Sample records for kingdom zip sw1y

  1. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  2. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  3. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  4. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  5. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  6. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  7. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  8. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  9. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  10. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  11. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  12. Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________

    E-Print Network [OSTI]

    de Lijser, Peter

    on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

  13. Zipping mechanism for force-generation by growing filament bundles

    E-Print Network [OSTI]

    Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld


    We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

  14. ZipZone Technologies | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone


    E-Print Network [OSTI]

    Weaver, Benjamin Patrick


    The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

  16. Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along

    E-Print Network [OSTI]

    VanRullen, Rufin

    Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips


    E-Print Network [OSTI]

    NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

  18. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

  19. Protein folding by zipping and assembly S. Banu Ozkan*

    E-Print Network [OSTI]

    Southern California, University of

    Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

  20. Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP

    E-Print Network [OSTI]

    Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

  1. Property:Incentive/Cont2Zip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

  2. Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory

    E-Print Network [OSTI]

    Helmstetter, Fred J.

    Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

  3. SUNY Programs: The United Kingdom

    E-Print Network [OSTI]

    Suzuki, Masatsugu

    SUNY Programs: The United Kingdom & Ireland Semester, Academic Year and Short Term #12;1 Table of Contents How to Use This Booklet 1 Choosing a Program in the UK and Ireland 2 Exchange versus Study Abroad 3 Semester & Academic Year Programs 4 Programs in London 4 Programs outside of London 7 Programs

  4. Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code

    E-Print Network [OSTI]

    Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

  5. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom


    E-Print Network [OSTI]

    Ohta, Shigemi

    86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

  10. Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP

    E-Print Network [OSTI]

    Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

  11. United Kingdom HEU Removal | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    HEU Removal United Kingdom HEU Removal Location United Kingdom United States 52 24' 15.1416" N, 1 34' 55.3116" W See map: Google Maps Javascript is required to view this map...

  12. Oil and Gas Company Oil and Gas Company Address Place Zip Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

  13. Chromista is a major eukaryotic kingdom comprising algae and former protozoa that is evolutionarily entirely distinct from the kingdoms Plantae and Protozoa (Cavalier-Smith 2007). Chromist chloroplasts

    E-Print Network [OSTI]

    Goldschmidt, Christina

    1 Chromista is a major eukaryotic kingdom comprising algae and former protozoa chloroplasts were acquired secondarily by enslavement of a red alga, itself a member of kingdom Plantae

  14. 2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.

    E-Print Network [OSTI]

    Daniels, Jeffrey J.

    Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

  15. Good Energies (United Kingdom) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place: Golden, CO Website:Panhandle WindEnergiesKingdom)

  16. Aggregate model and analysis of the energy dynamics in the Kingdom of Saudi Arabia

    E-Print Network [OSTI]

    Al-Ahmed, Khalid A. (Khalid Abdulrahim)


    The Kingdom of Saudi Arabia is facing a crisis in the near future centered on increasing energy consumption. Today, the kingdom consumes approximately 1/3 of its oil production. If no action is taken and the kingdom continues ...

  17. Kingdom of Saudi Arabia Assessment of Rainfall Augmentation

    E-Print Network [OSTI]

    Delene, David J.

    Submitted to The Presidency of Meteorology and Environment (PME) Kingdom of Saudi Arabia Through WeatherKingdom of Saudi Arabia Assessment of Rainfall Augmentation 2009 Spring Field Season Final Report performance was very good during the spring 2009 IOP conducted in Riyadh, Saudi Arabia. Very good instrument

  18. Use of the Internet among dermatologists in the United Kingdom, Sweden and Norway

    E-Print Network [OSTI]

    Gjersvik, Petter Jensen; Nylenna, Magne; Aasland, Olaf Gjerlřw


    Denmark, Iceland, and Norway, 2000. [In Swedish]. 9.United Kingdom, Sweden and Norway Petter Jensen Gjersvik 1Kingdom, Sweden, and Norway. Six hundred fifty-three (51%)

  19. E-Print Network 3.0 - ancient peruvian kingdom Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    art... ancient Marawi. The Nubian kingdoms straddling the southern third of modern Egypt and the northern third... LOST KINGDOMS OF THE NILE, FOUND --...

  20. Expedient benevolence : international development and the United Kingdom

    E-Print Network [OSTI]

    Pandit, Ninad (Ninad Ravindra)


    This thesis examines the role of International Development in the United Kingdom during its transition from a colonial ruler to a neo-liberal capitalist state. Starting with the inter-war period, it looks at the changing ...

  1. CANADA RUSSIA UNITED KINGDOM UNITED STATES Building / Launching / Operating first ever high definition,

    E-Print Network [OSTI]

    1 CANADA · RUSSIA · UNITED KINGDOM · UNITED STATES 1 #12;2 Building / Launching / Operating first

  2. Renewable Energy Scenarios for the Kingdom of Saudi Arabia

    E-Print Network [OSTI]

    Watson, Andrew

    Renewable Energy Scenarios for the Kingdom of Saudi Arabia Yasser Al-Saleh, Paul Upham and Khaleel Malik October 2008 Tyndall Centre for Climate Change Research Working Paper 125 #12;Renewable Energy compromising those of future generations. Renewable energy technologies, in particular, are becoming

  3. A comparison of the progression on sustainable procurement between England and Scotland following the United Kingdom’s third sustainable development strategy.

    E-Print Network [OSTI]

    Woodward, Caitlin


    ??In 2005, the United Kingdom published its third sustainable development strategy and simultaneously announced its goal to become a leader in the European Union on… (more)

  4. Brighton, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHISBrickyard Energy PartnersUnited Kingdom: Energy

  5. Brighton, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHISBrickyard Energy PartnersUnited Kingdom:

  6. A comparison of the progression on sustainable procurement between England and Scotland following the United Kingdom’s third sustainable development strategy 

    E-Print Network [OSTI]

    Woodward, Caitlin

    In 2005, the United Kingdom published its third sustainable development strategy and simultaneously announced its goal to become a leader in the European Union on sustainable procurement by 2009. Four sustainable development priorities and six key...

  7. Institutionnal dynamics and barriers to sustainable construction in France, the United Kingdom and the

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    resources in sustainable urban design and sustainable building design. In Britain, a broader agenda has beenInstitutionnal dynamics and barriers to sustainable construction in France, the United Kingdom). Institutionnal dynamics and barriers to sustainable construction in France, the United Kingdom


    E-Print Network [OSTI]

    Applebaum, David


  9. All fired-up about coal : technology & policy recommendations for the 2030 United Kingdom energy strategy

    E-Print Network [OSTI]

    Donnelly, Kathy A. (Kathy Ann)


    Given United Kingdom (UK) carbon dioxide emissions policies that direct attention at the electricity segment, the focus is on the largest electricity polluter, coal, and the immediately pressing issue of UK coal policy. ...

  10. "Auto"-mobile Beijing : a bicycle network for a renewed "bicycle kingdom"

    E-Print Network [OSTI]

    Liau, August


    This thesis intends to be a catalyst for a renewed bicycle culture in Beijing, the capital of the former "Bicycle Kingdom". Beijing, only 15 years ago had more bicycles than any other city in the world, has in recent years ...

  11. Inter-kingdom Recognition of Norepinephrine by E. Coli : Identification of the Receptors Involved in Chemotaxis

    E-Print Network [OSTI]

    Kim, Dae Nyun



  12. Very soon now the Kingdom of the Netherlands will undergo an important political change. One of the three countries of the Kingdom, The Netherlands Antilles, will be dissolved. This

    E-Print Network [OSTI]

    van den Brink, Jeroen

    Summary Very soon now the Kingdom of the Netherlands will undergo an important political change. One of the three countries of the Kingdom, The Netherlands Antilles, will be dissolved. This political construction "Netherlands Antilles" ­ in fact nothing more than the compilation of a few leftover Dutch


    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    REFLECTIONS ON THE NOTIONS OF "EMPIRE" AND "KINGDOM" IN SEVENTEENTH-CENTURY ETHIOPIA: ROYAL POWER depuis 2006 le Centre d'études des mondes africains Generally, historians of Ethiopia have remained vague, in his excellent synthesis on "medieval" Ethiopia, chose "kingdom" over "empire."1 Several modern authors

  14. Inter- and Intra-kingdom Signaling in Bacterial Chemotaxis, Biofilm Formation, and Virulence

    E-Print Network [OSTI]

    Hegde, Manjunath


    that the actions of NE are mediated primarily through the LasR, and not the RhlR QS system. We investigated the molecular mechanism underlying the chemo-sensing of the intra-kingdom signal autoinducer-2 (AI-2) by pathogens Escherichia coli and Salmonella...

  15. Judicial review of legislation: Constitutionalism personified in the United Kingdom, the Netherlands and South Africa

    E-Print Network [OSTI]

    van den Brink, Jeroen

    , the Netherlands and South Africa By Gerhard van der Schyff Supervisor: prof. dr. Paul Cliteur Although fast, three systems have been selected for this study, namely those of the United Kingdom, the Netherlands of any threatened violation. The Netherlands has been chosen for its interesting brand of judicial review

  16. Ship of the God: The Amun-Userhet in New Kingdom Egypt

    E-Print Network [OSTI]

    Collier, Megan


    The Amun-Userhet was a ship which played a crucial role in the development of religious thought in New Kingdom Egypt. The pharaoh and his entourage sailed down the Nile on its deck as part of a religious celebration called the Opet festival...

  17. J. Fluid Mech. (1997), vol. 345, pp. 4578. Printed in the United Kingdom c 1997 Cambridge University Press

    E-Print Network [OSTI]

    Texas at Austin. University of

    J. Fluid Mech. (1997), vol. 345, pp. 45­78. Printed in the United Kingdom c 1997 Cambridge-mail: (Received 30 September 1996 and in revised form 4 March 1997) Surface

  18. EA-1123: Transfer of Normal and Low-Enriched Uranium Billets to the United Kingdom, Hanford Site, Richland, Washington

    Broader source: [DOE]

    This EA evaluates the environmental impacts of the proposal to transfer approximately 710,000 kilograms (1,562,000 pounds) of unneeded normal and low-enriched uranium to the United Kingdom; thus,...

  19. A review of "The Stuart Kingdoms in the Seventeenth Century: Awkward Neighbors." by Allan I. Macinnes and Jane Ohlmeyer, eds.

    E-Print Network [OSTI]

    Brett Parker


    Trials, 1794 (1992) and Treason: Famous En- glish Treason Trials (1995). Allan I. Macinnes and Jane Ohlmeyer, eds. The Stuart Kingdoms in the Seventeenth Century: Awkward Neighbors. Dublin: Four Courts Press. 2002. 256 pp. $45.00. Review by BRETT... essays ask what were the cultural perceptions of these king- doms and to what degree were they a product of their shared history. Editors Allan I. Macinnes and Jane Ohlmeyer have cleverly orga- nized Stuart Kingdoms into five sections that relate...

  20. Sustainable Architectural Applications in the Gulf States-Post Occupancy Evaluation Case Study of Kingdom of Saudi Arabia

    E-Print Network [OSTI]

    Ali, H.; Alfalah, G.

    of the assembly tools and the surfaces of sunlight collection (12). Region Winter (December, January, February) Summer (June, July, August) maximum minimum maximum minimum Northern region 15 ? C -3 ? C 38 ? C 23 ? C The Western coastal region... that invite us to stop and review the value of the sustainable architecture in the Kingdom of Saudi Arabia. (3) Above all, the Saudi Government has made great efforts and attempts to support and encourage this design schema in the Kingdom of Saudi...

  1. Name * First Last Address Street Address Address Line 2 City State ...

    E-Print Network [OSTI]

    Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada ...

  2. Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note

    E-Print Network [OSTI]

    de Lijser, Peter

    Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

  3. Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note

    E-Print Network [OSTI]

    de Lijser, Peter

    only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

  4. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings of the 27th Symposium On Fusion Technology

    E-Print Network [OSTI]

    © 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings Torino, Torino, Italy In the ITER equatorial ports containing ICRH antennas, parasitic electrical resonances can be excited in the nominal 20 mm clearance gap between the port walls and the plug contained

  5. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings of the 27th Symposium On Fusion Technology

    E-Print Network [OSTI]

    © 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings Performance stage 2 (EP2) shutdown of JET. This was a demanding and challenging activity which was based to the outside via a feed through located in a main vertical port. #12;The scale and complexity of this project

  6. Biofilms (2004) 1, 239263 C 2005 Cambridge University Press doi:10.1017/S1479050505001596 Printed in the United Kingdom

    E-Print Network [OSTI]

    Jacob, Eshel Ben

    in the United Kingdom REVIEW ARTICLE Bacteria harnessing complexity E. Ben Jacob , Y. Aharonov and Y. Shapira interpretations of chemical cues, exchange of meaning-bearing chemical messages, and dialogues. The meaning context. * Corresponding author: Dr E. Ben Jacob School of Physics and Astronomy Raymond & Beverly Sackler

  7. Unattended system for monitoring skip movement at the Sellafield Facility in the United Kingdom

    SciTech Connect (OSTI)

    Bosler, G.E.; Klosterbuer, S.F.; Johnson, C.S.; Hale, W.R.; Marsh, R.D.; Dickinson, R.J.


    An unattended system for monitoring spent-fuel movement in the storage area of a reprocessing facility has been developed and tested. The system uses radiation detectors to determine when fuel is being moved and a video system to record images of the container movement. In addition to the recorded image, other recorded data include the date and time of the movement and ''fingerprint'' information from the radiation detectors. The direction of motion either into or out of the storage pond is indicated on the video image and on the printed readout. This system was extensively tested at the Sellafield Facility in the United Kingdom. This paper gives the details of the system design and presents results of the field evaluation. 1 ref., 10 figs.

  8. Gatsby Computational Neuroscience Unit 17 Queen Square, London University College London WC1N 3AR, United Kingdom

    E-Print Network [OSTI]

    Welling, Max

    statistics of the data. We may define the energy E of the system at a particular state fv; hg to be, E(v; h, United Kingdom +44 20 7679 1176 Funded in part by the Gatsby Charitable. This eliminates the need to estimate equilibrium statistics, so we do not need to ap­ proximate the multimodal

  9. United Kingdom Carotid Artery Stent Registry: Short- and Long-Term Outcomes

    SciTech Connect (OSTI)

    Goode, S. D., E-mail:; Cleveland, T. J.; Gaines, P. A. [Northern General Hospital, Sheffield Vascular Institute (United Kingdom)] [Northern General Hospital, Sheffield Vascular Institute (United Kingdom)


    Background: Carotid artery stenting (CAS) has evolved to treat carotid artery disease with the intention of prevent stroke. The British Society of Interventional Radiologists developed a voluntary registry to monitor the practice of this novel procedure. We present the data from the United Kingdom (UK) CAS registry for short and long-term outcomes for symptomatic and asymptomatic carotid disease. Methods: The UK CAS registry collected data from 1998 to 2010 from 31 hospitals across the UK for 1,154 patients. All interventions were enrolled in the registry for both asymptomatic and symptomatic patients. Initial entry forms were completed for each patient entered with data including indications, demographic data, CAS data (including stents and protection device details) and 30-day outcomes. Complications were documented. Follow-up data were collected at yearly intervals. Results: Nine hundred fifty-three (83 %) symptomatic and 201 (17 %) asymptomatic patients were enrolled into the registry. The 30-day all stroke and death rates for symptomatic patients were 5.5 and 2.2 % for those with asymptomatic disease. The 30-day mortality rate was 1.7 % for symptomatic and 0.6 % for asymptomatic patients. For symptomatic patients undergoing CAS, the 7-year all-cause mortality rate was 22.2 % and for asymptomatic patients 18.1 %. The 7-year all-cause mortality and disabling stroke rates were 25.3 and 19.4 %, respectively. Conclusion: These data indicate that outside of the tight constraints of a randomised trial, CAS provides effective prophylaxis against stroke and death.

  10. Current Status of the United Kingdom Programme for Long-Term Radioactive Waste Management

    SciTech Connect (OSTI)

    Murray, C. H.; Hooper, A. J.; Mathieson, J.


