Powered by Deep Web Technologies
Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


United States-Republic of Korea (ROK) International Nuclear Energy...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

United States-Republic of Korea (ROK) International Nuclear Energy Research Initiative (INERI) Annual Steering Committee Meeting United States-Republic of Korea (ROK) International...


Republic of Korea Country report Description of dosimetry services in the Republic of Korea  

E-Print Network [OSTI]

The Korea Atomic Energy Research Institute (KAERI) has a state-of-the-art In Vivo Radioassay and Research Facility (IVRRF) facility designed expressly for in vivo measurement of radioactive material. Although the IVRRF's primary activity is providing routine in vivo counting services to KAERI radiation workers, the facility also conducts work for clients including a fuel fabrication facilities and nuclear facilities. Counting System KAERI in vivo counter combines the characteristics of the U/Pu lung counter and the advantage of a high sensitivity scanning NaI(Tl) whole body counter into one compact system. The low energy lung counter is designed for facilities that need to accurately measure lung depositions of actinides such as uranium, plutonium and americium. The scanning whole body counter is designed to detect and identify the location of higher energy nuclides anywhere in the body. The detection system of the low energy lung counter consists of two arrays of ACT (Actinide)-II detector system which combi...

Lee, T Y



Current MSW Management and Waste-to-Energy Status in the Republic of Korea  

E-Print Network [OSTI]

(WTE) in Korea and the potential for improvement. Despite growth of per capita GDP of nearly 501 Current MSW Management and Waste-to-Energy Status in the Republic of Korea By Yoonjung Seo of the generally accepted hierarchy of waste management. The study also investigated the status of waste-to-energy

Columbia University


SMART WATER GRID INTERNATIONAL CONFERENCE 2013 12-14 November 2013, Incheon, Republic of Korea  

E-Print Network [OSTI]

SMART WATER GRID INTERNATIONAL CONFERENCE 2013 12-14 November 2013, Incheon, Republic of Korea SMART WATER GRIDS AND NETWORK VULNERABILITY Pierre Y. Julien1 and Olga A. Martyusheva2 1 Professor, Colorado State University, Fort Collins, CO 80521-1372, USA Keywords: Energy Conservation; Smart Water Grid

Julien, Pierre Y.


Republic of Korea Reduction of Financing Barriers for Energy Savings Performance Contracts  

SciTech Connect (OSTI)

This paper discusses the findings developed for strengthening the role of performance contracting in improving energy efficiency in the Republic of Korea. The U.S. Environmental Protection Agency (EPA) sponsored development of this paper by the National Renewable Energy Laboratory (NREL), as a part of the Korean-U.S. Climate Technology Partnerships (CTP) program. The results and recommendations outlined in this paper together with other efforts are designed to assist other countries striving to improve their efficient use of energy.

Howard, D. L.



Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the Republic of Korea  

E-Print Network [OSTI]

KEMCO, 2012c. Korea's Energy Standards and Labeling: MarketBaseline Unit Energy Consumption Adjustment Market Sharesof Conserved Energy Table for Freezers Market Share Lifetime

McNeil, Michael A.



Report on Project Action Sheet PP05 task 3 between the U.S. Department of Energy and the Republic of Korea Ministry of Education, Science, and Technology (MEST).  

SciTech Connect (OSTI)

This report documents the results of Task 3 of Project Action Sheet PP05 between the United States Department of Energy (DOE) and the Republic of Korea (ROK) Ministry of Education, Science, and Technology (MEST) for Support with Review of an ROK Risk Evaluation Process. This task was to have Sandia National Laboratories collaborate with the Korea Institute of Nuclear Nonproliferation and Control (KINAC) on several activities concerning how to determine the Probability of Neutralization, PN, and the Probability of System Effectiveness, PE, to include: providing descriptions on how combat simulations are used to determine PN and PE; comparisons of the strengths and weaknesses of two neutralization models (the Neutralization.xls spreadsheet model versus the Brief Adversary Threat-Loss Estimator (BATLE) software); and demonstrating how computer simulations can be used to determine PN. Note that the computer simulation used for the demonstration was the Scenario Toolkit And Generation Environment (STAGE) simulation, which is a stand-alone synthetic tactical simulation sold by Presagis Canada Incorporated. The demonstration is provided in a separate Audio Video Interleave (.AVI) file.

Snell, Mark Kamerer



Joint Statement by Energy Ministers of G8, The People's Republic...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Joint Statement by Energy Ministers of G8, The People's Republic of China, India and The Republic of Korea (June 2008) Joint Statement by Energy Ministers of G8, The People's...


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld



Pacific Affairs Volume 77, No.3 Fall 2004, 493-516 (Electricity Reform at a Crossroads: Problems in South Korea's Power  

E-Print Network [OSTI]

Policies of IEA Countries: The Republic of Korea 2002 Review (Paris: IEA, 2002) . #12;Byrne, John, L. Gover) , . 1) , , , , 2000. 2) Center for Energy and Environmental Policy (CEEP), A Review of US of Intent of the Government of the Republic of Korea (1999), and Memorandum of Economic Policies (1998

Delaware, University of


ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone



E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick



Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin



E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add


El Salvador Korea Design Your IT Career in Korea  

E-Print Network [OSTI]

1 El Salvador ­ Korea Design Your IT Career in Korea Hwang, Wonseok Senior Volunteer of KOICA, Korea scha@korea.ac.kr #12;Who is Wonseok Hwang? · KOICA Senior Volunteer in El Salvador, 2011~2013 ­ Consejo Nacional de Ciencia y Tecnología El Salvador · President, NetPG Systems Korea · Vice President


Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of


Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL


Islamic Republic of Afghanistan  

E-Print Network [OSTI]

Republic of Iran Ammunition and Metallurgy Industries Group (AMIG) Ammunition and Metallurgy Industry Group

Takada, Shoji


Seismological Evidence for a Low-Yield Nuclear Test on 12 May 2010 in North Korea  

E-Print Network [OSTI]

E Seismological Evidence for a Low-Yield Nuclear Test on 12 May 2010 in North Korea by Miao Zhang. INTRODUCTION Three nuclear tests (in 2006, 2009, and 2013) conducted by the Democratic People's Republic.g., the U. S. Geological Survey [USGS] and the Comprehensive Nuclear-Test-Ban Treaty Organization [CTBTO

Wen, Lianxing


Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip


Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.


Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation


Avian survey and field guide for Osan Air Base, Korea.  

SciTech Connect (OSTI)

This report summarizes the results of the avian surveys conducted at Osan Air Base (AB). This ongoing survey is conducted to comply with requirements of the Environmental Governing Standards (EGS) for the Republic of Korea, the Integrated Natural Resources Management Plan (INRMP) for Osan AB, and the 51st Fighter Wing's Bird Aircraft Strike Hazard (BASH) Plan. One hundred ten bird species representing 35 families were identified and recorded. Seven species are designated as Natural Monuments, and their protection is accorded by the Korean Ministry of Culture and Tourism. Three species appear on the Korean Association for Conservation of Nature's (KACN's) list of Reserved Wild Species and are protected by the Korean Ministry of Environment. Combined, ten different species are Republic of Korea (ROK)-protected. The primary objective of the avian survey at Osan AB was to determine what species of birds are present on the airfield and their respective habitat requirements during the critical seasons of the year. This requirement is specified in Annex J.14.c of the 51st Fighter BASH Plan 91-212 (51 FW OPLAN 91-212). The second objective was to initiate surveys to determine what bird species are present on Osan AB throughout the year and from the survey results, determine if threatened, endangered, or other Korean-listed bird species are present on Osan AB. This overall census satisfies Criterion 13-3.e of the EGS for Korea. The final objective was to formulate management strategies within Osan AB's operational requirements to protect and enhance habitats of known threatened, endangered, and ROK-protected species in accordance with EGS Criterion 13-3.a that are also favorable for the reproduction of indigenous species in accordance with the EGS Criterion 13-3.h.

Levenson, J.



Delivered by Publishing Technology to: Korea University IP: On: Tue, 24 Dec 2013 04:37:57  

E-Print Network [OSTI]

that silicide-Si heterostructures are formed by axially intruding contact metal and that the extent Vol. 13, 6222­6225, 2013 Fabrication and RF Characterization of a Single Nickel Silicide Nanowire, Suwon, Gyeonggi 440-746, Republic of Korea We fabricated a nickel silicide nanowire (NiSi NW) device

Hwang, Sung Woo


Islamic Republic of Afghanistan  

E-Print Network [OSTI]

of Afghanistan Islamic Republic of Pakistan Ummah Tameer E-Nau (UTN) N 4 United Arab Emirates Energy Global International FZE B,C,M,N 5 United Arab Emirates International General Resourcing FZE M 6 United Arab Emirates Modern Technologies FZC (MTFZC) N 7 United Arab Emirates Petroiran Development Company (PEDCO

Takada, Shoji


Mario Biagioli Patent Republic  

E-Print Network [OSTI]

Mario Biagioli Patent Republic: Representing Inventions, Constructing Rights and Authors social research Vol 73 : No 4 : Winter 2006 1129 compared to casting a vote, applying for a patent is slow, costly, Germany, and Russia), patents were gifts the sovereigns could either grant or withhold from their subjects



E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi


Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurements of radioxenon in ground level air in South Korea following the claimed nuclear test in North Korea on October 9, 2006  

SciTech Connect (OSTI)

Abstract Following the claimed nuclear test in the Democratic Peoples Republic of Korea (DPRK) on October 9, 2006, and a reported seismic event, a mobile system for sampling of atmospheric xenon was transported to the Republic of South Korea (ROK) in an attempt to detect possible emissions of radioxenon in the region from a presumed test. Five samples were collected in the ROK during October 1114, 2006 near the ROKDPRK border, and thereafter transported to the Swedish Defense Research Agency (FOI) in Stockholm, Sweden, for analysis. Following the initial measurements, an automatic radioxenon sampling and analysis system was installed at the same location in the ROK, and measurements on the ambient atmospheric radioxenon background in the region were performed during November 2006 to February 2007. The measured radioxenon concentrations strongly indicate that the explosion in October 9, 2006 was a nuclear test. The conclusion is further strengthened by atmospheric transport models. Radioactive xenon measurement was the only independent confirmation that the supposed test was in fact a nuclear explosion and not a conventional (chemical) explosive.

Ringbom, Anders; Elmgren, K.; Lindh, Karin; Peterson, Jenny; Bowyer, Ted W.; Hayes, James C.; McIntyre, Justin I.; Panisko, Mark E.; Williams, Richard M.



October 10th Daejeon Convention Center, KOREA  

E-Print Network [OSTI]

using pilot devices during the construction phase of International Thermonuclear Experimental Reactor Thermonuclear Experimental Reactor European Union Russia China Japan United States of America India Korea #12


Korea's Green Growth Strategy: Mitigating Climate Change and...  

Open Energy Info (EERE)

Korea's Green Growth Strategy: Mitigating Climate Change and Developing New Growth Engines Jump to: navigation, search Name Korea's Green Growth Strategy: Mitigating Climate Change...


Sunpower Korea | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen, Minnesota:36052°,Sunfield, Michigan:Sunnyvale,Korea Jump to:


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip


Michael Lavelle, `12 Santo Domingo, Dominican Republic  

E-Print Network [OSTI]

Michael Lavelle, `12 Santo Domingo, Dominican Republic La Posada del Buen Samaritano In the summer of the Dominican Republic, Santo Domingo. My classmate Craig and I spent six weeks at La Posada del Buen Samaritano as a place for people to stay while they are receiving medical care. As the Dominican Republic


E-Print Network 3.0 - arab republic malaysia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: Dominican Republic ---- TP East Timor -Iu- EC Ecuador (Republic of) bIU- EG Egypt (Arab Republic of) ---- SV... Liberia (Republic of) ---- LY Libyan Arab Jamahiriya...


E-Print Network 3.0 - arab republic niger Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: Dominican Republic ---- TP East Timor -Iu- EC Ecuador (Republic of) bIU- EG Egypt (Arab Republic of) ---- SV... Liberia (Republic of) ---- LY Libyan Arab Jamahiriya...


NRF Republic of South Africa  

E-Print Network [OSTI]

1 NRF Republic of South Africa GDRI Project Groupement de Recherche International International Africa called SACCLAP (Seasonal and Annual trends of Air quality at the South Africa scale and its impact Research Consortium Atmospheric Research in Southern Africa and Indian Ocean (ARSAIO) September 2008 #12

Dintrans, Boris


2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.


Hydrogeologic and topographic factors influencing well yields in fractured crystalline rocks - Seoul, Republic of Korea  

E-Print Network [OSTI]

, it is necessary to evaluate the factors affecting specific capacity. Siddiqui and Parizek (1971) state that the specific capacity of' a well may be affected by the well radiils, srdilrated thickness of rock penetrated by the well and several other factors.... (Siegel, 1956). In the present study, it was applied to evaluate the significance of differences in the effects of topographic setting, rock type, and distance from the Han River on the productivity of wells (Table 2). The statistic, V, used...

Kim, Sang-Il



Introduction Faculty 291 Daehak-ro, Yuseong-gu, Daejeon, Republic of Korea  

E-Print Network [OSTI]

Cryptology, information security Computer graphics, computer vision Software engineering, formal methods engineering Computer networks, distributed systems HCI, interaction devices Information hiding, multimedia, bioinformatics Programming languages and program analysis Real-time embedded systems, cyber-physical systems

Kim, Yong Jung


Fuel and Famine: Rural Energy Crisis in the Democratic People's Republic of Korea  

E-Print Network [OSTI]

Korean researcher conducting rural energy survey in villageFuel and Famine: Rural Energy Crisis in the Democratic7 Rural Energy

Williams, James H.; von Hippel, David; Hayes, Peter



Joint Statement between U.S. Department of Energy and Republic of Korea's  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomentheATLANTA,Fermi NationalBusinessDepartmentatJeffRoundtables


United States-Republic of Korea (ROK) International Nuclear Energy Research  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' Research Petroleum ReserveDepartment ofEnergy, Office ofNuclearVision"Initiative


International diffusion practice : lessons from South Korea's New Village Movement  

E-Print Network [OSTI]

This research focuses on how South Korea's development model-namely, the Saemaul Undong, or the New Village Movement-is diffused internationally, in particular, to the developing country of Vietnam. South Korea's successful ...

Kim, Jung Hwa, M.C.P. Massachusetts Institute of Technology



Advancing our Nuclear Collaboration with the Czech Republic ...  

Broader source: Energy.gov (indexed) [DOE]

our Nuclear Collaboration with the Czech Republic Advancing our Nuclear Collaboration with the Czech Republic September 28, 2011 - 5:36pm Addthis President Obama addresses a crowd...


United States and Czech Republic Join Together to Announce Bilateral...  

Office of Environmental Management (EM)

Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts United States and Czech Republic Join Together to Announce Bilateral Nuclear...


"Who needs MacArthur?" : analyzing South Korea's counterinvasion capability against North Korea  

E-Print Network [OSTI]

Assuming there is another North Korean invasion; could the South Koreans counterinvade North Korea and prevail even without the United States' assistance? This paper studies the possibility of a South Korean counterinvasion ...

Chung, Jonghyuk



South Korea: Hi-Tech Mecca  

E-Print Network [OSTI]

Broadcast Transcript: Greetings from South Korea, hi-tech Mecca. According to the San Francisco Chronicle, practically the entire country now has access to broadband speeds of up to 20 megabits per second. Compare that to a paltry 4 megabits per...

Hacker, Randi; Tsutsui, William


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Statutes of the Academy of Sciences of the Czech Republic  

E-Print Network [OSTI]

Statutes of the Academy of Sciences of the Czech Republic The Government of the Czech Republic of the Academy of Sciences of the Czech Republic Preamble The Academy Assembly of the Academy of Sciences, to the Act on the Academy of Sciences of the Czech Republic1 and to other legal regulations pertaining

Krejc, Pavel


E-Print Network 3.0 - area czech republic Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

15 List of participants Prague Czech Republic Summary: List of participants Austria Thailand Thailand Prague Czech Republic Austria Czech Republic Austria... Austria Warsaw...


South Korea: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerTypePonsa,HomeIndiana:Rhode Island References:Korea:


Korea Silicon Co Ltd | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6Kentwood,GeorgeKlimaschutz eKodiak,Kooskia, Idaho:Korea


AstroKorea | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine: Energy Resources JumpAspen Aerogels JumpRenewable EnergyAssured|AstroKorea


Study Abroad in South Korea Construction Management & Civil Engineering  

E-Print Network [OSTI]

Korea and North Korea. After having become more acclimated to culture the students separated from Institute for Defense Analysis, to speakers from the private sector working in oil refining plants, they went up to the ski slopes where 2018 Olympic ski events will be held. One of the main features

Hutcheon, James M.


Czech Republic HEU Removal | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

HEU Removal Czech Republic HEU Removal Location Czech Republic United States 49 35' 23.3628" N, 15 4' 23.6712" E See map: Google Maps Javascript is required to view this map....



E-Print Network [OSTI]

Update: March 28, 2014 1 EXECUTIVE SUMMARY: PEACECARE-DOMINICAN REPUBLIC A partnership between Peace Corps-Dominican Republic, the community of Guaymate, the University of Illinois) and Northwestern University (NU), Peace Corps volunteers in the Dominican Republic, and the Guaymate community

Alford, Simon


Country Report on Building Energy Codes in Korea  

SciTech Connect (OSTI)

This report is part of a series of reports on building energy efficiency codes in countries associated with the Asian Pacific Partnership (APP) - Australia, South Korea, Japan, China, India, and the United States of America (U.S.). This reports gives an overview of the development of building energy codes in Korea, including national energy policies related to building energy codes, history of building energy codes, recent national projects and activities to promote building energy codes. The report also provides a review of current building energy codes (such as building envelope, HVAC, and lighting) for commercial buildings in Korea.

Evans, Meredydd; McJeon, Haewon C.; Shui, Bin; Lee, Seung Eon



An assessment of North Korea's nuclear weapons capabilities  

E-Print Network [OSTI]

In February of 2013, North Korea conducted its third nuclear weapons test. Speculations are that this test was conducted to further develop a warhead small enough to fit on an intercontinental ballistic missile. This test ...

Sivels, Ciara (Ciara Brooke)



A Report on Smoking Advertising and Promotion Bans in The lslamic Republic of Iran  

E-Print Network [OSTI]

increase tobacco use in the Islamic Republic of Iran.The Islamic Republic of Iran Ministry of Health and MedicalCommittee Islamic Republic of Iran World Health Organization

World Health Organization; Ministry of Health and Medical Education Deputy of Health



Memorandum of Understanding the Government of the Republic of Indonesia and  

E-Print Network [OSTI]

Memorandum of Understanding between the Government of the Republic of Indonesia and the Government The Government of the Republic of Indonesia and the government of the People's Republic of China, hereinafter


Multicultural Education in the Republic of Korea: How Elementary School Teachers Interpret Multicultural Education and Its Practical Use in Classrooms  

E-Print Network [OSTI]

six in the Playground section, news article is on the Cia-Cia tribe in Buton Island, Indonesia (MEST, 2011a, p.As a traditional oral culture, the Cia-Cia had no indigenous

Lee, Jee Young



Business Case for Energy Efficiency in Support of Climate Change Mitigation, Economic and Societal Benefits in the Republic of Korea  

E-Print Network [OSTI]

Environmental Energy Technologies Division June 8, 2012 Thisand on high-efficiency technology options that are availableknown for their high- end technology, generate substantial

McNeil, Michael A.



Dominican Republic-Regional Programme for LAC: Support for the...  

Open Energy Info (EERE)

LAC: Support for the Preparation of the National Climate Change Policy (Redirected from UNDP-Dominican Republic Regional Programme for LAC - Support for the preparation of the...


Dominican Republic-Regional Programme for LAC: Support for the...  

Open Energy Info (EERE)

Preparation of the National Climate Change Policy Jump to: navigation, search Name UNDP-Dominican Republic Regional Programme for LAC - Support for the preparation of the National...


Dominican Republic-Support for the Preparation of National Climate...  

Open Energy Info (EERE)

National Climate Change Strategy Jump to: navigation, search Name Dominican Republic-Argentina-Support for the Preparation of National Climate Change Strategy AgencyCompany...


Central African Republic-National Adaptation Plan Global Support...  

Open Energy Info (EERE)

manual, Publications, Workshop Website http:undp-alm.orgprojectsn Program Start 2013 Country Central African Republic Middle Africa References National Adaptation Plan...


E-Print Network 3.0 - arab republic tunisia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

--Uf- DO Dominican Republic ----- TP East Timor -Iu-- EC Ecuador (Republic of) bIU-- EG Egypt (Arab... Sweden (Kingdom of) BIUFO CH Switzerland (Swiss Confederation) ----- SY Syria...


E-Print Network 3.0 - arab republic journal Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

--Uf- DO Dominican Republic ----- TP East Timor -Iu-- EC Ecuador (Republic of) bIU-- EG Egypt (Arab... Sweden (Kingdom of) BIUFO CH Switzerland (Swiss Confederation) ----- SY Syria...

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Transnational Circulations of "Laban" Methods: Gender, Power Relations, and Negotiated Meanings in Early Twenty-First Century South Korea's Modernity  

E-Print Network [OSTI]

economic globalization extends the economy beyond thein the economy during South Koreas globalization process,globalization, which conforms to the world economy order and

Hwang, Hye-Won



Country hedging for real income stabilization: a case study of South Korea and Egypt  

E-Print Network [OSTI]

It Manageable in the Case of Egypt?" Journal of Modeling, 2:S1UDY OF SOUIH KOREA AND EGYPT by Kathryn M. llirdon andSTUDY OF SOUTII KOREA AND EGYPT* By Kathryn M. Gordon and

Gordon, Kathryn M.; Rausser, Gordon C.



Holy Mother of Chiri Mountain: A Female Mountain Spirit in Korea  

E-Print Network [OSTI]

Spirit in Korea by Maya Stiller UCLA Center for the Study ofSpirit in Korea by Maya Stiller I n his case study of femaleand commoners alike. Maya Stiller is a graduate student in

Stiller, Maya



Electricity privatization : should South Korea privatize its state-owned electric utility?  

E-Print Network [OSTI]

The state-owned electric utility, Korea Electricity Power Cooperation (KEPCO), privatization has been a key word in South Korea since 1997, when the government received $55 billion from the International Monetary Fund in ...

Lim, Sungmin




E-Print Network [OSTI]

THREE WORDS ABOUT MOBILE PHONES: FINDINGS FROM SWEDEN, THE US, ITALY, JAPAN, AND KOREA Naomi S phones: findings from Sweden, the US, Italy, Japan, and Korea While roughly half of the world students in Sweden, the US, Italy, Japan, and Korea, between the ages of 18 and 24. One of our open

Carlini, David


REPORT from ISWA 2011 WORLD CONGRESS 17-20 October 2011, DAEGU, KOREA  

E-Print Network [OSTI]

Production ­ Fuell Cell Power by Plasma Gasification of Municipal Solid Waste", Mr. Jorgen Haukohl from Waste Association, held between 17th &20th October 2011 in Daegu, Korea, with a total participation of Environment of Korea, and Korea Society of Waste Management. Many Local companies like GS Caltex, Samsung

Columbia University



E-Print Network [OSTI]

MEMORANDUM OF UNDERSTANDING BETWEEN THE GOVERNMENT OF THE REPUBLIC OF INDONESIA AND THE GOVERNMENT The Government of the Republic of Indonesia and the Government of the United Kingdom of Great Britain Enforcement and Governance East Asia Ministerial Conference in Bali, Indonesia, in September 2001


Kimberly Robinson, '05 Las Matas de Farfan, Dominican Republic  

E-Print Network [OSTI]

Kimberly Robinson, '05 Las Matas de Farfan, Dominican Republic Nicci and I had the pleasure of spending our summer of service in the Dominican Republic. We stayed in the small town of Las Matas de Farfan about 10 miles from the Haitian border. The Dominican family that took us into their home


Advanced battery technology for electric two-wheelers in the people's Republic of China.  

