confinement. The cylinder-like cluster of aggregated hydrogen is formed and is confined in the disklike micropore. The evolution of spatial structures of adsorbed hydrogen with hydrogen pressure is elucidated. A direct experimental observation of the spatial distribution and the behavior of hydrogen adsorbed in the porous materials at RT is still scarce to date. The analysis results obtained by SANS provide new information for the future investigations of the RT storage mechanism of hydrogen in the nanoporous materials developed for the purpose of on-board hydrogen storage.

  3. Electron Scattering in InSb Quantum Wells due to Micro-twin Defects

    SciTech Connect (OSTI)

    Mishima, T. D.; Santos, M. B. [Homer L. Dodge Department of Physics and Astronomy, and Center for Semiconductor Physics in Nanostructure University of Oklahoma, 440 W. Brooks St., Norman, OK 73019 (United States)

    2011-12-26

    The transport electron scattering due to micro-twin (MT) defects in InSb quantum wells (QWs) has been investigated at room temperature (RT). A linear-regression-based scattering analysis showed that Matthiessen's rule is applicable to the RT electron mobility in 20-nm-thick InSb QWs that contain MTs (whose density is 5.6x10{sup 2}-1.2x10{sup 4} /cm) and threading dislocations (8.7x10{sup 8}-3.2x10{sup 9} /cm{sup 2}) as dominant structural defects. For such an InSb QW whose local electron mobility in its non-MT regions is 2.8x10{sup 4}-4.5x10{sup 4} cm{sup 2}/(Vs), the MT-originated energy barrier against the electron transport is deduced to be 0.081-0.093 eV at RT.

  4. Final Report - ILAW PCT, VHT, Viscosity, and Electrical Conductivity Model Development, VSL-07R1230-1

    SciTech Connect (OSTI)

    Kruger, Albert A.; Cooley, S. K.; Joseph, I.; Pegg, I. L.; Piepel, G. F.; Gan, H.; Muller, I.

    2013-12-17

    This report describes the results of work and testing specified by the Test Specifications (24590-LAW-TSP-RT-01-013 Rev.1 and 24590-WTP-TSP-RT-02-001 Rev.0), Test Plans (VSL-02T4800-1 Rev.1 & TP-RPP-WTP-179 Rev.1), and Text Exception (24590-WTP-TEF-RT-03-040). The work and any associated testing followed established quality assurance requirements and conducted as authorized. The descriptions provided in this test report are an accurate account of both the conduct of the work and the data collected. Results required by the Test Plans are reported. Also reported are any unusual or anomalous occurrences that are different from the starting hypotheses. The test results and this report have been reviewed and verified.

  5. Effects of laser energy fluence on the onset and growth of the Rayleigh-Taylor instabilities and its influence on the topography of the Fe thin film grown in pulsed laser deposition facility

    SciTech Connect (OSTI)

    Mahmood, S. [National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616 (Singapore); Department of Physics, University of Karachi, Karachi 75270 (Pakistan); Rawat, R. S.; Wang, Y.; Lee, S.; Tan, T. L.; Springham, S. V.; Lee, P. [National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616 (Singapore); Zakaullah, M. [Department of Physics, Quaid-i-Azam University, 45320 Islamabad (Pakistan)

    2012-10-15

    The effect of laser energy fluence on the onset and growth of Rayleigh-Taylor (RT) instabilities in laser induced Fe plasma is investigated using time-resolved fast gated imaging. The snow plow and shock wave models are fitted to the experimental results and used to estimate the ablation parameters and the density of gas atoms that interact with the ablated species. It is observed that RT instability develops during the interface deceleration stage and grows for a considerable time for higher laser energy fluence. The effects of RT instabilities formation on the surface topography of the Fe thin films grown in pulsed laser deposition system are investigated (i) using different laser energy fluences for the same wavelength of laser radiation and (ii) using different laser wavelengths keeping the energy fluence fixed. It is concluded that the deposition achieved under turbulent condition leads to less smooth deposition surfaces with bigger sized particle agglomerates or network.