    In 1997, the UK programme for the deep disposal of radioactive waste was ''stopped dead in its tracks'' with the refusal by the Secretary of State for the Environment to allow Nirex to go ahead with its plans for an underground Rock Characterisation Facility at Sellafield in north-west England. Since that time a House of Lords' Select Committee has held an inquiry into what went wrong and what the way ahead should be. In addition, Nirex and the nuclear industry players have also been analyzing the past with a view to learning from the experience in taking things forward. In Nirex's view this is essentially an ethical issue; the waste exists and we should deal with it in this generation. Three areas need to be better addressed if a successful program of management of the nation's radioactive waste is to be achieved: the process of how policy development and implementation can be achieved; the structure of the nuclear industry and its relationship to the waste management organization; and the behavior of the players in their interaction with stakeholders. All three are underpinned by the need for transparency. In recognition that developing a policy for managing radioactive waste has to be achieved with the support of all stakeholders, the Government instigated a consultation exercise in September 2001. The initial phase of this initiative is essentially a consultation about consultation and is intended to decide on how the next stages of a six year policy development program should be addressed. In addition to this exercise, the Government is undertaking a fundamental review of the structuring of the United Kingdom Atomic Energy Authority (UKAEA) and British Nuclear Fuels plc (BNFL). They are both shareholders in Nirex and in November 2001 the Government announced the setting up of a Liabilities Management Authority (LMA) to manage the long-term nuclear liabilities that are publicly owned, particularly through those organizations. The future of Nirex will be directly influenced by the outcome of these reviews.

  11. FLEGT Asia, Baseline Study 1, China: Overview of Forest Law Enforcement, Governance and Trade, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany, the Netherlands and the United Kingdom.

    E-Print Network [OSTI]

    , June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany of Finland, France, Germany, the Netherlands and the United Kingdom. www

  12. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Fusion Science and Technology, Vol.64, No.2, August 2013,

    E-Print Network [OSTI]

    © 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Fusion Science on the Technology of Fusion Energy (TOFE-2012) (Part 1), Nashville, Tennessee, August 27-31, 2012 Pulsed DEMO design of energy storage issues, and fatigue life improvements in Nb3Sn CICC superconductors. I. BACKGROUND In 2011

  13. J. Child Lang. 29 (2002), 403416. # 2002 Cambridge University Press DOI: 10.1017\\S030500090200510X Printed in the United Kingdom

    E-Print Network [OSTI]

    Chase, Sheila

    , say, Down's syndrome. Note, however, that these are RELATIVE, not absolute advantages. This fact Printed in the United Kingdom NOTE A study of relative clauses in Williams syndrome* JULIA GRANT evidence to the contrary, claims continue to be made that the grammar of people with Williams syndrome (WS

  14. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Journal of Nuclear Materials, Vol.439, Issues 1-3, August

    E-Print Network [OSTI]

    © 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Journal of Nuclear temperatures, reaction path (i) (sinks) dominates and at a high dose rates and/or low irradiation temperature for Fusion Energy (CCFE) Abingdon, Oxfordshire OX14 3DB, UK Name: Christopher Hardie Address: Department

  15. J. Fluid Mech. (2008), vol. 595, pp. 291321. c 2008 Cambridge University Press doi:10.1017/S0022112007009226 Printed in the United Kingdom

    E-Print Network [OSTI]

    Boyer, Edmond

    of parametric instability in a rotating cylinder subject to periodic axial compression by small sinusoidal0022112007009226 Printed in the United Kingdom 291 Parametric instability in a rotating cylinder of gas subject to sinusoidal axial compression. Part 2. Weakly nonlinear theory J.-P. RACZ AND J. F. S COTT Laboratoire de M

  16. Math. Proc. Camb. Phil. Soc. (2002), 133, 345 c 2002 Cambridge Philosophical Society DOI: 10.1017/S030500410200590X Printed in the United Kingdom

    E-Print Network [OSTI]

    Li, Wenxia

    030500410200590X Printed in the United Kingdom 345 Non-differentiability of devil's staircases and dimensions probability measure on C. Consider the distribution function which is often referred to as the Devil's staircase (for a = 1 3 ): F(x) = µ([0, x]), x [0, 1]. It is easy to check that the derivative of F

  17. Quarterly Reviews of Biophysics 35, 3 (2002), pp. 205286. " 2002 Cambridge University Press DOI: 10.1017/S0033583502003785 Printed in the United Kingdom

    E-Print Network [OSTI]

    Plotkin, Steven S.

    : 10.1017/S0033583502003785 Printed in the United Kingdom 205 Understanding protein folding with energy and kinetics of protein folding 234 5.1 A protein Hamiltonian with cooperative interactions 234 5.2 Variance of native contact energies 235 5.3 Thermodynamics of protein folding 236 5.4 Free-energy surfaces

  18. Property:Zip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

  19. An integrated appraisal of energy recovery options in the United Kingdom using solid recovered fuel derived from municipal solid waste

    SciTech Connect (OSTI)

    Garg, A.; Smith, R. [Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Hill, D. [DPH Environment and Energy Ltd., c/o Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Longhurst, P.J.; Pollard, S.J.T. [Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Simms, N.J. [Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom)], E-mail:


    This paper reports an integrated appraisal of options for utilising solid recovered fuels (SRF) (derived from municipal solid waste, MSW) in energy intensive industries within the United Kingdom (UK). Four potential co-combustion scenarios have been identified following discussions with industry stakeholders. These scenarios have been evaluated using (a) an existing energy and mass flow framework model, (b) a semi-quantitative risk analysis, (c) an environmental assessment and (d) a financial assessment. A summary of results from these evaluations for the four different scenarios is presented. For the given ranges of assumptions; SRF co-combustion with coal in cement kilns was found to be the optimal scenario followed by co-combustion of SRF in coal-fired power plants. The biogenic fraction in SRF (ca. 70%) reduces greenhouse gas (GHG) emissions significantly ({approx}2500 g CO{sub 2} eqvt./kg DS SRF in co-fired cement kilns and {approx}1500 g CO{sub 2} eqvt./kg DS SRF in co-fired power plants). Potential reductions in electricity or heat production occurred through using a lower calorific value (CV) fuel. This could be compensated for by savings in fuel costs (from SRF having a gate fee) and grants aimed at reducing GHG emission to encourage the use of fuels with high biomass fractions. Total revenues generated from coal-fired power plants appear to be the highest ( Pounds 95/t SRF) from the four scenarios. However overall, cement kilns appear to be the best option due to the low technological risks, environmental emissions and fuel cost. Additionally, cement kiln operators have good experience of handling waste derived fuels. The scenarios involving co-combustion of SRF with MSW and biomass were less favourable due to higher environmental risks and technical issues.

  20. Late Middle Kingdom

    E-Print Network [OSTI]

    Grajetzki, Wolfram


    The amethyst mining inscriptions of Wadi el-Hudi, Vol. I.mining inscriptions of Wadi el-Hudi, Vol. II. Warminster:are unattested. Only at Wadi el-Hudi, there are a number of

  1. Emergency Preparedness technology support to the Health and Safety Executive (HSE), Nuclear Installations Inspectorate (NII) of the United Kingdom. Appendix A

    SciTech Connect (OSTI)

    O`Kula, K.R.


    The Nuclear Installations Inspectorate (NII) of the United Kingdom (UK) suggested the use of an accident progression logic model method developed by Westinghouse Savannah River Company (WSRC) and Science Applications International Corporation (SAIC) for K Reactor to predict the magnitude and timing of radioactivity releases (the source term) based on an advanced logic model methodology. Predicted releases are output from the personal computer-based model in a level-of-confidence format. Additional technical discussions eventually led to a request from the NII to develop a proposal for assembling a similar technology to predict source terms for the UK`s advanced gas-cooled reactor (AGR) type. To respond to this request, WSRC is submitting a proposal to provide contractual assistance as specified in the Scope of Work. The work will produce, document, and transfer technology associated with a Decision-Oriented Source Term Estimator for Emergency Preparedness (DOSE-EP) for the NII to apply to AGRs in the United Kingdom. This document, Appendix A is a part of this proposal.

  2. Decommissioning of the Dragon High Temperature Reactor (HTR) Located at the Former United Kingdom Atomic Energy Authority (UKAEA) Research Site at Winfrith - 13180

    SciTech Connect (OSTI)

    Smith, Anthony A. [Research Sites Restoration Ltd, Winfrith, Dorset (United Kingdom)] [Research Sites Restoration Ltd, Winfrith, Dorset (United Kingdom)


    The Dragon Reactor was constructed at the United Kingdom Atomic Energy Research Establishment at Winfrith in Dorset through the late 1950's and into the early 1960's. It was a High Temperature Gas Cooled Reactor (HTR) with helium gas coolant and graphite moderation. It operated as a fuel testing and demonstration reactor at up to 20 MW (Thermal) from 1964 until 1975, when international funding for this project was terminated. The fuel was removed from the core in 1976 and the reactor was put into Safestore. To meet the UK's Nuclear Decommissioning Authority (NDA) objective to 'drive hazard reduction' [1] it is necessary to decommission and remediate all the Research Sites Restoration Ltd (RSRL) facilities. This includes the Dragon Reactor where the activated core, pressure vessel and control rods and the contaminated primary circuit (including a {sup 90}Sr source) still remain. It is essential to remove these hazards at the appropriate time and return the area occupied by the reactor to a safe condition. (author)

  3. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

  4. Institution Name Institution Name Address Place Zip Notes Website...

    Open Energy Info (EERE)

    www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

  5. Name Name Address Place Zip Category Sector Telephone number...

    Open Energy Info (EERE)

    Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

  9. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

  10. Exploring zipping and assembly as a protein folding principle

    E-Print Network [OSTI]

    Voelz, Vince A; Dill, Ken A


    C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

  11. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

  12. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

  13. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

  14. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

  15. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

  16. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

  17. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

  18. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

  19. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

  20. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

  1. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

  2. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

  3. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

  4. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

  5. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

  9. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

  10. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

  11. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

  12. Name Address Place Zip Sector Product Stock Symbol Year founded...

    Open Energy Info (EERE)

    Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

  13. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

  14. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

  15. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

  16. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

  17. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

  18. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

  19. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

  20. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

  1. Name Name Address Place Zip Category Sector Telephone number Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

  2. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

  3. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

  4. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

  5. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

  6. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

  7. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

  8. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

  9. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

  10. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

  11. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

  12. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

  13. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

  14. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

  15. Organization Organization Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

  16. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

  17. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

  18. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

  19. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

  20. Company Name Company Name Address Place Zip Product Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

  1. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

  2. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

  3. Company Name Company Name Address Place Zip Sector Product Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

  4. Property:Incentive/Cont4Zip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

  5. Property:Incentive/ContZip | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

  6. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

  7. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

  8. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

  9. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

  10. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

  11. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

  12. Kingdom of Saudi Arabia Solar Radiation Atlas

    SciTech Connect (OSTI)



    This atlas provides a record of monthly mean solar radiation generated by a Climatological Solar Radiation model, using quasi-climatological inputs of cloud cover, aerosol optical depth, precipitable water vapor, ozone, surface albedo, and atmospheric pressure.

  13. The boatbuilding industry of New Kingdom Egypt

    E-Print Network [OSTI]

    Monroe, Christopher Mountfort


    (Krakow 1975) fig. 12 . . 45 l7 Disassembled chair of NK date showing mortise-and-tenon joinery and holes for dowels or pegs, from Killen (Warminster 1980) pl. 90 . . . . . . . . . . . . . . . . 46 18 a. Square-bar mortising chisel BM 6053, from Killen... and the Griffith Institute . 64 31 Model tool bin from a MK carpenters' workshop model, from Winlock (New York 1955) pl. 28 . 65 32 Egyptian ships on the sea: Hatshepsut's expedition to Punt (left), from Naville (London 1898) pl. LXXIV; Ramesses III's naval...

  14. Keele University Royaume-Uni | United Kingdom

    E-Print Network [OSTI]

    Petriu, Emil M.

    .S Government and Politics PIR 20071 POL 3140 Arts I.R. of the Environment PIR 20064 POL4190 Arts Politics of Sustainability PIR 10047 POL 3XXX Arts Freedom and Equality PIR 20066 POL 4XXX Arts Imperialism and Empire HIS PIR 10039 POL 3XXX Arts Why Policy Changes PIR 20068 TO BE DETERMINED Arts The Practice of Politics

  15. Boats of Egypt before the old kingdom

    E-Print Network [OSTI]

    Vinson, Steve


    clarified by radiocarbon and thermoluminescent dating, which have, if nothing else, shown that the lower chronology is correct. But dates stiil vary widely, and contradictory results are often obtained. ln 1971, Oerricourt published a set of dates... of Baderi were put in the proper sequence with the thermoluminescence technique but surprisingly old dates were obtained for the oldest Badarian pottery: 5580 B. C. , plus or minus 420 years for a sherd of rough were from the 6. 5 foot (1. 9 m) level...

  16. United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,Save Energy Now Jump(EC-LEDS) | OpenPennsylvania) JumpLoading

  17. Kingdom Community Wind | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place:Keystone Clean Air Jump to:King Abdulaziz City

  18. Oil and Gas Company Oil and Gas Company Address Place Zip Website

    Open Energy Info (EERE)

    Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

  19. Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor

    E-Print Network [OSTI]

    Hur, Jung-Im


    results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

  20. Address State: Zip: All participants: please complete the form below and return it to

    E-Print Network [OSTI]

    Schladow, S. Geoffrey

    to UCDEA Contact the Retiree Center via e-mail: or telephone: (530) 752-5182

  1. Business Name Year Address City State Zip Phone Email Address Contact

    E-Print Network [OSTI]

    Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

  2. A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor

    E-Print Network [OSTI]

    Yang, Xue'en, 1975-


    Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...


    E-Print Network [OSTI]

    Tsien, Roger Y.


  4. Business Name Year Address City State Zip Phone Email Address Contact

    E-Print Network [OSTI]

    water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

  5. Business Name Year Address City State Zip Phone Email Address Contact

    E-Print Network [OSTI]

    is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

  6. 3D compression: from A to Zip: a first complete example THOMAS LEWINER

    E-Print Network [OSTI]

    Lewiner, Thomas (Thomas Lewiner)

    the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

  7. Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*

    E-Print Network [OSTI]

    Schäfer, Eberhard

    in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

  8. Determining protein interaction specificity of native and designed bZIP family transcription factors

    E-Print Network [OSTI]

    Reinke, Aaron W


    Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

  9. Quick Start The various sample data files after expansion (use Zip)

    E-Print Network [OSTI]

    library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

  10. Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

  11. Looking for a way to find utilites per zip code (a list?) | OpenEI

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

  12. Name Address Place Zip Sector Product Stock Symbol Year founded Number

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

  13. State Oil and Gas Board State Oil and Gas Board Address Place Zip Website

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

  14. Do we get actual vendor name while we searched with zip code? | OpenEI

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

  15. Electric Utility Company Assigned to a Zip Code? | OpenEI Community

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

  16. Helen Gordon Child Development Center WAITLIST APPLICATION

    E-Print Network [OSTI]

    Lafferriere, Gerardo

    ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E


    E-Print Network [OSTI]

    Weitz, Joshua S.

    : ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

  18. Green Enterprises | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place: Golden, COIndianaLondon, United Kingdom Zip: SW7

  19. Green Exchange | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place: Golden, COIndianaLondon, United Kingdom Zip:

  20. Green Fuel Technologies Corporation | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat Jump to:Photon Place: Golden, COIndianaLondon, United Kingdom Zip:Green

  1. ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.

    E-Print Network [OSTI]

    Thomases, Becca or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

  2. Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review

    E-Print Network [OSTI]

    Chapman, Michael S.

    experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

  3. Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)

    E-Print Network [OSTI]

    Ciaccio, Natalie Anne


    was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

  4. Late Second Intermediate Period to Early New Kingdom

    E-Print Network [OSTI]

    Popko, Lutz


    and society in ancient Egypt: Part 1. Göttinger MiszellenJanine 1981 Nubians in Egypt during the Second Intermediateroyal families of ancient Egypt. London: Thames & Hudson.


    E-Print Network [OSTI]

    Al-Zaid, Ahmad Abdulaziz


    , Companies Act's provisions which describe the function, effect, scope and what they fall short of by themselves and/or within other rules forming the system of corporate governance in Saudi Arabia. In addition, there has been little to no treatment...

  6. Inter-Kingdom Signaling Interactions in Enterohemorrhagic Escherichia coli Infections

    E-Print Network [OSTI]

    Bansal, Tarun


    and the human intestinal epithelial cells, which they colonize. Differential gene expression of EHEC was studied upon exposure to the human neuroendocrine hormones epinephrine and norepinephrine. We determined that these hormones increase EHEC chemotaxis...

