Powered by Deep Web Technologies
Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.



Good Energies (United Kingdom) | Open Energy Information  

Open Energy Info (EERE)

United Kingdom) United Kingdom) Name Good Energies (United Kingdom) Address 2-5 Old Bond Street Place London, United Kingdom Zip W1S 4PD Product Global investor in renewable energy and energy efficiency industries Year founded 2001 Phone number +44 20 7659 3300 Website http://www.goodenergies.com/ Coordinates 51.5083291°, -0.1403335° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5083291,"lon":-0.1403335,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx


Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http


Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +


Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter


London Waste and Recycling Board | Open Energy Information  

Open Energy Info (EERE)

London Waste and Recycling Board Jump to: navigation, search Name: London Waste and Recycling Board Place: London, England, United Kingdom Zip: SE1 0AL Sector: Services Product:...



E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...


Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +


Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology




E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add


Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +


Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +


Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin


Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of


Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org


York's Wild Kingdom : a development proposal  

E-Print Network [OSTI]

York's Wild Kingdom is a privately held zoo and amusement park in York, a Massachusetts based shopping center developer and investment compa Kingdom and the 150 acres that surround it. The community is culturaIl ( and York ...

Rae, Kimberley Whiting



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon


Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are


Oil shale - Heir to the petroleum kingdom  

Science Journals Connector (OSTI)

Oil shale - Heir to the petroleum kingdom ... A discussion of oil shale provides students with real-world problems that require chemical literacy. ...

Y. Schachter



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto


Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.


D1 Fuel Crops Ltd | Open Energy Information  

Open Energy Info (EERE)

D1 Fuel Crops Ltd Jump to: navigation, search Name: D1 Fuel Crops Ltd Place: London, United Kingdom Zip: SE1 2RE Product: London-based JV between BP and D1 oils focusing on the...


Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...



E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of


The expansion of the kingdom of Strathclyde  

E-Print Network [OSTI]

. Rollason, Northumbria, 5001100: Creation and Destruction of a Kingdom (Cambridge, 2003), pp. 249 51; D.M. Hadley, The Vikings in England: Settlement, Society and Culture (Manchester, 2006), pp. 62, 71. 8 Following current scholarly conventions, I shall...

Edmonds, F. L.



Kingdom Community Wind | Open Energy Information  

Open Energy Info (EERE)

Kingdom Community Wind Kingdom Community Wind Jump to: navigation, search Name Kingdom Community Wind Facility Kingdom Community Wind Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Green Mountain Power / Vermont Electric Cooperative Developer Green Mountain Power Energy Purchaser Green Mountain Power Location Lowell VT Coordinates 44.74307558°, -72.40848541° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.74307558,"lon":-72.40848541,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...


Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade


Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions


Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.


United Kingdom HEU Removal | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

HEU Removal United Kingdom HEU Removal Location United Kingdom United States 52 24' 15.1416" N, 1 34' 55.3116" W See map: Google Maps Javascript is required to view this map...


Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL



E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi


United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

United Kingdom: Energy Resources United Kingdom: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378051,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Chromista is a major eukaryotic kingdom comprising algae and former protozoa that is evolutionarily entirely distinct from the kingdoms Plantae and Protozoa (Cavalier-Smith 2007). Chromist chloroplasts  

E-Print Network [OSTI]

1 Chromista is a major eukaryotic kingdom comprising algae and former protozoa chloroplasts were acquired secondarily by enslavement of a red alga, itself a member of kingdom Plantae

Goldschmidt, Christina


State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California


Viscosity and radial distribution function in PbxSe(1-x) melts for stoechiometric and peritectic compositions  

E-Print Network [OSTI]

L-529 Viscosity and radial distribution function in PbxSe(1-x) melts for stoechiometric by lead atoms sur- rounded by Se atoms are considered. Kinematic viscosity data are compared a molecular structure in the liquid state rather than a chain-structure [1]. Viscosity is very sensitive

Paris-Sud XI, Université de


Aggregate model and analysis of the energy dynamics in the Kingdom of Saudi Arabia  

E-Print Network [OSTI]

The Kingdom of Saudi Arabia is facing a crisis in the near future centered on increasing energy consumption. Today, the kingdom consumes approximately 1/3 of its oil production. If no action is taken and the kingdom continues ...

Al-Ahmed, Khalid A. (Khalid Abdulrahim)



E-Print Network 3.0 - ancient peruvian kingdom Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

art... ancient Marawi. The Nubian kingdoms straddling the southern third of modern Egypt and the northern third... .sinha@emory.edu LOST KINGDOMS OF THE NILE, FOUND --...


2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.


United Kingdom Low Carbon Transition Plan | Open Energy Information  

Open Energy Info (EERE)

United Kingdom Low Carbon Transition Plan United Kingdom Low Carbon Transition Plan Jump to: navigation, search Tool Summary LAUNCH TOOL Name: United Kingdom Low Carbon Transition Plan Agency/Company /Organization: United Kingdom Department of Energy and Climate Change Sector: Energy, Land Topics: Low emission development planning Resource Type: Publications, Case studies/examples Website: www.decc.gov.uk/en/content/cms/what_we_do/lc_uk/lc_trans_plan/lc_trans Country: United Kingdom UN Region: Northern Europe Coordinates: 55.378051°, -3.435973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378051,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brighton, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Brighton, United Kingdom: Energy Resources Brighton, United Kingdom: Energy Resources (Redirected from Brighton, UK) Jump to: navigation, search Name Brighton, United Kingdom Equivalent URI DBpedia GeoNames ID 2654710 Coordinates 50.82838°, -0.13947° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.82838,"lon":-0.13947,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EM Renews Information-Sharing Agreement with United Kingdom's Nuclear  

Broader source: Energy.gov (indexed) [DOE]

Renews Information-Sharing Agreement with United Kingdom's Renews Information-Sharing Agreement with United Kingdom's Nuclear Decommissioning Authority EM Renews Information-Sharing Agreement with United Kingdom's Nuclear Decommissioning Authority March 1, 2012 - 12:00pm Addthis DOE Senior Advisor for Environmental Management David Huizenga (left) and Mark Lesinski, U.K.'s Nuclear Decommissioning Authority (NDA) Executive Director for Delivery, renewed the Statement of Intent between DOE and NDA in a signing ceremony this week. DOE Senior Advisor for Environmental Management David Huizenga (left) and Mark Lesinski, U.K.'s Nuclear Decommissioning Authority (NDA) Executive Director for Delivery, renewed the Statement of Intent between DOE and NDA in a signing ceremony this week. Florida International University's DOE Fellows gather for a photo with DOE Senior Advisor for Environmental Management David Huizenga (eighth from left) and DOE Fellows director, Dr. Leo Lagos (tenth from left), at the 2012 Waste Management Symposia in Phoenix this week.


United Kingdom Department for International Development | Open Energy  

Open Energy Info (EERE)

Department for International Development Department for International Development Jump to: navigation, search Logo: United Kingdom Department for International Development Name United Kingdom Department for International Development Address 1 Palace Street Place London, United Kingdom Year founded 1997 Phone number +44 (0) 1355 84 3132 Website http://www.dfid.gov.uk Coordinates 51.4988017°, -0.1417935° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.4988017,"lon":-0.1417935,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom | Department  

Broader source: Energy.gov (indexed) [DOE]

Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom September 30, 2011 - 10:06am Addthis Colorized TEM (Transmission Electron Microscopy) micrograph of a cell of Geobacter sulfurreducens (orange) with its pili (yellow) stretching out like arms and immobilizing the uranium (black precipitate). | Image courtesy of Dena Cologgi and Gemma Reguera, Michigan State University Colorized TEM (Transmission Electron Microscopy) micrograph of a cell of Geobacter sulfurreducens (orange) with its pili (yellow) stretching out like arms and immobilizing the uranium (black precipitate). | Image courtesy of Dena Cologgi and Gemma Reguera, Michigan State University Charles Rousseaux Charles Rousseaux

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom | Department  

Broader source: Energy.gov (indexed) [DOE]

Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom Geobacter: The Junk Food Connoisseurs of the Bacterial Kingdom September 30, 2011 - 10:06am Addthis Colorized TEM (Transmission Electron Microscopy) micrograph of a cell of Geobacter sulfurreducens (orange) with its pili (yellow) stretching out like arms and immobilizing the uranium (black precipitate). | Image courtesy of Dena Cologgi and Gemma Reguera, Michigan State University Colorized TEM (Transmission Electron Microscopy) micrograph of a cell of Geobacter sulfurreducens (orange) with its pili (yellow) stretching out like arms and immobilizing the uranium (black precipitate). | Image courtesy of Dena Cologgi and Gemma Reguera, Michigan State University Charles Rousseaux Charles Rousseaux


Solar energy in the Kingdom of Saudi Arabia  

Science Journals Connector (OSTI)

The Kingdom of Saudi Arabia is blessed with abundant solar energy which is renewable, clean and available freely. It is harnessed through known processes and technologies, but progress towards its commercialization is very slow for several reasons, such as higher cost and low efficiency. This paper reviews our R&D efforts, and concludes that future utilization of solar energy in the Kingdom of Saudia Arabia is dependent on current R&D activities in the field, combined with a proper educational campaign for its effective commercialization.

Saleh A. Al-Athel



CANADA RUSSIA UNITED KINGDOM UNITED STATES Building / Launching / Operating first ever high definition,  

E-Print Network [OSTI]

1 CANADA · RUSSIA · UNITED KINGDOM · UNITED STATES 1 #12;2 Building / Launching / Operating first


EUDEEP (Smart Grid Project) (United Kingdom) | Open Energy Information  

Open Energy Info (EERE)

United Kingdom United Kingdom Coordinates 55.378052°, -3.435973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378052,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tonbridge, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Tonbridge, United Kingdom: Energy Resources Tonbridge, United Kingdom: Energy Resources Jump to: navigation, search Name Tonbridge, England Equivalent URI DBpedia GeoNames ID 2635703 Coordinates 51.19242°, 0.27532° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.19242,"lon":0.27532,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Brighton, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Brighton, United Kingdom Brighton, United Kingdom Equivalent URI DBpedia GeoNames ID 2654710 Coordinates 50.82838°, -0.13947° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.82838,"lon":-0.13947,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hertfordshire, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hertfordshire, United Kingdom: Energy Resources Hertfordshire, United Kingdom: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2647043 Coordinates 51.8097823°, -0.2376744° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.8097823,"lon":-0.2376744,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


London, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

London, United Kingdom: Energy Resources London, United Kingdom: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2643743 Coordinates 51.5001524°, -0.1262362° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5001524,"lon":-0.1262362,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Leeds, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Leeds, United Kingdom: Energy Resources Leeds, United Kingdom: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2644688 Coordinates The following coordinate was not recognized: 53.79648 / -1.54785.The following coordinate was not recognized: 53.79648 / -1.54785. Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Fenix (Smart Grid Project) (United Kingdom) | Open Energy Information  

Open Energy Info (EERE)

United Kingdom United Kingdom Coordinates 55.378052°, -3.435973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378052,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oxford, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Oxford, United Kingdom: Energy Resources Oxford, United Kingdom: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2640729 Coordinates 51.7522764°, -1.2558243° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.7522764,"lon":-1.2558243,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Dursley, United Kingdom: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Dursley, United Kingdom: Energy Resources Dursley, United Kingdom: Energy Resources Jump to: navigation, search Equivalent URI DBpedia GeoNames ID 2650613 Coordinates The following coordinate was not recognized: 51.6811°N 2.3543°W.The following coordinate was not recognized: 51.6811°N 2.3543°W. Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.4382736,"lon":127.1314973,"alt":0,"address":"\ufeff51.6811\u00b0N 2.3543\u00b0W","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Institutionnal dynamics and barriers to sustainable construction in France, the United Kingdom and the  

E-Print Network [OSTI]

resources in sustainable urban design and sustainable building design. In Britain, a broader agenda has beenInstitutionnal dynamics and barriers to sustainable construction in France, the United Kingdom). Institutionnal dynamics and barriers to sustainable construction in France, the United Kingdom

Paris-Sud XI, Université de


Work Capacity, Thermal Responses and Lung Function: United Kingdom Studies in the I.B.P.  