SciTech Connect (OSTI)

This report focuses on lithium-ion (Li-ion) battery technology applications for two- and possibly three-wheeled vehicles. The author of this report visited the People's Republic of China (PRC or China) to assess the status of Li-ion battery technology there and to analyze Chinese policies, regulations, and incentives for using this technology and for using two- and three-wheeled vehicles. Another objective was to determine if the Li-ion batteries produced in China were available for benchmarking in the United States. The United States continues to lead the world in Li-ion technology research and development (R&D). Its strong R&D program is funded by the U.S. Department of Energy and other federal agencies, such as the National Institute of Standards and Technology and the U.S. Department of Defense. In Asia, too, developed countries like China, Korea, and Japan are commercializing and producing this technology. In China, more than 120 companies are involved in producing Li-ion batteries. There are more than 139 manufacturers of electric bicycles (also referred to as E-bicycles, electric bikes or E-bikes, and electric two-wheelers or ETWs in this report) and several hundred suppliers. Most E-bikes use lead acid batteries, but there is a push toward using Li-ion battery technology for two- and three-wheeled applications. Highlights and conclusions from this visit are provided in this report and summarized.

Patil, P. G.; Energy Systems



hal-00585316,version1-12Apr2011 Korea nuclear exports: Why did the Koreans win the UAE tender?  

E-Print Network [OSTI]

, thanks to an active national program of Nuclear Power Plant (NPP) construction, Korea has developed


Potential Collaborative Research topics with Koreas Agency for Defense Development  

SciTech Connect (OSTI)

This presentation provides a high level summary of current research activities at the Los Alamos National Laboratory (LANL)-University of California Jacobs School of Engineering (UCSD) Engineering Institute that will be presented at Korea's Agency for Defense Development (ADD). These research activities are at the basic engineering science level with different level of maturity ranging from initial concepts to field proof-of-concept demonstrations. We believe that all of these activities are appropriate for collaborative research activities with ADD subject to approval by each institution. All the activities summarized herein have the common theme that they are multi-disciplinary in nature and typically involved the integration of high-fidelity predictive modeling, advanced sensing technologies and new development in information technology. These activities include: Wireless Sensor Systems, Swarming Robot sensor systems, Advanced signal processing (compressed sensing) and pattern recognition, Model Verification and Validation, Optimal/robust sensor system design, Haptic systems for large-scale data processing, Cyber-physical security for robots, Multi-source energy harvesting, Reliability-based approaches to damage prognosis, SHMTools software development, and Cyber-physical systems advanced study institute.

Farrar, Charles R. [Los Alamos National Laboratory; Todd, Michael D. [Univ. of California, San Diego



West Nile virus transmission in resident birds, Dominican Republic  

E-Print Network [OSTI]

We report West Nile virus (WNV) activity in the Dominican Republic for the first time. Specific anti-WNV antibodies were detected in 5 (15%) of 33 resident birds sampled at one location in November 2002. One seropositive bird ...

Komar, Oliver; Robbins, Mark B.; Klenk, Kaci; Blitvich, Bradley J.; Marlenee, Nicole L.; Burkhalter, Kristen L.; Gubler, Duane J.; Gonzá lvez, Guillermo; Peñ a, Carlos J.; Peterson, A. Townsend; Komar, Nicholas



Microsoft Word - CX-Colville-Republic_Rebuild_WEB.doc  

Broader source: Energy.gov (indexed) [DOE]

Eric Orth Project Manager - TEP-TPP-3 Proposed Action: Colville-Republic No. 1 115-kV rebuild project Budget Information: Work Order 00270698 PP&A Project No.: PP&A 1786...


United States Department of Energy and the Republic of Kazakhstan...  

National Nuclear Security Administration (NNSA)

States Department of Energy and the Republic of Kazakhstan Ministry of Energy Mark the Completion of the Packaging of the BN-350 Fast Breeder Reactor Spent Fuel | National Nuclear...


Republic of South Africa Constitution Act 110 of 1983 To introduce a new constitution for the Republic of South Africa and to provide for matters  

E-Print Network [OSTI]

Republic of South Africa Constitution Act 110 of 1983 ACT To introduce a new constitution for the Republic of South Africa and to provide for matters incidental thereto. (English text signed by the State; and ARE DESIROUS OF GIVING THE REPUBLIC OF SOUTH AFRICA A CONSTITUTION which provides for elected and responsible

Sheridan, Jennifer


Factors affecting attitudinal patterns toward education in the Dominican Republic  

E-Print Network [OSTI]

FACTORS AF'FECTING ATTITUDINAL PATTERNS TOWARD EDUCATION IN THE DOHINICAN REPUBLIC A Thesi. s by EDWIN HUGH CARPENTER Submitted to the Graduate College of the Texas A&M University in partial fulfillment of the requirements for the degree... of NASTER OF SCIENCE August 1968 Major Sub)sot: Sociology FACTORS AFFECTING ATTITUDINAL PATTERNS TOWARD EDUCATION IN THE DOMINICAN REPUBLIC A Thesis by EDWIN HUGH CARPENTER Approved as to style and content by: (Chairman gf Commit tee) (Head...

Carpenter, Edwin Hugh



The status of coal briquetting technology in Korea  

SciTech Connect (OSTI)

Anthracite is the only indigenous fossil fuel resource produced in Korea and is an important main source of residential fuel. Due to its particular characteristics, the best way to use Korean coal is in the form of briquettes, called {open_quotes}Yontan.{close_quotes} The ability to use this coal as briquettes was a great discovery made nearly 50 years ago and since then, has made a great contribution to the energy consumption of low and middle income households. Korean anthracite in coal briquette form has been used widely for household heating purposes. Collieries in Korea produced no more than one million tons of anthracite annually in the 1960s. Production, however, increased substantially up to about 17 million tons per year in the mid-1970s. In 1986, Korea succeeded in raising its coal production to 24.2 million tons, which was the maximum production level achieved by the Korean coal industrial sector. Since then, anthracite production has fallen. In 1991, coal output dropped to 15.1 million tons, a decrease of 12.2 percent from the 17.2 million tons produced in 1990, due to falling coal demand and rising labor costs. The role of coal as an energy source will be more important in the future to meet projected economic growth in Korea. While the production of indigenous Korean anthracite is expected to decrease under a coal mining rationalization policy, imports of bituminous coal will increase rapidly and will be used as an oil substitute in industry and power generation. In this chapter, general aspects of the Korean coal industry and coal utilization for residential uses, especially the Yontan coal briquetting techniques, are discussed. In addition, coal briquetting technology applications suitable for the APEC region will be presented.

Choi, Woo-Zin



Corporate Governance from a Comparative Perspective: Specific Applications of the Duty of Loyalty in Korea  

E-Print Network [OSTI]

transaction. Kon S. Kim, Corporate Governance in Korea, 8 J.ARTICLES CORPORATE GOVERNANCE FROM A COMPARATIVEof Care Standard in Corporate Governance, 75 IOWA L. REV. 1,

Kwon, Jae Yeol



Bangladesh-Korea Information Access Center (IAC) Department of CSE, BUET, Dhaka 1000  

E-Print Network [OSTI]

Notice As per MOU signed by BUET and KADO, Korea, IAC is a self sustainable center and BUET will not pay

Rahman, A.K.M. Ashikur


Case Studies from the Climate Technology Partnership: Landfill Gas Projects in South Korea and Lessons Learned  

SciTech Connect (OSTI)

This paper examines landfill gas projects in South Korea. Two case studies provide concrete examples of lessons learned and offer practical guidance for future projects.

Larney, C.; Heil, M.; Ha, G. A.


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - area korea implications Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of this material is permitted. However, permission to reprintrepublish this material for advertising or promotional purposes or for creating Summary: -mail : kim1849@korea.com...


6.-Zoned Cr-spinel and "ferritchromit" alteration in forearc serpentinites from the northern Dominican Republic  

E-Print Network [OSTI]

Dominican Republic B. Saumur 1,2 , and K. H. Hattori2 1 Dept. of Geology, University of Toronto, 22 Russell in northern Dominican Republic belong to the northern Caribbean peridotite belt, which extends from Cuba


Michael Van Vliet and Amy Todd, `02 Santo Domingo, Dominican Republic  

E-Print Network [OSTI]

Michael Van Vliet and Amy Todd, `02 Santo Domingo, Dominican Republic In July of 2001, Amy Todd in the capitol of the Dominican Republic, Santo Domingo, we were immediately overcome and shocked by the poverty


E-Print Network 3.0 - arab republic senegal Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Republic 2 Costa Rica 13 Cote D'Ivoire 1 Cyprus 1 Czech Republic 1 Denmark 4 Ecuador 1 Egypt 7 El... Honduras 2 Hong Kong 32 Hungary 2 India 164 Indonesia 11 Iran ... Source:...


Memorandum of Understanding the Government of the Republic of Indonesia and  

E-Print Network [OSTI]

Memorandum of Understanding between the Government of the Republic of Indonesia and the Government The Government of the Republic of Indonesia and the government of the People's Republic of China, hereinafter practices toward sustainable forest management; http://www.illegal-logging.info/uploads/Indonesia


Keith Bartolomei and Anita Reddy, `03 Las Matas de Farfn, Dominican Republic  

E-Print Network [OSTI]

Keith Bartolomei and Anita Reddy, `03 Las Matas de Farfán, Dominican Republic Keith Bartolomei for malnourished children. We worked in Las Matas de Farfán, Dominican Republic, on the western side of the country with great love." At the close of our six-week trip to the Dominican Republic, I realized that the people we


Author's personal copy Corundum-bearing garnet peridotite from northern Dominican Republic  

E-Print Network [OSTI]

Author's personal copy Corundum-bearing garnet peridotite from northern Dominican Republic in the late Cretaceous to early Tertiary subduction complex in northern Dominican Republic. The garnet., 2009) and in the Rio San Juan Complex of northern Dominican Republic (Abbott et al., 2005, 2006, 2007


Climate Change in the Dominican Republic Esther Parish, Auroop R Ganguly* and Karsten Steinhaeuser  

E-Print Network [OSTI]

Climate Change in the Dominican Republic Esther Parish, Auroop R Ganguly* and Karsten Steinhaeuser1FI Projections for the Dominican Republic The analysis presented here uses twelve CCSM3 model grid cells overlaying the Dominican Republic and the immediately surrounding areas. The outputs from CCSM3

Minnesota, University of


How Does the Republic of Science Shape the Patent System? Broadening the  

E-Print Network [OSTI]

357 How Does the Republic of Science Shape the Patent System? Broadening the Institutional Analysis of Innovation Beyond Patents Fiona E. Murray,* Joshua S. Gans,** and Mackey L. Craven*** I. The Republic. Intertwined Relationship Between the Patent System & the Republic of Science

Loudon, Catherine


Effect of Flow Pulses on Degradation Downstream of Hapcheon Dam, South Korea  

E-Print Network [OSTI]

Effect of Flow Pulses on Degradation Downstream of Hapcheon Dam, South Korea Young Ho Shin1 and Pierre Y. Julien, M.ASCE2 Abstract: The changes in channel geometry downstream of Hapcheon Dam, South: Channels; Geometry; Dams; Korea, South; Sediment transport. Author keywords: Alluvial channels; Downstream

Julien, Pierre Y.



E-Print Network [OSTI]

reviewed overall market reform prospects in the Republic of Georgia. The findings indicate that Georgia's market reform lags behind several other New Independent State (NIS) countries. This is largely due' support for market reform initiatives. With the ethnic conflict under control, the USAID assessment team

Onsrud, Harlan J.



E-Print Network [OSTI]

MARINE TURTLES IN THE COMOROS FEDERAL ISLAMIC REPUBLIC : Their Status and Recommendations a Gainesville, Florida 32611 U.S.A. Phone: (904) 373-4480 FAX : (904) 392-3704 #12;Mortimer: Comoros Turtles Banning the Harvest of Turtles 18 #12;Mortimer: Comoros Turtles -- i i i TABLE OF CONTENTS (CONED) Page

Prestwich, Ken


The Rhenish stoneware from the Monte Cristi shipwreck, Dominican Republic  

E-Print Network [OSTI]

Discovered in 1966 off the north coast of the Dominican Republic, the Monte Cristi shipwreck represents the remains of an English-built ship carrying a Dutch cargo that sank in Spanish waters during the mid-17th century. Despite heavy salvage...

Lessmann, Anne Wood



Stability and Nukes: China's Domestic Concerns over North Korea's Nuclear Program  

E-Print Network [OSTI]

While the bilateral friendship between China and North Korea was solidified and endured during the Korean war, Beijing's ties to Pyongyang have weakened considerably during the nuclear crisis on the Korean Peninsula, which ...

Xu, Jun



Variations in patterns of low fertility in South Korea in 2004: a county level analysis  

E-Print Network [OSTI]

Since the early 1960s, South Korea has been going through a rapid fertility decline, along with its socioeconomic development and effective family planning programs. After achieving a desired replacement level of fertility in 1984, the total...

Yoon, Jungwon



Urban settlement design, Seoul, Korea : a comparative study for low-income housing  

E-Print Network [OSTI]

The study proposes an alternative design approach for urban dwelling environments of the low-income sectors in Seoul, Korea, based upon a comparative evaluation of the physical and socio-economic performance of the existing ...

Je, Hae-Seong



Pool Party TheELIWeekly  

E-Print Network [OSTI]

Dominican Republic Ecuador Israel Japan Korea Kuwait Libya Nigeria Pakistan Qatar Saudi Arabia Senegal

Pilyugin, Sergei S.


The security and foreign policy of the Islamic republic of Iran: An offensive realism perspective.  

E-Print Network [OSTI]

??This study argues that security and foreign policy of the Islamic Republic of Iran is mainly driven by the main principles of the Offensive Realism (more)

Prifti, Bledar



Microsoft Word - CX-Colville-Republic-Maintenance-FY13_WEB.docx  

Broader source: Energy.gov (indexed) [DOE]

3 REPLY TO ATTN OF: KEPR-4 SUBJECT: Environmental Clearance Memorandum Terry Kugler Lineman Foreman III - TFSF-Bell Proposed Action: Routine maintenance on the Colville-Republic...


1st NIFS-CRC Int. Symp. and 1st Korea-Japan WS, 5/20-22, 2007  

E-Print Network [OSTI]

1st NIFS-CRC Int. Symp. and 1st Korea-Japan WS, 5/20-22, 2007 1 Excitation of atomic hydrogen at metal surfaces promoted by proton motion Daiji Kato NIFS #12;1st NIFS-CRC Int. Symp. and 1st Korea of the excited state formation. · Conclusion #12;1st NIFS-CRC Int. Symp. and 1st Korea-Japan WS, 5/20-22, 2007 3

Princeton Plasma Physics Laboratory

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analysis of the factors and the roles of HRD in organizational learning styles as identified by key informants at selected corporations in the Republic of Korea  

E-Print Network [OSTI]

what organizational learning styles exist; 2) to identify the factors that differentiate the organizations with different organizational learning styles; 3) to identify the roles of HRD to facilitate organizational learning within the organizations...

Jeong, Jinchul



"Embrace China" show in Houston will celebrate 65th anniversary of the founding of the People's Republic of China  

E-Print Network [OSTI]

"Embrace China" show in Houston will celebrate 65th anniversary of the founding of the People's Republic of China "Embrace China," a multi-arts show of the People's Republic of China. The Sino Professionals Association will host


ITHET 05 July, 2005 Santo Domingo, Dominican Republic Multi-Campus Courses Via video conference: An Assesment  

E-Print Network [OSTI]

ITHET 05 July, 2005 Santo Domingo, Dominican Republic 1 Multi-Campus Courses Via video conference;ITHET 05 July, 2005 Santo Domingo, Dominican Republic 2 systems based on IP such as WebEx or Polycom

Cruz-Pol, Sandra L.


44403Federal Register / Vol. 79, No. 147 / Thursday, July 31, 2014 / Notices Republic of China and Taiwan: Initiation of  

E-Print Network [OSTI]

, 2014, Letter to the Secretary, ``Crystalline Silicon Photovoltaic Products from the People's Republic Determination.'' 3 See Certain Crystalline Silicon Photovoltaic Products From the People's Republic of China Alaska; Bering Sea and Aleutian Islands Crab Rationalization Cost Recovery Program AGENCY: National


Iranian Journal of Science & Technology, Transaction A, Vol. 32, No. A3 Printed in the Islamic Republic of Iran, 2008  

E-Print Network [OSTI]


Yu, K.N.



E-Print Network [OSTI]

THE DOMINICAN REPUBLIC FLOYD W. SHOCKLEY Department of Entomology 413 Biological Sciences Building University, Stenotarsus nigrivestis Shockley, is described from the Dominican Republic, representing the first description]. ``DOMINICAN REP.: Prov. Barahona, nr. Filipinas Larimar Mine: 20­26-VI-1992, R.E. Woodruff & P.E. Skelley

Mathis, Wayne N.


Conservation status of Black-capped Petrels (Pterodroma hasitata): colony surveys at Sierra de Baoruco, Dominican Republic, January 2002  

E-Print Network [OSTI]

Baoruco, Dominican Republic, January 2002 Black-capped Petrel photographed off the North Carolina coast in the Sierra de Baoruco in the Dominican Republic (Ottenwalder and Vargas 1979; Lee and Vina 1993, Lee 2000 populations must be initiated immediately. A visit by the principal investigators to the Dominican Republic

Buckel, Jeffrey A.


Effectiveness of a sports-based HIV prevention intervention in the Dominican Republic: a quasi-experimental study  

E-Print Network [OSTI]

Effectiveness of a sports-based HIV prevention intervention in the Dominican Republic: a quasi, and strenuous efforts to minimize loss-to-follow-up. Keywords: HIV; youth; sport; Dominican Republic; Caribbean living in Haiti and the Dominican Republic (DR) (PAHO, 2007; UNAIDS, 2008). In recent years, national

Vermont, University of


Protrusion of forearc mantle serpentinites along major strike-slip faults in an oceanic subduction complex in Dominican Republic  

E-Print Network [OSTI]

complex in Dominican Republic 1 1 2 1 Benoit-Michel SAUMUR , Kéiko H. HATTORI , Stéphane GUILLOT , Serge Plata area, northern Dominican Republic, GSA Spec. Paper 262(1991) 97-114. [6] G. Draper, F. Nagle; Geology, structure, and tectonic development of the Rio San Juan Complex, northern Dominican Republic, GSA


Adult entertainment in the Republic of Texas, 1836-1846  

E-Print Network [OSTI]

. ames H. Gramann (Chairman, Advisory Committee) Dr. Victor H. Treat (Committee Member) D yes (Committee Member) Dr. ie . Reid (Committee Member) Dr. Daniel R. Fesenmaier (Committee Member) Dr. Thomas M. Bonnicksen (Head of Department) July, 1986... on the format and content of this paper. Dr. Robert A. Calvert for suggestions on sources for this paper. D. Ryan Smith, Ellen N. Murry, Sherry B. Humphreys, Tami O' Bannion, Suzette Jensen, and the res t o f the st sf f of the Star of the Republic Museum...

Lund, Daniel Lamar



Dominican Republic - Annual Average Wind Speed at 80 meters  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation Proposed Newcatalyst phasesDataTranslocationDiurnal Cycle ofDoDocuments Dominican Republic -


Republic County, Kansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia Blue Ridge AndREII Jump to:RFSLOpenRenvilleRepublic County,


Republic of Macedonia: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia Blue Ridge AndREII Jump to:RFSLOpenRenvilleRepublic


EUDEEP (Smart Grid Project) (Czech Republic) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen EnergyOpen EnergyCzech Republic)


Shallow hydraulic fracturing measurements in Korea support tectonic and seismic indicators of regional stress.  

SciTech Connect (OSTI)

We have conducted five hydraulic fracturing stress measurement campaigns in Korea, involving 13 test holes ranging in depth from 30 to 250 m, at locations from North Seoul to the southern coast of the peninsula. The measurements reveal consistent crustal stress magnitudes and directions that suggest persistence throughout western and southern Korea. The maximum horizontal stress {sigma}{sub H} is oriented between ENE-WSW and E-W, in accord with plate movement and deformation, and with directions indicated by both focal mechanism solutions from earthquakes inland and offshore as well as borehole breakouts in mainland China close to its eastern coast. With respect to magnitudes, the vertical stress is the overall minimum stress at all tested locations, suggesting a thrust faulting regime within the relatively shallow depths reached by our tests. Typically, such a stress regime becomes one favoring strike-slip at greater depths, as is also indicated by the focal mechanism solutions around Korea.

Haimson, Bezalel Cecil (University of Wisconsin, Madison, WI); Lee, Moo Yul; Song, I. (Ruhr-University Bochum, Bochum, Germany)



An Analysis of Relationships between the Green Building Certification System for Multi-family Housing (GBCS-MF) Scores and Resident Perception Ratings in Korea  

E-Print Network [OSTI]

forward. I dedicate this dissertation to my loving parents. . vi NOMENCLATURE GBCS-MF Green Building Certification System for Multi-Family MLTM Ministry of Land, Transportation and Maritime Affairs, Korea MEV Ministry of Environment, Korea....7.8. Ecological Environment (EE) ........................................................................ 43 2.7.9. Indoor Environmental Quality (IEQ) ............................................................. 44 2.8. GBCS-MF Related Studies in Korea...

Lee, Joo Hyun



Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter


Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter


Evidence for Gassy Sediments on the Inner Shelf of SE Korea From Geoacoustic Properties  

E-Print Network [OSTI]

1 Evidence for Gassy Sediments on the Inner Shelf of SE Korea From Geoacoustic Properties (Tuesday is characterized by an up to 40 m thick blanket of soft sediments often characterized by acoustic turbidity structures below that gas layer. Sound speeds were measured directly in these sediments using the Acoustic


Biogeochemical changes at early stage after the closure of radioactive waste geological repository in South Korea  

E-Print Network [OSTI]

Biogeochemical changes at early stage after the closure of radioactive waste geological repository e Korea Radioactive Waste Agency (KORAD), 111, Daedeok-daero 989 beon-gil, Yuseong-gu, Daejeon 305 Organic waste a b s t r a c t Permanent disposal of low- and intermediate-level radioactive wastes

Ohta, Shigemi

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


August 24~28, 2014 International Convention Center (ICC) Jeju, Jeju Island, Korea  

E-Print Network [OSTI]

Arab Emirates). Korea is working not only for successful completion in UAE but also actively promote, and Slovenia (more than 30%); the United States, United Kingdom, and Russia (less than 20%). In China, 28 units power plants and building 5 new nuclear power plants domestically and 4 nuclear power plants in UAE(United


In IEEE International Conference on Robotics and Automation Pages 29412947, Seoul, Korea, May 2001  

E-Print Network [OSTI]

In IEEE International Conference on Robotics and Automation Pages 2941­2947, Seoul, Korea, May 2001 Evaluating Control Strategies for Wireless-Networked Robots Using an Integrated Robot and Network Simulation communication is an enabling factor in mul- tiple mobile robot systems. There is signi#12;cant interac- tion

Sukhatme, Gaurav S.


