Powered by Deep Web Technologies
Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


United States-Republic of Korea (ROK) International Nuclear Energy...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

United States-Republic of Korea (ROK) International Nuclear Energy Research Initiative (INERI) Annual Steering Committee Meeting United States-Republic of Korea (ROK) International...


Sehun Jeong1, JunbeomYoo2, Sungdeok Cha1 1Korea University, Republic of Korea  

E-Print Network (OSTI)

, Republic of Korea VIS Analyzer: Visual Assistant forVISVerification and Analysis *Photo was taken at Real #12;KNICS Project · Development of software for nuclear power plant reactor protection system (2000 techniques when feasible to demonstrate high reliability · Domain experts should NOT be left alone


Joint Statement between U.S. Department of Energy and Republic of Korea's  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Joint Statement between U.S. Department of Energy and Republic of Joint Statement between U.S. Department of Energy and Republic of Korea's Ministry of Trade, Industry, and Energy Joint Statement between U.S. Department of Energy and Republic of Korea's Ministry of Trade, Industry, and Energy May 7, 2013 - 2:18pm Addthis NEWS MEDIA CONTACT (202) 586-4940 Acting Secretary of Energy Daniel B. Poneman and Mr. Yoon Sang-jick, Minister of Trade, Industry, and Energy (MOTIE) of the Republic of Korea, met on May 7, 2013, at the Department of Energy (DOE) headquarters in Washington, D.C., where they exchanged views on cooperation on a wide range of energy priorities. They noted the importance of clean energy technologies for energy security, economic competitiveness and sustainable growth while mitigating the effects of greenhouse gas emissions. Acting Secretary Poneman and


Joint Statement between U.S. Department of Energy and Republic of Korea's  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

between U.S. Department of Energy and Republic of between U.S. Department of Energy and Republic of Korea's Ministry of Trade, Industry, and Energy Joint Statement between U.S. Department of Energy and Republic of Korea's Ministry of Trade, Industry, and Energy May 7, 2013 - 2:18pm Addthis NEWS MEDIA CONTACT (202) 586-4940 Acting Secretary of Energy Daniel B. Poneman and Mr. Yoon Sang-jick, Minister of Trade, Industry, and Energy (MOTIE) of the Republic of Korea, met on May 7, 2013, at the Department of Energy (DOE) headquarters in Washington, D.C., where they exchanged views on cooperation on a wide range of energy priorities. They noted the importance of clean energy technologies for energy security, economic competitiveness and sustainable growth while mitigating the effects of greenhouse gas emissions. Acting Secretary Poneman and


SMART WATER GRID INTERNATIONAL CONFERENCE 2013 12-14 November 2013, Incheon, Republic of Korea  

E-Print Network (OSTI)

SMART WATER GRID INTERNATIONAL CONFERENCE 2013 12-14 November 2013, Incheon, Republic of Korea SMART WATER GRIDS AND NETWORK VULNERABILITY Pierre Y. Julien1 and Olga A. Martyusheva2 1 Professor, Colorado State University, Fort Collins, CO 80521-1372, USA Keywords: Energy Conservation; Smart Water Grid

Julien, Pierre Y.


Republic of Korea Reduction of Financing Barriers for Energy Savings Performance Contracts  

SciTech Connect

This paper discusses the findings developed for strengthening the role of performance contracting in improving energy efficiency in the Republic of Korea. The U.S. Environmental Protection Agency (EPA) sponsored development of this paper by the National Renewable Energy Laboratory (NREL), as a part of the Korean-U.S. Climate Technology Partnerships (CTP) program. The results and recommendations outlined in this paper together with other efforts are designed to assist other countries striving to improve their efficient use of energy.

Howard, D. L.



Analysis of the factors and the roles of HRD in organizational learning styles as identified by key informants at selected corporations in the Republic of Korea  

E-Print Network (OSTI)

organization. Organizational learning style, therefore, is an important research topic for the field of HRD (human resource development). This study had four primary purposes, which were germane to the corporations in the Republic of Korea: 1) to identify...

Jeong, Jinchul



Energy demand and supply, energy policies, and energy security in the Republic of Korea  

Science Journals Connector (OSTI)

The Republic of Korea (ROK) has enjoyed rapid economic growth and development over the last 30 years. Rapid increases in energy useespecially petroleum, natural gas, and electricity, and especially in the industrial and transport sectorshave fueled the ROK's economic growth, but with limited fossil fuel resources of its own, the result has been that the ROK is almost entirely dependent on energy imports. The article that follows summarizes the recent trends in the ROK energy sector, including trends in energy demand and supply, and trends in economic, demographic, and other activities that underlie trends in energy use. The ROK has been experiencing drastic changes in its energy system, mainly induced by industrial, supply security, and environmental concerns, and energy policies in the ROK have evolved over the years to address such challenges through measures such as privatization of energy-sector activities, emphases on enhancing energy security through development of energy efficiency, nuclear power, and renewable energy, and a related focus on reducing greenhouse gas emissions. The assembly of a model for evaluating energy futures in the ROK (ROK2010 LEAP) is described, and results of several policy-based scenarios focused on different levels of nuclear energy utilization are described, and their impacts on of energy supply and demand in the ROK through the year 2030 are explored, along with their implications for national energy security and long-term policy plans. Nuclear power continues to hold a crucial position in the ROK's energy policy, but aggressive expansion of nuclear power alone, even if possible given post-Fukushima global concerns, will not be sufficient to attain the ROK's green economy and greenhouse gas emissions reduction goals.

Hoseok Kim; Eui-soon Shin; Woo-jin Chung



Noise impact assessment by utilizing noise map and GIS: A case study in the city of Chungju, Republic of Korea  

Science Journals Connector (OSTI)

In this study, a scheme to develop a noise map and noise impact assessment method using GIS has been suggested. After developing a road-traffic noise map for the city of Chungju, Republic of Korea, noise impact assessment was performed through analyzing the map. A 3-dimensional terrain model was generated using digital maps and building models were prepared using the information from draft and digital maps. To develop a noise evaluation model, a noise-source map for each road was generated. The noise levels at 25 locations close to roads were measured and compared with the expected noise levels to verify the developed noise map. An excess noise map was generated by comparing the road-traffic noise map with a noise-standard map. Using the excess noise map, the areas exceeding environmental noise standards were effectively evaluated through a GIS space analysis. The 3-dimensional facade noise map was generated to calculate the number of people exposed to a certain noise level.

Joon Hee Ko; Seo Il Chang; Byung Chan Lee



Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the Republic of Korea  

E-Print Network (OSTI)

KEMCO, 2012c. Korea's Energy Standards and Labeling: MarketBaseline Unit Energy Consumption Adjustment Market Sharesof Conserved Energy Table for Freezers Market Share Lifetime

McNeil, Michael A.



ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.



Joint Statement by Energy Ministers of G8, The People's Republic of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Joint Statement by Energy Ministers of G8, The People's Republic Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea (June 2008) Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea (June 2008) Energy Ministers of the G8, The People's Republic of China, India and The Republic of Korea met in Aomori, Japan on 8 June 2008 in order to discuss the globally significant issues related to addressing energy security and climate change. Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea (June 2008) More Documents & Publications Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea (Energy Efficiency) IEA Response System for Oil Supply Emergencies 2012


South Korea-Economics of Climate Change and Low Carbon Growth Strategies in  

Open Energy Info (EERE)

South Korea-Economics of Climate Change and Low Carbon Growth Strategies in South Korea-Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Jump to: navigation, search Name South Korea-Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Agency/Company /Organization Asian Development Bank Partner Government of Republic of Korea Topics Background analysis, Low emission development planning Program Start 2009 Country South Korea Eastern Asia References Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia[1] Overview The Asian Development Bank (ADB) is planning a study entitled the Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia, covering the People's Republic of China (PRC), Japan, the Republic of Korea, and Mongolia. The Government of the Republic of Korea will cofinance


Source contributions to carbonaceous aerosol concentrations in Korea Jaein I. Jeong a  

E-Print Network (OSTI)

fossil fuels and 65% from biofuels) and 78% (42% from fossil fuels and 36% from biofuels) to the OC Science, Kangwon National University, Kangwondo, Republic of Korea d Department of Environmental Health, School of Public Health, Seoul National University, Seoul, Republic of Korea a r t i c l e i n f o

Park, Rokjin


South Korea Fossil-Fuel CO2 Emissions  

NLE Websites -- All DOE Office Websites (Extended Search)

Far East » South Korea Far East » South Korea South Korea Fossil-Fuel CO2 Emissions Graph graphic Graphics Data graphic Data Trends South Korea, or the Republic of Korea, is the world's tenth largest emitter of CO2 based on 2008 fossil-fuel consumption and cement production with 139 million metric tons of carbon. From 1946-1997 South Korea experienced phenomenal growth in fossil-fuel CO2 emissions with a growth rate that averaged 11.5%. Initial growth in emissions was due to coal consumption, which still accounts for 46.9% of South Korea's fossil-fuel CO2 emissions. Since the late 1960s oil consumption has been a major source of emissions. South Korea is the world's fifth largest importer of crude oil. Natural gas became a significant source of CO2 for the first time in 1987, as South


Korea's Thyroid-Cancer Epidemic Screening and Overdiagnosis  

Science Journals Connector (OSTI)

The Republic of Korea has provided national health insurance to its 50 million citizens since the 1980s. Although health care expenditures in South Korea's single-payer system are relatively low accounting for 7.6% of the country's gross domestic product the system is technologically intensive... In 2011, the rate of thyroid-cancer diagnoses in the Republic of Korea was 15 times that observed in 1993, yet thyroid-cancer mortality remains stable a combination that suggests that the problem is overdiagnosis attributable to widespread thyroid-cancer screening.

Ahn H.S.Kim H.J.Welch H.G.



North Korea Fossil-Fuel CO2 Emissions  

NLE Websites -- All DOE Office Websites (Extended Search)

Far East » North Korea Far East » North Korea North Korea Fossil-Fuel CO2 Emissions Graph graphic Graphics Data graphic Data Trends The total fossil-fuel CO2 emissions for North Korea, or the Democratic People's Republic of Korea, averaged 11.2% growth from 1950-93, reaching 71 million metric tons of carbon. Since 1993 according to published UN energy statistics, fossil-fuel CO2 emissions have declined 70% to 21.4 million metric tons of carbon. As the world's 14th largest producer of coal, it is no surprise North Korea's fossil-fuel CO2 emissions record is dominated by emissions from coal burning. Coal consumption accounted for 93% of the 2008 CO2 emission total. With no natural gas usage, another 3.4% currently comes from liquid petroleum consumption, and the remainder is from cement


Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +


Verification Checklist Home Address: City: State: Zip:  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network (OSTI)

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Korea Silicon Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Silicon Co Ltd Silicon Co Ltd Jump to: navigation, search Name Korea Silicon Co Ltd Place Seongnam, Gyeonggi-do, Korea (Republic) Sector Solar Product Korean manufacturer planning to output polysilicon, ingots and wafers for the solar industry. Coordinates 37.397652°, 127.115189° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.397652,"lon":127.115189,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Korea Solar Inc | Open Energy Information  

Open Energy Info (EERE)

Solar Inc Solar Inc Jump to: navigation, search Name Korea Solar Inc Place Seoul, Korea (Republic) Sector Solar Product Manufacturer of solar collectors, modules, and water heaters. Coordinates 37.557121°, 126.977379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.557121,"lon":126.977379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



E-Print Network (OSTI)

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick



Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +


Electrostatic zipping actuators and their applications to MEMS  

E-Print Network (OSTI)

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology




E-Print Network (OSTI)

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add


Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +


Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +


Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network (OSTI)

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin


Seismological Evidence for a Low-Yield Nuclear Test on 12 May 2010 in North Korea  

E-Print Network (OSTI)

E Seismological Evidence for a Low-Yield Nuclear Test on 12 May 2010 in North Korea by Miao Zhang. INTRODUCTION Three nuclear tests (in 2006, 2009, and 2013) conducted by the Democratic People's Republic.g., the U. S. Geological Survey [USGS] and the Comprehensive Nuclear-Test-Ban Treaty Organization [CTBTO

Wen, Lianxing


Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network (OSTI)

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL


Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network (OSTI)

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of


Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org


A study on the proposes of energy analysis indicator by the window elements of office buildings in Korea  

Science Journals Connector (OSTI)

Abstract Recently, the window area ratio of buildings has increased but the thermal insulation performance of windows is lower than the wall. Therefore, many studies have been carried out to reduce this heat loss. The Republic of Korea policies and guidelines for windows do not consider the optical and design elements of windows because it is more important to the insulation performance of windows. This paper proposes the supplement point of the Korea's policies and guidelines regarding windows through a comparison of Korea's policies and guidelines for windows, checks the variation of the energy consumption of buildings through the variation of the window elements, and proposes an energy analysis indicator for the Republic of Korea's situation. This study confirmed that the variation of the window elements affect to energy consumption by previous studies to consider in window design according to the policies and guidelines. The window elements were divided into performance elements of the windows and architectural/equipment plan element. By analyzing the energy consumption by changing the element, this study confirmed the variation of energy consumption by using the COMFEN4.0 simulation tool. This paper proposes an actual energy analysis indicator in the Republic of Korea.

Seok-Hyun Kim; Sun-Sook Kim; Kwang-Woo Kim; Young-Hum Cho



Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Avian survey and field guide for Osan Air Base, Korea.  

SciTech Connect

This report summarizes the results of the avian surveys conducted at Osan Air Base (AB). This ongoing survey is conducted to comply with requirements of the Environmental Governing Standards (EGS) for the Republic of Korea, the Integrated Natural Resources Management Plan (INRMP) for Osan AB, and the 51st Fighter Wing's Bird Aircraft Strike Hazard (BASH) Plan. One hundred ten bird species representing 35 families were identified and recorded. Seven species are designated as Natural Monuments, and their protection is accorded by the Korean Ministry of Culture and Tourism. Three species appear on the Korean Association for Conservation of Nature's (KACN's) list of Reserved Wild Species and are protected by the Korean Ministry of Environment. Combined, ten different species are Republic of Korea (ROK)-protected. The primary objective of the avian survey at Osan AB was to determine what species of birds are present on the airfield and their respective habitat requirements during the critical seasons of the year. This requirement is specified in Annex J.14.c of the 51st Fighter BASH Plan 91-212 (51 FW OPLAN 91-212). The second objective was to initiate surveys to determine what bird species are present on Osan AB throughout the year and from the survey results, determine if threatened, endangered, or other Korean-listed bird species are present on Osan AB. This overall census satisfies Criterion 13-3.e of the EGS for Korea. The final objective was to formulate management strategies within Osan AB's operational requirements to protect and enhance habitats of known threatened, endangered, and ROK-protected species in accordance with EGS Criterion 13-3.a that are also favorable for the reproduction of indigenous species in accordance with the EGS Criterion 13-3.h.

Levenson, J.



Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network (OSTI)

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.


Delivered by Publishing Technology to: Korea University IP: On: Tue, 24 Dec 2013 04:37:57  

E-Print Network (OSTI)

that silicide-Si heterostructures are formed by axially intruding contact metal and that the extent Vol. 13, 6222­6225, 2013 Fabrication and RF Characterization of a Single Nickel Silicide Nanowire, Suwon, Gyeonggi 440-746, Republic of Korea We fabricated a nickel silicide nanowire (NiSi NW) device

Hwang, Sung Woo


Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...



E-Print Network (OSTI)

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of


WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...


Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network (OSTI)

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade


Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions


Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network (OSTI)

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL



E-Print Network (OSTI)

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi


Korea Power Exchange (KPX) | Open Energy Information  

Open Energy Info (EERE)

Exchange (KPX) Exchange (KPX) Jump to: navigation, search Logo: Korea Power Exchange (KPX) Name Korea Power Exchange (KPX) Agency/Company /Organization Argonne National Laboratory Sector Energy Focus Area Energy Efficiency Topics Background analysis Website http://www.dis.anl.gov/news/Ko Country South Korea Eastern Asia References http://www.dis.anl.gov/news/KoreaKpxIit.html Abstract In an agreement signed on March 26, 2007, Argonne National Laboratory and the Illinois Institute of Technology are joining with the Korea Power Exchange to establish a joint training program combining training and research at Argonne with formal academic education at IIT. Argonne-IIT Joint Graduate Program in Electricity Markets: In an agreement signed on March 26, 2007, Argonne National Laboratory and the Illinois


E-Print Network 3.0 - arab republic niger Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary: Dominican Republic ---- TP East Timor -Iu- EC Ecuador (Republic of) bIU- EG Egypt (Arab Republic of) ---- SV... Liberia (Republic of) ---- LY Libyan Arab Jamahiriya...


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California


Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http


NRF Republic of South Africa  

E-Print Network (OSTI)

1 NRF Republic of South Africa GDRI Project Groupement de Recherche International International Africa called SACCLAP (Seasonal and Annual trends of Air quality at the South Africa scale and its impact Research Consortium Atmospheric Research in Southern Africa and Indian Ocean (ARSAIO) September 2008 #12

Dintrans, Boris


Introduction Faculty 291 Daehak-ro, Yuseong-gu, Daejeon, Republic of Korea  

E-Print Network (OSTI)

the hardware and software technologies. Moreover, as computing truly pervades everyday life, social computing- centric computing Hardware- centric computingEarly computing Modern computing is human-centric. Its focus

Kim, Yong Jung


Hydrogeologic and topographic factors influencing well yields in fractured crystalline rocks - Seoul, Republic of Korea  

E-Print Network (OSTI)

, the Mann ? Whitney II test or Kruskal ? Wallis One ? Way Analysis of Variance was applied according to the number of samples or categories which were tested. In each case the 10 percent level of significance was used to test the null hypothesis. Detailed... than five cases in the various groups, that is, n~ ) 5, H is distributed approximately as chi square (y ) with degree of freedom (df) = k ? 1. The following steps are used to perform the Kruskal ? Wallis test: 1. set an approximate null hypothesis Hs...

Kim, Sang-Il


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Crunch Time for North Korea's Revolutionary New University  

Science Journals Connector (OSTI)

...University of Science and Technology in South Korea. Splendid...Massachusetts Institute of Technology], says PUST computer...avid interest in information technology. North Korea has chosen IT as...Bright Light, a national Intranet not connected to the outside...

Richard Stone



United States and Czech Republic Join Together to Announce Bilateral...  

Office of Environmental Management (EM)

Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts United States and Czech Republic Join Together to Announce Bilateral Nuclear...


North Korea: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

North Korea: Energy Resources North Korea: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40,"lon":127,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


South Korea: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Korea: Energy Resources Korea: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37,"lon":127.5,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Science Journals Connector (OSTI)

...Communications SKARN GOLD MINERALIZATION AT THE GEODO MINE, SOUTH KOREA Eui-Jun Kim 1 Maeng-Eon Park 2 Noel C. White 3 Corresponding...Skarn gold mineralization at the Geodo Mine, South Korea Kim Eui-Jun Author Korea Institute of Geoscience and Mineral Resources...

Eui-Jun Kim; Maeng-Eon Park; Noel C. White


Korea's Green Growth Strategy: Mitigating Climate Change and Developing New  

Open Energy Info (EERE)

Korea's Green Growth Strategy: Mitigating Climate Change and Developing New Korea's Green Growth Strategy: Mitigating Climate Change and Developing New Growth Engines Jump to: navigation, search Name Korea's Green Growth Strategy: Mitigating Climate Change and Developing New Growth Engines Agency/Company /Organization Organisation for Economic Co-Operation and Development Topics Policies/deployment programs, Pathways analysis, Background analysis Resource Type Publications, Guide/manual Website http://www.oecd.org/officialdo Country South Korea UN Region Eastern Asia References Korea's Green Growth Strategy[1] Overview "Korea's greenhouse gas emissions almost doubled between 1990 and 2005, the highest growth rate in the OECD area. Korea recently set a target of reducing emissions by 30% by 2020 relative to a "business as usual"


E-Print Network 3.0 - area czech republic Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

15 List of participants Prague Czech Republic Summary: List of participants Austria Thailand Thailand Prague Czech Republic Austria Czech Republic Austria... Austria Warsaw...


2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network (OSTI)

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.


Study Abroad in South Korea Construction Management & Civil Engineering  

E-Print Network (OSTI)

Korea and North Korea. After having become more acclimated to culture the students separated from Institute for Defense Analysis, to speakers from the private sector working in oil refining plants, they went up to the ski slopes where 2018 Olympic ski events will be held. One of the main features

Hutcheon, James M.


North Korea: The next nuclear nightmare  

SciTech Connect

The crisis in the Persian Gulf has reawakened concerns over the spread of nuclear arms. Even before its invasion of Kuwait, Iraq's history of aggression and support for international terrorism triggered fears in Washington that its acquisition of nuclear weapons might damage international stability and US interests far more than the emergence of India, Israel, Pakistan, and South Africa as de facto nuclear powers. Thus, when the Gulf War began on January 16, Iraq's nuclear sites were among the first attacked by allied air strikes. Unfortunately, Iraq has not been the only hostile proliferator looming on the horizon. North Korea, which has been no less dedicated than Iraq to the use of violence to advance its expansionist goals, has also tenaciously pursued a nuclear-weapons capability. Moreover, the North Korean program is considerably closer to bearing fruit than the Iraqi effort. And although North Korea, like Iraq, has signed the Nuclear Nonproliferation Treaty, unlike Iraq it has refused to conclude the safeguards agreement with the International Atomic Energy Agency that the treaty requires.

Spector, L.S.; Smith, J.R.



Marine Turtles in the Republic of the Seychelles  

E-Print Network (OSTI)

Marine Turtles in the Republic of the Seychelles Status and Management Report on Project 1809 (1981 Wildlife Fund #12;Marine Turtles in the Republic of the Seychelles Status and Management Report on Project Resources World Wildlife Fund #12;Marine Turtles in the Republic_ of the Seychelles Status and Managemen

Prestwich, Ken


Dominican Republic: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Dominican Republic: Energy Resources Dominican Republic: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":19,"lon":-70.66667,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Czech Republic: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Czech Republic: Energy Resources Czech Republic: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.75,"lon":15,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Dominican Republic-Fast-Track Development of Transformative  

Open Energy Info (EERE)

Dominican Republic-Fast-Track Development of Transformative Dominican Republic-Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities Jump to: navigation, search Logo: Dominican Republic-Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities Name Dominican Republic-Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities Agency/Company /Organization Coalition for Rainforest Nations Focus Area Economic Development Topics Low emission development planning, Policies/deployment programs Resource Type Guide/manual, Presentation Website http://www.rainforestcoalition Country Dominican Republic UN Region Caribbean


Roles and effects of pyroprocessing for spent nuclear fuel management in South Korea  

Science Journals Connector (OSTI)

Abstract Republic of Korea (ROK) changed its spent nuclear fuel policy from the once-through usage and direct disposal to a total system approach that includes pyroprocessing, sodium-cooled fast reactors, and a two-tier geological repository to achieve a breakthrough for domestic deadlock situation and thus enable sustainable utilization of nuclear power, but caused disagreement in the bilateral negotiation with the United States (US) for the Nuclear Cooperation Agreement. Analysis has revealed that this shift is effective to make a breakthrough for domestic deadlock because it augments variety of technological options, with which more reversible decision-making process can be conducted to accommodate broad public needs. A trade-off has been explored first by deriving four engineering options from the ROK's system concept and then by comparing their performance from six viewpoints. The option including separation of high-heat emitting radionuclides by the electrolytic reduction process has been recommended. This option should be modified as exogenous and endogenous situations change in future. It is imperative for ROK to integrate a public-participatory decision-making process that works in concert with technology development. US can verify that ROK's motivation is not deviating from successful spent fuel management by checking if a transparent process with public participation is conducted.

Joonhong Ahn



South Korea-Green Growth Strategy Support | Open Energy Information  

Open Energy Info (EERE)

South Korea-Green Growth Strategy Support South Korea-Green Growth Strategy Support Jump to: navigation, search Name South Korea-Green Growth Strategy Support Agency/Company /Organization Global Green Growth Institute (GGGI) Partner Brazilian Finance Ministry, EMBRAPA, FGV, Danish Energy Agency Sector Energy, Land Topics Low emission development planning Resource Type Publications Website http://www.gggi.org/ Program Start 2010 Country South Korea Eastern Asia References Global Green Growth Institute[1] Contents 1 Overview 2 Brazil 3 Indonesia 4 References Overview The Global Green Growth Institute (GGGI) was founded on the belief that economic growth and environmental sustainability are not merely compatible objectives; their integration is essential for the future of humankind. GGGI is dedicated to pioneering and diffusing a new model of economic


Image, Incorporated : a study of securities buildings in Seoul, Korea  

E-Print Network (OSTI)

This study deals with the images of corporate high-rises in Seoul, Korea, the main city of a rapidly growing industrial nation. The questions explored concern mainly the images of office high-rises. Five multi-story ...

Chang, Ji-in



The Political Economies of Broadband Development in Korea and Japan  

E-Print Network (OSTI)

the game is nothing new to Japan and Korea. Both saw rapid17,000 to 1.6 million. 7 Japan followed suit in the earlyDSL was ?rst introduced, Japan was among the most expensive

Kushida, Kenji; Oh, Seung-Youn



Joint design and technology transfer for CANDU projects in Korea  

SciTech Connect

Since the first commercial operation of Kori Unit 1 in April 1978, nine nuclear units are operating and seven, including three CANDU 6 reactors (Wolsong 2, 3 & 4), are currently under construction in Korea. One of the cornerstones of Korea`s nuclear energy policy is the drive for technological self-reliance. Thus, as part of the Wolsong Project scope, a Technology Transfer Agreement for CANDU NSSS System Design was concluded. Under tills agreement Atomic Energy of Canada Limited (AECL) is transferring technologies relating to CANDU 6 NSSS design to Korea Atomic Energy Research Institute (KAERI). As a result KAERI is now performing joint design with AECL for the NSSS of the Wolsong Projects. The current NSSS engineering and design progress for Wolsong 2, 3 & 4 is 58 percent as of December 1993. AECL and KAERI will also pursue the development of advanced technology including a large CANDU system on the basis of CANDU 6 technology.

Harris, D.; Lee, I.H.



Dominican Republic-OAS Activities | Open Energy Information  

Open Energy Info (EERE)

Republic-OAS Activities Republic-OAS Activities Jump to: navigation, search Name Dominican Republic-OAS Activities Agency/Company /Organization Organization of American States (OAS) Sector Energy Focus Area Biomass Topics Background analysis Website http://www.sepa-americas.net/p Program Start 2009 Program End 2010 Country Dominican Republic UN Region Latin America and the Caribbean References OAS Project Database[1] "A bioenergy development project in the rural community of Mata de Palma, Dominican Republic." References ↑ "OAS Project Database" Retrieved from "http://en.openei.org/w/index.php?title=Dominican_Republic-OAS_Activities&oldid=374412" Category: Programs What links here Related changes Special pages Printable version Permanent link Browse properties

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the Republic of Korea  

E-Print Network (OSTI)

35.3 Table of Price-Regression Results for Gas Boilers 48.Pr od uct Cl ass Gas boiler 49. R 50. Number 51. of Observa+32.40 Table A. 60.3 Boilers Minimum Energy Performance

McNeil, Michael A.



Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the Republic of Korea  

E-Print Network (OSTI)

Environmental Energy Technologies Division June 8, 2012 Thisand on high-efficiency technology options that are availableknown for their high- end technology, generate substantial

McNeil, Michael A.



Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the Republic of Korea  

E-Print Network (OSTI)

ventilators, three-phase electric motors, and home gatewayand three-phase phase electric motors as a single unit ofPlan for 3-phase Electric Motors Apr 1, 2012- Jan 1, 2015~

McNeil, Michael A.



United States-Republic of Korea (ROK) International Nuclear Energy Research Initiative (INERI) Annual Steering Committee Meeting  

Energy.gov (U.S. Department of Energy (DOE))

On November 17-18, 2014, the Department of Energys Office of Nuclear Energy (DOE/NE) hosted the annual U.S.-ROK INERI Steering Committee meeting in Washington, D.C. The Steering Committee...


Geochemistry and genesis of hydrothermal Au-Ag-Pb-Zn deposits in the Hwanggangri mineralized district, Republic of Korea  

Science Journals Connector (OSTI)

...Chen,H. S.,Kaas,J.R., andBarduhn,A. J., 1975, Thepropertiesofhydratesofchlorineandcarbondioxide:Desa- lination,v. 16, p. 303-320. Brown,P. E., Bowman,J.R., andKelly,W. C., 1985,Petrologic andstableisotopeconstraintsonthe...

Chil-Sup So; Seong-Taek Yun


Togolese Republic-Climate Technology Initiative Private Financing Advisory  

Open Energy Info (EERE)

Togolese Republic-Climate Technology Initiative Private Financing Advisory Togolese Republic-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Jump to: navigation, search Logo: Togolese Republic-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Name Togolese Republic-Climate Technology Initiative Private Financing Advisory Network (CTI PFAN) Agency/Company /Organization Climate Technology Initiative (CTI), United States Agency for International Development (USAID), Renewable Energy and Energy Efficiency Partnership (REEEP) Partner International Centre for Environmental Technology Transfer Sector Energy Focus Area Agriculture, Biomass, - Biofuels, - Landfill Gas, - Waste to Energy, Buildings, Energy Efficiency, Forestry, Geothermal, Greenhouse Gas, Solar, Transportation, Water Power, Wind


NNSA helps train first responders in Czech Republic | National...  

NLE Websites -- All DOE Office Websites (Extended Search)

train first responders in Czech Republic | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing...


E-Print Network 3.0 - arab republic journal Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

--Uf- DO Dominican Republic ----- TP East Timor -Iu-- EC Ecuador (Republic of) bIU-- EG Egypt (Arab... Sweden (Kingdom of) BIUFO CH Switzerland (Swiss Confederation) ----- SY Syria...


Economic Considerations of Nuclear Desalination in Korea  

SciTech Connect

The objective of this study is to assess the economics of SMART (System-integrated Modular Advanced Reactor) desalination plant in Korea through DEEP (Devaluation Economic Evaluation Program). SMART is mainly designed for the dual purpose of producing water and electricity with the total capacity of 100 MWe which 10 MWe is used for water production and the remains for the electric generation. SMART desalination plant using MED (Multi-Effect Distillation) process is in the stage of the commercial development and its cost information is also being accumulated. In this circumstances, the economic assessment of nuclear desalination by SMART and the effect of water(or electric) supply price to the regional economy is meaningful to the policy maker. This study is focused on the case study analysis about the economics of SMART desalination plant and the meanings of the case study result. This study is composed of two parts. One is prepared to survey the methodology regarding cost allocation between electricity and water in DEEP and the other is for the economic assessment of SMART. The cost allocation methods that have been proposed or used can be classified into two main groups, one is the cost prorating method and the other is the credit method. The cost of an product item in the dual-purpose plant can be determined differently depending on the costing methods adopted. When it comes to applying credit method adopted in this thesis, the production cost of water depends on what kind of the power cost will be chosen in calculating the power credit. This study also analyses the changes of nuclear desalination economics according to the changes of the important factors such as fossil fuel price. I wish that this study can afford to give an insight to the policy maker about SMART desalination plant. (authors)

Man-Ki, Lee; Seung-Su, Kim [Korea Atomic Energy Research Institute, 150, Deok-jin dong, Yu-seong gu, Dae-jeon city (Korea, Republic of)



Holy Mother of Chiri Mountain: A Female Mountain Spirit in Korea  

E-Print Network (OSTI)

Spirit in Korea by Maya Stiller UCLA Center for the Study ofSpirit in Korea by Maya Stiller I n his case study of femaleand commoners alike. Maya Stiller is a graduate student in

Stiller, Maya



Electricity privatization : should South Korea privatize its state-owned electric utility?  