  6. Study of Rayleigh–Taylor growth in laser irradiated planar SiO{sub 2} targets at ignition-relevant conditions

    SciTech Connect (OSTI)

    Hager, J. D.; Collins, T. J. B.; Knauer, J. P.; Meyerhofer, D. D.; Sangster, T. C. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States)] [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Smalyuk, V. A. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)] [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States)

    2013-07-15

    Rayleigh–Taylor (RT) growth experiments were performed on the OMEGA laser [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)] using planar SiO{sub 2} targets seeded with a single mode 60-?m wavelength perturbation driven at peak laser intensities up to 9 × 10{sup 14} W/cm{sup 2}. These are the first RT measurements in SiO{sub 2} at conditions relevant to direct-drive inertial confinement fusion ignition. The measured average modulation growth rates agree with the 2-D hydrodynamics code DRACO, providing an important step in the development of target ablators that are robust to RT growth and hot- electron preheat considerations when driven at the intensities required to achieve thermonuclear ignition.

  7. Synthesis of Fluorosugar Reagents for the Construction of Well-Defined Fluoroglycoproteins

    E-Print Network [OSTI]

    Salvadó, Míriam; Amgarten, Beatrice; Castillón, Sergio; Bernardes, Gonçalo J. L.; Boutureira, Omar

    2015-05-22

    Na2CO3 aq (0.04 M), rt, from 1 h up to 7 days unless otherwise indicated. b Determined by 19 F NMR of the crude reaction mixture. c 2-F- ?-galactosyl bromide 2b (1 equiv), Nu (2 equiv), TBAB (2 equiv) in 3:2 CH2Cl2–5% NaOH aq (0.02 M), rt, 14... –22 h. d 2-F- ?-galactosyl bromide 2b (2 equiv), estrone (1 equiv), 60% NaH in mineral oil (1.5 equiv) in dry 1,4-dioxane (0.08 M), rt, 24 h. Nu = nucleophile. TBAHS = tetrabutylammonium hydrogen sulfate. TBAB = tetrabutylammonium bromide. Next...

  8. Conjugacy of daytime ELF-VLF emission activities in the auroral zones

    SciTech Connect (OSTI)

    Sato, Natsuo (National Institute of Polar Research, Tokyo (Japan)); Suzuki, Hiroyuki; Maezawa, Kiyoshi (Yamagata Univ. (Japan)); Saemundsson, T. (Univ. of Iceland, Reykjavik (Iceland))

    1990-06-01

    Statistical characteristics of emission occurrence are examined, using 1 year of digital data of 750-Hz, 2-kHz, and 4-kHz intensity records. These waves were measured simultaneously at a conjugate pair of stations, namely Syowa Station in Antarctica and Husafell in Iceland. The following notable diurnal and seasonal variation and Kp dependence was found for the daytime emissions (04-14 MLT): (1) The 750-Hz emissions were mostly observed during the daytime around noon in both conjugate regions. The emission occurrence reached a maximum 1-3 hours earlier at Syowa than at Husafell during the equinox season. The seasonal variation of 750-Hz emission occurrence showed a maximum during local summer and a minimum during local winter at both stations. The ratio of the emission enhancement in summer to that at the equinox is higher at Husafell than at Syowa. The emissions mostly occurred during moderately disturbed conditions of Kp {approximately} 2-4 at both stations. (2) The 2-kHz emission occurrence reached a maximum around 13 MLT at Syowa and around 11 MLT at Husafell. Peaks of the emission occurrence during summer shifted to the afternoonside at Syowa and to the morningside at Husafell. The occurrences at Syowa reached a maximum during local summer and a minimum during winter. (3) The occurrence of 4-kHz emissions was much more frequent at Husafell than at Syowa. The emissions at Husafell occurred mostly in the morning ({approximately}08 MLT) and in local winter, and the occurrences became more frequent with increasing magnetic activity. On the bases of these statistical characteristics, the authors discuss the effects of sunlight and geomagnetic activity which cause an asymmetry of wave propagation from the magnetosphere to the ionosphere in the two hemispheres.