Culturally Variable Preferences for Robot Design and Use in South Korea, Turkey, and the United States  

E-Print Network [OSTI]

.2 [User- Centered Design]; I.2.9 [Robotics]: Commercial robots and applications; K.4: Computers, Turkey, United States, survey, robot design, robot application, user preferences. 1. INTRODUCTIONCulturally Variable Preferences for Robot Design and Use in South Korea, Turkey, and the United

Sabanovic, Selma


Transactions of the Korean Nuclear Society Autumn Meeting Pyeongchang, Korea, October 30-31, 2014  

E-Print Network [OSTI]

Transactions of the Korean Nuclear Society Autumn Meeting Pyeongchang, Korea, October 30-31, 2014 System) in Korean nuclear power plants. Recently, there have been attempted to implement the software and the higher performance of FPGAs. The FPGAs are typically modeled with HDLs (Hardware Description Languages


Transactions of the Korean Nuclear Society Spring Meeting Jeju, Korea, May 17-18, 2012  

E-Print Network [OSTI]

Transactions of the Korean Nuclear Society Spring Meeting Jeju, Korea, May 17-18, 2012 NuDE: Development Environment for Safety-Critical Software of Nuclear Power Plant Jong-Hoon Lee , Junbeom Yoo, software V&V should be performed in parallel with software development. In IEEE standard 1012 for Software


Transactions of the Korean Nuclear Society Autumn Meeting Pyeongchang, Korea, October 30-31, 2014  

E-Print Network [OSTI]

Transactions of the Korean Nuclear Society Autumn Meeting Pyeongchang, Korea, October 30-31, 2014 A Translator Verification Technique for FPGA Software Development in Nuclear Power Plants Jaeyeob Kim a , Eui- critical system such as RPS (Reactor Protection System) in NPP (Nuclear Power Plants). Increasing


Japan, France Vying for Korea's Nuclear Project By Cho Jin-seo  

E-Print Network [OSTI]

. Haignere promised privileges in fusion energy businesses and supports for Korea's own fusion energy energy source and considered the next-generation energy of the planet. indizio@koreatimes.co.kr 01,000 Jobs for Poor, Aged Roh's Supporters Launch Fresh 'Piggybank' Drive | | | | Copyright© Hankooki.com All


Maritime trade and port evolution in a socialist developing country: Nampo, gateway of North Korea  

E-Print Network [OSTI]

Maritime trade and port evolution in a socialist developing country: Nampo, gateway of North Korea. The study refers to port development issues in the socialist developing countries, in terms of constraints and advantages for ports, and proposes some analysis based on Nampo, the main international trading port city

Paris-Sud XI, Université de


The Regulatory Challenges of Decommissioning Nuclear Power Plants in Korea - 13101  

SciTech Connect (OSTI)

As of 2012, 23 units of nuclear power plants are in operation, but there is no experience of permanent shutdown and decommissioning of nuclear power plant in Korea. It is realized that, since late 1990's, improvement of the regulatory framework for decommissioning has been emphasized constantly from the point of view of International Atomic Energy Agency (IAEA)'s safety standards. And it is known that now IAEA prepare the safety requirement on decommissioning of facilities, its title is the Safe Decommissioning of Facilities, General Safety Requirement Part 6. According to the result of IAEA's Integrated Regulatory Review Service (IRRS) mission to Korea in 2011, it was recommended that the regulatory framework for decommissioning should require decommissioning plans for nuclear installations to be constructed and operated and these plans should be updated periodically. In addition, after the Fukushima nuclear disaster in Japan in March of 2011, preparedness for early decommissioning caused by an unexpected severe accident became also important issues and concerns. In this respect, it is acknowledged that the regulatory framework for decommissioning of nuclear facilities in Korea need to be improved. First of all, we identify the current status and relevant issues of regulatory framework for decommissioning of nuclear power plants compared to the IAEA's safety standards in order to achieve our goal. And then the plan is to be established for improvement of regulatory framework for decommissioning of nuclear power plants in Korea. After dealing with it, it is expected that the revised regulatory framework for decommissioning could enhance the safety regime on the decommissioning of nuclear power plants in Korea in light of international standards. (authors)

Lee, Jungjoon; Ahn, Sangmyeon; Choi, Kyungwoo [Korea Institute of Nuclear Safety, 62 Gwahak-ro, Yuseong-gu, Daejeon 305-338 (Korea, Republic of)] [Korea Institute of Nuclear Safety, 62 Gwahak-ro, Yuseong-gu, Daejeon 305-338 (Korea, Republic of); Kim, Juyoul; Kim, Juyub [FNC Technology, 46 Tabsil-ro, Giheung-gu, Yongin 446-902 (Korea, Republic of)] [FNC Technology, 46 Tabsil-ro, Giheung-gu, Yongin 446-902 (Korea, Republic of)



The earth matter effects in neutrino oscillation experiments from Tokai to Kamioka and Korea  

E-Print Network [OSTI]

We study the earth matter effects in the Tokai-to-Kamioka-and-Korea experiment (T2KK), which is a proposed extension of the T2K (Tokai-to-Kamioka) neutrino oscillation experiment between J-PARC at Tokai and Super-Kamiokande (SK) in Kamioka, where an additional detector is placed in Korea along the same neutrino beam line.By using recent geophysical measurements, we examine the earth matter effects on the oscillation probabilities at Kamioka and Korea. The average matter density along the Tokai-to-Kamioka baseline is found to be 2.6 g/cm^3, and that for the Tokai-to-Korea baseline is 2.85, 2.98, and 3.05 g/cm^3 for the baseline length of L = 1000, 1100, and 1200 km, respectively. The uncertainty of the average density is about 6%, which is determined by the uncertainty in the correlation between the accurately measured sound velocity and the matter density. The effect of the matter density distribution along the baseline is studied by using the step function approximation and the Fourier analysis. We find that the nu_mu -> nu_e oscillation probability is dictated mainly by the average matter density, with small but non-negligible contribution from the real part of the first Fourier mode. We also find that the sensitivity of the T2KK experiment on the neutrino mass hierarchy does not improve significantly by reducing the matter density error from 6% to 3%, since the measurement is limited by statistics for the minimum scenario of T2KK with SK at Kamioka anda 100 kt detector in Korea considered in this report. The sensitivity of the T2KK experiment on the neutrino mass hierarchy improves significantly by splitting the total beam time into neutrino and anti-neutrino runs, because the matter effect term contributes to the oscillation amplitudes with the opposite sign.

Kaoru Hagiwara; Naotoshi Okamura; Ken-ichi Senda



E-Print Network 3.0 - aachen federal republic Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

results for: aachen federal republic Page: << < 1 2 3 4 5 > >> 1 UMIC DAY11 Aachen, Germany Summary: of Excellence RWTH Aachen Excellence initiative of the German federal and...


The tourism industry and its link to poverty alleviation in the Dominican Republic  

E-Print Network [OSTI]

The Dominican Republic has an interesting juxtaposition of the largest tourism industry in the Caribbean with some of the worst social conditions in the region such as high rates of unemployment, poverty, and infant ...

Weiner, Angelica (Angelica G.)



A new species of the allodapine bee genus Braunsapis from the Central African Republic (Hymenoptera: Apidae)  

E-Print Network [OSTI]

A new species of the allodapine bee genus Braunsapis Michener (Allodapini: Allodapina) is described and figured from a series of females collected in the Central African Republic. Braunsapis maxschwarzi Engel, new species, ...

Engel, Michael S.



Two new halictine bees in Miocene amber from the Dominican Republic (Hymenoptera, Halictidae)  

E-Print Network [OSTI]

Two new halictine bees (Halictidae: Halictinae) are described and figured from females preserved in Early Miocene (Burdigalian) amber from the Dominican Republic. Oligochlora semirugosa sp. n. (Augochlorini) is similar to ...

Engel, Michael S.



EA-1255: Project Partnership Transportation of Foreign-Owned Enriched Uranium from the Republic of Georgia  

Broader source: Energy.gov [DOE]

This EA evaluates the environmental impacts for the proposal to transport 5.26 kilograms of enriched uranium-23 5 in the form of nuclear fuel, from the Republic of Georgia to the United Kingdom.


Oil to Coal Conversion of Power and Industrial Facilities in the Dominican Republic  

E-Print Network [OSTI]

Realizing that the use of coal has the potential to offset the effects of world oil prices on the Dominican Republic's economy, the Commission Nacional de Politica Energetica (CNPE) requested Bechtel Power Corporation to study the technical...

Causilla, H.; Acosta, J. R.



E-Print Network 3.0 - arab republic of egypt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of egypt Search Powered by Explorit Topic List Advanced Search Sample search results for: arab republic of egypt Page: << < 1 2 3 4 5 > >> 1 Human Resources, Safety and Risk...


Disparities in nuclear power plant performance in the United States and the Federal Republic of Germany  

E-Print Network [OSTI]

This report presents data comparing the performance of light water reactors in the United States and the Federal Republic of Germany (FRG). The comparisons are made for the years 1980-1983 and include 21 Westinghouse ...

Hansen, Kent F.



Historical Jesus and Mokmin hermeneutics with reference to the description of Jesus in Minjung theology in Korea  

E-Print Network [OSTI]

The quest for the contextual meaning of the life and teaching of the historical Jesus seems to be a perennial question. Given the religious, cultural and social situation in Korea as well as in Asia generally, any ...

Lee, Moonjang



The politics of consensus-building : case study of diesel vehicles and urban air pollution in South Korea  

E-Print Network [OSTI]

Look at the three efforts to resolve public disputes over diesel passenger cars and urban air quality management in South Korea. this dissertation explores the main obstacles in nascent democracies to meeting the necessary ...

Kim, Dong-Young, Ph. D. Massachusetts Institute of Technology


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A new direction and business plan for the golf business in Korea : strategies to attract customers to the domestic market  

E-Print Network [OSTI]

The golf industry in South Korea has been flourishing and has maintained high profitability. However, the South Korean market is not adequately prepared for the increasingly globalized world economy and resulting changes ...

Kim, Ikhwan



The trend of digital control system design for nuclear power plants in Korea  

SciTech Connect (OSTI)

Currently there are 20 nuclear power plants (NPPs) in operation, and 6 more units are under construction in Korea. The control systems of those NPPs have also been developed together with the technology advancement. Control systems started with On-Off control using the relay logic, had been evolved into Solid-State logic using TTL ICs, and applied with the micro-processors since the Yonggwang NPP Units 3 and 4 which started its construction in 1989. Multiplexers are also installed at the local plant areas to collect field input and to send output signals while communicating with the controllers located in the system cabinets near the main control room in order to reduce the field wiring cables. The design of the digital control system technology for the NPPs in Korea has been optimized to maximize the operability as well as the safety through the design, construction, start-up and operation experiences. Both Shin-Kori Units 1 and 2 and Shin-Wolsong Units 1 and 2 NPP projects under construction are being progressed at the same time. Digital Plant Control Systems of these projects have adopted multi-loop controllers, redundant loop configuration, and soft control system for the radwaste system. Programmable Logic Controller (PLC) and Distributed Control System (DCS) are applied with soft control system in Shin-Kori Units 3 and 4. This paper describes the evolvement of control system at the NPPs in Korea and the experience and design improvement through the observation of the latest failure of the digital control system. In addition, design concept and its trend of the digital control system being applied to the NPP in Korea are introduced. (authors)

Park, S. H.; Jung, H. Y.; Yang, C. Y.; Choe, I. N. [Korea Power Engineering Company, 360-9 Mabuk-Dong, Yongin-Si, Gyeonggi-Do, 446-713 (Korea, Republic of)



Miocene paleomagnetic data from southeastern Korea: implications on models for opening of the Japan Sea  

E-Print Network [OSTI]

1989) Jiwon Han, B. S. , Hanyang University Chair of Advisory Committee: Robert J. McCabe Early Miocene to middle Miocene age samples were collected from 30 paleo- magnetic sites from southeastern Korea. The characteristic directions of magne...- tization were determined by use of vector plots after AF and thermal demagne- tization. The mean paleomagnetic direction for 25 sites (14 normal polarity snd 11 reversed polarity) is D = 39. 4', I = 46. 2' (ass ? 9. 4', k=10. 3). Five sites which...

Han, Jiwon



Sovereign Wealth Funds: Stylized Facts about their Determinants and Governance*  

E-Print Network [OSTI]

Algeria Brunei Korea Kazakhstan Venezuela Malaysia Nigeriac Algeria Brunei Korea Kazakhstan Venezuela Malaysia NigeriaFund for the Republic of Kazakhstan National Development

Aizenman, Joshua; Glick, Reuven



Prospect for natural bitumen production development in Republic of Tatarstan  

SciTech Connect (OSTI)

The Republic of Tatarstan possesses large volumes of natural bitumen and extremely viscous heavy oil reserves. However to date processing oils of this kind is not economically viable but in the future heavy oils can become an alternative to conventional crude oil. The authors have developed a feasibility study of the prospects for the small bitumen-producing complexes construction for bitumen production and in-place bitumen processing in a simple scheme. The bitumen-producing complex will provide in situ recovery of bitumen with the surface cluster spacing of wells, transportation of bitumen produced to the central terminal, field primary bitumen processing by combining the functions of desalting, dewatering, and deasphalting of extracted bitumen. The field processing facilities, steam generators, compressors and so on will be housed in the central terminal. The central terminal will handle up to three fields which are 2-3 km distance from each other and from the central terminal. The objective of the field processing is to reduce sulphur and metal contents and remove water and salts from the bitumen. Thanks to bitumen-producing complex creating and providing high bitumen quality the economical efficiency of the natural bitumen production will be improved and enable environmental disturbance to be minimized.

Rakutin, Yu. [Scientific and Technological Centre for Production of Bitumen and High-Viscous Oils, Bugulma, Tartarstan (Russian Federation); Muslimov, R. [Joint-Stock Co., Tatarstan (Russian Federation); Volkov, Yu. [Oil and Gas Producing Department, Tatarstan (Russian Federation)



http://onlinex.mit.edu/bigdata Registrations by Country  

E-Print Network [OSTI]

Cyprus Kazakstan Portugal Ukraine Czech Republic Kenya Puerto Rico United Arab Emirates Denmark Kuwait Qatar United Kingdom Ecuador Latvia Republic of Korea United States Vietnam #12;http

Jackson, Daniel


Korea's Newly Enacted Unified Bankruptcy Act: The Role of the New Act in Facilitating (or Discouraging) the Transfer of Corporate Control  

E-Print Network [OSTI]

perspective of corporate governance, the decision whether toefforts to implement corporate governance reforms and otherthe weakness of the corporate governance mechanism in Korea,

Ko, Haksoo



Catalogue of alien plants of the Czech Republic (2nd edition): checklist update, taxonomic diversity and invasion patterns  

E-Print Network [OSTI]

Catalogue of alien plants of the Czech Republic (2nd edition): checklist update, taxonomic): Catalogue of alien plants of the Czech Republic (2nd edition): checklist update, taxonomic diversity and invasion patterns. ­ Preslia 84: 155­255. A complete list of all alien taxa ever recorded in the flora

Kratochvíl, Lukas


Arubolana Botosaneanu and Stock, 1979: a genus of stygobitic cirolanid isopods, with description of a new species from the Dominican Republic  

E-Print Network [OSTI]

of a new species from the Dominican Republic Lazare BOTOSANEANU(1) and Thomas M. ILIFFE(2) (1) Zoölogisch cave in the Dominican Republic. The species of Arubolana are well characterized by shared characters. Key words: stygobitic Cirolanidae; Arubolana; Dominican Republic; colonization of stygal habitats

Iliffe, Thomas M.


Reply to Comment on "Garnet-bearing ultramafic rocks from the Dominican Republic: Fossil mantle plume fragments in an ultra high pressure oceanic complex?"  

E-Print Network [OSTI]

Discussion Reply to Comment on "Garnet-bearing ultramafic rocks from the Dominican Republic: Fossil-pressure metamorphism REE partitioning Garnet-spinel thermometry Dominican Republic Two competing hypotheses have been proposed for garnet-bearing ultramafic rocks in the Dominican Republic: (1) The ultrahigh pressure (UHP

Abbott Jr., Richard N.


Session F2D 0-7803-9141-1/05/$20.00 2005 IEEE July 7 9, 2005, Juan Dolio, Dominican Republic  

E-Print Network [OSTI]

Session F2D 0-7803-9141-1/05/$20.00 © 2005 IEEE July 7 ­ 9, 2005, Juan Dolio, Dominican Republic including: Brazil, Chile, China, Czech Republic, France; or Germany. The course involves lectures in the Czech Republic, University of Santa Maria in Chile, and University of Nanjing in China. Two trips were

Larkin, Teresa L.


Background Report on Eastern Democratic Republic of the Congo  

SciTech Connect (OSTI)

Each month, approximately 45,000 people die from violence, hunger, disease, and other effects of displacement as a result of war in the Democratic Republic of the Congo (DRC). The country is often said to be plagued by a 'resource curse.' During each period in history since its discovery by the West, the DRC has possessed the resources the world craves and the world has sought these without regard for the consequences to the Congolese people. The catastrophic consequences of Congo's history of natural resource exploitation are the direct and indirect death of millions of Congolese people. The current war in Congo is multi-causal in nature but explanations are often reduced to describing it as an ethic conflict based on objective grievance. Objective grievance such as inequality, ethnic tensions, land disputes, and lack of democracy do exist, but they are neither necessary nor sufficient to explain the cause of the violent conflict, and more importantly, they fall short in explaining why this conflict has continued for years. The reality is the conflict is an economic war in which the trade of conflict minerals, gold and the 3Ts (tin, tantalum, tungsten), is directly linked to the financial sustainability of the groups fighting each other in eastern DRC. Objective grievance is a by-product of the conflict, used to create a false but plausible moral justification to continue violence. This paper examines the history of conflict in the DRC and the socio-economic variables contributing to the current war fought over conflict minerals.

Warren, Tracy A [ORNL



Defenseless against an enemy: the history of epidemics, disease and medicine in the Republic of Texas  

E-Print Network [OSTI]

settled in the reqion until late in the republic period; thus, there were few settlers to get sick or to report on 19 health conditions. In the early 1840's. as more and more people settled in the western region, the diseases which had previously... seemed typical only of the lowlands now appeared in the newly oc- cupied region. It was exciting times for those who lived in Texas during the republic period . The young nation was deve loping and solving many of its problems. Unfortunately, health...

Depew, Diane Kay



Liquefied U.S. Natural Gas Exports to South Korea (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 14343 342 328 370Japan (MillionSouth Korea


Sabine Pass, LA Exports to Korea Liquefied Natural Gas (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet) Brazil Liquefied NaturalKorea


Freeport, TX Liquefied Natural Gas Exports to South Korea (Million Cubic  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 1 0 0 0ThousandFeet) South Korea (Million



E-Print Network [OSTI]

China, the Republic of Korea and the ASEAN countries. Sales to these markets almost tripled. In 2010

De Luca, Alessandro


International Conference February 10 -13, 2010 CYBERNETICS AND INFORMATICS VYSN BOCA, Slovak Republic  

E-Print Network [OSTI]

International Conference February 10 - 13, 2010 CYBERNETICS AND INFORMATICS VYSNÁ BOCA, Slovak to be part of this development during my PhD study days at Caltech from 1983 to 1987 and this led VYSNÁ BOCA, Slovak Republic 2 and using model-based control". This statement is right in saying that one

Skogestad, Sigurd


Capacity Building in Sharing Forest and Market Information Prague & Krtiny, Czech Republic, 25 October 2005  

E-Print Network [OSTI]

Capacity Building in Sharing Forest and Market Information Prague & Krtiny, Czech Republic, 25 Specialist UNECE/FAO Timber Branch Geneva, Switzerland #12;Capacity Building in Sharing Forest and Market forest products market information #12;Capacity Building in Sharing Forest and Market Information Prague


Foreign Fishery Developments Figure I.-The People's Republic of China.  

E-Print Network [OSTI]

Foreign Fishery Developments Figure I.-The People's Republic of China. Figure 2.-China's total 1983 harvest. China's fisheries catch increased sig- nificantly after its fishery development policy and freshwater aquaculture. China hopes to realize the full potential of its fisheries by continuing to implement

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network [OSTI]

FISHES OF THE REPUBLIC OF EL SALVADOR,. CENTRAL AMERICA By SAMUEL F. HILDEBRAND Ichthyologist, U. S-Descriptive catalogue of the fishes occurring in the fresh waters of El Salvador _ Characinidre, _ Astyanax fasciatus INTRODUCTION This report is based upon collections made in EI Salvador during the last half of January


Water Use and Sustainability in La Altagracia, Dominican Republic Caitlin Grady  

E-Print Network [OSTI]

Water Use and Sustainability in La Altagracia, Dominican Republic By Caitlin Grady Tamim Younos Research Experiences for Undergraduates (NSF REU) program Grant No.0649070, the Virginia Water Resources as necessarily representing the official policies, either expressed or implied, of the Virginia Water Resources

Beex, A. A. "Louis"


Original article 137Cs in flowers, pollen and honey from the Republic  

E-Print Network [OSTI]

on the earth's surface as fallout. The radioactive contamination "picture" of territory in the Republic of Croatia well known (Bariic et al, 1987a). The evalua- tion of radioactive contamination based radioactive contamination, radioactivi- ty in honey is of particular interest when tracing radioactive

Boyer, Edmond


Scientific and technical assistance to the Republic of Belarus in the wake of the Chernobyl accident  

SciTech Connect (OSTI)

Observations are presented in this paper from a visit to the Republic of Belarus after the Chernobyl accident. The trip was part of the Volunteers in Overseas Cooperative Assistance (VOCA) program. The primary focus of the paper is on environmental issues and the impact on agriculture. This overview discusses pertinent technical, social, and economic issues, and provides recommendations for continued international assistance. 4 refs.

Stanley, N.W.



1 2010 International Conference of the System Dynamics Society Seoul, Korea Greening the Economy with New Markets  

E-Print Network [OSTI]

with the climate system. Countries around the world are experimenting with a combination of green stimulus spending conservation, river management and protection of natural resources. "Green New Deal" spending in South Korea for governments around the world, and most countries will use a combination of green stimulus spending

Ford, Andrew


Transactions of the Korean Nuclear Society Autumn Meeting PyeongChang, Korea, October 25-26, 2007  

E-Print Network [OSTI]

of the deterministic guidance contained in this Regulatory Guide, in conjunction with NEI (Nuclear Energy InstituteTransactions of the Korean Nuclear Society Autumn Meeting PyeongChang, Korea, October 25-26, 2007 " MCR " . Guideline of Cyber Security Policy for Digital I&C Systems in Nuclear Power Plant Zeen

Kim, Kwangjo


Development of an Integrated Natural Barrier Database System for Site Evaluation of a Deep Geologic Repository in Korea - 13527  

SciTech Connect (OSTI)

Korea Radioactive-waste Management Corporation (KRMC) established in 2009 has started a new project to collect information on long-term stability of deep geological environments on the Korean Peninsula. The information has been built up in the integrated natural barrier database system available on web (www.deepgeodisposal.kr). The database system also includes socially and economically important information, such as land use, mining area, natural conservation area, population density, and industrial complex, because some of this information is used as exclusionary criteria during the site selection process for a deep geological repository for safe and secure containment and isolation of spent nuclear fuel and other long-lived radioactive waste in Korea. Although the official site selection process has not been started yet in Korea, current integrated natural barrier database system and socio-economic database is believed that the database system will be effectively utilized to narrow down the number of sites where future investigation is most promising in the site selection process for a deep geological repository and to enhance public acceptance by providing readily-available relevant scientific information on deep geological environments in Korea. (authors)

Jung, Haeryong; Lee, Eunyong; Jeong, YiYeong; Lee, Jeong-Hwan [Korea Radioactive-waste Management Corportation - KRMC, 1045 Daedeokdaero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)] [Korea Radioactive-waste Management Corportation - KRMC, 1045 Daedeokdaero, Yuseong-gu, Daejeon 305-353 (Korea, Republic of)



Carbon finance, tropical forests and the state : governing international climate risk in the Democratic Republic of Congo  

E-Print Network [OSTI]

This thesis examines how evolving norms of international climate change mitigation are translated into national forest governance policies and land management techniques in the Democratic Republic of Congo (DRC). The ...