Science Journals Connector (OSTI)

...1976 research-article Work Capacity, Thermal Responses and Lung Function: United Kingdom...and water, as shown by studies in the Sudan and Tanzania. Lung function of some seven...factors was examined. Work capacity, thermal responses and lung function: united kingdom...



bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond



UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



U.S. Liquefied Natural Gas Exports to United Kingdom  

Gasoline and Diesel Fuel Update (EIA)

Babb, MT Havre, MT Port of Morgan, MT Pittsburg, NH Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Sweetgrass, MT Total to Chile Sabine Pass, LA Total to China Kenai, AK Sabine Pass, LA Total to India Freeport, TX Sabine Pass, LA Total to Japan Cameron, LA Kenai, AK Sabine Pass, LA Total to Mexico Douglas, AZ Nogales, AZ Calexico, CA Ogilby Mesa, CA Otay Mesa, CA Alamo, TX Clint, TX Del Rio, TX Eagle Pass, TX El Paso, TX Hidalgo, TX McAllen, TX Penitas, TX Rio Bravo, TX Roma, TX Total to Portugal Sabine Pass, LA Total to Russia Total to South Korea Freeport, TX Sabine Pass, LA Total to Spain Cameron, LA Sabine Pass, LA Total to United Kingdom Sabine Pass, LA Period: Monthly Annual


United Kingdom Department of Energy and Climate Change (DECC) | Open Energy  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » United Kingdom Department of Energy and Climate Change (DECC) Jump to: navigation, search Logo: United Kingdom Department for Energy and Climate Change (DECC) Name United Kingdom Department for Energy and Climate Change (DECC) Address 3 Whitehall Place London SW1A 2AW Place London, United Kingdom Phone number 0300 060 4000 Website http://www.decc.gov.uk/ References http://www.decc.gov.uk/ No information has been entered for this organization. Add Organization "DECC is a small department, with a big mission. Our vision is of a thriving, globally competitive, low carbon energy economy. Our key


U.S. Department of Energy Welcomes the United Kingdom as 21st Member of the  

Broader source: Energy.gov (indexed) [DOE]

Welcomes the United Kingdom as 21st Welcomes the United Kingdom as 21st Member of the Global Nuclear Energy Partnership U.S. Department of Energy Welcomes the United Kingdom as 21st Member of the Global Nuclear Energy Partnership January 26, 2008 - 11:29am Addthis WASHINGTON, DC -The U.S. Department of Energy (DOE) today welcomed the United Kingdom (UK) as the Global Nuclear Energy Partnership's (GNEP) twenty-first partner. GNEP, a voluntary international partnership, aims to safely and securely expand nuclear power worldwide while responsibly managing nuclear waste and reducing proliferation risks. U.S. Energy Secretary Samuel Bodman met with UK Secretary of State for Business, Enterprise and Regulatory Reform, Rt. Hon. John Hutton prior to the UK signing the GNEP Statement of Principles in Washington, DC.


All fired-up about coal : technology & policy recommendations for the 2030 United Kingdom energy strategy  

E-Print Network [OSTI]

Given United Kingdom (UK) carbon dioxide emissions policies that direct attention at the electricity segment, the focus is on the largest electricity polluter, coal, and the immediately pressing issue of UK coal policy. ...

Donnelly, Kathy A. (Kathy Ann)


Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"Auto"-mobile Beijing : a bicycle network for a renewed "bicycle kingdom"  

E-Print Network [OSTI]

This thesis intends to be a catalyst for a renewed bicycle culture in Beijing, the capital of the former "Bicycle Kingdom". Beijing, only 15 years ago had more bicycles than any other city in the world, has in recent years ...

Liau, August



Inter-kingdom Recognition of Norepinephrine by E. Coli : Identification of the Receptors Involved in Chemotaxis  

E-Print Network [OSTI]


Kim, Dae Nyun



U.S. Liquefied Natural Gas Exports to United Kingdom  

Gasoline and Diesel Fuel Update (EIA)

Warroad, MN Babb, MT Havre, MT Port of Morgan, MT Sherwood, ND Pittsburg, NH Buffalo, NY Grand Island, NY Massena, NY Niagara Falls, NY Waddington, NY Sumas, WA Sweetgrass, MT Total to Chile Sabine Pass, LA Total to China Kenai, AK Sabine Pass, LA Total to India Freeport, TX Sabine Pass, LA Total to Japan Cameron, LA Freeport, TX Kenai, AK Port Nikiski, AK Sabine Pass, LA Total to Mexico Douglas, AZ Nogales, AZ Calexico, CA Ogilby Mesa, CA Otay Mesa, CA San Diego, CA Alamo, TX Clint, TX Del Rio, TX Eagle Pass, TX El Paso, TX Hidalgo, TX McAllen, TX Penitas, TX Rio Bravo, TX Roma, TX Total to Portugal Sabine Pass, LA Total to Russia Kenai, AK Total to South Korea Freeport, TX Sabine Pass, LA Total to Spain Cameron, LA Sabine Pass, LA Total to United Kingdom Freeport, TX Sabine Pass, LA LNG Exports from Cameron, LA LNG Exports from Kenai, AK LNG Exports from Freeport, TX LNG Exports from Nogales, AZ LNG Exports from Otay Mesa, CA LNG Exports from Sabine Pass, LA LNG Exports from Sweetgrass, MT Period: Monthly Annual


A thousand years of energy use in the United Kingdom  

SciTech Connect (OSTI)

This paper examines the evolution of energy use and its influences in the United Kingdom over the very long run by combining economic literature and statistical information. The paper argues that the provision of energy services, mainly heat and power, is bound by the tensions between a changing growth rate and structure of economic activity and the constraints of energetic resources. After periods of tension, energy price differentials, as well as the diffusion of technological innovation and the development of new fuels, led to new mixes of energy sources to supply heat and power. This paper identifies three major changes that characterize the history of UK energy use: first, the dramatic increase in per capita energy use; second, the shift in methods of supplying energy services, from biomass sources to fossil fuels, from coal to petroleum to natural gas, and from raw forms to more value-added energy sources; and, third, the replacing of direct methods of generating power, from animate sources, wind and water, by the use of mechanical and electrical methods, which have so far depended mainly on fossil fuels. These changes were instrumental in influencing the relationship between GDP and energy use, and also the levels of environmental pollution.

Fouquet, R.; Pearson, P.J.G. (Imperial Coll. of Science, Technology and Medicine, London (United Kingdom). T.H. Huxley School of Environment, Earth Sciences and Engineering)



Very soon now the Kingdom of the Netherlands will undergo an important political change. One of the three countries of the Kingdom, The Netherlands Antilles, will be dissolved. This  

E-Print Network [OSTI]

Summary Very soon now the Kingdom of the Netherlands will undergo an important political change. One of the three countries of the Kingdom, The Netherlands Antilles, will be dissolved. This political construction "Netherlands Antilles" ­ in fact nothing more than the compilation of a few leftover Dutch

van den Brink, Jeroen


United States-United Kingdom Collaboration on Fossil Energy R&D |  

Broader source: Energy.gov (indexed) [DOE]

International Cooperation » United States-United International Cooperation » United States-United Kingdom Collaboration on Fossil Energy R&D United States-United Kingdom Collaboration on Fossil Energy R&D U.S.-UK Collaboration in Fossil Energy R&D The United States and the United Kingdom are participating in a multi-year collaboration on advanced materials supported by the UK Department of Energy and Climate Change (DECC) and the U.S. Department of Energy (DOE). The collaboration is an outgrowth of the US-UK Memorandum of Understanding and the associated Implementing Arrangement for Fossil Energy Research and Technology Development. The MOU, signed on November 6, 2000, provides a framework to continue, expand, and maximize cooperation in energy research and development between the two nations.


DLC+VIT4IP (Smart Grid Project) (United Kingdom) | Open Energy Information  

Open Energy Info (EERE)

Kingdom) Kingdom) Jump to: navigation, search Project Name DLC+VIT4IP Country United Kingdom Coordinates 55.378052°, -3.435973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378052,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ship of the God: The Amun-Userhet in New Kingdom Egypt  

E-Print Network [OSTI]

The Amun-Userhet was a ship which played a crucial role in the development of religious thought in New Kingdom Egypt. The pharaoh and his entourage sailed down the Nile on its deck as part of a religious celebration called the Opet festival...

Collier, Megan




E-Print Network [OSTI]

Clark and Clegg 1 ASSESSING THE IMPACT OF UNITED KINGDOM FUEL PRICE PROTEST ACTIONS IN THE CITY of dissatisfaction amongst the haulier and farming communities in Europe over the price of fuel was shown In early September 2000 protests about high levels of taxation on fuel took place in Europe. In the United

Clegg, Richard G.


Inter- and Intra-kingdom Signaling in Bacterial Chemotaxis, Biofilm Formation, and Virulence  

E-Print Network [OSTI]

that the actions of NE are mediated primarily through the LasR, and not the RhlR QS system. We investigated the molecular mechanism underlying the chemo-sensing of the intra-kingdom signal autoinducer-2 (AI-2) by pathogens Escherichia coli and Salmonella...

Hegde, Manjunath



Judicial review of legislation: Constitutionalism personified in the United Kingdom, the Netherlands and South Africa  

E-Print Network [OSTI]

, the Netherlands and South Africa By Gerhard van der Schyff Supervisor: prof. dr. Paul Cliteur Although fast, three systems have been selected for this study, namely those of the United Kingdom, the Netherlands of any threatened violation. The Netherlands has been chosen for its interesting brand of judicial review

van den Brink, Jeroen


Kingdom of Saudi Arabia Ministry of Petroleum and Mineral Resources | Open  

Open Energy Info (EERE)

Kingdom of Saudi Arabia Ministry of Petroleum and Mineral Resources Kingdom of Saudi Arabia Ministry of Petroleum and Mineral Resources Jump to: navigation, search Logo: Kingdom of Saudi Arabia Ministry of Petroleum and Mineral Resources Country Saudi Arabia Name Kingdom of Saudi Arabia Ministry of Petroleum and Mineral Resources Address PO Box 757, Airport Road, Riyadh 11189 City Riyadh Website http://www.mopm.gov.sa/mopm/ma Coordinates 24.800234°, 46.71742° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":24.800234,"lon":46.71742,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EA-1123: Transfer of Normal and Low-Enriched Uranium Billets to the United Kingdom, Hanford Site, Richland, Washington  

Broader source: Energy.gov [DOE]

This EA evaluates the environmental impacts of the proposal to transfer approximately 710,000 kilograms (1,562,000 pounds) of unneeded normal and low-enriched uranium to the United Kingdom; thus,...