E-Print Network (OSTI)

The state-owned electric utility, Korea Electricity Power Cooperation (KEPCO), privatization has been a key word in South Korea since 1997, when the government received $55 billion from the International Monetary Fund in ...

Lim, Sungmin



A study on carbon dioxide emissions from bituminous coal in Korea  

Science Journals Connector (OSTI)

Consumption of primary energy in Korea increased 5.25% per year over a 10years span starting in 1990. Korea ranked 8th in primary energy consumption in 2011; coal consumption increased 35% from 87,827 milli...

Jeongwoo Lee; Chang-Sang Cho; Ki-hyup Hong; Jae-Hak Jeong



Seoul, South Korea: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Seoul, South Korea: Energy Resources Seoul, South Korea: Energy Resources Jump to: navigation, search Name Seoul, South Korea Equivalent URI DBpedia GeoNames ID 1835848 Coordinates 37.5985°, 126.9783° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.5985,"lon":126.9783,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Chimpanzee tool technology in the Goualougo Triangle, Republic of Congo  

E-Print Network (OSTI)

Chimpanzee tool technology in the Goualougo Triangle, Republic of Congo Crickette M. Sanz a, Deutscher Platz 6, 04103 Leipzig, Germany b Wildlife Conservation Society, Congo Program, B.P. 14537, Brazzaville, Republic of Congo c Lester E. Fisher Center for the Study and Conservation of Apes, Lincoln Park


Democratic Republic of Congo-REDD Programme | Open Energy Information  

Open Energy Info (EERE)

Congo-REDD Programme Congo-REDD Programme Jump to: navigation, search Name Democratic Republic of Congo-REDD Programme Agency/Company /Organization United Nations Development Programme Partner United Nations Environment Programme Sector Land Focus Area Forestry Topics Policies/deployment programs, Background analysis Website http://www.un-redd.org/UNREDDP Country Democratic Republic of Congo Middle Africa References UN-REDD Democratic Republic of Congo[1] "This initial DRC UN-REDD programme aims at putting in place the enabling conditions for a REDD strategy in the Democratic Republic of Congo. It was elaborated through a qualitative dialogue with governmental and non-governmental stakeholders, both national and international." References ↑ "UN-REDD Democratic Republic of Congo"


Czech Republic HEU Removal | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Czech Republic HEU Removal | National Nuclear Security Administration Czech Republic HEU Removal | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > content > Four-Year Plan > Czech Republic HEU Removal Czech Republic HEU Removal Location Czech Republic United States 49° 35' 23.3628" N, 15° 4' 23.6712" E See map: Google Maps Printer-friendly version Printer-friendly version


Dominican Republic-Climate Change Mitigation and Agriculture in Latin  

Open Energy Info (EERE)

Dominican Republic-Climate Change Mitigation and Agriculture in Latin Dominican Republic-Climate Change Mitigation and Agriculture in Latin America and the Caribbean Jump to: navigation, search Logo: Dominican Republic-Climate Change Mitigation and Agriculture in Latin America and the Caribbean Name Dominican Republic-Climate Change Mitigation and Agriculture in Latin America and the Caribbean Agency/Company /Organization Inter-American Development Bank, The Regional Fund for Agricultural Technology, Government of New Zealand Sector Climate, Land Focus Area Agriculture Topics Background analysis, GHG inventory, Low emission development planning Website http://www.iadb.org/en/news/ne Program Start 2011 Country Dominican Republic Caribbean References IDB, FONTAGRO, Government of New Zealand sign agreement on climate change mitigation and agriculture in Latin America and the Caribbean[1]


Seoul, South Korea -classification deteriorating slope stability -Robert Hack 1 SLOPE STABILITY CLASSIFICATION  

E-Print Network (OSTI)

Seoul, South Korea - classification deteriorating slope stability - Robert Hack 1 SLOPE STABILITY CLASSIFICATION OF TIME DEPENDENT DETERIORATING SLOPES Seoul, Korea, 29 February 2008 Robert Hack Engineering) The Netherlands #12;Seoul, South Korea - classification deteriorating slope stability - Robert Hack 2 Jan van

Hack, Robert



E-Print Network (OSTI)

THREE WORDS ABOUT MOBILE PHONES: FINDINGS FROM SWEDEN, THE US, ITALY, JAPAN, AND KOREA Naomi S phones: findings from Sweden, the US, Italy, Japan, and Korea While roughly half of the world students in Sweden, the US, Italy, Japan, and Korea, between the ages of 18 and 24. One of our open

Carlini, David


bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Green Growth in Motion: Sharing Korea's Experience | Open Energy  

Open Energy Info (EERE)

Green Growth in Motion: Sharing Korea's Experience Green Growth in Motion: Sharing Korea's Experience Jump to: navigation, search Tool Summary Name: Green Growth in Motion: Sharing Korea's Experience Agency/Company /Organization: Global Green Growth Institute (GGGI) Sector: Climate Focus Area: Renewable Energy, Economic Development, People and Policy Topics: Finance, Implementation, Low emission development planning, -LEDS, Market analysis, Pathways analysis, Policies/deployment programs, Resource assessment Resource Type: Case studies/examples Website: www.gggi.org/sites/www.gggi.org/files/research/GreenGrowthInMotion.pdf Country: South Korea Cost: Free Eastern Asia Coordinates: 35.907757°, 127.766922° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.907757,"lon":127.766922,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Shock: South Korea wins Battle of nuclear titans  

SciTech Connect

A South Korean consortium won the contract to build and operate four nuclear power plants in Abu Dhabi valued at $20.4 billion. The deal was significant since it is the first major nuclear contract of its kind awarded in the rapidly growing Persian Gulf region, and signals the rise of Korea as an exporter of nuclear know-how.




Democratic Republic of Congo-Nationally Appropriate Mitigation Actions  

Open Energy Info (EERE)

Democratic Republic of Congo-Nationally Appropriate Mitigation Actions Democratic Republic of Congo-Nationally Appropriate Mitigation Actions (NAMAs) in the Congo Basin Jump to: navigation, search Name Democratic Republic of Congo-Nationally Appropriate Mitigation Actions (NAMAs) in the Congo Basin Agency/Company /Organization Environment Canada, International Institute for Sustainable Development (IISD) Sector Climate, Energy, Land, Water Focus Area Non-renewable Energy, Agriculture, Buildings, Economic Development, Energy Efficiency, Forestry, Greenhouse Gas, Grid Assessment and Integration, Industry, Land Use, Offsets and Certificates, Transportation Topics Adaptation, Background analysis, Baseline projection, GHG inventory, Low emission development planning, -NAMA, Pathways analysis, Policies/deployment programs


USAID-Central Asian Republics Climate Activities | Open Energy Information  

Open Energy Info (EERE)

USAID-Central Asian Republics Climate Activities USAID-Central Asian Republics Climate Activities Jump to: navigation, search Name USAID-Central Asian Republics Climate Activities Agency/Company /Organization U.S. Agency for International Development Sector Energy, Land Focus Area Energy Efficiency, Renewable Energy Topics Background analysis Website http://www.usaid.gov/our_work/ Country Kazakhstan, Uzbekistan, Turkmenistan, Kyrgyzstan, Tajikistan Central Asia, Central Asia, Central Asia, Central Asia, Central Asia References USAID Climate Activities [1] "USAID activities in the Central Asian Republics have assisted countries in developing extensive greenhouse gas mitigation and energy efficiency projects. Primarily through training and technical assistance, USAID continues to support the region in these endeavors and is helping them move


Republic of Iraq - Ministry of Oil | Open Energy Information  

Open Energy Info (EERE)

Republic of Iraq - Ministry of Oil Republic of Iraq - Ministry of Oil Jump to: navigation, search Logo: Republic of Iraq - Ministry of Oil Country Iraq Name Republic of Iraq - Ministry of Oil Address Oil Complex Building Port Saeed Street City Baghdad Website http://www.oil.gov.iq/ Coordinates 33.3157°, 44.3922° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.3157,"lon":44.3922,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


United States and Czech Republic Join Together to Announce Bilateral  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

United States and Czech Republic Join Together to Announce United States and Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts United States and Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts September 29, 2011 - 1:43pm Addthis PRAGUE, Czech Republic - The U.S. Department of Energy recently joined with the Rež Nuclear Research Institute, the U.S. Embassy in Prague, Texas A&M and the Czech Nuclear Education Network (CENEN) to announce a series of bilateral nuclear research and development programs that will help to advance safe and secure nuclear energy technologies in both countries. These efforts, including workshops and teacher exchanges, will leverage the expertise of research institutions and universities in the United States


Republic of Macedonia-Enhancing Capacity for Low Emission Development  

Open Energy Info (EERE)

Republic of Macedonia-Enhancing Capacity for Low Emission Development Republic of Macedonia-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Jump to: navigation, search Name Republic of Macedonia-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS) Agency/Company /Organization United States Agency for International Development, United States Environmental Protection Agency, United States Department of Energy, United States Department of Agriculture, United States Department of State Sector Climate, Energy, Land Topics Low emission development planning, -LEDS Program Start 2010 Program End 2016 Country Republic of Macedonia Southern Europe References EC-LEDS[1] Contents 1 Overview 2 Framework 3 Lessons Learned and Good Practices 4 Framework 5 Lessons Learned and Good Practices 6 Progress and Outcomes


Preliminary GHG Emissions Inventory for the Slovak Republic  

Science Journals Connector (OSTI)

This paper presents preliminary results of a greenhouse gas emissions inventory for the Slovak Republic. The key gases included are carbon dioxide, methane, and nitrous oxide. Chlorofluorocarbons are excluded ...

Katarna Mare?kova; Pavol Bielek; Stanislav Kucirek



United States Department of Energy and the Republic of Kazakhstan...  

National Nuclear Security Administration (NNSA)

States Department of Energy and the Republic of Kazakhstan Ministry of Energy Mark the Completion of the Packaging of the BN-350 Fast Breeder Reactor Spent Fuel | National Nuclear...


Factors affecting attitudinal patterns toward education in the Dominican Republic  

E-Print Network (OSTI)

. , along with the fact that in 1966, only 43 per cent of the population of the Dominican Republic was literate (121, p. 1) suggests a needed change with respect to the education obtained by the majority of people in this Caribbean nation if development... interviews; *Cuarto censo nacional de oblacidn 1960. National Office of Statistics, Santo Domingo, Dominican Republic. 26 lower class, 75, 000 people, 144 interviews. Following these procedures, 380 completed interviews were taken, with six additional...

Carpenter, Edwin Hugh



Republic of South Africa Constitution Act 110 of 1983 To introduce a new constitution for the Republic of South Africa and to provide for matters  

E-Print Network (OSTI)

Republic of South Africa Constitution Act 110 of 1983 ACT To introduce a new constitution for the Republic of South Africa and to provide for matters incidental thereto. (English text signed by the State; and ARE DESIROUS OF GIVING THE REPUBLIC OF SOUTH AFRICA A CONSTITUTION which provides for elected and responsible

Sheridan, Jennifer


MHK Projects/South Korea | Open Energy Information  

Open Energy Info (EERE)

Korea Korea < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.9078,"lon":127.767,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


The status of coal briquetting technology in Korea  

SciTech Connect

Anthracite is the only indigenous fossil fuel resource produced in Korea and is an important main source of residential fuel. Due to its particular characteristics, the best way to use Korean coal is in the form of briquettes, called {open_quotes}Yontan.{close_quotes} The ability to use this coal as briquettes was a great discovery made nearly 50 years ago and since then, has made a great contribution to the energy consumption of low and middle income households. Korean anthracite in coal briquette form has been used widely for household heating purposes. Collieries in Korea produced no more than one million tons of anthracite annually in the 1960s. Production, however, increased substantially up to about 17 million tons per year in the mid-1970s. In 1986, Korea succeeded in raising its coal production to 24.2 million tons, which was the maximum production level achieved by the Korean coal industrial sector. Since then, anthracite production has fallen. In 1991, coal output dropped to 15.1 million tons, a decrease of 12.2 percent from the 17.2 million tons produced in 1990, due to falling coal demand and rising labor costs. The role of coal as an energy source will be more important in the future to meet projected economic growth in Korea. While the production of indigenous Korean anthracite is expected to decrease under a coal mining rationalization policy, imports of bituminous coal will increase rapidly and will be used as an oil substitute in industry and power generation. In this chapter, general aspects of the Korean coal industry and coal utilization for residential uses, especially the Yontan coal briquetting techniques, are discussed. In addition, coal briquetting technology applications suitable for the APEC region will be presented.

Choi, Woo-Zin



U.S. and South Korea Sign Agreement on FutureGen Project | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

South Korea Sign Agreement on FutureGen Project South Korea Sign Agreement on FutureGen Project U.S. and South Korea Sign Agreement on FutureGen Project June 26, 2006 - 2:34pm Addthis Korea to Participate in World's First Integrated Carbon Sequestration and Hydrogen Production Research Power Plant WASHINGTON, DC - U.S. Energy Secretary Samuel W. Bodman and South Korean Minister of Commerce, Industry & Energy, Chung Sye Kyun, today signed an agreement making South Korea the second country, after India, to join the United States in the FutureGen International Partnership. Korea has pledged $10 million to help build and operate the world's first zero-emissions coal-fired power plant and will sit on a government steering committee to oversee this initiative. Once operational, this plant will remove and sequester carbon dioxide while producing electricity and


Existing and anticipated technology strategies for reducing greenhouse gas emissions in Koreas petrochemical and steel industries  

Science Journals Connector (OSTI)

This study examines the existing and anticipated technology strategies for reducing greenhouse gas (GHG) emissions in Koreas petrochemical and steel industries. The results of the cluster analysis identify three types of technology strategies employed by firms for reducing GHG emissions: wait-and-see in-process-focused, and all-round strategies. The in-process-focused strategy was the most widely used strategy, followed by the all-round strategy. However, firms in these industries are expected to change their technology strategies to treatment-reliance, inbound-substitution, and all-round strategies in 510 years by employing a wider range of technology options to respond more effectively to the issue of GHG emissions. The demand for new energy sources and raw material substitutes is expected to strengthen in the near future as related technologies advance rapidly and become more widely available.

Su-Yol Lee



Bangladesh-Korea Information Access Center (IAC) Department of CSE, BUET, Dhaka 1000  

E-Print Network (OSTI)

Notice As per MOU signed by BUET and KADO, Korea, IAC is a self sustainable center and BUET will not pay

Rahman, A.K.M. Ashikur


EWIS European wind integration study (Smart Grid Project) (Czech Republic)  

Open Energy Info (EERE)

study (Smart Grid Project) (Czech Republic) study (Smart Grid Project) (Czech Republic) Jump to: navigation, search Project Name EWIS European wind integration study Country Czech Republic Coordinates 49.817493°, 15.472962° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.817493,"lon":15.472962,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE Solar Decathlon: News Blog » Czech Republic  

NLE Websites -- All DOE Office Websites (Extended Search)

Czech Republic Czech Republic Below you will find Solar Decathlon news from the Czech Republic archive, sorted by date. Vienna University of Technology Wins Solar Decathlon 2013! Saturday, October 12, 2013 By Solar Decathlon Team Austria from the Vienna University of Technology has won the U.S. Department of Energy Solar Decathlon 2013. Photo of the exterior of LISI. Team Austria's LISI house is the winner of the U.S. Department of Energy Solar Decathlon 2013. (Credit: Jason Flakes/U.S. Department of Energy Solar Decathlon) The first-time U.S. competitor consistently wowed juries with its LISI house, after winning first place in the Communications Contest, second place in Market Appeal, and tying for third place in Engineering. In measured contests, Team Austria received first place in both the Hot Water


People's Republic of China Fossil-Fuel CO2 Emissions  

NLE Websites -- All DOE Office Websites (Extended Search)

Asia Asia » People's Republic of China People's Republic of China Fossil-Fuel CO2 Emissions Graph graphic Graphics Data graphic Data Trends According to reported energy statistics, coal production and use in China has increased ten-fold since the 1960s. As a result, Chinese fossil-fuel CO2 emissions have more than doubled 2000 alone. At 1.92 billion metric tons of carbon in 2008, the People's Republic of China is the world's largest emitter of CO2 due to fossil-fuel use and cement production. Even with the reported decline in Chinese emissions from 1997 to 1999, China's industrial emissions of CO2 have grown phenomenally since 1950, when China stood tenth among nations based on annual fossil-fuel CO2 emissions. From 1970 to 1997, China's fossil-fuel CO2 emissions grew at an annual rate of

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


United States and Czech Republic Join Together to Announce Bilateral  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Join Together to Announce Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts United States and Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts September 29, 2011 - 10:08am Addthis PRAGUE, Czech Republic - The U.S. Department of Energy recently joined with the Řež Nuclear Research Institute, the U.S. Embassy in Prague, Texas A&M and the Czech Nuclear Education Network (CENEN) to announce a series of bilateral nuclear research and development programs that will help to advance safe and secure nuclear energy technologies in both countries. These efforts, including workshops and teacher exchanges, will leverage the expertise of research institutions and universities in the United States and the Czech Republic to support the safe and secure


Democratic Republic of Congo: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Democratic Republic of Congo: Energy Resources Democratic Republic of Congo: Energy Resources (Redirected from Democratic Republic of the Congo) Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":0,"lon":25,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


United States and Czech Republic Establish a Joint Civil Nuclear  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Establish a Joint Civil Nuclear Establish a Joint Civil Nuclear Cooperation Center in Prague United States and Czech Republic Establish a Joint Civil Nuclear Cooperation Center in Prague June 12, 2013 - 12:17pm Addthis News Media Contact (202) 586-4940 PRAGUE, Czech Republic - The U.S. Department of Energy (DOE) recently joined with the U.S. Embassy in Prague and the Czech Republic's Ministry of Education, Youth and Sports to sign an agreement that establishes a joint Civil Nuclear Cooperation Center in Prague. The creation of this Center is another valued step in expanding U.S.-Czech energy collaboration and fulfills the commitment made by President Obama and Czech Prime Minister Nečas in October 2011 to establish such a Center to facilitate and coordinate joint activities and support regional initiatives in the


EUDEEP (Smart Grid Project) (Czech Republic) | Open Energy Information  

Open Energy Info (EERE)

Czech Republic) Czech Republic) Jump to: navigation, search Project Name EUDEEP Country Czech Republic Coordinates 49.817493°, 15.472962° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.817493,"lon":15.472962,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The divergence of the U.S. alliance solidarity: new relationships with South Korea and Japan after the Cold War.  

E-Print Network (OSTI)

??The United States alliance with South Korea and Japan faced new challenges in the post-Cold War period. The recent tendency shows that U.S.-South Korea alliance (more)

Seo, Mooyoul



Dominican Republic-The Mitigation Action Implementation Network (MAIN) |  

Open Energy Info (EERE)

Dominican Republic-The Mitigation Action Implementation Network (MAIN) Dominican Republic-The Mitigation Action Implementation Network (MAIN) Jump to: navigation, search Name Dominican Republic-The Mitigation Action Implementation Network (MAIN) Agency/Company /Organization Center for Clean Air Policy (CCAP) Partner ICI, Environment Canada, BP, World Bank Institute, Thailand, Ministry of Energy Thailand, Ministry of Industry Thailand, Ministry of Natural Resources and Environment Thailand, Pollution Control Department, Ministry of Natural Resources and Environment Philippines, Climate Change Commission Philippines, Department of Environment and Natural Resources Vietnam, Ministry of Planning and Investment Vietnam, Sub-Institute of Hydrometeorology and Environment of South Vietnam, Ministry of Industry and Trade Vietnam, Ministry of Finance Indonesia, Ministry of Public Works Indonesia, Ministry of Transport Indonesia, Dept. of Clean & Efficient Energy Technology Implementation Indonesia, National Council on Climate Change Malaysia, Ministry of Natural Resources and Environment Malaysia, Dept. of Economic Planning Malaysia, Ministry of Green Technology, Energy and Water Malaysia, Land Public Transport Commission India, Central Electricity Regulatory Commission Pakistan, Dept. of Planning & Development Pakistan, Ministry of Finance Pakistan, Ministry of Foreign Affairs Pakistan, Ministry of Water and Power Germany, Federal Environment Ministry Argentina, Ministry of Energy Argentina, Ministry of Industry Chile, Ministry of Environment Chile, Ministry of Energy Chile, Ministry of Transport Chile, Ministry of Finance Colombia, Ministry of Environment Colombia, Ministry of Transport Colombia, Department of National Planning Colombia, Ministry of Housing Costa Rica, Climate Change Direction Costa Rica, Ministry of Agriculture Costa Rica, Ministry of Housing Costa Rica, Ministry of Energy Dominican Republic, National Climate Change Commission Dominican Republic, National Energy Commission Dominican Republic, Ministry of Environment and Natural Resources Dominican Republic, Ministry of Economy, Planning and Development Dominican Republic, Technical Office for Land Transport (OTTT) Panama Canal Authority Panama Maritime Authority Peru, Ministry of Environment Peru, Ministry of Energy and Mines Peru, Ministry of Transport and Communications Peru, Ministry of Energy and Mines Uruguay, Ministry of the Environment Uruguay, National Transport Directorate Uruguay, Ministry of Industry, Energy and Minerals Uruguay, Ministry of Agriculture Canada, Ministry of the Environment Norway, Ministry of the Environment Sweden, Department of the Environment UK, Department for Energy and Climate Change (DECC), Danish Government


Central African Republic: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Republic: Energy Resources Republic: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":7,"lon":21,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Republic of Macedonia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Republic of Macedonia: Energy Resources Republic of Macedonia: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.83333,"lon":22,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Republic of the Congo: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Republic of the Congo: Energy Resources Republic of the Congo: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-1,"lon":15,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wind Energy Resource Atlas of the Dominican Republic  

SciTech Connect

The Wind Energy Resource Atlas of the Dominican Republic identifies the wind characteristics and the distribution of the wind resource in this country. This major project is the first of its kind undertaken for the Dominican Republic. The information contained in the atlas is necessary to facilitate the use of wind energy technologies, both for utility-scale power generation and off-grid wind energy applications. A computerized wind mapping system developed by NREL generated detailed wind resource maps for the entire country. This technique uses Geographic Information Systems (GIS) to produce high-resolution (1-square kilometer) annual average wind resource maps.

Elliott, D.; Schwartz, M.; George, R.; Haymes, S.; Heimiller, D.; Scott, G.; Kline, J.



Adult entertainment in the Republic of Texas, 1836-1846  

E-Print Network (OSTI)

ABSTRACT This paper examines adult entertainment in the Republic of Texas, which existed from 1836 to 1846. Although the new nation had major cities such as Houston, Galveston, and Austin much of it still was basically a frontier. This mixture... point for the average person is the fact that Texas existed as its own nation before it became a part of the United States. It was as a republic that Texas acquired much of the unique imagery that we associate with the' State today. Among...

Lund, Daniel Lamar



Public Approval of Plant and Animal Biotechnology in Korea: An Ordered Probit Analysis  

E-Print Network (OSTI)

Public Approval of Plant and Animal Biotechnology in Korea: An Ordered Probit Analysis Ramu Director Food policy Institute, Ho-Min Jang is Director Korean Institute of Bioscience and Biotechnology Economics. #12;2 Public Approval of Plant and Animal Biotechnology in Korea: An Ordered Probit Analysis

Neimark, Alexander V.


The current status of NORM/TENORM industries and establishment of regulatory framework in Korea  

Science Journals Connector (OSTI)

......Because of the rapid economic growth in Korea, the...dollars and import of coal has reached 12.4 billion...Natural radioactivity of coal and fly ash in several coal-fired power plants...Because of the rapid economic growth in Korea, the......

Byung-Uck Chang; Yongjae Kim; Jang-Jin Oh



South Korea-UNEP Green Economy Advisory Services | Open Energy Information  

Open Energy Info (EERE)

South Korea-UNEP Green Economy Advisory Services South Korea-UNEP Green Economy Advisory Services Jump to: navigation, search Logo: Korea-UNEP Green Economy Advisory Services Name Korea-UNEP Green Economy Advisory Services Agency/Company /Organization United Nations Environment Programme (UNEP) Partner German Agency for International Cooperation (GIZ), Global Green Growth Knowledge Platform (GGKP), Green Jobs Initiative, United Nations Development Programme (UNDP), United Nations Department of Economic and Social Affairs (UNDESA) Sector Climate, Energy, Land, Water Focus Area People and Policy Topics Co-benefits assessment, Low emission development planning, -LEDS Country South Korea Eastern Asia References UNEP Green Economy Advisory Services[1] Overview "UNEP Green Economy Advisory Services consist of policy advice, technical


Photovoltaics in the Czech Republic: example of a distorted market  

Science Journals Connector (OSTI)

Analysing the development of "sustainable energy" incentives in the Czech Republic over the last five years and drawing on experience from other countries, the study discovers that the "environmental friendliness" of the so-called "renewable sources", ... Keywords: electricity, energy industry, energy security, environment, investment bubble, photovoltaics, political decisions, renewable sources, wind turbines

Lubo Smr?ka




E-Print Network (OSTI)

VISA PACKET REPUBLIC OF PANAMA 2014-2015 In order to be in Panama legally as a student on our Visa will be applied for and obtained in country with the help of the Panama Staff, the visa support police or sheriff's office with Apostille Certification: Since your stay in Panama is longer than 90 days

Hull, Elaine



E-Print Network (OSTI)

MARINE TURTLES IN THE COMOROS FEDERAL ISLAMIC REPUBLIC : Their Status and Recommendations a Gainesville, Florida 32611 U.S.A. Phone: (904) 373-4480 FAX : (904) 392-3704 #12;Mortimer: Comoros Turtles -- i i TABLE OF CONTENTS (CONTD) Page 7.2. Slaughter of Green Turtles for Meat 1 0 7

Prestwich, Ken


National Assembly of the Republic of Slovenia Subiceva ulica 4  

E-Print Network (OSTI)

of the Republic of Slovenia, Your leadership is needed on a matter concerning plans for a new lignite-fired power, which is used in ways that prohibit practical CO2 capture, has reserves sufficient to take global climate to the danger zone. Coal, with larger reserves, has the potential to destroy life on our planet

Hansen, James E.


Economic Contribution of Ports to the Local Economies in Korea  

Science Journals Connector (OSTI)

Ports function as important gateways of international trade and, accordingly, they tend to be regarded as major accelerators of local economic development in the age of globalization. However, due to advancement of logistic technology, change of economic structure and so on, local benefits derived from ports show decreasing trend. In this paper, major literatures regarding port-city interface are reviewed and input-output linkage effects of ports are examined. And then, the relationship between ports and economic performances of major port cities in Korea are discussed based on empirical data of port throughput and economic indicators. According to the analyses, typical port cities of Busan and Incheon failed to get out of poor state of economic performances until lately. It seems the convenience of readily available port services cannot guarantee economic success of the cities where ports are located. Local economies may no longer benefit much from nearby ports.

Bong-min Jung



PPPL teams with South Korea on the forerunner of a commercial fusion power  

NLE Websites -- All DOE Office Websites (Extended Search)

PPPL teams with South Korea on the forerunner of a commercial fusion power PPPL teams with South Korea on the forerunner of a commercial fusion power station By John Greenwald December 21, 2012 Tweet Widget Facebook Like Google Plus One Schematic sketch of the proposed K-DEMO fusion facility. (Photo by Courtesy of South Korea's National Fusion Research Institute.) Schematic sketch of the proposed K-DEMO fusion facility. The U.S. Department of Energy's Princeton Plasma Physics Laboratory (PPPL) has joined forces with researchers in South Korea to develop a pre-conceptual design for a pioneering fusion facility in that Asian nation. The proposed device, called K-DEMO, could be completed in the mid-to-late 2030s as the final step before construction of a commercial fusion power plant that would produce clean and abundant energy for

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Curriculum Reform in Korea: Issues and Challenges for Twenty-first Century Learning  

Science Journals Connector (OSTI)

Since the introduction of international achievement assessments, Korea has received a great deal of global attention because of its strong academic performance achieved at primary and secondary education levels. ...

Kyunghee So; Jiyoung Kang



Stability and Nukes: China's Domestic Concerns over North Korea's Nuclear Program  

E-Print Network (OSTI)

While the bilateral friendship between China and North Korea was solidified and endured during the Korean war, Beijing's ties to Pyongyang have weakened considerably during the nuclear crisis on the Korean Peninsula, which emerged in October 2002...

Xu, Jun



Economic feasibility of a PV system for grid-connected semiconductor facilities in South Korea  

Science Journals Connector (OSTI)

In this study, a cost optimization and sensitivity analysis were carried out for the deployment of a photovoltaic (PV) system in a semiconductor facility in South Korea. The Microgrid software (HOMER) was used...