Gray, Ian P



Radon Concentration in Groundwater in the Central Region of Gyeongju, Korea - 13130  

SciTech Connect (OSTI)

Radon is a naturally occurring radioactive gas that is a well known cause of lung cancer through inhalation. Nevertheless, stomach cancer can also occur if radon-containing water is ingested. This study measured the radon concentration in groundwater for drinking or other domestic uses in the central region of Gyeongju, Korea. The groundwater samples were taken from 11 points chosen from the 11 administrative districts in the central region of Gyeongju by selecting a point per district considering the demographic distribution including the number of tourists who visit the ancient ruins and archaeological sites. The mean radon concentrations in the groundwater samples ranged from 14.38 to 9050.73 Bq.m{sup -3}, which were below the recommendations by the U.S. EPA and WHO. (authors)

Lee, Jung Min; Lee, A. Rim; Park, Chan Hee; Moon, Joo Hyun [Dongguk University, Seokjangdong, Gyeongju, Gyeongbuk, 780-714 (Korea, Republic of)] [Dongguk University, Seokjangdong, Gyeongju, Gyeongbuk, 780-714 (Korea, Republic of)



Overview of large scale experiments performed within the LBB project in the Czech Republic  

SciTech Connect (OSTI)

During several recent years NRI Rez has been performing the LBB analyses of safety significant primary circuit pipings of NPPs in Czech and Slovak Republics. The analyses covered the NPPs with reactors WWER 440 Type 230 and 213 and WWER 1000 Type 320. Within the relevant LBB projects undertaken with the aim to prove the fulfilling of the requirements of LBB, a series of large scale experiments were performed. The goal of these experiments was to verify the properties of the components selected, and to prove the quality and/or conservatism of assessments used in the LBB-analyses. In this poster, a brief overview of experiments performed in Czech Republic under guidance of NRI Rez is presented.

Kadecka, P.; Lauerova, D. [Nuclear Research Institute, Rez (Czechoslovakia)



Keynote paper at the International Workshop on TMDL Monitoring and Abatement Program presented at Konkuk University, Seoul (Korea0 on May 16, 2008  

E-Print Network [OSTI]

1 Keynote paper at the International Workshop on TMDL Monitoring and Abatement Program presented at Konkuk University, Seoul (Korea0 on May 16, 2008 DIFFUSE POLLUTION MONITORING AND ABATEMENT IN THE FUTURE

Sridhar, Srinivas


The City as a national growth machine : city-building and the role of urban development in South Korea's political and economic transitions  

E-Print Network [OSTI]

This dissertation bridges the fields of international development and urban studies to examine South Korea's city building and urban development processes, arguing that the interaction between urban and industrial policies ...

Joo, Yu Min



Investigation of relativistic runaway electrons in electron cyclotron resonance heating discharges on Korea Superconducting Tokamak Advanced Research  

SciTech Connect (OSTI)

The behavior of relativistic runaway electrons during Electron Cyclotron Resonance Heating (ECRH) discharges is investigated in the Korea Superconducting Tokamak Advanced Research device. The effect of the ECRH on the runaway electron population is discussed. Observations on the generation of superthermal electrons during ECRH will be reported, which will be shown to be consistent with existing theory for the development of a superthermal electron avalanche during ECRH [A. Lazaros, Phys. Plasmas 8, 1263 (2001)].

Kang, C. S. [Department of Plasma Physics and Nuclear Fusion, Korea University of Science and Technology, Daejeon 305-350 (Korea, Republic of); Lee, S. G., E-mail: sglee@nfri.re.kr [Department of Plasma Physics and Nuclear Fusion, Korea University of Science and Technology, Daejeon 305-350 (Korea, Republic of); National Fusion Research Institute, Daejeon 305-806 (Korea, Republic of)



Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +


77Chapter 7 -General Equilibrium Analysis of Effects of Regional Cooperation in Trade Policy, Transport, and Customs Transit on the Kyrgyz Republic General Equilibrium Analysis  

E-Print Network [OSTI]

, Transport, and Customs Transit on the Kyrgyz Republic 7 General Equilibrium Analysis of the Effects of Regional Cooperation in Trade Policy, Transport, and Customs Transit on the Kyrgyz Republic The preceding policy, transport, and customs transit. In particular, Chapter 4 argued that by acceding to the WTO

Kammen, Daniel M.


ArchiveofSID Journal of Sciences, Islamic Republic of Iran 18(2): 139-149 (2007) http://jsciences.ut.ac.ir  

E-Print Network [OSTI]

ArchiveofSID Journal of Sciences, Islamic Republic of Iran 18(2): 139-149 (2007) http the Cretaceous-Tertiary Boundary in Southwestern Iran B. Darvishzad,1,* E. Ghasemi-Nejad,2 S. Ghourchaei,2 and G of Iran 2 Department of Geology, Faculty of Science, University of Tehran, Tehran, Islamic Republic

Keller, Gerta


Development of frequency modulation reflectometer for Korea Superconducting Tokamak Advanced Research tokamak  

SciTech Connect (OSTI)

Frequency modulation reflectometer has been developed to measure the plasma density profile of the Korea Superconducting Tokamak Advanced Research tokamak. Three reflectometers are operating in extraordinary polarization mode in the frequency range of Q band (33.654 GHz), V band (4872 GHz), and W band (72108 GHz) to measure the density up to 7 10{sup 19} m{sup ?3} when the toroidal magnetic field is 2 T on axis. The antenna is installed inside of the vacuum vessel. A new vacuum window is developed by using 50 ?m thick mica film and 0.1 mm thick gold gasket. The filter bank of low pass filter, notch filter, and Faraday isolator is used to reject the electron cyclotron heating high power at attenuation of 60 dB. The full frequency band is swept in 20 ?s. The mixer output is directly digitized with sampling rate of 100 MSamples/s. The phase is obtained by using wavelet transform. The whole hardware and software system is described in detail and the measured density profile is presented as a result.

Seo, Seong-Heon; Wi, H. M.; Lee, W. R.; Kim, H. S.; Lee, T. G.; Kim, Y. S. [National Fusion Research Institute, Daejeon 305-333 (Korea, Republic of)] [National Fusion Research Institute, Daejeon 305-333 (Korea, Republic of); Park, Jinhyung [University of Science and Technology, Daejeon 305-333 (Korea, Republic of)] [University of Science and Technology, Daejeon 305-333 (Korea, Republic of); Kang, Jin-Seob [Korea Research Institute of Standards and Science, Daejeon 305-340 (Korea, Republic of)] [Korea Research Institute of Standards and Science, Daejeon 305-340 (Korea, Republic of); Bog, M. G. [Yoonseul, Daejeon 306-120 (Korea, Republic of)] [Yoonseul, Daejeon 306-120 (Korea, Republic of); Yokota, Y.; Mase, A. [Kyushu University, Kasuga 816-8580 (Japan)] [Kyushu University, Kasuga 816-8580 (Japan)



Analysis of line integrated electron density using plasma position data on Korea Superconducting Tokamak Advanced Research  

SciTech Connect (OSTI)

A 280 GHz single-channel horizontal millimeter-wave interferometer system has been installed for plasma electron density measurements on the Korea Superconducting Tokamak Advanced Research (KSTAR) device. This system has a triangular beam path that does not pass through the plasma axis due to geometrical constraints in the superconducting tokamak. The term line density on KSTAR has a different meaning from the line density of other tokamaks. To estimate the peak density and the mean density from the measured line density, information on the position of the plasma is needed. The information has been calculated from tangentially viewed visible images using the toroidal symmetry of the plasma. Interface definition language routines have been developed for this purpose. The calculated plasma position data correspond well to calculation results from magnetic analysis. With the position data and an estimated plasma profile, the peak density and the mean density have been obtained from the line density. From these results, changes of plasma density themselves can be separated from effects of the plasma movements, so they can give valuable information on the plasma status.

Nam, Y. U.; Chung, J. [National Fusion Research Institute, Gwahangno 113, Daejeon 305-333 (Korea, Republic of)



Biogeochemical Changes at Early Stage After the Closure of Radioactive Waste Geological Repository in South Korea  

SciTech Connect (OSTI)

Permanent disposal of low- and intermediate-level radioactive wastes in the subterranean environment has been the preferred method of many countries, including Korea. A safety issue after the closure of a geological repository is that biodegradation of organic materials due to microbial activities generates gases that lead to overpressure of the waste containers in the repository and its disintegration with the release of radionuclides. As part of an ongoing large-scale in situ experiment using organic wastes and groundwater to simulate geological radioactive waste repository conditions, we investigated the geochemical alteration and microbial activities at an early stage (~63 days) intended to be representative of the initial period after repository closure. The increased numbers of both aerobes and facultative anaerobes in waste effluents indicate that oxygen content could be the most significant parameter to control biogeochemical conditions at very early periods of reaction (<35 days). Accordingly, the values of dissolved oxygen and redox potential were decreased. The activation of anaerobes after 35 days was supported by the increased concentration to ~50 mg L-1 of ethanol. These results suggest that the biogeochemical conditions were rapidly altered to more reducing and anaerobic conditions within the initial 2 months after repository closure. Although no gases were detected during the study, activated anaerobic microbes will play more important role in gas generation over the long term.

Choung, Sungwook [Pohang Univ. of Science and Technology (Korea, Republic of); Um, Wooyong [Pohang Univ. of Science and Technology (Korea, Republic of); Pacific Northwest National Laboratory (PNNL), Richland, WA (United States); Choi, Seho [Pohang Univ. of Science and Technology (Korea, Republic of); Francis, Arokiasamy J. [Pohang Univ. of Science and Technology (Korea, Republic of); Brookhaven National Laboratory (BNL), Upton, NY (United States); Kim, Sungpyo [Korea Univ., Sejong (Korea, Republic of); Park, Jin beak [Korea Radioactive Waste Agency (KORAD), Daejeon (Korea, Republic of); Kim, Suk-Hoon [FNC Technology Co., Seoul National University (Korea, Republic of)



Influence of kernel size on the presence of Aspergillus flavus, aflatoxin content and moisture content in Dominican Republic grown peanuts  

E-Print Network [OSTI]

, Aflatoxin Content and Moisture Content in Dominican Republic Grown Peanuts (Auqust, 1969) Teodoro Herrera-Perez, B. S. Ingeniero Agronomo, Escuela Superior de Agricultura "Antonio Narro". Directed by: Dr. David W. Rosberg. Incidence oi As..., Dominican Republic for provid- ing the friendly environment which made this work and my stay in this c ountry !!rore enjoyable. I a!r d e;:!Iy ir d; bt-. d Lo Dr. Rafael Nirabal Roclriguc z and Nr. Tais Crouch for their friendsnip and help which fa- ci1...

Herrera-Perez, Teodoro


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Brine migration test report: Asse Salt Mine, Federal Republic of Germany: Technical report  

SciTech Connect (OSTI)

This report presents a summary of Brine Migration Tests which were undertaken at the Asse mine of the Federal Republic of Germany (FRG) under a bilateral US/FRG agreement. This experiment simulates a nuclear waste repository at the 800-m (2624-ft) level of the Asse salt mine in the Federal Republic of Germany. This report describes the Asse salt mine, the test equipment, and the pretest properties of the salt in the mine and in the vicinity of the test area. Also included are selected test data (for the first 28 months of operation) on the following: brine migration rates, thermomechaical behavior of the salt (including room closure, stress reading, and thermal profiles), borehole gas pressures, and borehole gas analyses. In addition to field data, laboratory analyses of pretest salt properties are included in this report. The operational phase of these experiments was completed on October 4, 1985, with the commencement of cooldown and the start of posttest activities. 7 refs., 68 figs., 48 tabs.

Coyle, A.J.; Eckert, J.; Kalia, H.



A nuclear physics program at the Rare Isotope Beams Accelerator Facility in Korea  

SciTech Connect (OSTI)

This paper outlines the new physics possibilities that fall within the field of nuclear structure and astrophysics based on experiments with radioactive ion beams at the future Rare Isotope Beams Accelerator facility in Korea. This ambitious multi-beam facility has both an Isotope Separation On Line (ISOL) and fragmentation capability to produce rare isotopes beams (RIBs) and will be capable of producing and accelerating beams of wide range mass of nuclides with energies of a few to hundreds MeV per nucleon. The large dynamic range of reaccelerated RIBs will allow the optimization in each nuclear reaction case with respect to cross section and channel opening. The low energy RIBs around Coulomb barrier offer nuclear reactions such as elastic resonance scatterings, one or two particle transfers, Coulomb multiple-excitations, fusion-evaporations, and direct capture reactions for the study of the very neutron-rich and proton-rich nuclides. In contrast, the high energy RIBs produced by in-flight fragmentation with reaccelerated ions from the ISOL enable to explore the study of neutron drip lines in intermediate mass regions. The proposed studies aim at investigating the exotic nuclei near and beyond the nucleon drip lines, and to explore how nuclear many-body systems change in such extreme regions by addressing the following topics: the evolution of shell structure in areas of extreme proton to neutron imbalance; the study of the weak interaction in exotic decay schemes such as beta-delayed two-neutron or two-proton emission; the change of isospin symmetry in isobaric mirror nuclei at the drip lines; two protons or two neutrons radioactivity beyond the drip lines; the role of the continuum states including resonant states above the particle-decay threshold in exotic nuclei; and the effects of nuclear reaction rates triggered by the unbound proton-rich nuclei on nuclear astrophysical processes.

Moon, Chang-Bum, E-mail: cbmoon@hoseo.edu [Hoseo University, Asan, Chung-Nam 336-795 (Korea, Republic of)] [Hoseo University, Asan, Chung-Nam 336-795 (Korea, Republic of)



http://www.isc.tohoku.ac.jp/map.html 1 Dr. Jan Hrdlicka (Czech Technical University in Prague, Czech Republic)  

E-Print Network [OSTI]

(Czech Technical University in Prague, Czech Republic) · Renewable energy in Europe: Wind and solar a trend during last years and current problems with wind power installation in Northern Germany (impact current situation with the energy share for electricity generation in Europe and the present state

Murota, Kazuo


ICPIG, July 15-20, 2007, Prague, Czech Republi Negative streamer fronts: comparison of particle and fluid models and  

E-Print Network [OSTI]

that propagates into non-ionized matter. Streamers are used in industrial applications such as ozone generation28th ICPIG, July 15-20, 2007, Prague, Czech Republi Negative streamer fronts: comparison be generated during early stages of the lighting event. Both questions require a fully kinetic description

Ebert, Ute


Solar energy potential atlas for planning energy system off-grid electrification in the Republic of Djibouti  

E-Print Network [OSTI]

1 Solar energy potential atlas for planning energy system off-grid electrification in the Republic solar resource can therefore be an interesting mean to produce energy where it is consumed. The aimWh/m². Furthermore, the solar radiation reaching Djibouti corresponded to 20 000 times the total yearly energy

Boyer, Edmond


Impact of Pelvic Radiotherapy on Gut Microbiota of Gynecological Cancer Patients Revealed by Massive  

E-Print Network [OSTI]

, Republic of Korea, 2 Fermentation and Functionality Research Group, Korea Food Research Institute, Sungnam University, Seoul, Republic of Korea Abstract Although pelvic irradiation is effective for the treatment. Introduction More than 50% of cancer patients receive irradiation for cancer treatment [1]. Pelvic irradiation

Bae, Jin-Woo


Environmental problems in the People`s Republic of China: Current magnitude and possible control options  

SciTech Connect (OSTI)

The People`s Republic of China has been undergoing rapid economic development over the past several decades. This development has taken place with little or no attention being paid to its environmental consequences. This situation has resulted in severe contamination of the air, water, and soil resources of China, with attendant damage to human and natural populations. This report determines the major causes of air, water, and soil pollution in China and assesses their extent and magnitude. It then examines the impacts of the pollutants on various components of the human and natural environment. It identifies possible regulatory and ameliorative options available to China to deal with these pollution problems and provides information on specific strategies and the costs associated with their implementation. The objective is to shed light on China`s pollution control and remediation requirements in the near future.

Bhadtti, N.; Biang, C.A.; Poch, L.A.; Tompkins, M.M.



Innovation in the management of upstream state oil contracts in the Republic of Congo : from transaction to Cooperation for Economic Development  

E-Print Network [OSTI]

This thesis examines the often competitive interests involved in oil contracts and the ensuing strategic dilemmas faced by both the Republic of Congo and international oil companies that operate in that country. Throughout ...

Moussa, Yaya



The World Bank's Participatory Development Approach in the Country Assistance Strategy (CAS) Paper for the Republic of Senegal: Rhetoric or Reality?  

E-Print Network [OSTI]

The aim of this thesis is to study the World Bank's participatory development process in the 2007 Country Assistance Strategy (CAS) for the Republic of Senegal. I seek to shed light on the question of whether or not the ...

Ndiaye, Rokhaya



Aging of Development: the Saemangeum Tideland Reclamation Project (STRP) in South Korea and Sustainable Development of the Two Townships in and out of the STRP  

E-Print Network [OSTI]

Is the biggest tideland reclamation project in the world (the STRP) sustainable? Since 1991, the STRP which aims at converting mudflats into 401 km2 farmland and industrial complex has been carried out in the southwestern coast of South Korea. I...

Choi, In Huck



Pacific Basin Nuclear Conference (PBNC 2012), BEXCO, Busan, Korea, March 18 ~ 23, 2012 CHALLENGES OF CYBER SECURITY FOR NUCLEAR POWER PLANTS  

E-Print Network [OSTI]

PBNC 2012 CHALLENGES OF CYBER SECURITY FOR NUCLEAR POWER PLANTS Kwangjo Kim KAIST, Daejeon, Korea.kim@kustar.ac.ae Abstract Nuclear Power Plants (NPPs) become one of the most important infrastructures in providing improvement. 1. Introduction Nuclear Power Plants (NPPs) become one of the most important infrastructures

Kim, Kwangjo


A review of "Transforming the Republic of Letters: Pierre-Daniel Huet and European Intellectual Life" By April G. Shelford  

E-Print Network [OSTI]

(2002), Shelford argues that those who opposed the more radical elements of the Enlightenment had a serious and viable intellectual and moral alternative that was not merely reactionary. Sometimes they were even right. Shelford also goes beyond... and to the transformation of the Republic of Letters into something perhaps more open, but also intellectually shallower, less scholarly and, despite the claims of some historians, less egalitarian. The rise of salon culture dominated by socially elite women gave rise...

Adkins, Matthew G.



A Study on Optimized Management Options for the Wolsong Low- and Intermediate - Level Waste Disposal Center in Korea - 13479  

SciTech Connect (OSTI)

The safe and effective management of radioactive waste is a national task required for sustainable generation of nuclear power and for energy self-reliance in Korea. Currently, for permanent disposal of low- and intermediate-level waste (LILW), the Wolsong LILW Disposal Center (WLDC) is under construction. It will accommodate a total of 800,000 drums at the final stage after stepwise expansion. As an implementing strategy for cost-effective development of the WLDC, various disposal options suitable for waste classification schemes would be considered. It is also needed an optimized management of the WLDC by taking a countermeasure of volume reduction treatment. In this study, various management options to be applied to each waste class are analyzed in terms of its inventory and disposal cost. For the volume reduction and stabilization of waste, the vitrification and plasma melting methods are considered for combustible and incombustible waste, respectively. (authors)

Park, JooWan; Kim, DongSun; Choi, DongEun [Korea Radioactive Waste Management Corporation, Korea 89, Bukseongno, Gyeongju, 780-050 (Korea, Republic of)] [Korea Radioactive Waste Management Corporation, Korea 89, Bukseongno, Gyeongju, 780-050 (Korea, Republic of)



Heterozygous mutations in cyclic AMP phosphodiesterase-4D (PDE4D) and protein kinase A (PKA) provide new insights into the molecular  

E-Print Network [OSTI]

Department of Pediatric Imaging, Tokyo Metropolitan Children's Medical Center, Tokyo, Japan i Seitoku University, Chiba, Japan j Department of Radiology, Gachon University Gil Medical Center, Incheon, Republic, Seoul, Republic of Korea m Department of Pediatrics Samsung Medical Center, Sungkyunkwan University

Lee, Jooyoung


University Health Center Name The University of Georgia UGA ID # 81  

E-Print Network [OSTI]

incidence rates of > 20 cases per 100,000 population. University Health Center review Date Page 2 Republic Republic of Korea Nigeria Suriname Armenia Ecuador Kuwait Niue Swaziland Azerbaijan Egypt

Kissinger, Jessica


Developments in lithium-ion battery technology in the Peoples Republic of China.  

SciTech Connect (OSTI)

Argonne National Laboratory prepared this report, under the sponsorship of the Office of Vehicle Technologies (OVT) of the U.S. Department of Energy's (DOE's) Office of Energy Efficiency and Renewable Energy, for the Vehicles Technologies Team. The information in the report is based on the author's visit to Beijing; Tianjin; and Shanghai, China, to meet with representatives from several organizations (listed in Appendix A) developing and manufacturing lithium-ion battery technology for cell phones and electronics, electric bikes, and electric and hybrid vehicle applications. The purpose of the visit was to assess the status of lithium-ion battery technology in China and to determine if lithium-ion batteries produced in China are available for benchmarking in the United States. With benchmarking, DOE and the U.S. battery development industry would be able to understand the status of the battery technology, which would enable the industry to formulate a long-term research and development program. This report also describes the state of lithium-ion battery technology in the United States, provides information on joint ventures, and includes information on government incentives and policies in the Peoples Republic of China (PRC).

Patil, P. G.; Energy Systems



Coal use in the People`s Republic of China. Volume 1: Environmental impacts  

SciTech Connect (OSTI)

The People`s Republic of China (hereafter referred to as China) is the largest producer and consumer of coal in the world. Coal makes up 76% and 74% of China`s primary energy consumption and production, respectively. This heavy dependence on coal has come at a high price for China, accounting for a large share of its environmental problems. This report examines the dominance of coal in China`s energy balance, its impact on the environment, and the need for technical and financial assistance, specifically for two distinct aspects: the effect of coal use on the environment and the importance of coal to China`s economy. The results of the analysis are presented in two volumes. Volume 1 focuses on full fuel cycle coal emissions and the environmental effects of coal consumption. Volume 2 provides a detailed analysis by sector of China`s economy and examines the economic impact of constraints on coal use. 51 refs., 19 figs., 15 tabs.

Bhatti, N.; Tompkins, M.M. [Argonne National Lab., IL (United States). Decision and Information Sciences Div.; Carlson, J.L. [Argonne National Lab., IL (United States). Decision and Information Sciences Div.]|[Illinois State Univ., Normal, IL (United States); Simbeck, D.R. [Argonne National Lab., IL (United States). Decision and Information Sciences Div.]|[SFA Pacific, Inc., Mountain View, CA (United States)



Global Nuclear Energy Partnership Inaugural Steering Group Meeting...  

Broader source: Energy.gov (indexed) [DOE]

Italy, Japan, Jordan, Kazakhstan, Lithuania, Poland, Republic of Korea, Romania, Russia, Slovenia and Ukraine and three international organizations as observers in...


Regulation of inflammatory arthritis by the upstream kinase mitogen activated protein kinase kinase 7 in the c-Jun N-Terminal kinase pathway  

E-Print Network [OSTI]

Jinju, Republic of Korea. 3 Isis Pharmaceuticals, Inc. ,Berdeja is an employee of Isis Pharmaceuticals, Inc. Thereas described (kind gift of Isis Pharmaceuticals, Inc. (

Lee, Sang-il; Boyle, David L; Berdeja, Andres; Firestein, Gary S



The power of the family  

E-Print Network [OSTI]

Denmark, Estonia, Spain, Finland, France, Great Britain,ties Croatia Algeria Finland Sweden Latvia Czech RepublicRep. South Africa (Union of) Finland Korea Mexico Bangladesh

Alesina, Alberto; Giuliano, Paola


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


International reserves management and the current account  

E-Print Network [OSTI]

Guyana Indonesia Jordan Kazakhstan Kyrgyz Republic Laoof Iraq Jamaica Jordan Kazakhstan Macedonia, FYR MaldivesJamaica Japan Jordan Kazakhstan Kenya Korea Kuwait Kyrgyz

Aizenman, Joshua




Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Macao, Moldova, Mongolia, Myanmar (Burma), North Korea, Peoples' Republic of China, Romania, Russia, Sudan, Syria, Tajikistan, Turkmenistan, Ukraine, Uzbekistan and Vietnam)....