  9. Prospective Study Evaluating Postoperative Radiotherapy Plus 2-Year Androgen Suppression for Post-Radical Prostatectomy Patients With Pathologic T3 Disease and/or Positive Surgical Margins

    SciTech Connect (OSTI)

    Choo, Richard [Department of Radiation Oncology, Mayo Clinic, Rochester, MN (United States)], E-mail: choo.c@mayo.edu; Danjoux, Cyril; Gardner, Sandra; Morton, Gerard; Szumacher, Ewa; Loblaw, D. Andrew; Cheung, Patrick [Department of Radiation Oncology, Odette Cancer Centre, University of Toronto, Toronto, ON (Canada); Pearse, Maria [Department of Radiation Oncology, Auckland Hospital, Auckland (New Zealand)

    2009-10-01

    Purpose: To determine the efficacy of a combined approach of postoperative radiotherapy (RT) plus 2-year androgen suppression (AS) for patients with pathologic T3 disease (pT3) and/or positive surgical margins (PSM) after radical prostatectomy (RP). Methods and Materials: A total of 78 patients with pT3 and/or PSM after RP were treated with RT plus 2-year AS, as per a pilot, prospective study. Androgen suppression started within 1 month after the completion of RT and consisted of nilutamide for 4 weeks and buserelin acetate depot subcutaneously every 2 months for 2 years. Relapse-free rate, including freedom from prostate-specific antigen (PSA) relapse, was estimated using the Kaplan-Meier method. A Cox regression analysis was performed to evaluate prognostic factors for relapse. Prostate-specific antigen relapse was defined as a PSA rise above 0.2 ng/mL, with two consecutive increases over a minimum of 3 months. Results: The median age was 61 years at the time of RP. The median interval between RP and postoperative RT was 4.2 months. Forty-nine patients had undetectable PSA (<0.2 ng/mL), and 29 had persistently detectable postoperative PSA at the time of the protocol treatment. Median follow-up from RT was 6.4 years. Relapse-free rates at 5 and 7 years were 94.4% and 86.3%, respectively. Survival rates were 96% at 5 years and 93.1% at 7 years. On Cox regression analysis, persistently detectable postoperative PSA and pT3b-T4 were significant predictors for relapse. Conclusion: The combined treatment of postoperative RT plus 2-year AS yielded encouraging results for patients with pT3 and/or PSM and warrants a confirmatory study.

  10. Consideration of Dose Limits for Organs at Risk of Thoracic Radiotherapy: Atlas for Lung, Proximal Bronchial Tree, Esophagus, Spinal Cord, Ribs, and Brachial Plexus

    SciTech Connect (OSTI)

    Kong, Feng-Ming; Ritter, Timothy; Quint, Douglas J.; Senan, Suresh; Gaspar, Laurie E.; Komaki, Ritsuko U.; Hurkmans, Coen W.; Timmerman, Robert; Bezjak, Andrea; Bradley, Jeffrey D.; Movsas, Benjamin; Marsh, Lon; Okunieff, Paul; Choy, Hak; Curran, Walter J.

    2011-12-01

    Purpose: To review the dose limits and standardize the three-dimenional (3D) radiographic definition for the organs at risk (OARs) for thoracic radiotherapy (RT), including the lung, proximal bronchial tree, esophagus, spinal cord, ribs, and brachial plexus. Methods and Materials: The present study was performed by representatives from the Radiation Therapy Oncology Group, European Organization for Research and Treatment of Cancer, and Soutwestern Oncology Group lung cancer committees. The dosimetric constraints of major multicenter trials of 3D-conformal RT and stereotactic body RT were reviewed and the challenges of 3D delineation of these OARs described. Using knowledge of the human anatomy and 3D radiographic correlation, draft atlases were generated by a radiation oncologist, medical physicist, dosimetrist, and radiologist from the United States and reviewed by a radiation oncologist and medical physicist from Europe. The atlases were then critically reviewed, discussed, and edited by another 10 radiation oncologists. Results: Three-dimensional descriptions of the lung, proximal bronchial tree, esophagus, spinal cord, ribs, and brachial plexus are presented. Two computed tomography atlases were developed: one for the middle and lower thoracic OARs (except for the heart) and one focusing on the brachial plexus for a patient positioned supine with their arms up for thoracic RT. The dosimetric limits of the key OARs are discussed. Conclusions: We believe these atlases will allow us to define OARs with less variation and generate dosimetric data in a more consistent manner. This could help us study the effect of radiation on these OARs and guide high-quality clinical trials and individualized practice in 3D-conformal RT and stereotactic body RT.