  7. Steve P. Hopkin University of Reading, Reading, United Kingdom

    E-Print Network [OSTI]

    Hopkin, Steve

    Tetrodontophora bielanensis can reach 9 mm in length, and some members of the Subfamily Uchidanurinae grow to 10 are beneficial; however, there are a few species, including Sminthurus viridis the "Lucerne flea," which feed

  8. The united kingdom's changing requirements for spent fuel storage

    SciTech Connect (OSTI)

    Hodgson, Z.; Hambley, D.I.; Gregg, R.; Ross, D.N. [National Nuclear Laboratory, Chadwick House, Birchwood Park, Warrington, Cheshire WA3 6AE (United Kingdom)


    The UK is adopting an open fuel cycle, and is necessarily moving to a regime of long term storage of spent fuel, followed by geological disposal once a geological disposal facility (GDF) is available. The earliest GDF receipt date for legacy spent fuel is assumed to be 2075. The UK is set to embark on a programme of new nuclear build to maintain a nuclear energy contribution of 16 GW. Additionally, the UK are considering a significant expansion of nuclear energy in order to meet carbon reduction targets and it is plausible to foresee a scenario where up to 75 GW from nuclear power production could be deployed in the UK by the mid 21. century. Such an expansion, could lead to spent fuel storage and its disposal being a dominant issue for the UK Government, the utilities and the public. If the UK were to transition a closed fuel cycle, then spent fuel storage should become less onerous depending on the timescales. The UK has demonstrated a preference for wet storage of spent fuel on an interim basis. The UK has adopted an approach of centralised storage, but a 16 GW new build programme and any significant expansion of this may push the UK towards distributed spent fuel storage at a number of reactors station sites across the UK.

  9. London, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(Monaster AndLittletown, Arizona:Lockland, Ohio:London Waste andUnited

  10. EUDEEP (Smart Grid Project) (United Kingdom) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS Corp JumpESVEUDEEPEUDEEPEUDEEP

  11. EWIS European wind integration study (Smart Grid Project) (United Kingdom)

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37. It is classified as ASHRAEDuvalJusticeEPS CorpEVI| Open Energy

  12. United Kingdom Low Carbon Transition Plan | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov PtyInformation UC 19-6-401 et seq.NorthUniopolis, Ohio:Low Carbon Transition

  13. Hertfordshire, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:Greer CountyCorridorPartImagesHensley,Hernando

  14. Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom

    Broader source: [DOE]

    With a healthy appetitie for uranium and petroleum, this family of bacteria clean up nuclear waste and other toxic materials. A team of researchers has discovered exactly how they use their arms to do this.

  15. An Energy Overview of the Kingdom of Thailand

    SciTech Connect (OSTI)



    The DOE Office of Fossil Energy is maintaining a web site that is meant to provide useful business- and energy-related information about countries and regions of the world for exporters, project developers, and researchers. The site consists of more than 130 country pages (organized into seven different world regions), with each country page having its own set of links to information sources about that country. There are also more than 30 Country Energy Overviews at the web site -- each of these is a comprehensive review of a specific country's entire energy situation, including sections on Energy Policy, Oil, Natural Gas, Coal, Hydroelectric/Renewables, Nuclear Power, Energy Transmission Infrastructure, Electricity, Electric Industry Overview, Environmental Activities, Privatization, Trade, and Economic Situation. The specific country highlighted in this Country Energy Overview is Thailand. The site is designed to be dynamic. Updates to the overviews will be made as need and resource s permit.

  16. Leeds, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October, 2012Lee County Electric Coop,

  17. EM Renews Information-Sharing Agreement with United Kingdom's Nuclear

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-UpHeat PumpRecord of DecisionDraftDepartment ofAdvisoryFebruaryJuly 1, 2011

  18. Oxford, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty,Orleans County, Vermont:OttawaCounty,2.8247524°,is a city in

  19. United Kingdom Department for International Development | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop,Save Energy Now Jump(EC-LEDS) | OpenPennsylvania) Jump

  20. Dursley, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirect EnergyOrganizationsealing JumpSales,Jump

  1. Tonbridge, United Kingdom: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:Seadov Pty LtdSteen,Ltd JumpOperations Jump to:NationalToledo,Tonalea, Arizona:Tonbridge,

  2. Fenix (Smart Grid Project) (United Kingdom) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address:011-DNA Jump37.California: EnergyFeilden Clegg Bradley Studios Jump to:

  3. 2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.

    E-Print Network [OSTI]

    Qiu, Weigang

    #_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

  4. Cal State Fullerton Alumni Association Candidate Information Sheet

    E-Print Network [OSTI]

    de Lijser, Peter

    ________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

  5. 2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.

    E-Print Network [OSTI]

    Qiu, Weigang

    #_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

  6. 16 au Spring 2012 Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers

    E-Print Network [OSTI]

    Short, Daniel

    on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

  7. The Excel model for Beta testing is available for download at Please provide feedback or

    E-Print Network [OSTI]

    1 The Excel model for Beta testing is available for download at

  8. Codes for the fast SSS QR eigens

    E-Print Network [OSTI]

    Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip ...

  9. Microsoft Word - VIPERS instructions.doc

    Office of Environmental Management (EM)

    Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

  10. The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom

    E-Print Network [OSTI]

    Kroenke, Karin Roberta


    three fragments of painted mud plaster near the entrance offound remnants of white plaster applied over mud and paintedof a figure painted on plaster survived on the back wall of

  11. The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom

    E-Print Network [OSTI]

    Kroenke, Karin Roberta


    Newberry, Percy E. 1893. Beni Hasan. Part I. London: Egypt1904. ?Excavations at Beni Hasan (1902-1903-1904). ? Annalesmade in the Necropolis of Beni Hasan during1902-3-4. London:

  12. The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom

    E-Print Network [OSTI]

    Kroenke, Karin Roberta


    Bothmer, Bernard. 2003. Egypt 1950 My First Visit. Edited byMogens. 1996. Catalogue Egypt I (3000-1550 B.C. ). NyPottery in Second Millennium Egypt. Mainz am Rhein: Philipp

  13. The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom

    E-Print Network [OSTI]

    Kroenke, Karin Roberta


    Institut Kairo im MnTw- Htp-Tempel und in El-TârifC.J.C. 1941. ?Growth of the Htp-di-nsw formula in the Middle11 th Dynasty tomb of MnTw-Htp/BwAw at Deir el-Bahri (pit

  14. The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom

    E-Print Network [OSTI]

    Kroenke, Karin Roberta


    Expedition von Kairo bis Wadi Halfa zwecks Abschluss desthe mouth of Reisner?s first wadi. 622 For a general view ofReisner?s second and third wadis. For a general view of the

  15. Boise State University Human Resource Services Employee Information Form

    E-Print Network [OSTI]

    Barrash, Warren

    : ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

  16. U.S. Department of Energy Welcomes the United Kingdom as 21st...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    partnership tripled its size when the original GNEP partners - China, France, Japan, Russia and the United States - signed the GNEP Statement of Principles, along with Australia,...

  17. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    E-Print Network [OSTI]

    Zhou, Nan


    Coal Raw Mtce FIGURE 1 Coal dominates energy consumption in=1 Mtce Total Energy Consumption Coal Consumption Constantthe dominant use of coal in China’s energy system from 1950

  18. A Resurgence of United Kingdom Nuclear Power Research (2011 EFRC Forum)

    ScienceCinema (OSTI)

    Grimes, Robin W. (Imperial College, London, UK)


    Robin W. Grimes, Professor at Imperial College, London,was the third speaker in the the May 26, 2011 EFRC Forum session, "Global Perspectives on Frontiers in Energy Research." In his presentation, Professor Grimes discussed recent research endeavors in advanced nuclear energy systems being pursued in the UK. The 2011 EFRC Summit and Forum brought together the EFRC community and science and policy leaders from universities, national laboratories, industry and government to discuss "Science for our Nation's Energy Future." In August 2009, the Office of Science established 46 Energy Frontier Research Centers. The EFRCs are collaborative research efforts intended to accelerate high-risk, high-reward fundamental research, the scientific basis for transformative energy technologies of the future. These Centers involve universities, national laboratories, nonprofit organizations, and for-profit firms, singly or in partnerships, selected by scientific peer review. They are funded at $2 to $5 million per year for a total planned DOE commitment of $777 million over the initial five-year award period, pending Congressional appropriations. These integrated, multi-investigator Centers are conducting fundamental research focusing on one or more of several ?grand challenges? and use-inspired ?basic research needs? recently identified in major strategic planning efforts by the scientific community. The purpose of the EFRCs is to integrate the talents and expertise of leading scientists in a setting designed to accelerate research that transforms the future of energy and the environment.

  19. Diagnostic experiments at a 3 MeV test stand at Rutherford Appleton Laboratory (United Kingdom)

    SciTech Connect (OSTI)

    Gabor, C. [ASTeC Intense Beams Group, Rutherford Appleton Laboratory, Oxfordshire OX11 0QX (United Kingdom); Faircloth, D. C.; Lawrie, S. R.; Letchford, A. P. [Isis Pulsed Spallation Neutron Source, Rutherford Appleton Laboratory, Oxfordshire OX11 0QX (United Kingdom); Lee, D. A. [Department of Physics, Imperial College of Science and Technology, London SW7 2AZ (United Kingdom); Pozimski, J. K. [Isis Pulsed Spallation Neutron Source, Rutherford Appleton Laboratory, Oxfordshire OX11 0QX (United Kingdom); Department of Physics, Imperial College of Science and Technology, London SW7 2AZ (United Kingdom)


    A front end is currently under construction consisting of a H{sup -} Penning ion source (65 keV, 60 mA), low energy beam transport (LEBT), and radio frequency quadrupole (3 MeV output energy) with a medium energy beam transport suitable for high power proton applications. Diagnostics can be divided either in destructive techniques such as beam profile monitor, pepperpot, slit-slit emittance scanner (preferably used during commissioning) or nondestructive, permanently installed devices such as photodetachment-based techniques. Another way to determine beam distributions is a scintillator with charge-coupled device camera. First experiments have been performed to control the beam injection into the LEBT. The influence of beam parameters such as particle energy and space-charge compensation on the two-dimensional distribution and profiles will be presented.

  20. EDITION: UK CA Canada Qubec FR France US United States UK United Kingdom

    E-Print Network [OSTI]

    Haszeldine, Stuart

    Like 5 Do You Know Where Green Electricity Will Come From? Posted: 2/03/2012 09:42 React By not a pastel green. Somewhere well out of sight is a vast generating plant - which burns stuff, usually fossil. Today, green electricity isn't cheap, and there is not enough available when needed. Intelligence

  1. J. Mar. Biol. Ass. U.K. (2007), 87, 327338 Printed in the United Kingdom

    E-Print Network [OSTI]

    Pierce, Graham

    ), pollution (Aguilar & Borrell, 1995), over-fishing of prey species (Evans, 1990; Jackson et al., 2001), and disturbance from sound sources such as shipping, seismic surveys, sonar and acoustic deterrents (Evans, 1996

  2. A review of "Swordsmen: The Martial Ethos in the Three Kingdoms." by Roger B. Manning

    E-Print Network [OSTI]

    Simon Healy


    of the records of the Earl Marshal?s court (housed at the College of Arms in London and are being calendared by Richard Cust and Andrew Hopper), established in 1623 specifically to check the spiralling problem of duelling in London and at Court. The most... tendencies of the early modern state (this is probably more true of France than England, although the 2 nd Earl of Essex was a natural- born frondeur). On the basis of these assumptions, he speculates that the martial ethos, when combined with classical...

  3. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    E-Print Network [OSTI]

    Zhou, Nan


    Elasticity =1 Mtce Total Energy Consumption Coal Consumptionpercent of total energy consumption in China. The Top 1,000percent of total industrial-sector energy consumption and 30

  4. United Kingdom The University of Strathclyde is a charitable body, registered in Scotland (number SC015263)

    E-Print Network [OSTI]

    Mottram, Nigel

    ; rising oil prices and commodity/food prices; and the Scottish government's economic strategy. Growth borrowing and lending to an as yet unknown degree. · Rising oil prices and commodity/food prices are a major impediment to the growth of the world economy. Since last July oil prices have risen from $75 to $139

  5. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    E-Print Network [OSTI]

    Zhou, Nan


    1/2/a7612e71ef7f84b4cade01abbd34106b. Sinton, J. , and M.promote energy efficiency see Sinton and Levine (1998). It

  6. Black carbon emissions in the United Kingdom during the past four decades: An empirical analysis

    SciTech Connect (OSTI)

    Novakov, T.; Hansen, J.E.


    We use data from a unique 40-year record of 150 urban and rural stations in the ''Black Smoke and SO2 Network'' in Great Britain to infer information about sources of atmospheric black carbon (BC). The data show a rapid decline of ambient atmospheric BC between 1962 and the early 1990s that exceeds the decline in official estimates of BC emissions based only on amount of fuel use and mostly fixed emission factors. This provides empirical confirmation of the existence and large impact of a time-dependent ''technology factor'' that must multiply the rate of fossil fuel use. Current ambient BC amounts in Great Britain comparable to those in western and central Europe, with diesel engines being the principal present source. From comparison of BC and SO2 data we infer that current BC emission inventories understate true emissions in the U.K. by about a factor of two. The results imply that there is the potential for improved technology to achieve large reduction of global ambient BC. There is a need for comparable monitoring of BC in other countries.

  7. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    E-Print Network [OSTI]

    Zhou, Nan


    China View. 2009. China’s energy intensity down 2.9% in Q1:demand at constant energy intensity, 1980–2006. Source: NBS,percent reduction in energy intensity (defined as energy use

  8. Gods Who Hear Prayers: Popular Piety or Kingship in Three Theban monuments of New Kingdom Egypt

    E-Print Network [OSTI]

    Ausec, Cindy Lee


    caps or baldachins. Brand believes the images with specialshrines over the images; while Brand (2007) believes theywritten by Brand, which discussed an image, believed to have

  9. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    SciTech Connect (OSTI)

    Levine, Mark D.; Zhou, Nan; Price, Lynn


    The dominant image of China's energy system is of billowing smokestacks from the combustion of coal. More heavily dependent on coal than any other major country, China uses it for about 70 percent of its energy (NBS, 2008). Furthermore, until recently, China had very few environmental controls on emissions from coal combustion; recent efforts to control sulfur dioxide (SO{sub 2}) emissions appear to be meeting with some success (Economy, 2007, 2009). Figure 1 shows the dominant use of coal in China's energy system from 1950 to 1980 (NBS, various years). However, this is just one side of China's energy story. Figure 2 illustrates the second part, and what may be the most important part of the story - China's energy system since 1980, shortly after Deng Xiaoping assumed full leadership. This figure compares the trends in energy consumption and gross domestic product (GDP) by indexing both values to 100 in 1980. The upper line shows what energy consumption in China would have been if it had grown at the same rate as GDP, since energy consumption usually increases in lockstep with GDP in an industrializing, developing country, at least until it reaches a high economic level. The lower line in Figure 2 shows China's actual energy consumption, also indexed to 1980. The striking difference between the lines shows that GDP in China grew much faster than energy demand from 1980 to 2002. As a result, by 2002 energy and energy-related carbon dioxide (CO{sub 2}) emissions were more than 40% percent of what they would have been if energy and GDP had grown in tandem. In the next chapter of China's energy history, from 2002 to 2005, the increase in energy demand outstripped a very rapidly growing economy, and because of the large size of the Chinese economy, the increase had substantial impacts. The construction of power plants increased to 100 gigawatts per year; over the three-year period newly constructed plants had a capacity of more than 30 percent of total electricity-generation capacity in the United States. At the same time, energy-related CO{sub 2} emissions in China increased dramatically. In the latest stage, another abrupt change, this time for the better in terms of energy efficiency, began late in 2005. As senior officials in the government turned their attention to the problem of growing energy demand, the government set a mandatory goal for 2010 of a 20 percent reduction in energy intensity (defined as energy use per unit of GDP) from 2005 levels. To meet this goal, China undertook significant legislative, regulatory, and organizational reforms at the national, provincial, and municipal levels to ensure that measures to reduce energy intensity would be implemented in all sectors and activities in China. At the time of this writing, it appears that China is on its way to meeting the 20 percent goal, thus reducing CO{sub 2} emissions by 1.5 billion tones, as compared with consumption at 2005 energy-intensity levels. In this paper, we describe and assess these three significant periods in China's energy story and provide a context by briefly reviewing the three decades prior to 1980.