Mike Lavelle and I decided to spend our six-week summer of service in the capital of the Dominican Republic, Santo Domingo. Although this inner city was not  

E-Print Network [OSTI]

, and what I soon learned after experiencing the Dominican Republic, is that I learned much more about who IMike Lavelle and I decided to spend our six-week summer of service in the capital of the Dominican Republic, Santo Domingo. Although this inner city was not the first place I thought of as I was considering


Management of Disused Radioactive Sealed Sources in the Slovak Republic - 12100  

SciTech Connect (OSTI)

After splitting-up the Czechoslovak Federation in 1993, the system of management of institutional radioactive waste, where disused sources represent its significant part, had had to build from beginning, since all corresponding activities had remained in the Czech part of the Federation. The paper presents the development of legislative and institutional framework of the disused radioactive sealed source management, development of the national inventory and development of management practices. According the Governmental decision (1994), the management of disused sealed sources and institutional radioactive waste at whole was based on maximal utilization of facilities inside nuclear facilities, particularly in the NPP A1 (shut down in the past, currently under decommissioning). This approach has been recently changing by Governmental decision (2009) to construct 'non-nuclear facility' - central storage for remained disused sealed sources collected from the places of use, where they were stored in some cases for tens of years. The approaches to siting and construction of this storage facility will be presented, as well as the current approaches to solution of the disused radioactive sources final disposal. Environmental impact assessment process in regard to the given facility/activity is slowly drawing to a close. The final statement of the Ministry of Environment can be expected in January or February 2012, probably recommending option 1 as preferred [6]. According to the Slovak legislation, the final statement has a status of recommendation for ongoing processes leading to the siting license. Very recently, in December 2012, Government of the Slovak republic decided to postpone putting the facility into operation by the end of June, 2014. (author)

Salzer, Peter [DECOM, a.s., 91901 Trnava (Slovakia)



Two long-term instrumental climatic data bases of the People`s Republic of China  

SciTech Connect (OSTI)

Two long-term instrumental data bases containing meteorological observations from the People`s Republic of China (PRC) are described. These data sets were compiled in accordance with a joint research agreement signed by the United States Department of Energy (DOE) and the PRC Chinese Academy of Sciences (CAS) on August 19, 1987. CAS has provided records from 265 stations, partitioned into networks of 60 and 205 stations which each provide good geographical coverage of the PRC. The 60-station network data contain monthly measurements of barometric pressure, air temperature, precipitation amount, relative humidity, sunshine duration, cloud amount, wind direction and speed, and number of days with snow cover. Detailed station histories are presented for all 60 stations. The 205-station network data contain monthly mean temperatures and monthly precipitation totals; however, station histories are not currently available. Sixteen stations from these data sets (13 from the 60-station, 3 from the 205-station) have temperature and/or precipitation records which begin prior to 1900, whereas the remaining stations began observing in the early to mid 1900s. Records from the 262 stations extend through 1988; the remaining three station records extend through the early 1980s. These data can be used in defining regional climate changes, establishing relationships between regional and large-scale climates, and in studying the climatic impacts of urbanization and increased concentrations of greenhouse gases. Additional uses could include examining impacts of periodic events such as volcanic eruptions or the El Nino/Southern Oscillation (ENSO). These data sets represent the most comprehensive, long-term instrumental Chinese climate data presently available.

Kaiser, D.P.



Two long-term instrumental climatic data bases of the People's Republic of China  

SciTech Connect (OSTI)

Two long-term instrumental data bases containing meteorological observations from the People's Republic of China (PRC) are described. These data sets were compiled in accordance with a joint research agreement signed by the United States Department of Energy (DOE) and the PRC Chinese Academy of Sciences (CAS) on August 19, 1987. CAS has provided records from 265 stations, partitioned into networks of 60 and 205 stations which each provide good geographical coverage of the PRC. The 60-station network data contain monthly measurements of barometric pressure, air temperature, precipitation amount, relative humidity, sunshine duration, cloud amount, wind direction and speed, and number of days with snow cover. Detailed station histories are presented for all 60 stations. The 205-station network data contain monthly mean temperatures and monthly precipitation totals; however, station histories are not currently available. Sixteen stations from these data sets (13 from the 60-station, 3 from the 205-station) have temperature and/or precipitation records which begin prior to 1900, whereas the remaining stations began observing in the early to mid 1900s. Records from the 262 stations extend through 1988; the remaining three station records extend through the early 1980s. These data can be used in defining regional climate changes, establishing relationships between regional and large-scale climates, and in studying the climatic impacts of urbanization and increased concentrations of greenhouse gases. Additional uses could include examining impacts of periodic events such as volcanic eruptions or the El Nino/Southern Oscillation (ENSO). These data sets represent the most comprehensive, long-term instrumental Chinese climate data presently available.

Kaiser, D.P.



Experiences in the field of radioactive materials seizures in the Czech Republic  

SciTech Connect (OSTI)

In recent years, the amount of radioactive materials seizures (captured radioactive materials) has been rising. It was above all due to newly installed detection facilities that were able to check metallic scrap during its collection in scrap yards or on the entrance to iron-mills, checking municipal waste upon entrance to municipal disposal sites, even incineration plants, or through checking vehicles going through the borders of the Czech Republic. Most cases bore a relationship to secondary raw materials or they were connected to the application of machines and installations made from contaminated metallic materials. However, in accordance to our experience, the number of cases of seizures of materials and devices containing radioactive sources used in the public domain was lower, but not negligible, in the municipal storage yards or incineration plants. Atomic Act No. 18/1997 Coll. will apply to everybody who provides activities leading to exposure, mandatory assurance as high radiation safety as risk of the endangering of life, personal health and environment is as low as reasonably achievable in according to social and economic aspects. Hence, attention on the examination of all cases of the radioactive material seizure based on detection facilities alarm or reasonably grounds suspicion arising from the other information is important. Therefore, a service carried out by group of workers who ensure assessment of captured radioactive materials and eventual retrieval of radioactive sources from the municipal waste has come into existence in the Nuclear Research Institute Rez plc. This service has covered also transport, storage, processing and disposal of found radioactive sources. This service has arisen especially for municipal disposal sites, but later on even other companies took advantage of this service like incineration plants, the State Office for Nuclear Safety, etc. Our experience in the field of ensuring assessment of captured radioactive materials and eventual retrieval of radioactive sources will be presented in the paper. (authors)

Svoboda, Karel; Podlaha, Josef; Sir, David; Mudra, Josef [Nuclear Research Institute Rez plc (Czech Republic)



A review of "Publishing in the Republic of Letters: The Mnage-Grvius-Wetstein Correspondence 1679-1692." by Richard Maber  

E-Print Network [OSTI]

is of greater interest in terms of his visions of the book than his visions of Persia. Richard Maber. Publishing in the Republic of Letters: The M?nage-Gr?vius-Wetstein Correspondence 1679-1692. Amsterdam: Rodopi Press, 2005. viii + 274 pp. $56.00. Review... by LAURA CRUZ, WESTERN CAROLINA UNIVERSITY. Publishing in the Republic of Letters is a slender volume, consisting primarily of the transcribed and annotated letters that were part of an international exchange between two scholars, Johann-Georg Graevius (at...

Laura Cruz



Atmospheric deposition of polycyclic aromatic hydrocarbons in an urban and a suburban area of Korea from 2002 to 2004  

SciTech Connect (OSTI)

Atmospheric bulk samples (wet and dry) were collected monthly during 2002 to 2004 from an urban and a suburban area in Korea for assessment of depositional flux and seasonal variations in the concentrations of polycyclic aromatic hydrocarbons (PAHs). PAH depositional flux ranged from 64.1 to 610 {mu} g/m{sup 2}/y for the urban area and from 65 to 460 {mu} g/m{sup 2}/y for the suburban area. The fluxes of PAHs measured in this study were comparable with those reported for urban and suburban areas in other countries. The fluxes of particulates and PAHs were higher in winter than in summer, consistent with the greater per capita consumption of fossil fuel in winter than in summer. Ambient temperature played a major role in the seasonal variability in PAH fluxes. Photochemical degradation of PAHs appears to occur during the summer months. The relationship of PAH depositional fluxes with major air pollutants, such as ozone, sulfur dioxide, carbon monoxide, nitrogen dioxide, and presence of particulate matter up to 10 {mu} m in size (PM10), was also investigated. Dominant PAH compounds in both the urban and the suburban locations were benzo(g,h,i)perylene, pyrene, and indeno(1,2,3-c,d)pyrene. Based on the PAH diagnostic ratios and a factor analysis, the major sources of PAHs in the urban and the suburban regions were found to be similar. Diesel exhaust, coal combustion, and gasoline emissions contributed predominantly to atmospheric PAH contamination.

Moon, H.B.; Kannan, K.; Lee, S.J.; Ok, G. [National Fisheries Research & Development Institute, Pusan (Republic of Korea)



In-Vessel Retention Technology Development and Use for Advanced PWR Designs in the USA and Korea  

SciTech Connect (OSTI)

In-Vessel Retention (IVR) of molten core debris by means of external reactor vessel flooding is a cornerstone of severe accident management for Westinghouse's AP600 (advanced passive light water reactor) design. The case for its effectiveness (made in previous work by the PI) has been thoroughly documented, reviewed as part of the licensing certification, and accepted by the US Nuclear Regulatory Commission. A successful IVR would terminate a severe accident, passively, with the core in a stable, coolable configuration (within the lower head), thus avoiding the largely uncertain accident evolution with the molten debris on the containment floor. This passive plant design has been upgraded by Westinghouse to the AP1000, a 1000 MWe plant very similar to the AP600. The severe accident management approach is very similar too, including In-Vessel Retention as the cornerstone feature, and initial evaluations indicated that this would be feasible at the higher power as well. A similar strategy is adopted in Korea for the APR1400 plant. The overall goal of this project is to provide experimental data and develop the necessary basic understanding so as to allow the robust extension of the AP600 In-Vessel Retention strategy for severe accident management to higher power reactors, and in particular, to the AP1000 advanced passive design.

T.G. Theofanous; S.J. Oh; J.H. Scobel



Coal upgrading program for Usti nad Labem, Czech Republic: Task 8.3. Topical report, October 1994--August 1995  

SciTech Connect (OSTI)

Coal has been a major energy source in the Czech Republic given its large coal reserves, especially brown coal and lignite (almost 4000 million metric tons) and smaller reserves of hard, mainly bituminous, coal (over 800 million tons). Political changes since 1989 have led to the reassessment of the role of coal in the future economy as increasing environmental regulations affect the use of the high-sulfur and high-ash brown coal and lignite as well as the high-ash hard coal. Already, the production of brown coal has declined from 87 million metric tons per year in 1989 to 67 million metric tons in 1993 and is projected to decrease further to 50 million metric tons per year of brown coal by the year 2000. As a means of effectively utilizing its indigenous coal resources, the Czech Republic is upgrading various technologies, and these are available at different stages of development, demonstration, and commercialization. The purpose of this review is to provide a database of information on applicable technologies that reduce the impact of gaseous (SO{sub 2}, NO{sub x}, volatile organic compounds) and particulate emissions from the combustion of coal in district and residential heating systems.

Young, B.C.; Musich, M.A.



Indo-German (CSIR BMBF) Joint Call for Proposals 2013 Within the agreement of Indo-German cooperation in S&T of 1974, Federal Republic  

E-Print Network [OSTI]

-German cooperation in S&T of 1974, Federal Republic of Germany, defining cooperation in Science and Technology of Scientific and Industrial Research, Ministry of Science & Technology, Government of India, New Delhi to SMEs and to a limited extent. German industries are asked to see the German call text for further

Jayaram, Bhyravabotla


''A far more formidable task'': the 101st Airborne Division's pacification of Thua Thien Province, Republic of Vietnam, 1968-1972  

E-Print Network [OSTI]

This thesis seeks to identify, describe, and analyze the tactics used by the 101st Airborne Division in the pacification of the Republic of Vietnam's Thua Thien province from 1968 to 1972. Despite the larger calamity of the Vietnam War, the 101st...

Werkheiser, Edwin Brooks, II



Proceedings CIEAEM 58 SRNI, Czech Republic, July 9-15, 2006 "Quaderni di Ricerca in Didattica (Matematica)", Supplemento n. 3, 2009.  

E-Print Network [OSTI]

) CIEAEM 58 ­SRNI, Czech Republic, July 9-15, 2006 CONTEXT CALLS ON AXIOLOGY Paolo Longoni, "Didactics and teachers, as to as acquire the properties of a specific school of didactics of mathe- matics. Paper folding itself for the peculiarity of its specific temporal scanning. This latter has a strong didactical meaning

Spagnolo, Filippo


Dual comb-type electrodes as a plasma source for very high frequency plasma enhanced chemical vapor deposition  

E-Print Network [OSTI]

Technology Group, Productivity Research Institute, LG electronics Inc. 19-1 Cheongho-ri, Jinwi-myeon, Pyeongtaek-si, Gyeonggi-do 451-713, Republic of Korea b Solar Energy Group, Devices & Materials Lab. LG electronics Institute of Technology 16 Woomyeon-dong, Seocho-Gu, Seoul 137-224, Republic of Korea a b s t r

Park, Byungwoo


Self-Assembled and Field-Induced 2D Structures of Glutaric Acid on Eun Hee Park,  

E-Print Network [OSTI]

, Daejeon 305-701, Republic of Korea Material Characterization Team, Materials & Components R&D Lab, LG Electronics Advanced Research Institute, 38 Baumoe-ro, Seocho-gu, Seoul 137-724, Republic of Korea *S catalysis, and electronic devices.1-4 One powerful approach to the preparation of surfaces coated

Kim, Sehun


Joint United States and People`s Republic of China clean coal activities. Annual report, April 1994--December 1995  

SciTech Connect (OSTI)

The United States Department of Energy (U.S. DOE) and the Ministry of Coal Industry of the People`s Republic of China (China) signed a protocol in the field of fossil energy research and development in April 1985. An annex to this agreement, Annex IX, was signed in April 1994 for cooperation between the U.S. DOE and China`s State Science and Technology Commission (SSTC) in the area of clean coal utilization. Article III of Annex IX requires the United States and China jointly to prepare an annual report i describing the work performed and results achieved. This report, in compliance with Article III, is a description of the activities conducted under Annex IX during the period from April 1994 through December 1995. The report also contains the plans for future activities for the next 12 months, or through December 1996.




Co-operation agreement between the European Organization for Nuclear Research (CERN) and the Government of People's Republic of Bangladesh concerning Education, Scientific and Technical Co-operation in High-Energy Physics  

E-Print Network [OSTI]

Co-operation agreement between the European Organization for Nuclear Research (CERN) and the Government of People's Republic of Bangladesh concerning Education, Scientific and Technical Co-operation in High-Energy Physics



Successful Completion of the Largest Shipment of Russian Research Reactor High-Enriched Uranium Spent Nuclear Fuel from Czech Republic to Russian Federation  

SciTech Connect (OSTI)

On December 8, 2007, the largest shipment of high-enriched uranium spent nuclear fuel was successfully made from a Russian-designed nuclear research reactor in the Czech Republic to the Russian Federation. This accomplishment is the culmination of years of planning, negotiations, and hard work. The United States, Russian Federation, and the International Atomic Energy Agency have been working together on the Russian Research Reactor Fuel Return (RRRFR) Program in support of the Global Threat Reduction Initiative. In February 2003, RRRFR Program representatives met with the Nuclear Research Institute in Re, Czech Republic, and discussed the return of their high-enriched uranium spent nuclear fuel to the Russian Federation for reprocessing. Nearly 5 years later, the shipment was made. This paper discusses the planning, preparations, coordination, and cooperation required to make this important international shipment.

Michael Tyacke; Dr. Igor Bolshinsky; Jeff Chamberlin



Porous GaN nanowires synthesized using thermal chemical vapor deposition  

E-Print Network [OSTI]

Seo a , Jeunghee Park a,*, Hyunik Yang b , Bongsoo Kim c a Department of Chemistry, Korea University-791, Republic of Korea c Department of Chemistry, Korea Advanced Institute of Science and Technology, Daejeon nanotube-confined reaction [4], arc discharge [5], laser ablation [6], sublimation [7], pyrolysis [8

Kim, Bongsoo

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...


Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...


Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A



Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...


Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1


Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP


Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for


EA-1977: Acceptance and Disposition of Used Nuclear Fuel Containing U.S.-Origin Highly Enriched Uranium from the Federal Republic of Germany  

Broader source: Energy.gov [DOE]

This environmental assessment (EA) will evaluate the potential environmental impacts of a DOE proposal to accept used nuclear fuel from the Federal Republic of Germany at DOEs Savannah River Site (SRS) for processing and disposition. This used nuclear fuel is composed of kernels containing thorium and U.S.-origin highly enriched uranium (HEU) embedded in small graphite spheres that were irradiated in nuclear reactors used for research and development purposes.


Au Australia 307 Br Brasil 307  

E-Print Network [OSTI]

307 Ch China, Republic of D ChT China, Taiwan D Cs Czecho Slovakia 307 Fr France 307 Ge Germany (Reich)1945 E Ge.W Germany, Federal Republic of 307 Germany(Reich=1945 E Ge.E Germany, Democratic Republic of 307 Germany(Reich=1945 E Hu Hungry 307 It Italy 307 Ju Jugoslavia 307 Ko Korea 307 Ko

Miyashita, Yasushi


Assessment of RELAP5/MOD2 code using loss of offsite power transient data of KNU (Korea Nuclear Unit) No. 1 Plant  

SciTech Connect (OSTI)

This report presents a code assessment study based on a real plant transient that occurred on June 9, 1981 at the KNU {number sign}1 (Korea Nuclear Unit Number 1). KNU {number sign}1 is a two-loop Westinghouse PWR plant of 587 Mwe. The loss of offsite power transient occurred at the 77.5% reactor power with 0.5%/hr power ramp. The real plant data were collected from available on-line plant records and computer diagnostics. The transient was simulated by RELAP5/MOD2/36.05 and the results were compared with the plant data to assess the code weaknesses and strengths. Some nodalization studies were performed to contribute to developing a guideline for PWR nodalization for the transient analysis. 5 refs., 18 figs., 3 tabs.

Chung, Bud-Dong; Kim, Hho-Jung (Korea Advanced Energy Research Inst., Daeduk-Danji (Republic of Korea). Korea Nuclear Safety Center); Lee, Young-Jin (Seoul National Univ. (Republic of Korea))



Radioxenon detections in the CTBT International Monitoring System likely related to the announced nuclear test in North Korea conducted on February 12, 2013  

SciTech Connect (OSTI)

Abstract: Observations of the radioxenon isotopes 133Xe and 131mXe collected at the IMS stations RN38 and RN58 on April 7-8, and April 12-13 2013, respectively, are unique with respect to the measurement history of these stations. Comparison of measured data with calculated isotopic ratios as well as analysis using atmospheric transport modeling indicate that it is likely that the xenon measured was created in the underground nuclear test conducted by North Korea on February 12, 2013, and released 7 weeks later. More than one release is required to explain all observations. The 131mXe source terms for each release were calculated to 7x1011 Bq, corresponding to about 1-10% of the total xenon inventory for a 10-kt explosion, depending on fractionation and release scenario. The observed ratios could not be used to obtain any information regarding the fissile material that was used in the test.

Ringbom, Anders; Axelssson, A.; Aldener, M.; Auer, M.; Bowyer, Ted W.; Fritioff, T.; Hoffman, Ian; Khrustalev, Kirill; Nikkinen, Mika; Popov, Vladimir Y.; Popov, Y.; Ungar, R. Kurt; Wotawa, G.



Coal use in the People`s Republic of China, Volume 2: The economic effects of constraining coal utilization  

SciTech Connect (OSTI)

The People`s Republic of China (hereafter referred to as China) is the largest producer and consumer of coal in the world. The dominance of coal in China`s energy balance has come at a high price to the environment. With the recent attention given to global warming issues, China`s energy consumption and production practices have become the subject of much concern. Of particular concern is China`s ability to reduce CO{sub 2} emissions by constraining coal use and the impact such policies will likely have on the Chinese economy. The study is divided into two reports. Volume 1 focuses on the full coal fuel cycle, emissions, and environmental effects. This report (Volume 2) analyzes various CO{sub 2} mitigation strategies and determines their effect on economic growth. Contrary to what some analysts have claimed, the current work suggests that it would not be costly for the Chinese to reduce CO{sub 2} emissions. In fact, some strategies were accompanied by increases in China`s energy and economic efficiency, which actually stimulated economic growth.

Rose, A.; Lim, D.; Frias, O.; Benavides, J. [Pennsylvania State Univ., University Park, PA (United States). Dept. of Mineral Economics; Tompkins, M.M. [Argonne National Lab., IL (United States)



Conference on alternatives for pollution control from coal-fired low emission sources, Plzen, Czech Republic. Plzen Proceedings  

SciTech Connect (OSTI)

The Conference on Alternatives for Pollution Control from Coal-Fired Emission Sources presented cost-effective approaches for pollution control of low emission sources (LES). It also identified policies and strategies for implementation of pollution control measures at the local level. Plzen, Czech Republic, was chosen as the conference site to show participants first hand the LES problems facing Eastern Europe today. Collectively, these Proceedings contain clear reports on: (a) methods for evaluating the cost effectiveness of alternative approaches to control pollution from small coal-fired boilers and furnaces; (b) cost-effective technologies for controlling pollution from coal-fired boilers and furnaces; (c) case studies of assessment of cost effective pollution control measures for selected cities in eastern Europe; and (d) approaches for actually implementing pollution control measures in cities in Eastern Europe. It is intended that the eastern/central European reader will find in these Proceedings useful measures that can be applied to control emissions and clean the air in his city or region. The conference was sponsored by the United States Agency for International Development (AID), the United States Department of Energy (DOE), and the Czech Ministry of Industry and Trade. Selected papers have been indexed separately for inclusion in the Energy Science and Technology Database.

Not Available


Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The effect of sociocultural factors on the quality of relations of the United States with Hispaniola: analysis of the American military occupation of Haiti and the Dominican Republic (1915-1934)  

E-Print Network [OSTI]


Alvarez, Fausto B.



The changing character of household waste in the Czech Republic between 1999 and 2009 as a function of home heating methods  

SciTech Connect (OSTI)

Highlights: The character of household waste in the three different types of households were assesed. The quantity, density and composition of household waste were determined. The physicochemical characteristics were determined. The changing character of household waste during past 10 years was described. The potential of energy recovery of household waste in Czech republic was assesed. - Abstract: The authors of this paper report on the changing character of household waste, in the Czech Republic between 1999 and 2009 in households differentiated by their heating methods. The data presented are the result of two projects, financed by the Czech Ministry of Environment, which were undertaken during this time period with the aim of focusing on the waste characterisation and complete analysis of the physicochemical properties of the household waste. In the Czech Republic, the composition of household waste varies significantly between different types of households based on the methods of home heating employed. For the purposes of these studies, the types of homes were divided into three categories urban, mixed and rural. Some of the biggest differences were found in the quantities of certain subsample categories, especially fine residue (matter smaller than 20 mm), between urban households with central heating and rural households that primarily employ solid fuel such coal or wood. The use of these solid fuels increases the fraction of the finer categories because of the higher presence of ash. Heating values of the residual household waste from the three categories varied very significantly, ranging from 6.8 MJ/kg to 14.2 MJ/kg in 1999 and from 6.8 MJ/kg to 10.5 MJ/kg in 2009 depending on the type of household and season. The same factors affect moisture of residual household waste which varied from 23.2% to 33.3%. The chemical parameters also varied significantly, especially in the quantities of Tl, As, Cr, Zn, Fe and Mn, which were higher in rural households. Because knowledge about the properties of household waste, as well as its physicochemical characteristics, is very important not only for future waste management, but also for the prediction of the behaviour and influence of the waste on the environment as the country continues to streamline its legislation to the European Unions solid waste mandates, the results of these studies were employed by the Czech Ministry of Environment to optimise the national waste management strategy.