Hyung Jong Choi; Gwon Deok Han



Port Republic, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Republic, New Jersey: Energy Resources Republic, New Jersey: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.5206733°, -74.485707° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.5206733,"lon":-74.485707,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Republic County, Kansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Republic County, Kansas: Energy Resources Republic County, Kansas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.807989°, -97.6982272° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.807989,"lon":-97.6982272,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Democratic Republic of Congo: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Democratic Republic of Congo: Energy Resources Democratic Republic of Congo: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":0,"lon":25,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DOE Solar Decathlon: News Blog » Czech Republic  

NLE Websites -- All DOE Office Websites (Extended Search)

'Czech Republic' 'Czech Republic' Vienna University of Technology Wins Solar Decathlon 2013! Saturday, October 12, 2013 By Solar Decathlon Team Austria from the Vienna University of Technology has won the U.S. Department of Energy Solar Decathlon 2013. Photo of the exterior of LISI. Team Austria's LISI house is the winner of the U.S. Department of Energy Solar Decathlon 2013. (Credit: Jason Flakes/U.S. Department of Energy Solar Decathlon) The first-time U.S. competitor consistently wowed juries with its LISI house, after winning first place in the Communications Contest, second place in Market Appeal, and tying for third place in Engineering. In measured contests, Team Austria received first place in both the Hot Water and Energy Balance contests. University of Las Vegas Nevada took second place in the overall


Village of Republic, Ohio (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Ohio (Utility Company) Ohio (Utility Company) Jump to: navigation, search Name Village of Republic Place Ohio Utility Id 15865 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes RTO PJM Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Residential Residential Three Phase Commercial Average Rates Residential: $0.1250/kWh Commercial: $0.1350/kWh Industrial: $0.1910/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Village_of_Republic,_Ohio_(Utility_Company)&oldid=412064


Lawrence Livermore to build advanced laser system in Czech Republic  

NLE Websites -- All DOE Office Websites (Extended Search)

9-06 9-06 For immediate release: 09/17/2013 | NR-13-09-06 High Resolution Image The High Repetition-Rate Advanced Petawatt Laser System, or HAPLS, will be designed, developed, assembled and tested at Lawrence Livermore. It will be transferred to the ELI Beamlines facility in 2016, where it will be commissioned for use by the international scientific community. Lawrence Livermore to build advanced laser system in Czech Republic Breanna Bishop, LLNL, (925) 423-9802, bishop33@llnl.gov High Resolution Image Artist renderings of the ELI Beamlines facility, currently under construction in the Czech Republic. High Resolution Image A CAD image of the ELI-HAPLS laser. LIVERMORE, Calif. - Lawrence Livermore National Laboratory (LLNL), through Lawrence Livermore National Security LLC (LLNS), has been awarded more than


DOE Solar Decathlon: Czech Republic: Czech Technical University  

NLE Websites -- All DOE Office Websites (Extended Search)

Czech Republic: Czech Technical University Czech Republic: Czech Technical University AIR House www.airhouse.cz Czech Technical University designed the AIR House for the U.S. Department of Energy Solar Decathlon 2013 and for the generation of 50+-year-olds who are empty-nesters and nearing retirement. Many of the team members' parents fall into this demographic, which inspires a compelling conversation about senior housing. The AIR House, a prototype for an affordable (A), innovative (I), and recyclable (R) house, is designed for the Czech tradition of spending weekends in the countryside. Czech seniors can use the AIR House as a weekend getaway during their pre-retirement years and as a permanent residence after retirement. Design Philosophy The AIR House offers an energy-efficient, environmentally responsible house


Prospects for Microgrids in the Republic of South Africa  

NLE Websites -- All DOE Office Websites (Extended Search)

Prospects for Microgrids in the Republic of South Africa Prospects for Microgrids in the Republic of South Africa Speaker(s): S.P. Chowdhury Sunetra Chowdhury Date: October 12, 2011 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Chris Marnay The South African utility Eskom is the main key player for the energy business in South Africa. Eskom owns the electricity networks and most of the electricity generation, transmission and distribution leading to monopolistic energy market in the country. The South African economy is quite strong in the African Continent and the energy demand has been growing very fast in the country. Most of the current energy mix is coming from coal fired thermal power stations in addition with a small fraction from nuclear as well as open cycle gas turbine and a bit of hydro power.


E-Print Network 3.0 - arab republic of egypt Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Cuba Egypt Ethiopia Federal Republic of Yugoslavia India Indonesia Iran Israel Jordan... Arab Emirates Uzbekistan Venezuela Afghanistan Angola Bosnia Herzegovina Burundi...


The security and foreign policy of the Islamic republic of Iran: An offensive realism perspective.  

E-Print Network (OSTI)

??This study argues that security and foreign policy of the Islamic Republic of Iran is mainly driven by the main principles of the Offensive Realism (more)

Prifti, Bledar



Diamagnetic loop measurement in Korea Superconducting Tokamak Advanced Research machine  

SciTech Connect

Diamagnetic loop (DL), which consists of two poloidal loops inside the vacuum vessel, is used to measure the diamagnetic flux during a plasma discharge in the Korea Superconducting Tokamak Advanced Research (KSTAR) machine. The vacuum fluxes in the DL signal can be compensated up to 0.1 mWb by using the coefficients, which are obtained from experimental investigations, in the vacuum flux measurements during vacuum shots under same operational conditions of magnetic coils for plasma experiment in the KSTAR machine. The maximum error in the diamagnetic flux measurement due to the errors of the coefficients was estimated as {approx}0.22 mWb. From the diamagnetic flux measurements for the ohmically heated circular plasmas in the KSTAR machine, the stored energy agrees well with the estimated kinetic energy within the discrepancy of 25%. When the electron cyclotron heating, the neutral beam injection, and the ion cyclotron resonance heating are added to the ohmically heated limiter plasmas, the additional heating effects can be clearly observed from the increase of the stored energy evaluated in the DL measurement.

Bak, J. G.; Lee, S. G.; Kim, H. S. [National Fusion Research Institute, Gwahangno 113, Yuseong-Gu, Daejeon 305-333 (Korea, Republic of)



Has globalization strengthened South Korea's national research system? National and international dynamics of the Triple Helix of scientific co-authorship relationships in South Korea  

Science Journals Connector (OSTI)

We trace the structural patterns of co-authorship between Korean researchers at three institutional types (university, government, and industry) and their international partners in terms of the mutual information generated in these relations. Data were ... Keywords: Co-authorship, Globalization, Innovation, International collaboration, National research system, R&D internationalization, South Korea, Triple Helix, University---industry---government relationship

Ki-Seok Kwon; Han Woo Park; Minho So; Loet Leydesdorff



44403Federal Register / Vol. 79, No. 147 / Thursday, July 31, 2014 / Notices Republic of China and Taiwan: Initiation of  

E-Print Network (OSTI)

, 2014, Letter to the Secretary, ``Crystalline Silicon Photovoltaic Products from the People's Republic Determination.'' 3 See Certain Crystalline Silicon Photovoltaic Products From the People's Republic of China Alaska; Bering Sea and Aleutian Islands Crab Rationalization Cost Recovery Program AGENCY: National


"Embrace China" show in Houston will celebrate 65th anniversary of the founding of the People's Republic of China  

E-Print Network (OSTI)

"Embrace China" show in Houston will celebrate 65th anniversary of the founding of the People's Republic of China "Embrace China," a multi-arts show of the People's Republic of China. The Sino Professionals Association will host


Efficacy of intramuscular amopyroquin for treatment of Plasmodium falciparum malaria in the Gabon Republic.  

Science Journals Connector (OSTI)

...of Plasmodium falciparum malaria in the Gabon Republic. C Gaudebout E Pussard F Clavier...152 patients (children and adults) in Gabon with Plasmodium falciparum malaria. All...of Plasmodium falciparum malaria in the Gabon Republic. | The efficacy of a 12-mg...

C Gaudebout; E Pussard; F Clavier; D Gueret; J Le Bras; O Brandicourt; F Verdier



Lesula: A New Species of Cercopithecus Monkey Endemic to the Democratic Republic of Congo and Implications  

E-Print Network (OSTI)

Lesula: A New Species of Cercopithecus Monkey Endemic to the Democratic Republic of Congo and Implications for Conservation of Congo's Central Basin John A. Hart1,2 , Kate M. Detwiler3 *, Christopher C, Democratic Republic of Congo, 2 Division of Vertebrate Zoology, Yale Peabody Museum of Natural History, New

Sargis, Eric J.


The energy policy of the Republic of Cyprus  

Science Journals Connector (OSTI)

This paper presents the energy policy of the Republic of Cyprus government controlled areas from 1960 till 2006. It describes the sectors of electricity, petroleum, natural gas and renewable energy sources. It also deals with the marine layers of oil and with environmental aspects. The energy policy of Cyprus is harmonized with that of the European Union according to its national obligations, having as its guidelines to secure competition in the market and to fulfill the energy needs of the country, with the least burden to the economy and to the environment. The future plans and targets of Cyprus related to its energy strategy are also presented.

P.A. Pilavachi; N.G. Kalampalikas; M.K. Kakouris; E. Kakaras; D. Giannakopoulos


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear education and knowledge management in the Czech Republic  

Science Journals Connector (OSTI)

As a nuclear energy user, the Czech Republic needs a number of nuclear specialists for the operation of Nuclear Power Plants (NPPs) and the Research and Development (R&D) of new nuclear devices. They are educated in few technical universities and the educational institutions of industrial companies. A main role is played in nuclear education by the Faculty of Nuclear Sciences and Physical Engineering of the Czech Technical University (CTU) in Prague, which operates the VR-1 training reactor. The Czech Nuclear Education Network (CENEN) was established for better cooperation, preservation and further development of higher nuclear education and expertise.

K. Matejka; O. Huml



Republic of Macedonia-Low Carbon Growth Country Studies Program | Open  

Open Energy Info (EERE)

Republic of Macedonia-Low Carbon Growth Country Studies Program Republic of Macedonia-Low Carbon Growth Country Studies Program Jump to: navigation, search Name Republic of Macedonia-Low Carbon Growth Country Studies Program Agency/Company /Organization Energy Sector Management Assistance Program of the World Bank Sector Climate, Energy Focus Area Buildings, Energy Efficiency, Industry, Transportation Topics Background analysis, Baseline projection, Low emission development planning, Policies/deployment programs Website http://www.esmap.org/esmap/ Country Republic of Macedonia UN Region Northern Europe References ESMAP-Macedonia-Low Carbon Growth Country Studies Program[1] References ↑ "ESMAP-Macedonia-Low Carbon Growth Country Studies Program" Retrieved from "http://en.openei.org/w/index.php?title=Republic_of_Macedonia-Low_Carbon_Growth_Country_Studies_Program&oldid=700212


Democratic Republic of Congo-Forest Investment Program (FIP) | Open Energy  

Open Energy Info (EERE)

Democratic Republic of Congo-Forest Investment Program (FIP) Democratic Republic of Congo-Forest Investment Program (FIP) Jump to: navigation, search Name Democratic Republic of Congo-Forest Investment Program (FIP) Agency/Company /Organization World Bank Sector Land Topics Background analysis, Finance, Implementation, Low emission development planning, Market analysis Website http://www.climatefundsupdate. Program Start 2008 Country Democratic Republic of Congo Middle Africa References Forest Investment Program (FIP)[1] Forest Investment Program[2] Brazil Specific Documents[3] Democratic Republic of Congo Specific Documents[4] Ghana Specific Documents[5] Indonesia Specific Documents[6] Laos Specific Documents[7] Mexico Specific Documents[8] Peru Specific Documents[9] Overview "The Forest Investment Program (FIP) is a targeted program of the Strategic


South Korea-Joint Programme on Resource Efficient and Cleaner Production  

Open Energy Info (EERE)

South Korea-Joint Programme on Resource Efficient and Cleaner Production South Korea-Joint Programme on Resource Efficient and Cleaner Production (RECP) in Developing and Transition Countries Jump to: navigation, search Name South Korea-Joint Programme on Resource Efficient and Cleaner Production (RECP) in Developing and Transition Countries Agency/Company /Organization United Nations Industrial Development Organization (UNIDO), United Nations Environment Programme (UNEP) Partner Ministry of Energy, Ministry of Planning, Ministry of Finance, Ministry of Environment, Ministry of Industry Sector Climate, Energy, Water Focus Area Renewable Energy, Non-renewable Energy, Agriculture, Economic Development, Goods and Materials, Industry, People and Policy, Water Conservation Topics Background analysis, Co-benefits assessment, - Environmental and Biodiversity, - Health, - Macroeconomic, Finance, GHG inventory, Implementation, Low emission development planning, -LEDS, -NAMA, -Roadmap, -TNA, Market analysis, Pathways analysis, Policies/deployment programs, Resource assessment, Technology characterizations


Shallow hydraulic fracturing measurements in Korea support tectonic and seismic indicators of regional stress.  

SciTech Connect

We have conducted five hydraulic fracturing stress measurement campaigns in Korea, involving 13 test holes ranging in depth from 30 to 250 m, at locations from North Seoul to the southern coast of the peninsula. The measurements reveal consistent crustal stress magnitudes and directions that suggest persistence throughout western and southern Korea. The maximum horizontal stress {sigma}{sub H} is oriented between ENE-WSW and E-W, in accord with plate movement and deformation, and with directions indicated by both focal mechanism solutions from earthquakes inland and offshore as well as borehole breakouts in mainland China close to its eastern coast. With respect to magnitudes, the vertical stress is the overall minimum stress at all tested locations, suggesting a thrust faulting regime within the relatively shallow depths reached by our tests. Typically, such a stress regime becomes one favoring strike-slip at greater depths, as is also indicated by the focal mechanism solutions around Korea.

Haimson, Bezalel Cecil (University of Wisconsin, Madison, WI); Lee, Moo Yul; Song, I. (Ruhr-University Bochum, Bochum, Germany)



Optimal green energy management in Jeju, South Korea On-grid and off-grid electrification  

Science Journals Connector (OSTI)

Abstract Green Growth and Sustainability are now keywords for industrial growth engines. This research examines the economic, environmental, and technological feasibility of hybrid systems by simulating a system composed of renewable energy, an existing grid system, and a diesel generator on Jeju Island in South Korea. Korea depends heavily on oil imports. Thus, in Korea, efficient energy management is imperative. For this reason, the current Korean administration is striving to improve its energy infrastructure with the construction of stable energy supplies and reliable systems the implementation of energy policies, such as smart grids, and the diffusion of renewable energy generation sources. This study finds that the most economically feasible hybrid system is a grid-connected wind turbinephotovoltaicbatteryconverter hybrid system. Given the economic feasibility of this hybrid system, implementing it would decrease the price of electricity in Jeju. Both the implications and limitations of this study will be discussed in the last section of this paper.

Heetae Kim; Seoin Baek; Eunil Park; Hyun Joon Chang



Transactions of the Korean Nuclear Society Autumn Meeting PyeongChang, Korea, October 25-26, 2007  

E-Print Network (OSTI)

Transactions of the Korean Nuclear Society Autumn Meeting PyeongChang, Korea, October 25-26, 2007 " MCR " . Guideline of Cyber Security Policy for Digital I&C Systems in Nuclear Power Plant Zeen and Control Dept., Korea Institute of Nuclear Safety, {k407kyd,dikim}@kins.re.kr *** Reactor Engineering

Kim, Kwangjo


The role of technology readiness in consumers' adoption of mobile internet services between South Korea and China  

Science Journals Connector (OSTI)

This study built a causal model using the technology readiness and acceptance model TRAM to identify the factors influencing the adoption of mobile internet services in South Korea and China. In order to compare South Korea and China, a survey was conducted ...

Jong Chul Oh; Sung Joon Yoon; Namho Chung




E-Print Network (OSTI)

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS


Republic of Congo-Nationally Appropriate Mitigation Actions (NAMAs) in the  

Open Energy Info (EERE)

Republic of Congo-Nationally Appropriate Mitigation Actions (NAMAs) in the Republic of Congo-Nationally Appropriate Mitigation Actions (NAMAs) in the Congo Basin Jump to: navigation, search Name Republic of Congo-Nationally Appropriate Mitigation Actions (NAMAs) in the Congo Basin Agency/Company /Organization Environment Canada, International Institute for Sustainable Development (IISD) Sector Climate, Energy, Land, Water Focus Area Non-renewable Energy, Agriculture, Buildings, Economic Development, Energy Efficiency, Forestry, Greenhouse Gas, Grid Assessment and Integration, Industry, Land Use, Offsets and Certificates, Transportation Topics Adaptation, Background analysis, Baseline projection, GHG inventory, Low emission development planning, -NAMA, Pathways analysis, Policies/deployment programs Program Start 2012 Program End 2013


Wind Energy Resource Atlas of the Dominican Republic  

NLE Websites -- All DOE Office Websites (Extended Search)

October 2001 * NREL/TP-500-27602 October 2001 * NREL/TP-500-27602 Wind Energy Resource Atlas of the Dominican Republic D. Elliott M. Schwartz R. George S. Haymes D. Heimiller G. Scott National Renewable Energy Laboratory J. Kline RAM Associates Prepared under Task Nos. WER11050 and DO059999 NOTICE This report was prepared as an account of work sponsored by an agency of the United States government. Neither the United States government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial


Microsoft Word - CX-Colville-Republic_Rebuild_WEB.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Eric Orth Eric Orth Project Manager - TEP-TPP-3 Proposed Action: Colville-Republic No. 1 115-kV rebuild project Budget Information: Work Order #00270698 PP&A Project No.: PP&A 1786 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3, Routine maintenance activities...for structures, rights-of-way, infrastructures such as roads, equipment... routine maintenance activities, corrective....are required to maintain... infrastructures...in a condition suitable for a facility to be used for its designated purpose. B4.6, Additions or modifications to electric power transmission facilities that would not affect the environment beyond the previously developed facility area including...changing insulators, and replacement of poles, ...conductors, ...and crossarms.


Comparisons of technological innovation capabilities in the solar photovoltaic industries of Taiwan, China, and Korea  

Science Journals Connector (OSTI)

This paper investigates the technological innovation capabilities of the three Asian latecomers--namely Taiwan, China, and Korea--in the emergent solar photovoltaic industry. For this study, I deploy a new dataset of 75,540 solar photovoltaic patents ... Keywords: Catch-up, Innovation capability, Patent, Photovoltaic (PV), Solar, Technology platform

Ching-Yan Wu



August 24~28, 2014 International Convention Center (ICC) Jeju, Jeju Island, Korea  

E-Print Network (OSTI)

Symposium on Future I&C for Nuclear Power Plants International Symposium on Symbiotic Nuclear Power Systems, Jeju Island, Korea International Symposium on Future I&C for Nuclear Power Plants International Symposium on Symbiotic Nuclear Power Systems ISOFIC/ISSNP 2014 www.isofic.org #12;Contents 04 06 06 07 09 10


Electricity-generation mix considering energy security and carbon emission mitigation: Case of Korea and Mongolia  

Science Journals Connector (OSTI)

Abstract To compare electricity-generation fuel mixes in two countries with multiple energy policy goals and unique circumstances, we look at three scenarios reflecting the carbon emissions mitigation targets, differences in energy security levels, and electricity-generating costs of each nation. Korea and Mongolia show clear differences in electricity-generation structure related to import dependency, the potential of renewable energy, and threats to energy security. These variations lead to different decisions on the power-generation fuel mix plan. Use of fossil fuel resources in Korea results in carbon dioxide emissions and energy insecurity, while in Mongolia carbon emissions, also from fossil fuels, and energy insecurity are separate concerns as Mongolia domestically operates coal-fired power plants and imports electricity. Policies targeting two objectives, carbon emissions mitigation and energy security improvement, show complementarity in Korea as fossil fuels are replaced by renewables or nuclear power, but represent trade-offs in Mongolia as emissions mitigation and improved energy security cannot be achieved with one strategy. In conclusion, national plans to achieve two goals differ by country: In Korea, the appropriate portion of nuclear energy is the determining policy factor. In Mongolia, carbon capture and storage is the clear alternative for mitigating carbon emissions despite large renewables potential.

Hanee Ryu; Shonkhor Dorjragchaa; Yeonbae Kim; Kyunam Kim



Returning HEU Fuel from the Czech Republic to Russia  

SciTech Connect

In December 1999, representatives from the United States, Russian Federation, and International Atomic Energy Agency began working on a program to return Russian supplied, highly enriched, uranium fuel stored at foreign research reactors to Russia. Now, under the Global Threat Reduction Initiatives Russian Research Reactor Fuel Return Program, this effort has repatriated over 800 kg of highly enriched uranium to Russia from over 10 countries. In May 2004, the Agreement Between the Government of the United States of America and the Government of the Russian Federation Concerning Cooperation for the Transfer of Russian Produced Research Reactor Nuclear Fuel to the Russian Federation was signed. This agreement provides legal authority for the Russian Research Reactor Fuel Return Program and establishes parameters whereby eligible countries may return highly enriched uranium spent and fresh fuel assemblies and other fissile materials to Russia. On December 8, 2007, one of the largest shipments of highly enriched uranium spent nuclear fuel was successfully made from a Russian-designed nuclear research reactor in the Czech Republic to the Russian Federation. This accomplishment is the culmination of years of planning, negotiations, and hard work. The United States, Russian Federation, and the International Atomic Energy Agency have been working together. In February 2003, Russian Research Reactor Fuel Return Program representatives met with the Nuclear Research Institute in Re, Czech Republic, and discussed the return of their highly enriched uranium spent nuclear fuel to the Russian Federation for reprocessing. Nearly 5 years later, the shipment was made. This article discusses the planning, preparations, coordination, and cooperation required to make this important international shipment.

Michael Tyacke; Dr. Igor Bolshinsky



Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network (OSTI)

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter


Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network (OSTI)

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter


Dominican Republic-Low-Carbon Energy Roadmaps for the Greater Antilles |  

Open Energy Info (EERE)

Dominican Republic-Low-Carbon Energy Roadmaps for the Greater Antilles Dominican Republic-Low-Carbon Energy Roadmaps for the Greater Antilles Jump to: navigation, search Name Dominican- Republic-Low-Carbon Energy Roadmaps for the Greater Antilles Agency/Company /Organization World Watch Institute Partner Deutsche Gesellschaft für Internationale Zusammenarbeit (GIZ) GmbH, National Energy Commission Sector Climate, Energy Focus Area Economic Development, Greenhouse Gas Topics Adaptation, Co-benefits assessment, - Environmental and Biodiversity, - Macroeconomic, Finance, Low emission development planning, -LEDS, -Roadmap Website http://www.worldwatch.org/ener Program Start 2010 Program End 2013 Country Dominican Republic Caribbean References Low-Carbon Energy Roadmaps for the Greater Antilles[1] Overview "Launched in spring 2010, Worldwatch's Caribbean project is partnering


UNDP-Dominican Republic Regional Programme for LAC - Support for the  

Open Energy Info (EERE)

Dominican Republic Regional Programme for LAC - Support for the Dominican Republic Regional Programme for LAC - Support for the preparation of the National Climate Change Policy Jump to: navigation, search Name UNDP-Dominican Republic Regional Programme for LAC - Support for the preparation of the National Climate Change Policy Agency/Company /Organization United Nations Development Programme (UNDP) Sector Climate Focus Area People and Policy Topics Finance, Low emission development planning, -LEDS Country Dominican Republic Caribbean References UNDP - Latin America & the Caribbean[1] Contents 1 Program Overview 1.1 Program Focus 1.2 Environment and Sustainable Development 2 References Program Overview "Across Latin America and the Caribbean, UNDP helps countries build and share their own solutions to urgent development challenges, supporting

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Democratic Republic of Congo-ClimateWorks Low Carbon Growth Planning  

Open Energy Info (EERE)

Democratic Republic of Congo-ClimateWorks Low Carbon Growth Planning Democratic Republic of Congo-ClimateWorks Low Carbon Growth Planning Support Jump to: navigation, search Name Democratic Republic of Congo-Low Carbon Growth Planning Support Agency/Company /Organization ClimateWorks, Project Catalyst, McKinsey and Company Sector Energy, Land Topics Background analysis, Low emission development planning, Policies/deployment programs Country Democratic Republic of Congo Middle Africa References LCGP support[1] Low Carbon Growth Plans Advancing Good Practice, August 2009[2] Overview "Achieving development goals depends on enabling poorer countries to accelerate or maintain robust economic growth despite the disproportionate impacts of climate change which they face. The central challenge is to enable all countries to strengthen delivery of their own development


Dominican Republic-Support for the Preparation of National Climate Change  

Open Energy Info (EERE)

Dominican Republic-Support for the Preparation of National Climate Change Dominican Republic-Support for the Preparation of National Climate Change Strategy Jump to: navigation, search Name Dominican Republic-Argentina-Support for the Preparation of National Climate Change Strategy Agency/Company /Organization United Nations Development Programme (UNDP) Sector Climate Focus Area People and Policy Topics Low emission development planning, -LEDS Country Dominican Republic Caribbean References UNDP - Latin America & the Caribbean[1] Contents 1 Program Overview 1.1 Program Focus 1.2 Environment and Sustainable Development 2 References Program Overview "Across Latin America and the Caribbean, UNDP helps countries build and share their own solutions to urgent development challenges, supporting coalitions for change and connecting individuals and institutions so they


Republic of Macedonia-World Bank Climate Projects | Open Energy Information  

Open Energy Info (EERE)

Macedonia-World Bank Climate Projects Macedonia-World Bank Climate Projects Jump to: navigation, search Name Republic of Macedonia-World Bank Climate Projects Agency/Company /Organization World Bank Sector Energy, Land Focus Area Energy Efficiency, Renewable Energy Topics Background analysis Website http://web.worldbank.org/exter Country Republic of Macedonia UN Region Southern Europe References World Bank-Macedonia[1] World Bank Active Climate Projects in the Republic of Macedonia Sustainable Energy GEF Project Sustainable Energy GEF Project "The development objective of the Sustainable Energy Project of the Former Yugoslav Republic of Macedonia is to develop a sustainable market for energy efficiency (EE) and renewable energy (RE) by supporting the development of an enabling framework, institutional capacity, and necessary


Dominican Republic-Regional Programme for LAC: Support for the Preparation  

Open Energy Info (EERE)

Dominican Republic-Regional Programme for LAC: Support for the Preparation Dominican Republic-Regional Programme for LAC: Support for the Preparation of the National Climate Change Policy Jump to: navigation, search Name UNDP-Dominican Republic Regional Programme for LAC - Support for the preparation of the National Climate Change Policy Agency/Company /Organization United Nations Development Programme (UNDP) Sector Climate Focus Area People and Policy Topics Finance, Low emission development planning, -LEDS Country Dominican Republic Caribbean References UNDP - Latin America & the Caribbean[1] Contents 1 Program Overview 1.1 Program Focus 1.2 Environment and Sustainable Development 2 References Program Overview "Across Latin America and the Caribbean, UNDP helps countries build and share their own solutions to urgent development challenges, supporting


E-Print Network 3.0 - aachen federal republic Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

results for: aachen federal republic Page: << < 1 2 3 4 5 > >> 1 UMIC DAY11 Aachen, Germany Summary: of Excellence RWTH Aachen Excellence initiative of the German federal and...


The tourism industry and its link to poverty alleviation in the Dominican Republic  

E-Print Network (OSTI)

The Dominican Republic has an interesting juxtaposition of the largest tourism industry in the Caribbean with some of the worst social conditions in the region such as high rates of unemployment, poverty, and infant ...

Weiner, Angelica (Angelica G.)



The Second International Stirling Engine Conference, Shanghai, Peoples Republic of China, June 1984  

SciTech Connect

The Second International Stirling Engine Conference was held in Shanghai, Peoples Republic of China in June 1984. This paper reviews some of the events leading to the conference and the establishment of the Stirling Engine Conference Council.

Walker, G.



Biomass as Traditional and Local Source of Energy in the Czech Republic  

Science Journals Connector (OSTI)

The paper is focused on history of biomass usage in the Czech Republic importance ... policy. It is also clarified usage of biomass energy in present times from the sources point ... resources. There is defined...

Eduard Scerba; Jan Skorpil; Emil Dvorsky



Occurrence ofGlossina nashi Potts 1955 Diptera Glossinidae in the Republic of Gabon  

Science Journals Connector (OSTI)

Glossina nashi..., a little known species of tsetse fly, inhabits the forests of central Africa. It has recently been detected in the Province of Haut Ogoou in the south-east of the Republic of

S. G. A. Leak; P. Jeannin



Uranium levels in the Naryn and Mailuu-Suu rivers of Kyrgyz Republic  

Science Journals Connector (OSTI)

In March of 2000, scientists from four nuclear physics research institutes in the Central Asia Republics of Kazakhstan, Kyrgyzstan, Tajikistan, and Uzbekistan, and the U.S. Sandia National Laboratories embarke...

I. A. Vasiliev; D. S. Barber; V. M. Alekhina



The Acid Lakes of Lignite Mining District of the former German Democratic Republic  

Science Journals Connector (OSTI)

Large areas of central and eastern Europe have reserves of hard and brown coal. The map ... Germany, Poland and the Czech Republic. The reserves of lignite in Germany with 56 x 109 tons ... output correspond to 1...

M. Schultze; W. Geller



Evaluation of air injection and extraction tests in a landfill site in Korea: implications for landfill management  

Science Journals Connector (OSTI)

Air extraction and injection were evaluated for extracting hazardous landfill gas and enhancing degradation of organic materials in a landfill in Korea. From the pilot and full ... pressure radius of influence wa...

J. Lee; C. Lee; K. Lee



Hydrogeological studies on the mechanical behavior of landfill gases and leachate of the Nanjido Landfill in Seoul, Korea  

Science Journals Connector (OSTI)

?The Nanjido Landfill is the largest uncontrolled landfill in Korea and it causes various kinds of environmental problems. Landfill gases and leachate are recognized as the most serious environmental problems ass...

K. K. Lee; Y. Y. Kim; H. W. Chang; S. Y. Chung



A new direction and business plan for the golf business in Korea : strategies to attract customers to the domestic market  

E-Print Network (OSTI)

The golf industry in South Korea has been flourishing and has maintained high profitability. However, the South Korean market is not adequately prepared for the increasingly globalized world economy and resulting changes ...

Kim, Ikhwan



The potential of plantations of Terminalia superba Engl. & Diels for wood and biomass production (Mayombe Forest, Democratic Republic of Congo)  

Science Journals Connector (OSTI)

In the 1940s1950s, large limba (Terminalia superba Engl. & Diels) plantations were established in the Democratic Republic of Congo to reduce the pressur...

Maaike De Ridder; Wannes Hubau; Jan Van Den Bulcke



MHK Projects/GCK Technology Uldolmok Strait South Korea | Open Energy  

Open Energy Info (EERE)

Strait South Korea Strait South Korea < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.4936,"lon":126.416,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


MHK Projects/Lunar Energy Wando Hoenggan Waterway South Korea | Open Energy  

Open Energy Info (EERE)

Wando Hoenggan Waterway South Korea Wando Hoenggan Waterway South Korea < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.2441,"lon":126.615,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}


Energy technology roadmap for the next 10 years: The case of Korea  

Science Journals Connector (OSTI)

The Korea Institute of Energy Research (KIER), the only government-sponsored research institute specialized in the development of energy technology and policy, has established a long-term strategic energy technology roadmap (ETRM) for the period spanning from 2006 to 2015. Taking into account such variables as the energy environment, economic spin-off, and commercial potential, the ETRM was classified into 3 sectors, namely high oil prices, the UNFCCC, and the hydrogen economy. The ETRM not only represents a milestone in terms of the development of national energy technology in Korea, but also serves to identify the primary energy technologies which should be developed. The ETRM also supplies energy policymakers with successful R&D alternatives vis--vis the development of energy technologies under the current Korean energy environment.