BeyWatch (Smart Grid Project) (United Kingdom) | Open Energy Information  

Open Energy Info (EERE)

United Kingdom United Kingdom Coordinates 55.378052°, -3.435973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378052,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


A Strategy for Carbon Capture and Storage (CCS) in the United Kingdom and  

Open Energy Info (EERE)

Strategy for Carbon Capture and Storage (CCS) in the United Kingdom and Strategy for Carbon Capture and Storage (CCS) in the United Kingdom and Beyond Jump to: navigation, search Tool Summary LAUNCH TOOL Name: A Strategy for Carbon Capture and Storage (CCS) in the United Kingdom and Beyond Focus Area: Clean Fossil Energy Topics: Market Analysis Website: www.ccsassociation.org/index.php/download_file/view/251/76/ Equivalent URI: cleanenergysolutions.org/content/strategy-carbon-capture-and-storage-c Policies: "Regulations,Financial Incentives" is not in the list of possible values (Deployment Programs, Financial Incentives, Regulations) for this property. Regulations: "Emissions Mitigation Scheme,Mandates/Targets,Cost Recovery/Allocation" is not in the list of possible values (Agriculture Efficiency Requirements, Appliance & Equipment Standards and Required Labeling, Audit Requirements, Building Certification, Building Codes, Cost Recovery/Allocation, Emissions Mitigation Scheme, Emissions Standards, Enabling Legislation, Energy Standards, Feebates, Feed-in Tariffs, Fuel Efficiency Standards, Incandescent Phase-Out, Mandates/Targets, Net Metering & Interconnection, Resource Integration Planning, Safety Standards, Upgrade Requirements, Utility/Electricity Service Costs) for this property.


Resource Letter SE?1: Solar energy  

Science Journals Connector (OSTI)

Prepared at the request of the AAPT Editorial Board for Resource Letters. This is one of a series of Resource Letters on different topics intended to guide college physicists astronomers and other scientists to some of the literature and other teaching aids that may help improve course contents in specified fields. No Resource Letter is meant to be exhaustive and complete; in time there may be more than one letter on some of the main subjects of interest. Comments on these materials as well as suggestions for future topics will be welcomed. Please send such communications to Professor Aaron Owens Editor Resource Letter Board Department of Physics Lake Forest College Lake Forest IL 60045.

D. K. McDaniels; M. J. Throop




E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS


AffiliAtions: Bodas-salcedo, WeBB, and John--Met Office Hadley Centre, Exeter, United Kingdom; Bony, chepfer, and  

E-Print Network [OSTI]

AffiliAtions: Bodas-salcedo, WeBB, and John--Met Office Hadley Centre, Exeter, United Kingdom; Bony-Salcedo, Met Office Hadley Centre, FitzRoy Road, Exeter EX1 3PB United Kingdom E-mail: alejandro

Robert, Pincus


Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter


Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


J. Plasma Physics (2009), vol. 75, part 5, pp. 709711. c 2009 Cambridge University Press Printed in the United Kingdom  

E-Print Network [OSTI]

J. Plasma Physics (2009), vol. 75, part 5, pp. 709­711. c 2009 Cambridge University Press Printed in the United Kingdom 709 B O O K R E V I E W Elementary Physics of Complex Plasmas, Lecture Notes on Physics0022377809990225 The treatise Elementary Physics of Complex Plasmas was written primarily for researchers

Merlino, Robert L.


2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings of the 27th Symposium On Fusion Technology  

E-Print Network [OSTI]

© 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings Torino, Torino, Italy In the ITER equatorial ports containing ICRH antennas, parasitic electrical resonances can be excited in the nominal 20 mm clearance gap between the port walls and the plug contained


2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings of the 27th Symposium On Fusion Technology  

E-Print Network [OSTI]

© 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Proceedings Performance stage 2 (EP2) shutdown of JET. This was a demanding and challenging activity which was based to the outside via a feed through located in a main vertical port. #12;The scale and complexity of this project


HiperDNO (Smart Grid Project) (United Kingdom) | Open Energy Information  

Open Energy Info (EERE)

HiperDNO HiperDNO Country United Kingdom Coordinates 55.378052°, -3.435973° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.378052,"lon":-3.435973,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Unattended system for monitoring skip movement at the Sellafield Facility in the United Kingdom  

SciTech Connect (OSTI)

An unattended system for monitoring spent-fuel movement in the storage area of a reprocessing facility has been developed and tested. The system uses radiation detectors to determine when fuel is being moved and a video system to record images of the container movement. In addition to the recorded image, other recorded data include the date and time of the movement and ''fingerprint'' information from the radiation detectors. The direction of motion either into or out of the storage pond is indicated on the video image and on the printed readout. This system was extensively tested at the Sellafield Facility in the United Kingdom. This paper gives the details of the system design and presents results of the field evaluation. 1 ref., 10 figs.

Bosler, G.E.; Klosterbuer, S.F.; Johnson, C.S.; Hale, W.R.; Marsh, R.D.; Dickinson, R.J.



Fuel Poverty as an Outcome Measure: A Comparative Study of Energy Policies in Norway and the United Kingdom  

Science Journals Connector (OSTI)

ABSTRACT Whether low income families have difficulty in being warm at home or not can be considered as an outcome measure of the effectiveness of policies for housing, energy, and income maintenance. This study aims to compare such policies in Norway and the United Kingdom. As background, evidence of fuel poverty in a wider international context is presented. To conclude, policies from Norway which might help to relieve fuel poverty in Britain are set out.

S. Hutton; T. Braend; L. Warren



Potential of using olive pomace as a source of renewable energy for electricity generation in the Kingdom of Jordan  

Science Journals Connector (OSTI)

This paper discusses the potential of using olive pomace as a clean renewable and reliable source of energy that has the potential to contribute to the total energy supply of the Kingdom of Jordan. Available data were first compiled on available quantities of this raw material in Jordan calculating the useful stored energy that can be eventually converted into electricity. The data then were reflected against the energy demand in Jordan. Finally recommendations on the prospect of this alternative energysource would be made. Statistical data for electricity demand in the Kingdom of Jordan show a growth by around 7.4% in 2010 compared to 2009 and an electric peak load increases by 15%. The Kingdom's local crude oil and natural gas production are contributing only 2.8% of the total energy needs of the country and the rest is being imported while renewable sources share to the energy mix has not exceeded 2% as of 2010. Therefore the need for new energysources is highly imperative.

Oraib Al-Ketan



Revised feed-in tariff for solar photovoltaic in the United Kingdom: A cloudy future ahead?  

Science Journals Connector (OSTI)

The United Kingdom (UK) started implementing a national Feed-In Tariff (FiT) mechanism on the 1 April 2010, which included specific payment tariffs for solar photovoltaic (PV) installations. However, a revised FiT rate has been put in place starting from 1 April 2012, applicable to any installations with an eligibility date of on or after 3 March 2012. This paper presents, first, an overview of solar PV installation in the UK. This followed by a general concept of the FiT in the UK before analyzing the financial impact of the new FiT rate on the consumers. Similar financial analysis is conducted with selected countries in Europe. The financial analysis investigates the total profit, the average rate of return and the payback period. It is found that the new FiT rate generates very low profit, minimum rate of return and a longer payback period, suggesting a downward trend of solar PV uptake in the future.

Firdaus Muhammad-Sukki; Roberto Ramirez-Iniguez; Abu Bakar Munir; Siti Hajar Mohd Yasin; Siti Hawa Abu-Bakar; Scott G. McMeekin; Brian G. Stewart



FLEGT Asia, Baseline Study 1, China: Overview of Forest Law Enforcement, Governance and Trade, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany, the Netherlands and the United Kingdom.  

E-Print Network [OSTI]

, June 2011 This Action is funded by the European Union and Governments of Finland, France, Germany of Finland, France, Germany, the Netherlands and the United Kingdom. www


Evergreen Securities formerly Ethanol Investments | Open Energy...  

Open Energy Info (EERE)

Securities formerly Ethanol Investments Jump to: navigation, search Name Evergreen Securities (formerly Ethanol Investments) Place London, England, United Kingdom Zip EC2V 5DE...


Carbon Markets Global Ltd | Open Energy Information  

Open Energy Info (EERE)

Markets Global Ltd Place: London, United Kingdom Zip: NW4 2HT Product: Assist project originators develop and finance clean development projects. References: Carbon Markets Global...


Westwind Wind Turbines | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Westwind Wind Turbines Place: Northern Ireland, United Kingdom Zip: BT29 4TF Sector: Wind energy Product: Northern Ireland based small scale wind...


British Energy Renewables | Open Energy Information  

Open Energy Info (EERE)

British Energy Renewables Jump to: navigation, search Name: British Energy Renewables Place: East Kilbride, Scotland, United Kingdom Zip: G74 5PR Sector: Renewable Energy, Wind...


Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada...


XCO2 Ltd | Open Energy Information  

Open Energy Info (EERE)

search Name: XCO2 Ltd Place: London, Greater London, United Kingdom Zip: N1 1DH Sector: Services Product: Environmental engineering consultancy providing integrated energy design...


Dabbrook Services | Open Energy Information  

Open Energy Info (EERE)

Yarmouth, United Kingdom Zip: NR31 6PT Sector: Services Product: Provides design and engineering services, as well as the development and installation of power systems....


AMEC Plc | Open Energy Information  

Open Energy Info (EERE)

Greater London, United Kingdom Zip: EC1V 9RU Sector: Services Product: An international services provider covering project delivery, maintenance and engineering solutions...


Wardell Armstrong International | Open Energy Information  

Open Energy Info (EERE)

Wardell Armstrong International Jump to: navigation, search Name: Wardell Armstrong International Place: Cornwall, United Kingdom Zip: TR3 6EH Sector: Biomass, Geothermal energy,...


Scira Offshore Energy | Open Energy Information  

Open Energy Info (EERE)

Scira Offshore Energy Jump to: navigation, search Name: Scira Offshore Energy Place: Lowestoft, Suffolk, United Kingdom Zip: NR32 1DE Sector: Wind energy Product: Developer of the...


Carbon International | Open Energy Information  

Open Energy Info (EERE)

Kingdom Zip: NW1 8LH Sector: Carbon Product: London-based energy and communications agency specialising in low carbon energy and climate change. References: Carbon...

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ZEN Eaga Solar Ltd | Open Energy Information  

Open Energy Info (EERE)

Newcastle upon Tyne, United Kingdom Zip: NE2 1DB Sector: Solar Product: Distributes solar thermal water heating and PV products. References: ZEN Eaga Solar Ltd1 This...


Hunterston Hydrogen Ltd | Open Energy Information  

Open Energy Info (EERE)

Hunterston Hydrogen Ltd Jump to: navigation, search Name: Hunterston Hydrogen Ltd Place: Anglesey, United Kingdom Zip: LL65 4RJ Sector: Hydro, Hydrogen, Wind energy Product:...


Bryte Energy | Open Energy Information  

Open Energy Info (EERE)

Name: Bryte Energy Place: Leicestershire, United Kingdom Zip: LE3 0QP Sector: Hydro, Hydrogen, Renewable Energy, Services Product: Bryte Energy Ltd provides consultancy services...


VT Nuclear Services ltd | Open Energy Information  

Open Energy Info (EERE)

VT Nuclear Services ltd Jump to: navigation, search Name: VT Nuclear Services ltd Place: Warrington, United Kingdom Zip: WA4 4BP Sector: Services Product: VT Nuclear Services...


International Nuclear Services Ltd | Open Energy Information  

Open Energy Info (EERE)

Services Ltd Jump to: navigation, search Name: International Nuclear Services Ltd Place: Cheshire, England, United Kingdom Zip: WA3 6AS Sector: Services Product: England-based firm...


Universal Carbon Credits Limited | Open Energy Information  

Open Energy Info (EERE)

Universal Carbon Credits Limited Jump to: navigation, search Name: Universal Carbon Credits Limited Place: London, England, United Kingdom Zip: EC3A6DF Sector: Carbon Product:...


BP Gas Power and Renewables | Open Energy Information  

Open Energy Info (EERE)

Renewables Jump to: navigation, search Name: BP Gas, Power and Renewables Place: Central Milton Keynes, United Kingdom Zip: MK9 1ES Sector: Renewable Energy Product: Subsidiary of...


Conduit Ventures Ltd | Open Energy Information  

Open Energy Info (EERE)

United Kingdom Zip: EC1N 8LS Sector: Hydro, Hydrogen Product: Focuses purely upon fuel cells and related hydrogen technologies. Opening an office in Shanghai. References:...