  11. SU-E-T-85: Comparison of Treatment Plans Calculated Using Ray Tracing and Monte Carlo Algorithms for Lung Cancer Patients Having Undergone Radiotherapy with Cyberknife

    SciTech Connect (OSTI)

    Pennington, A; Selvaraj, R; Kirkpatrick, S; Oliveira, S [21st Century Oncology, Deerfield Beach, FL (United States); Leventouri, T [Florida Atlantic University, Boca Raton, FL (United States)

    2014-06-01

    Purpose: The latest publications indicate that the Ray Tracing algorithm significantly overestimates the dose delivered as compared to the Monte Carlo (MC) algorithm. The purpose of this study is to quantify this overestimation and to identify significant correlations between the RT and MC calculated dose distributions. Methods: Preliminary results are based on 50 preexisting RT algorithm dose optimization and calculation treatment plans prepared on the Multiplan treatment planning system (Accuray Inc., Sunnyvale, CA). The analysis will be expanded to include 100 plans. These plans are recalculated using the MC algorithm, with high resolution and 1% uncertainty. The geometry and number of beams for a given plan, as well as the number of monitor units, is constant for the calculations for both algorithms and normalized differences are compared. Results: MC calculated doses were significantly smaller than RT doses. The D95 of the PTV was 27% lower for the MC calculation. The GTV and PTV mean coverage were 13 and 39% less for MC calculation. The first parameter of conformality, as defined as the ratio of the Prescription Isodose Volume to the PTV Volume was on average 1.18 for RT and 0.62 for MC. Maximum doses delivered to OARs was reduced in the MC plans. The doses for 1000 and 1500 cc of total lung minus PTV, respectively were reduced by 39% and 53% for the MC plans. The correlation of the ratio of air in PTV to the PTV with the difference in PTV coverage had a coefficient of ?0.54. Conclusion: The preliminary results confirm that the RT algorithm significantly overestimates the dosages delivered confirming previous analyses. Finally, subdividing the data into different size regimes increased the correlation for the smaller size PTVs indicating the MC algorithm improvement verses the RT algorithm is dependent upon the size of the PTV.

  12. Decision Regret in Men Undergoing Dose-Escalated Radiation Therapy for Prostate Cancer

    SciTech Connect (OSTI)

    Steer, Anna N.; Aherne, Noel J.; Gorzynska, Karen; Hoffman, Matthew; Last, Andrew; Hill, Jacques; Shakespeare, Thomas P.; Rural Clinical School Faculty of Medicine, University of New South Wales, Coffs Harbour

    2013-07-15

    Purpose: Decision regret (DR) is a negative emotion associated with medical treatment decisions, and it is an important patient-centered outcome after therapy for localized prostate cancer. DR has been found to occur in up to 53% of patients treated for localized prostate cancer, and it may vary depending on treatment modality. DR after modern dose-escalated radiation therapy (DE-RT) has not been investigated previously, to our knowledge. Our primary aim was to evaluate DR in a cohort of patients treated with DE-RT. Methods and Materials: We surveyed 257 consecutive patients with localized prostate cancer who had previously received DE-RT, by means of a validated questionnaire. Results: There were 220 responses (85.6% response rate). Image-guided intensity modulated radiation therapy was given in 85.0% of patients and 3-dimensional conformal radiation therapy in 15.0%. Doses received included 73.8 Gy (34.5% patients), 74 Gy (53.6%), and 76 Gy (10.9%). Neoadjuvant androgen deprivation (AD) was given in 51.8% of patients and both neoadjuvant and adjuvant AD in 34.5%. The median follow-up time was 23 months (range, 12-67 months). In all, 3.8% of patients expressed DR for their choice of treatment. When asked whether they would choose DE-RT or AD again, only 0.5% probably or definitely would not choose DE-RT again, compared with 8.4% for AD (P<.01). Conclusion: Few patients treated with modern DE-RT express DR, with regret appearing to be lower than in previously published reports of patients treated with radical prostatectomy or older radiation therapy techniques. Patients experienced more regret with the AD component of treatment than with the radiation therapy component, with implications for informed consent. Further research should investigate regret associated with individual components of modern therapy, including AD, radiation therapy and surgery.