Seong Kon Lee; Gento Mogi; Jong Wook Kim



Estimation of the Transportation Risks for the Spent Fuel in Korea for Various Transportation Scenarios  

SciTech Connect

According to the long term management strategy for spent fuels in Korea, they will be transported from the spent fuel pools in each nuclear power plant to the central interim storage facility (CISF) which is to start operation in 2016. Therefore, we have to determine the safe and economical logistics for the transportation of these spent fuels by considering their transportation risks and costs. In this study, we developed four transportation scenarios by considering the type of transportation casks and transport means in order to suggest safe and economical transportation logistics for the spent fuels in Korea. Also, we estimated and compared the transportation risks for these four transportation scenarios. From the results of this study, we found that these four transportation scenarios for spent fuels have a very low radiological risk activity with a manageable safety and health consequences. The results of this study can be used as basic data for the development of safe and economical logistics for a transportation of the spent fuels in Korea by considering the transportation costs for the four scenarios which will be needed in the near future. (authors)

Jongtae, Jeong; Cho, D.K.; Choi, H.J.; Choi, J.W. [Korea Atomic Energy Research Institute, Yuseong, Daejeon (Korea, Republic of)



Application of LBB to high energy pipings of a pressurized water reactor in Korea  

Science Journals Connector (OSTI)

The application of the leak before break (LBB) technology to the newly constructed pressurized water reactors (PWRs) has been approved in Korea for several high energy systems that can meet rigorous acceptance criteria. The LBB application in Korea is based on the US Nuclear Regulatory Commision (USNRC) requirements. The purpose of the LBB evaluation is to eliminate the dynamic effects associated with the postulated double-ended guillotine break (DEGB) from design basis loads, as well as to eliminate pipe whip restraints and jet impingement barriers. There were several issues on the application of LBB to the primary coolant loop and the pressurizer surge line. Of concern were the material properties for the carbon steel for the primary coolant loop, estimation of the crack opening area at the pipe-to-nozzle interface considering the asymmetry, and the leakage crack size which barely meets the required margin of 2 for the surge line, etc. Some additional work was required by the safety authority to maintain the global safety of the plant at a sufficient level. This paper describes the regulatory application of LBB in Korea, and the issues encountered during the regulatory review.

Jeong-Bae Lee; Young Hwan Choi


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Possibilities of electricity generation in the Republic of Croatia by means of geothermal energy  

Science Journals Connector (OSTI)

In the Republic of Croatia there are some medium temperature geothermal sources by means of which it is possible to produce electricity. However, only recently concrete initiatives for the construction of geothermal power plants have been started. Consequently, the paper provides proposals of the possible cycles for the Republic of Croatia. On the example of the most prospective geothermal source in the Republic of Croatia detailed analysis for the proposed energy conversion cycles is performed: for Organic Rankine Cycle (ORC) and Kalina cycle. On the basis of analysis results both the most suitable cycle for selected and for other geothermal sources in the Republic of Croatia are proposed. It is ORC which in case of the most prospective geothermal source in the Republic of Croatia has better both the thermal efficiency (the First Law efficiency) and the exergetic efficiency (the Second Law efficiency): 14.1% vs. 10.6% and 52% vs. 44%. The ORC gives net power of 5270kW with mass flow rate 80.13kg/s, while the Kalina cycle gives net power of 3949kW with mass flow rate 35.717kg/s.

Z. Guzovi?; D. Lon?ar; N. Ferdelji



Renault Samsung Motors | Open Energy Information  

Open Energy Info (EERE)

Renault Samsung Motors Place: Korea (Republic) Sector: Solar Product: Korea-based automobile manufacturer. The firm is also involved in solar project development. References:...


Catalogue of alien plants of the Czech Republic (2nd edition): checklist update, taxonomic diversity and invasion patterns  

E-Print Network (OSTI)

Catalogue of alien plants of the Czech Republic (2nd edition): checklist update, taxonomic): Catalogue of alien plants of the Czech Republic (2nd edition): checklist update, taxonomic diversity and invasion patterns. ­ Preslia 84: 155­255. A complete list of all alien taxa ever recorded in the flora

Kratochvíl, Lukas


Post-partum depression in Kinshasa, Democratic Republic of Congo: Validation of a concept using a mixed-methods  

E-Print Network (OSTI)

Post-partum depression in Kinshasa, Democratic Republic of Congo: Validation of a concept using Agency for International Development (USAID), Democratic Republic of Congo 5 Department of International of Congo, by adapting and validating standard screening instruments. methods Using qualitative interviewing

Scharfstein, Daniel



E-Print Network (OSTI)

FALCIPARUM FROM AN AREA (REPUBLIC OF THE CONGO) HIGHLY ENDEMIC FOR MALARIA P. DURAND, Y. MICHALAKIS, S of the Congo) and compared with a cosmopolitan sample of 21 isolates collected from different countries living in Pointe Noire, Republic of the Congo and characterized P. falciparum isolates at 28 micro


CfRN-Dominican Republic-Fast-Track Development of Transformative  

Open Energy Info (EERE)

CfRN-Dominican Republic-Fast-Track Development of Transformative CfRN-Dominican Republic-Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities Jump to: navigation, search Logo: Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities Name Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities Agency/Company /Organization Coalition for Rainforest Nations Focus Area Economic Development Topics Low emission development planning, Policies/deployment programs Resource Type Presentation, Guide/manual Website http://www.rainforestcoalition Country Dominican Republic UN Region Caribbean References Fast-Track Development of Transformative Climate-Compatible Development Plans and Building of Regional and Local Capacities[1]


Republic of Kosovo-Supporting RBEC Transition to Low-Emission Development |  

Open Energy Info (EERE)

Republic of Kosovo-Supporting RBEC Transition to Low-Emission Development Republic of Kosovo-Supporting RBEC Transition to Low-Emission Development Jump to: navigation, search Name Republic of Kosovo-Supporting RBEC Transition to Low-Emission Development Agency/Company /Organization United Nations Development Programme (UNDP), UNDP Bratislava Regional Center Partner Interministerial committees headed by the national focal point on climate change Sector Climate, Energy Focus Area Renewable Energy, Non-renewable Energy, Agriculture, Biomass, Buildings, Economic Development, Greenhouse Gas, Industry, People and Policy, Transportation Topics Background analysis, Baseline projection, Co-benefits assessment, Low emission development planning, -LEDS Website http://europeandcis.undp.org/e Program Start 2010 Program End 2012


Republic of Macedonia-Joint Programme on Resource Efficient and Cleaner  

Open Energy Info (EERE)

Republic of Macedonia-Joint Programme on Resource Efficient and Cleaner Republic of Macedonia-Joint Programme on Resource Efficient and Cleaner Production (RECP) in Developing and Transition Countries Jump to: navigation, search Name Republic of Macedonia-Joint Programme on Resource Efficient and Cleaner Production (RECP) in Developing and Transition Countries Agency/Company /Organization United Nations Industrial Development Organization (UNIDO), United Nations Environment Programme (UNEP) Partner Ministry of Energy, Ministry of Planning, Ministry of Finance, Ministry of Environment, Ministry of Industry Sector Climate, Energy, Water Focus Area Renewable Energy, Non-renewable Energy, Agriculture, Economic Development, Goods and Materials, Industry, People and Policy, Water Conservation Topics Background analysis, Co-benefits assessment, - Environmental and Biodiversity, - Health, - Macroeconomic, Finance, GHG inventory, Implementation, Low emission development planning, -LEDS, -NAMA, -Roadmap, -TNA, Market analysis, Pathways analysis, Policies/deployment programs, Resource assessment, Technology characterizations


Democratic Republic of Congo-EU-UNDP Climate Change Capacity Building  

Open Energy Info (EERE)

Democratic Republic of Congo-EU-UNDP Climate Change Capacity Building Democratic Republic of Congo-EU-UNDP Climate Change Capacity Building Program Jump to: navigation, search Name Democratic Republic of Congo-EU-UNDP Climate Change Capacity Building Program Agency/Company /Organization The European Union (EU), United Nations Development Programme (UNDP) Partner Multiple Ministries Sector Climate, Energy Focus Area Renewable Energy, Agriculture, Biomass, Buildings, Energy Efficiency, Forestry, Geothermal, Greenhouse Gas, Industry, Land Use, Offsets and Certificates, People and Policy, Solar, Transportation, Water Power, Wind Topics Background analysis, Baseline projection, Co-benefits assessment, - Energy Access, - Environmental and Biodiversity, GHG inventory, Implementation, Low emission development planning, -LEDS, -NAMA, -Roadmap, -TNA, Policies/deployment programs, Resource assessment



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Bilateral Cooperation | Department of Energy  

Office of Environmental Management (EM)

MOUs and Energy Partnerships with Argentina, Brazil, Kazakhstan, the Czech Republic, Jordan, Mongolia, Egypt and the Republic of Korea . International Nuclear Energy Research...


How to Obtain Authorization to Import and/or Export Natural Gas...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canada, Chile, Colombia, Dominican Republic, El Salvador, Guatemala, Honduras, Jordan, Mexico, Morocco, Nicaragua, Oman, Panama, Peru, Republic of Korea and Singapore....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



INSAG-15 Key Practical Issues  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Amphibians and reptiles of Nouabale-Ndoki National Park, Republic of Congo Rheinbach,20 August 2007 ISSN 0036-3375149-164343SALAMANDRA  

E-Print Network (OSTI)

149 Amphibians and reptiles of Nouabale-Ndoki National Park, Republic of Congo Rheinbach,20 AugustGesellschaftfürHerpetologieundTerrarienkundee.V.(DGHT) The amphibians and reptiles of Nouabale-Ndoki National Park, Republic of Congo (Brazzaville) Kate Jackson & David along the southern edge of Nouabale-Ndoki National Park in the Republic of Congo, which comprises

Jackson, Kate


Czech Republic-Joint Programme on Resource Efficient and Cleaner Production  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Czech Republic-Joint Programme on Resource Efficient and Cleaner Production (RECP) in Developing and Transition Countries Jump to: navigation, search Name Czech Republic-Joint Programme on Resource Efficient and Cleaner Production (RECP) in Developing and Transition Countries Agency/Company /Organization United Nations Industrial Development Organization (UNIDO), United Nations Environment Programme (UNEP) Partner Ministry of Energy, Ministry of Planning, Ministry of Finance, Ministry of Environment, Ministry of Industry Sector Climate, Energy, Water Focus Area Renewable Energy, Non-renewable Energy, Agriculture, Economic Development, Goods and Materials, Industry, People and Policy, Water Conservation


Defenseless against an enemy: the history of epidemics, disease and medicine in the Republic of Texas  

E-Print Network (OSTI)

settled in the reqion until late in the republic period; thus, there were few settlers to get sick or to report on 19 health conditions. In the early 1840's. as more and more people settled in the western region, the diseases which had previously... seemed typical only of the lowlands now appeared in the newly oc- cupied region. It was exciting times for those who lived in Texas during the republic period . The young nation was deve loping and solving many of its problems. Unfortunately, health...

Depew, Diane Kay



Feasibility study of offshore wind turbine substructures for southwest offshore wind farm project in Korea  

Science Journals Connector (OSTI)

Abstract Korea has huge potential for offshore wind energy and the first Korean offshore wind farm has been initiated off the southwest coast. With increasing water depth, different substructures of the offshore wind turbine, such as the jacket and multipile, are the increasing focus of attention because they appear to be cost-effective. However, these substructures are still in the early stages of development in the offshore wind industry. The aim of the present study was to design a suitable substructure, such as a jacket or multipile, to support a 5MW wind turbine in 33m deep water for the Korean Southwest Offshore Wind Farm. This study also aimed to compare the dynamic responses of different substructures including the monopile, jacket and multipile and evaluate their feasibility. We therefore performed an eigenanalysis and a coupled aero-hydro-servo-elastic simulation under deterministic and stochastic conditions in the environmental conditions in Korea. The results showed that the designed jacket and multipile substructures, together with the modified monopile, were well located at softstiff intervals, where most modern utility-scale wind turbine support structures are designed. The dynamic responses of the different substructures showed that of the three substructures, the performance of the jacket was very good. In addition, considering the simple configuration of the multipile, which results in lower manufacturing cost, this substructure can provide another possible solution for Koreans first offshore wind farm. This study provides knowledge that can be applied for the deployment of large-scale offshore wind turbines in intermediate water depths in Korea.

Wei Shi; Jonghoon Han; Changwan Kim; Daeyong Lee; Hyunkyoung Shin; Hyunchul Park



Scientific and technical assistance to the Republic of Belarus in the wake of the Chernobyl accident  

SciTech Connect

Observations are presented in this paper from a visit to the Republic of Belarus after the Chernobyl accident. The trip was part of the Volunteers in Overseas Cooperative Assistance (VOCA) program. The primary focus of the paper is on environmental issues and the impact on agriculture. This overview discusses pertinent technical, social, and economic issues, and provides recommendations for continued international assistance. 4 refs.

Stanley, N.W.




E-Print Network (OSTI)

FISHES OF THE REPUBLIC OF EL SALVADOR,. CENTRAL AMERICA By SAMUEL F. HILDEBRAND Ichthyologist, U. S-Descriptive catalogue of the fishes occurring in the fresh waters of El Salvador _ Characinidre, _ Astyanax fasciatus INTRODUCTION This report is based upon collections made in EI Salvador during the last half of January

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

THE STATUS OF SEA TURTLE CONSERVATION IN THE REPUBLIC OF SEYCHELLES JEANNE A . MORTIMER JOHN COLLI E CHARLES MBIND O ABSTRACT Both green turtles (Chelonia mydas) and hawksbills (Eretmochelys imbricata) nest throughout the Seychelles islands. Green turtles nest predominantly in the southern islands

Prestwich, Ken


Water Use and Sustainability in La Altagracia, Dominican Republic Caitlin Grady  

E-Print Network (OSTI)

Water Use and Sustainability in La Altagracia, Dominican Republic By Caitlin Grady Tamim Younos Research Experiences for Undergraduates (NSF REU) program Grant No.0649070, the Virginia Water Resources as necessarily representing the official policies, either expressed or implied, of the Virginia Water Resources

Beex, A. A. "Louis"


National human resource development in the developing world: the Republic of Kazakhstan  

E-Print Network (OSTI)

The purpose of this study was two-fold. The first was to explore, describe and define the emerging construct of Human Resource Development (HRD) in the Republic of Kazakhstan (RKZ). The second was to examine specific national contexts and associated...

Kenzhegaranova, Madina




E-Print Network (OSTI)

China, the Republic of Korea and the ASEAN countries. Sales to these markets almost tripled. In 2010

De Luca, Alessandro


Preliminary conceptual design and cost estimation for Korea Advanced Pyroprocessing Facility Plus (KAPF+)  

Science Journals Connector (OSTI)

Abstract Korea has developed pyroprocessing technology as a potential option for recycling spent fuels (SFs) from pressurized water reactors (PWRs). The pyroprocessing consists of various key unit processes and a number of research activities have been focused on each process. However, to realize the whole pyroprocessing concept, there is a critical need for integrating the individual developments and addressing a material flow from feed to final products. In addition, the advancement on overall facility design is an indispensable aspect for demonstration and commercialization of the pyroprocessing. In this study, a facility named as Korea Advanced Pyroprocess Facility Plus (KAPF+) is conceptualized with a capacity of 400tHM/yr. The process steps are categorized based on their own characteristics while the capacities of process equipment are determined based on the current technical levels. The facility concept with a site layout of 104,000m2 is developed by analyzing the operation conditions and materials treated in each process. As an economic approach to the proposed facility, the unit cost (781$/kgHM denominated in 2009USD) for KAPF+ is also analyzed with the conceptual design with preliminary sensitivity assessments including decontamination and decommissioning costs, a discount rate, staffing costs, and plant lifetime. While classifying and describing cost details of KAPF+, this study compares the unit cost of KAPF+ treating PWR SF to that of the pyroprocessing facility treating sodium-cooled fast reactor (SFR) SF.

Won Il Ko; Ho Hee Lee; Sungyeol Choi; Sung-Ki Kim; Byung Heung Park; Hyo Jik Lee; In Tae Kim; Han Soo Lee



Newsletter Signup Form  

NLE Websites -- All DOE Office Websites (Extended Search)

EETD NEWSLETTER - MANAGE SUBSCRIPTIONS EETD NEWSLETTER - MANAGE SUBSCRIPTIONS (red fields are required) Manage subscriptions: Subscribe Unsubscribe Name E-Mail Affiliation Address Address (line 2) City State/Province Zip/Postal Code Country (please select a country) none Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegowina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Congo, the Democratic Republic of the Cook Islands Costa Rica Cote d'Ivoire Croatia (Hrvatska) Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands (Malvinas) Faroe Islands Fiji Finland France France, Metropolitan French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guinea Guinea-Bissau Guyana Haiti Heard and Mc Donald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran (Islamic Republic of) Iraq Ireland Israel Italy Jamaica Japan Jordan Kazakhstan Kenya Kiribati Korea, Democratic People's Republic of Korea, Republic of Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macau Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia, Federated States of Moldova, Republic of Monaco Mongolia Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Kitts and Nevis Saint LUCIA Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Seychelles Sierra Leone Singapore Slovakia (Slovak Republic) Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Islands Spain Sri Lanka St. Helena St. Pierre and Miquelon Sudan Suriname Svalbard and Jan Mayen Islands Swaziland Sweden Switzerland Syrian Arab Republic Taiwan, Province of China Tajikistan Tanzania, United Republic of Thailand Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates United Kingdom United States United States Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Viet Nam Virgin Islands (British) Virgin Islands (U.S.) Wallis and Futuna Islands Western Sahara Yemen Yugoslavia Zambia Zimbabwe


Assessment of Mangrove Carbon Stocks in Cameroon, Gabon, the Republic of Congo (RoC) and the Democratic Republic of Congo (DRC) Including their Potential for Reducing Emissions from Deforestation and Forest Degradation (REDD+)  

Science Journals Connector (OSTI)

We present results of the field assessment using a total of fifteen 0.1ha mangrove permanent sample plots (PSPs) in four selected countries in Central Africa, including: Cameroon, Gabon, Republic of Congo and De...

Gordon N. Ajonina; James Kairo



Abstract 1709: The effect of a XIAP inhibitor, embelin, on apoptosis of thyroid cancer cell lines  

Science Journals Connector (OSTI)

...Choi Min Ho Han Cheng-Yun Park Gi-Young Kim Byung Tae Choi Won Ho Lee Seong-Yun Jeong Dong-Eui Univ., Pusan, Republic of Korea, Dong-Eui University, Pusan, Republic of Korea, Pusan National University, Pusan, Republic of Korea...

Ji Min Han; Won Bae Kim; Ji Hye Yim; Won Gu Kim; Tae Young Kim; Hyun-Jeung Choi; Eui Young Kim; Young Kee Shong



The perceptions of information systems designers from the United States, Japan, and Korea on success and failure factors  

Science Journals Connector (OSTI)

This study examined the views of information systems (IS) designers from the United States, Japan and Korea on the importance of IS development factors in terms of how they contribute to both the success and failure of IS projects. IS designers from ... Keywords: Attribution theory, IS designers' perceptions, IS success and failure factors

Dane K. Peterson; Chung Kim; Joong Han Kim; Toshiyuki Tamura



Biomass and Carbon Storage in an Age-Sequence of Korean Pine (Pinus koraiensis) Plantation Forests in Central Korea  

Science Journals Connector (OSTI)

Korean pine (Pinus koraiensis...Sieb. et Zucc.) is one of the major plantation tree species in Korea because of high-value wood products and nuts (Son et al. 2007), covering about 8.6% of the total forest area in...

Xiaodong Li; Myong Jong Yi; Yowhan Son; Pil Sun Park



Development of an Integrated Natural Barrier Database System for Site Evaluation of a Deep Geologic Repository in Korea - 13527  

SciTech Connect

Korea Radioactive-waste Management Corporation (KRMC) established in 2009 has started a new project to collect information on long-term stability of deep geological environments on the Korean Peninsula. The information has been built up in the integrated natural barrier database system available on web (www.deepgeodisposal.kr). The database system also includes socially and economically important information, such as land use, mining area, natural conservation area, population density, and industrial complex, because some of this information is used as exclusionary criteria during the site selection process for a deep geological repository for safe and secure containment and isolation of spent nuclear fuel and other long-lived radioactive waste in Korea. Although the official site selection process has not been started yet in Korea, current integrated natural barrier database system and socio-economic database is believed that the database system will be effectively utilized to narrow down the number of sites where future investigation is most promising in the site selection process for a deep geological repository and to enhance public acceptance by providing readily-available relevant scientific information on deep geological environments in Korea. (authors)

Jung, Haeryong; Lee, Eunyong; Jeong, YiYeong; Lee, Jeong-Hwan [Korea Radioactive-waste Management Corportation - KRMC, 1045 Daedeokdaero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)] [Korea Radioactive-waste Management Corportation - KRMC, 1045 Daedeokdaero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)



G R Inc formerly known as Jawon Medical Co Ltd | Open Energy Information  

Open Energy Info (EERE)

known as Jawon Medical Co Ltd known as Jawon Medical Co Ltd Jump to: navigation, search Name G&R Inc (formerly known as Jawon Medical Co Ltd) Place Gwangju, Gwangju, Korea (Republic) Zip 506-455 Sector Solar Product Korea-based solar system integrator and project developer. Coordinates 35.15007°, 126.833847° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.15007,"lon":126.833847,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Etasolar Ltd | Open Energy Information  

Open Energy Info (EERE)

Etasolar Ltd Etasolar Ltd Jump to: navigation, search Name Etasolar Ltd Place Gyeongsan, North Gyeongsang, Korea (Republic) Zip 712-210 Sector Solar Product Korea-based manufacturer of monocrystalline PV modules, inverters, tracking systems, and solar-powered street lamp. Coordinates 35.841728°, 128.824249° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.841728,"lon":128.824249,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Kangnam Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Kangnam Co Ltd Kangnam Co Ltd Jump to: navigation, search Name Kangnam Co Ltd Place Changwon, South Gyeongsang, Korea (Republic) Zip 641 923 Sector Solar Product Korea-based manufacturer of solar heating systems and electrical boilers. Coordinates 35.268002°, 128.658524° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.268002,"lon":128.658524,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Gimcheon Enervix Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Gimcheon Enervix Co Ltd Gimcheon Enervix Co Ltd Jump to: navigation, search Name Gimcheon Enervix Co., Ltd Place Gimcheon, Korea (Republic) Zip 740-831 Sector Solar Product SPV for Gimcheon Solar PV Site 1 CDM Project, located in Gyeongbuk, Korea. Coordinates 36.038219°, 128.088318° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.038219,"lon":128.088318,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Democratic Republic of Congo-EU-UNDP Low Emission Capacity Building  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Democratic Republic of Congo-EU-UNDP Low Emission Capacity Building Programme (LECBP) Jump to: navigation, search Name Democratic Republic of Congo-EU-UNDP Low Emission Capacity Building Programme (LECBP) Agency/Company /Organization The European Union (EU), United Nations Development Programme (UNDP), German Federal Ministry for the Environment, Nature Conservation and Nuclear Safety (BMU), Australian Department of Climate Change and Energy Efficiency (DCCEE), Australian Agency for International Development (AusAID) Partner Multiple Ministries Sector Climate Focus Area Renewable Energy, Non-renewable Energy, Agriculture, Biomass, Buildings, Economic Development, Energy Efficiency, Forestry, Geothermal, Goods and Materials, Greenhouse Gas, Industry, Land Use, Offsets and Certificates, People and Policy, Solar, Transportation, Water Power, Wind


Microsoft Word - CX-Colville-Republic-Maintenance-FY13_WEB.docx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REPLY TO ATTN OF: KEPR-4 SUBJECT: Environmental Clearance Memorandum Terry Kugler Lineman Foreman III - TFSF-Bell Proposed Action: Routine maintenance on the Colville-Republic No. 1 transmission line PP&A Project No.: 2,139 Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B1.3 Routine maintenance Location: Ferry and Stevens counties, Washington; Bonneville Power Administration's (BPA) Bell District Proposed by: BPA Description of the Proposed Action: BPA proposes to replace deteriorating wood pole towers and associated components (e.g. cross arms, insulators, guy anchors, etc.) along its Colville- Republic No. 1, 115-kilovolt transmission line in Ferry and Stevens counties, Washington. This


Radon Concentration in Groundwater in the Central Region of Gyeongju, Korea - 13130  

SciTech Connect

Radon is a naturally occurring radioactive gas that is a well known cause of lung cancer through inhalation. Nevertheless, stomach cancer can also occur if radon-containing water is ingested. This study measured the radon concentration in groundwater for drinking or other domestic uses in the central region of Gyeongju, Korea. The groundwater samples were taken from 11 points chosen from the 11 administrative districts in the central region of Gyeongju by selecting a point per district considering the demographic distribution including the number of tourists who visit the ancient ruins and archaeological sites. The mean radon concentrations in the groundwater samples ranged from 14.38 to 9050.73 Bq.m{sup -3}, which were below the recommendations by the U.S. EPA and WHO. (authors)

Lee, Jung Min; Lee, A. Rim; Park, Chan Hee; Moon, Joo Hyun [Dongguk University, Seokjangdong, Gyeongju, Gyeongbuk, 780-714 (Korea, Republic of)] [Dongguk University, Seokjangdong, Gyeongju, Gyeongbuk, 780-714 (Korea, Republic of)



Development of a housing performance evaluation model for multi-family residential buildings in Korea  

Science Journals Connector (OSTI)

This paper presents the development and application of a housing performance evaluation model for multi-family residential buildings in Korea. This model is intended to encourage initiatives toward achieving better housing performance and to support a homebuyer's decision-making on housing comparison and selection. Forty-one objective and feasible housing performance indicators, which were selected from the review of existing evaluation models and interviews with experts, are classified into a series of categories. The weights of each category and indicator are calculated by using the analytic hierarchy process (AHP) analysis, and a weight is converted into credit. Next, the performance grades are divided into four levels, and evaluation criteria are suggested based on statutory performance value or the one frequently met in practice. Finally, the evaluation program and the application procedure are established through the field case study. This model can be used for objective and practical evaluation and comparison of residential housing alternatives.

Sun-Sook Kim; In-Ho Yang; Myoung-Souk Yeo; Kwang-Woo Kim



The socio-political economy of nuclear power development in Japan and South Korea  

Science Journals Connector (OSTI)

Abstract This paper analyzes the socio-cultural, political and economic conditions prevalent during the inception of nuclear power programs in Japan and South Korea in order to identify commonalities which support nuclear power program expansion. The study identifies six factors as having a clear influence on supporting nuclear power development: (1) strong state involvement in guiding economic development; (2) centralization of national energy policymaking and planning; (3) campaigns to link technological progress with national revitalization; (4) influence of technocratic ideology on policy decisions; (5) subordination of challenges to political authority, and (6) low levels of civic activism. The paper postulates that insights from this study can be used to assess the propensity of nations which have the emergent capacity to support nuclear power development to actually embark on such programs.

Scott Victor Valentine; Benjamin K. Sovacool


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Lessons Learned from Internal Fire PSAs on Candu Reactors and PWRs in Korea  

SciTech Connect

Internal fire risk has been one of the major concerns for nuclear power plants. To reduce the risk from internal fire, installing the suppression system, establishment of fire protection program, changing to qualified cables, and sealing the opening can be considered. The approaches to fire protection design are different for each plant design, and they are highly dependent on the plant type. The fire PSA revealed that the potential plant risk due to a fire event is highly dependent on the design. The approaches to fire protection design are different for each plant type, especially between Wolsong Unit 1 (Candu) and Korea Standard Nuclear Plants (KSNP). In this paper, plant design and fire PSA of Wolsong Unit 1 (Candu) were compared with those of the KSNP (PWR) to identify plant-specific and risk-significant items. (authors)

Kim, Sung-Hyun; Jeong, Beom-Hee; Kang, Sun-Koo [Integrated Safety Assessment Department Korea Power Engineering Co., 360-9, Mabuk-Ri, Kusung-Eup, Yongin-Shi, Kyunggi-Do, 449-713 (Korea, Republic of); Jeong, Young-Ki; Kim, Poong-Shick; Cho, Byung-Ok [Nuclear Safety and Technology Department, Korea Hydro and Nuclear Power Co., 167, Samseong-Dong, Gangnam-Gu, Seoul 135-791 (Korea, Republic of)



Electrical power systems (Brazil, Chile, Colombia, Dominican Republic, Guatemala, Jamaica, Panama and Peru)  

SciTech Connect

This 12-part set of reports contains market information on the following countries and topics: Brazil - potentiometers, steam turbines, gas turbines, electric generators; Chile - power systems; Colombia - electric generators; Dominican Republic - electric generators; Guatemala - power generation and distribution equipment, non-current carriers, electric generators, and turbines; Jamaica - power systems; Panama - power generation and control equipment; and Peru - power generation equipment. These reports have been processed separately for inclusion on the data base.

Not Available



Fatal Chromobacterium violaceum Bacteremia in Rural Bandundu, Democratic Republic of the Congo  

Science Journals Connector (OSTI)

Abstract We describe the first case of bacteremia due to Chromobacterium violaceum in the Democratic Republic of the Congo. This diagnosis was made in an apparently healthy adult who was admitted in a rural hospital of the province of Bandundu with a severe community-acquired sepsis. The patient develop multi-organ failure and died, being to our knowledge the first reported fatal case in an adult in Africa

Emmanuel Bottieau; Deby Mukendi; Jean-Roger Kalo; Alain Mpanya; Pascal Lutumba; Barbara Barb; Franois Chappuis; Octavie Lunguya; Marleen Boelaert; Jan Jacobs



A review of "Jesuit Science and the Republic of Letters." by Mordechai Feingold ed.  

E-Print Network (OSTI)

Science and the Republic of Letters. Cambridge: The MIT Press, 2003. xi + 483 pp. $50.00. Review by DAVID A. SALOMON, BLACK HILLS STATE UNIVERSITY. This collection of eleven essays looks at the role of science in the Society of Jesus, focusing...? works ended up on the Index of Prohibited Books in 1663. The antagonism between the Jesuits and Descartes only escalated, and eventually, Ariew writes, ?some Jesuits became enemies of Cartesian philosophy and science? (182). Alfredo Dinis reports...

David A. Salomon



Chapter 5 - Mineralogy of Burning-Coal Waste Piles in Collieries of the Czech Republic  

Science Journals Connector (OSTI)

Abstract Due to long-lasting tradition of coal mining and industrial history on the territory of Czech Republic, significant amount of waste piles of various ages and scales occur. Many of them, along with scarce occurrences of naturally burned coal measures, spontaneously ignited and subsequently, served as a source of diverse assemblage of newly formed minerals products of pyrometamorphism, alteration, and sublimation. Several new minerals associated with combustion metamorphism were first described from the Czech Republic: tschermigite (1853), rosickite (1931), letovicite (1932), kratochvlite (1937), kladnoite (1942), koktaite (1948), and rostite (1979). This chapter mainly focuses on two most famous localities, both situated to the Carboniferous sedimentary basins: Kladno Coal District in Central Bohemia near the capital Prague and Radvanice at Trutnov in Eastern Bohemia, close to border with Poland. These two localities, which were studied in detail, provided nearly 100 recently formed minerals and unnamed compounds. Sulfur and AsS efflorescence nucleated around a high-temperature coal-fire gas vent in Radvanice, Czech Republic. Photo by Vladimr ?ek, 1994.