Hydro Generation Ltd | Open Energy Information  

Open Energy Info (EERE)

Hydro Generation Ltd Place: Devon, United Kingdom Zip: EX16 9EU Sector: Hydro, Services Product: Micro hydropower company. Provides technical services such as feasibility studies,...


Green Peninsula | Open Energy Information  

Open Energy Info (EERE)

Peninsula Place: St Austell, Cornwall, England, United Kingdom Zip: PL25 3NL Sector: Wind energy Product: Uk based, Green Peninsula, is a wind power project development service...


Green Chicane | Open Energy Information  

Open Energy Info (EERE)

Chicane Jump to: navigation, search Name: Green Chicane Place: East Horsley, England, United Kingdom Zip: KT24 5AG Sector: Services Product: Surrey based company that invests in...


Pzero | Open Energy Information  

Open Energy Info (EERE)

search Name: Pzero Place: Brighton, United Kingdom Zip: BN1 9RH Sector: Renewable Energy, Services Product: A consultant and project management services provider. Services...


Solar Century Holdings Solarcentury | Open Energy Information  

Open Energy Info (EERE)

Holdings Solarcentury Holdings Solarcentury Jump to: navigation, search Name Solar Century Holdings (Solarcentury) Place London, Greater London, United Kingdom Zip SE1 7AB Sector Buildings, Solar Product Designs, installs and maintains solar PV and thermal systems in buildings as well as managing the sale of surplus power back to the grid. References Solar Century Holdings (Solarcentury)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solar Century Holdings (Solarcentury) is a company located in London, Greater London, United Kingdom . References ↑ "Solar Century Holdings (Solarcentury)" Retrieved from "http://en.openei.org/w/index.php?title=Solar_Century_Holdings_Solarcentury&oldid=351254


STAT 3540: Assignment 2 -Due Friday February 24 1. The data file retail lists total U.K. (United Kingdom) retail sales (in billions of pounds)  

E-Print Network [OSTI]

STAT 3540: Assignment 2 - Due Friday February 24 1. The data file retail lists total U.K. (United Kingdom) retail sales (in billions of pounds) from January 1986 through March 2007. a) Display to determine the month with highest and lowest retail sales. iii. Construct a graph of the seasonally adjusted

Oyet, Alwell


2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Fusion Science and Technology, Vol.64, No.2, August 2013,  

E-Print Network [OSTI]

© 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Fusion Science on the Technology of Fusion Energy (TOFE-2012) (Part 1), Nashville, Tennessee, August 27-31, 2012 Pulsed DEMO design of energy storage issues, and fatigue life improvements in Nb3Sn CICC superconductors. I. BACKGROUND In 2011


J. Fluid Mech. (2009), vol. 622, pp. 121. c 2009 Cambridge University Press doi:10.1017/S0022112008004023 Printed in the United Kingdom  

E-Print Network [OSTI]

(Received 29 April 2007 and in revised form 20 July 2008) The stability of the recirculation bubble behind0022112008004023 Printed in the United Kingdom 1 Direct and adjoint global modes of a recirculation bubble: lift to a deformation of the recirculation bubble in which streamwise vortices induce low- and high-speed streaks

Paris-Sud XI, Université de


2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Journal of Nuclear Materials, Vol.439, Issues 1-3, August  

E-Print Network [OSTI]

© 2013 UNITED KINGDOM ATOMIC ENERGY AUTHORITY The following article appeared in Journal of Nuclear temperatures, reaction path (i) (sinks) dominates and at a high dose rates and/or low irradiation temperature for Fusion Energy (CCFE) Abingdon, Oxfordshire OX14 3DB, UK Name: Christopher Hardie Address: Department


Math. Proc. Camb. Phil. Soc. (2002), 133, 345 c 2002 Cambridge Philosophical Society DOI: 10.1017/S030500410200590X Printed in the United Kingdom  

E-Print Network [OSTI]

030500410200590X Printed in the United Kingdom 345 Non-differentiability of devil's staircases and dimensions probability measure on C. Consider the distribution function which is often referred to as the Devil's staircase (for a = 1 3 ): F(x) = µ([0, x]), x [0, 1]. It is easy to check that the derivative of F

Li, Wenxia


Quarterly Reviews of Biophysics 35, 3 (2002), pp. 205286. " 2002 Cambridge University Press DOI: 10.1017/S0033583502003785 Printed in the United Kingdom  

E-Print Network [OSTI]

: 10.1017/S0033583502003785 Printed in the United Kingdom 205 Understanding protein folding with energy and kinetics of protein folding 234 5.1 A protein Hamiltonian with cooperative interactions 234 5.2 Variance of native contact energies 235 5.3 Thermodynamics of protein folding 236 5.4 Free-energy surfaces

Plotkin, Steven S.


ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A literature review of methods of analysis of organic analytes in radioactive wastes with an emphasis on sources from the United Kingdom  

SciTech Connect (OSTI)

This report, compiled by Pacific Northwest Laboratory (PNL), examines literature originating through the United Kingdom (UK) nuclear industry relating to the analyses of organic constituents of radioactive waste. Additionally, secondary references from the UK and other counties, including the United States, have been reviewed. The purpose of this literature review was to find analytical methods that would apply to the mixed-waste matrices found at Hanford.

Clauss, S.A.; Bean, R.M.



An integrated appraisal of energy recovery options in the United Kingdom using solid recovered fuel derived from municipal solid waste  

SciTech Connect (OSTI)

This paper reports an integrated appraisal of options for utilising solid recovered fuels (SRF) (derived from municipal solid waste, MSW) in energy intensive industries within the United Kingdom (UK). Four potential co-combustion scenarios have been identified following discussions with industry stakeholders. These scenarios have been evaluated using (a) an existing energy and mass flow framework model, (b) a semi-quantitative risk analysis, (c) an environmental assessment and (d) a financial assessment. A summary of results from these evaluations for the four different scenarios is presented. For the given ranges of assumptions; SRF co-combustion with coal in cement kilns was found to be the optimal scenario followed by co-combustion of SRF in coal-fired power plants. The biogenic fraction in SRF (ca. 70%) reduces greenhouse gas (GHG) emissions significantly ({approx}2500 g CO{sub 2} eqvt./kg DS SRF in co-fired cement kilns and {approx}1500 g CO{sub 2} eqvt./kg DS SRF in co-fired power plants). Potential reductions in electricity or heat production occurred through using a lower calorific value (CV) fuel. This could be compensated for by savings in fuel costs (from SRF having a gate fee) and grants aimed at reducing GHG emission to encourage the use of fuels with high biomass fractions. Total revenues generated from coal-fired power plants appear to be the highest ( Pounds 95/t SRF) from the four scenarios. However overall, cement kilns appear to be the best option due to the low technological risks, environmental emissions and fuel cost. Additionally, cement kiln operators have good experience of handling waste derived fuels. The scenarios involving co-combustion of SRF with MSW and biomass were less favourable due to higher environmental risks and technical issues.

Garg, A.; Smith, R. [Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Hill, D. [DPH Environment and Energy Ltd., c/o Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Longhurst, P.J.; Pollard, S.J.T. [Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom); Simms, N.J. [Sustainable Systems Department, School of Applied Sciences, Cranfield University, Cranfield, Bedfordshire, MK43 0AL (United Kingdom)], E-mail: n.j.simms@cranfield.ac.uk



Climate and Development Knowledge Network (CDKN) | Open Energy Information  

Open Energy Info (EERE)

Network (CDKN) Network (CDKN) Jump to: navigation, search Logo: The Climate and Development Knowledge Network (CDKN) Name The Climate and Development Knowledge Network (CDKN) Address 7 More London Riverside London Place London, United Kingdom Zip SE1 2RT Year founded 2010 Website http://www.cdkn.org/ Coordinates 51.504573679871°, -0.081045627593994° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.504573679871,"lon":-0.081045627593994,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The Climate Group | Open Energy Information  

Open Energy Info (EERE)

Climate Group Climate Group Place London, England, United Kingdom Zip SE1 7NX Sector Carbon Product London-based non-profit organisation working with government and business leaders to advance smart policies and technologies to cut global emissions and accelerate a low carbon economy. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bioethanol Limited | Open Energy Information  

Open Energy Info (EERE)

Bioethanol Limited Bioethanol Limited Jump to: navigation, search Name Bioethanol Limited Place London, United Kingdom Zip SE1 7TJ Sector Renewable Energy Product Aims to develop a global renewable transport fuel business supplying primarily bioethanol but also biodiesel. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The family of terpene synthases in plants: a midsize family of genes for specialized metabolism that is highly diversified throughout the kingdom  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PLANT PLANT GENOME: AN EVOLUTIONARY VIEW ON STRUCTURE AND FUNCTION The family of terpene synthases in plants: a mid-size family of genes for specialized metabolism that is highly diversified throughout the kingdom Feng Chen 1,* , Dorothea Tholl 2 , Jo ¨ rg Bohlmann 3 and Eran Pichersky 4 1 Department of Plant Sciences, University of Tennessee, Knoxville, TN 37996, USA, 2 Department of Biological Sciences, 408 Latham Hall, Virginia Polytechnic Institute and State University, Blacksburg, VA 24061, USA, 3 Michael Smith Laboratories, 2185 East Mall, University of British Columbia, Vancouver, BC V6T 1Z4, Canada, and 4 Department of Molecular, Cellular and Developmental Biology, University of Michigan, Ann Arbor, MI 48109, USA Received 14 October 2010; revised 19 January 2011; accepted 31 January 2011. * For correspondence (fax +1 865 974 1947; e-mail fengc@utk.edu). SUMMARY Some plant


GHESolar | Open Energy Information  

Open Energy Info (EERE)

Name: GHESolar Place: United Kingdom Zip: RG14 2TF Sector: Solar Product: Wholesaler of solar panels based in Berkshire, UK. References: GHESolar1 This article is a stub. You...


Fuel Cell Markets Ltd | Open Energy Information  

Open Energy Info (EERE)

Fuel Cell Markets Ltd Place: Buckinghamshire, United Kingdom Zip: SL0 9AQ Sector: Hydro, Hydrogen Product: Fuel Cell Markets was set up to assist companies in the fuel cell and...


Scotrenewables Wind Power and Marine Power Ltd | Open Energy...  

Open Energy Info (EERE)

Wind Power and Marine Power Ltd Jump to: navigation, search Name: Scotrenewables Wind Power and Marine Power Ltd Place: Orkey, Scotland, United Kingdom Zip: KW16 3AW Sector:...


Celt Power Ltd | Open Energy Information  

Open Energy Info (EERE)

search Name: Celt Power Ltd Place: Newton, United Kingdom Zip: SY16 1RB Sector: Wind energy Product: JV between Euros Energy Europe and ScottishPower to develop UK wind...


GAOH Offshore | Open Energy Information  

Open Energy Info (EERE)

GAOH Offshore Jump to: navigation, search Name: GAOH Offshore Place: St Peter Port, United Kingdom Zip: GY1 4EE Sector: Wind energy Product: Intends to become the preferred...


Tidal Hydraulic Generators Ltd | Open Energy Information  

Open Energy Info (EERE)

Generators Ltd Address: 14 Thislesboon Drive Place: Mumbles Zip: SA3 4HY Region: United Kingdom Sector: Marine and Hydrokinetic Phone Number: 44 (0)1792 360400 Website: http:...


Slough Heat and Power | Open Energy Information  

Open Energy Info (EERE)

Slough Heat and Power Jump to: navigation, search Name: Slough Heat and Power Place: SL1 4TU, England, United Kingdom Zip: SL1 4TU Sector: Renewable Energy Product: String...


CeCap LLP | Open Energy Information  

Open Energy Info (EERE)

Name: CeCap LLP Place: London, United Kingdom Zip: W1S 2LQ Product: London-based investment boutique which provides investment advice to, and invests in, small to mediun size...