  13. Intensity Modulated Radiation Therapy With Dose Painting to Treat Rhabdomyosarcoma

    SciTech Connect (OSTI)

    Yang, Joanna C.; Dharmarajan, Kavita V.; Wexler, Leonard H.; La Quaglia, Michael P.; Happersett, Laura; Wolden, Suzanne L.

    2012-11-01

    Purpose: To examine local control and patterns of failure in rhabdomyosarcoma patients treated with intensity modulated radiation therapy (RT) with dose painting (DP-IMRT). Patients and Methods: A total of 41 patients underwent DP-IMRT with chemotherapy for definitive treatment. Nineteen also underwent surgery with or without intraoperative RT. Fifty-six percent had alveolar histologic features. The median interval from beginning chemotherapy to RT was 17 weeks (range, 4-25). Very young children who underwent second-look procedures with or without intraoperative RT received reduced doses of 24-36 Gy in 1.4-1.8-Gy fractions. Young adults received 50.4 Gy to the primary tumor and lower doses of 36 Gy in 1.8-Gy fractions to at-risk lymph node chains. Results: With 22 months of median follow-up, the actuarial local control rate was 90%. Patients aged {<=}7 years who received reduced overall and fractional doses had 100% local control, and young adults had 79% (P=.07) local control. Three local failures were identified in young adults whose primary target volumes had received 50.4 Gy in 1.8-Gy fractions. Conclusions: DP-IMRT with lower fractional and cumulative doses is feasible for very young children after second-look procedures with or without intraoperative RT. DP-IMRT is also feasible in adolescents and young adults with aggressive disease who would benefit from prophylactic RT to high-risk lymph node chains, although dose escalation might be warranted for improved local control. With limited follow-up, it appears that DP-IMRT produces local control rates comparable to those of sequential IMRT in patients with rhabdomyosarcoma.

  14. Outcomes of Patients With Revised Stage I Clear Cell Sarcoma of Kidney Treated in National Wilms Tumor Studies 1-5

    SciTech Connect (OSTI)

    Kalapurakal, John A., E-mail: j-kalapurakal@northwestern.edu [Northwestern University, Chicago, Illinois (United States); Perlman, Elizabeth J. [Northwestern University, Chicago, Illinois (United States)] [Northwestern University, Chicago, Illinois (United States); Seibel, Nita L. [Cancer Therapy and Evaluation Program, Bethesda, Maryland (United States)] [Cancer Therapy and Evaluation Program, Bethesda, Maryland (United States); Ritchey, Michael [Phoenix Children's Hospital, Phoenix, Arizona (United States)] [Phoenix Children's Hospital, Phoenix, Arizona (United States); Dome, Jeffrey S. [Children's National Medical Center, Washington, District of Columbia (United States)] [Children's National Medical Center, Washington, District of Columbia (United States); Grundy, Paul E. [University of Alberta, Edmonton, AB (Canada)] [University of Alberta, Edmonton, AB (Canada)

    2013-02-01

    Purpose: To report the clinical outcomes of children with revised stage I clear cell sarcoma of the kidney (CCSK) using the National Wilms Tumor Study Group (NWTS)-5 staging criteria after multimodality treatment on NWTS 1-5 protocols. Methods and Materials: All CCSK patients enrolled in the National Wilms Tumor Study Group protocols had their pathology slides reviewed, and only those determined to have revised stage I tumors according to the NWTS-5 staging criteria were included in the present analysis. All patients were treated with multimodality therapy according to the NWTS 1-5 protocols. Results: A total of 53 children were identified as having stage I CCSK. All patients underwent primary surgery with radical nephrectomy. The chemotherapy regimens used were as follows: regimen A, C, F, or EE in 4 children (8%); regimen DD or DD4A in 33 children (62%); regimen J in 4 children (8%); and regimen I in 12 children (22%). Forty-six patients (87%) received flank radiation therapy (RT). Seven children (13%) did not receive flank RT. The median delay between surgery and the initiation of RT was 9 days (range, 3-61). The median RT dose was 10.8 Gy (range, 10-36). The flank RT doses were as follows: 10.5 or 10.8 Gy in 25 patients (47%), 11-19.9 Gy in 2 patients (4%), 20-29.9 Gy in 9 patients (17%), and 30-40 Gy in 10 patients (19%). The median follow-up for the entire group was 17 years (range, 2-36). The relapse-free and cancer-specific survival rate was 100% at the last follow-up examination. Conclusions: The present results have demonstrated that children with revised stage I CCSK using the NWTS-5 staging criteria have excellent survival rates despite the use of varying RT doses and chemotherapy regimens in the NWTS 1-5 protocols.