Dolealov, Markta, E-mail: mdolezalova@email.cz [Institute for Environmental Studies, Faculty of Science, Charles University in Prague, Benatska 2, 128 01 Prague 2 (Czech Republic); Beneov, Libue [Institute for Environmental Studies, Faculty of Science, Charles University in Prague, Benatska 2, 128 01 Prague 2 (Czech Republic); Zvodsk, Anita [School of Adult and Continuing Education, Barry University, 8001 SW 36th Street, Suite #1, Davie, FL 33328 (United States)



Islamic Republic of Afghanistan  

E-Print Network [OSTI]

and Metallurgy Industries Group (AMIG) Ammunition and Metallurgy Industry Group Ammunition Industries Group

Takada, Shoji


Federal Republic of Germany  

E-Print Network [OSTI]

Business process re-engineering is becoming a main focus in todays efforts to overcome problems and deficits in the automotive and aerospace industries (e.g., integration in international markets, product complexity, increasing number of product variants, reduction in product development time and cost). In this paper, we investigate the steps needed to apply virtual reality (VR) for virtual prototyping (VP) to verify assembly and maintenance processes. After a review of todays business process in vehicle prototyping, we discuss CAD-VR data integration and identify new requirements for design quality. We present several new interaction paradigms so that engineers and designers can experiment naturally with the prototype. Finally, some results of a user survey performed at BMW are presented, showing the acceptance and feasability of VP and the paradigms implemented for our key process. The results show that VR will play an important role for VP in the near future.

Antonino Gomes De S; Gabriel Zachmann


The UNIVERSITY of NORTH CAROLINA at CHARLOTTE An Equal Opportunity/Affirmative Action Employer  

E-Print Network [OSTI]

, Iran, Iraq, Lebanon, Former Liberian Regime of Charles Taylor, Libya, North Korea, Somalia, Sudan, Afghanistan, Democratic Republic of the Congo, Haiti, Libya, Vietnam, Somalia, and Sri Lanka. Please contact

Howitt, Ivan


Joint Statement on Multinational Cooperation on High-Density...  

National Nuclear Security Administration (NNSA)

Release Mar 25, 2014 The White House Office of the Press Secretary Belgium, France, Germany, the Republic of Korea and the United States, the parties to this joint statement...


Nuclear Security Summit | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Uranium Fuel Development The White HouseOffice of the Press SecretaryBelgium, France, Germany, the Republic of Korea and the United States, the parties to this joint statement...


army research office: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Crawley@usace.army.mil; (601) 634-2142 or 3123; 3242 fax Puerto Rico Republic of Korea US Marshall Islands Virgin Islands 12;2 Alabama Amiri Engineering Corp 35 DEPARTMENT OF THE...


Algorithms for Three-Dimensional Free-Form Object Matching  

E-Print Network [OSTI]

Architecture and Ocean Engineering (1995) Seoul National University, Republic of Korea M.S. in Naval of Technology Submitted to the Department of Ocean Engineering in partial fulfillment of the requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Department of Ocean Engineering March 13, 2003 Certified by

Patrikalakis, Nicholas M.


E-Print Network 3.0 - agenda abstracts index Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Science and Engineering Pohang, Republic of Korea lcj80,hugman,gblee@postech.ac.kr Abstract... This work presents an agenda-based approach to improve the robustness of the...


U.S. Geological Survey China's Growing Appetite for Minerals  

E-Print Network [OSTI]

: Coal 45 1 Oil 4.7 6 Industrial minerals: Cement 42 1 Fluorspar 55 1 Rare earths 85 1 Metals: Aluminum Republic of Korea Thailand Other Asian Crisis 1997 #12;Production Flow for Cement #12;Country-Level Ou


Investigation of the Dashigil mud volcano (Azerbaijan) using beryllium-10 K.J. Kim a,  

E-Print Network [OSTI]

Geological Research Division, Korea Institute of Geoscience and Mineral Resources, Daejeon 305-350, Republic of Korea b Department of Geology, Wayne State University, Detroit, MI 48202, USA c Geology Institute volcanoes, sedimentary volca- noes, gasoil volcanoes etc. Mud volcanoes resemble magmatic volcanoes


2006 IEEE International Conference on Systems, Man, and Cybernetics  

E-Print Network [OSTI]

energy with each other. The time-domain passivity controller has the landing force as input and controls studies in walking trajectory gener- ation [7],[8] and online (real-time) balance control [9],[10] during Engineering, Korea University of Technology and Education, Cheoan-city, 330-708, Republic of Korea j hryu

Ryu, Jee-Hwan


New Media Practices in Korea  

E-Print Network [OSTI]

jeongchekgwaje [Present of youth fandom culture and policyof girls participatory fandom culture, which alreadyyoung Korean fans various fandom activities around trans-

Ok, Hyeryoung



New Media Practices in Korea  

E-Print Network [OSTI]

current prestige as an IT powerhouse, global digital testtransformed into an IT powerhouse, I address how these

Ok, Hyeryoung



New Media Practices in Korea  

E-Print Network [OSTI]

P. , & Kerr, A. (2001). Digital media, nation-states andmost advanced IT and digital media culture, Korean youthsconstruction of the global digital media scene. Introduction

Ok, Hyeryoung



"Market Watch 2010" The Timber Sector in Malaysia  

E-Print Network [OSTI]

sectors are palm oil & palm oil-based products, crude petroleum, liquefied natural gas and timber Major export countries for Malaysian goods are Singapore, Japan, China, India, Korea as well, the Republic of Singapore, the European Union, the People's Republic of China and Japan. Malaysian FDI reached


Activities with Argentina. Spring 1999. A U.S. Department of Energy Cooperative Program with the National Atomic Energy Commission of the Argentine Republic  

SciTech Connect (OSTI)

In 1989, the US Department of Energy (DOE) responded to the need to redirect resources from weapons production to environmental restoration and waste management by establishing the Office of Environmental Management (EM) and delegated to this office the responsibility of cleaning up the US nuclear weapons complex. Now in its eight year, EM`s mission has three central facets: (1) to assess, remediate, and monitor contaminated sites and facilities; (2) to store, treat, and dispose of waste from past and current operations; and (3) to develop and implement innovative technologies for environmental cleanup. To this end, EM has established domestic and international cooperative technology development programs, including one with the Republic of Argentina. Cooperating with Argentine scientific institutes and industries meets US cleanup objectives by: (1) identifying and accessing Argentine EM-related technologies, thereby leveraging investments and providing cost-savings; (2) improving access to technical information, scientific expertise, and technologies applicable to EM needs; and (3) fostering the development of innovative environmental technologies by increasing US private sector opportunities in Argentina in EM-related areas.




The United States of America and the People`s Republic of China experts report on integrated gasification combined-cycle technology (IGCC)  

SciTech Connect (OSTI)

A report written by the leading US and Chinese experts in Integrated Gasification Combined Cycle (IGCC) power plants, intended for high level decision makers, may greatly accelerate the development of an IGCC demonstration project in the People`s Republic of China (PRC). The potential market for IGCC systems in China and the competitiveness of IGCC technology with other clean coal options for China have been analyzed in the report. Such information will be useful not only to the Chinese government but also to US vendors and companies. The goal of this report is to analyze the energy supply structure of China, China`s energy and environmental protection demand, and the potential market in China in order to make a justified and reasonable assessment on feasibility of the transfer of US Clean Coal Technologies to China. The Expert Report was developed and written by the joint US/PRC IGCC experts and will be presented to the State Planning Commission (SPC) by the President of the CAS to ensure consideration of the importance of IGCC for future PRC power production.




" . , ' ~. I., 0, , , . IC. onl. n. awar for orcan Health Fair, Korean-Am. Nail A, ~'cl . Seoul. R~chr. Kyullggi (Korell) Pnn'inl:;Korea. 1976-78: lab. chief Inc" Fhl'hillg. 1999, Fellow: Am. Acad. redial.: mem.: Coalililln forA  

E-Print Network [OSTI]

NIH. 8AICAN, ROMAN HORATIU, retired physicisl; b. Blaj. Romania, Feb. 23, Childrell 111ld Fal1ulie:a, Livia. Elvira. r...ch. pro;Cl'1 199 J), Hunter Coil. U.S. Koreau-Arn. Paren'" A1isn. (pre.. 198R Sgt. K... Hl',dtl1 ,Hid Well"all'. 19810:. Pre~. ltward Rcpuhlil.: of Korea, 2OCl(); granlee Ass!. U. Cluj

Baica, Malvina

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identification of potential sources and source regions of fine ambient particles measured at Gosan background site in Korea using advanced hybrid receptor model combined with positive matrix factorization - article no. D22217  

SciTech Connect (OSTI)

The size- and time-resolved measurement of particulate trace elements was made using an eight-stage Davis Rotating Unit for Monitoring sampler and synchrotron X-ray fluorescence system from 29 March to 29 May in 2002 at Gosan, Korea, which is one of the representative background sites in east Asia. A sa result, continuous 3-hour average concentrations were obtained for 19 elements including S, Si, Al, Fe, Ca, Cl, Cu, Zn, Ti, K, Mn, Pb, Ni, V, Se, As, Rb, Cr, and Br. Positive matrix factorization (PMF) method was applied to the size-resolved aerosol data sets in order to identify the possible sources and to estimate their contribution to particulate matter mass in each size range. Twelve sources were then resolved in the fine size range ( 0.07 to 1.15 {mu}m), including continental aerosol, biomass burning, coal combustion, oil heating furnace, residual oil-fired boiler, municipal incineration, nonferrous metal source, ferrous metal source, gasoline vehicle, diesel vehicle, copper smelter, and volcanic emission. A newly developed hybrid receptor model, concentration, retention time, and source emission weighted trajectory (CRSWT) was then applied to the source intensities derived from the PMF analysis by incorporating meteorological and source inventory information of the study region in order to suggest the regional information of long-range transported fine aerosol sources. The CRSWT model was able to resolve highly potential source areas and pathways for the fine ambient aerosol at the Gosan background site.

Han, J.S.; Moon, K.J.; Kim, Y.J. [National Institute of Environmental Research, Inchon (Republic of Korea). Dept. of Air Quality Research



Impressions on Chinas Popular Republic  

ScienceCinema (OSTI)

Le D.G. Jentschke prsente le Prof.Yang, ne en 1922 en Chine o il a aussi fait ses tudes; il parle de ses impressions en Chine (p.e. mariage etc....) avec prsentation des dias




IEA participating countries Czech Republic  

E-Print Network [OSTI]

-encompassing annual studies of oil, natural gas, coal, electricity and renewables are indispensable tools for energy, journalist or student will have at his or her fingertips the annual Canadian production of coal, the electricity consumption in Thailand, the price of diesel oil in Spain and thousands of other useful energy

Schrijver, Karel


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...


Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im



Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced


A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-




E-Print Network [OSTI]


Tsien, Roger Y.


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397


3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)


Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schfer, Eberhard


Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W



Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate


Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August


Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is


Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem


Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump


Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo



E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.


4/5/2014 10 ways alternative energyis about to change the waytech gets powered -TechRepublic http://www.techrepublic.com/article/10-ways-alternative-energy-is-about-to-change-the-way-tech-gets-powered/ 1/10  

E-Print Network [OSTI]

to Apple; it owns two solar farms and one fuel-cell farm near its data center in North Carolina4/5/2014 10 ways alternative energyis about to change the waytech gets powered - TechRepublic http://www.techrepublic.com/article/10-ways-alternative-energy-is-about-to-change-the-way-tech-gets-powered/ 1/10 Solar-powered laptops

Chiao, Jung-Chih


2006200620062006 Taiwan-Korea Plasma Conference 2006  

E-Print Network [OSTI]

/16-1/18 Place: NTU (1/16) NCHC(1/17 -18) 1/16 PSROC@NTU 10:00-13:00 Registration and Lunch 13:00-19:00 Plasma/NTHU, HsinChu, Taiwan Optical tunneling effect of localized surface plasmon: A simulation study using

Hsu, Jang-Yu


Crowdfunding in Korea Hye-Hwal SEONG  

E-Print Network [OSTI]

-18, 2013 UC Berkeley Symposium UC Berkeley International Symposium on Crowdfunding #12;I. Current Situation for Consumer Protection in Electronic Commerce as far as there is no monetary return üIf any monetary return combined, it can be an `investment contract' and regulated byCapital Market Act October 17-18, 2013 UC

Sekhon, Jasjeet S.


Korea Solar Inc | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6Kentwood,GeorgeKlimaschutz eKodiak,Kooskia,


Golf and Taxes in South Korea  

E-Print Network [OSTI]

Broadcast Transcript: Bad news for golf mad South Koreans: forget about teeing off if you tee off the National Tax Service. The NTS is cracking down on tax cheats by revoking memberships in pricey golf clubs. Do the math: if you can afford the steep...

Hacker, Randi



Korea Power Exchange (KPX) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach, Florida:Kenyon


SolarWorld Korea | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to:Information SilverSolarStructure Ltd Jump


South Korea - NETL Cooperation | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd JumpGTZHolland, Illinois: Energy Resources Jump to:Maryland:


Published: May 16, 2011 r 2011 American Chemical Society 1893 dx.doi.org/10.1021/ct200211b |J. Chem. Theory Comput. 2011, 7, 18931901  

E-Print Network [OSTI]

Institute of Science and Technology, Daejeon 305-701, Republic of Korea ) Centre for Condensed Matter Theory for by the broadening of the normal modes into bands from sampling the velocities over the trajectory. The low frequencyS as a superposition of gas-phase and solid-phase components (two phases). The analytical decomposition of the Do

Goddard III, William A.


Atmos. Chem. Phys., 6, 211223, 2006 www.atmos-chem-phys.org/acp/6/211/  

E-Print Network [OSTI]

-gu, Incheon, 404-170, Republic of Korea 2ADvanced Environmental Monitoring Research Center (ADEMRC) at Gwangju size ranges (0.0712 m) and included continental soil, local soil, sea salt, biomass/biofuel burning such as coal combustion and biomass/biofuel burning con- tributed about 60% in the fine size range (0.562.5 m

Paris-Sud XI, Universit de


High Throughput Ultralong (20 cm) Nanowire Fabrication Using a Wafer-Scale Nanograting Template  

E-Print Network [OSTI]

-gu, Daejeon, 305-701, Republic of Korea LG Innotek Components & Materials R&D Center, 55 Hanyang Daehak actively explored as promising nanostructured materials for high performance flexible electronics (centimeter- long) nanowires are highly attractive from the perspective of electronic performance, device


Nanostructural analysis of ZnO:Al thin films for carrier-transport Seung-Yoon Lee a,b  

E-Print Network [OSTI]

Il Jang a , Sungeun Lee a , Heon-Min Lee a , Byungwoo Park b,* a Emerging Technology Laboratory, LG Electronics Advanced Research Institute, Seoul 137-724, Republic of Korea b WCU Hybrid Materials Program important research themes. Carrier-transport mechanisms for the electron mobility of doped ZnO thin films

Park, Byungwoo



E-Print Network [OSTI]

and Technology, 373-1 Guseong, Yuseong, Daejeon, 305-701, Republic of Korea 3 Doosan Heavy Industries-constructed nuclear power plants and also in the upgrade of existing analog-based reactor protection systems (RPSs) [1 with their corresponding setpoints and a group of coincidence processors (CPs) that generate a trip signal when a trip

Jee, Eunkyoung



E-Print Network [OSTI]

-44-225-7001, michel.chatelier@cea.fr Japan Ministry of Education, Culture, Sports, Science and Technology Office from China, European Union, Japan, the Republic of Korea, the Russian Federation and the United States mission to India, delegates identified a series of steps for the near future leading towards a possible


Geomicrobiology Journal, 26:189198, 2009 Copyright Taylor & Francis Group, LLC  

E-Print Network [OSTI]

and Ocean Sciences, Inha University, Incheon 402­751, Republic of Korea 4 Rankin Science South, Appalachian from the dorsal surface of a hydrother- mal vent tubeworm. 16S rRNA analysis reveals Aurantimonas. Other organisms within this clade have been isolated from disparate environments such as surface

Dick, Christopher


Comparison of the Catalytic Oxidation Reaction on Graphene Oxide and Reduced Graphene Oxide  

E-Print Network [OSTI]

Comparison of the Catalytic Oxidation Reaction on Graphene Oxide and Reduced Graphene Oxide Laboratory (PAL), Pohang 790-784, Republic of Korea ABSTRACT: The capacities of graphene oxide (GO) and reduced graphene oxide (rGO) films grown on silicon substrate to cause the aniline to azobenzene oxidation

Kim, Sehun


Elsevier Editorial System(tm) for Pervasive and Mobile Computing Manuscript Draft  

E-Print Network [OSTI]

, Israel cLG Semicon Hall 2106, KAIST, 373-1, Guseong-dong, Yuseong-gu, Daejeon, 305-701, Republic of Korea- forms a precise segmentation and labeling of swimming sessions. This allows a comprehensive break introduce a grammar into the SMM framework. Using the trained model on test swimming sessions of different

Shamir, Ron

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Enzyme and Microbial Technology 45 (2009) 218225 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

of General Education, Kwangwoon University, Seoul 130-791, Republic of Korea d School of Computational, threading, and SCOP fold classification ­ have been applied to generate the template library and to select and other biotechnological application. Until now, many researchers have reported computer programs which

Lee, Jooyoung


Final revised ms for Aquatic Microbial Ecology Feeding by raphidophytes on the cyanobacterium Synechococcus  

E-Print Network [OSTI]

-333, Republic of Korea 4 Environment Energy Resource Institute, Advanced Institute of Convergence Technology interference contrast optics under an inverted epifluorescence microscope. In addition, we measured ingestion rates of C. ovata and H. akashiwo on Synechococcus sp. as a function of prey concentration using

Jeong, Hae Jin


Port-city relationships in Europe and Asia Published in: Journal of International Logistics and Trade 4(2), pp. 13-35  

E-Print Network [OSTI]

1 Port-city relationships in Europe and Asia Published in: Journal of International Logistics-712 Republic of Korea Abstract This paper investigates the nature of port-city relationships in two major port studies or general models, it proposes a complementary approach based on urban and port indicators

Paris-Sud XI, Université de


http://jim.sagepub.com Systems and Structures  

E-Print Network [OSTI]

of Civil and Environmental Engineering Rice University, Houston, TX 77005, USA 2 Department of Mechanical Engineering, Dohgguk University Seoul, 100-715, Republic of Korea 3 Departments of Civil and Environmental of the extent of damage. The objective of this article is to present a new formulation using a predesigned set

Nagarajaiah, Satish


A guidebook to alternative energy projects on American Samoa, The Commonwealth of the Northern Mariana Islands, The Federated States of Micronesia, Guam, and The Republics of the Marshall Islands and Palau. [Contains bibliography  

SciTech Connect (OSTI)

The purpose of this guidebook is to help transfer information concerning alternative energy projects that have been tried on the Pacific islands affiliated with the US. These islands include those in American Samoa, the Commonwealth of the Northern Mariana Islands, the Federated States of Micronesia (Kosrae, Pohnpei, Truk, and Yap), Guam, and the Republics of the Marshall Islands and Palau. Distances are long between islands and populations are sparse, making communication and the transfer of information particularly difficult. A project that works on American Samoa might be appropriate for Yap, but to get this information to the proper people on Yap in a reasonable period of time is extremely difficult. This book describes 100 alternative energy projects that have been tried on the islands since the mid-1970's. This description and record of what has been done to date should be a source of ideas for energy workers, reduce duplication of work, and help encourage successes by describing other successes and failures. Alternative energy projects are projects that use indigenous, renewable resources in order to reduce local dependency on imported petroleum for electricity or liquid fuels. The islands have an apparent abundance of natural resources for this purpose such as the sun, rivers, vegetation, the ocean, and wind; and, ideally, it should be relatively simple to convert these resources to electricity or fuel. However, there are problems unique to the remote, tropical Pacific that often appear insurmountable, and successes to date are the results of unusual persistence, hard work, and ingenuity of those on the islands. Projects are confined to those that actually develop or demonstrate hardware. These projects use the complete spectrum of alternative technologies such as biomass conversion, wind electric, solar water heating, photovoltaics, wind water pumping, hydroelectric, water desalination, and integrated systems. 381 refs., 85 figs.

Case, C.W.



ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca


Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.


Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne



Accounting standards for the Dominican Republic  

E-Print Network [OSTI]

HISTORICAL BACKGROUND Statement of the Problem Methodology CHAPTER II ACCOUNTING ENVIRONMENT Socio-Political Context Economic Context CHAPTER III ACCOUNTING PRACTICE 18 General Considerations Legal Factors Sources of Accounting Practices Form... of the govern- ment machinery of the dictatorship of 30 years, new policies were adopted to adjust the behavior of the people and these factors acti- vated the new economic trend of the country. 6 Translated by the author from the "Platform for the Social...

Reyes-Lugo, Ramon



Czech Republic in Eniac and Artemis  

E-Print Network [OSTI]

ARTEMOS: TESLA a.s.; BUT 2010 MOTOR-BRAIN: IMA s.r.o.; BUT Notes: BUT = Brno University of Technology CTU

Savicky, Petr



E-Print Network [OSTI]

SECRETARIAT OF RESEARCH & TECHNOLOGY NATIONAL CENTRE FOR SCIENTIFIC RESEARCH «DEMOKRITOS» PATR. GRIGORIOU possesses: 1. Satellite Infrastructure (Central Fixed Base Station & Mobile Satellite Station) 2. Wireless & neural nets (data mining, evaluation methods), security & telecom patents, e-services platforms 4

Karkaletsis, Vangelis



E-Print Network [OSTI]

are explored, Arizona's geography will make it a focal point for solar- energy initiatives, and its expertise particular area: science. Arizona is already a global leader, but it needs to build on that strength of the largest land-based telescopes on earth, including the Large Binocular Telescope. · Biosphere 2, north

Fay, Noah


Czech Republic: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC JumpCrow Lake Wind JumpCuttings Analysis AtCyclocean


Dominican Republic: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSixfor


China Energy Databook -- User Guide and Documentation, Version 7.0  

E-Print Network [OSTI]

Jamaica Japan Jordan Kazakhstan Kenya Korea (DPRK) Korea (Jamaica Japan Jordan Kazakhstan Kenya Korea (DPRK) Korea (Jamaica Japan Jordan Kazakhstan Kenya Korea (DPRK) Korea (

Fridley, Ed., David



2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter


2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


The effects of prevention and public health expenditure on measles immunization rates in Organisation for Economic Co-Operation and Development (OECD) countries  

E-Print Network [OSTI]

Belgium* 40 40 0 Canada 185 184 1 Czech Republic 27 23 4 Denmark 15 13 2 Finland 87 41 47 France 90 68 22 Germany 100 86 15 Greece 65 35 30 Hungary** 54 29 24 Iceland 40 40 0 Ireland 78 59 19 Italy 15 15 0 Japan* 50 30 20 Korea 21 20 1....4 Austria 74.0 Belgium 82. Canada** 94.5 Czech Republic 96.9 Denmark 96.0 Finland 97. France 87.1 Germany 93.3 Greece 88.0 Hungary 99.9 Iceland* 99.0 Ireland 81. Italy 85.5 Japan*** 100.0 Korea**** 90.2 Luxembourg 91.0 Mexico 96.4 Netherlands...

Chen, Christina Melonie



Localization of a Site of Action for Benzofuroindole-Induced Potentiation of BKCa ChannelsS  

E-Print Network [OSTI]

, and Chul-Seung Park School of Life Sciences (B.-C.L., H.-H.L., H.-S.Y., Y.-C.K., S.H.E., C.-S.P.), National Leading Research Laboratory for Ion Channels (B.-C.L., C.-S.P.), and Cell Dynamic Research Center (B.-C.L., S.H.E., C.-S.P.), Gwangju Institute of Science and Technology, Gwangju, Republic of Korea; Division

Lee, Keun Woo

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


This article appeared in a journal published by Elsevier. The attached copy is furnished to the author for internal non-commercial research  

E-Print Network [OSTI]

after 11 d of exposure. Although sunlight irradiation of food-grade TiO2 generated ROS (assessed's personal copy Technical Note Photocatalytic pre-treatment with food-grade TiO2 increases, Hwarangno 14-gil 5, Seongbuk-gu, Seoul 136-791, Republic of Korea h i g h l i g h t s " Food-grade TiO2 has

Alvarez, Pedro J.