Catal International Ltd | Open Energy Information  

Open Energy Info (EERE)

Catal International Ltd. Place: Sheffield, United Kingdom Zip: S10 3YT Sector: Hydro, Hydrogen Product: Catal has worked together with LIFE-IC on the "hydrogen producing steam...


Cambrian Wind Energy | Open Energy Information  

Open Energy Info (EERE)

Place: London, Greater London, United Kingdom Zip: W1U 6RP Sector: Renewable Energy, Wind energy Product: UK wind energy company acquired by Falck Renewables Ltd, the wind energy...


BP Alternative Energy | Open Energy Information  

Open Energy Info (EERE)

BP Alternative Energy Place: London, United Kingdom Zip: SW1Y 4PD Product: London-based holding company for BP's activities in alternative energy and a subsidiary of BP plc....


Carbon Compliance Acquisition 5 Limited | Open Energy Information  

Open Energy Info (EERE)

Acquisition 5 Limited Jump to: navigation, search Name: Carbon Compliance Acquisition 5 Limited Place: Greater London, United Kingdom Zip: EC2M 2TD Sector: Carbon Product: This is...


Less Carbon Ltd | Open Energy Information  

Open Energy Info (EERE)

Less Carbon Ltd Jump to: navigation, search Name: Less Carbon Ltd Place: London, Greater London, United Kingdom Zip: EC3M 4BT Sector: Carbon Product: Less Carbon advises energy...


First Carbon Fund Ltd | Open Energy Information  

Open Energy Info (EERE)

First Carbon Fund Ltd Jump to: navigation, search Name: First Carbon Fund Ltd Place: London, Greater London, United Kingdom Zip: EC1V 9EE Sector: Carbon Product: First Carbon Fund...

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gamesa Energy UK | Open Energy Information  

Open Energy Info (EERE)

Kingdom Zip: NP10 8FY Sector: Wind energy Product: UK arm of wind farm developer and turbine manufacturer Gamesa. References: Gamesa Energy UK1 This article is a stub. You...


Green Capital Management | Open Energy Information  

Open Energy Info (EERE)

Green Capital Management Place: London, United Kingdom Zip: SW10 0BB Sector: Services Product: The Green Capital Management Fund LP is a private equity fund dedicated to investing...


Smith Electric Vehicles SEV Group Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Jump to: navigation, search Name: Smith Electric Vehicles (SEV) Group Ltd Place: Tyne & Wear, United Kingdom Zip: NE38 9DA Sector: Vehicles Product: UK-based manufacturer of...


Coronation Power | Open Energy Information  

Open Energy Info (EERE)

Coronation Power Jump to: navigation, search Name: Coronation Power Place: London, Greater London, United Kingdom Zip: EC1A 4JQ Sector: Wind energy Product: UK company formed to...


Prenergy Power Ltd | Open Energy Information  

Open Energy Info (EERE)

Prenergy Power Ltd Jump to: navigation, search Name: Prenergy Power Ltd Place: London, England, United Kingdom Zip: W1J 5HS Sector: Biomass Product: Prenergy is owned by a group of...


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean



Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds



Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area


Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...


Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...


Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A



Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...


Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en


Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California


Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member


End of the Old Kingdom  

E-Print Network [OSTI]

Hassan, Fekri 1997 Nile floods and political disorder inhypothesis that reduced Nile floods in conjunction with the

Mueller-Wollermann, Renate



The London Hydrogen Partnership | Open Energy Information  

Open Energy Info (EERE)

Partnership Partnership Jump to: navigation, search Name The London Hydrogen Partnership Place London, United Kingdom Zip SE1 2AA Sector Hydro, Hydrogen Product The London Hydrogen Partnership is striving to promote the use of hydrogen as an alternative fuel in the capital to improve air quality, reduce greenhouse gases and noise, improve energy security and support Londonâ€(tm)s green economy. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Climate and Development Knowledge Network (CDKN) | Open Energy Information  

Open Energy Info (EERE)

Climate and Development Knowledge Network (CDKN) Climate and Development Knowledge Network (CDKN) (Redirected from UK Climate and Development Knowledge Network (CDKN)) Jump to: navigation, search Logo: The Climate and Development Knowledge Network (CDKN) Name The Climate and Development Knowledge Network (CDKN) Address 7 More London Riverside London Place London, United Kingdom Zip SE1 2RT Year founded 2010 Website http://www.cdkn.org/ Coordinates 51.504573679871°, -0.081045627593994° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.504573679871,"lon":-0.081045627593994,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The boatbuilding industry of New Kingdom Egypt  

E-Print Network [OSTI]

(Krakow 1975) fig. 12 . . 45 l7 Disassembled chair of NK date showing mortise-and-tenon joinery and holes for dowels or pegs, from Killen (Warminster 1980) pl. 90 . . . . . . . . . . . . . . . . 46 18 a. Square-bar mortising chisel BM 6053, from Killen... and the Griffith Institute . 64 31 Model tool bin from a MK carpenters' workshop model, from Winlock (New York 1955) pl. 28 . 65 32 Egyptian ships on the sea: Hatshepsut's expedition to Punt (left), from Naville (London 1898) pl. LXXIV; Ramesses III's naval...

Monroe, Christopher Mountfort



Kingdom protozoa and its 18 phyla.  

Science Journals Connector (OSTI)

...Melkonian, and D. J. Chapman (ed.), Handbook of Protoctista. Jones & Bartlett, Boston...Melkonian, and D. J. Chapman (ed.), Handbook of Protoctista. Jones & Bartlett, Boston...Melkonian, and D. J. Chapman (ed.), Handbook of Protoctista. Jones & Bartlett, Boston...

T Cavalier-Smith



Marine Nuclear Propulsion for the United Kingdom  

Science Journals Connector (OSTI)

... the Government in an adjournment debate in the House of Commons on March 21 on marine nuclear ... nuclear propulsion, the Joint Parliamentary Secretary to the Ministry of Transport, Mr. John Hay, said ...



Hydrological Summary for the United Kingdom  

E-Print Network [OSTI]

concentrations of suspended solids restricted replenishment to some pumped storage reservoirs (e.g. Farmoor. On the 19th , however, the passage of a very vigorous frontal system heralded an exceptionally unsettled

Watson, Andrew


Cheap acoustics as a learning methodology London South Bank University, FESBE, Borough Road, SE1 0AA London, UK  

E-Print Network [OSTI]

, Revit:Ecotect, Google Sketchup, ARTA, and winMLS. Through info4education.co.uk the students have access

Paris-Sud XI, Université de


Synthesis, Structure, and Properties of Turbostratically Disordered (PbSe)1.18(TiSe2)2  

Science Journals Connector (OSTI)

Department of Natural Sciences, Oregon Institute of Technology, Klamath Falls, Oregon 97601, United States ... The chemical formula that describes these compounds is generally written as [(MX)1+?]m(TX2)n where X is a chalcogen, M is Sn, Pb, Bi, or a rare earth metal, T is a group IV, V, or VI transition metal, and ? reflects the difference in the in-plane packing density of the two constituents. ... The thermal conductivities of these nanoscale layered materials fall below the predicted min. ...

Daniel B. Moore; Matt Beekman; Sabrina Disch; Paul Zschack; Ines Husler; Wolfgang Neumann; David C. Johnson



Formation of core/shell-like ZnSe(1?x)Te(x) nanocrystals due to equilibrium surface segregation  

SciTech Connect (OSTI)

We report results of equilibrium surface segregation in ZnSe{sub 1?x}Te{sub x} nanocrystals based on a computational analysis of coupled compositional, structural, and volume relaxation of the nanocrystals that employs Monte Carlo and conjugate-gradient methods according to a first-principles-parameterized description of interatomic interactions. We have determined the equilibrium concentration distribution as a function of nanocrystal size and composition for nanocrystal morphologies that include faceted equilibrium crystal shapes. The results identify the nanoparticle size and composition ranges that allow for self-assembly of core/shell-like nanocrystal structures characterized by a Te-deficient core and a Te-rich shell.

Pandey, Sumeet C.; Mountziaris, T. J.; Venkataraman, Dhandapani; Maroudas, Dimitris



3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)


Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...


Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced


A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-



Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating



Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music


Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi


Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne



Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu



Inter-Kingdom Signaling Interactions in Enterohemorrhagic Escherichia coli Infections  

E-Print Network [OSTI]

and the human intestinal epithelial cells, which they colonize. Differential gene expression of EHEC was studied upon exposure to the human neuroendocrine hormones epinephrine and norepinephrine. We determined that these hormones increase EHEC chemotaxis...

Bansal, Tarun



An Energy Overview of the Kingdom of Thailand  

SciTech Connect (OSTI)

The DOE Office of Fossil Energy is maintaining a web site that is meant to provide useful business- and energy-related information about countries and regions of the world for exporters, project developers, and researchers. The site consists of more than 130 country pages (organized into seven different world regions), with each country page having its own set of links to information sources about that country. There are also more than 30 Country Energy Overviews at the web site -- each of these is a comprehensive review of a specific country's entire energy situation, including sections on Energy Policy, Oil, Natural Gas, Coal, Hydroelectric/Renewables, Nuclear Power, Energy Transmission Infrastructure, Electricity, Electric Industry Overview, Environmental Activities, Privatization, Trade, and Economic Situation. The specific country highlighted in this Country Energy Overview is Thailand. The site is designed to be dynamic. Updates to the overviews will be made as need and resource s permit.




Heterotrimeric G protein signalling in the plant kingdom  

Science Journals Connector (OSTI)

...found in a screen for mutants defective in gibberellin (GA) responsiveness...protein(s) [75]. In fact, cAR-like proteins are found in...homologous gene encoding a non-cAR GPCR is found in plant genomes...Rice dwarf mutant d1, which is defective in the alpha subunit of the...



Dissemination and Storage of Scientific Information in the United Kingdom  

Science Journals Connector (OSTI)

... flavours; triazines; town gas; ultra-high pressure; ultra-high vacuum; ultrasonics; water desalination. The Centre has been able to provide material for all 'Current Awareness' requests ...




The Evolution of Sex: a Perspective from the Fungal Kingdom  

Science Journals Connector (OSTI)

...Penalva, M. Pertea, C. Price, B. L. Pritchard, M. A...A. Shemanchuk. 1975. Life history of Coelomomyces psorophorae...Given their unique evolutionary history as opisthokonts, along with...Center, Durham, NC 27710, USA. | Journal Article Research...

Soo Chan Lee; Min Ni; Wenjun Li; Cecelia Shertz; Joseph Heitman



Policy and regulation for smart grids in the United Kingdom  

Science Journals Connector (OSTI)

Abstract The UK has adopted legal obligations concerning climate change which will place increased stresses on the current traditional model of centralised generation. This will include the stimulation of large volumes of intermittent generation, more distributed generation and larger and more variable loads at grid extremities, potentially including large volumes of electric vehicles and heat pumps. Smarter grids have been mooted as a major potential contributor to the decarbonisation of electricity, through facilitation of reduced losses, greater system efficiency, enhanced flexibility to allow the system to deal with intermittent sources and a number of other benefits. This article considers the different policy elements of what will be required for energy delivery in the UK to become smarter, the challenges this presents, the extent to which these are currently under consideration and some of the changes that might be needed in the future.