Memorandum of Understanding between US Department of Energy and the Public Agency for Radioactive Waste Management of the Republic of Hungary  

Energy.gov (U.S. Department of Energy (DOE))

Memorandum of Understanding between US Department of Energy and the Public Agency for Radioactive Waste Management of the Republic of Hungary for information exchange relating to operation of...


Proceedings of the 3rd Workshop on Computational Approaches to Subjectivity and Sentiment Analysis, pages 110118, Jeju, Republic of Korea, 12 July 2012. c 2012 Association for Computational Linguistics  

E-Print Network (OSTI)

`ecnica de Val`encia prosso@dsic.upv.es Thamar Solorio CoRAL Lab University of Alabama at Birmingham solorio of different nature: cy- bersex logs available online and the NPS chat corpus. Naive Bayes classification based- aged (Snyder, 2000). On the Internet, attempts to solicit children have become common as well. Mitchell

Rosso, Paolo


Investigation of relativistic runaway electrons in electron cyclotron resonance heating discharges on Korea Superconducting Tokamak Advanced Research  

SciTech Connect

The behavior of relativistic runaway electrons during Electron Cyclotron Resonance Heating (ECRH) discharges is investigated in the Korea Superconducting Tokamak Advanced Research device. The effect of the ECRH on the runaway electron population is discussed. Observations on the generation of superthermal electrons during ECRH will be reported, which will be shown to be consistent with existing theory for the development of a superthermal electron avalanche during ECRH [A. Lazaros, Phys. Plasmas 8, 1263 (2001)].

Kang, C. S. [Department of Plasma Physics and Nuclear Fusion, Korea University of Science and Technology, Daejeon 305-350 (Korea, Republic of); Lee, S. G., E-mail: sglee@nfri.re.kr [Department of Plasma Physics and Nuclear Fusion, Korea University of Science and Technology, Daejeon 305-350 (Korea, Republic of); National Fusion Research Institute, Daejeon 305-806 (Korea, Republic of)



ArchiveofSID Journal of Sciences, Islamic Republic of Iran 18(2): 139-149 (2007) http://jsciences.ut.ac.ir  

E-Print Network (OSTI)

ArchiveofSID Journal of Sciences, Islamic Republic of Iran 18(2): 139-149 (2007) http the Cretaceous-Tertiary Boundary in Southwestern Iran B. Darvishzad,1,* E. Ghasemi-Nejad,2 S. Ghourchaei,2 and G of Iran 2 Department of Geology, Faculty of Science, University of Tehran, Tehran, Islamic Republic

Keller, Gerta


Integration of ground subsidence hazard maps of abandoned coal mines in Samcheok, Korea  

Science Journals Connector (OSTI)

Integrated techniques were developed, applied, and validated for the analysis of ground subsidence hazards by abandoned coal mines in Samcheok, Korea, using a geographic information system (GIS). Slope, depth of drift, distance from drift, groundwater level, permeability, geology, and land use were extracted or calculated from the digital elevation model, topographic, drift distribution, borehole, geologic, and land use database. By using the constructed spatial database, the relations between the ground subsidence location and seven related factors were identified and quantified by frequency ratio (FR), weights-of-evidence (WOE), logistic regression (LR), and artificial neural network (ANN) models. The relations were used as factor ratings in the overlay analysis to create ground subsidence hazard indices and maps. The four ground subsidence hazard maps were reflected as the new input factors and integrated using FR, WOE, LR, and ANN models to make a hazard map. All of the subsidence hazard maps were validated by comparison with known ground subsidence locations that were not used in the analysis. As a result, the integrated ground subsidence hazard maps used four new subsidence-related input factors that showed a greater accuracy (96.46% for FR, 97.22% for WOE, 97.20% for LR, and 96.70% for ANN, respectively), than the individual ground subsidence maps (95.54% for FR, 94.22% for WOE, 96.89% for LR, and 94.45% for ANN, respectively) using the first seven factors.

Hyun-Joo Oh; Saro Lee



Development of frequency modulation reflectometer for Korea Superconducting Tokamak Advanced Research tokamak  

SciTech Connect

Frequency modulation reflectometer has been developed to measure the plasma density profile of the Korea Superconducting Tokamak Advanced Research tokamak. Three reflectometers are operating in extraordinary polarization mode in the frequency range of Q band (33.654 GHz), V band (4872 GHz), and W band (72108 GHz) to measure the density up to 7 10{sup 19} m{sup ?3} when the toroidal magnetic field is 2 T on axis. The antenna is installed inside of the vacuum vessel. A new vacuum window is developed by using 50 ?m thick mica film and 0.1 mm thick gold gasket. The filter bank of low pass filter, notch filter, and Faraday isolator is used to reject the electron cyclotron heating high power at attenuation of 60 dB. The full frequency band is swept in 20 ?s. The mixer output is directly digitized with sampling rate of 100 MSamples/s. The phase is obtained by using wavelet transform. The whole hardware and software system is described in detail and the measured density profile is presented as a result.

Seo, Seong-Heon; Wi, H. M.; Lee, W. R.; Kim, H. S.; Lee, T. G.; Kim, Y. S. [National Fusion Research Institute, Daejeon 305-333 (Korea, Republic of)] [National Fusion Research Institute, Daejeon 305-333 (Korea, Republic of); Park, Jinhyung [University of Science and Technology, Daejeon 305-333 (Korea, Republic of)] [University of Science and Technology, Daejeon 305-333 (Korea, Republic of); Kang, Jin-Seob [Korea Research Institute of Standards and Science, Daejeon 305-340 (Korea, Republic of)] [Korea Research Institute of Standards and Science, Daejeon 305-340 (Korea, Republic of); Bog, M. G. [Yoonseul, Daejeon 306-120 (Korea, Republic of)] [Yoonseul, Daejeon 306-120 (Korea, Republic of); Yokota, Y.; Mase, A. [Kyushu University, Kasuga 816-8580 (Japan)] [Kyushu University, Kasuga 816-8580 (Japan)



First results on disruption mitigation by massive gas injection in Korea Superconducting Tokamak Advanced Research  

SciTech Connect

Massive gas injection (MGI) system was developed on Korea Superconducting Tokamak Advanced Research (KSTAR) in 2011 campaign for disruption studies. The MGI valve has a volume of 80 ml and maximum injection pressure of 50 bar, the diameter of valve orifice to vacuum vessel is 18.4 mm, the distance between MGI valve and plasma edge is {approx}3.4 m. The MGI power supply employs a large capacitor of 1 mF with the maximum voltage of 3 kV, the valve can be opened in less than 0.1 ms, and the amount of MGI can be controlled by the imposed voltage. During KSTAR 2011 campaign, MGI disruptions are carried out by triggering MGI during the flat top of circular and limiter discharges with plasma current 400 kA and magnetic field 2-3.5 T, deuterium injection pressure 39.7 bar, and imposed voltage 1.1-1.4 kV. The results show that MGI could mitigate the heat load and prevent runaway electrons with proper MGI amount, and MGI penetration is deeper under higher amount of MGI or lower magnetic field. However, plasma start-up is difficult after some of D{sub 2} MGI disruptions due to the high deuterium retention and consequently strong outgassing of deuterium in next shot, special effort should be made to get successful plasma start-up after deuterium MGI under the graphite first wall.

Yu Yaowei [National Fusion Research Institute, Daejeon 305-806 (Korea, Republic of); Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Kim, Young-Ok; Kim, Hak-Kun; Kim, Hong-Tack; Kim, Woong-Chae; Kim, Kwang-Pyo; Son, Soo-Hyun; Bang, Eun-Nam; Hong, Suk-Ho; Yoon, Si-Woo [National Fusion Research Institute, Daejeon 305-806 (Korea, Republic of); Zhuang Huidong [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Chen Zhongyong [Huazhong University of Science and Technology, Wuhan 430074 (China)



Estimation of tritium and helium inventory in the tritium handling system in Korea  

SciTech Connect

In Korea, the Wolsong Tritium Removal Facility (WTRF) is under construction to reduce the amount of tritium present in the moderator and coolant of the CANDU type Wolsong nuclear power plants. Recently, a study on the tritium handling system for recovery of the tritium collected from the WTRF was started. Some tritium would enter the steel of the container walls and subsequently decay to helium. This helium can deteriorate the mechanical properties of the material of the tritium handling system. To evaluate the tritium and helium inventory in the stainless steel wall of this system, the time-dependent diffusion equation was developed, solved and the results are presented in this paper. These results were compared to previous work that evaluated the tritium inventory in the stainless steel wall of 50-L tritium containers. Tritium and helium concentration profiles and the corresponding inventories were evaluated with respect to the various parameters such as exposure time, temperature, and partial pressure. After 24 years, the helium inventory in the wall of the tritium handling system exceeds the tritium inventory. (authors)

Yook, D.; Lee, S.; Lee, K. [Dept. of Nuclear Eng., KAIST, 373-1, Kusong-dong, Yusong-gu, Daejon 305-701 (Korea, Republic of); Song, K. M.; Shon, S. H. [KEPRI, 103-16 Munji-Dong, Yuseong-Gu, Daejeon, 305-380 (Korea, Republic of)



ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...


Influence of kernel size on the presence of Aspergillus flavus, aflatoxin content and moisture content in Dominican Republic grown peanuts  

E-Print Network (OSTI)

, Aflatoxin Content and Moisture Content in Dominican Republic Grown Peanuts (Auqust, 1969) Teodoro Herrera-Perez, B. S. Ingeniero Agronomo, Escuela Superior de Agricultura "Antonio Narro". Directed by: Dr. David W. Rosberg. Incidence oi As..., Dominican Republic for provid- ing the friendly environment which made this work and my stay in this c ountry !!rore enjoyable. I a!r d e;:!Iy ir d; bt-. d Lo Dr. Rafael Nirabal Roclriguc z and Nr. Tais Crouch for their friendsnip and help which fa- ci1...

Herrera-Perez, Teodoro



An assessment of infrastructure needs and project opportunities in the coal fired subsector of the former Soviet bloc republics  

SciTech Connect

At the request of Congress, the US Agency for International Development (AID) funded an assessment of the infrastructure needs of countries in the former Soviet bloc, consisting of the republics of Central and Eastern Europe, and Baltic States, the Newly Independent States (NIS), and Mongolia. This paper presents a summary of the finding submitted to AID`s Office of Capital Projects and Engineering. It describes the current status and outlook of the thermal electric infrastructure in the region and points to capital project opportunities for US products and services. The specific republics studied are listed.

Peterson, E. [Agency for International Development, Washington, DC (United States); Guerra, C. [Burns and Roe Co., Oradell, NJ (United States); Huber, D. [Burns and Roe Services Corp., Fairfax, VA (United States)



A nuclear physics program at the Rare Isotope Beams Accelerator Facility in Korea  

SciTech Connect

This paper outlines the new physics possibilities that fall within the field of nuclear structure and astrophysics based on experiments with radioactive ion beams at the future Rare Isotope Beams Accelerator facility in Korea. This ambitious multi-beam facility has both an Isotope Separation On Line (ISOL) and fragmentation capability to produce rare isotopes beams (RIBs) and will be capable of producing and accelerating beams of wide range mass of nuclides with energies of a few to hundreds MeV per nucleon. The large dynamic range of reaccelerated RIBs will allow the optimization in each nuclear reaction case with respect to cross section and channel opening. The low energy RIBs around Coulomb barrier offer nuclear reactions such as elastic resonance scatterings, one or two particle transfers, Coulomb multiple-excitations, fusion-evaporations, and direct capture reactions for the study of the very neutron-rich and proton-rich nuclides. In contrast, the high energy RIBs produced by in-flight fragmentation with reaccelerated ions from the ISOL enable to explore the study of neutron drip lines in intermediate mass regions. The proposed studies aim at investigating the exotic nuclei near and beyond the nucleon drip lines, and to explore how nuclear many-body systems change in such extreme regions by addressing the following topics: the evolution of shell structure in areas of extreme proton to neutron imbalance; the study of the weak interaction in exotic decay schemes such as beta-delayed two-neutron or two-proton emission; the change of isospin symmetry in isobaric mirror nuclei at the drip lines; two protons or two neutrons radioactivity beyond the drip lines; the role of the continuum states including resonant states above the particle-decay threshold in exotic nuclei; and the effects of nuclear reaction rates triggered by the unbound proton-rich nuclei on nuclear astrophysical processes.

Moon, Chang-Bum, E-mail: cbmoon@hoseo.edu [Hoseo University, Asan, Chung-Nam 336-795 (Korea, Republic of)] [Hoseo University, Asan, Chung-Nam 336-795 (Korea, Republic of)



Solar energy potential atlas for planning energy system off-grid electrification in the Republic of Djibouti  

E-Print Network (OSTI)

1 Solar energy potential atlas for planning energy system off-grid electrification in the Republic solar resource can therefore be an interesting mean to produce energy where it is consumed. The aimWh/m². Furthermore, the solar radiation reaching Djibouti corresponded to 20 000 times the total yearly energy

Boyer, Edmond


Description of a new octoploid frog species (Anura: Pipidae: Xenopus) from the Democratic Republic of the Congo, with a  

E-Print Network (OSTI)

of the Congo, with a discussion of the biogeography of African clawed frogs in the Albertine Rift B. J. Evans1´mocratique du Congo 4 Department of Biological Sciences, Columbia University, New York, NY, USA Keywords (Xenopus) from the Lendu Plateau in the northern Albertine Rift of eastern Democratic Republic of the Congo

Kelley, Darcy B.


Two Long-Term Instrumental Climatic Data Bases of the People's Republic of  

NLE Websites -- All DOE Office Websites (Extended Search)

9 9 DOI: 10.3334/CDIAC/cli.ndp039 Two Long-Term Instrumental Climatic Data Bases of the People's Republic of China (1997) Download the Data and ASCII Documentation files of NDP-039 Download View, download, or print PDF documentation of NDP-039 Contributed by Tao Shiyan, Fu Congbin, Zeng Zhaomei, Zhang Qingyun Institute of Atmospheric Physics Chinese Academy of Sciences Beijing, China Prepared by D. P. Kaiser (d9k@ornl.gov) Carbon Dioxide Information Analysis Center Oak Ridge National Laboratory Oak Ridge, Tennessee Environmental Sciences Division Publication No. 4699 Date Published: September 1997 Prepared for the Environmental Sciences Division Office of Biological and Environmental Research U.S. Department of Energy Budget Activity Number KP 12 04 01 0 Prepared by the

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Stock option fraud detection and an analysis for its reasons: Arabic Republic of Egypt case  

Science Journals Connector (OSTI)

This paper investigates how stock option turned from an incentive for good management to a tool of management fraud. The objective of this paper is accomplished through studying the stock option phenomenon in the Arab Republic of Egypt (ARE). Stock option grants data are obtained from all firms that have stock option grants and listed in the Egyptian stock market. The empirical study covers the period from 2006 through 2009. Detecting stock option fraud and distinguishing between control and fraud firms was done through calculating the cumulative abnormal returns before and after stock option grants. Results of this research reveal that the incidence of stock option fraud is higher in unscheduled option grants compared to scheduled ones. These results strongly support that the reason of stock option fraud in ARE is dating games rather than news announcements manipulation.

Zakia M. Alaa Eldeen; Ahmed F. Elbayoumi



Assessment of solar energy as an alternative energy source for the Republic of Panama  

SciTech Connect

A number of different applications of solar energy were selected for an assessment of the potential solar use in the industrial, commercial and agricultural sectors of the Panamanian economy. Various solar technologies are taken into consideration with the solar water heating for industrial, commercial and institutional uses being designated as preferable for a large scale implementation. The anticipated energy saving by using solar energy to provide 50% of the energy contribution for water heating for selected applications is presented. Data showing the cost of materials required for such a solar energy contribution are given. Data for the monthly average of the daily total insolation and the reliability of these data are discussed. Finally, the expected impact of solar energy use in the Republic of Panama is discussed.

Pytlinski, J.T. ( Univ. of Puerto Rico, Mayaguez); Soderstrom, K.G.; Bryson, T.; Osorio, A.



Planning the reconstruction of the electric power system in the Republic of Georgia  

SciTech Connect

The Government of the Republic of Georgia and the United States Agency for International Development (USAID) agreed, in January 1998, to carry out a study to identify and prioritize technical and financial requirements for the rehabilitation and development of Georgia`s electric power sector. The primary objective of the study was to assist the Georgian Government to define an appropriate capital investment plan for the sector through the year 2010. A secondary objective of the study was to transfer technology to power system planning to Georgian professionals engaged in the business of electricity supply. Burns and Roe together with a team of Georgian and US experts were charged with determining the least-cost options for meeting the electricity demand during the study period. The study took into account strategic needs for energy independence and environmental compliance, along with the need to reestablish reliable electric service throughout the country.

Fecho, T.R. [AEP Resources Service Co., Columbus, OH (United States); Howell, B.M.; Margvelashvili, M.; Tuckhorn, D.D. [Burns and Roe Enterprises, Inc., Pittsburgh, PA (United States); Kreczko, A. [ICF Kaiser, Fairfax, VA (United States)



Characteristics in nutritional status of patients on dialysis in south korea  

Science Journals Connector (OSTI)

Malnutrition has been shown to be an important risk factor for increased mortality in the dialysis patients, and insufficient amino acid intake is one of the causes. Especially in Korea, the protein wasting would be more prevalent and severe because protein is relatively deficient in traditional Korean diet. We investigated the nutritional parameters of 72 hemodialysis (HD) patients(men : 35, women : 37) and 63 continuous ambulatory peritoneal dialysis (CAPD) patients (men : 30, women : 33) by measureing %IBW (ideal body weight), %TSF (tricep skin fold), %MAC (mid arm circumference), %MAMC (mid arm muscle circumference), serum albumin, serum transferrin, TLC (total lymphocyte count), SGA (subjective global assessment), and by estimating energy and protein intakes with 1-month food frequency method. Between HD and CAPD group, mean age (55 12vs. 56 12yr), dialysis durations (45 31 vs. 41 24 mon), dietary energy intakes (28.3 9.0 vs. 28.8 8.6 kcal/kg/day), dietary protein intakes (1.1 0.3 vs. 1.0 0.5 g/kg/day) and incidence of co-morbid conditions (67.0% vs. 67.6%) were not significantly different. Data by using SGA showed a higher incidence of malnutrition in CAPD patients (47.8%) than in HD patients (35.2%). %IBW (p < 0.001), %TSF (p < 0.001) and %MAC (p < 0.001) were higher in CAPD patients than were in HD patients. But serum albumin (p < 0.001) and transferrin (p < 0.001) were significantly lower in CAPD patients than were in HD patients. A higher incidence of malnutrition was shown in CAPD Patients than in HD Patients due to different dialysis type. A significant finding was that CAPD showed protein deficient malnutrition and HD did calorie deficient malnutrition. In conclusion, specialized nutrition education depending on dialytic modality should be necessary to efficiently improve nutritional status, and it can be postulated that essential amino acid and other supplement are helpful for improving nutritional status in dialysis patients, especially in peritoneal dialysis patients

Jonghyo Lee



Evaluation of the long-term power generation mix: The case study of South Korea's energy policy  

Science Journals Connector (OSTI)

Abstract This paper presents a practical portfolio model for the long-term power generation mix problem. The proposed model optimizes the power generation mix by striking a trade-off between the expected cost of power generation and its variability. We use Monte Carlo simulation techniques to consider the uncertainty associated with future electricity demand, fuel prices and their correlations, and the capital costs of power plants. Unlike in the case of conventional power generation mix models, we employ \\{CVaR\\} (Conditional Value-at-Risk) in designing variability to consider events that are rare but enormously expensive. A comprehensive analysis on South Korea's generation policy using the portfolio model shows that a large annual cost is additionally charged to substitute a portion of nuclear energy with other alternatives. Nonetheless, if Korea has to reduce its dependency on nuclear energy because of undermined social receptivity from the Fukushima disaster, it turns out that LNG or coal could be a secure candidate from an economic perspective.

Daiki Min; Jaewoo Chung



The estimation of N{sub 2}O emissions from municipal solid waste incineration facilities: The Korea case  

SciTech Connect

The greenhouse gases (GHGs) generated in municipal solid waste (MSW) incineration are carbon dioxide (CO{sub 2}), methane (CH{sub 4}), and nitrous oxide (N{sub 2}O). In South Korea case, the total of GHGs from the waste incineration facilities has been increasing at an annual rate 10%. In these view, waste incineration facilities should consider to reduce GHG emissions. This study is designed to estimate the N{sub 2}O emission factors from MSW incineration plants, and calculate the N{sub 2}O emissions based on these factors. The three MSW incinerators examined in this study were either stoker or both stoker and rotary kiln facilities. The N{sub 2}O concentrations from the MSW incinerators were measured using gas chromatography-electron capture detection (GC-ECD) equipment. The average of the N{sub 2}O emission factors for the M01 plant, M02 plant, and M03 plant are 71, 75, and 153 g-N{sub 2}O/ton-waste, respectively. These results showed a significant difference from the default values of the intergovernmental panel on climate change (IPCC), while approaching those values derived in Japan and Germany. Furthermore, comparing the results of this study to the Korea Energy Economics Institute (KEEI) (2007) data on waste incineration, N{sub 2}O emissions from MSW incineration comprised 19% of the total N{sub 2}O emissions.

Park, Sangwon; Choi, Jun-Ho [Department of Chemical and Biomolecular Engineering, Yonsei University, 262 Seongsanno, Seodaemun-gu, Seoul 120-749 (Korea, Republic of); Park, Jinwon, E-mail: jwpark@yonsei.ac.kr [Department of Chemical and Biomolecular Engineering, Yonsei University, 262 Seongsanno, Seodaemun-gu, Seoul 120-749 (Korea, Republic of)



Picking up the bill - improving health-care utilisation in the Democratic Republic of Congo through user fee subsidisation: a before and after study  

Science Journals Connector (OSTI)

User fees have been shown to constitute a major barrier to the utilisation of health-care, particularly in low-income countries such as the Democratic Republic of Congo (DRC). Importantly, such barriers can le...

Rishma Maini; Rafael Van den Bergh; Johan van Griensven



Pacific Basin Nuclear Conference (PBNC 2012), BEXCO, Busan, Korea, March 18 ~ 23, 2012 CHALLENGES OF CYBER SECURITY FOR NUCLEAR POWER PLANTS  

E-Print Network (OSTI)

PBNC 2012 CHALLENGES OF CYBER SECURITY FOR NUCLEAR POWER PLANTS Kwangjo Kim KAIST, Daejeon, Korea.kim@kustar.ac.ae Abstract Nuclear Power Plants (NPPs) become one of the most important infrastructures in providing improvement. 1. Introduction Nuclear Power Plants (NPPs) become one of the most important infrastructures

Kim, Kwangjo


A Study on Optimized Management Options for the Wolsong Low- and Intermediate - Level Waste Disposal Center in Korea - 13479  

SciTech Connect

The safe and effective management of radioactive waste is a national task required for sustainable generation of nuclear power and for energy self-reliance in Korea. Currently, for permanent disposal of low- and intermediate-level waste (LILW), the Wolsong LILW Disposal Center (WLDC) is under construction. It will accommodate a total of 800,000 drums at the final stage after stepwise expansion. As an implementing strategy for cost-effective development of the WLDC, various disposal options suitable for waste classification schemes would be considered. It is also needed an optimized management of the WLDC by taking a countermeasure of volume reduction treatment. In this study, various management options to be applied to each waste class are analyzed in terms of its inventory and disposal cost. For the volume reduction and stabilization of waste, the vitrification and plasma melting methods are considered for combustible and incombustible waste, respectively. (authors)

Park, JooWan; Kim, DongSun; Choi, DongEun [Korea Radioactive Waste Management Corporation, Korea 89, Bukseongno, Gyeongju, 780-050 (Korea, Republic of)] [Korea Radioactive Waste Management Corporation, Korea 89, Bukseongno, Gyeongju, 780-050 (Korea, Republic of)



Prime GLP Inc | Open Energy Information  

Open Energy Info (EERE)

GLP Inc GLP Inc Jump to: navigation, search Name Prime GLP Inc Place Anseong, Gyeonggi-do, Korea (Republic) Zip 456-933 Sector Solar Product Korean supplier of scrap silicon to the solar industry. Coordinates 37.019451°, 127.315132° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.019451,"lon":127.315132,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Komex Electronics Material Inc KEMI | Open Energy Information  

Open Energy Info (EERE)

Komex Electronics Material Inc KEMI Komex Electronics Material Inc KEMI Jump to: navigation, search Name Komex Electronics Material Inc (KEMI) Place Seoul, Seoul, Korea (Republic) Zip 135709 Sector Solar Product Korean supplier of semiconductor materials for the solar industry. Coordinates 37.557121°, 126.977379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.557121,"lon":126.977379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Unison Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Unison Co Ltd Unison Co Ltd Jump to: navigation, search Name Unison Co Ltd Place Cheonan, South Chungcheong, Korea (Republic) Zip 330 882 Sector Solar, Wind energy Product Korean solar and wind project developer; manufacturer of turbine components and PV modules. Coordinates 36.791431°, 127.220459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.791431,"lon":127.220459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Daiyang Metal Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Daiyang Metal Co Ltd Daiyang Metal Co Ltd Jump to: navigation, search Name Daiyang Metal Co Ltd Place Seoul, Seoul, Korea (Republic) Zip 137-040 Sector Solar Product Stainless steel manufacturing and CIGS solar cell maker. Coordinates 37.557121°, 126.977379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.557121,"lon":126.977379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hex Power System | Open Energy Information  

Open Energy Info (EERE)

Hex Power System Hex Power System Jump to: navigation, search Name Hex Power System Place Seoul, Korea (Republic) Zip 152-780 Sector Solar Product Main business in manufacturing solar inverters. Coordinates 37.557121°, 126.977379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.557121,"lon":126.977379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geo Energy Technology | Open Energy Information  

Open Energy Info (EERE)

Geo Energy Technology Geo Energy Technology Place Gangwon-Do, Korea (Republic) Zip 210-792 Sector Solar Product Manufacturs biodiesel plants and designs and constructs solar power systems. Coordinates 37.81773°, 128.234558° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.81773,"lon":128.234558,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Haesung Solar Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Haesung Solar Co Ltd Haesung Solar Co Ltd Jump to: navigation, search Name Haesung Solar Co Ltd Place Gyeonggi, Korea (Republic) Zip 411-722 Sector Solar Product Specialist manufacturer of PV modules, mini-solar modules (1.4W to 160W), and OEM solar modules. Coordinates 37.585381°, 127.180923° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.585381,"lon":127.180923,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Template-Free Electrochemical Synthesis of Sn Nanofibers as High-Performance Anode Materials for Na-Ion Batteries  

Science Journals Connector (OSTI)

Department of Materials Science and Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701, Republic of Korea ... sciences and engineering. ...

Do-Hwan Nam; Tae-Hee Kim; Kyung-Sik Hong; Hyuk-Sang Kwon




SciTech Connect

The Global Threat Reduction Initiative (GTRI) reduces and protects vulnerable nuclear and radiological material located at civilian sites worldwide from sabotage, theft or diversion. The GTRI has worked successfully with foreign countries to remove and protect nuclear and radioactive materials including high-activity sources used in medical, commercial, and research applications. There are many barriers to successful bilateral cooperation that must be overcome including language, preconceived perceptions, long distances, and different views on the threat and protection requirements. Successful cooperation is often based on relationships and building trusting relationships takes time. In the case of Dominican Republic, the GTRI first received contact in 2008 from the Government of Dominican Republic. They requested cooperation that was similar to the tri-partite cooperation between Colombia, Mexico and the United States. Throughout the region it was widely known that the GTRIs cooperation with the Government of Colombia was a resounding success resulting in the securing of forty sites; the consolidation of numerous disused/orphan sources at a secure national storage facility; and, the development of a comprehensive approach to security including, inter alia, training and sustainability. The Government of Colombia also showcased this comprehensive approach to thirteen Central American and Caribbean countries at a GTRI regional security conference held in Panama in October 2004. In 2007, Colombia was an integral component of GTRI multi-lateral cooperation initiation in Mexico. As a result, twenty two of Mexicos largest radioactive sites have been upgraded in the past eighteen months. These two endeavors served as catalysts for cooperation opportunities in the Dominican Republic. Representatives from the Colombian government were aware of GTRIs interest in initiating cooperation with the Government of Dominican Republic and to facilitate this cooperation, they traveled to the Dominican Republic and provided briefings and presentations which demonstrated its successful cooperation with the GTRI. Shortly after that visit, the Government of Dominican Republic agreed to move forward and requested that the cooperative efforts in Dominican Republic be performed in a tripartite manner, leveraging the skills, experience, and resources of the Colombians, and the financial and technical support of the United States. As a result, two of Dominican Republics largest radioactive sites had security upgrades in place within 90 days of the cooperation visit in December 2008.

Butler, Nicholas; McCaw, Erica E.; Wright, Kyle A.; Medina, Maximo



Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

41 - 7050 of 31,917 results. 41 - 7050 of 31,917 results. Download EIS-0291: Notice of Intent to Prepare an Environmental Impact Statement High Flux Beam Reactor Transition Project at the Brookhaven National Laboratory, Upton, New York http://energy.gov/nepa/downloads/eis-0291-notice-intent-prepare-environmental-impact-statement Download Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea http://energy.gov/downloads/joint-statement-energy-ministers-g8-people-s-republic-china-india-and-republic-korea Download Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea (June 2008) http://energy.gov/downloads/joint-statement-energy-ministers-g8-people-s-republic-china-india-and-republic-korea-june


Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular  

E-Print Network (OSTI)

Department of Pediatric Imaging, Tokyo Metropolitan Children's Medical Center, Tokyo, Japan i Seitoku University, Chiba, Japan j Department of Radiology, Gachon University Gil Medical Center, Incheon, Republic, Seoul, Republic of Korea m Department of Pediatrics Samsung Medical Center, Sungkyunkwan University

Lee, Jooyoung

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - assistance case study Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

of the 11th Asia... Experience Assistant in Research, September 2010 - present Liberty Research Group, Department of Computer... , Republic of Korea Assistant in...


Secretary Bodman and Rosatom Director Kiriyenko Meet to Discuss...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to nuclear power, including: Australia, Bulgaria, Canada, Ghana, Hungary, Italy, Jordan, Kazakhstan, Lithuania, Poland, Republic of Korea, Romania, Senegal, Slovenia, and...