ASPAC (Asian and Pacific Council) Nations: Popular support for governments, political communities, and regimes ---------- 1960-1971  

E-Print Network [OSTI]

-1971. The nine countries are: The Republic of Korea, Japan, Nationalist China, the Philippines, Thailand, Malaysia, South Vietnam, New Zealand, and Australia, which consti. tute the Asian and Pacific Council. Eighteen national-level variables as independent..., Japan, Nationalist China, the Philippines, Thailand, Nalaysia, South Vietnam, New Zea1and, and Australia, for the period of 1960-1971. These nations constitute the Asian and Pacific Council, which has been the least integrated of the ma)or world...

Lim, Kook-Joon



Strangelet search in Au plus Au collisions at root s(NN)=200 GeV  

E-Print Network [OSTI]

of High Energy Physics, Protvino, Russia 33Purdue University, West Lafayette, Indiana 47907, USA 34Pusan National University, Pusan, Republic of Korea 35University of Rajasthan, Jaipur 302004, India 36Rice University, Houston, Texas 77251, USA 37...) to the experiment. Normal spectator fragments other than neutrons cannot reach the ZDCs due to the strong fields of the DX magnets. There is one ZDC to the east of the interaction region at STAR, and another to the west, located 18m from the center...

Abelev, B. I.; Aggarwal, M. M.; Ahammed, Z.; Anderson, B. D.; Arkhipkin, D.; Averichev, G. S.; Bai, Y.; Balewski, J.; Barannikova, O.; Barnby, L. S.; Baudot, J.; Baumgart, S.; Belaga, V. V.; Bellingeri-Laurikainen, A.; Bellwied, R.; Benedosso, F.; Betts, R. R.; Bhardwaj, S.; Bhasin, A.; Bhati, A. K.; Bichsel, H.; Bielcik, J.; Bielcikova, J.; Bland, L. C.; Blyth, S. -L; Bombara, M.; Bonner, B. E.; Botje, M.; Bouchet, J.; Brandin, A. V.; Bravar, A.; Burton, T. P.; Bystersky, M.; Cadman, R. V.; Cai, X. Z.; Caines, H.; Sanchez, M. Calderon de la Barca; Callner, J.; Catu, O.; Cebra, D.; Chajecki, Z.; Chaloupka, P.; Chattopadhyay, S.; Chen, H. F.; Chen, J. H.; Chen, J. Y.; Cheng, J.; Cherney, M.; Chikanian, A.; Christie, W.; Chung, S. U.; Coffin, J. P.; Cormier, T. M.; Cosentino, M. R.; Cramer, J. G.; Crawford, H. J.; Das, D.; Dash, S.; Daugherity, M.; de Moura, M. M.; Dedovich, T. G.; DePhillips, M.; Derevschikov, A. A.; Didenko, L.; Dietel, T.; Djawotho, P.; Dogra, S. M.; Dong, X.; Drachenberg, J. L.; Draper, J. E.; Du, F.; Dunin, V. B.; Dunlop, J. C.; Mazumdar, M. R. Dutta; Eckardt, V.; Edwards, W. R.; Efimov, L. G.; Emelianov, V.; Engelage, J.; Eppley, G.; Erazmus, B.; Estienne, M.; Fachini, P.; Fatemi, R.; Fedorisin, J.; Feng, A.; Filip, P.; Finch, E.; Fine, V.; Fisyak, Y.; Fu, J.; Gagliardi, Carl A.; Gaillard, L.; Ganti, M. S.; Garcia-Solis, E.; Ghazikhanian, V.; Ghosh, P.; Gorbunov, Y. G.; Gos, H.; Grebenyuk, O.; Grosnick, D. D.; Guertin, S. M.; Guimaraes, K. S. F. F.; Gupta, N.; Haag, B.; Hallman, T. J.; Hamed, A.; Harris, J. W.; He, W.; Heinz, M.; Henry, T. W.; Hepplemann, S.; Hippolyte, B.; Hirsch, A.; Hjort, E.; Hoffman, A. M.; Hoffmann, G. W.; Hofman, D.; Hollis, R.; Horner, M. J.; Huang, H. Z.; Hughes, E. W.; Humanic, T. J.; Igo, G.; Iordanova, A.; Jacobs, P.; Jacobs, W. W.; Jakl, P.; Jia, F.; Jones, P. G.; Judd, E. G.; Kabana, S.; Kang, K.; Kapitan, J.; Kaplan, M.; Keane, D.; Kechechyan, A.; Kettler, D.; Khodyrev, V. Yu; Kim, B. C.; Kiryluk, J.; Kisiel, A.; Kislov, E. M.; Klein, S. R.; Knospe, A. G.; Kocoloski, A.; Koetke, D. D.; Kollegger, T.; Kopytine, M.; Kotchenda, L.; Kouchpil, V.; Kowalik, K. L.; Kravtsov, P.; Kravtsov, V. I.; Krueger, K.; Kuhn, C.; Kulikov, A. I.; Kumar, A.; Kurnadi, P.; Kuznetsov, A. A.; Lamont, M. A. C.; Landgraf, J. M.; Lange, S.; LaPointe, S.; Laue, F.; Lauret, J.; Lebedev, A.; Lednicky, R.; Lee, C. -H; Lehocka, S.; LeVine, M. J.; Li, C.; Li, Q.; Li, Y.; Lin, G.; Lin, X.; Lindenbaum, S. J.; Lisa, M. A.; Liu, F.; Liu, H.; Liu, J.; Liu, L.; Ljubicic, T.; Llope, W. J.; Longacre, R. S.; Love, W. A.; Lu, Y.; Ludlam, T.; Lynn, D.; Ma, G. L.; Ma, J. G.; Ma, Y. G.; Mahapatra, D. P.; Majka, R.; Mangotra, L. K.; Manweiler, R.; Margetis, S.; Markert, C.; Martin, L.; Matis, H. S.; Matulenko, Yu A.; McClain, C. J.; McShane, T. S.; Melnick, Yu; Meschanin, A.; Millane, J.; Miller, M. L.; Minaev, N. G.; Mioduszewski, Saskia; Mironov, C.; Mischke, A.; Mitchell, J.; Mohanty, B.; Morozov, D. A.; Munhoz, M. G.; Nandi, B. K.; Nattrass, C.; Nayak, T. K.; Nelson, J. M.; Nepali, N. S.; Netrakanti, P. K.; Nogach, L. V.; Nurushev, S. B.; Odyniec, G.; Ogawa, A.; Okorokov, V.; Oldenburg, M.; Olson, D.; Pachr, M.; Pal, S. K.; Panebratsev, Y.; Pavlinov, A. I.; Pawlak, T.; Peitzmann, T.; Perevoztchikov, V.; Perkins, C.; Peryt, W.; Phatak, S. C.; Planinic, M.; Pluta, J.; Poljak, N.; Porile, N.; Poskanzer, A. M.; Potekhin, M.; Potrebenikova, E.; Potukuchi, B. V. K. S.; Prindle, D.; Pruneau, C.; Putschke, J.; Qattan, I. A.; Raniwala, R.; Raniwala, S.; Ray, R. L.; Relyea, D.; Ridiger, A.; Ritter, H. G.; Roberts, J. B.; Rogachevskiy, O. V.; Romero, J. L.; Rose, A.; Roy, C.; Ruan, L.; Russcher, M. J.; Sahoo, R.; Sakrejda, I.; Sakuma, T.; Salur, S.; Sandweiss, J.; Sarsour, M.; Sazhin, P. S.; Schambach, J.; Scharenberg, R. P.; Schmitz, N.; Seger, J.; Selyuzhenkov, I.; Seyboth, P.; Shabetai, A.; Shahaliev, E.; Shao, M.; Sharma, M.; Shen, W. Q.; Shimanskiy, S. S.; Sichtermann, E. P.; Simon, F.; Singaraju, R. N.; Smirnov, N.; Snellings, R.; Sorensen, P.; Sowinski, J.; Speltz, J.; Spinka, H. M.; Srivastava, B.; Stadnik, A.; Stanislaus, T. D. S.; Staszak, D.; Stock, R.; Strikhanov, M.; Stringfellow, B.; Suaide, A. A. P.; Suarez, M. C.; Subba, N. L.; Sumbera, M.; Sun, X. M.; Sun, Z.; Surrow, B.; Symons, T. J. M.; de Toledo, A. Szanto; Szeliga, B.; Takahashi, J.; Tang, A. H.; Tarnowsky, T.; Thomas, J. H.; Timmins, A. R.; Timoshenko, S.; Tokarev, M.; Trainor, T. A.; Trentalange, S.; Tribble, Robert E.; Tsai, O. D.; Ulery, J.; Ullrich, T.; Underwood, D. G.; Van Buren, G.; van der Kolk, N.; van Leeuwen, M.; Vander Molen, A. M.; Varma, R.; Vasilevski, I. M.; Vasiliev, A. N.; Vernet, R.; Vigdor, S. E.; Viyogi, Y. P.; Vokal, S.; Voloshin, S. A.; Waggoner, W. T.; Wang, F.; Wang, G.; Wang, J. S.



Assessment of public perception of radioactive waste management in Korea.  

SciTech Connect (OSTI)

The essential characteristics of the issue of radioactive waste management can be conceptualized as complex, with a variety of facets and uncertainty. These characteristics tend to cause people to perceive the issue of radioactive waste management as a 'risk'. This study was initiated in response to a desire to understand the perceptions of risk that the Korean public holds towards radioactive waste and the relevant policies and policy-making processes. The study further attempts to identify the factors influencing risk perceptions and the relationships between risk perception and social acceptance.

Trone, Janis R.; Cho, SeongKyung (Myongji University, Korea); Whang, Jooho (Kyung Hee University, Korea); Lee, Moo Yul



The Division System in Crisis: Essays on Contemporary Korea  

E-Print Network [OSTI]

nuclear crisis is that the old-style diehard reunification position and hardcore anti-Americanism have lost much of their power to

Nak-chung, Paik



Dongho Jung, Hyeonju Kim, Hosaeng Lee KIOST, KOREA  

E-Print Network [OSTI]

CONSISTING OF LAMINATED COMPOSITE MATERIAL WITH A HYBRID NUMERICAL SCHEME OTEC with Large diameter riser for OTEC in commercial Thick and fiber composite with various laminate Different elastic and shear


approved korea labor: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

148 Office of Workforce Policy and Labor Relations Engineering Websites Summary: .254-7232 f. 607.255.0298 e. equalopportunity@cornell.edu www.ohr.cornell.edu Cornell University...


Bangladesh Korea Information Access Center znd Batch Result  

E-Print Network [OSTI]

Bakar Siddique 20100220 Mahmud Hasan Naim 20100222 Md. Faruque Hasan 20too2L7 Afrin Amin Course code. Mofizullslam 20100190 Uzzal Kumar Modok 20roo27t Mahmudul Hasan ChowdhurY 20100181 Md Asif Hasan 20L00L92 Ali lslam 20100189 A.K.M Ashrafur Rahman 20t00123 Tasvia Mausumi Rashid 20L00272 Gazi Hasan Arefin #12;

Rahman, A.K.M. Ashikur



E-Print Network [OSTI]

.0002 chlorine : 100 mg/l max. (3) Steam pressure at B.L. : 5 kg/cm 2 -g sat'd (4) Instrument air pressure at B : C200) Reboiler(E210), Condenser (E220) , (MeOH RECOV. COLUMN : C300) Reboiler (E310), Condenser

Hong, Deog Ki


Strategy for Designing DSM Program after the Restructuring in Korea  

E-Print Network [OSTI]

introduce a new DSM mechanism and program development strategies based on customer response and electricity industry efficiency. Especially we introduced DLC(Direct Load Control) technology via two-way communication scheme for large customer. This DLC...

Rhee, C.; Lee, K.; Jo, I.



Feasibility study of Korea biocluster with real estate perspectives  

E-Print Network [OSTI]

Globalization has created a dynamic and rapidly changing marketplace. A business must move quickly to capitalize on the changing environment. For example, many global biotechnology firms are seeking new geographical locations ...

Choi, Junghun



U.S. Style Corporate Governance in Korea's Largest Companies  

E-Print Network [OSTI]

E.g. , D. Gordon Smith, Corporate Governance and ManagerialPrinciples of Corporate Governance, http://www.oecd.orgdaf/Bank/OECD Global Corporate Governance Forum, Washington

Ehrlich, Craig; Kang, Dae-Seob



Factory Girl Literature: Sexuality, Violence, and Representation in Industrializing Korea  

E-Print Network [OSTI]

suk shares a desk with Miso, who keeps a copy of a book byjealously what it is about, Miso responds that she has noMind your own business Miso responds, who cannot explain

Barraclough, Ruth



The Division System in Crisis: Essays on Contemporary Korea  

E-Print Network [OSTI]

nuclear weapons, 15152; regionalism, 11920; response to nuclear tests,test, manufacture, produce, receive, possess, store, deploy or use nuclear weapons.

Nak-chung, Paik



Korea's Green Growth Strategy: Mitigating Climate Change and Developing New  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (botOpen6Kentwood,GeorgeKlimaschutz eKodiak,Kooskia,Growth Engines |


MHK Projects/South Korea | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAKGalway Bay IE < MHK Project CitySantonaSimmesport <


Korea Institute of Energy Research Seong-Ryong Park  

E-Print Network [OSTI]

+semi-conductor,+ship) exports 172.5 Bil USD (Energy imports) '09 '10 '11(p) *Source: International Monetary Fund - 2011 World.5 38.3 36.8 36.1 22.0 14.2 17.5 15.8 3.7 *source: : Annual Energy Statistics #12;3 Annual energy consumption /p (toe,'09) Power consumption/p (kWh,'09) CO2 emission/p (tCO2,'09) *Source: Energy Balances

Oak Ridge National Laboratory


Seoul, South Korea: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd Jump to: navigation, search Name:OpenOpenInformation onSentech


South Korea-Green Growth Strategy Support | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty Ltd JumpGTZHolland, Illinois: Energy Resources Jump to:Maryland:Northeast


Green Growth in Motion: Sharing Korea's Experience | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power BasicsGermany: Energy ResourcesNews Home > Blogs >Growth

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Korea Advanced Nano Fab Center KANC | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place:Keystone Clean Air JumpMaine. Its FIPSJV Jump to:Fab Center


Korea-Australia Rheology Journal March 2010 Vol. 22, No. 1 31 Korea-Australia Rheology Journal  

E-Print Network [OSTI]

products as well as having important applications in the oilfield indus- try. While the shear rheology


Implications of a North Korean Nuclear Weapons Program  

SciTech Connect (OSTI)

The Democratic People`s Republic of Korea (DPRK) is one of the Cold War`s last remaining totalitarian regimes. Rarely has any society been as closed to outside influences and so distant from political, economic, and military developments around the globe. In 1991 and in 1992, however, this dictatorship took a number of political steps which increased Pyongyang`s interaction with the outside world. Although North Korea`s style of engagement with the broader international community involved frequent pauses and numerous steps backward, many observers believed that North Korea was finally moving to end its isolated, outlaw status. As the end of 1992 approached, however, delay and obstruction by Pyongyang became intense as accumulating evidence suggested that the DPRK, in violation of the nuclear Non-Proliferation Treaty (NPT), was seeking to develop nuclear weapons. On March 12, 1993, North Korea announced that it would not accept additional inspections proposed by the International Atomic Energy Agency (IAEA) to resolve concerns about possible violations and instead would withdraw from the Treaty. Pyongyang`s action raised the specter that, instead of a last act of the Cold War, North Korea`s diplomatic maneuvering would unravel the international norms that were to be the basis of stability and peace in the post-Cold War era. Indeed, the discovery that North Korea was approaching the capability to produce nuclear weapons suggested that the nuclear threat, which had been successfully managed throughout the Cold War era, could increase in the post-Cold War era.

Lehman, R.F. II



16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel


The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta


Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip...


Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...


Paradoxical Republics: Tropes of Civic Longing in Postcolonial Caribbean Writing  

E-Print Network [OSTI]

Longing in Postcolonial Caribbean Writing By Luis Ramos ALonging in Postcolonial Caribbean Writing by Luis Ramoscorrespondence between Caribbean realities and a European

Ramos, Luis



The cultural politics of Evangelical Christianity in the Dominican Republic  

E-Print Network [OSTI]

and the Struggle for Hispaniola. New York: Hill and Wang.Historically, the island of Hispaniola has relied on the

Thornton, Brendan Jamal



200 Years of Pb Deposition throughout the Czech Republic  

E-Print Network [OSTI]

of the most air-polluted countries in the world (3-5). Although coal mining in northern Bohemia began in the 1860s, considerable air pollution began in 1945 with use of lignite coal for energy production susceptibility determinations, wewereabletoidentifypastperiodsofelevatedPbdeposition related to local mining

Wieder, R. Kelman


Household scale slow sand filtration in the Dominican Republic  

E-Print Network [OSTI]

Slow sand filtration is a method of water treatment that has been used for hundreds of years. In the past two decades, there has been resurgence in interest in slow sand filtration, particularly as a low-cost, household-scale ...

Donison, Kori S. (Kori Shay), 1981-



An Energy Overview of the Republic of Azerbaijan  

SciTech Connect (OSTI)

The DOE Office of Fossil Energy had maintained a web site that was meant to provide useful business- and energy-related information about countries and regions of the world for exporters, project developers, and researchers. The site consisted of more than 130 country pages (organized into seven different world regions), with each country page having its own set of links to information sources about that country. There were also more than 30 Country Energy Overviews at the web site -- each of these was a comprehensive review of a specific country's entire energy situation, including sections on Energy Policy, Oil, Natural Gas, Coal, Hydroelectric/Renewables, Nuclear Power, Energy Transmission Infrastructure, Electricity, Electric Industry Overview, Environmental Activities, Privatization, Trade, and Economic Situation. The specific country highlighted in this Country Energy Overview is Azerbaijan.




Democratic Republic of Congo-Low Emission Capacity Building Programme...  

Open Energy Info (EERE)

area in Africa, making it a carbon sink of estimated 140Gt CO2, and has large hydroelectric potential of 100,000 megawatts, of which so far 2.5% is used. The population is 72...


Democratic Republic of Congo-National Adaptation Plan Global...  

Open Energy Info (EERE)

that the NAP could build on Vision 2035 and that the NAP-GSP could help identify political entry-points for long term adaptation planning through Vision 2015. DRC are keen for...


Dominican Republic-Fast-Track Development of TransformativeClimate...  

Open Energy Info (EERE)

Finally, an additional goal is to return the experiences made to the international political level." References "Fast-Track Development of Transformative Climate-Compatible...


SIAM UK and Republic of Ireland section annual meeting 2007  

E-Print Network [OSTI]

flow in buildings, a subject with huge implications in energy efficient design. Some examples of zero


National Assembly of the Republic of Slovenia Subiceva ulica 4  

E-Print Network [OSTI]

is that most CO2 emitted by burning fossil fuels stays in the surface carbon/climate system for millennia. Oil, which is used in ways that prohibit practical CO2 capture, has reserves sufficient to take global climate to the danger zone. Coal, with larger reserves, has the potential to destroy life on our planet

Hansen, James E.


Republic of Congo-Nationally Appropriate Mitigation Actions ...  

Open Energy Info (EERE)

Congo Basin AgencyCompany Organization Environment Canada, International Institute for Sustainable Development (IISD) Sector Climate, Energy, Land, Water Focus Area...


Republic of Macedonia-Enhancing Capacity for Low Emission Development...  

Open Energy Info (EERE)

initiative to support developing countries' efforts to pursue long-term, transformative development and accelerate sustainable, climate-resilient economic growth while slowing...


Central African Republic-Nationally Appropriate Mitigation Actions...  

Open Energy Info (EERE)

Congo Basin AgencyCompany Organization Environment Canada, International Institute for Sustainable Development (IISD) Sector Climate, Energy, Land, Water Focus Area...

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


United States and Czech Republic Establish a Joint Civil Nuclear...  

Broader source: Energy.gov (indexed) [DOE]

collaboration with the Center, including R&D workshops, seminars, training activities and academic exchanges. This funding will be supplemented by contributions from the Czech...


An Energy Overview of the Republic of Kazakhstan  

SciTech Connect (OSTI)

The DOE Office of Fossil Energy is maintaining a web site that is meant to provide useful business- and energy-related information about countries and regions of the world for exporters, project developers, and researchers. The site consists of more than 130 country pages (organized into seven different world regions), with each country page having its own set of links to information sources about that country. There are also more than 30 Country Energy Overviews at the web site -- each of these is a comprehensive review of a specific country's entire energy situation, including sections on Energy Policy, Oil, Natural Gas, Coal, Hydroelectric/Renewables, Nuclear Power, Energy Transmission Infrastructure, Electricity, Electric Industry Overview, Environmental Activities, Privatization, Trade, and Economic Situation. The specific country highlighted in this Country Energy Overview is Kazakhstan. The site is designed to be dynamic. Updates to the overviews will be made as need and resources permit.





E-Print Network [OSTI]

of Desk research Market analysis Data analysis #12; Business model development Communication activities in companies and institutions, as well as in efficient support of developing an approachable have been awarded and received support from regional, national or European financial resources

Robbiano, Lorenzo


argentine republic analysis: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ar entina (Washington U. S. Oovernamnt Printing Office, 1945), 44, The inportancs to Argentina of foreign nsrkets for its export products did not prevent the developnent, in the...



E-Print Network [OSTI]

I am confident that in this dynamic new era of the African Renaissance and in the spirit of the World Summit on Sustainable Development, hosted by South Africa (2002), we shall see Renewable Energy taking its rightful place in the South African Energy Sector and playing a significant role in contributing towards sustainable development. The repercussions of a growing local renewable energy industry will be felt throughout the African Continent and the SADC region with the breakdown of trade barriers and the move towards a common policy, a move that will encourage competition and lower costs. The world is facing the challenge of harnessing the earths resources effectively and efficiently. There is still a vast dependence on fossil fuels, and the use of this energy source is common to both developing and developed countries. It is well known that the excessive burning of fossil fuels does not go without a price as they release large amounts of carbon dioxide into the atmosphere. Air pollution from using fuelwood unsustainably is still a familiar sight in developing countries, where women and children are the most affected. Research has indicated that one of the highest causes of infant mortality is from acute respiratory illness associated with the

White Paper


Energy Efficiency Country Study: Republic Of South Africa  

E-Print Network [OSTI]

the Free Basic Electricity (FBE) program as explained inalso benefit from the Free Basic Electricity (FBE) program.FBE is part of a government social welfare policy that has

Can, Stephane de la Rue du



Diversification of the Republic: Cultural Diversity in Contemporary France  

E-Print Network [OSTI]

to broad- cast their message to the inchoate French nationbroad terms, then, what I propose for further consideration is whether or not the focus of the FrenchFrench nation was formed and reformed over time (in light of coloni- zation and decolonization, for instance), but the broad

Rosas, Alexander Steven



Dominican Republic-Designing and Communicating Low Carbon Energy...  

Open Energy Info (EERE)

measures in place or planned Analysis of additional efficiency opportunities 3. Technology Assessment Assess current status of renewable energy deployment. Provide...


Democratic Republic of Congo-Low Emission Capacity Building Programme...  

Open Energy Info (EERE)

Programme (UNDP), German Federal Ministry for the Environment, Nature Conservation and Nuclear Safety (BMU), Australian Department of Climate Change and Energy Efficiency...


Mr Jacques Chirac President of the French Republic  

E-Print Network [OSTI]

will also open up new prospects for many sectors in the high-tech industries, public works and engineering for its scientific ambition: to harness the sun's power to take up the challenge of ecological energy warming call for a revolution in our methods of production and consumption. It is our duty to undertake


Radioactive waste management strategy in the Republic of Croatia  

SciTech Connect (OSTI)

Environmental preservation and human health protection have been proclaimed by the Croatian Government as priority actions. Hence, all organized actions toward this aim are expected to be supported by the State. Radioactive waste management plays a significant role in controlling materials that could harm the environment. Strategy in handling radioactive wastes is a prerequisite for well-organized radwaste management. It should be applied to all radioactive wastes that have already been produced in various industries, medical institutions, and scientific laboratories. Additionally, radioactive wastes that are being generated in the Krsko NPP must not be neglected, as well as possible future nuclear program needs in Croatia. For all considered actions, world-wide experiences and safety requirements should be strictly respected.