Peter M. Connor; Philip E. Baker; Dimitrios Xenias; Nazmiye Balta-Ozkan; Colin J. Axon; Liana Cipcigan



The united kingdom's changing requirements for spent fuel storage  

SciTech Connect (OSTI)

The UK is adopting an open fuel cycle, and is necessarily moving to a regime of long term storage of spent fuel, followed by geological disposal once a geological disposal facility (GDF) is available. The earliest GDF receipt date for legacy spent fuel is assumed to be 2075. The UK is set to embark on a programme of new nuclear build to maintain a nuclear energy contribution of 16 GW. Additionally, the UK are considering a significant expansion of nuclear energy in order to meet carbon reduction targets and it is plausible to foresee a scenario where up to 75 GW from nuclear power production could be deployed in the UK by the mid 21. century. Such an expansion, could lead to spent fuel storage and its disposal being a dominant issue for the UK Government, the utilities and the public. If the UK were to transition a closed fuel cycle, then spent fuel storage should become less onerous depending on the timescales. The UK has demonstrated a preference for wet storage of spent fuel on an interim basis. The UK has adopted an approach of centralised storage, but a 16 GW new build programme and any significant expansion of this may push the UK towards distributed spent fuel storage at a number of reactors station sites across the UK.

Hodgson, Z.; Hambley, D.I.; Gregg, R.; Ross, D.N. [National Nuclear Laboratory, Chadwick House, Birchwood Park, Warrington, Cheshire WA3 6AE (United Kingdom)



Kingdom of Saudi Arabia Assessment of Rainfall Augmentation  

E-Print Network [OSTI]

of the cloud droplet size distribution. · Focus on improving the AIMMS vertical wind measurements. 2 #12 a month ahead of time. In addition to lectures, Dr. Tilley worked closely with local scientists using their installation of the Weather and Research Forecasting (WRF) model. Topics coved by Dr. Tilley's lectures

Delene, David J.


Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo



E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.


Baywind Energy Co operative Ltd | Open Energy Information  

Open Energy Info (EERE)

Baywind Energy Co operative Ltd Baywind Energy Co operative Ltd Jump to: navigation, search Name Baywind Energy Co-operative Ltd Place Barrow in Furness, Cumbria, United Kingdom Zip LA14 2PN Sector Renewable Energy, Wind energy Product A co-operative which owns 6 wind turbines in Cumbria and is seeking further opportunities to build renewable schemes. References Baywind Energy Co-operative Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Baywind Energy Co-operative Ltd is a company located in Barrow in Furness, Cumbria, United Kingdom . References ↑ "Baywind Energy Co-operative Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Baywind_Energy_Co_operative_Ltd&oldid=34255


Pulsar Energy Capital L L P | Open Energy Information  

Open Energy Info (EERE)

Pulsar Energy Capital L L P Pulsar Energy Capital L L P Jump to: navigation, search Name Pulsar Energy Capital L.L.P. Place London, United Kingdom Zip SW20 0PU Product Pulsar Energy Capital LLP is a private equity firm that invests in high growth companies in the energy sector. References Pulsar Energy Capital L.L.P.[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Pulsar Energy Capital L.L.P. is a company located in London, United Kingdom . References ↑ "Pulsar Energy Capital L.L.P." Retrieved from "http://en.openei.org/w/index.php?title=Pulsar_Energy_Capital_L_L_P&oldid=350046" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Renewable Energy Systems Ltd RES Group | Open Energy Information  

Open Energy Info (EERE)

Systems Ltd RES Group Systems Ltd RES Group Jump to: navigation, search Name Renewable Energy Systems Ltd (RES Group) Place Hertfordshire, United Kingdom Zip WD4 8LR Sector Wind energy Product UK based wind energy company with over 800 MW of capacity built and more than 600 MW in development in the UK, Europe, North America, the Caribbean and Asia. References Renewable Energy Systems Ltd (RES Group)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Energy Systems Ltd (RES Group) is a company located in Hertfordshire, United Kingdom . References ↑ "Renewable Energy Systems Ltd (RES Group)" Retrieved from "http://en.openei.org/w/index.php?title=Renewable_Energy_Systems_Ltd_RES_Group&oldid=350336


Cambrian Caledonian Ltd formerly Cambrian Engineering Ltd | Open Energy  

Open Energy Info (EERE)

Ltd formerly Cambrian Engineering Ltd Ltd formerly Cambrian Engineering Ltd Jump to: navigation, search Name Cambrian Caledonian Ltd (formerly Cambrian Engineering Ltd) Place Bangor, Gwynedd, United Kingdom Zip LL57 4YH Sector Renewable Energy, Wind energy Product Manufactures wind turbine towers and monopile foundations for the onshore and offshore renewable energy sector. References Cambrian Caledonian Ltd (formerly Cambrian Engineering Ltd)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Cambrian Caledonian Ltd (formerly Cambrian Engineering Ltd) is a company located in Bangor, Gwynedd, United Kingdom . References ↑ "Cambrian Caledonian Ltd (formerly Cambrian Engineering Ltd)" Retrieved from


Innovative Materials Processing Technologies Ltd IMPT | Open Energy  

Open Energy Info (EERE)

Processing Technologies Ltd IMPT Processing Technologies Ltd IMPT Jump to: navigation, search Name Innovative Materials Processing Technologies Ltd (IMPT) Place United Kingdom Zip NG1 1GF Sector Solar Product UK-based manufacturer of non-vacuum coating systems for fuel cells and solar sectors. References Innovative Materials Processing Technologies Ltd (IMPT)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Innovative Materials Processing Technologies Ltd (IMPT) is a company located in United Kingdom . References ↑ "Innovative Materials Processing Technologies Ltd (IMPT)" Retrieved from "http://en.openei.org/w/index.php?title=Innovative_Materials_Processing_Technologies_Ltd_IMPT&oldid=346972


Carbon Trust Enterprises Limited | Open Energy Information  

Open Energy Info (EERE)

Enterprises Limited Enterprises Limited Jump to: navigation, search Name Carbon Trust Enterprises Limited Place London, United Kingdom Zip WC2A 2AZ Sector Carbon Product Carbon Trust Enterprises creates and invests in new, high growth, carbon reducing businesses. Typically the company focuses on use of mature technologies rather than on technology innovations. References Carbon Trust Enterprises Limited[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Carbon Trust Enterprises Limited is a company located in London, United Kingdom . References ↑ "Carbon Trust Enterprises Limited" Retrieved from "http://en.openei.org/w/index.php?title=Carbon_Trust_Enterprises_Limited&oldid=343250"


Broadview Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Broadview Energy Ltd Broadview Energy Ltd Jump to: navigation, search Name Broadview Energy Ltd Place London, Greater London, United Kingdom Zip SW14 8SN Sector Wind energy Product Broadview Energy Ltd is a wind project developer in Great Britain focusing on small scale projects (between 2 to 10 turbines). References Broadview Energy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Broadview Energy Ltd is a company located in London, Greater London, United Kingdom . References ↑ "Broadview Energy Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Broadview_Energy_Ltd&oldid=343058" Categories: Clean Energy Organizations Companies Organizations Stubs


Renewable Fuel Supply Ltd RFSL | Open Energy Information  

Open Energy Info (EERE)

Supply Ltd RFSL Supply Ltd RFSL Jump to: navigation, search Name Renewable Fuel Supply Ltd (RFSL) Place United Kingdom Zip W1J 5EN Sector Biomass Product UKâ€(tm)s largest supplier of biomass to the UK co-firing power stations. References Renewable Fuel Supply Ltd (RFSL)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Fuel Supply Ltd (RFSL) is a company located in United Kingdom . References ↑ "[fsl@@Pikefsl@@Renewablefsl@@generationfsl@@sub*-Utilityfsl@@Photovoltanicsfsl@@Fuelfsl@@Wind-Poerfsl@@/ Renewable Fuel Supply Ltd (RFSL)" Retrieved from "http://en.openei.org/w/index.php?title=Renewable_Fuel_Supply_Ltd_RFSL&oldid=350339" Categories:

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Integrated Energy Systems International Ltd | Open Energy Information  

Open Energy Info (EERE)

Energy Systems International Ltd Energy Systems International Ltd Jump to: navigation, search Name Integrated Energy Systems International Ltd Place United Kingdom Zip PR1 2NL Sector Biomass Product UK-based firm which operates in energy technology management and cost control. The firm is working with International Paper on a biomass project. References Integrated Energy Systems International Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Integrated Energy Systems International Ltd is a company located in United Kingdom . References ↑ "Integrated Energy Systems International Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Integrated_Energy_Systems_International_Ltd&oldid=347005"


Hazel Capital | Open Energy Information  

Open Energy Info (EERE)

Hazel Capital Hazel Capital Jump to: navigation, search Name Hazel Capital Place London, England, United Kingdom Zip WC2A 1AL Sector Efficiency, Renewable Energy Product Hazel Capital is an asset management company investing in Renewable Energy, Energy Efficiency (in energy transmission, building construction, electronic and engineered products), Water, Transportation, Waste Management, Recycling & Pollution Control. References Hazel Capital[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Hazel Capital is a company located in London, England, United Kingdom . References ↑ "Hazel Capital" Retrieved from "http://en.openei.org/w/index.php?title=Hazel_Capital&oldid=346400


Dulas Ltd | Open Energy Information  

Open Energy Info (EERE)

Dulas Ltd Dulas Ltd Jump to: navigation, search Name Dulas Ltd Place Powys, Wales, United Kingdom Zip SY20 8AX Sector Biomass, Hydro, Renewable Energy, Solar, Wind energy Product Renewable energy consultancy encompassing all aspects of the industry from policy, market simulation and resource assessment right through to research, design, training and the implementation of wind, solar, small hydro and biomass projects. References Dulas Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Dulas Ltd is a company located in Powys, Wales, United Kingdom . References ↑ "Dulas Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Dulas_Ltd&oldid=344343


Amrite Ltd | Open Energy Information  

Open Energy Info (EERE)

Amrite Ltd Amrite Ltd Jump to: navigation, search Name Amrite Ltd Place High Wycombe, United Kingdom Zip HP10 8QP Sector Renewable Energy Product Invests in renewable energy project development and power generation. Same shareholders as Renewable Energy Management Ltd. References Amrite Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Amrite Ltd is a company located in High Wycombe, United Kingdom . References ↑ "Amrite Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Amrite_Ltd&oldid=342165" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


Ceres BioVentures Ltd | Open Energy Information  

Open Energy Info (EERE)

Ceres BioVentures Ltd Ceres BioVentures Ltd Jump to: navigation, search Name Ceres BioVentures Ltd Place Surrey, United Kingdom Zip TW10 5ED Sector Biomass Product UK-based firm that provides biomass supply solutions to European power and heat markets. It controls the entire supply chain to deliver reliable, repeatable and certifiably sustainable volumes in woodchip and wood pellet form. References Ceres BioVentures Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Ceres BioVentures Ltd is a company located in Surrey, United Kingdom . References ↑ "Ceres BioVentures Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Ceres_BioVentures_Ltd&oldid=343419"


Wind Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Edinburgh, Scotland, United Kingdom Edinburgh, Scotland, United Kingdom Zip EH2 2ER Sector Wind energy Product Company attempting to secure planning permission for wind projects in Scotland. Coordinates 55.954155°, -3.202774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.954155,"lon":-3.202774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


West Coast Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Mold, Scotland, United Kingdom Mold, Scotland, United Kingdom Zip CH7 4EW Sector Wind energy Product Wind farm developer. Coordinates 47.742828°, -119.3423° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.742828,"lon":-119.3423,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Carbon Disclosure Project | Open Energy Information  

Open Energy Info (EERE)

Disclosure Project Disclosure Project Jump to: navigation, search Name Carbon Disclosure Project Place London, United Kingdom Zip EC1R 0NE Product A secretariat for 143 institutional investors with USD 20 trn under management, it aims to encourage the development of a common emissions measurement methodology and to facilitate its integration into general investment analysis. References Carbon Disclosure Project[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Carbon Disclosure Project is a company located in London, United Kingdom . References ↑ "Carbon Disclosure Project" Retrieved from "http://en.openei.org/w/index.php?title=Carbon_Disclosure_Project&oldid=343232


Wind Power Renewables | Open Energy Information  

Open Energy Info (EERE)