  10. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    E-Print Network [OSTI]

    Zhou, Nan


    defined as energy use per unit of GDP) from 2005 levels. Tomeasured as energy consumption per RMBĄ 5 of GDP). The

  11. CCFE is the fusion research arm of the United Kingdom Atomic Energy Authority Fusion Technology at

    E-Print Network [OSTI]

    , very challenging heat transfer and material problem critical to the success of fusion which drives 10 of 11 Some current research at CCFE · "Heat Transfer enhancement for fusion power plant divertors at CCFE David Hancock #12;PhD and Masters Open Day 15th November 2012slide 2 of 11 Objectives · The role

  12. J. Mar. Biol. Ass. U.K. (2007), 87, 14 Printed in the United Kingdom

    E-Print Network [OSTI]

    Pierce, Graham

    of `Marine mammals and man in coastal ecosystems: can they co-exist?' Many of the papers contained range of pressures--habitat modification, pollution, disturbance, and conflicts with fisheries through--either stranded specimens or a by- product of the whaling industry, a range of techniques has now been developed

  13. Exclusionary rule of evidence in the United Kingdom, United States and China 

    E-Print Network [OSTI]

    Hsieh, Kuo-Hsing


    If there is any fixed star in our constitutional and criminal procedure constellation, it is that torture is illegal and torture-introduced evidence is inadmissible. The purposes of this research are to (1) assess the ...

  14. Gods Who Hear Prayers: Popular Piety or Kingship in Three Theban monuments of New Kingdom Egypt

    E-Print Network [OSTI]

    Ausec, Cindy Lee


    God who hears prayers? (Htp-di-nswt RSpw ntr aA sDm nHwt).inscribed statues include the Htp-di-nswt formula in theirroyal offerings, ir.t di nswt Htp to Amun-Re. 112 Thus the

  15. An assessment of using oil shale for power production in the Hashemite Kingdom of Jordan

    SciTech Connect (OSTI)

    Hill, L.J.; Holcomb, R.S.; Petrich, C.H.; Roop, R.D.


    This report addresses the oil shale-for-power-production option in Jordan. Under consideration are 20- and 50-MW demonstration units and a 400-MW, commercial-scale plant with, at the 400-MW scale, a mining operation capable of supplying 7.8 million tonnes per year of shale fuel and also capable of disposal of up to 6.1 million tonnes per year of wetted ash. The plant would be a direct combustion facility, burning crushed oil shale through use of circulating fluidized bed combustion technology. The report emphasizes four areas: (1) the need for power in Jordan, (2) environmental aspects of the proposed oil shale-for-power plant(s), (3) the engineering feasibility of using Jordan's oil shale in circulating fluidized bed combustion (CFBC) boiler, and (4) the economic feasibility of the proposed plant(s). A sensitivity study was conducted to determine the economic feasibility of the proposed plant(s) under different cost assumptions and revenue flows over the plant's lifetime. The sensitivity results are extended to include the major extra-firm benefits of the shale-for-power option: (1) foreign exchange savings from using domestic energy resources, (2) aggregate income effects of using Jordan's indigenous labor force, and (3) a higher level of energy security. 14 figs., 47 tabs.

  16. Joint Statement by Sir John Beddington, United Kingdom (UK) Government Chief Scientific Adviser

    E-Print Network [OSTI]

    , aviation operation and security of satellites. Our respective key organizations have numerous common and Head of the Government Office for Science and Dr. Kathryn D. Sullivan, Deputy Administrator National

  17. Third Party Nuclear Liability: The Case of a Supplier in the United Kingdom

    E-Print Network [OSTI]

    Thomas, Anthony; Heffron, Raphael J.


    The law surrounding third party nuclear liability is important to all parties in the nuclear supply chain whether they are providing decommissioning services, project management expertise or a new reactor. This paper examines third party nuclear...

  18. Gods Who Hear Prayers: Popular Piety or Kingship in Three Theban monuments of New Kingdom Egypt

    E-Print Network [OSTI]

    Ausec, Cindy Lee


    Search for God in Ancient Egypt. Translated by David Lorton.Press. ———, 2002. The Mind of Egypt. History and Meaning inIn Temples of Ancient Egypt. Edited by Byron E. Schafer.

  19. Price Liquefied Freeport, TX Natural Gas Exports Price to United Kingdom

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per Thousand Cubic Feet)

  20. Price Liquefied Sabine Pass, LA Natural Gas Exports Price to United Kingdom

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per Thousandperper Thousand(Dollars

  1. Price Liquefied Sabine Pass, LA Natural Gas Exports Price to United Kingdom

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear Jan670,174per Thousandperper

  2. DLC+VIT4IP (Smart Grid Project) (United Kingdom) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin:2003)CrowleyEnergyMasse) Jump to:DEXA Jump

  3. Liquefied U.S. Natural Gas Exports to United Kingdom (Million Cubic Feet)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 14343 342 328 370Japan (MillionSouth

  4. BeyWatch (Smart Grid Project) (United Kingdom) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio JumpVentures JumpGermany: EnergyBeyWatch (Smart

  5. HiperDNO (Smart Grid Project) (United Kingdom) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHi Gtel Jump to:County,1143807°,Hilltop,Hinsdale Wave3° Loading


    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarlyEnergyDepartment ofDepartment ofof EnergyYou$0.C. 20545*. . : '*I_ - I _ _ _ _ --~ *-^xJerseyRECE

  7. Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in Nonproducing Reservoirs Year in Review1,213 136,422Year Jan FebYear Jan Feb

  8. Price of Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia,(Million Barrels) Crude Oil Reserves in NonproducingAdditions to Capacity on the U.S.ThousandThousandThousand Cubicper

  9. Energy implications of the thermal recovery of biodegradable municipal waste materials in the United Kingdom

    SciTech Connect (OSTI)

    Burnley, Stephen, E-mail: [Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom); Phillips, Rhiannon, E-mail: [Strategy Unit, Welsh Assembly Government, Ty Cambria, 29 Newport Road, Cardiff CF24 0TP (United Kingdom); Coleman, Terry, E-mail: [Environmental Resources Management Ltd, Eaton House, Wallbrook Court, North Hinksey Lane, Oxford OX2 0QS (United Kingdom); Rampling, Terence, E-mail: [7 Thurlow Close, Old Town Stevenage, Herts SG1 4SD (United Kingdom)


    Highlights: > Energy balances were calculated for the thermal treatment of biodegradable wastes. > For wood and RDF, combustion in dedicated facilities was the best option. > For paper, garden and food wastes and mixed waste incineration was the best option. > For low moisture paper, gasification provided the optimum solution. - Abstract: Waste management policies and legislation in many developed countries call for a reduction in the quantity of biodegradable waste landfilled. Anaerobic digestion, combustion and gasification are options for managing biodegradable waste while generating renewable energy. However, very little research has been carried to establish the overall energy balance of the collection, preparation and energy recovery processes for different types of wastes. Without this information, it is impossible to determine the optimum method for managing a particular waste to recover renewable energy. In this study, energy balances were carried out for the thermal processing of food waste, garden waste, wood, waste paper and the non-recyclable fraction of municipal waste. For all of these wastes, combustion in dedicated facilities or incineration with the municipal waste stream was the most energy-advantageous option. However, we identified a lack of reliable information on the energy consumed in collecting individual wastes and preparing the wastes for thermal processing. There was also little reliable information on the performance and efficiency of anaerobic digestion and gasification facilities for waste.

  10. The Greening of the Middle Kingdom: The Story of Energy Efficiency in China

    E-Print Network [OSTI]

    Zhou, Nan


    Energy Consumption FIGURE 2 Actual energy demand in China isvery much lower than energy demand at constant energyGDP Energy FIGURE 3a Energy demand grew twice as fast as GDP

  11. An analysis of tomb reliefs depicting boat construction from the Old Kingdom period in Egypt

    E-Print Network [OSTI]

    Rogers, Edward Morgan


    of Rectangular Features The Ends of Papyriform Boats Hull Shapes . 106 108 112 114 VII CONCLUSIONS 120 REFERENCES APPENDIX I APPENDIX 2 APPENDIX 3 125 130 157 158 VITA 161 LIST OF FIGURES FIGURE Page I Funerary sites of Lower Egypt 2 Saqqara... Necropolis 3 Three workers in the Ty rclicf using axes and an adze to process a log . . 16 4 Axes with holes in the center of the blades, through which the fastenings v ould have passed . 16 5 Workers using axes to shave surfaces of hull planks 6 Sawyer...

  12. "This Modern Day Slavery": Sex Trafficking and Moral Panic in the United Kingdom

    E-Print Network [OSTI]

    Hill, Angela


    purported catalyst: the abduction and corruption of whitepreoccupation with the abduction tale of vulnerable whiteand Jarrett were convicted of abduction and procurement, and

  13. Kingdom of Saudi Arabia Ministry of Petroleum and Mineral Resources | Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende New Energy Co Ltd Jump to:Kenersys India Pvt LtdKhmer

  14. Price of Liquefied U.S. Natural Gas Exports to United Kingdom (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear(DollarsDollarsCubicThousandThousand

  15. Price of Liquefied U.S. Natural Gas Exports to United Kingdom (Dollars per

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998through 1996)DecadeYear(DollarsDollarsCubicThousandThousandThousand

  16. Price of Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Dollars

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998throughThousand Cubic Feet) Decade Year-0Thousand Cubicper

  17. Sabine Pass, LA Exports to United kingdom Liquefied Natural Gas (Million

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet) Brazil LiquefiedSpainCubic

  18. United Kingdom Department of Energy and Climate Change (DECC) | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-gTagusparkCalculator Jump to:Unionmet Singapore Limited

  19. Price of Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Dollars

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30 2013 Macroeconomicper8,170Thousand Cubic Feet) Year JanThousand Cubicper

  20. A Strategy for Carbon Capture and Storage (CCS) in the United Kingdom and

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 SouthWater Rights, Substantive(Sichuan,FinancialTracer TestsOfBeyond | Open

  1. Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Million Cubic

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines AboutDecemberSteam CoalReserves (MillionYear JanDecadeYear

  2. U.S. Department of Energy Welcomes the United Kingdom as 21st Member of the

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of EnergyTheDepartmentFeedContractor | Department

  3. United States-United Kingdom Collaboration on Fossil Energy R&D |

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists' Research Petroleum ReserveDepartment ofEnergy, OfficeDepartment of Energy U.S.-UK

  4. Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Million Cubic

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998 10,643NorwayBase Gas)CubicFeet)2009DecadeDecade Year-0

  5. A review of "Pueblos, Spaniards, and the Kingdom of New Mexico" by John L. Kessell

    E-Print Network [OSTI]

    García, Patricia Marie


    reviews 61 vital insight into the politics of medical authority and the clash between Eurocentric and indigenous approaches to healing in Latin America. Clark?s essay o ers a #15;tting conclusion to this volume, because it not only... as to the savage treatment of the Pueblo delegation sent as envoys to Coronado?s expedition helps explain the Pueblos? uneasiness at the Spaniards? renewed attempts in the 1590s to settle the area under Juan de O?ate. O?ate?s #15;rst attempts are described...

  6. The Middle Class in the Middle Kingdom: Regime Support for the Chinese Leadership?

    E-Print Network [OSTI]

    Paden, Eric


    Over the last thirty years China has witnessed economic development at an extraordinary rate. China has also developed a growing urban middle class. However, China remains the world's largest authoritarian regime. Modernization ...

  7. Honors Program Parent Society MEMBERSHIP INFORMATION

    E-Print Network [OSTI]

    Arnold, Jonathan

    : State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

  8. E-Print Network 3.0 - addressing medical coding Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

  9. [ Enter captions text ] THURSDAY, AUGUST 26, 2010.

    E-Print Network [OSTI]

    Sze, Lawrence


  10. The University of Utah Alumni Association Young Alumni

    E-Print Network [OSTI]

    ________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone


    Energy Science and Technology Software Center (OSTI)

    003183WKSTN00 The National Solar Permitting Database 

  12. Proceedings of the TOUGH Symposium 2009

    E-Print Network [OSTI]

    Moridis, George J.


    by the United Kingdom’s Nuclear Decommissioning by the UK Nuclear Decommissioning Authority (NDA),by the United Kingdom’s Nuclear Decommissioning Authority.

  13. MULTI-SCIENCE PUBLISHING CO. LTD. 5 Wates Way, Brentwood, Essex CM15 9TB, United Kingdom

    E-Print Network [OSTI]

    is produced from the thermo-chemical conversion (through pyrolysis) of biomass into a composite material-oils. Pyrolysis is the chemical decomposition of organic matter that occurs spontaneously at high enough for combining carbon abatement from biomass with one or more of the following: sustainable energy production

  14. Math. Proc. Camb. Phil. Soc. (2001), 130, 365 Printed in the United Kingdom c 2001 Cambridge Philosophical Society

    E-Print Network [OSTI]

    GrĂĽbel, Rudolf

    in this direction were obtained by Westcott [21, 22], who considered the one-sided case and gave conditions that implied rr((x, )) m1/x, where m1 = m1(µ) xµ(dx) denotes the first moment associated with µ. Westcott also

  15. Oliver F. Quinn, R.Stuart Haszeldine, John R. Underhill, and John E. Dixon, University of Edinburgh, Edinburgh, United Kingdom

    E-Print Network [OSTI]

    Haszeldine, Stuart

    Oliver F. Quinn, R.Stuart Haszeldine, John R. Underhill, and John E. Dixon, University of Edinburgh around 60-70jC. Hydrocarbon inclusions, galena and fluorite are also present. The structural high acted

  16. A review of "The Kingdom of Science: Literary Utopianism and British Education, 1612-1870." by Paul A. Olson

    E-Print Network [OSTI]

    Michael Leslie


    in Ireland and the fate of those who subsequently settled there has been woefully neglected. In Ireland Huguenot ancestry is prized and respected even to this day, but sadly miscon- ceptions and embellishments, which for centuries remained unchallenged, have...

  17. J. Fluid Mech. (2001), vol. 435, pp. 261287. Printed in the United Kingdom c 2001 Cambridge University Press

    E-Print Network [OSTI]

    Ponty, Yannick

    University Press 261 Kinematic dynamo action in large magnetic Reynolds number flows driven by shear) A numerical investigation is presented of kinematic dynamo action in a dynamically driven fluid flow layer shear flow. The onset of instability is characterized by a horizontal wave vector inclined at some

  18. CCFE is the fusion research arm of the United Kingdom Atomic Energy Authority Engineering Research at CCFE

    E-Print Network [OSTI]

    ­ Tritium inventory control and processing ­ Remote handling ­ and many more! #12;4 Technology Theme.; ­ Response to transients, EM loads; ­ Maintainability ­ remote handling design. ­ Manufacturability in ITER · Test if Nanofluids are suitable as an advanced cooling fluid able to remove extreme heat energy fluxes

  19. A Novel Kingdom of Parasitic Archaea Karl O. Stetter1,2* | Michael J. Hohn1 | Harald Huber1

    E-Print Network [OSTI]

    Ahmad, Sajjad

    discovered in terrestrial high temperature environments like solfataras, hot springs, smoldering coal refuse piles, and deep, geothermally- heated rocks. In addition, submarine high temperature environments like- thermophiles which are adapted to the high salinity of sea water (Stetter 1999). Hyperthermophiles occur within

  20. CCFE is the fusion research arm of the United Kingdom Atomic Energy Authority Culham Materials Research Facility -for universities,

    E-Print Network [OSTI]

    McDonald, Kirk

    (beam damage & analysis) to form £15M "NNUF" proposal (National Nuclear Users Facility ­ CCFE, NNL ­ First tranche of funding (£5M for whole NNUF) - to be spent by March · March 2013 - Beddington review. 37MBq (e.g. Oxford) Universities 35TBq (Co60) CCFE Medium activity, structural NNL Most active, fuel

  1. J. Fluid Mech. (2000), vol. 420, pp. 301324. Printed in the United Kingdom c 2000 Cambridge University Press

    E-Print Network [OSTI]

    Luo, Xiaoyu

    physiological applications of flow in collapsible tubes. Examples are: arteries compressed by a sphygmomanometer

  2. The kingdom and its subjects : charisms, language, economy, and the birth of a progressive politics in the vineyard

    E-Print Network [OSTI]

    Bialecki, Jon


    Public Culture 20(3):453-459. Graeber, David 2001 Toward anformalist debate (see Graeber 2001: 9-12). revenue-

  3. A review of "The Irish Rebellion of 1641 and the Wars of Three Kingdoms" by Eamon Darcy

    E-Print Network [OSTI]

    Bennett, Martyn


    ;#17;#16;#30;. xiv +#18;#16;#16; pp. + #16; illus. $#12;#17;.#17;#17;. Review by ?#8;#21;#25;#20;#26; #7;#28;#26;#26;#28;#25;#25;, #26;?#25;#25; #26;?#24;#8;? #25;#21;#28;#26;#25; #22;#26; #27;#28;#21;#29; #25;#20;. #2;e Irish Rebellion began on the night of #18... and revolutions across Britain and Ireland in the mid-century. It also ensured that it and moreover the oral, written, and illustrated representations of it would resonate throughout the next three and a half centuries. Each ?Marching Season? in the six...