  15. Molecular analysis of endothelial progenitor cell (EPC) subtypes reveals two distinct cell populations with different identities

    E-Print Network [OSTI]

    Medina, Reinhold J.; O'Neill, Christina L.; Sweeney, Mark; Guduric-Fuchs, Jasenka; Gardiner, Tom A.; Simpson, David A.; Stitt, Alan W.

    2010-05-13

    products were resolved by 2% agarose gel electrophoresis. Real time RT-PCR Quantitative real time RT-PCR reactions were performed in a 10 ?l volume containing 2 ?l of 1:15 diluted cDNA template, 0.5 ?M of sense and anti-sense primers (Invit- rogen), and 5... stepwise fashion (Step 1: 500 volts, 1 mA, 5 watts(W) and 5 volt hours (Vhrs); step 2: 3500 volts, 1 mA, 5 W and 5200 Vhrs; and step 3: 3000 volts, 1 mA, 5 W and 3500 Vhrs). After IEF, reduction and alkylation of thiol groups was performed by immersing...

  16. Instabilities and Mixing in SN 1993J

    E-Print Network [OSTI]

    K. Iwamoto; T. R. Young; N. Nakasato; T. Shigeyama; K. Nomoto; I. Hachisu; H. Saio

    1997-01-15

    Rayleigh-Taylor (R-T) instabilities in the explosion of SN 1993J are investigated by means of two-dimensional hydrodynamical simulations. It is found that the extent of mixing is sensitive to the progenitor's core mass and the envelope mass. Because the helium core mass (3 - 4 \\ms) is smaller than that of SN 1987A, R-T instabilities at the He/C+O interfaces develop to induce a large scale mixing in the helium core, while the instability is relatively weak at the H/He interface due to the small envelope mass. The predicted abundance distribution, in particular the amount of the \

  17. Enhanced Radiation Tolerance of Ceramic Thin Films by Nano-structural Design 

    E-Print Network [OSTI]

    Jiao, Liang

    2015-04-28

    -dep ZrN film, (f) RT-dep/rad ZrN film, (g) 500-dep ZrN film, (h) 500-dep/rad ZrN film. ................................................................ 88 Figure 16 (a1) Bright field TEM image of RT-dep/rad ZrN with arrows indicating moiré fringes..., (d) Dark-field image of the MgO multilayer after irradiation, (e) MgO grain size in the thin layer before irradiation, (f) MgO grain size in the thin layer after irradiation, (g) MgO grain size in the thick layer before irradiation, (h) MgO grain...

  18. Phase I Three-Dimensional Conformal Radiation Dose Escalation Study in Newly Diagnosed Glioblastoma: Radiation Therapy Oncology Group Trial 98-03

    SciTech Connect (OSTI)

    Tsien, Christina Moughan, Jennifer; Michalski, Jeff M.; Gilbert, Mark R.; Purdy, James; Simpson, Joseph; Kresel, John J.; Curran, Walter J.; Diaz, Aidnag; Mehta, Minesh P.