Global Nuclear Energy Partnership Inaugural Steering Group Meeting...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

members, Australia, Bulgaria, Canada, China, France, Ghana, Hungary, Italy, Japan, Jordan, Kazakhstan, Lithuania, Poland, Republic of Korea, Romania, Russia, Slovenia and...


Renetec Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Korea (Republic) Sector: Solar Product: A specialist installer of solar, tidal, and biogas power generation plants. References: Renetec Co Ltd1 This article is a stub. You can...


Slide12 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Current ETDE Member Countries Brazil Canada Denmark Finland France Germany Korea, Republic of Mexico The Netherlands Norway Portugal Spain Sweden Switzerland United Kingdom United...


Slide04 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Current ETDE Member Countries Brazil Canada Denmark Finland France Germany Korea, Republic of Mexico The Netherlands Norway Portugal Spain Sweden Switzerland United Kingdom United...


The power of the family  

E-Print Network (OSTI)

Denmark, Estonia, Spain, Finland, France, Great Britain,ties Croatia Algeria Finland Sweden Latvia Czech RepublicRep. South Africa (Union of) Finland Korea Mexico Bangladesh

Alesina, Alberto; Giuliano, Paola



Citizens' social media use and homeland security information policy: Some evidences from Twitter users during the 2013 North Korea nuclear test  

Science Journals Connector (OSTI)

Abstract In the era of Web 2.0, managing risk communication on social networking sites has increasingly become crucial and complicated issues in the field of homeland security. The response to the 2013 nuclear test in North Korea was largely based on a coordinated effort by Korea's Ministry of Defense, the United Nations, and many countries from around the globe. By analyzing risk communication networks emerged from Twitter users for the period from January 30 to February 24, 2013, this study investigates the way in which citizens' risk communication is formulated through social media and how they transmit risk information in homeland security. Analysis results show the dynamic evolution of risk communication networks based on influential actors with critical information who played pivotal roles in distributing this information to other actors.

Kyujin Jung; Han Woo Park



Experiences in the field of radioactive materials seizures in the Czech Republic  

SciTech Connect

In recent years, the amount of radioactive materials seizures (captured radioactive materials) has been rising. It was above all due to newly installed detection facilities that were able to check metallic scrap during its collection in scrap yards or on the entrance to iron-mills, checking municipal waste upon entrance to municipal disposal sites, even incineration plants, or through checking vehicles going through the borders of the Czech Republic. Most cases bore a relationship to secondary raw materials or they were connected to the application of machines and installations made from contaminated metallic materials. However, in accordance to our experience, the number of cases of seizures of materials and devices containing radioactive sources used in the public domain was lower, but not negligible, in the municipal storage yards or incineration plants. Atomic Act No. 18/1997 Coll. will apply to everybody who provides activities leading to exposure, mandatory assurance as high radiation safety as risk of the endangering of life, personal health and environment is as low as reasonably achievable in according to social and economic aspects. Hence, attention on the examination of all cases of the radioactive material seizure based on detection facilities alarm or reasonably grounds suspicion arising from the other information is important. Therefore, a service carried out by group of workers who ensure assessment of captured radioactive materials and eventual retrieval of radioactive sources from the municipal waste has come into existence in the Nuclear Research Institute Rez plc. This service has covered also transport, storage, processing and disposal of found radioactive sources. This service has arisen especially for municipal disposal sites, but later on even other companies took advantage of this service like incineration plants, the State Office for Nuclear Safety, etc. Our experience in the field of ensuring assessment of captured radioactive materials and eventual retrieval of radioactive sources will be presented in the paper. (authors)

Svoboda, Karel; Podlaha, Josef; Sir, David; Mudra, Josef [Nuclear Research Institute Rez plc (Czech Republic)



Two long-term instrumental climatic data bases of the People`s Republic of China  

SciTech Connect

Two long-term instrumental data bases containing meteorological observations from the People`s Republic of China (PRC) are described. These data sets were compiled in accordance with a joint research agreement signed by the United States Department of Energy (DOE) and the PRC Chinese Academy of Sciences (CAS) on August 19, 1987. CAS has provided records from 265 stations, partitioned into networks of 60 and 205 stations which each provide good geographical coverage of the PRC. The 60-station network data contain monthly measurements of barometric pressure, air temperature, precipitation amount, relative humidity, sunshine duration, cloud amount, wind direction and speed, and number of days with snow cover. Detailed station histories are presented for all 60 stations. The 205-station network data contain monthly mean temperatures and monthly precipitation totals; however, station histories are not currently available. Sixteen stations from these data sets (13 from the 60-station, 3 from the 205-station) have temperature and/or precipitation records which begin prior to 1900, whereas the remaining stations began observing in the early to mid 1900s. Records from the 262 stations extend through 1988; the remaining three station records extend through the early 1980s. These data can be used in defining regional climate changes, establishing relationships between regional and large-scale climates, and in studying the climatic impacts of urbanization and increased concentrations of greenhouse gases. Additional uses could include examining impacts of periodic events such as volcanic eruptions or the El Nino/Southern Oscillation (ENSO). These data sets represent the most comprehensive, long-term instrumental Chinese climate data presently available.

Kaiser, D.P.



Two long-term instrumental climatic data bases of the People's Republic of China  

SciTech Connect

Two long-term instrumental data bases containing meteorological observations from the People's Republic of China (PRC) are described. These data sets were compiled in accordance with a joint research agreement signed by the United States Department of Energy (DOE) and the PRC Chinese Academy of Sciences (CAS) on August 19, 1987. CAS has provided records from 265 stations, partitioned into networks of 60 and 205 stations which each provide good geographical coverage of the PRC. The 60-station network data contain monthly measurements of barometric pressure, air temperature, precipitation amount, relative humidity, sunshine duration, cloud amount, wind direction and speed, and number of days with snow cover. Detailed station histories are presented for all 60 stations. The 205-station network data contain monthly mean temperatures and monthly precipitation totals; however, station histories are not currently available. Sixteen stations from these data sets (13 from the 60-station, 3 from the 205-station) have temperature and/or precipitation records which begin prior to 1900, whereas the remaining stations began observing in the early to mid 1900s. Records from the 262 stations extend through 1988; the remaining three station records extend through the early 1980s. These data can be used in defining regional climate changes, establishing relationships between regional and large-scale climates, and in studying the climatic impacts of urbanization and increased concentrations of greenhouse gases. Additional uses could include examining impacts of periodic events such as volcanic eruptions or the El Nino/Southern Oscillation (ENSO). These data sets represent the most comprehensive, long-term instrumental Chinese climate data presently available.

Kaiser, D.P.



Design, development and deployment of public service photovoltaic power/load systems for the Gabonese Republic. Final report  

SciTech Connect

Five different types of public service photovoltaic power/load systems installed in the Gabonese Republic are discussed. The village settings, the systems, performance results and some problems encountered are described. Most of the systems performed well, but some of the systems had problems due to failure of components or installation errors. The project was reasonably successful in collecting and reporting data for system performance evaluation that will be useful for guiding officials and system designers involved in village power applications in developing countries.

Kaszeta, W.J.



Application of various membranes to remove NOM typically occurring in Korea with respect to DBP, AOC and transport parameters  

Science Journals Connector (OSTI)

Bench- and pilot-scale membrane tests were performed to remove natural organic matter (NOM) originating from Paldang Lake in Korea. Membrane performance was demonstrated in terms of DOC, biodegradable organic carbon (BDOC), assimilable organic carbon (AOC), and transport parameters. Various membranes such as reverse osmosis (RO), nanofiltration (NF) and ultrafiltration (UF) were investigated for this study. Four different NF membranes were selected for pilot-scale filtration testing and investigated in terms of both flux decline and DOC removal. To demonstrate the effect of temperature on the source water seasonally, the flux of membranes was measured with pure water at different temperatures ranging from 25 to 7C. Coagulation/sedimentation treated water was used as feed water without removing residual chlorine; related plants were located at the Suji water treatment plant of Yongin City. To investigate more rigorously the organic fouling for various NF membranes, mass transport behaviors of organic matter solutes were evaluated by an irreversible thermodynamic model. The pore sizes of the NF membranes tested in the pilot slightly increased due to the oxidation of the polymer structure of the membranes from residual chlorine during the 4-month tests. Periodic chemical cleaning with a caustic solution was made to prevent accumulation of foulants on the membrane surface. The NF membranes exhibited stable efficiencies in terms of DOC and AOC removal during the test for 4 months.

Noeon Park; Boksoon Kwon; Minjeong Sun; Hyowon Ahn; Chunghwan Kim; Changho Kwoak; Dongju Lee; Seonha Chae; Hoon Hyung; Jaeweon Cho



A process leading to strategic alliance outcome: The case of IT companies in China, Japan and Korea  

Science Journals Connector (OSTI)

Abstract Although theories and research have provided valuable information on strategic alliance, it still seems difficult for practitioners to overview the process and subsequent outcomes of strategic alliance in a single frame. This is because the conditions of alliance are different from one alliance to another, which makes it difficult for practitioners to apply existing research findings to their own cases. One of the ways to overcome such difficulties in practical application would not be focusing on alliance processes with unique or idiosyncratic features of each alliance but instead focusing on elements that exist in most alliances. To find out the process that leads to the outcome in strategic alliance that is easily applicable for practitioners, the current study measured the behavioral direction and relational outcomes of strategic alliance based on benefit and risk perception in information technology (IT) companies in China, Japan and South Korea. Results show that firms set the direction and the intensity of their participation in alliance based on benefit and risk perception. Specifically, while perceived benefits promoted active participation in alliance, perceived risks increased protective participation in alliance. Also, these behavioral directions predicted the relational outcome in strategic alliance such that while active behavioral orientation predicted commitment to the relationship with the partner firms, protective behavioral orientation led to dissolution of the relationship. The present study provides useful insights for strategy associates, and evoke more various and detached academic approaches in the field of strategic alliance discussions.

Inwon Kang; Shin Han; Geon-Cheol Shin



Coal upgrading program for Usti nad Labem, Czech Republic: Task 8.3. Topical report, October 1994--August 1995  

SciTech Connect

Coal has been a major energy source in the Czech Republic given its large coal reserves, especially brown coal and lignite (almost 4000 million metric tons) and smaller reserves of hard, mainly bituminous, coal (over 800 million tons). Political changes since 1989 have led to the reassessment of the role of coal in the future economy as increasing environmental regulations affect the use of the high-sulfur and high-ash brown coal and lignite as well as the high-ash hard coal. Already, the production of brown coal has declined from 87 million metric tons per year in 1989 to 67 million metric tons in 1993 and is projected to decrease further to 50 million metric tons per year of brown coal by the year 2000. As a means of effectively utilizing its indigenous coal resources, the Czech Republic is upgrading various technologies, and these are available at different stages of development, demonstration, and commercialization. The purpose of this review is to provide a database of information on applicable technologies that reduce the impact of gaseous (SO{sub 2}, NO{sub x}, volatile organic compounds) and particulate emissions from the combustion of coal in district and residential heating systems.

Young, B.C.; Musich, M.A.



Indo-German (CSIR BMBF) Joint Call for Proposals 2013 Within the agreement of Indo-German cooperation in S&T of 1974, Federal Republic  

E-Print Network (OSTI)

-German cooperation in S&T of 1974, Federal Republic of Germany, defining cooperation in Science and Technology of Scientific and Industrial Research, Ministry of Science & Technology, Government of India, New Delhi to SMEs and to a limited extent. German industries are asked to see the German call text for further

Jayaram, Bhyravabotla


''A far more formidable task'': the 101st Airborne Division's pacification of Thua Thien Province, Republic of Vietnam, 1968-1972  

E-Print Network (OSTI)

This thesis seeks to identify, describe, and analyze the tactics used by the 101st Airborne Division in the pacification of the Republic of Vietnam's Thua Thien province from 1968 to 1972. Despite the larger calamity of the Vietnam War, the 101st...

Werkheiser, Edwin Brooks, II



Scale-dependent gas hydrate saturation estimates in sand reservoirs in the Ulleung Basin, East Sea of Korea  

Science Journals Connector (OSTI)

Through the use of 2-D and 3-D seismic data, several gas hydrate prospects were identified in the Ulleung Basin, East Sea of Korea and thirteen drill sites were established and logging-while-drilling (LWD) data were acquired from each site in 2010. Sites UBGH26 and UBGH210 were selected to test a series of high amplitude seismic reflections, possibly from sand reservoirs. LWD logs from the UBGH26 well indicate that there are three significant sand reservoirs with varying thickness. Two upper sand reservoirs are water saturated and the lower thinly bedded sand reservoir contains gas hydrate with an average saturation of 13%, as estimated from the P-wave velocity. The well logs at the UBGH26 well clearly demonstrated the effect of scale-dependency on gas hydrate saturation estimates. Gas hydrate saturations estimated from the high resolution LWD acquired ring resistivity (vertical resolution of about 58cm) reaches about 90% with an average saturation of 28%, whereas gas hydrate saturations estimated from the low resolution A40L resistivity (vertical resolution of about 120cm) reaches about 25% with an average saturation of 11%. However, in the UBGH210 well, gas hydrate occupies a 5-m thick sand reservoir near 135mbsf with a maximum saturation of about 60%. In the UBGH210 well, the average and a maximum saturation estimated from various well logging tools are comparable, because the bed thickness is larger than the vertical resolution of the various logging tools. High resolution wireline log data further document the role of scale-dependency on gas hydrate calculations.

M.W. Lee; T.S. Collett



Genetic variation of the HIV-1 integrase region in newly diagnosed anti-retroviral drug-nave patients with HIV/AIDS in Korea  

Science Journals Connector (OSTI)

Abstract The survival time of HIV/AIDS patients in Korea has increased since HAART (highly active anti-retroviral therapy) was introduced. However, the occurrence of drug-resistant strains requires new anti-retroviral drugs, one of which, an integrase inhibitor (INI), was approved by the US Food and Drug Administration (FDA) in 2007. \\{INIs\\} have been used for therapy in many countries and are about to be employed in Korea. Therefore, it is important to identify basic mutant variants prior to the introduction of \\{INIs\\} in order to estimate their efficacy. To monitor potential drug-resistant INI mutations in Korean HIV/AIDS patients, the polymorphism of the int gene was investigated together with the pol gene using a genotypic assay for 75 randomly selected Korean HIV-1 patients newly diagnosed in 2007. The drug-resistant mutation sequences were analysed using the Stanford HIV DB and the International AIDS Society resistance testing-USA panel (IAS-USA). Seventy strains of Korean subtype B were compared with foreign subtype-B strains, and there were no significantly different variants of the int gene region in the study population. Major mutation sites in the integrase (E92Q, F121Y, G140A/S, Y143C/R, Q148H/R/K and N155H) were not detected, and only a few minor mutation sites (L74M, V151I, E157Q, V165I, I203M, S230N and D232N) were identified in 21 strains (28%). Resistance due to mutations in the pol gene was observed in a single strain (1.3%) resistant to protease inhibitors (PIs) and in four strains (5.3%) resistant to reverse transcriptase inhibitors (RTIs). In summary, this demonstrates that \\{INIs\\} will be susceptible to drug nave HIV/AIDS patients in Korea.

J.-Y. Kim; E.-J. Kim; J.-Y. Choi; O.-K. Kwon; G.J. Kim; S.Y. Choi; S.S. Kim



Towards democratic consolidation in Africa? A look at the 28 November 2011 elections in the Democratic Republic of Congo  

Science Journals Connector (OSTI)

On 18 February 2006, President Joseph Kabila promulgated a new constitution for the Democratic Republic of Congo. This constitution was approved by referendum on 18-19 December 2005. It provides for a democratic state based on respect for the rule of law and the organisation of multiparty, free and fair elections. The 28 November 2011 elections were the second elections held under this constitution after the ones that took place in July 2006. This paper is based on the assumption that although democracy requires the holding of elections, the two concepts are not synonymous. Against this background, it critically reflects on the 28 November 2011 elections in Congo, the legislative framework that governed these elections, the results and the different reactions. It concludes that they were not free and fair and stresses the conditions for elections leading to democratic consolidation in this country and the rest of the African continent.

Mpfariseni Budeli; Andre Mbata B. Mangu


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Exploring open innovation approaches adopted by small and medium firms in emerging/growth industries: case studies from Daegu-Gyeongbuk region of South Korea  

Science Journals Connector (OSTI)

This study explores the status of open innovation in small and medium firms that operate in emerging or growth technological industries that have been designated as new growth engines in the Daegu-Gyeongbuk district in South Korea. Chesbrough (2003, 2006a,b) had demonstrated that the motive power of growth and development of big enterprises, be it in hi-tech or low-tech industries of USA, is 'open innovation'. Studies that followed examined the relationship between open innovation and industry performance had focused considerably on developed/mature industries. Though they analysed open innovation of small and medium firms, their analysis was limited to statistical relationships between open innovation and industry performances. Through the case studies this study's findings indicate that small and medium firms in South Korea seem to be dynamically adopting open innovation in the process of changing their business lines to more prospective hi-tech areas for their existence. It also seems that continuous growth and development could not be expected with closed innovation, and that the existence of small and medium firms can be threatened during verification period because it takes considerable time to get approval or support form markets or science and technology business circle.

Jin-Hyo Joseph Yun; Avvari V. Mohan



EA-1977: Acceptance and Disposition of Used Nuclear Fuel Containing U.S.-Origin Highly Enriched Uranium from the Federal Republic of Germany  

Energy.gov (U.S. Department of Energy (DOE))

This environmental assessment (EA) will evaluate the potential environmental impacts of a DOE proposal to accept used nuclear fuel from the Federal Republic of Germany at DOEs Savannah River Site (SRS) for processing and disposition. This used nuclear fuel is composed of kernels containing thorium and U.S.-origin highly enriched uranium (HEU) embedded in small graphite spheres that were irradiated in nuclear reactors used for research and development purposes.


HiTech Solar | Open Energy Information  

Open Energy Info (EERE)

Solar Place: Uherske Hradiste, Czech Republic Zip: 686 01 Sector: Solar Product: HiTech Solar is a PV equiptment distributor and solar project developer. They are a division of...


Porous GaN nanowires synthesized using thermal chemical vapor deposition  

E-Print Network (OSTI)

Seo a , Jeunghee Park a,*, Hyunik Yang b , Bongsoo Kim c a Department of Chemistry, Korea University-791, Republic of Korea c Department of Chemistry, Korea Advanced Institute of Science and Technology, Daejeon nanotube-confined reaction [4], arc discharge [5], laser ablation [6], sublimation [7], pyrolysis [8

Kim, Bongsoo


POSCO Engineering Construction Co Ltd POSCO E C | Open Energy Information  

Open Energy Info (EERE)

POSCO Engineering Construction Co Ltd POSCO E C POSCO Engineering Construction Co Ltd POSCO E C Jump to: navigation, search Name POSCO Engineering & Construction Co Ltd (POSCO E&C) Place Gyeongsangbuk-Do, Korea (Republic) Zip 790-704 Sector Biomass, Renewable Energy Product Korea's major engineering and construction companies; builds incinerators for biomass and builds renewable energy plants and systems. Coordinates 36.351452°, 128.694275° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.351452,"lon":128.694275,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...


Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...


Exploring zipping and assembly as a protein folding principle  

E-Print Network (OSTI)

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member


Designing policies for reducing future emissions of greenhouse gases in the People`s Republic of China  

SciTech Connect

The People`s Republic of China has recognized the importance of climate change concerns and has signed the Climate Change Convention formulated at the United Nations Conference on Environment and Development. China is now beginning the process of developing an appropriate response strategy for climate change. Several projects have been initiated that deal with various aspects of global climate change. The Asian Development Bank is assisting the Chinese Government in this endeavor by providing technical assistance under an agreement signed in August 1992. The Bank selected a team of international consultants, coordinated by the East-West Center in Hawaii and including Argonne National Laboratory and Japanese scientists, to work closely with Chinese scientists to develop information that would contribute to a national response strategy. The Chinese research team is led by scientists from Tsinghua University and includes specialists from a number of research institutes and government agencies, all under the aegis of the State Science and Technology Commission. This paper presents results from the study concerning the interrelationship between economic growth, energy use, and carbon dioxide emissions in China. The study shows that, despite rapid improvements in energy efficiency and development of nonfossil-fuel energy sources, it will be difficult to prevent a two- to three-fold increase in carbon dioxide emissions between 1990 and 2050.

Streets, D.G. [Argonne National Lab., IL (United States); Jiankun, H.; Zongxin, W. [Tsinghua Univ., Beijing (China). Inst. of Nuclear Energy Technology; Siddiqi, T.A. [East-West Center, Honolulu, HI (United States)



Dispossession, displacement and resistance: Artisanal miners in a gold concession in South-Kivu, Democratic Republic of Congo  

Science Journals Connector (OSTI)

Abstract This article reports on an empirical study of the relationship between artisanal and industrial mining at the Twangiza gold concession in South Kivu Province, Democratic Republic of Congo (DRC). The setting is a post-conflict context where artisanal mining activities have supported livelihoods for several decades, but where the arrival of a multinational company, with explicit backing from the national government, has caused dispossession and displacement and altered local power relations, leaving former artisanal miners with few alternatives for making a living. Although Congolese law recognizes artisanal mining and policies have been proposed to formalize and support this sector, reality is often very different and artisanal miners frequently clash with industrial enterprises. This article argues that, in order to understand the dynamics underlying these clashes, closer attention needs to be paid to the practices and discourses of the artisanal miners themselves: how do they conceptualize notions such as property, legitimacy and livelihood, and what is their outlook on development? The empirical analysis shows how miners in Twangiza resist dispossession by the multinational corporation in both words and actions.

Sara Geenen



Radioxenon detections in the CTBT International Monitoring System likely related to the announced nuclear test in North Korea conducted on February 12, 2013  

SciTech Connect

Abstract: Observations of the radioxenon isotopes 133Xe and 131mXe collected at the IMS stations RN38 and RN58 on April 7-8, and April 12-13 2013, respectively, are unique with respect to the measurement history of these stations. Comparison of measured data with calculated isotopic ratios as well as analysis using atmospheric transport modeling indicate that it is likely that the xenon measured was created in the underground nuclear test conducted by North Korea on February 12, 2013, and released 7 weeks later. More than one release is required to explain all observations. The 131mXe source terms for each release were calculated to 7x1011 Bq, corresponding to about 1-10% of the total xenon inventory for a 10-kt explosion, depending on fractionation and release scenario. The observed ratios could not be used to obtain any information regarding the fissile material that was used in the test.

Ringbom, Anders; Axelssson, A.; Aldener, M.; Auer, M.; Bowyer, Ted W.; Fritioff, T.; Hoffman, Ian; Khrustalev, Kirill; Nikkinen, Mika; Popov, Vladimir Y.; Popov, Y.; Ungar, R. Kurt; Wotawa, G.



Au Australia 307 Br Brasil 307  

E-Print Network (OSTI)

307 Ch China, Republic of D ChT China, Taiwan D Cs Czecho Slovakia 307 Fr France 307 Ge Germany (Reich)1945 E Ge.W Germany, Federal Republic of 307 Germany(Reich=1945 E Ge.E Germany, Democratic Republic of 307 Germany(Reich=1945 E Hu Hungry 307 It Italy 307 Ju Jugoslavia 307 Ko Korea 307 Ko

Miyashita, Yasushi


Microalgal biofilms on common yew needles in relation to anthropogenic air pollution in urban Prague, Czech Republic  

Science Journals Connector (OSTI)

Abstract Excessive occurrence of microalgae on needles of gymnosperms was reported for the first time in the 1980s from the Scandinavian countries. Since then, it has been repeatedly encountered on needles from various European forest habitats. The abundance of these biofilms has been related to the climatic conditions, such as temperature and precipitation, as well as to the air pollution by nitrogen and sulfur oxides. Urban areas typically have relatively homogenous climates and profound variation in levels of air pollution. Therefore, variation in the occurrence of biofilms in localities within an urban area may be related to local anthropogenic air pollution. We investigated the abundance of biofilms occurring on needles of the common yew (Taxus baccata) in the city of Prague, Czech Republic. The biofilms were composed of algae, fungi and particulate matter. The cover area of the biofilms was marginally explained by a positive influence of short-term maximum atmospheric levels of nitrogen dioxide (NO2). The amounts of the microalgae were also positively influenced by short-term maximum NO2 levels. In addition, high atmospheric levels of particulate matter (PM10) were related to low abundance of algae. The microbial biofilms growing on widely cultivated conifers, such as the common yew, form one of the few commonly occurring natural communities in highly urbanized central areas of temperate European cities. Consequently, we propose that microscopic analysis of biofilms may be used as a rapid and cheap method to collect ecological data. Such data may be used in biomonitoring schemes illustrating the effects of anthropogenic air pollution on natural microcommunities in urban areas.

Radka Novkov; Ji? Neustupa



Department of Energy Announces New Clean Energy Partnership with the  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Energy Partnership with Clean Energy Partnership with the Republic of Korea Department of Energy Announces New Clean Energy Partnership with the Republic of Korea October 13, 2011 - 5:08pm Addthis WASHINGTON, D.C. - On October 10, U.S. Secretary of Energy Steven Chu and Minister of Knowledge Economy Joong-Kyung Choi of the Republic of Korea signed a new agreement establishing the U.S.-Korea Clean Energy Technology Partnership that will strengthen our bilateral cooperation in clean energy technology research and development (R&D). "The agreement will enable the United States and the Republic of Korea to expand our already strong bilateral cooperation on clean energy," Secretary Chu said. "By working together toward our shared clean energy goals, we can promote the kind of innovation that will help win the clean


Memorandum of Understanding between the Department of Energy of the United States of America and the National Development and Reform Commission of the People's Republic of China Concerning Industrial Energy Efficiency Cooperation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

THE DEPARTMENT OF ENERGY OF THE UNITED STATES OF AMERICA AND THE NATIONAL DEVELOPMENT AND REFORM COMMISSION OF THE PEOPLE'S REPUBLIC OF CHINA CONCERNING INDUSTRIAL ENERGY EFFICIENCY COOPERATION The Department of Energy of the United States of America (DOE) and the National Development and Reform Commission of the People's Republic of China (NDRC), jointly referred to herein as the "Participants"; RECOGNIZING that the development and use of energy are key elements of the economic growth of the United States and the People's Republic of China (PRC); SHARING common serious energy challenges from increasing energy imports and worsening environmental impacts as energy use rises; SHARING the sense of commitment to enhancing energy security through cooperation;


An economic analysis of the Philippine Republic's foreign trade in coconut and coconut by-products with emphasis on trade with the United States  

E-Print Network (OSTI)

in part~ fulfillment of the requirements for the degree of Nay 196& Wager Subject& kgricultural Economics kN lEQIQGC kNkl ISIS QF THE PHILIPPINE REPUBLIC'6 FQREIGN TRkDE IN CQGONUT kND CCCQNVT NX-PR($1ETS WITH EMPHkSIS QN TRkDE NITH THE CNITED STk... by the expansion of eaport voluxie. Xhie export expansion also enabled the economy to raise pro:iuction of hxme conswnption goods by enablix&g the importation oi' capital goods. 4 In 1959? total foreign trade accounted for 11 percent of net, national procuct...

Aspiras, Rogelio A



Resources and resourcefulness: Roles, opportunities and risks for women working at artisanal mines in South Kivu, Democratic Republic of the Congo  

Science Journals Connector (OSTI)

Abstract Two dominant narratives have characterized the conflict in eastern Democratic Republic of the Congo (DRC): (1) the horrific abuse of women through sexual violence and (2) the use of conflict minerals to fuel the fighting. These two advocacy narratives intersect uniquely in artisanal and small-scale mining (ASM) towns and can lead to flawed understandings of the true dynamics of women's experiences in these contexts. Mining areas are important centers of economic activity for women, but also pose distinct risks. A simplistic portrayal of women's victimization in mining towns suppress discussion of their participation in non-conflict political and social processes. Yet, these processes are among the most important to ensure that women secure opportunities for long-term, substantive engagement in mining activities. This paper draws on systematically collected qualitative data from two territories in South Kivu, Walungu and Kalehe, to examine how women negotiate these complex social and economic mining landscapes in eastern Democratic Republic of Congo. Their accounts compel a re-examination of development efforts to remove women from the mines altogether, and to look more closely at the measures available to help them realize their legal rights to work safely and fairly in these contexts.

Jocelyn T.D. Kelly; Alexandria King-Close; Rachel Perks


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Effects of exposure to television advertising for energy-dense/nutrient-poor food on children's food intake and obesity in South Korea  

Science Journals Connector (OSTI)

Abstract The aim of this study was to determine the effect of television food advertising on participant food intake and risk of obesity. A total of 2419 children aged 1113?years were selected from 118 elementary schools in South Korea. All participants completed a self-administered questionnaire with questions about height, weight, television viewing times, food preferences, and food intakes. To estimate actual exposure to food advertising, we asked participants to specify the times at which they usually watched television. We then collected data on the various types of food advertisement broadcast on five different television networks during those viewing times over the course of the previous 7?months. The amount of television watched and exposure to energy-dense/nutrient-poor (EDNP) food advertising were associated with an increased risk of being overweight or obese. Exposure to television advertising for EDNP food was also significantly associated with higher EDNP food preference and intake and lower fruit and vegetable intake. However, these relationships disappeared for all foods after adjusting for the overall amount of television watched. Although it was not possible to conclude that exposure to television advertising for EDNP food was associated with an increased risk of obesity, preference for EDNP foods, or overall food intake due to the strong comprehensive effects of television viewing time, there was a reason to believe the evidence of the effects of advertising in this study. Future longitudinal studies are needed to determine the exclusive effects of exposure to television advertising for EDNP food.

Bora Lee; Hyogyoo Kim; Soo-Kyung Lee; Jihyun Yoon; Sang-Jin Chung



CO{sub 2} emissions from developing countries: Better understanding the role of energy in the long term. Volume 3, China, India, Indonesia, and South Korea  

SciTech Connect

Recent years have witnessed a growing recognition of the link between emissions of carbon dioxide (CO{sub 2}) and changes in the global climate. Of all anthropogenic activities, energy production and use generate the single largest portion of these greenhouse gases. Although developing countries currently account for a small share of global carbon emissions, their contribution is increasing rapidly. Due to the rapid expansion of energy demand in these nations, the developing world`s share in global modern energy use rose from 16 to 27 percent between 1970 and 1990. If the growth rates observed over the past 20 years persist, energy demand in developing nations will surpass that in the countries of the Organization for Economic Cooperation and Development (OECD) early in the 21st century. The study seeks to examine the forces that galvanize the growth of energy use and carbon emissions, to assess the likely future levels of energy and Co{sub 2} in selected developing nations and to identify opportunities for restraining this growth. The purpose of this report is to provide the quantitative information needed to develop effective policy options, not to identify the options themselves. These individual studies were conducted for China, India, Indonesia and South Korea in Asia.