  4. Head Office: 1 Trumpington Street, Cambridge, CB2 1QA, United Kingdom Telephone: +44 (0)1223 768850

    E-Print Network [OSTI]

    infographics and key facts, and summarises the likely impacts of climate change on agriculture, buildings: The significant impact of climate change on agriculture, including reduced crop yields, and predicted food price Invaluable briefing series unpacks climate change impacts for business Scientists, corporate leaders

  5. J. Fluid Mech. (1998), vol. 377, pp. 189222. Printed in the United Kingdom c 1998 Cambridge University Press

    E-Print Network [OSTI]

    Dimitrakopoulos, Panagiotis

    of the lubrication models proves to be extremely limited. The critical shear rate is found to be sensitive) The yield conditions for the displacement of three-dimensional fluid droplets from solid boundaries of the optimization prob- lem provides an upper bound for the yield condition for droplets on solid surfaces

  6. J. Fluid Mech. (1999), vol. 391, pp. 123149. Printed in the United Kingdom c 1999 Cambridge University Press

    E-Print Network [OSTI]

    Renardy, Yuriko

    conditions, the fully nonlinear saturation to steady bamboo waves is achieved. As the speed is increased-dependent. The appearance of vortices and the locations of the extremal values of pressure are investigated for both up material. An industrial application is the lubricated pipelining of crude oil with the addition of water

  7. J. Plasma Physics (2009), vol. 75, part 5, pp. 709711. c 2009 Cambridge University Press Printed in the United Kingdom

    E-Print Network [OSTI]

    Merlino, Robert L.


    gravity, the ion drag force, thermophoretic force and neutral drag force are among the forces considered

  8. CCFE is the fusion research arm of the United Kingdom Atomic Energy Authority Presentation to PhD and

    E-Print Network [OSTI]

    energy consumption (efficiency improvement balances growth) 10 12 14 16 18 20 Gtoe Developing countries FSU/CEE OECD 0 2 4 6 8 1860 Source: World Energy Council, World Bank. The graph for the period 2000-2060 shows a scenario of future energy consumption based on current trends. 1880 1900 19801940 20201920

  9. Eavesdroppers : how scientists are learning to listen in on the animal kingdom : four stories on wildlife and sound

    E-Print Network [OSTI]

    Quill, Elizabeth H. (Elizabeth Helene)


    Typically, if scientists want to study animals in the wild they rely on field observations by eye. If they want to track those species to know where they are, where they are going, and how they behave, then researchers may ...

  10. J. Fluid Mech. (1998), vol. 356, pp. 199220. Printed in the United Kingdom c 1998 Cambridge University Press

    E-Print Network [OSTI]

    Schulze, Tim

    solutions at low Rayleigh numbers, presumably corresponding to stable and unstable portions of a subcritical), NaCl­water solutions (Wettlaufer, Worster

  11. ,"Liquefied U.S. Natural Gas Re-Exports to United Kingdom (Million Cubic Feet)"

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale Proved Reserves (Billion Cubic Feet)" ,"Click worksheet name orSpain

  12. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings of the 27th Symposium On Fusion Technology

    E-Print Network [OSTI]

    , in conjunction with the upgraded neutral beam heating system, to achieve ITER relevant conditions. The design of the bulk Be plasma facing components had to be compatible with increased heating power and pulse length carbon based tiles and be installed by remote handling. Risk reduction measures (prototypes, jigs, etc

  13. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings of the 27th Symposium On Fusion Technology

    E-Print Network [OSTI]

    Engineering and Design, Vol.88, Issues 9-10, October 2013, p.2043-2047 Status of ITER neutral beam cell remote;_______________________________________________________________________________ author's email: Status of ITER Neutral Beam Cell Remote Handling System N Sykesa14 1RJ The ITER neutral beam cell will contain up to three heating neutral beams and one diagnostic

  14. J. Fluid Mech. (1999), vol. 380, pp. 205232. Printed in the United Kingdom c 1999 Cambridge University Press

    E-Print Network [OSTI]

    Shemer, Lev

    Department of Fluid Mechanics and Heat Transfer, Faculty of Engineering, Tel-Aviv University, Tel-Aviv 69978 for remote sensing of the ocean surface by airborne and spaceborne radars. Of particular interest­capillary waves in the remote sensing of the ocean surface partially motivated this study. The present

  15. J. Fluid Mech. (2001), vol. 426, pp. 355386. Printed in the United Kingdom c 2001 Cambridge University Press

    E-Print Network [OSTI]

    Linden, Paul F.

    part of energy expenditure in modern buildings is due to air condi- tioning and other mechanical means of the energy of comparable air-conditioned buildings (Energy Consumption Guide 19, Best Practice Programme of the wind. The flow of wind around a building produces a dynamic (or wind) pressure distribution over its

  16. UCR 05/2013 Washington Academic Internship Program

    E-Print Network [OSTI]

    : Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship


    E-Print Network [OSTI]

    US Army Corps of Engineers

    . Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

  18. PHYSICAL REVIEW E 84, 026109 (2011) Temporal evolution of financial-market correlations

    E-Print Network [OSTI]

    Porter, Mason A.

    Kingdom 3 FX Quantitative Strategy, HSBC Bank, 8 Canada Square, London E14 5HQ, United Kingdom 4 Oxford

  19. Archaism

    E-Print Network [OSTI]

    Kahl, Jochem


    UEE 2010 Figure 7. Late plaster casts of Old Kingdom reliefsevidence, in the form of late plaster casts of Old KingdomModels Figure 7. Late plaster casts of Old Kingdom reliefs

  20. Encore Energy Systems formerly Energy Vision International formerly...

    Open Energy Info (EERE)

    Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

  1. Institute of Chemical Engineering and High Temperature Chemical...

    Open Energy Info (EERE)

    Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

  2. National Interest Security Company NISC Formerly Technology Management...

    Open Energy Info (EERE)

    search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

  3. Wind: wind power density GIS data at 50m above ground and 1km...

    Open Energy Info (EERE)

    of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

  4. E-Print Network 3.0 - aldrich death rode Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

  5. Institute of Photo Electronic Thin Film Devices and Technology...

    Open Energy Info (EERE)

    Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

  6. E-Print Network 3.0 - american industry classification Sample...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

  7. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

  8. E-Print Network 3.0 - acute abdomen pt Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)


  9. Cape Peninsula University of Technology - Centre for Distributed...

    Open Energy Info (EERE)

    Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...


    E-Print Network [OSTI]

    Connor, Ed

    : (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone


    E-Print Network [OSTI]

    de Lijser, Peter

    #________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

  12. Furman Graduate Studies Registration Form Spring 2014 Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

  13. Furman Graduate Studies Registration Form 2013 Fall Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

  14. Hot Topics | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

  15. Furman Graduate Studies Registration Form 2012 Fall Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294


    E-Print Network [OSTI]

    Fernandez, Eduardo

    : ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email


    E-Print Network [OSTI]

    de Lijser, Peter

    #________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

  18. Participant Medical Record Ocean Classroom Foundation

    E-Print Network [OSTI]

    Pontius Jr., Duane H.

    ____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

  19. Furman Graduate Studies Registration Form Spring 2015 Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

  20. Furman Graduate Studies Registration Form 2014 Fall Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

  1. Indian Ministry of New and Renewable Energy formerly Ministry...

    Open Energy Info (EERE)

    Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

  2. E-Print Network 3.0 - assembly competent proteins Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

  3. Hawaii Department of Land and Natural Resources Commission on...

    Open Energy Info (EERE)

    Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

  4. Hawaii Department of Land and Natural Resources Division of Forestry...

    Open Energy Info (EERE)

    Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

  5. Horizontal Plate Plate

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    zip> Description:...

  6. Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...

    Open Energy Info (EERE)

    Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

  7. african higher education: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

  8. affect foreign bank: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

  9. allied irish bank: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

  10. affects higher education: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...


    E-Print Network [OSTI]

    of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

  12. E-Print Network 3.0 - attentional set shifting Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

  13. Wind: wind power density maps at 50m above ground and 1km resolution...

    Open Energy Info (EERE)

    density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

  14. Wind: wind power density maps at 50 m above ground and 1km resolution...

    Open Energy Info (EERE)

    density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

  15. J. Fluid Mech. (2003), vol. 485, pp. 307335. c 2003 Cambridge University Press DOI: 10.1017/S0022112003004518 Printed in the United Kingdom

    E-Print Network [OSTI]

    Eldredge, Jeff

    with bias flow By JEFF D. ELDREDGE AND ANN P. DOWLING Department of Engineering, University of Cambridge Williams (1972). Leppington & Levine (1973) performed the same analysis with the help of an integral equation, which allowed a correction to the Ffowcs Williams result. They also considered the case when

  16. The different urban efforts to revitalize urban neighborhoods in the United States and the United Kingdom: comparative case study based on governmental responses focusing on urban neighborhood revitalization

    E-Print Network [OSTI]

    Ko, Youngho


    of Housing and Urban Development, 1975) Stable and viable #0;? Homogeneous #0;? New #0;? Single family First Grade "A" Area (green) Well-planned, homogeneous population First Stage New residential construction Stage 1 Single-family residential... to be marked by the dramatic fall of employment opportunities as well as decisions by public and private institutions that were detrimental to urban neighborhoods by discouraging investment and support for social and institutional resources in them...

  17. J. Fluid Mech. (2006), vol. 552, pp. 299309. c 2006 Cambridge University Press doi:10.1017/S0022112005008347 Printed in the United Kingdom

    E-Print Network [OSTI]

    Kasman, Alex

    larger than the ambient pressure. We show that the effect of increasing the ambient sound speed in a following reaction zone, which can occur in gaseous, liquid or solid explosives. The idealized detonation the reaction wave structure in detonating liquid and solid explosives, where the extreme high

  18. Bird Conservation International (2003) 13:299306. BirdLife International 2003 DOI: 10.1017/S0959270903003228 Printed in the United Kingdom

    E-Print Network [OSTI]

    Jamieson, Ian

    (Armstrong and McLean 1995, Armstrong et al. 1995). Some studies have attempted to assess translocation, Armstrong et al. 1999, Armstrong and Ewen 2001), or whether survival and reproductive success are enhanced if translocated groups are made up of individuals that are familiar with one another (Armstrong 1995, Armstrong

  19. The municipal solid waste landfill as a source of Montreal Protocol-restricted halocarbons in the United States and United Kingdom

    E-Print Network [OSTI]

    Hodson, Elke L. (Elke Lynn Ann)


    Central to the study of stratospheric ozone recovery and climate change, is the ability to predict emissions of Montreal Protocol-restricted halocarbons (MPGs) over the coming decades. The prediction of emissions has become ...

  20. Systematics and Biodiversity 5 (2): 145158 Issued 25 May 2007 doi:10.1017/S1477200006002180 Printed in the United Kingdom C The Natural History Museum

    E-Print Network [OSTI]

    Olson, Mark

    , represented by Moringa longituba (Moringaceae, the drumstick tree family), from an arborescent ancestral- type

  1. J. Fluid Mech. (2005), vol. 544, pp. 353377. c 2005 Cambridge University Press doi:10.1017/S0022112005006725 Printed in the United Kingdom

    E-Print Network [OSTI]

    Entekhabi, Dara

    to stable minimum-energy configurations #12;354 R. Stocker and A. E. Hosoi (Kalliadasis, Bielarz & Homsy system. The exact integration of the mass conservation equation for a no-slip boundary condition yields al. 2002). Unfortunately, a standard lubrication approach is a priori not expected to be accur- ate

  2. J. Fluid Mech. (2001), vol. 447, pp. 377408. c 2001 Cambridge University Press DOI 10.1017/S0022112001005870 Printed in the United Kingdom

    E-Print Network [OSTI]

    Tufo III, Henry M.

    .05­0.06 for an Atwood number of 0.34; as the Reynolds number is high ( 105 ) in these linear electric motor (LEM. Tufo, A. Dubey and R. Rosner can be thought of as a measure of the efficiency of potential energy

  3. J. Fluid Mech. (2006), vol. 558, pp. 3352. c 2006 Cambridge University Press doi:10.1017/S0022112006009839 Printed in the United Kingdom

    E-Print Network [OSTI]

    Bush, John W.M.


    J. Fluid Mech. (2006), vol. 558, pp. 33­52. c 2006 Cambridge University Press doi:10.1017/S hydraulic jump By JOHN W. M. BUS H1 , JEFFREY M. ARISTOFF1 AND A. E. HOSOI2 1 Department of Mathematics; Nonlinearity, vol. 12, 1999, p. 1) demonstrated that the axial symmetry of the circular hydraulic jump may

  4. J. Fluid Mech. (2009), vol. 633, pp. 285309. c 2009 Cambridge University Press doi:10.1017/S0022112009007034 Printed in the United Kingdom

    E-Print Network [OSTI]

    Hogg, Andrew


    J. Fluid Mech. (2009), vol. 633, pp. 285­309. c 2009 Cambridge University Press doi:10.1017/S conservation of mass and momentum across the shock and thus we show how the hydraulic jump moves within waves form, leading to hydraulic jumps, which translate throughout the domain. Such motions were

  5. J. Fluid Mech. (2008), vol. 606, pp. 75104. c 2008 Cambridge University Press doi:10.1017/S0022112008001572 Printed in the United Kingdom

    E-Print Network [OSTI]


    J. Fluid Mech. (2008), vol. 606, pp. 75­104. c 2008 Cambridge University Press doi:10.1017/S of the dimensionless hydraulic permeability of the Brinkman medium. The free motion of the neutrally buoyant sphere for several values of the dimensionless hydraulic permeability. The work is motivated by insights it offers

  6. J. Fluid Mech. (2002), vol. 464, pp. 279286. c 2002 Cambridge University Press DOI: 10.1017/S0022112002001131 Printed in the United Kingdom

    E-Print Network [OSTI]

    uniform electric and magnetic fields (E, B) is considered. The electric field drives a current J which by the electric field interacts with the magnetic field to produce a rotational Lorentz force. This drives a flow ambient electric and magnetic fields. Part 1. General theory By H. K. MO FFAT T1 AND A. SELLIER2 1

  7. J. Fluid Mech. (2006), vol. 568, pp. 303327. c 2006 Cambridge University Press doi:10.1017/S002211200600231X Printed in the United Kingdom

    E-Print Network [OSTI]

    Muraki, David J.

    triad interaction. For flow over two peaks, the threshold heights for instability are roughly half those. 1. Introduction A mountain, or lee wave is a form of internal gravity wave generated by the flow a dynamical means to produce flow overturning, it represents yet another efficient pathway for the generation

  8. J. Fluid Mech. (2007), vol. 578, pp. 95112. c 2007 Cambridge University Press doi:10.1017/S0022112007004661 Printed in the United Kingdom

    E-Print Network [OSTI]

    Huppert, Herbert

    to pump a given flux of oil through the pipe by lubricating the high shear region near the wall. The flow), motivated in part by the interest of oil companies in pumping viscous oils through pipelines. The inclusion of water, whose viscosity is very much less than the oil, can considerably reduce the pressure needed

  9. The Lichenologist 40(5): 437448 (2008) 2008 British Lichen Society doi:10.1017/S0024282908006610 Printed in the United Kingdom

    E-Print Network [OSTI]