Norfolk, United Kingdom Norfolk, United Kingdom Zip NR29 5BG Sector Wind energy Product Wind project developer Coordinates 36.846825°, -76.285069° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.846825,"lon":-76.285069,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Climate Change Advisory Ltd | Open Energy Information  

Open Energy Info (EERE)

Climate Change Advisory Ltd Climate Change Advisory Ltd Jump to: navigation, search Name Climate Change Advisory Ltd Place London, United Kingdom Zip W1K 3HP Sector Renewable Energy, Services Product CCA provides advisory services in relation to corporate and project finance to companies seeking to develop renewable energy projects and technologies. References Climate Change Advisory Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Climate Change Advisory Ltd is a company located in London, United Kingdom . References ↑ "Climate Change Advisory Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Climate_Change_Advisory_Ltd&oldid=343703" Categories: Clean Energy Organizations


ABEnergy Ltd | Open Energy Information  

Open Energy Info (EERE)

ABEnergy Ltd ABEnergy Ltd Jump to: navigation, search Name ABEnergy Ltd Place Staverton, Glos, United Kingdom Zip GL2 9QL Sector Wind energy Product Developer & owner / operator of wind projects in the UK. References ABEnergy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. ABEnergy Ltd is a company located in Staverton, Glos, United Kingdom . References ↑ "[ ABEnergy Ltd]" Retrieved from "http://en.openei.org/w/index.php?title=ABEnergy_Ltd&oldid=341674" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load)


Institutional Investors Group on Climate Change IIGCC | Open Energy  

Open Energy Info (EERE)

Institutional Investors Group on Climate Change IIGCC Institutional Investors Group on Climate Change IIGCC Jump to: navigation, search Name Institutional Investors Group on Climate Change (IIGCC) Place London, United Kingdom Zip EC1N 7WF Product The IIGCC is a forum for collaboration between pension funds and other institutional investors on issues related to climate change. References Institutional Investors Group on Climate Change (IIGCC)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Institutional Investors Group on Climate Change (IIGCC) is a company located in London, United Kingdom . References ↑ "Institutional Investors Group on Climate Change (IIGCC)" Retrieved from "http://en.openei.org/w/index.php?title=Institutional_Investors_Group_on_Climate_Change_IIGCC&oldid=346996


Scotia Wind Ltd | Open Energy Information  

Open Energy Info (EERE)

Scotia Wind Ltd Scotia Wind Ltd Jump to: navigation, search Name Scotia Wind Ltd Place Stirling, Scotland, United Kingdom Zip FK9 7AJ Sector Wind energy Product Scotia Wind is an independent developer and operator of small to medium scale wind energy projects in the United Kingdom. Coordinates 40.67068°, -74.494569° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.67068,"lon":-74.494569,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Core Technology Ventures Services CTV | Open Energy Information  

Open Energy Info (EERE)

Technology Ventures Services CTV Technology Ventures Services CTV Jump to: navigation, search Name Core Technology Ventures Services (CTV) Place Co Durham, United Kingdom Zip DL13 3DS Sector Hydro, Hydrogen Product An independent advisory team focused on seed and early stage companies developing fuel cell systems and hydrogen storage technologies. References Core Technology Ventures Services (CTV)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Core Technology Ventures Services (CTV) is a company located in Co Durham, United Kingdom . References ↑ "Core Technology Ventures Services (CTV)" Retrieved from "http://en.openei.org/w/index.php?title=Core_Technology_Ventures_Services_CTV&oldid=34391


Proven Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Proven Energy Ltd Proven Energy Ltd Jump to: navigation, search Name Proven Energy Ltd Place Stewarton, Ayrshire, Scotland, United Kingdom Zip KA3 5LH Sector Wind energy Product Scottish micro wind turbine manufacturer. References Proven Energy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Proven Energy Ltd is a company located in Stewarton, Ayrshire, Scotland, United Kingdom . References ↑ "Proven Energy Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Proven_Energy_Ltd&oldid=350019" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


Gulfsands Petroleum | Open Energy Information  

Open Energy Info (EERE)

Gulfsands Petroleum Gulfsands Petroleum Jump to: navigation, search Logo: Gulfsands Petroleum Name Gulfsands Petroleum Address 2-4 Cork Street Place London, United Kingdom Zip W1S 3LG Product oil and gas exploration and production Stock Symbol AIM:GPX Phone number +44 20 7434 60 60 Website http://www.gulfsands.com/s/Hom References Gulfsands Petroleum[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Gulfsands Petroleum is a company based in London, United Kingdom. Gulfsands Petroleum has oil exploration and development projects in Syria, oil exploration projects in Tunisia, and upstream and midstream oil and gas development activities in Iraq. While Gulfsands Petroleum's focus areas are


BVG Associates Ltd | Open Energy Information  

Open Energy Info (EERE)

BVG Associates Ltd BVG Associates Ltd Jump to: navigation, search Name BVG Associates Ltd Place London, Greater London, United Kingdom Zip W13 9ES Sector Renewable Energy, Wind energy Product London-based consultancy, providing clients with assistance at all stages of activities that propose renewable electricity generation as an ends. Specialising in wind turbine processes. References BVG Associates Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. BVG Associates Ltd is a company located in London, Greater London, United Kingdom . References ↑ "BVG Associates Ltd" Retrieved from "http://en.openei.org/w/index.php?title=BVG_Associates_Ltd&oldid=343112"


Marine Projects International Ltd MPI formerly Mayflower Energy Ltd | Open  

Open Energy Info (EERE)

MPI formerly Mayflower Energy Ltd MPI formerly Mayflower Energy Ltd Jump to: navigation, search Name Marine Projects International Ltd (MPI) (formerly Mayflower Energy Ltd) Place United Kingdom Zip TS3 8BS Sector Wind energy Product Specialist offshore wind installation equipment supplier. References Marine Projects International Ltd (MPI) (formerly Mayflower Energy Ltd)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Marine Projects International Ltd (MPI) (formerly Mayflower Energy Ltd) is a company located in United Kingdom . References ↑ "Marine Projects International Ltd (MPI) (formerly Mayflower Energy Ltd)" Retrieved from "http://en.openei.org/w/index.php?title=Marine_Projects_International_Ltd_MPI_formerly_Mayflower_Energy_Ltd&oldid=348642


Cleantech Professional Resource Global Limited CPR Global | Open Energy  

Open Energy Info (EERE)

Professional Resource Global Limited CPR Global Professional Resource Global Limited CPR Global Jump to: navigation, search Name Cleantech Professional Resource Global Limited (CPR Global) Place London, United Kingdom Zip EC4M 9DN Product Cleantech Professional Resource is a resource management consultancy focusing on the cleantech sector in the UK and Europe. References Cleantech Professional Resource Global Limited (CPR Global)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Cleantech Professional Resource Global Limited (CPR Global) is a company located in London, United Kingdom . References ↑ "Cleantech Professional Resource Global Limited (CPR Global)" Retrieved from "http://en.openei.org/w/index.php?title=Cleantech_Professional_Resource_Global_Limited_CPR_Global&oldid=343687


EPOD Solar Wales Ltd formerly ICP Solar Technologies Ltd | Open Energy  

Open Energy Info (EERE)

Wales Ltd formerly ICP Solar Technologies Ltd Wales Ltd formerly ICP Solar Technologies Ltd Jump to: navigation, search Name EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd) Place Mid Glamorgan, United Kingdom Zip CF31 3YN Sector Solar Product Research, development, manufacturing,marketing and sales of leading-edge solar energy products. References EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd) is a company located in Mid Glamorgan, United Kingdom . References ↑ "EPOD Solar (Wales) Ltd (formerly ICP Solar Technologies Ltd)" Retrieved from "http://en.openei.org/w/index.php?title=EPOD_Solar_Wales_Ltd_formerly_ICP_Solar_Technologies_Ltd&oldid=34508

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


3G Energi | Open Energy Information  

Open Energy Info (EERE)

Energi Energi Jump to: navigation, search Name 3G Energi Place United Kingdom Zip TD5 7BH Product Manufacturers of pellet stoves and boilers. Also offers consultancy, feasability studies and advice. References 3G Energi[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. 3G Energi is a company located in United Kingdom . References ↑ "3G Energi" Retrieved from "http://en.openei.org/w/index.php?title=3G_Energi&oldid=341626" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load)


Ocean Navitas | Open Energy Information  

Open Energy Info (EERE)

Navitas Navitas Jump to: navigation, search Name Ocean Navitas Address Nursery House Place United Kingdom Zip DN21 5BQ Sector Ocean Product Ocean Navitas was incorporated in May 2006 by experienced engineers, businessmen and sailing enthusiasts David Hunt, James McCague and Simon Condry. Website http://www.oceannavitas.com Region United Kingdom References Ocean NavitasUNIQ75db538f85b32404-ref-000014E2-QINU LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: Ocean Navitas NaREC This company is involved in the following MHK Technologies: Aegir Dynamo This article is a stub. You can help OpenEI by expanding it.


PI Renewables Ltd | Open Energy Information  

Open Energy Info (EERE)

PI Renewables Ltd PI Renewables Ltd Jump to: navigation, search Name PI Renewables Ltd Place Livingston, United Kingdom Zip EH55 8QL Sector Hydro, Wind energy Product Builds, owns and operates wind, LFG and small hydro assets in the UK market. Mistral LP invested USD 0.9m in the company in August 2004. References PI Renewables Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. PI Renewables Ltd is a company located in Livingston, United Kingdom . References ↑ "PI Renewables Ltd" Retrieved from "http://en.openei.org/w/index.php?title=PI_Renewables_Ltd&oldid=349739" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Renewable Power and Light | Open Energy Information  

Open Energy Info (EERE)

and Light and Light Jump to: navigation, search Name Renewable Power and Light Place London, Greater London, United Kingdom Zip W1 J5P2 Sector Biofuels, Renewable Energy Product Renewable Power and Light intend to become a power producer generating from renewable sources with renewable technologies, in particluar with regard to biofuels. References Renewable Power and Light[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Power and Light is a company located in London, Greater London, United Kingdom . References ↑ "Renewable Power and Light" Retrieved from "http://en.openei.org/w/index.php?title=Renewable_Power_and_Light&oldid=350347"


Bloomberg New Energy Finance formerly New Energy Finance Ltd | Open Energy  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Bloomberg New Energy Finance (formerly New Energy Finance Ltd) Place London, Greater London, United Kingdom Zip EC2A 1PQ Sector Carbon Product London-based subsidiary of Bloomberg LP, which provides industry information and analysis to investors, corporations and governments in clean energy, low carbon technologies and the carbon markets. References Bloomberg New Energy Finance (formerly New Energy Finance Ltd)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Bloomberg New Energy Finance (formerly New Energy Finance Ltd) is a company located in London, Greater London, United Kingdom . Documents Opendata.pdf Open Data and "Crowdsourcing" can help Developing Countries make crucial


Natural Power | Open Energy Information  

Open Energy Info (EERE)

Power Power Place Castle Douglas, Scotland, United Kingdom Zip DG7 3XS Sector Services, Wind energy Product Specialists including project managers, ecologists, GIS and mapping experts, construction managers, wind farm designers, geotechnical engineers and land agents who deliver technical and management services. Number of employees 201-500 Phone number +1 (518) 308-0200 Website http://www.naturalpower.com/ References Natural Power[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Natural Power is a company located in Castle Douglas, Scotland, United Kingdom, Saratoga Springs, NY, and other locations worldwide. References Cite error: tags exist, but no tag was found


Solargen Solutions UK | Open Energy Information  

Open Energy Info (EERE)

UK UK Jump to: navigation, search Name Solargen Solutions UK Place United Kingdom Zip NP 44 3AS Sector Renewable Energy, Solar Product String representation "SolarGen is a E ... s requirements." is too long. References Solargen Solutions UK[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solargen Solutions UK is a company located in United Kingdom . References ↑ "Solargen Solutions UK" Retrieved from "http://en.openei.org/w/index.php?title=Solargen_Solutions_UK&oldid=351378" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