Sathaye, J.; Goldman, N. [eds.



Renewable energy in eastern Asia: Renewable energy policy review and comparative SWOT analysis for promoting renewable energy in Japan, South Korea, and Taiwan  

Science Journals Connector (OSTI)

Abstract Japan, South Korea, and Taiwan are deficient of domestic fossil energy sources and depend significantly on imported fuels. Since the oil shock in the 1970s, all three countries have promoted renewable energy as an alternative energy source to improve energy security. Currently, renewable energy is being promoted to build low-carbon economies. This study reviews the development of renewable energy policies and roadmaps. It also examines and compares strengths, weaknesses, opportunities, and threats (SWOT) of these countries in the context of advancing renewable energy policies and technologies and expanding domestic renewable energy installations, as well as strategically positioning themselves in the international renewable energy market as exporters of clean energy technologies. Through the SWOT analysis, this paper identifies a capacity for additional renewable energy deployment in these countries and highlights the necessity of increased cooperation between the three countries to strengthen their domestic and regional renewable energy sectors and compete in the global renewable energy market in the post-Fukushima era.

Wei-Ming Chen; Hana Kim; Hideka Yamaguchi



A verification study on saving energy cost and reducing CO2 emission with large-scale geothermal heat pump systems in Korea  

Science Journals Connector (OSTI)

This paper presents economic and environmental effects by using monitoring data collected over a 2-yr period in geothermal heating and cooling facilities in Jungwon University Korea. The facility has heating capacity of 7045?kW and cooling capacity of 5947?kW. Such monitoring data are rarely reported in the literature; thus the evaluation based on long-term operational data will contribute greatly to the objective assessment of the geothermal heat pump system (GHPS) as a renewable energy resource. The effects of relative energy cost saving and reductions in CO2 emission were predicted for comparison with conventional heating and cooling systems. The GHPS was estimated to reduce energy costs by 76.4%85.3% and yield a reduction of CO2 emission of 398595 tons annually. We also conducted an economic analysis using the benefit/cost ratio (BCR) method according to scenarios in which the lifespan and discount rate for the GHPS were varied. Since the BCR for the GHPS was in the range of 1.993.58 (case 1) and 1.673.01 (case 2) GHPS is considered to be more economic than other types of heating and cooling systems. These results provide evidentiary data to help overcome skepticism over the applicability of large-scale GHPSs.

Byeong-Hak Park; Hyoung-Soo Kim; Kang-Kun Lee



Evaluation of Flood Runoff Reduction Effect of LID (Low Impact Development) based on the Decrease in CN: Case Studies from Gimcheon Pyeonghwa District, Korea  

Science Journals Connector (OSTI)

Abstract LID are spread on a small scale throughout target area, therefore, evaluation of their overall effect on flood reduction is not straightforward. As one solution dealing with this problem, Yoo et al. (2012) proposed a methodology for quantifying the flood runoff reduction effect of storage facilities by curve number (CN). Introduction of various infiltration or storage facilities causes the decrease in CN, which can be calculated using the runoff. The result derived was summarized in a graph showing the decrease in CN as an effect of the runoff reduction. That is, the runoff reduction effect of infiltration or storage facilities was able to be easily estimated using the derived graph. In this study, LID effects of Gimcheon Pyeonghwa district in Korea was quantified using this method. Additionally, the reduction amount of the runoff volume using the method suggested by Yoo et al. (2012) was compared with that estimated by using SWMM 5.0. As a result of this, the effect of LID facilities was shown similarly in both cases using the methodology used in this study and simulated using SWMM 5.0. This result verified that the methodology was valid even though it is straightforward and simple.

J. Sin; C. Jun; J.H. Zhu; C. Yoo



Anisotropy of elastic moduli, P-wave velocities, and thermal conductivities of Asan Gneiss, Boryeong Shale, and Yeoncheon Schist in Korea  

Science Journals Connector (OSTI)

This paper presents the anisotropic characteristics of the elastic moduli, P-wave velocities, and thermal conductivities of three types of anisotropic rocks, i.e., Asan gneiss, Boryeong shale, and Yeoncheon schist, occurring in Korea. The experiments were conducted on rock samples that show clear evidence of transverse isotropy. Cylindrical core samples with different anisotropy angles were prepared by coring at 15-degree intervals from the transversely isotropic plane using the laboratory directional coring system established for this study. Elastic moduli, P-wave velocities, and thermal conductivities were determined along the sample axis for different anisotropy angles. The anisotropy ratio is defined as the ratio of the properties parallel to the transversely isotropic plane to those perpendicular to the plane, and the anisotropy ratios for the thermal conductivities (K(90)/K(0)) of Asan gneiss, Boryeong shale, and Yeoncheon schist were 1.4, 2.1, and 2.5, respectively. The P-wave velocity anisotropy ratios (VP(90)/VP(0)) for Asan gneiss, Boryeong shale, and Yeoncheon schist were 1.2, 1.5, and 2.3, respectively. The elastic moduli, P-wave velocities, and thermal conductivities that were obtained were compared with theoretical predictions by mean prediction error (MPE). The correlations between the measured properties were evidently correlated with some minor scatter in the data. The degree of anisotropy measured in this study suggests that ignoring anisotropy in rock properties may mislead to erroneous results. The application of tensorial transformation evaluations revealed that the three types of rocks chosen for this study can be modeled effectively by a transversely isotropic model.

Hanna Kim; Jung-Woo Cho; Insun Song; Ki-Bok Min



Memorandum of Understanding between US Department of Energy and the Public Agency for Radioactive Waste Management of the Republic of Hungary  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

between The Department of Energy of the United States of America and The Public Agency for Radioactive Waste Management of the Republic of Hungary for Information Exchange Relating to Operation of Modular Vault Systems for Storage of Spent Nuclear Fuel 1. Participants The United States Department of Energy (DOE), a Participant to this Memorandum of Understanding (Memorandum), is the agency responsible for the management of radioactive wastes produced by or in the possession of tla U.S. Government (&mmercial reactor nuclear waste excluded) within the United Stztes, including spent nuclear fuel (SNF). DOE is the owner, operator, and licensee of the Fort St. Vrain (FSV) MVDS and the Hanford Canister Storage Building (CSB). DOE's Idaho Operations Office (DOE-


"Traffic Signalization in a Design/Build Contract Awarded as a Firm-Fixed Price Contract in South Korea Challenges in Scope Determination and Users Expectations." A Case Study  

E-Print Network (OSTI)

in its 52-year history. http://www.pof.usace.army.mil/Portals/35/docs/Library/EGE%20Archive/2009%20EGE? July%202009.pdf F. LISTSERV 16.0 - USKOREA-KR Archives, U.S. Troop Relocation Shows Strength of U.S.-Korea Alliance, U.S., and ROK...-signalized operation method has advantage of reducing the degree of delay, signalized operation method has advantage of minimize safety hazard factors such as collision between pedestrians and vehicles. Therefore, signalized operation method has been selected...

Martin, Raymond W.



Economics of Climate Change and Low Carbon Growth Strategies in Northeast  

Open Energy Info (EERE)

Low Carbon Growth Strategies in Northeast Low Carbon Growth Strategies in Northeast Asia Jump to: navigation, search Name Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Agency/Company /Organization Asian Development Bank Partner Government of Republic of Korea Topics Background analysis, Low emission development planning Program Start 2009 Country China, Japan, Mongolia, South Korea Eastern Asia, Eastern Asia, Eastern Asia, Eastern Asia References Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia[1] Overview The Asian Development Bank (ADB) is planning a study entitled the Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia, covering the People's Republic of China (PRC), Japan, the Republic of Korea, and Mongolia. The Government of the Republic of Korea will cofinance


Uncertainties on Atomic Data  

Science Journals Connector (OSTI)

Technical Paper / Selected papers from IAEA-NFRI Technical Meeting on Data Evaluation for Atomic, Molecular and Plasma-Material Interaction Processes in Fusion, September 4-7, 2012, Daejeon, Republic of Korea

C. P. Ballance; S. D. Loch; A. R. Foster; R. K. Smith; M. C. Witthoeft; T. R. Kallman


Aurora Energy Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Korea (Republic) Sector: Solar, Wind energy Product: Manufacturer of 1-225kW micro wind turbines and solar modules. References: Aurora Energy Co Ltd1 This article is a stub. You...


Joint Statement on Multinational Cooperation on High-Density...  

National Nuclear Security Administration (NNSA)

Release Mar 25, 2014 The White House Office of the Press Secretary Belgium, France, Germany, the Republic of Korea and the United States, the parties to this joint statement...


Nuclear Security Summit | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Uranium Fuel Development The White HouseOffice of the Press SecretaryBelgium, France, Germany, the Republic of Korea and the United States, the parties to this joint statement...


U.S. Geological Survey China's Growing Appetite for Minerals  

E-Print Network (OSTI)

: Coal 45 1 Oil 4.7 6 Industrial minerals: Cement 42 1 Fluorspar 55 1 Rare earths 85 1 Metals: Aluminum Republic of Korea Thailand Other Asian Crisis 1997 #12;Production Flow for Cement #12;Country-Level Ou


The Strengthened Safeguards System: Objectives, Challenges and Expectations  

Science Journals Connector (OSTI)

Since the early 1990s, with Iraq, with the Democratic Peoples Republic of Korea, with South Africa, with Argentina and Brazil, and with the 14 new States that emerged from the former Soviet Union, the IAEA Inspe...

Bruno Pellaud



Quantitative Peptidomics Study Reveals That a Wound-Induced Peptide from PR-1 Regulates Immune Signaling in Tomato  

Science Journals Connector (OSTI)

...Academia Sinica, Taipei 11529, Taiwan b Department of Life Science and Institute of Plant Biology, National Taiwan University...d Department of New Biology, Daegu Gyeongbuk Institute of Science and Technology, Daegu 711-873, Republic of Korea e Department...

Ying-Lan Chen; Chi-Ying Lee; Kai-Tan Cheng; Wei-Hung Chang; Rong-Nan Huang; Hong Gil Nam; Yet-Ran Chen



Draft Genome Sequence of Bacillus oceanisediminis 2691  

Science Journals Connector (OSTI)

...SSAC-PJ008170), Rural Development Administration, and by the KRIBB Innovative Research Program, Republic of Korea. REFERENCES 1. Achal...Pan, Q Fu, and D Zhang. 2012. Biomineralization based remediation of As(III) contaminated soil by Sporosarcina ginsengisoli...

Yong-Jik Lee; Sang-Jae Lee; Haeyoung Jeong; Hyun Ju Kim; Naeun Ryu; Byoung-Chan Kim; Han-Seung Lee; Dong-Woo Lee; Sang Jun Lee



European Workshop on Individual Monitoring of Ionising Radiation (IM2005) Vienna, Austria April 1115 2005  

Science Journals Connector (OSTI)

......Federal Office for Radiation Protection Radon GERMANY Beeslaar Frik South African...Inessa KATEP-AE Radiation Laboratory KAZAKHSTAN Kim Jang-Lyul Korea Atomic Energy...Iran Radiation protection (Neutron, Radon Dosimetry) ISLAMIC REPUBLIC OF IRAN......

European Workshop on Individual Monitoring of Ionising Radiation (IM2005) Vienna; Austria April 1115 2005



This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network (OSTI)

and output energy at each port. This condition satisfies the passivity of the network system independent University of Technology and Education, Cheoan-city 330-708, Republic of Korea b Institute of Robotics of the energy-based approach,

Ryu, Jee-Hwan


IVAAIU urban instrument : hyper-complex civic monument for Seoul  

E-Print Network (OSTI)

This thesis aims to plan and design an urban monument in Seoul, Republic of Korea, that can reflect the political movement of the city at the urban area which has been historically associated with political representations ...

Lee, Donguk


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Western and Central Pacific Fisheries Commission David Itano Pelagic Fisheries Research Program  

E-Print Network (OSTI)

Taipei, Tonga, Tuvalu, United States of America, Vanuatu. · Participating territories American Samoa Union, Federated States of Micronesia, Fiji, France, Japan, Kiribati, Korea, Republic of Marshall composition · Forum Fisheries Agency (FFA) Australia, Cook Islands, Federated States of Micronesia, Fiji

Hawai'i at Manoa, University of


E-Print Network 3.0 - agenda abstracts index Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Science and Engineering Pohang, Republic of Korea lcj80,hugman,gblee@postech.ac.kr Abstract... This work presents an agenda-based approach to improve the robustness of the...



Gasoline and Diesel Fuel Update (EIA)

0 0 0 0 0 0 0 0 0 Ecuador ... 4,535 0 0 0 0 0 0 540 0 0 Japan ... 0 0 0 0 0 825 0 0 0 0 Korea, Republic of...


Memorandum of Understanding Between the Department of Agriculture and the Department of Energy and the National Development and Reform Commission of the People's Republic of China on Cooperation in the Development of Biofuels  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AGRICULTURE AGRICULTURE AND THE DEPARTMENT OF ENERGY AND THE NATIONAL DEVELOPMENT AND REFORM COMMISSION OF THE PEOPLE'S REPUBLIC OF CHINA ON COOPERATION IN THE DEVELOPMENT OF BIOFUELS The Department of Agriculture (USDA) and the Department of Energy (DOE) of the United States of America, acting jointly, and the National Development and Reform Commission (NDRC) of the People's Republic of China, hereinafter the "Participants", Acknowledging that developing fuels that utilize biomass resources is an important way to significantly reduce fossil fuel consumption, promote the agricultural sector, and support rural development, Recognizing the important role played by other government entities in both countries in the area of biofuels development, and the benefits expected from their potential


New Media Practices in Korea  

E-Print Network (OSTI)

current prestige as an IT powerhouse, global digital testtransformed into an IT powerhouse, I address how these

Ok, Hyeryoung



Energy Security for North Korea  

Science Journals Connector (OSTI)

...and quite possibly less, is actually operable today (9). Of this, about 3.9 GWe...depending on the season and availability of operable supply. The thermal (fossil fuel-based...for the DPRK's one operating major refinery. Since the end of heavy fuel oil shipments...

David Von Hippel; Peter Hayes



Daewoo Engineering Company | Open Energy Information  

Open Energy Info (EERE)

Daewoo Engineering Company Daewoo Engineering Company Jump to: navigation, search Name Daewoo Engineering Company Place Seongnam-Si, Korea (Republic) Zip 463-825 Sector Solar Product Complete engineering service provider offering R&D, engineering, design, procurement, construction, and project management; involved in building a 3MW solar power plant in South Jeolla. Coordinates 37.397652°, 127.115189° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.397652,"lon":127.115189,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SFC Ltd formerly SamWoo Film | Open Energy Information  

Open Energy Info (EERE)

SFC Ltd formerly SamWoo Film SFC Ltd formerly SamWoo Film Jump to: navigation, search Name SFC Ltd (formerly SamWoo Film) Place Boryeong, Korea (Republic) Zip 355-110 Sector Solar Product Korean manufacturer of various types of film, including light diffusion, printing, OHP, inkjet films and TPT-type backsheets for solar modules. Coordinates 36.343021°, 126.609177° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.343021,"lon":126.609177,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hanwha L C Hanwha Living and Creative | Open Energy Information  

Open Energy Info (EERE)

Hanwha L C Hanwha Living and Creative Hanwha L C Hanwha Living and Creative Jump to: navigation, search Name Hanwha L&C (Hanwha Living and Creative) Place Seoul, Seoul, Korea (Republic) Zip 100-797 Sector Solar Product Seoul-based construction materials company. The company is also a producer of solar EVA laminates. Coordinates 37.557121°, 126.977379° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.557121,"lon":126.977379,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Large 1/f noise of unipolar resistance switching and its percolating nature S. B. Lee,1  

E-Print Network (OSTI)

Large 1/f noise of unipolar resistance switching and its percolating nature S. B. Lee,1 S. Park,2 J-747, Republic of Korea 2 Quantum Materials Research Team, Korea Basic Science Institute, Daejeon 305 that show unipolar resistance switching. When they were switched from the low to high resistance states

Kahng, Byungnam


Two-dimensional packet classification algorithm using a quad-tree Hyesook Lim a,*, Min Young Kang a  

E-Print Network (OSTI)

of Korea b Department of Internet and Multimedia Engineering, Konkuk University, Seoul, Republic of Korea and the deployment of network applications that transmit and receive audio and video over the Internet. In order is called the quality of services (QoS). An essential element for the Internet routers to provide the Qo

Yim, Changhoon


ARTHRITIS & RHEUMATISM Vol. 46, No. 4, April 2002, pp 11091120  

E-Print Network (OSTI)

-Youn Min,1 Eui-Young Bae,2 Sue-Yun Hwang,1 Sung-Hwan Park,1 Chul-Soo Cho,1 Jong-Sang Park,2 and Ho-Youn Kim-Youn Kim, MD: The Catholic University of Korea, Seoul, Republic of South Korea; 2 Woo- Kyoung Lee, MS, Eui

Park, Jong-Sang


The United States of America and the People`s Republic of China experts report on integrated gasification combined-cycle technology (IGCC)  

SciTech Connect

A report written by the leading US and Chinese experts in Integrated Gasification Combined Cycle (IGCC) power plants, intended for high level decision makers, may greatly accelerate the development of an IGCC demonstration project in the People`s Republic of China (PRC). The potential market for IGCC systems in China and the competitiveness of IGCC technology with other clean coal options for China have been analyzed in the report. Such information will be useful not only to the Chinese government but also to US vendors and companies. The goal of this report is to analyze the energy supply structure of China, China`s energy and environmental protection demand, and the potential market in China in order to make a justified and reasonable assessment on feasibility of the transfer of US Clean Coal Technologies to China. The Expert Report was developed and written by the joint US/PRC IGCC experts and will be presented to the State Planning Commission (SPC) by the President of the CAS to ensure consideration of the importance of IGCC for future PRC power production.




A combination of existing concepts and approaches to take on energy system transitions The Republic of Panama as a case-study  

Science Journals Connector (OSTI)

Abstract The impact of our energy systems on the climate mandates an energy system transition. In this paper a combination of existing concepts and approaches to take on such transitions is discussed. This combination starts with first defining the unit of analysis, after which actors in the socio-technical energy system are charted through literature research and interviews. Next, using social network analysis, regimes and niches are identified to depict the unit of analysis in a more useful manner for managing transitions. The step hereafter consists of creating internal and external scenarios based on critical uncertainties to insure transition management efforts against uncertainty in and outside the unit of analysis. Moving to transition management, robustness analysis is then used to evaluate strategies and policies in all combinations of these internal and external scenarios to get to an optimum set of strategies and policies which are used to form a normative scenario. This will be used to get stakeholders behind the transition effort. This combination of approaches and concepts is used in the case of the Republic of Panama. It results in a clear overview of the energy system, impediments and opportunities regarding transition, possible futures, and the validity of strategies and policies in different scenarios.

Danil A. Lachman



The overexploitation and illegal trade of Prunus africana in the protected areas in the light of international environmental law (a case study of the Democratic Republic of Congo)  

Science Journals Connector (OSTI)

The increasing demand in natural resources for various reasons has driven humanity to unsustainable consumption of natural capital. Meanwhile, the emerging concept of 'sustainability', which emphasises on the intersection and balance between economy, society and environment, is becoming a gospel. The Brundtland report defines sustainable development as ''development, which meets the needs of the present without compromising the ability of future generations to meet their own needs'' (Brundtland, 1987). Hence, two ethical elements have been drawn: the intra-generational justice or equity and the inter-generational justice. The latter element of the inter-generational justice, which links with the concern for future generations, is a key point in international environmental law. Therefore, this study will cover the overexploitation and illegal trade of Prunus africana in Virunga and Kahuzi-Biega national parks in the Democratic Republic of Congo (DRC) and the legal framework which regulates the preservation and trade of wild flora and fauna under the convention on International trade in endangered species of wild flora and fauna (CITES) from 1996-2009.

Freddy Tshibundu Shamwana



Vulnerability factors for malnutrition among people living with HIV under antiretroviral treatment in an outpatient clinic: Kinshasa, Democratic Republic of Congo  

Science Journals Connector (OSTI)

AbstractBackground Significant progress has been made in the fight against HIV/AIDS across the world. However, in sub-Saharan countries, there remain numerous obstacles to achieving treatment goals. The aim of this study was to identify factors underlying vulnerability to malnutrition among people living with HIV (PLWHIV) under antiretroviral treatment (ART) in resource-limited settings. Methods A cross-sectional study was carried out in May 2010 in Kinshasa, the capital of the Democratic Republic of Congo. Baseline characteristics of PLWHIV were analyzed, and statistical analyses were performed in order to compare proportions of low weight, low mid-upper arm circumference, and low body mass index. Further analyses were performed to compare means of anthropometric characteristics according to sociodemographic, socioeconomic, and clinical characteristics. Multiple regression analyses were used to assess vulnerability determinants for malnutrition following adjustment. Results We identified specific sociodemographic characteristics, socioeconomic level and clinical characteristics (i.e. autonomous activity, appetite, asthenia level, and HIV clinical stage) that were significantly associated with malnutrition in PLWHIV. Conclusions Determining factors underlying vulnerability to malnutrition may be helpful to health providers in poor income settings for more effectively target patient interventions.

K. Tshingani; C. Schirvel; H. Mukumbi; S. Ngambwe; M. Wilmet-Dramaix



Use of the K ppen-Trewartha Climate Classification to Evaluate Climatic Refugia in Statistically Derived Ecoregions for the People's Republic of China  

SciTech Connect

Changes in climate as projected by state-of-the-art climate models are likely to result in novel combinations of climate and topo-edaphic factors that will have substantial impacts on the distribution and persistence of natural vegetation and animal species. We have used multivariate techniques to quantify some of these changes; the method employed was the Multivariate Spatio-Temporal Clustering (MSTC) algorithm. We used the MSTC to quantitatively define ecoregions for the People s Republic of China for historical and projected future climates. Using the K ppen Trewartha classification system we were able to quantify some of the temperature and precipitation relationships of the ecoregions. We then tested the hypothesis that impacts to environments will be lower for ecoregions that retain their approximate geographic locations. Our results showed that climate in 2050, as projected from anthropogenic forcings using the Hadley Centre HadCM3 general circulation model, were sufficient to create novel environmental conditions even where ecoregions remained spatially stable; cluster number was found to be of paramount importance in detecting novelty. Continental-scale analyses are generally able to locate potentially static ecoregions but they may be insufficient to define the position of those reserves at a grid cell-by-grid cell basis.

Baker, Barry [Nature Conservancy, The; Diaz, Henry [NOAA ESRL and CIRES; HargroveJr., William Walter [USDA Forest Service; Hoffman, Forrest M [ORNL



Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 - 22520 of 31,917 results. 11 - 22520 of 31,917 results. Article Department of Energy Announces 24 Nuclear Energy Research Awards to U.S. Universities $12 Million in Support to Be Provided for Innovative R&D Projects http://energy.gov/articles/department-energy-announces-24-nuclear-energy-research-awards-us-universities Article Department of Energy Announces New Clean Energy Partnership with the Republic of Korea U.S. Secretary of Energy Steven Chu and Minister of Knowledge Economy Joong-Kyung Choi of the Republic of Korea sign a new agreement establishing the U.S.-Korea Clean Energy Technology Partnership. http://energy.gov/articles/department-energy-announces-new-clean-energy-partnership-republic-korea Article Mississippi State University Wins DOE and GM Challenge X 2008 Advanced Vehicle Competition


Japan-Economics of Climate Change and Low Carbon Growth Strategies in  

Open Energy Info (EERE)

Japan-Economics of Climate Change and Low Carbon Growth Strategies in Japan-Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Jump to: navigation, search Name Japan-Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Agency/Company /Organization Asian Development Bank Partner Government of Republic of Korea Topics Background analysis, Low emission development planning Program Start 2009 Country Japan Eastern Asia References Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia[1] Overview The Asian Development Bank (ADB) is planning a study entitled the Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia, covering the People's Republic of China (PRC), Japan, the Republic of Korea, and Mongolia. The Government of the Republic of Korea will cofinance


China-Economics of Climate Change and Low Carbon Growth Strategies in  

Open Energy Info (EERE)

China-Economics of Climate Change and Low Carbon Growth Strategies in China-Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Jump to: navigation, search Name China-Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia Agency/Company /Organization Asian Development Bank Partner Government of Republic of Korea Topics Background analysis, Low emission development planning Program Start 2009 Country China Eastern Asia References Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia[1] Overview The Asian Development Bank (ADB) is planning a study entitled the Economics of Climate Change and Low Carbon Growth Strategies in Northeast Asia, covering the People's Republic of China (PRC), Japan, the Republic of Korea, and Mongolia. The Government of the Republic of Korea will cofinance

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


" . , ' ~. I., 0, , , . IC. onl. n. awar for orcan Health Fair, Korean-Am. Nail A, ~'cl . Seoul. R~chr. Kyullggi (Korell) Pnn'inl:;Korea. 1976-78: lab. chief Inc" Fhl'hillg. 1999, Fellow: Am. Acad. redial.: mem.: Coalililln forA  

E-Print Network (OSTI)

NIH. 8AICAN, ROMAN HORATIU, retired physicisl; b. Blaj. Romania, Feb. 23, Childrell 111ld Fal1ulie:a, Livia. Elvira. r...ch. pro;Cl'1 199 J), Hunter Coil. U.S. Koreau-Arn. Paren'" A1isn. (pre.. 198R Sgt. K... Hl',dtl1 ,Hid Well"all'. 19810:. Pre~. ltward Rcpuhlil.: of Korea, 2OCl(); granlee Ass!. U. Cluj

Baica, Malvina


(Energy Efficiency)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Statement by Energy Ministers of G8, The People's Republic of China, India and Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea Aomori, Japan on 8 June 2008 Energy Ministers of the G8, The People's Republic of China, India and The Republic of Korea met in Aomori, Japan on 8 June 2008 in order to discuss the globally significant issues related to addressing energy security and climate change. While recognizing varied national circumstances among the 11 participating countries, given the fact that we collectively account for about 65% of the global energy consumption, we must play an important role in achieving global energy security, climate change mitigation and sustainable development. We affirmed that this Meeting extended the following message to contribute to the fruitful discussion


IEA participating countries Czech Republic  

E-Print Network (OSTI)

-encompassing annual studies of oil, natural gas, coal, electricity and renewables are indispensable tools for energy, journalist or student will have at his or her fingertips the annual Canadian production of coal, the electricity consumption in Thailand, the price of diesel oil in Spain and thousands of other useful energy

Schrijver, Karel


Impressions on Chinas Popular Republic  

ScienceCinema (OSTI)

Le D.G. Jentschke prsente le Prof.Yang, ne en 1922 en Chine o il a aussi fait ses tudes; il parle de ses impressions en Chine (p.e. mariage etc....) avec prsentation des dias




Archology in the Congo Republic  

Science Journals Connector (OSTI)

... THE Institut des Pares Nationaux du Congo et du Ruanda-Urundi has recently published Part 6 of Exploration du Pare National Albert ... de Braucourt. Pp. 34 + 47 planches. (Bruxelles: Institut des Pares Nationaux du Congo et du Ruanda-Urundi, 1961.)) Most of this considerable work is occupied by ...



3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network (OSTI)

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network (OSTI)

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced


A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network (OSTI)

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-



Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating



Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network (OSTI)

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music


4/5/2014 10 ways alternative energyis about to change the waytech gets powered -TechRepublic http://www.techrepublic.com/article/10-ways-alternative-energy-is-about-to-change-the-way-tech-gets-powered/ 1/10  

E-Print Network (OSTI)

to Apple; it owns two solar farms and one fuel-cell farm near its data center in North Carolina4/5/2014 10 ways alternative energyis about to change the waytech gets powered - TechRepublic http://www.techrepublic.com/article/10-ways-alternative-energy-is-about-to-change-the-way-tech-gets-powered/ 1/10 Solar-powered laptops

Chiao, Jung-Chih


Effects of Bisphenol S Exposure on Endocrine Functions and Reproduction of Zebrafish  

Science Journals Connector (OSTI)

Division of Environmental Science and Ecological Engineering, Korea University, Seoul 136-713, Republic of Korea ... After the acclimation period, fish were exposed to control, vehicle control (MeOH with a final concentration of 1:1,000 v/v water), 0.5, 5, or 50 ?g/L of BPS for 21 d following OECD test guideline 229 with minor modifications. ...

Kyunghee Ji; Seongjin Hong; Younglim Kho; Kyungho Choi



Golf and Taxes in South Korea  

E-Print Network (OSTI)

Broadcast Transcript: Bad news for golf mad South Koreans: forget about teeing off if you tee off the National Tax Service. The NTS is cracking down on tax cheats by revoking memberships in pricey golf clubs. Do the math: if you can afford the steep...

Hacker, Randi



Crowdfunding in Korea Hye-Hwal SEONG  

E-Print Network (OSTI)

-18, 2013 UC Berkeley Symposium UC Berkeley International Symposium on Crowdfunding #12;I. Current Situation for Consumer Protection in Electronic Commerce as far as there is no monetary return üIf any monetary return combined, it can be an `investment contract' and regulated byCapital Market Act October 17-18, 2013 UC

Sekhon, Jasjeet S.