    Herben, Tomas

    the response of the epiphytic lichen vegetation to sulphur air pollution is affected by interaction with other of the total number of lichen species per tree. In general, species sensitive to air pollution decreased, while that the effect of eutrophication (mainly increased bark pH) may ameliorate the effects of air pollution; a local

  10. J. Fluid Mech. (2006), vol. 560, pp. 1951. c 2006 Cambridge University Press doi:10.1017/S002211200600036X Printed in the United Kingdom

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and J. C. Lasheras greatly increases or until they are diagnosed during an incidental exam (Szilagyi

  11. J. Fluid Mech. (2008), vol. 599, pp. 241268. c 2008 Cambridge University Press doi:10.1017/S0022112008000153 Printed in the United Kingdom

    E-Print Network [OSTI]

    Esler, Gavin

    . After a period of initial wave growth, wave breaking leads to turbulence within each layer energy, and the further `kinematic' constraint that the potential vorticity changes through a process, and that an unphysical `exchange' of bands of fluid will occur across the channel in the lower layer. The kinematic

  12. J. Fluid Mech. (2005), vol. 537, pp. 125144. c 2005 Cambridge University Press doi:10.1017/S0022112005005033 Printed in the United Kingdom

    E-Print Network [OSTI]

    Meiburg, Eckart H.

    wave and the internal bore on the basis of the two- layer shallow-water equations, following in reality. Simulations are conducted for fluids with the same kinematic viscosity, as well as for fluids then demands that these energy conserving fronts are connected by an expansion wave, and that a bore forms

  13. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Nuclear Fusion, Vol.53, No.10, October 2013, p.104008

    E-Print Network [OSTI]

    /DEMO and the MAST Upgrade H. Meyer1, I.G. Abel2, R.J. Akers1, A. Allan3, S.Y. Allan1, L.C. Appel1, O. Asunta4, M

  14. Journal of Tropical Ecology (2008) 24:918. Copyright 2008 Cambridge University Press doi:10.1017/S0266467407004695 Printed in the United Kingdom

    E-Print Network [OSTI]

    Bermingham, Eldredge

    dynamics: a cross-site comparison in four lowland tropical forests Margaret R. Metz,1 , Liza S. Comita, Yu

  15. J. Fluid Mech. (2007), vol. 579, pp. 6383. c 2007 Cambridge University Press doi:10.1017/S0022112007005216 Printed in the United Kingdom

    E-Print Network [OSTI]

    of partially wetting liquid. The study is performed in the framework of lubrication theory, in which be described using a universal relation between speed and apparent contact angle, but viscous effects have of environmental and technological contexts, ranging from the treatment of plants to oil-recovery and coating. Yet

  16. J. Fluid Mech. (2005), vol. 541, pp. 293315. c 2005 Cambridge University Press doi:10.1017/S0022112005006105 Printed in the United Kingdom

    E-Print Network [OSTI]

    Daerr, Adrian - Laboratoire Matière et Systèmes Complexes, Université Paris 7

    , the in-plane and out-of-plane angles obeying a simple relationship dictated by a lubrication analysis? At what velocity does it slide and what shape does it assume to accommodate capillary effects and drop oil drops sliding down a glass plate coated with fluoropolymers (Podgorski, Flesselles & Limat 2001

  17. J. Fluid Mech. (2007), vol. 592, pp. 2349. c 2007 Cambridge University Press doi:10.1017/S0022112007008269 Printed in the United Kingdom

    E-Print Network [OSTI]

    Meiburg, Eckart H.

    of stability investigations on immiscible core­annular flows. Motivated by the application of lubricated oil thickness has a uniformly stabilizing effect. The flow is least stable when the interface between the two

  18. J. Fluid Mech. (2005), vol. 527, pp. 115139. c 2005 Cambridge University Press DOI: 10.1017/S0022112004003106 Printed in the United Kingdom

    E-Print Network [OSTI]

    Yang, Vigor

    been of serious concern in the development of high-pressure combustion devices, such as diesel, liquid-propellant rocket and gas-turbine engines. The fuel, initially delivered to the combustion chamber at a subcritical

  19. Journal of Tropical Ecology (2009) 25:541550. Copyright 2009 Cambridge University Press doi:10.1017/S0266467409990113 Printed in the United Kingdom

    E-Print Network [OSTI]

    Howe, Henry F.

    , but most seeds were dispersed by wind. A pattern of seed rain biased strongly towards wind and mortality of seeds and seedlings in the site (Schupp et al. 1989, Svenning & Wright 2005, Tilman 1997 and seedling mortality from random and non-random factors is immense (Harper 1977), with far more seeds

  20. J. Fluid Mech. (2005), vol. 525, pp. 115159. c 2005 Cambridge University Press DOI: 10.1017/S0022112004002629 Printed in the United Kingdom

    E-Print Network [OSTI]

    Maxworthy, Tony

    being dominant. Here, m is the azimuthal wavenumber, and the positive sign represents the counter-winding of the flow fields in natural, forced and transient experiments, we suggest that the helical wave m = +2 absolute instability in the wake region of the breakdown structure. This self-excited oscillation first

  1. J. Fluid Mech. (2004), vol. 507, pp. 142. c 2004 Cambridge University Press DOI: 10.1017/S0022112004007888 Printed in the United Kingdom

    E-Print Network [OSTI]

    Hunt, Julian

    , Aoba-ku, Sendai 980-8577, Japan 2 Departments of Space and Climate Physics and Geological Sciences of Technology, Delft, The Netherlands (Received 14 February 2002 and in revised form 14 November 2003 the turbulence is determined by Nt at the leading order, and the effects of vertical shear generally appear

  2. J. Fluid Mech. (2007), vol. 587, pp. 337346. c 2007 Cambridge University Press doi:10.1017/S0022112007007537 Printed in the United Kingdom

    E-Print Network [OSTI]

    Shashikanth, Banavara N.

    J. Fluid Mech. (2007), vol. 587, pp. 337­346. c 2007 Cambridge University Press doi:10.1017/S. JOUANNE2 AND B. N. SHASHIKANTH1 1 Department of Mechanical Engineering, New Mexico State University, NM, USA 2 Department of Mechanical Engineering, l'Ecole Polytechnique, Universit´e de Nantes, France

  3. J. Fluid Mech. (2006), vol. 556, pp. 283308. c 2006 Cambridge University Press doi:10.1017/S0022112006009633 Printed in the United Kingdom

    E-Print Network [OSTI]

    J. Fluid Mech. (2006), vol. 556, pp. 283­308. c 2006 Cambridge University Press doi:10.1017/S Microfluids Laboratory, Department of Mechanical Engineering, MIT, Cambridge, MA 02139, USA 2 Universit of uniform threads connecting spherical fluid drops. In this paper, high-precision meas- urements

  4. J. Fluid Mech. (2009), vol. 629, pp. 231262. c 2009 Cambridge University Press doi:10.1017/S0022112009006351 Printed in the United Kingdom

    E-Print Network [OSTI]

    Dabiri, John O.

    precursor and water-hammer shocks that arise from the re-entrant jet formation and its impact upon the distal side of the bubble, respectively. The water-hammer shock can generate very high pressures-entrant jet (Haas & Sturtevant 1987; Bourne & Field 1992). The water-hammer pressure associated with the jet

  5. J. Fluid Mech. (2007), vol. 572, pp. 111120. c 2007 Cambridge University Press doi:10.1017/S0022112006003648 Printed in the United Kingdom

    E-Print Network [OSTI]

    Bou-Zeid, Elie

    October 2006) We use direct Lyapunov exponents (DLE) to identify Lagrangian coherent structures in two find that, despite additional computational cost, the DLE method has several advantages over Eulerian on a preselected threshold. As a further advantage, the DLE method requires no velocity derivatives, which

  6. Transcribed from: The Electric Infrastructure Security Summit III, London, May 14-15 2012, The Houses of Parliament, United Kingdom 1 The Electric Infrastructure

    E-Print Network [OSTI]

    Schrijver, Karel

    for investment in e-threat grid protection in the UK Indeed one of the big challenges that we as politicians face across international borders. I'd like to give a particular welcome to the representatives from around

  7. 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Fusion Engineering and Design, Vol.88, Issues 9-10,

    E-Print Network [OSTI]

    high heat flux cooling systems Barrett T R, Robinson S, Flinders K, Sergis A, Hardalupas Y The Version Cooling Systems Thomas R. Barretta , S. Robinsona , K. Flindersa , A. Sergisb , Y. Hardalupasb a EURATOM cooling [3] while retaining all the advantages of water. The exciting prospect of nanofluids has motivated

  8. J. Fluid Mech. (2009), vol. 619, pp. 7994. c 2008 Cambridge University Press doi:10.1017/S0022112008004370 Printed in the United Kingdom

    E-Print Network [OSTI]

    Boyer, Edmond

    in a turbulent self-sustained mechanism (Jim´enez & Moin 1991; Hamilton, Kim & Waleffe 1995; Waleffe 1995; Ellingsen & Palm 1975; Landahl 1980) is an important process embedded in this self-sustained mechanism

  9. J. Fluid Mech. (2008), vol. 605, pp. 429443. c 2008 Cambridge University Press doi:10.1017/S0022112008000323 Printed in the United Kingdom

    E-Print Network [OSTI]

    Boyer, Edmond

    results from the ability of the flow to self-sustain perturbations, is studied through a modal stability dynamics similar to the self-sustained oscillations observed in bluff body flows, or an amplifier dynamics

  10. J. Fluid Mech. (2007), vol. 577, pp. 137159. c 2007 Cambridge University Press doi:10.1017/S0022112007004624 Printed in the United Kingdom

    E-Print Network [OSTI]


    of phase-locked upward and downward propagating beams, which are characterized by both horizontal. A possible mechanism is identified for the excitation of vortex cores that are lifted over the shelf break

  11. Robotica (2004) volume 22, pp. 599609. 2004 Cambridge University Press DOI: 10.1017/S0263574704000396 Printed in the United Kingdom

    E-Print Network [OSTI]

    Kim, Jongwon

    Robotica (2004) volume 22, pp. 599­609. © 2004 Cambridge University Press DOI: 10.1017/S, and manufacturability consideration. Part II on real machine design will follow in the next issue of Robotica. KEYWORDS

  12. Conceptualisations of citizenship in Sweden and the United Kingdom: an empirical study and analysis of how ‘citizenship’ is understood in policy and by policy-makers. 

    E-Print Network [OSTI]

    McIver, Scott Iain


    This empirical study identifies and analyses what conceptualisations of citizenship emerge in policy thinking around naturalisation and how these conceptualisations have been articulated in citizenship policy and by policy-makers in the two specific...

  13. J. Fluid Mech. (2007), vol. 591, pp. 97116. c 2007 Cambridge University Press doi:10.1017/S0022112007007732 Printed in the United Kingdom

    E-Print Network [OSTI]

    Bolster, Diogo

    ) and energy consumption. The US Energy Information Administration states that approximately 10% of the total energy consumption in the USA is consumed by heating, cooling and ventilation of buildings. Currently buoyant economies will boost demand. Furthermore the US Energy Information Administration states

  14. Journal of Tropical Ecology (2007) 23:715719. Copyright 2007 Cambridge University Press doi:10.1017/S0266467407004440 Printed in the United Kingdom

    E-Print Network [OSTI]

    Bermingham, Eldredge

    Journal of Tropical Ecology (2007) 23:715­719. Copyright © 2007 Cambridge University Press doi:10, multi-trophic interactions, Theobroma cacao In the Neotropics, crops that are grown in agroforestry systems with shade trees support high levels of bird diversity compared with crops grown without shade

  15. J. Fluid Mech. (2009), vol. 626, pp. 211240. c 2009 Cambridge University Press doi:10.1017/S0022112009005795 Printed in the United Kingdom

    E-Print Network [OSTI]

    Bush, John W.M.

    geometries. Particular attention is given to the influence of the fluid viscosity on the evolution of the sheet and its bounding rim. In both geometries, after a transient that depends on the sheet viscosity rupture can be either desirable, as in spray formation (e.g. Pomeau & Villermaux 2006), or undesirable

  16. J. Fluid Mech. (2006), vol. 553, pp. 227252. c 2006 Cambridge University Press doi:10.1017/S0022112006008810 Printed in the United Kingdom

    E-Print Network [OSTI]

    Abdou, Mohamed

    is established. Similarities and differences with the flow around solid obstacles are discussed. 1. Introduction The effect of a uniform magnetic field on the flow around solid obstacles has attrac- ted the attention of many researchers since the pioneering works by Stewartson (1956) and Ludford (1960). Kolesnikov

  17. Mycologist, Volume 19, Part 2 May 2005. Cambridge University Press Printed in the United Kingdom. DOI: 10.1017/S0269915X0500203X

    E-Print Network [OSTI]

    species of morels occur in western North America; however, most do not have valid scientific names (Weber attention from scientists in North America. We are unaware of any validly published scientific names Morchella species harvested as non-timber forest products in Idaho and Montana ERIKA M. MCFARLANE1 , DAVID

  18. J. Fluid Mech. (2007), vol. 582, pp. 341376. c 2007 Cambridge University Press doi:10.1017/S0022112007005903 Printed in the United Kingdom

    E-Print Network [OSTI]

    Boyer, Edmond

    repeated for different fuel types (methane, propylene and propane), transitional and turbulent microgravity buoyancy induced by heat release or buoyancy arising from a non-unity ratio of the density of air. The latter effect is present in many combustion applications in which the density of the fuel does not match

  19. Epidemiol. Infect. (1999), 123, 511513. Printed in the United Kingdom # 1999 Cambridge University Press Determination of natural versus laboratory human infection

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , a French overseas Department between Surinam and Brazil. In this region, Mayaro infections are currently with Mayaro virus. Virus was recovered from Vero cell culture super- natants infected with the early blood

  20. Theory of spin-transfer torque in the current-in-plane geometries Department of Mathematics, Imperial College, London SW7 2BZ, United Kingdom

    E-Print Network [OSTI]

    Umerski, Andrey

    the lateral dimensions of the switching magnet are of the order of 50­100 interatomic distances, i.e., about the switching magnet and nonmagnetic spacer. Polarization achieved using a lateral magnet in the CIP geometry then flows through a non- magnetic layer the spacer layer and becomes partially or fully absorbed

  1. J. Plasma Physics (2003), vol. 69, part 5, pp. 397412. c 2003 Cambridge University Press DOI: 10.1017/S0022377803002241 Printed in the United Kingdom

    E-Print Network [OSTI]

    Tatsuno, Tomoya

    O S H I D A Graduate School of Frontier Sciences, University of Tokyo, Tokyo 113-0033, Japan (hirota associated with multiple continuous spectra. Since the generating operator is non- Hermitian produces an essential singularity generating a continuous spectrum [1]. We consider a simple model

  2. JFP 16 (6): 663670, 2006. c 2006 Cambridge University Press doi:10.1017/S0956796806006149 First published online 14 September 2006 Printed in the United Kingdom

    E-Print Network [OSTI]

    Yi, Kwangkeun "Kwang"

    , even essential, in developing both correct and efficient programs. 1 Introduction Harper (Harper, 1999-order continuation-passing style (CPS), making it inaccessible to beginning students. If we wish to teach. In short, our new version can #12;664 K. Yi convince students that the idea is useful, even essential

  3. J. Fluid Mech. (2006), vol. 554, pp. 393409. c 2006 Cambridge University Press doi:10.1017/S0022112006008974 Printed in the United Kingdom

    E-Print Network [OSTI]

    frequency is given, within 10 % accuracy, by the absolute frequency at the front location and, as expected, within 2 % accuracy, by the absolute frequency at the convective/absolute instability boundary. More strikingly, this same criterion has been demonstrated by Pier (2002) to predict within 10 % accuracy the von

  4. J. Fluid Mech. (2006), vol. 556, pp. 121146. c 2006 Cambridge University Press doi:10.1017/S0022112006009463 Printed in the United Kingdom

    E-Print Network [OSTI]

    of Physics, DK-2800 Kgs. Lyngby, Denmark 3 Risø National Laboratory, Optics and Plasma Research Department

  5. J. Fluid Mech. (2006), vol. 565, pp. 363380. c 2006 Cambridge University Press doi:10.1017/S0022112006001455 Printed in the United Kingdom

    E-Print Network [OSTI]