Subasic, D.; Saler, A.; Skanata, D. [Javno poduzece za zbrinjavanje radioaktivnog otpada, Zagreb (Croatia)



Conceptual approach to radioactive waste management in Czech Republic  

SciTech Connect (OSTI)

The need, initiation and commencing of work on the creation of the Czech national policy and strategy of radioactive waste management is presented in this paper. The main steps of the national concept are defined in agreement with the worldwide approved approach, keeping the goal to reach all international standards in radioactive waste management. The description of the financial expenses of radwaste activities is also briefly discussed.

Marek, J. [Ministry of Industry and Trade of the Czech Republic, Prague (Czech Republic)



Energy Efficiency Country Study: Republic Of South Africa  

E-Print Network [OSTI]

TARGET APPLIANCE Solar Water Heater (low and high pressure)content/solar-water-heaters-save- electricity-south-africaOffer Program SWH Solar Water Heater F IGURES F IGURE 1. E

Can, Stephane de la Rue du



Energy Efficiency Country Study: Republic Of South Africa  

E-Print Network [OSTI]

Time of Use Tariff.cooking services. TIME OF USE TARIFF The highest peak loadEskom, n.s. ) Time of Use (TOU) tariffs were introduced

Can, Stephane de la Rue du



Republic of Macedonia-Enhancing Capacity for Low Emission Development  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to:CoStrategies (EC-LEDS) | Open Energy


Democratic Republic of Congo-Low Emission Capacity Building Programme  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park,DellProgramme (LECBP) | Open


Democratic Republic of Congo-National Adaptation Plan Global Support  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park,DellProgramme (LECBP) | OpenProgramme


Democratic Republic of Congo-Nationally Appropriate Mitigation Actions  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park,DellProgramme (LECBP) |


Democratic Republic of Congo: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1 No38e4011f618bDeer Park,DellProgramme (LECBP) |(Redirected


Dominican Republic-Climate Change Mitigation and Agriculture in Latin  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump to:52c8ff988c1DeringDolgeville, New York: EnergyAmerica and the Caribbean |

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Village of Republic, Ohio (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformation UCOpenVerona,Hampton Place:Plymouth Place: Ohio


SIAM UK and Republic of Ireland section annual meeting 2009  

E-Print Network [OSTI]

that the formation of drumlins occurs through and instability associated with the flow of ice over a wet deformable version of the model may be solved numerically to produce two-dimensional wave forms with the properties


Energy Efficiency Country Study: Republic Of South Africa  

E-Print Network [OSTI]

TECHNOLOGY ..UBLISHED S TANDARD O FFER TECHNOLOGY CATEGORY RATES IN R M /of Best Available Technology. Makonese, T. , Kimemia, D. , &

Can, Stephane de la Rue du



Republic of Iraq - Ministry of Oil | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende New EnergyAnatolia Jump to:ToolkitRenovalia Energy Jump


Wind Energy Resource Atlas of the Dominican Republic  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun DengWISP SignInWhoWillistonWEFOctober 2001 *


MOED_of_the_Italian_Republic.PDF | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department of Energy Low-Temperature CombustionGlass MECS-8,2011 MISO


Togolese Republic-Climate Technology Initiative Private Financing Advisory  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTaguspark JumpDetective: Terminology andInformationTocardoNetwork


USAID-Central Asian Republics Climate Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTagusparkCalculator Jump to: navigation, search Tool


Central African Republic-Nationally Appropriate Mitigation Actions (NAMAs)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarreis aCallahanWindSyracuse, NYCedarCAPS JumpForestryin the


Central African Republic: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarreis aCallahanWindSyracuse, NYCedarCAPS JumpForestryin


NNSA helps train first responders in Czech Republic | National Nuclear  

National Nuclear Security Administration (NNSA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartmentNational Nuclearhas 'Natitude' | National Nuclear Security Administration


Republic of Yemen Energy Access Project | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia Blue Ridge AndREII Jump to:RFSLOpenRenvilleRepublicof Yemen


Republic of the Congo: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to: navigation, searchVirginia Blue Ridge AndREII Jump to:RFSLOpenRenvilleRepublicof


Democratic Republic of Congo-Low Emission Capacity Building Programme  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has beenFinancial IncentiveEnergy(LECBP) | Open


Democratic Republic of Congo: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has beenFinancial IncentiveEnergy(LECBP) |


Dominican Republic-Designing and Communicating Low Carbon Energy Roadmaps  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSixfor Small Island


Dominican Republic-The Mitigation Action Implementation Network (MAIN) |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSixfor Small


Port Republic, New Jersey: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:Plug Power Inc Jump to:Venture,149.PopeNew Jersey:


United States and Czech Republic Establish a Joint Civil Nuclear  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of EnergyofProject is on Track| DepartmentPinakin2 DOEDepartmentCooperation


United States and Czech Republic Join Together to Announce Bilateral  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of EnergyofProject is on Track| DepartmentPinakin2

Note: This page contains sample records for the topic "korea republic zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


United States and Czech Republic Join Together to Announce Bilateral  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' Research Petroleum ReserveDepartment ofEnergy, Office of


Democratic Republic of Congo-REDD Programme | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The following text09-0018-CXBasin JumpTexasProgramme Partner


Dominican Republic-Fast-Track Development of Transformative  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirect Energy


Dominican Republic-OAS Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirect EnergyOrganization of American States (OAS)


EWIS European wind integration study (Smart Grid Project) (Czech Republic)  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen EnergyOpenInformation| Open


Central African Republic-National Adaptation Plan Global Support Programme  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuoCatalyst Renewables JumpView formDemonstration


Energy Efficiency Country Study: Republic Of South Africa  

E-Print Network [OSTI]

electricity production in South Africa relies heavily onwith about 94% of South Africas electricity generationMarquard, A. (2008). South Africas rapid electrification

Can, Stephane de la Rue du



Markets for coal and coal technologies in Asian and Pacific Basin countries  

SciTech Connect (OSTI)

In a new market analysis available from the Utility Data Institute (UDI), Viking Systems International (VSI) of Pittsburgh, PA, argues that the nations in the Pacific Basin and South Asia provide an exciting market opportunity for vendors and suppliers of coal power technology, services, and fuel. Critical market factors for increased coal use include: (1) availability of domestic coal resources; (2) price of competing fuels; (3) infrastructure for mining and transportation; (4) environmental regulations concerning coal use; and (5) the development and application of new coal technologies. An overview is presented of the current energy situation and future development options in thirteen different countries: Afghanistan, Australia, India, Indonesia, Japan, Malaysia, New Zealand, Pakistan, People's Republic of China, Philippines, Republic of China (Taiwan), Republic of Korea (South Korea), and Thailand. More than 150 detailed tables, charts, and maps present analyses of existing coal reserves, coal characteristics, domestic energy production by fuel mix, energy consumption, electric power generation, and regulatory practices in each country. The report was developed by VSI from two computerized data bases---one on coal characteristics and reserves, the other on electric utilities and power plants in Asian countries. A chapter in the report describes the data bases in more detail.

Not Available



Thin Film Receiver Materials for Deterministic Assembly by Transfer Tae-il Kim,*,  

E-Print Network [OSTI]

, Sungkyunkwan University (SKKU), Suwon 440-746, Korea R&I Korea, Solvay Special Chemicals, Solvay Korea Co. LTD

Rogers, John A.


Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren


Design and Implementation of an International Training Program on Repository Development and Management  

SciTech Connect (OSTI)

Korea Hydro and Nuclear Power Co., Ltd. (KHNP) is an electric company in the Republic of Korea with twenty operational nuclear power plants and eight additional units that are either planned or currently under construction. Regulations require that KHNP manage the radioactive waste generated by their nuclear power plants. In the course of planning low, intermediate, and high level waste storage facilities, KHNP sought interaction with an acknowledged expert in the field of radioactive waste management and, consequently, contacted Sandia National Laboratories (SNL). KHNP has contracted with SNL to provide a year long training program on repository science. This paper discusses the design of the curriculum, specific plans for execution of the training program, and recommendations for smooth implementation of international training programs. (authors)

Vugrin, K.W. [Sandia National Laboratories Carlsbad Programs Group, Performance Assessment and Decision Analysis Department, Carlsbad, NM (United States); Twitchell, Ch.A. [Sandia National Laboratories, Carlsbad Programs Group, Center Business Operations Department, Carlsbad, NM (United States)



A Technology Roadmap for Generation IV Nuclear Energy Systems Executive Summary  

SciTech Connect (OSTI)

To meet future energy needs, ten countries--Argentina, Brazil, Canada, France, Japan, the Republic of Korea, the Republic of South Africa, Switzerland, the United Kingdom, and the United States--have agreed on a framework for international cooperation in research for an advanced generation of nuclear energy systems, known as Generation IV. These ten countries have joined together to form the Generation IV International Forum (GIF) to develop future-generation nuclear energy systems that can be licensed, constructed, and operated in a manner that will provide competitively priced and reliable energy products while satisfactorily addressing nuclear safety, waste, proliferation, and public perception concerns. The objective for Generation IV nuclear energy systems is to be available for international deployment before the year 2030, when many of the world's currently operating nuclear power plants will be at or near the end of their operating licenses.




Proceedings: 2002 EPRI International Low Level Waste Conference  

SciTech Connect (OSTI)

Nuclear utilities are continually evaluating methods to improve operations and minimize cost. EPRI's 11th annual International Low Level Waste (LLW) Conference--coupled with the 25th annual Radwaste Workshop cosponsored by the American Society of Mechanical Engineers (ASME) and EPRI--offered valuable insights into this effort. Industry representatives presented papers covering new or improved technology developed worldwide for LLW management, processing, shipment, disposal, and regulation. This year, in collaboration with the International Atomic Energy Agency (IAEA), foreign participation increased, with papers from Canada, Korea, Germany, Finland, Ukraine, Belgium, the Slovak Republic, and the United Kingdom expanding the conference scope.




rho(0) photoproduction in ultraperipheral relativistic heavy ion collisions at root s(NN)=200 GeV  

E-Print Network [OSTI]

Purdue University, West Lafayette, Indiana 47907, USA 36Pusan National University, Pusan, Republic of Korea 37University of Rajasthan, Jaipur 302004, India 38Rice University, Houston, Texas 77251, USA 39Universidade de Sao Paulo, Sao Paulo, Brazil 40... no neutrons are detected in either ZDC. The last two modes are only accessible with the topology trigger. A typical ZDC spectrum is shown in Fig. 2. In the west ZDC, the ratio of 1n : 2n : 3n is 1 : 0.48? 0.07 : 0.42? 0.04, whereas in the east ZDC, we find...

Abelev, B. I.; Aggarwal, M. M.; Ahammed, Z.; Anderson, B. D.; Arkhipkin, D.; Averichev, G. S.; Bai, Y.; Balewski, J.; Barannikova, O.; Barnby, L. S.; Baudot, J.; Baumgart, S.; Beavis, D. R.; Bellwied, R.; Benedosso, F.; Betts, R. R.; Bhardwaj, S.; Bhasin, A.; Bhati, A. K.; Bichsel, H.; Bielcik, J.; Bielcikova, J.; Bland, L. C.; Blyth, S. -L; Bombara, M.; Bonner, B. E.; Botje, M.; Bouchet, J.; Braidot, E.; Brandin, A. V.; Bueltmann, S.; Burton, T. P.; Bystersky, M.; Cai, X. Z.; Caines, H.; Sanchez, M. Calderon de la Barca; Callner, J.; Catu, O.; Cebra, D.; Cervantes, M. C.; Chajecki, Z.; Chaloupka, P.; Chattopadhyay, S.; Chen, H. F.; Chen, J. H.; Chen, J. Y.; Cheng, J.; Cherney, M.; Chikanian, A.; Choi, K. E.; Christie, W.; Chung, S. U.; Clarke, R. F.; Codrington, M. J. M.; Coffin, J. P.; Cormier, T. M.; Cosentino, M. R.; Cramer, J. G.; Crawford, H. J.; Das, D.; Dash, S.; Daugherity, M.; de Moura, M. M.; Dedovich, T. G.; DePhillips, M.; Derevschikov, A. A.; de Souza, R. Derradi; Didenko, L.; Dietel, T.; Djawotho, P.; Dogra, S. M.; Dong, X.; Drachenberg, J. L.; Draper, J. E.; Du, F.; Dunlop, J. C.; Mazumdar, M. R. Dutta; Edwards, W. R.; Efimov, L. G.; Elhalhuli, E.; Emelianov, V.; Engelage, J.; Eppley, G.; Erazmus, B.; Estienne, M.; Eun, L.; Fachini, P.; Fatemi, R.; Fedorisin, J.; Feng, A.; Filip, P.; Finch, E.; Fine, V.; Fisyak, Y.; Fu, J.; Gagliardi, Carl A.; Gaillard, L.; Ganti, M. S.; Garcia-Solis, E.; Ghazikhanian, V.; Ghosh, P.; Gorbunov, Y. N.; Gordon, A.; Grebenyuk, O.; Grosnick, D.; Grube, B.; Guertin, S. M.; Guimaraes, K. S. F. F.; Gupta, A.; Gupta, N.; Guryn, W.; Haag, B.; Hallman, T. J.; Hamed, A.; Harris, J. W.; He, W.; Heinz, M.; Henry, T. W.; Hepplemann, S.; Hippolyte, B.; Hirsch, A.; Hjort, E.; Hoffman, A. M.; Hoffmann, G. W.; Hofman, D. J.; Hollis, R. S.; Horner, M. J.; Huang, H. Z.; Hughes, E. W.; Humanic, T. J.; Igo, G.; Iordanova, A.; Jacobs, P.; Jacobs, W. W.; Jakl, P.; Jin, F.; Jones, P. G.; Judd, E. G.; Kabana, S.; Kajimoto, K.; Kang, K.; Kapitan, J.; Kaplan, M.; Keane, D.; Kechechyan, A.; Kettler, D.; Khodyrev, V. Yu; Kiryluk, J.; Kisiel, A.; Klein, S. R.; Knospe, A. G.; Kocoloski, A.; Koetke, D. D.; Kollegger, T.; Kopytine, M.; Kotchenda, L.; Kouchpil, V.; Kowalik, K. L.; Kravtsov, P.; Kravtsov, V. I.; Krueger, K.; Kuhn, C.; Kumar, A.; Kurnadi, P.; Lamont, M. A. C.; Landgraf, J. M.; Lange, S.; LaPointe, S.; Laue, F.; Lauret, J.; Lebedev, A.; Lednicky, R.; Lee, C. -H; LeVine, M. J.; Li, C.; Li, Q.; Li, Y.; Lin, G.; Lin, X.; Lindenbaum, S. J.; Lisa, M. A.; Liu, F.; Liu, H.; Liu, J.; Liu, L.; Ljubicic, T.; Llope, W. J.; Longacre, R. S.; Love, W. A.; Lu, Y.; Ludlam, T.; Lynn, D.; Ma, G. L.; Ma, J. G.; Ma, Y. G.; Mahapatra, D. P.; Majka, R.; Mangotra, L. K.; Manweiler, R.; Margetis, S.; Markert, C.; Matis, H. S.; Matulenko, Yu A.; McShane, T. S.; Meschanin, A.; Millane, J.; Miller, M. L.; Minaev, N. G.; Mioduszewski, Saskia; Mischke, A.; Mitchell, J.; Mohanty, B.; Morozov, D. A.; Munhoz, M. G.; Nandi, B. K.; Nattrass, C.; Nayak, T. K.; Nelson, J. M.; Nepali, C.; Netrakanti, P. K.; Ng, M. J.; Nogach, L. V.; Nurushev, S. B.; Odyniec, G.; Ogawa, A.; Okada, H.; Okorokov, V.; Olson, D.; Pachr, M.; Pal, S. K.; Panebratsev, Y.; Pavlinov, A. I.; Pawlak, T.; Peitzmann, T.; Perevoztchikov, V.; Perkins, C.; Peryt, W.; Phatak, S. C.; Planinic, M.; Pluta, J.; Poljak, N.; Porile, N.; Poskanzer, A. M.; Potekhin, M.; Potukuchi, B. V. K. S.; Prindle, D.; Pruneau, C.; Pruthi, N. K.; Putschke, J.; Qattan, I. A.; Raniwala, R.; Raniwala, S.; Ray, R. L.; Relyea, D.; Ridiger, A.; Ritter, H. G.; Roberts, J. B.; Rogachevskiy, O. V.; Romero, J. L.; Rose, A.; Roy, C.; Ruan, L.; Russcher, M. J.; Rykov, V.; Sahoo, R.; Sakrejda, I.; Sakuma, T.; Salur, S.; Sandweiss, J.; Sarsour, M.; Schambach, J.; Scharenberg, R. P.; Schmitz, N.; Seger, J.; Selyuzhenkov, I.; Seyboth, P.; Shabetai, A.; Shahaliev, E.; Shao, M.; Sharma, M.; Shi, X. -H; Sichtermann, E. P.; Simon, F.; Singaraju, R. N.; Skoby, M. J.; Smirnov, N.; Snellings, R.; Sorensen, P.; Sowinski, J.; Speltz, J.; Spinka, H. M.; Srivastava, B.; Stadnik, A.; Stanislaus, T. D. S.; Staszak, D.; Stock, R.; Strikhanov, M.; Stringfellow, B.; Suaide, A. A. P.; Suarez, M. C.; Subba, N. L.; Sumbera, M.; Sun, X. M.; Sun, Z.; Surrow, B.; Symons, T. J. M.; de Toledo, A. Szanto; Takahashi, J.; Tang, A. H.; Tang, Z.; Tarnowsky, T.; Thein, D.; Thomas, J. H.; Tian, J.; Timmins, A. R.; Timoshenko, S.; Tokarev, M.; Trainor, T. A.; Tram, V. N.; Trattner, A. L.; Trentalange, S.; Tribble, Robert E.; Tsai, O. D.; Ulery, J.; Ullrich, T.; Underwood, D. G.; Van Buren, G.; van der Kolk, N.; van Leeuwen, M.; Molen, A. M. Vander; Varma, R.; Vasconcelos, G. M. S.; Vasilevski, I. M.; Vasiliev, A. N.; Vernet, R.; Videbaek, F.; Vigdor, S. E.; Viyogi, Y. P.; Vokal, S.



Conservation Genetics of the Philippine Tarsier: Cryptic Genetic Variation Restructures Conservation Priorities for an Island Archipelago Primate  

E-Print Network [OSTI]

, Melizar V. Duya4, Myron Shekelle5, Irene Neri-Arboleda6, Jacob A. Esselstyn7, Nathaniel J. Dominy8, Perry S. Ong9, Gillian L. Moritz10, Adrian Luczon9, Mae Lowe L. Diesmos11, Arvin C. Diesmos12, Cameron D. Siler13 1 Biodiversity Institute and Department..., Quezon City, Philippines, 4Diliman Science Research Foundation Inc., University of the Philippines Diliman, Quezon City, Philippines, 5 Research Institute of EcoScience, Ewha Womans University, Seoul, Republic of Korea, 6 Thomas Glen Erin Animal Hospital...

Brown, Rafe M.; Weghorst, Jennifer A.; Olson, Karen V.; Duya, Mariano R. M.; Barley, Anthony J.; Duya, Malizar V.; Shekelle, Myron; Neri-Aboleda, Irene; Esselstyn, Jacob A.; Dominy, Nathaniel J.; Ong, Perry S.; Moritz, Gillian L.; Luczon, Adrian; Diesmos, Mae Lowe L.; Diesmos, Arvin C.; Siler, Cameron D.



U.S.-Africa Energy Ministerial Co-Chairs' Summary from Energy...  

Office of Environmental Management (EM)

Republic of the Gambia, the Republic of Ghana, the Republic of Guinea, the Republic of Kenya, the Kingdom of Lesotho, the Republic of Liberia, Libya, the Republic of Malawi, the...


IPIRG-2 task 1 - pipe system experiments with circumferential cracks in straight-pipe locations. Final report, September 1991--November 1995  

SciTech Connect (OSTI)

This report presents the results from Task 1 of the Second International Piping Integrity Research Group (IPIRG-2) program. The IPIRG-2 program is an international group program managed by the US Nuclear Regulatory Commission (US NRC) and funded by a consortium of organizations from 15 nations including: Bulgaria, Canada, Czech Republic, France, Hungary, Italy, Japan, Republic of Korea, Lithuania, Republic of China, Slovak Republic, Sweden, Switzerland, the United Kingdom, and the United States. The objective of the program was to build on the results of the IPIRG-1 and other related programs by extending the state-of-the-art in pipe fracture technology through the development of data needed to verify engineering methods for assessing the integrity of nuclear power plant piping systems that contain defects. The IPIRG-2 program included five main tasks: Task 1 - Pipe System Experiments with Flaws in Straight Pipe and Welds Task 2 - Fracture of Flawed Fittings Task 3 - Cyclic and Dynamic Load Effects on Fracture Toughness Task 4 - Resolution of Issues From IPIRG-1 and Related Programs Task 5 - Information Exchange Seminars and Workshops, and Program Management. The scope of this report is to present the results from the experiments and analyses associated with Task 1 (Pipe System Experiments with Flaws in Straight Pipe and Welds). The rationale and objectives of this task are discussed after a brief review of experimental data which existed after the IPIRG-1 program.

Scott, P.; Olson, R.; Marschall, C.; Rudland, D. [and others



E-Print Network 3.0 - arab jamahiriya madagascar Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

--Uf- DO Dominican Republic ----- TP East Timor -Iu-- EC Ecuador (Republic of) bIU-- EG Egypt (Arab... -- MG Madagascar (Democratic Republic of) ---f- MW Malawi (Republic of) ......


Study of quality assurance regulations for linear accelerators in Korea: A comparison study between the current status in Korea and the international guidelines  

E-Print Network [OSTI]

Quality assurance (QA) for medical linear accelerators is indispensable for appropriate cancer treatment. Some international organizations and western advanced countries provide QA guidelines for linear accelerators. Currently, QA regulations for linear accelerators in Korean hospitals specify a system in which each hospital stipulates its independent hospital-based protocols for QA procedures (HP_QAPs) and conducts QA based on these HP_QAPs while regulatory authorities verify whether items under these HP_QAPs have been performed. However, because this regulatory method cannot guarantee the quality of universal treatment, and QA items with tolerance criteria are different in many hospitals, the presentation of standardized QA items and tolerance criteria is essential. In this study, QA items in HP_QAPs from various hospitals and those presented by international organizations. Concordance rates between QA items for linear accelerators that were presented by the aforementioned organizations and those currently ...

Lee, Hyunho; Jo, Yunhui; Yoon, Myonggeun



Research needs and data acquisition to apply US technology to foreign coals: Quarterly report, January-March 1987  

SciTech Connect (OSTI)

Data on coal characteristics, resources and environmental aspects were gathered previously for India, Pakistan, Indonesia, Malaysia, Philippines, Thailand, Afghanistan and Colombia. The relevant data from the information obtained on these countries was retrieved, summarized and transmitted for inclusion in the PETC coal database. Coal deposits and their locations on national maps were also provided. The data on coal characteristics was stored in a computerized database. Data has now been gathered for the Republic of Korea (South Korea), Australia, and People's Republic of China (China). Data for 104 developing countries was obtained from the World Bank on energy inputs to electric utilities. This data was entered into a computerized database prepared at Viking. The data includes types of fuel input for electricity generation, power plant capacities, total electricity generation, system frequencies, etc. The user can extract information of his/her choice from the database in a spreadsheet format, which can then be interfaced with a graphics software package to obtain a pictorial representation of the data.

Not Available