2006200620062006 Taiwan-Korea Plasma Conference 2006  

E-Print Network (OSTI)

/16-1/18 Place: NTU (1/16) NCHC(1/17 -18) 1/16 PSROC@NTU 10:00-13:00 Registration and Lunch 13:00-19:00 Plasma/NTHU, HsinChu, Taiwan Optical tunneling effect of localized surface plasmon: A simulation study using

Hsu, Jang-Yu


Federal Acquisition Regulation Federal Acquisition Circular 2005-61  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 1 Summary of Rules in FAC 2005-61 Item Subject FAR Case I. United States--Korea Free Trade Agreement. 2012-004 II. Delete Outdated FAR Reference to the 2012-026 DoD Industrial Preparedness Program. III. NAICS and Size Standards 2012-021 IV. Bid Protest and Appeal Authorities. 2012-008 V. Technical Amendments. Item I--United States-Korea Free Trade Agreement (FAR Case 2012-004) This final rule adopts without change the interim rule published in the Federal Register on March 7, 2012 (77 FR 13952), to implement the United States-Korea Free Trade Agreement. The Republic of Korea is already party to the World Trade Organization Government Procurement Agreement (WTO GPA). The Korea Free Trade Agreement now covers acquisition of supplies and services between $100,000 and the current WTO GPA threshold of


Deputy Secretary Poneman's Remarks as Prepared for Delivery at the American  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Deputy Secretary Poneman's Remarks as Prepared for Delivery at the Deputy Secretary Poneman's Remarks as Prepared for Delivery at the American Chamber of Commerce in Korea Deputy Secretary Poneman's Remarks as Prepared for Delivery at the American Chamber of Commerce in Korea June 21, 2010 - 1:04pm Addthis Remarks as Prepared for Delivery U.S. Deputy Secretary of Energy Daniel Poneman American Chamber of Commerce in Korea Monday, June 21, 2010 Seoul, Korea Good afternoon. Thank you, Amy [Jackson] for the introduction. It's a pleasure to be back in Seoul. I have many fond memories from past visits, and I am glad to have the opportunity to join all of you today. Before I begin my remarks, I would like to thank the American Chamber of Commerce in Korea for hosting me, and for its work fostering dialogue on issues that are critical to the businesses and citizens of the Republic of


Deputy Secretary Poneman's Remarks as Prepared for Delivery at the American  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Deputy Secretary Poneman's Remarks as Prepared for Delivery at the Deputy Secretary Poneman's Remarks as Prepared for Delivery at the American Chamber of Commerce in Korea Deputy Secretary Poneman's Remarks as Prepared for Delivery at the American Chamber of Commerce in Korea June 21, 2010 - 1:04pm Addthis Remarks as Prepared for Delivery U.S. Deputy Secretary of Energy Daniel Poneman American Chamber of Commerce in Korea Monday, June 21, 2010 Seoul, Korea Good afternoon. Thank you, Amy [Jackson] for the introduction. It's a pleasure to be back in Seoul. I have many fond memories from past visits, and I am glad to have the opportunity to join all of you today. Before I begin my remarks, I would like to thank the American Chamber of Commerce in Korea for hosting me, and for its work fostering dialogue on issues that are critical to the businesses and citizens of the Republic of


A guidebook to alternative energy projects on American Samoa, The Commonwealth of the Northern Mariana Islands, The Federated States of Micronesia, Guam, and The Republics of the Marshall Islands and Palau. [Contains bibliography  

SciTech Connect

The purpose of this guidebook is to help transfer information concerning alternative energy projects that have been tried on the Pacific islands affiliated with the US. These islands include those in American Samoa, the Commonwealth of the Northern Mariana Islands, the Federated States of Micronesia (Kosrae, Pohnpei, Truk, and Yap), Guam, and the Republics of the Marshall Islands and Palau. Distances are long between islands and populations are sparse, making communication and the transfer of information particularly difficult. A project that works on American Samoa might be appropriate for Yap, but to get this information to the proper people on Yap in a reasonable period of time is extremely difficult. This book describes 100 alternative energy projects that have been tried on the islands since the mid-1970's. This description and record of what has been done to date should be a source of ideas for energy workers, reduce duplication of work, and help encourage successes by describing other successes and failures. Alternative energy projects are projects that use indigenous, renewable resources in order to reduce local dependency on imported petroleum for electricity or liquid fuels. The islands have an apparent abundance of natural resources for this purpose such as the sun, rivers, vegetation, the ocean, and wind; and, ideally, it should be relatively simple to convert these resources to electricity or fuel. However, there are problems unique to the remote, tropical Pacific that often appear insurmountable, and successes to date are the results of unusual persistence, hard work, and ingenuity of those on the islands. Projects are confined to those that actually develop or demonstrate hardware. These projects use the complete spectrum of alternative technologies such as biomass conversion, wind electric, solar water heating, photovoltaics, wind water pumping, hydroelectric, water desalination, and integrated systems. 381 refs., 85 figs.

Case, C.W.


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Port-city relationships in Europe and Asia Published in: Journal of International Logistics and Trade 4(2), pp. 13-35  

E-Print Network (OSTI)

1 Port-city relationships in Europe and Asia Published in: Journal of International Logistics-712 Republic of Korea Abstract This paper investigates the nature of port-city relationships in two major port studies or general models, it proposes a complementary approach based on urban and port indicators

Paris-Sud XI, Université de


A New Boson with a Mass of 125 GeV Observed with the CMS Experiment at the Large Hadron Collider  

Science Journals Connector (OSTI)

...Demiragli A. Demiyanov L. Demortier D. Denegri G. Denis M. Deniz D. D'Enterria L.G. Denton P. Depasse A. Dermenev V. Dero G...Science and Technology and the World Class University program of NRF, Republic of Korea; the Lithuanian Academy of Sciences; the...

The CMS Collaboration



Effects of heat dissipation on unipolar resistance switching in Pt/NiO/Pt capacitors  

E-Print Network (OSTI)

Effects of heat dissipation on unipolar resistance switching in Pt/NiO/Pt capacitors S. H. Chang,1 151-747, Republic of Korea 3 School of Materials Science and Engineering, Seoul National University tBE and investigated their resistance switching behaviors. The capacitors with tBE 50 nm exhibited

Kahng, Byungnam


Geomicrobiology Journal, 26:189198, 2009 Copyright Taylor & Francis Group, LLC  

E-Print Network (OSTI)

and Ocean Sciences, Inha University, Incheon 402­751, Republic of Korea 4 Rankin Science South, Appalachian Aurantimonas. Other organisms within this clade have been isolated from disparate environments such as surface distributed around the globe and may be important contributors to Mn cycling in many environments. Our results

Dick, Christopher


Abstract NG03: Genomic characterization of 101 brain metastases and paired primary tumors reveals patterns of clonal evolution and selection of driver mutations  

Science Journals Connector (OSTI)

...NG03: Genomic characterization of 101 brain metastases and paired primary tumors reveals...Seoul, Republic of Korea. Background: Brain metastases are the most frequently occurring...Median survival after the diagnosis of a brain metastasis is in the order of a few months...

Priscilla K. Brastianos; Scott L. Carter; Sandro Santagata; Amaro Taylor-Weiner; Robert T. Jones; Peleg M. Horowitz; Keith L. Ligon; Joan Seaone; Elena Martinez-Saez; Josep Tabernero; Daniel P. Cahill; Sun-Ha Paek; Ian F. Dunn; Bruce E. Johnson; Toni K. Choueiri; Michael S. Rabin; Eric P. Winer; Nancy U. Lin; Paul Van Hummelen; Anat Stemmer-Rachamimov; Rameen Beroukhim; David L. Louis; Tracy T. Batchelor; Jose Baselga; Gad Getz; William C. Hahn



Comparison of the Catalytic Oxidation Reaction on Graphene Oxide and Reduced Graphene Oxide  

E-Print Network (OSTI)

Comparison of the Catalytic Oxidation Reaction on Graphene Oxide and Reduced Graphene Oxide Laboratory (PAL), Pohang 790-784, Republic of Korea ABSTRACT: The capacities of graphene oxide (GO) and reduced graphene oxide (rGO) films grown on silicon substrate to cause the aniline to azobenzene oxidation

Kim, Sehun


Proc. III IS Rose Research Eds. N. Zieslin & H. Agbaria  

E-Print Network (OSTI)

OF TEMPERATURE ON LEAF AREA AND FLOWER SIZE IN ROSE Hak Ki Shin National Horticultural Research Institute Suwon 440-310 Republic of Korea J. Heinrich Lieth and Soo-Hyung Kim Department of Environmental Horticulture to temperature was measured to develop a model for predicting rose flower size for a range of greenhouse

Lieth, J. Heinrich


Elsevier Editorial System(tm) for Pervasive and Mobile Computing Manuscript Draft  

E-Print Network (OSTI)

, Israel cLG Semicon Hall 2106, KAIST, 373-1, Guseong-dong, Yuseong-gu, Daejeon, 305-701, Republic of Korea- forms a precise segmentation and labeling of swimming sessions. This allows a comprehensive break introduce a grammar into the SMM framework. Using the trained model on test swimming sessions of different

Shamir, Ron


Sculpting on polymers using focused ion beam M.-W. Moon a  

E-Print Network (OSTI)

Sculpting on polymers using focused ion beam M.-W. Moon a , E.-K. Her b , K.H. Oh b , K.-R. Lee and Engineering, Seoul National University, San 56-1 Shillim, Kwanak, Seoul, 151-744, Republic of Korea c Department of Mechanical and Industrial Engineering, Northeastern University, Boston, MA 02115, USA A B S T R

Vaziri, Ashkan


Nuclear proliferation after the Cold War  

SciTech Connect

Today, former Soviet republics threaten to gain control over nuclear weapons sited on their territories, and reports on North Korea, Pakistan, India, and Iraq reveal current or recent weapon development programs. This document offers a timely assessment of the prospects for nuclear nonproliferation.

Reiss, M.; Litwak, R.S.



journal homepage: www.elsevier.com/locate/nanoenergy Available online at www.sciencedirect.com  

E-Print Network (OSTI)

Development of renewable and green energy based on natural resources such as solar, wind and geothermal, has.sciencedirect.com RAPID COMMUNICATION Flexible hybrid cell for simultaneously harvesting thermal and mechanical energies), Cheoncheon-dong 300, Jangan-gu, Suwon, Gyeonggi-do 440-746, Republic of Korea d Energy Lab, Samsung Advanced

Wang, Zhong L.



Science Journals Connector (OSTI)

Pohang University of Science and Technology, School of Environmental Science and Engineering, Pohang, 790-784,. Republic ... Research Laboratory Program of the Korea Science and Engineer- ... Phytoplankton populations in Young-Il bay waters are higher ..... with this information, to assess the accuracy of carbonate.



Comparison of four composite landfill liner systems considering leakage rate and mass flux  

E-Print Network (OSTI)

Comparison of four composite landfill liner systems considering leakage rate and mass flux T, Seoul, Republic of Korea ABSTRACT: Performance of four different municipal solid waste landfill liner to evaluate the performance of municipal solid waste (MSW) landfill liner systems. A liner system that allows


Appendix C: Hepatitis B Endemic Countries List Countries considered highly endemic (8% or higher HBsAg prevalence) for hepatitis B  

E-Print Network (OSTI)

Mauritania Federated States of Micronesia Indonesia Burundi Mauritius Fiji North Korea Cameroon Mozambique Trust Territories of the Pacific Islands Saudi Arabia Ghana Swaziland Tuvalu USA (indigenous populations of) Guinea Tanzania (United Republic of) Vanuatu Alaska Guinea-Bissau Togo Wallis and Futuna Islands

MacMillan, Andrew


(Data in thousand metric tons of metal unless otherwise noted) Domestic Production and Use: In 2012, 5 companies operated 10 primary aluminum smelters; 4 smelters were  

E-Print Network (OSTI)

­11): Canada, 62%; Russia, 7%; China, 5%; Mexico, 4%; and other, 22%. Tariff: Item Number Normal Trade@usgs.gov] #12;17 ALUMINUM with the amount exported in 2011, and imports of crude and semifabricated aluminum in 2012 were 21% higher than the amount imported in 2011. China, Canada, Mexico, and the Republic of Korea


(Data in metric tons unless otherwise noted) Domestic Production and Use: Indium was not recovered from ores in the United States in 2009. Indium-containing  

E-Print Network (OSTI)

, Japan, and the Republic of Korea--the countries where ITO production and sputtering take place. An LCD tailings viable when the price of indium is high. Import Sources (2005-08):1 China, 40%; Japan, 19%; Canada where exports of flat panels rose significantly owing to China's household appliance subsidy program


GPS V-Geocast @korea.ac.kr, lchoi@korea.ac.kr  

E-Print Network (OSTI)

Century", Sci. Amer., pp. 66­75, Sept. 1991 [2] Perkins, M. Royer, "Ad hoc on demand distance vector://www.isi.edu/nsman/ns. [4] T. Camp, J. Boleng, and V. Davies, "A survey of mobility models for ad hoc network research

Choi, Lynn



E-Print Network (OSTI)

SECRETARIAT OF RESEARCH & TECHNOLOGY NATIONAL CENTRE FOR SCIENTIFIC RESEARCH «DEMOKRITOS» PATR. GRIGORIOU possesses: 1. Satellite Infrastructure (Central Fixed Base Station & Mobile Satellite Station) 2. Wireless & neural nets (data mining, evaluation methods), security & telecom patents, e-services platforms 4

Karkaletsis, Vangelis


Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi



Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network (OSTI)

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu



Z Group Steel Holding Zelezarny Veseli | Open Energy Information  

Open Energy Info (EERE)

Z Group Steel Holding Zelezarny Veseli Z Group Steel Holding Zelezarny Veseli Jump to: navigation, search Name Z-Group Steel Holding - Zelezarny Veseli Place Veseli nad Moravou, Czech Republic Zip 698 12 Sector Wind energy Product Czech Republic-based steel making firm. They are diversifying into wind plant and PV plant development. References Z-Group Steel Holding - Zelezarny Veseli[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Z-Group Steel Holding - Zelezarny Veseli is a company located in Veseli nad Moravou, Czech Republic . References ↑ "Z-Group Steel Holding - Zelezarny Veseli" Retrieved from "http://en.openei.org/w/index.php?title=Z_Group_Steel_Holding_Zelezarny_Veseli&oldid=353435"


Anomalous Shape Changes of Silicon Nanopillars by Electrochemical Lithiation  

Science Journals Connector (OSTI)

Department of Energy, Environment, Water and Sustainability, Korea Advanced Institute of Science and Technology, 37311 Guseong Dong, Yuseong Gu, Daejeon 305-701, Republic of Korea. ... (20, 21) After pillar fabrication, the piece of Si wafer on which the nanopillars stood was used directly as the working electrode in electrochemical half cells with Li metal foil as the counter electrode, as shown in Supporting Information Figure S2. ... Finally, the cross-sectional area of all three types of pillars increased considerably after lithiation: the ?100? pillars increased 240%, the ?110? pillars increased 340%, and the ?111? pillars increased 272%. ...

Seok Woo Lee; Matthew T. McDowell; Jang Wook Choi; Yi Cui



Influence of Early Fuel Injection Timings on Premixing and Combustion in a Diesel Engine  

Science Journals Connector (OSTI)

Engine Laboratory, Department of Mechanical Engineering, Korea Advanced Institute of Science and Technology, 373-1 GuSeong-Dong, YuSeong-Gu, Daejeon 305-701, Republic of Korea ... Even with the same fueling rate, faster engine speed would need more advanced injection for achieving 6.5 ms of ?id; more than 100 CAD of ?id was needed at 3000 rpm, and it was increased to 200 CAD at 5000 rpm, which was quite occasional in modern automotive diesel engines. ... Several general observations may be made. ...

Sanghoon Kook; Seik Park; Choongsik Bae



Microsoft Word - SEC J_Appendix D - Sensitive Foreign Nations Control  

National Nuclear Security Administration (NNSA)

D, Page 1 D, Page 1 SECTION J APPENDIX D SENSITIVE FOREIGN NATIONS CONTROL 1. Pursuant to the Contract Section I Clause entitled "Sensitive Foreign Nations Controls," "sensitive foreign nations" is one of the countries listed below: Algeria Armenia Azerbaijan Belarus China (People's Republic of China) Cuba Georgia Hong Kong India Iran Iraq Israel Kazakhstan Kyrgyzstan Libya Moldova North Korea (Democratic People's Republic of) Pakistan Russia Sudan Syria Taiwan Tajikistan Turkmenistan Ukraine Uzbekistan 2. Due to the dynamic nature of world events, other countries may, at any time, become sensitive. Therefore, caution should be exercised with citizens of countries not listed above to


Dyesol Timo JV | Open Energy Information  

Open Energy Info (EERE)

Dyesol Timo JV Dyesol Timo JV Jump to: navigation, search Name Dyesol-Timo JV Place Seoul, Korea (Republic) Sector Solar Product Joint venture between Dyesol and Timo Technology for solar cell manufacturing. References Dyesol-Timo JV[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Dyesol-Timo JV is a company located in Seoul, Korea (Republic) . References ↑ "Dyesol-Timo JV" Retrieved from "http://en.openei.org/w/index.php?title=Dyesol_Timo_JV&oldid=344356" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)


Timo Technology Company Ltd | Open Energy Information  

Open Energy Info (EERE)

Timo Technology Company Ltd Timo Technology Company Ltd Jump to: navigation, search Name Timo Technology Company Ltd. Place Seoul, Korea (Republic) Sector Solar Product Korean-based Timo Technology has a joint venture with Australia's Dyesol for dye solar cell technology. References Timo Technology Company Ltd.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Timo Technology Company Ltd. is a company located in Seoul, Korea (Republic) . References ↑ "Timo Technology Company Ltd." Retrieved from "http://en.openei.org/w/index.php?title=Timo_Technology_Company_Ltd&oldid=352289" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81 - 19090 of 28,905 results. 81 - 19090 of 28,905 results. Article Joint Statement between U.S. Department of Energy and Republic of Korea's Ministry of Trade, Industry, and Energy Poneman and Sang-jick, met on May 7, 2013, at the Department of Energy (DOE) headquarters in Washington, D.C., where they exchanged views on cooperation on a wide range of energy priorities. http://energy.gov/articles/joint-statement-between-us-department-energy-and-republic-korea-s-ministry-trade-industry Download Intelligence Reform and Terroroism Prevention Act- December 17, 2004 To reform the intelligence community and the intelligence and intelligence-related activities of the United States Government, and for other purposes. http://energy.gov/hss/downloads/intelligence-reform-and-terroroism-prevention-act-december-17-2004


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81 - 22390 of 31,917 results. 81 - 22390 of 31,917 results. Article Joint Statement between U.S. Department of Energy and Republic of Korea's Ministry of Trade, Industry, and Energy Poneman and Sang-jick, met on May 7, 2013, at the Department of Energy (DOE) headquarters in Washington, D.C., where they exchanged views on cooperation on a wide range of energy priorities. http://energy.gov/articles/joint-statement-between-us-department-energy-and-republic-korea-s-ministry-trade-industry Article Energy 101: Feedstocks for Biofuels and More See how organic materials are used to create biofuels, reducing dependence on foreign oil and creating jobs. http://energy.gov/eere/articles/energy-101-feedstocks-biofuels-and-more Article Energy 101: Hydroelectric Power Learn how hydroelectric power, or hydropower, captures the kinetic energy


The effects of prevention and public health expenditure on measles immunization rates in Organisation for Economic Co-Operation and Development (OECD) countries  

E-Print Network (OSTI)

Belgium* 40 40 0 Canada 185 184 1 Czech Republic 27 23 4 Denmark 15 13 2 Finland 87 41 47 France 90 68 22 Germany 100 86 15 Greece 65 35 30 Hungary** 54 29 24 Iceland 40 40 0 Ireland 78 59 19 Italy 15 15 0 Japan* 50 30 20 Korea 21 20 1....4 Austria 74.0 Belgium 82. Canada** 94.5 Czech Republic 96.9 Denmark 96.0 Finland 97. France 87.1 Germany 93.3 Greece 88.0 Hungary 99.9 Iceland* 99.0 Ireland 81. Italy 85.5 Japan*** 100.0 Korea**** 90.2 Luxembourg 91.0 Mexico 96.4 Netherlands...

Chen, Christina Melonie



Global energy in transition: environmental aspects of new and renewable sources for development  

SciTech Connect

Technical, development, and environmental aspects of the following alternative sources are assessed: solar energy, wind energy, energy from the oceans, hydropower, geothermal energy, biomass, fuelwood and charcoal, peat, oil shale and tar sands, and draft animal power. Policy issues for energy planning and development are presented for: rural energy, industry and transport, and financing new and renewable sources of energy. Summaries of the following national reports are included: China, Federal Republic of Germany, Hungary, Jamaica, Korea, Pakistan, Peru, Sudan, and United States. (MHR)

Bassan, E.



ASPAC (Asian and Pacific Council) Nations: Popular support for governments, political communities, and regimes ---------- 1960-1971  

E-Print Network (OSTI)

-1971. The nine countries are: The Republic of Korea, Japan, Nationalist China, the Philippines, Thailand, Malaysia, South Vietnam, New Zealand, and Australia, which consti. tute the Asian and Pacific Council. Eighteen national-level variables as independent..., Japan, Nationalist China, the Philippines, Thailand, Nalaysia, South Vietnam, New Zea1and, and Australia, for the period of 1960-1971. These nations constitute the Asian and Pacific Council, which has been the least integrated of the ma)or world...

Lim, Kook-Joon



Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network (OSTI)

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo



E-Print Network (OSTI)

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.


Korea Brings U.S. Design to Life  

Science Journals Connector (OSTI)

...the Princeton Plasma Physics Laboratory (PPPL) felt a mixture of pride and regret last...a fusion research facility slated for PPPL that the U.S. Congress killed in 1995...continually and at high performance, says PPPL's George Neilson, physics coordinator...

Michael Baker



New Anti-Rebate Legislation in South Korea  

Science Journals Connector (OSTI)

The South Korean Government recently announced a reform in the drug anti-rebate law, with the purpose of eradicating pervasive, unethical, and illegal rebate practices in pharmaceutical marketing. The main object...

Su-Yeon Yu; Bong-Min Yang; Jin-Hyun Kim



Strategy for Designing DSM Program after the Restructuring in Korea  

E-Print Network (OSTI)

introduce a new DSM mechanism and program development strategies based on customer response and electricity industry efficiency. Especially we introduced DLC(Direct Load Control) technology via two-way communication scheme for large customer. This DLC...

Rhee, C.; Lee, K.; Jo, I.



Feasibility study of Korea biocluster with real estate perspectives  

E-Print Network (OSTI)

Globalization has created a dynamic and rapidly changing marketplace. A business must move quickly to capitalize on the changing environment. For example, many global biotechnology firms are seeking new geographical locations ...

Choi, Junghun



Bangladesh Korea Information Access Center znd Batch Result  

E-Print Network (OSTI)

Bakar Siddique 20100220 Mahmud Hasan Naim 20100222 Md. Faruque Hasan 20too2L7 Afrin Amin Course code. Mofizullslam 20100190 Uzzal Kumar Modok 20roo27t Mahmudul Hasan ChowdhurY 20100181 Md Asif Hasan 20L00L92 Ali lslam 20100189 A.K.M Ashrafur Rahman 20t00123 Tasvia Mausumi Rashid 20L00272 Gazi Hasan Arefin #12;

Rahman, A.K.M. Ashikur


Emerging Hubs: South Korea, Sri Lanka, Mauritius, and Bahrain  

Science Journals Connector (OSTI)

A crosscutting analysis of the six case studies and an examination of key issues and challenges related to education hub development are the focus of this chapter. The key themes for the comparative analysis i...

Lois Dou; Jane Knight


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Force Behind North Korea's New Science University  

Science Journals Connector (OSTI)

...University of Science and Technology (PUST) at a ceremony...University of Science and Technology (YUST) here in Yanji, capital...three schools: information technology; industry and management...in a country with a slick Intranet (Science, 17 September...

Richard Stone



Patient dose measurements in diagnostic radiology procedures in Korea  

Science Journals Connector (OSTI)

......by the International Atomic Energy Agency (IAEA) and a guiding...essential part of a medical audit and quality assurance programme...3. International Atomic Energy Agency. International basic...stated International Atomic Energy Agency (IAEA) reference levels......

You-hyun Kim; Jong-hak Choi; Chang-kyun Kim; Jung-min Kim; Sung-soo Kim; Yu-whan Oh; Chang-yeap Lee; Dae-hyun Kang; Young-bae Lee; Pyong-kon Cho; Hyung-chul Kim; Chel-min Kim



The Political Economies of Broadband Development in Korea and Japan  

E-Print Network (OSTI)

of DSL), gave Japan the fastest household broadband networksJapan third in the number of total broadband subscribers, 10 and by the end of 2005 over 44% of households

Kushida, Kenji; Oh, Seung-Youn



How ORISE is Making a Difference: REAC/TS Strengthens Preparedness for  

NLE Websites -- All DOE Office Websites (Extended Search)

REAC/TS Strengthens Preparedness for Radiation Emergencies Worldwide REAC/TS Strengthens Preparedness for Radiation Emergencies Worldwide ORISE's Global Partnerships Strengthen International Preparedness for Radiological Emergencies The Radiation Emergency Assistance Center/Training Site (REAC/TS) at the Oak Ridge Institute for Science and Education (ORISE) continues to establish international partnerships through education, exercises and conferences, which is helping to strengthen radiation emergency medical response around the globe. REAC/TS' international collaborations include observing a national full-field exercise at the Korea Hydroelectric CANDU Nuclear Power Plant complex in Wolsong, South Korea. The Republic of Korea Ministry of Science and Technology (MOST) invited REAC/TS Director Albert Wiley, M.D., Ph.D.,


Hanbit Solar Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Hanbit Solar Co Ltd Hanbit Solar Co Ltd Jump to: navigation, search Name Hanbit Solar Co Ltd Place Daejeon, Daejeon, Korea (Republic) Sector Solar Product Korea-based JV company established by Norwegian REC Group and local Central Micronics to oversee solar projects in Korea. Coordinates 36.336552°, 127.405899° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.336552,"lon":127.405899,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


IEA Response System for Oil Supply Emergencies 2011  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 1 IEA Response System for OIL SUPPLY 2 IEA MEMBER COUNTRIES Australia Austria Belgium Canada Czech Republic Denmark Finland France Germany Greece Hungary Ireland Italy Japan Korea (Republic of) Luxembourg Netherlands New Zealand Norway Poland Portugal Slovak Republic Spain Sweden Switzerland Turkey United Kingdom United States These countries are members of the Organisation for Economic Co-operation and Development (OECD), as the IEA is an autonomous agency linked with the OECD. The European Commission also participates in the work of the IEA. The International Energy Agency (IEA) is the energy forum for 28 industrialised countries. IEA member country governments are committed to taking joint measures to meet oil supply emergencies. They also have agreed to share energy information,


Total Crude Oil and Products Imports from All Countries  

Gasoline and Diesel Fuel Update (EIA)

Country: All Countries Persian Gulf OPEC Algeria Angola Ecuador Iraq Kuwait Libya Nigeria Qatar Saudi Arabia United Arab Emirates Venezuela Non OPEC Albania Argentina Aruba Australia Austria Azerbaijan Bahamas Bahrain Barbados Belarus Belgium Belize Benin Bolivia Brazil Brunei Bulgaria Burma Cameroon Canada Chad Chile China Colombia Congo (Brazzaville) Congo (Kinshasa) Cook Islands Costa Rica Croatia Cyprus Czech Republic Denmark Dominican Republic Egypt El Salvador Equatorial Guinea Estonia Finland France Gabon Georgia, Republic of Germany Ghana Gibralter Greece Guatemala Guinea Hong Kong Hungary India Indonesia Ireland Israel Italy Ivory Coast Jamaica Japan Kazakhstan Korea, South Kyrgyzstan Latvia Liberia Lithuania Malaysia Malta Mauritania Mexico Midway Islands Morocco Namibia Netherlands Netherlands Antilles New Zealand Nicaragua Niue Norway Oman Pakistan Panama Papua New Guinea Peru Philippines Poland Portugal Puerto Rico Romania Russia Senegal Singapore Slovakia South Africa Spain Spratly Islands Swaziland Sweden Switzerland Syria Taiwan Thailand Togo Trinidad and Tobago Tunisia Turkey Turkmenistan Ukraine United Kingdom Uruguay Uzbekistan Vietnam Virgin Islands (U.S.) Yemen


IEA Response System for OIL SUPPLY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 2 IEA Response System for OIL SUPPLY 2 IEA MEMBER COUNTRIES Australia Austria Belgium Canada Czech Republic Denmark Finland France Germany Greece Hungary Ireland Italy Japan Korea (Republic of) Luxembourg Netherlands New Zealand Norway Poland Portugal Slovak Republic Spain Sweden Switzerland Turkey United Kingdom United States These countries are members of the Organisation for Economic Co-operation and Development (OECD), as the IEA is an autonomous agency linked with the OECD. The European Commission also participates in the work of the IEA. The International Energy Agency (IEA) is the energy forum for 28 industrialised countries. IEA member country governments are committed to taking joint measures to meet oil supply emergencies. They also have agreed to share energy information,


Nationally Appropriate Mitigation Actions | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Nationally Appropriate Mitigation Actions Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Nationally Appropriate Mitigation Actions Agency/Company /Organization: United Nations Framework Convention on Climate Change Sector: Energy, Land Focus Area: Energy Efficiency Topics: GHG inventory, Low emission development planning Resource Type: Publications, Lessons learned/best practices, Case studies/examples Website: unfccc.int/home/items/5265.php Country: Afghanistan, Antigua and Barbuda, Armenia, Benin, Bhutan, Botswana, Brazil, Cameroon, Central African Republic, China, Democratic Republic of Congo, Costa Rica, Ivory Coast, Ethiopia, Eritrea, Gabon, Georgia (country), Ghana, India, Indonesia, Israel, Jordan, Madagascar, Maldives, Marshall Islands, Mauritania, Mexico, Mongolia, Morocco, Papua New Guinea, Peru, South Korea, Moldova, San Marino, Sierra Leone, Singapore, South Africa, Republic of Macedonia, Togo, Tunisia


The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network (OSTI)



Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce


The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert


UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.



UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network (OSTI)

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.


Nobility Solar Projects | Open Energy Information  

Open Energy Info (EERE)

Nobility Solar Projects Nobility Solar Projects Jump to: navigation, search Name Nobility Solar Projects Place Brno, Czech Republic Zip 602 00 Sector Solar Product A solar equipment distributer and project developer based in the Czech Republic. Coordinates 49.19729°, 16.603615° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.19729,"lon":16.603615,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


CEZ Obnovitelne zdroje sro Renewable Resources | Open Energy Information  

Open Energy Info (EERE)

CEZ Obnovitelne zdroje sro Renewable Resources CEZ Obnovitelne zdroje sro Renewable Resources Jump to: navigation, search Name CEZ Obnovitelne zdroje sro (Renewable Resources) Place Prague 4, Czech Republic Zip 140 53 Sector Biomass, Renewable Energy Product Subsidiary of CEZ Group that is focused on energy generation from renewable resources, except for combustion of biomass with coal. References CEZ Obnovitelne zdroje sro (Renewable Resources)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. CEZ Obnovitelne zdroje sro (Renewable Resources) is a company located in Prague 4, Czech Republic . References ↑ "[ CEZ Obnovitelne zdroje sro (Renewable Resources)]" Retrieved from "http://en.openei.org/w/index.php?title=CEZ_Obnovitelne_zdroje_sro_Renewable_Resources&oldid=343432"


Energy Efficiency Country Study: Republic Of South Africa  

E-Print Network (OSTI)

35 A NNEX 3. I NFORMATION ON H EAT P UMP REBATE PROGRAMby Eskom. Determines SOP rebate levels. Approve verificationAnnex 2. Information on SWH Rebate program details. TARGET

Can, Stephane de la Rue du



SIAM UK and Republic of Ireland section annual meeting 2009  

E-Print Network (OSTI)

that the formation of drumlins occurs through and instability associated with the flow of ice over a wet deformable version of the model may be solved numerically to produce two-dimensional wave forms with the properties