    Huppert, Herbert

    a one-layer shallow-water model and Navier­Stokes finite-difference simulations. There is good agreement a nose propagating into an unstratified ambient; and (b) currents propagating at subcritical speed of the current in the subcritical case has no significant influence on the energy balance of the current. 1

  6. J. Fluid Mech. (2008), vol. 595, pp. 265290. c 2008 Cambridge University Press doi:10.1017/S0022112007009238 Printed in the United Kingdom

    E-Print Network [OSTI]

    Boyer, Edmond

    instability in a finite-length rotating cylinder subject to periodic axial compression by small sinusoidal inertial- wave (Kelvin) modes of the cylinder and the oscillatory compression and is resisted by viscosity with frequency near to half that of compression, or a pair of non-axisymmetric modes of the same azimuthal

  7. Acta Numerica (2006), pp. 385470 c Cambridge University Press, 2006 doi: 10.1017/S0962492906250013 Printed in the United Kingdom

    E-Print Network [OSTI]

    Higdon, Robert L.

    serves to moderate the temperature differences caused by unequal solar heating. In the case of the ocean of the atmosphere and ocean move large amounts of heat from tropical regions to higher latitudes, and this transport in a recent report by the Intergovernmental Panel on Climate Change (2001). More localized aspects of ocean

  8. J. Fluid Mech. (2006), vol. 568, pp. 351386. c 2006 Cambridge University Press doi:10.1017/S0022112006002540 Printed in the United Kingdom

    E-Print Network [OSTI]

    Brown, Eric

    distribution p( ), i.e. there was no dominant value of and small were more common than large ones expansion coefficient, g the acceleration due to gravity, T the applied temperature difference, L the height; Funfschilling & Ahlers 2004; Sun et al. 2005a, b Tsuji et al. 2005), #12;352 E. Brown and G. Ahlers also known

  9. J. Fluid Mech. (2003), vol. 481, pp. 385411. c 2003 Cambridge University Press DOI: 10.1017/S0022112003003938 Printed in the United Kingdom

    E-Print Network [OSTI]

    Feng, James J.


    numbers by a finite-element method, and the motion of solid particles is tracked using an arbitrary, which couple the fluid dynamics with heat and mass transfer. As a step toward understanding heat transfer. The two- dimensional Navier­Stokes and energy equations are solved at moderate Reynolds

  10. Is Spain a Statist Society? A Research Perspective on Organizations, Reflexivity and Collective Action

    E-Print Network [OSTI]

    Larańa, Enrique


    the United Kingdom and Spain”, Dirección General de Cienciathe United Kingdom and Spain. ” Dirección General de Ciencia1994b. “Social Movements in Spain. ” Tocqueville Revue, Vol.

  11. E-Print Network 3.0 - acidophilic bioleaching-associated bacteria...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    for: acidophilic bioleaching-associated bacteria Page: << < 1 2 3 4 5 > >> 1 Biodiversity II: Kingdoms Eubacteria and Archaebacteria Summary: 1 Biodiversity II: Kingdoms...

  12. E-Print Network 3.0 - acidophilic bacteria kosansei Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    search results for: acidophilic bacteria kosansei Page: << < 1 2 3 4 5 > >> 1 Biodiversity II: Kingdoms Eubacteria and Archaebacteria Summary: 1 Biodiversity II: Kingdoms...

  13. Postprandial Lipoproteins and Cardiovascular Disease Risk in Diabetes Mellitus

    E-Print Network [OSTI]

    Enkhmaa, Byambaa; Ozturk, Zeynep; Anuurad, Erdembileg; Berglund, Lars


    Kingdom Prospec- tive Diabetes Study. Diabetologia 1997, 40(United Kingdom Prospective Diabetes Study, fasting TG levelHerman WH: Global burden of diabetes, 1995–2025: prevalence,

  14. Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  15. Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  16. Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  17. Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  18. Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  19. STUDENT / PARENT INFORMATION MAIL DELIVERY ON CAMPUS The information below provides the basic information you need to send and receive United States

    E-Print Network [OSTI]

    Moore, Paul A.

    West Street Address (if applicable) 522 Thurstin Ave. Bowling Green State University Bowling Green State University City, State and Zip Code Bowling Green, OH 43403-4603 Please note that BGSU has its own zip code, 43403, which is unique from the city of Bowling Green (43402). Please ensure to include

  20. Reference Buildings by Building Type: Secondary school

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  1. Reference Buildings by Building Type: Primary school

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  2. Sandia Group Medicare Advantage Plan Enrollment Form Senior Advantage Health Plan Choices (Choose One)

    E-Print Network [OSTI]

    Fuerschbach, Phillip

    Home Phone: Cell: E-Mail Address: Permanent Residence Address: City: State: Zip Code: County: Mailing Address (only if different from your Permanent Residence Address): City: State: Zip Code: County drug coverage, including other private insurance, TRI- CARE, Federal employee health benefits coverage

  3. 2011 ODU Game Development Summer Camp Registration Form Child's Name Date of Birth Sex

    E-Print Network [OSTI]

    Contacts Primary Emergency Contact Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work or Cell Phone Home Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information's/Guardian's Name Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work Phone Home Phone Work Phone Address Address

  4. Finance Division Employee Status Form Finance Division

    E-Print Network [OSTI]

    Crews, Stephen

    's Date: Employee Name: Home Address: City/State: Zip/Postal Code: Work Phone Home Phone: Cell Phone Phone: Work Phone: Cell Phone: Relationship: Name (2): Address: State/Province: Zip/Postal Code: Home Phone: Work Phone: Cell Phone: Relationship: Special Notes: Department New Employee Resignation Change

  5. University of Washington Transplant Services Rev. 5/23/02

    E-Print Network [OSTI]

    Borenstein, Elhanan

    .: City: State: Country: Zip Code: - Home Phone: Work Phone: Ext.: Cell Phone: Home Phone: Cell phone: Work Phone: DEMOGRAPHIC INFORMATION LIVING KIDNEY DONOR FORM #12;University to you: Street Address: Apt No: City, State, Zip: Home Phone: Cell phone: Work Phone: EMPLOYER Name

  6. UCR 09/2014 Washington Academic Internship Program

    E-Print Network [OSTI]

    : Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if different from above: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 09/2014 Do you currently receive): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship: Address: City: State

  7. #~i;:~~.:(' . AQUATIC PLANT CONTROL

    E-Print Network [OSTI]

    US Army Corps of Engineers

    -4 EFFECTS OF WATER CHEMISTRY ON SUBMERSED AQUATIC PLANTS: A SYNTHESIS by R. Michael Smart Environmental. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City. State, and ZIP Code) 3909 Halls Ferry Road IDENTIFICATION NUMBER ORGANIZATION (If applicable) US Army Corps of Engineers Be. ADDRESS (City, Stitte

  8. LES VOYAGEURS College of Agriculture Ambassadors

    E-Print Network [OSTI]

    . - Uphold the policies outlined by the LSU Code of Student Conduct. - Make a commitment of time and energy area of study, questions regarding the transition into college life, campus activities, and other address City State Zip Local phone number Home phone number Home address City State Zip Country E

  9. Note: The State Clearinghouse will assign identification numbers for all new projects. If a SCH number already exists for a project (e.g. Notice of Preparation or previous draft document) please fill in.

    E-Print Network [OSTI]

    : City: Zip: County: Project Location: County: City/Nearest Community: Cross Streets: Zip Code: Longitude Waste Land Use Drainage/Absorption Population/Housing Balance Toxic/Hazardous Cumulative Effects For LCNG Fueling Facility California Energy Commission Donald Coe 1516 Ninth Street (916) 654

  10. Reference Buildings by Building Type: Outpatient health care

    Broader source: [DOE]

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  11. Reference Buildings by Building Type: Hospital

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  12. Reference Buildings by Building Type: Full service restaurant

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  13. Reference Buildings by Building Type: Large office

    Office of Energy Efficiency and Renewable Energy (EERE)

    In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

  14. Introduction to SAS Programming Registration Form

    E-Print Network [OSTI]

    * Date of Birth Employer Job Title Work Address * Home Address City / State / Zip * City / State / Zip a certificate, you must complete at least 80% of the online quizzes and programming activities with scores of 70% or higher. Certificates of completion may take up to two weeks to process once your program has concluded

  15. UPS, the UPS brandmark and the color brown are trademarks that are used with permission by the owner, United Parcel Service of America, Inc. All rights reserved. You may type directly into this form

    E-Print Network [OSTI]

    Jones, Michelle

    UPS, the UPS brandmark and the color brown are trademarks that are used with permission VALUE Post / Zip Post / Zip UPS NEXT DAY AIR® Most deliveries made by 10:30 a.m. UPS GROUND Delivery in 1­5 business days (in-state deliveries usually arrive next day) UPS WORLDWIDE SAVERSM Int'l Service

  16. Help reduce the cost of complying with Sarbanes-

    E-Print Network [OSTI]

    Engineering Institute (SEI) · The ITIL (IT Infrastructure Library) framework, governed by the United Kingdom

  17. Shellfish consumption and intertidal occupancy review, Sellafield, 2004. This note describes a review of public radiation exposure pathways due to liquid radioactive

    E-Print Network [OSTI]

    Nuclear Fuels plc (BNFL), Sellafield and the United Kingdom Atomic Energy Authority (UKAEA), Windscale

  18. unknown title

    E-Print Network [OSTI]

    unknown authors

    Nuclear Fuels plc (BNFL), Sellafield and the United Kingdom Atomic Energy Authority (UKAEA), Windscale

  19. Research article Inhibition of SnRK1 by metabolites: Tissue-dependent effects and cooperative

    E-Print Network [OSTI]

    Davis, Ben G.

    , Hertfordshire AL5 2JQ, United Kingdom b Instituto de Tecnologia Química e Biológica, Laboratório de

  20. ACTING IN ORGANIZATIONS Students provide consulting services to external clients in this intensive real-world project.

    E-Print Network [OSTI]

    Huang, Jianyu

    , ROC Taiwan, Russia,Turkey, United Arab Emirates, United Kingdom, Venezuela #12;Analysis Group, Inc. AT

  1. Im Rahmen der Vorlesung Bank-und Kapitalmarktrecht veranstaltet der Lehrstuhl fr

    E-Print Network [OSTI]

    Schubart, Christoph

    Papua New Guinea Saudi Arabia Singapore Spain Sweden United Arab Emirates United Kingdom United States


    E-Print Network [OSTI]

    Royal Holloway, University of London


  3. The case of polar lows (Invited) H. von Storch1, 3; M. Zahn2

    E-Print Network [OSTI]

    Zahn, Matthias

    , Geesthacht, Germany. 2. Enviromental Systems Science Center, University of Reading, Reading, United Kingdom

  4. 1194 VOLUME 10J O U R N A L O F C L I M A T E 1997 American Meteorological Society

    E-Print Network [OSTI]

    Xue, Yongkang

    , United Kingdom u Institute for Atmospheric Physics, GKSS­Research Center, Max-Planck-Strasse, Geesthacht

  5. PUBLISHED VERSION Coherence imaging of scrape-off-layer and divertor impurity flows in the Mega Amp Spherical

    E-Print Network [OSTI]

    Kingdom 3 Plasma Research Laboratory, Australian National University, Canberra, ACT 0200, Australia 4 York

  6. China Energy Databook -- User Guide and Documentation, Version 7.0

    E-Print Network [OSTI]

    Fridley, Ed., David


    Thailand Tunisia Turkey Uganda UAE United Kingdom United States Vietnam Rep. Yemen Other [4] Total Coal &

  7. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    | Month | | | Persian | Total | Non | United | | Gulf(1) | OPEC(2) | OPEC | Kingdom | Venezuela| | | ||||| 1983...

  8. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    | Month | | | Persian | Total | Non | United | | Gulf(2) | OPEC(3) | OPEC | Kingdom | Venezuela | | | |||||...

  9. Proc. Natl. Acad. Sci. USA Vol. 95, pp. 60736078, May 1998

    E-Print Network [OSTI]

    Kingdom Communicated by David R. Davies, National Institute of Diabetes, Bethesda, MD, March 16, 1998

  10. Pale cyst nematode Globodera pallida Michigan State University's invasive species factsheets

    E-Print Network [OSTI]

    , United Kingdom; Latin America: Argentina, Bolivia, Chile, Colombia, Ecuador, Panama, Peru, Venezuela

  11. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    | Month | | | Persian | Total | Non | United | | Gulf(1) | OPEC(2) | OPEC | Kingdom | Venezuela| | | ||||| 1978...

  12. --No Title--

    U.S. Energy Information Administration (EIA) Indexed Site

    | Month | | | Persian | Total | Non | United | | Gulf(1) | OPEC(2) | OPEC | Kingdom | Venezuela | | | |||||...

  13. A Second-Site Noncomplementation Screen for Modifiers of Rho1 Signaling during Imaginal Disc Morpogenesis in Drosophila

    E-Print Network [OSTI]

    Patch, Kistie; Stewart, Shannon; Welch, Aaron; Ward, Robert


    +/+ RhoGEF2 11-3b 21 31 (239) 25 75 (61) Rho1 E3.10 +/+ RhoGEF2 11-3b 21 20 (143) 25 20 (30) Rho1 k02107b +/+ RhoGEF2 11-3b 21 80 (5) 25 100 (9) Rho1 J3.8 +/+ RhoGEF2 11-3b 21 55 (62) 25 91 (22) Rho1 E(br)246 +/+ zip E(br) 21 50 (82) 25 66 (44) Rho1 E...(br)233 +/+ zip E(br) 21 20 (102) 25 66 (29) Rho1 E3.10 +/+ zip E(br) 21 ND 25 33 (12) Rho1 k02107b +/+ zip E(br) 21 ND 25 ND Rho1 J3.8 +/+ zip E(br) 21 95 (20) 25 97 (30) a Balanced, Rho heterozygous mutant virgin females were crossed to either w 1118...

  14. Driving Demand for Home Energy Improvements: Motivating residential customers to invest in comprehensive upgrades that eliminate energy waste, avoid high utility bills, and spur the economy

    E-Print Network [OSTI]

    Fuller, Merrian C.


    Conservation Corporation (WECC). The project‘s goal was toConservation Corporation (WECC was contracted to support theRESNET RFP RPV SMUD VCEM WECC ZIP Baltimore Neighborhood

  15. Matlab-Kinect Interface Code

    E-Print Network [OSTI]

    Kowalski, Kevin


    This .zip file contains code and installation instructions for acquiring 3d arm movements in Matlab using the Microsoft Kinect 3d camera. The provided code has been validated in 32-bit and 64-bit Matlab with 32-bit and ...

  16. GT Human Resources PERSONAL DATA FORM

    E-Print Network [OSTI]

    Jacobs, Laurence J.

    GT Human Resources PERSONAL DATA FORM Page 1 Updated: 05/01/2014 Student Employee? Yes No Print clearly using black or blue ink. Personal Information Name) __________________________________________________________________________________________ (City) (State) (Zip) (County) Personal Telephone #: (_______)________-__________ GT Work Telephone

  17. E-Print Network 3.0 - approaches reveal splicing Sample Search...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RNA Structures... Structures at Mammalian Splice Sites Keywords: RNA secondary structure; looping-out; long-range; alternative... splicing; SF1; HNRNPK; ZFX; ZIP7; SLC39A7; ZNF384;...


    E-Print Network [OSTI]

    Alpay, S. Pamir

    CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' CONFERENCE Thursday, January 15, 2015 Maneeley. Connecticut Vegetable & Small Fruit Growers' Conference (We need folks to pre-register so Maneeley's has:______________________________________ ---- Town:______________ State:_____ Zip:____________ ---- Check off: Vegetable grower ___ Fruit grower


    E-Print Network [OSTI]

    de Lijser, Peter

    ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name Remit to Address City State Zip Code SECTION 2 INSTRUCTIONS Use the link to view approved categories. Vendor Number (if known) DP Requester AP Entry Check

  20. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    1A Miami, Florida Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida In addition to the ZIP file for each building type, you can directly view the...

  1. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    B Boulder, Colorado Reference Buildings by Climate Zone and Representative City: 5B Boulder, Colorado In addition to the ZIP file for each building type, you can directly view the...

  2. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    A Chicago, Illinois Reference Buildings by Climate Zone and Representative City: 5A Chicago, Illinois In addition to the ZIP file for each building type, you can directly view the...

  3. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    B Phoenix, Arizona Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona In addition to the ZIP file for each building type, you can directly view the...