    2009-03-01

    Purpose: To evaluate in a Phase I trial the feasibility and toxicity of dose-escalated three-dimensional conformal radiotherapy (3D-CRT) concurrent with chemotherapy in patients with primary supratentorial glioblastoma (GBM). Methods and Materials: A total of 209 patients were enrolled. All received 46 Gy in 2-Gy fractions to the first planning target volume (PTV{sub 1}), defined as the gross tumor volume (GTV) plus 1.8 cm. A subsequent boost was given to PTV{sub 2}, defined as GTV plus 0.3 cm. Patients were stratified into two groups (Group 1: PTV{sub 2} <75 cm{sup 3}; Group 2: PTV{sub 2} {>=}75 cm{sup 3}). Four RT dose levels were evaluated: 66, 72, 78, and 84 Gy. Carmustine 80 mg/m{sup 2} was given during RT, then every 8 weeks for 6 cycles. Pretreatment characteristics were well balanced. Results: Acute and late Grade 3/4 RT-related toxicities were no more frequent at higher RT dose or with larger tumors. There were no dose-limiting toxicities (acute Grade {>=}3 irreversible central nervous system toxicities) observed on any dose level in either group. On the basis of the absence of dose-limiting toxicities, dose was escalated to 84 Gy in both groups. Late RT necrosis was noted at 66 Gy (1 patient), 72 Gy (2 patients), 78 Gy (2 patients), and 84 Gy (3 patients) in Group 1. In Group 2, late RT necrosis was noted at 78 Gy (1 patient) and 84 Gy (2 patients). Median time to RT necrosis was 8.8 months (range, 5.1-12.5 months). Median survival in Group 1 was 11.6-19.3 months. Median survival in Group 2 was 8.2-13.9 months. Conclusions: Our study shows the feasibility of delivering higher than standard (60 Gy) RT dose with concurrent chemotherapy for primary GBM, with an acceptable risk of late central nervous system toxicity.

  19. Blockade of chemokine-induced signalling inhibits CCR5-dependent HIV infection in vitrowithout blocking gp120/CCR5 interaction

    E-Print Network [OSTI]

    Grainger, David J.; Lever, Andrew M. L.

    2005-04-04

    the Potts Mini RT assay as previously described [32]. THP-1 cells were differentiated prior to infection with hydrocortisone and PMA in 8-well chamber slides. Sixteen hours prior to infection, TNF? was added (100 ng/ml). Twelve hours later, the medium... of potent anti-HIV agents, are targeted at the HIV coreceptor fusin/CXCR-4. Antiviral Res 1997, 35:147-156. 32. Potts BJ: 'Mini' reverse transcriptase (RT) assay. In Techniques in HIV research Edited by: Aldovini A, Walker BD. New York: Stockton Press; 1990...

  20. Role of Salvage Radiation Therapy for Patients With Relapsed or Refractory Hodgkin Lymphoma Who Failed Autologous Stem Cell Transplant

    SciTech Connect (OSTI)

    Goda, Jayant S.; Massey, Christine; Kuruvilla, John; Gospodarowicz, Mary K.; Wells, Woodrow; Hodgson, David C.; Sun, Alexander; Keating, Armand; Crump, Michael; Tsang, Richard W.

    2012-11-01

    Purpose: To analyze, through chart review, the efficacy of salvage radiation therapy (sRT) for relapsed or progressive Hodgkin lymphoma (HL) patients who failed autologous stem cell transplant (ASCT). Patients and Methods: Among 347 patients with recurrent/refractory HL who received ASCT from 1986-2006, 163 had post-ASCT progression or relapse. Of these, 56 received sRT and form the basis of this report. Median age at sRT was 30 years (range, 17-59 years). Disease was confined to lymph nodes in 27 patients, whereas 24 had both nodal and extranodal disease. Salvage radiation therapy alone was given in 34 patients (61%), and sRT plus chemotherapy was given in 22 (39%). Median interval from ASCT to sRT was 0.8 years (range, 0.1-5.6 years). The median dose was 35 Gy (range, 8-40.3 Gy). The sRT technique was extended-field in 14 patients (25%) and involved-field in 42 (75%). Results: The median follow-up from sRT was 31.3 months (range, 0.2-205.5 months). Overall response rate was 84% (complete response: 36%; partial response: 48%). The median overall survival was 40.8 months (95% confidence interval, 34.2-56.3 months). The 5-year overall survival was 29% (95% confidence interval, 14%-44%). The 2-year progression-free survival (PFS) was 16%; the 2-year local PFS was 65%, whereas the 2-year systemic PFS was 17%. The 1-year PFS was higher in patients in whom all diseased sites were irradiated (49%) compared with those in whom only the symptomatic site was treated (22%, P=.07). Among 20 alive patients, 5 were disease free (at 6.4, 6.8, 7.4, 7.9, and 17.1 years). Conclusion: For patients with HL who fail ASCT, a selective use of RT provides a durable local control rate of 65% at 2 years and should be considered as part of the standard management plan for the palliation of incurable HL. Occasionally irradiation of truly localized disease can lead to long-term survival.