  4. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    7 Duluth, Minnesota Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota In addition to the ZIP file for each building type, you can directly view the...

  5. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    A Baltimore, Maryland Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland In addition to the ZIP file for each building type, you can directly view...

  6. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    C Seattle, Washington Reference Buildings by Climate Zone and Representative City: 4C Seattle, Washington In addition to the ZIP file for each building type, you can directly view...

  7. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    A Atlanta, Georgia Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia In addition to the ZIP file for each building type, you can directly view the...

  8. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    8 Fairbanks, Alaska Reference Buildings by Climate Zone and Representative City: 8 Fairbanks, Alaska In addition to the ZIP file for each building type, you can directly view the...

  9. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    B Las Vegas, Nevada Reference Buildings by Climate Zone and Representative City: 3B Las Vegas, Nevada In addition to the ZIP file for each building type, you can directly view the...

  10. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    A Houston, Texas Reference Buildings by Climate Zone and Representative City: 2A Houston, Texas In addition to the ZIP file for each building type, you can directly view the...

  11. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    B Helena, Montana Reference Buildings by Climate Zone and Representative City: 6B Helena, Montana In addition to the ZIP file for each building type, you can directly view the...

  12. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    C San Francisco, California Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California In addition to the ZIP file for each building type, you can...

  13. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    B Los Angeles, California Reference Buildings by Climate Zone and Representative City: 3B Los Angeles, California In addition to the ZIP file for each building type, you can...


    E-Print Network [OSTI]

    Collins, Gary S.

    ) (State) (Zip) (County if Washington) Gender M F Date of Birth Place of Birth Are you a citizen of the U State University: Fall (year) Spring (year) Summer (year) Location: Pullman Spokane Tri-Cities Vancouver


    E-Print Network [OSTI]

    Collins, Gary S.

    -Mail Address Present address (Street) (City) (State) (Zip) (County if Washington) Telephone (Work) (Home 20 Location: Pullman Spokane Tri-Cities Vancouver Global Campus (On-line) I am stating

  16. The Evolution of a Modular Software Network Miguel A. Fortuna

    E-Print Network [OSTI]

    Fortuna, Miguel A.

    The Evolution of a Modular Software Network Miguel A. Fortuna , Juan A. Bonachela, and Simon A the website of this journal as a zip folder. To whom correspondence should be addressed. E-mail: fortuna


    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site


  18. Furman Graduate Studies Registration Form 2013 Spring Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: To register, complete

  19. Furman Graduate Studies Registration Form 2013 Summer Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: To register, complete


    E-Print Network [OSTI]

    Barrett, Jeffrey A.

    : Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status: Single Preferred Phone: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status Last Relationship to Student: Language Spoken at Home: Address: Street City State Zip Preferred Phone

  1. Child Information: Our Little Village

    E-Print Network [OSTI]

    Escher, Christine

    /State/Zip Parent Information: Student ID #: _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email Insurance Information: Provider Provider Phone Policy Holder Policy

  2. Schiefelbusch Hearing Clinic

    E-Print Network [OSTI]

    _______ Zip_____________ E-Mail Cell Phone (____)_____________ Day Phone (____)_______________ Evening Phone to Jane Wegner by email at or by phone at 864-4690. Camper Information Camper Name

  3. Furman Graduate Studies Registration Form 2014 Summer Term

    E-Print Network [OSTI]

    _____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: To register, complete

  4. UT EID# __________ Student ID #: __________ AY: 20____ -20____ School: ____________________________ Grade: ________________

    E-Print Network [OSTI]

    Texas at Austin, University of

    : ___________________________________________ _________________________________________________________ CITY STATE ZIP Home Phone: ___________________ Cell#: __________________ Student Email _________________ ______________ ___________ __________ Parent(1)/Guardian Address Home Phone # Work Phone # Primary Language _________________ ______________ ___________ __________ Parent(2)/Guardian Address Home Phone # Work Phone # Primary Language In case of an emergency, contact

  5. Trends in template/fragment-free protein structure prediction

    E-Print Network [OSTI]

    Zhou, Yaoqi; Duan, Yong; Yang, Yuedong; Faraggi, Eshel; Lei, Hongxing


    1998) Pathways to a protein folding intermediate observed instudy of all-atom protein folding and structure predic-JD, Dill KA (2007) Protein folding by zipping and assembly.

  6. T-612: False Positive Detection Generic.dx!yxk in DAT 6329 |...

    Broader source: (indexed) [DOE]

    in This can be deployed via a Group Policy if you have Active Directory as described below. Addthis Related Articles V-101: McAfee VirusScan Enterprise Lets...

  7. arabidopsis bzip transcription: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor Texas A&M University -...

  8. University of New Hampshire Project SMART

    E-Print Network [OSTI]

    New Hampshire, University of

    University of New Hampshire Project SMART Student Application Form Summer Institute: July 2: ____________________ (Please include first, middle initial and last name) Home Address: _____________________________ City/Junior): _______ School Address: ______________________________ City, State, Zip Code: ____________________ List

  9. Covanta Energy Corporation formerly Ogden Martin Systems of Hillsborou...

    Open Energy Info (EERE)

    Inc) Place: Fairfield, New Jersey Zip: 7004 Product: Owner and operator of modern waste-to-energy facilities (over 1GW). Coordinates: 47.38522, -117.171254 Show Map...


    E-Print Network [OSTI]

    program located in the state of Michigan, and qualify for some form of financial aid which can be verified __________________________________________________________ City ______________________________________ MI Zip Code ________________ App Classification: ____Fr ______________________________________ A complete Scholarship Application must include the following: 1. A statement expressing your educational

  11. OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name

    E-Print Network [OSTI]

    OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone BBGS-001WS 1.50 Total Fees ($) Fee Adjustment Instructions: 1. Complete the fee collector's name

  12. OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name

    E-Print Network [OSTI]

    OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone Verification: Instructions: 1. Complete the fee collector's name, address, phone number, crab receiver permit

  13. C:\\...\\mailquestionnaire. [PFP#1121010499

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]


  14. Nanoscience Discovery AcademyNanoscience Discovery Academy A two-week Science Academy for 9th

    E-Print Network [OSTI]

    Houston area high schools Students competitively selected What Hands-on exposure to environmental science researchers using nanotechnology to tackle civilization's grand challenges ­ energy, water, environment and Street ________________________________________________________________________ City State Zip 3. E

  15. USAJOBS -Search Jobs[6/23/2011 2:47:01 PM

    E-Print Network [OSTI]

    Behmer, Spencer T.

    sensing-based energy balance ET algorithms (EB-ET) - Soil and Water Assessment Tool (SWAT) - ground water: (keywords) Where: (U.S. city, state or zip code) Go to section of this Job: #12;USAJOBS - Search Jobs http

  16. THE OSHER REENTRY SCHOLARSHIP AWARD The Bernard Osher Foundation Reentry scholarship targets students who did not have the

    E-Print Network [OSTI]

    Huang, Jianyu

    PHILANTHROPY: INVESTING IN YOU Venture philanthropy brings a new intensity and energy to providing scholarships in the future of students who have demonstrated the ability to balance work and competing demands with college City Zip

  17. E-Print Network 3.0 - aus der uebung Sample Search Results

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Information Sciences 2 Institut fur Computational Science Dept. of Computer Science, ETH Zurich Summary: . In fin- den Sie das C-Programm integrateNeedleMap zur...

  18. PARS II CPP Upload Template File | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site More Documents & Publications Proposed Data Elements for PARS II Web Application PARS II - Integrated Project Team Meeting PARS II End-of-Month Checklist...


    E-Print Network [OSTI]

    program in order to reduce Federal employee's contribution to traffic congestion and air pollutionUNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION PUBLIC TRANSPORTATION BENEFIT PROGRAM): ____________ City (Residence): __________________________State: _______________ Zip Code: ________________ Air Force

  20. Designing libraries of chimeric proteins using SCHEMA recombination Matthew A. Smith and Frances H. Arnold*

    E-Print Network [OSTI]

    Arnold, Frances H.

    1 Designing libraries of chimeric proteins using SCHEMA recombination and RASPP Matthew A. Smith toolbox. This is available from: 3

  1. Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold*

    E-Print Network [OSTI]

    Arnold, Frances H.

    1 Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold* Division downloaded and unpacked. This is available from: 3

  2. 2/1/2014 Using TinyWindmills To Power Portable Electronics 1/2

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    NEWSLETTERS ADVERTISE SEARCH Cost Of Solar Panels Enter Your Zip Code & Connect. Pre: Climate Impacts Could Lead To Drastic Increases In Food Prices Over Coming Decades Wind Power Growth

  3. International Oil and Gas Board International Oil and Gas Board...

    Open Energy Info (EERE)

    Oil and Gas Board Address Place Zip Website Abu Dhabi Supreme Petroleum Council Abu Dhabi Supreme Petroleum Council Abu Dhabi http www abudhabi ae egovPoolPortal WAR appmanager...


    E-Print Network [OSTI]

    Tsien, Roger Y.

    Personal Data Name: Last First Middle Home Address Street Phone: City, State, Zip E-mail Date of Birth: Sex degree Location of the Institution Degrees or Certificates Dates of Attendance Subject or Field Date

  5. University of Kentucky Automatic Bank Draft Donation Agreement

    E-Print Network [OSTI]

    Hayes, Jane E.

    University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account for purpose of charitable donations. Donations paid by bank draft

  6. To the student: The top portion of this form should be completed by you and given to the recommender who has agreed to provide you with an academic recommendation to accompany your application to the University of Kentucky.

    E-Print Network [OSTI]

    Hayes, Jane E.

    to the University of Kentucky _____________________________________________________________________________ ____________________________________________________________ City State Zip Code Name of High School To the recommender: The University of Kentucky appreciates your of Kentucky Office of Undergraduate Admission 100 Funkhouser Building Lexington, KY 40506-0054 Or send

  7. To the student: The top portion of this form should be completed by you and given to the recommender who has agreed to provide you with an academic recommendation to accompany your application to the University of Kentucky.

    E-Print Network [OSTI]

    Hayes, Jane E.

    to the University of Kentucky _____________________________________________________________________________ ____________________________________________________________ City State Zip Code Name of High School To the recommender: The University of Kentucky appreciates your: University of Kentucky Office of Undergraduate Admission 100 Funkhouser Building Lexington, KY 40506

  8. Reference Buildings by Climate Zone and Representative City:...

    Broader source: (indexed) [DOE]

    B Albuquerque, New Mexico Reference Buildings by Climate Zone and Representative City: 4B Albuquerque, New Mexico In addition to the ZIP file for each building type, you can...

  9. J. Zool., Lond. (2005) 266, 275281 C 2005 The Zoological Society of London Printed in the United Kingdom doi:10.1017/S0952836905006904 DNA-based identification of salmonid prey species in seal faeces

    E-Print Network [OSTI]

    Aberdeen, University of

    M. Parsons1 *, Stuart B. Piertney2 , Stuart J. Middlemas3 , Phillip S. Hammond4 and John D. Armstrong3 1 University of Aberdeen, School of Biological Sciences, Lighthouse Field Station, Cromarty, Ross Atlantic and Pacific salmonids (e.g. Middlemas, 2003; Middlemas, Armstrong & Thompson, 2003; Orr et al

  10. Harnan SE1; Uttley L1; Cantrell A1; Taylor CJ2; Walshaw M3; Brownlee K4; Tappenden P. 1 The University of Sheffield, Sheffield, United Kingdom, 2Sheffield Children's NHS Foundation

    E-Print Network [OSTI]

    Oakley, Jeremy

    /lung disorders in the intervention arm, and more cough adverse events. It was not possible to draw conclusions on antibiotics · More cough adverse events · May be more likely to not tolerate treatment (inferred from drop

  11. Genet. Res., Camb. (2001), 77, pp. 107116. With 2 figures. Printed in the United Kingdom # 2001 Cambridge University Press 107 Quantitative trait locus mapping of fitness-related traits in

    E-Print Network [OSTI]

    Mackay, Trudy F.C.


    Cambridge University Press 107 Quantitative trait locus mapping of fitness-related traits in Drosophila We examined the genetic architecture of four fitness-related traits (reproductive success, ovariole populations. Fisher's Fundamental Theorem states that the response to natural selection for fitness is equal

  12. J. Zool., Lond. (2005) 265, 107112 C 2005 The Zoological Society of London Printed in the United Kingdom DOI:10.1017/S0952836904006077 On lactation and rumination in bighorn ewes (Ovis canadensis)

    E-Print Network [OSTI]

    Festa-Bianchet, Marco

    ) Pierrick Blanchard* Groupe de Recherche en Ecologie, Nutrition et Energ´etique, D´epartement de Biologie ungulates according to reproductive status (Oakes, Harmsen & Eberl, 1992; Parsons et al., 1994; P´erez-Barber´ia & Nores, 1996; To¨igo, 1999), inclu- ding some that also reported evidence of lactation costs (P´erez-Barber´ia

  13. Simulations of heating and electron energy distributions in optical field ionized plasmas Imperial College of Science, Technology and Medicine, Prince Consort Road, London SW7 2BZ, United Kingdom

    E-Print Network [OSTI]

    Ditmire, Todd

    Simulations of heating and electron energy distributions in optical field ionized plasmas T is important. The consequences that the calculated energy distributions have on three-body recombination rates extent 7­9 . In calculating the magnitude of the collisional heating the electron energy distribution

  14. Nicholas (Nick) Ambraseys was born in Athens (Greece) on 19th January 1929 and died peacefully at his home in Putney (London, United Kingdom) on 28th December 2012 at the age of 83. Nick

    E-Print Network [OSTI]

    Boyer, Edmond

    this and service in the Royal Hellenic Navy, he moved to Imperial College in London to study in the Soil Mechanics in replying to the award of the Seismological Society of America's Reid Medal in 2006: `the site of a damaging learned societies: IASPEI, SECED, IAEE, International Society for Soil Mechanics and Geotechnical

  15. Animal Conservation (2005) 8, 329346 C 2005 The Zoological Society of London. Printed in the United Kingdom doi:10.1017/S1367943005002313 Genetic relatedness of the Preble's meadow jumping mouse

    E-Print Network [OSTI]

    Silver, Whendee

    or endangered. Thirty- five organisms have since been removed from the list. Seven `delistings' resulted from

  16. Animal Conservation (2004) 7, 16 C 2004 The Zoological Society of London. Printed in the United Kingdom DOI:10.1017/S1367943003001124 Developing recovery and monitoring strategies for the endemic

    E-Print Network [OSTI]

    Gerber, Leah R.

    the condition of an endangered or threatened population until it can be downlisted or delisted. Recovery teams

  17. Animal Conservation (2005) 7, 1725 C 2005 The Zoological Society of London. Printed in the United Kingdom DOI:10.1017/S1367943004001623 Effect of agro-forestry and landscape changes on common

    E-Print Network [OSTI]

    Penteriani, Vincenzo

    managed through coppice silviculture, are being converted to mature woodland, while land abandonment conservation guidelines focus on conversion of coppice woodland to mature forests and active management of dry habitats, mainly meadows. The forests were managed using a coppice silvicultural system (Matthews, 1989

  18. J. Zool., Lond. (2003) 261, 2133 C 2003 The Zoological Society of London Printed in the United Kingdom DOI:10.1017/S0952836903003935 Structure and variability of bat social calls: implications

    E-Print Network [OSTI]

    Wilkinson, Gerald S.


    , 1982; Avery, Racey & Fenton, 1984; Leonard & Fenton, 1984; Fenton, 1985, 1986; Balcombe & Fenton, 1988

  19. J 2001,Land (2002)256, 255-270 O 2002 The Zoolo@calSmiety of London Printed in the United Kingdom D01:101017/S0952836902000298 Behavioural responses of killer whales (Orcinus orca) to

    E-Print Network [OSTI]


    as recently as 1960 (Ford, Ellis & Balcomb, 1994). Today, such plans would be unthinkable. In fact, many

  20. PART 1 OF TUTORIAL ON EXTREMES TOOLKIT (1) Installation of R software

    E-Print Network [OSTI]

    Katz, Richard

    PART 1 OF TUTORIAL ON EXTREMES TOOLKIT (1) Installation of R software R-2.9.2-win32.exe Use default options (2) Installation of Extremes Toolkit extRemes (R package for extreme value analysis): ismev (R package used by extRemes): Lmoments (R package used by extRemes): Lmoments