Renewable Energy Association UK REA | Open Energy Information  

Open Energy Info (EERE)

UK REA UK REA Jump to: navigation, search Name Renewable Energy Association UK (REA) Place London, United Kingdom Zip SW1Y 4AR Sector Renewable Energy Product Trade association open to all companies involved in the UK renewable energy industry. References Renewable Energy Association UK (REA)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Energy Association UK (REA) is a company located in London, United Kingdom . References ↑ "Renewable Energy Association UK (REA)" Retrieved from "http://en.openei.org/w/index.php?title=Renewable_Energy_Association_UK_REA&oldid=350314" Categories: Clean Energy Organizations Companies Organizations Stubs


JV between KP Renewables and Living Buildings | Open Energy Information  

Open Energy Info (EERE)

and Living Buildings and Living Buildings Jump to: navigation, search Name JV between KP Renewables and Living Buildings Place Brentford, Middlesex, Greater London, United Kingdom Zip TW8 9JJ Sector Biomass Product JV established to develop up to 15.0MW per year of small biomass based power projects on industrial sites in the UK. References JV between KP Renewables and Living Buildings[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. JV between KP Renewables and Living Buildings is a company located in Brentford, Middlesex, Greater London, United Kingdom . References ↑ "JV between KP Renewables and Living Buildings" Retrieved from "http://en.openei.org/w/index.php?title=JV_between_KP_Renewables_and_Living_Buildings&oldid=34782


HydroVenturi Ltd previously RV Power Company Ltd | Open Energy Information  

Open Energy Info (EERE)

HydroVenturi Ltd previously RV Power Company Ltd HydroVenturi Ltd previously RV Power Company Ltd Jump to: navigation, search Name HydroVenturi Ltd (previously RV Power Company Ltd) Place London, Greater London, United Kingdom Zip SW7 1NA Sector Marine and Hydrokinetic Product String representation "Established tho ... ating stations." is too long. Website http://www.hydroventuri.com References HydroVenturi Ltd (previously RV Power Company Ltd)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This article is a stub. You can help OpenEI by expanding it. HydroVenturi Ltd (previously RV Power Company Ltd) is a company located in London, Greater London, United Kingdom . References ↑ "[ HydroVenturi Ltd (previously RV Power Company Ltd)]"


Dawn Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Dawn Energy Ltd Dawn Energy Ltd Jump to: navigation, search Name Dawn Energy Ltd Place London, United Kingdom Zip SW9 6DE Sector Wind energy Product London-based developer of small to mid size onshore wind projects in the UK. References Dawn Energy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Dawn Energy Ltd is a company located in London, United Kingdom . References ↑ "Dawn Energy Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Dawn_Energy_Ltd&oldid=344101" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Renewable Energy Development Group Ltd RED | Open Energy Information  

Open Energy Info (EERE)

RED RED Jump to: navigation, search Name Renewable Energy Development Group Ltd (RED) Place Edinburgh, United Kingdom Zip EH1 2DP Sector Biomass, Hydro, Wind energy Product Developer of wind farms. It is also active in the development of other types of renewably powered electricity generation including hydro-electric and biomass power projects. References Renewable Energy Development Group Ltd (RED)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Renewable Energy Development Group Ltd (RED) is a company located in Edinburgh, United Kingdom . References ↑ "Renewable Energy Development Group Ltd (RED)" Retrieved from "http://en.openei.org/w/index.php?title=Renewable_Energy_Development_Group_Ltd_RED&oldid=350319


Bloomberg New Energy Finance Carbon Markets formerly New Energy Finance  

Open Energy Info (EERE)

formerly New Energy Finance formerly New Energy Finance Carbon Markets Group Jump to: navigation, search Name Bloomberg New Energy Finance Carbon Markets (formerly New Energy Finance Carbon Markets Group) Place London, United Kingdom Zip EC2A 1PQ Sector Carbon, Services Product London-based carbon markets division of New Energy Finance which provides analysis, price forecasting, consultancy and risk management services relating to carbon. References Bloomberg New Energy Finance Carbon Markets (formerly New Energy Finance Carbon Markets Group)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Bloomberg New Energy Finance Carbon Markets (formerly New Energy Finance Carbon Markets Group) is a company located in London, United Kingdom .


Charlton Compact Power Ltd | Open Energy Information  

Open Energy Info (EERE)

Charlton Compact Power Ltd Charlton Compact Power Ltd Jump to: navigation, search Name Charlton Compact Power Ltd Place Frome, England, United Kingdom Zip BA11 2RH Sector Biomass Product A joint venture between A. J. Charlton & Sons and Compact Power to develop a 3.6MW to 4.5MW biomass plant in Somerset. References Charlton Compact Power Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Charlton Compact Power Ltd is a company located in Frome, England, United Kingdom . References ↑ "Charlton Compact Power Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Charlton_Compact_Power_Ltd&oldid=343457" Categories: Clean Energy Organizations Companies Organizations


Integrated Development Projects Ltd | Open Energy Information  

Open Energy Info (EERE)

Development Projects Ltd Development Projects Ltd Jump to: navigation, search Name Integrated Development Projects Ltd Place Devon, United Kingdom Zip EX18 7BL Sector Biomass Product The company's emphasis is placed on economic development in rural areas, and deplying biomass and municipal waste for electricity and CHP both in the UK and overseas. Their foundation project in North Devon includes a 40MWe biomass electricity plant. References Integrated Development Projects Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Integrated Development Projects Ltd is a company located in Devon, United Kingdom . References ↑ "Integrated Development Projects Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Integrated_Development_Projects_Ltd&oldid=347004"


Climate Human Capital | Open Energy Information  

Open Energy Info (EERE)

Climate Human Capital Climate Human Capital Jump to: navigation, search Name Climate Human Capital Place London, United Kingdom Zip W1K 6NG Sector Carbon, Renewable Energy, Services Product Green executive search company, listed in London's PLUS marketplace since 30 MArch 2010, focusing on the following target sectors: Carbon Markets, Environmental Sciences, Research and Advisory, Financial Services, Renewable Energy Generation and Policy. References Climate Human Capital[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Climate Human Capital is a company located in London, United Kingdom . References ↑ "Climate Human Capital" Retrieved from "http://en.openei.org/w/index.php?title=Climate_Human_Capital&oldid=343709


Sequoia Climate Investment Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Sequoia Climate Investment Ltd Place London, United Kingdom Zip EC1V 4PY Sector Carbon Product Start-up carbon credit management and consultancy firm with activities in Turkey and the United Kingdom. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Greenpark Energy | Open Energy Information  

Open Energy Info (EERE)

Greenpark Energy Greenpark Energy Jump to: navigation, search Name Greenpark Energy Place Corbriggs, Chesterfield, England, United Kingdom Zip S41 OJW Sector Biomass Product Uk based, Green Park Energy, project developer of a planned 50MW coal bed methane/biomass power plant. References Greenpark Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Greenpark Energy is a company located in Corbriggs, Chesterfield, England, United Kingdom . References ↑ "[ Greenpark Energy]" Retrieved from "http://en.openei.org/w/index.php?title=Greenpark_Energy&oldid=346104" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Camfridge Ltd | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Camfridge Ltd Jump to: navigation, search Name Camfridge Ltd Place Cambridge, United Kingdom Zip CB4 OWS Sector Efficiency Product Camfridge is a spinout of the University of Cambridge. It started in 2004 to focus on the development of high efficiency magnetic refrigeration technology. References Camfridge Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Camfridge Ltd is a company located in Cambridge, United Kingdom . References ↑ "Camfridge Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Camfridge_Ltd&oldid=343181" Categories: Clean Energy Organizations Companies


Hi Spec Research Developments Ltd | Open Energy Information  

Open Energy Info (EERE)

Spec Research Developments Ltd Spec Research Developments Ltd Jump to: navigation, search Name Hi-Spec Research & Developments Ltd Place Fowey, Cornwall, United Kingdom Zip PL12 1HB Sector Renewable Energy, Wind energy Product Developer of the OHEG renewable/natural energy system which makes an ideal foundation for offshore wind turbines, combining both tidal energy and wind energy. References Hi-Spec Research & Developments Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Hi-Spec Research & Developments Ltd is a company located in Fowey, Cornwall, United Kingdom . References ↑ "Hi-Spec Research & Developments Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Hi_Spec_Research_Developments_Ltd&oldid=346517

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RES UK Ireland Ltd | Open Energy Information  

Open Energy Info (EERE)

Ireland Ltd Ireland Ltd Jump to: navigation, search Name RES UK & Ireland Ltd Place County Antrim, Northern Ireland, United Kingdom Zip BT40 2SF Sector Services, Wind energy Product Wind farm development Ltd became known as RES UK and Ireland Ltd in February 2007. RES UK and Ireland also took control of B9 Energy Services' share of the company. References RES UK & Ireland Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. RES UK & Ireland Ltd is a company located in County Antrim, Northern Ireland, United Kingdom . References ↑ "RES UK & Ireland Ltd" Retrieved from "http://en.openei.org/w/index.php?title=RES_UK_Ireland_Ltd&oldid=350385


KP Renewables Plc | Open Energy Information  

Open Energy Info (EERE)

Plc Plc Jump to: navigation, search Name KP Renewables Plc Place Brentford, Middlesex, Greater London, United Kingdom Zip TW8 9JJ Sector Renewable Energy, Wind energy Product KP is a renewable energy project developer. KP raises funding for small renewable generating projects, especially using wind and waste as fuel and then acts as PPA arranger and power producer. References KP Renewables Plc[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. KP Renewables Plc is a company located in Brentford, Middlesex, Greater London, United Kingdom . References ↑ "KP Renewables Plc" Retrieved from "http://en.openei.org/w/index.php?title=KP_Renewables_Plc&oldid=348173


Earthcare Products | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Earthcare Products Jump to: navigation, search Name Earthcare Products Place Ware, Hertfordshire, England, United Kingdom Zip SG12 9PY Sector Efficiency Product Consultancy and service company for commercial cooling products, specialising in high efficiency and low environmental impact refrigeration and natural refrigerants. References Earthcare Products[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Earthcare Products is a company located in Ware, Hertfordshire, England, United Kingdom . References ↑ "Earthcare Products" Retrieved from "http://en.openei.org/w/index.php?title=Earthcare_Products&oldid=344409"


DEVELOPMENT Solutions | Open Energy Information  

Open Energy Info (EERE)

DEVELOPMENT Solutions DEVELOPMENT Solutions Jump to: navigation, search Name DEVELOPMENT Solutions Place Reading, England, United Kingdom Zip RG4 8UJ Sector Efficiency Product DEVELOPMENT Solutions (DS) supports investors to realise projects with sustainable applications, including in the areas of environment, energy efficiency, water resource management and other applications for sustainable development. References DEVELOPMENT Solutions[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. DEVELOPMENT Solutions is a company located in Reading, England, United Kingdom . References ↑ "DEVELOPMENT Solutions" Retrieved from "http://en.openei.org/w/index.php?title=DEVELOPMENT_Solutions&oldid=344207


Wind Prospect Ltd | Open Energy Information  

Open Energy Info (EERE)

Solihull, United Kingdom Solihull, United Kingdom Zip B91 2PQ Sector Renewable Energy, Wind energy Product Developer, engineer, operator, and advisor on renewable energy, especially wind projects in the UK, Ireland and Australia. Coordinates 52.415065°, -1.777849° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.415065,"lon":-1.777849,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solergy Power | Open Energy Information  

Open Energy Info (EERE)

Solergy Power Solergy Power Jump to: navigation, search Name Solergy Power Place London, United Kingdom Zip SW1 OBD Sector Renewable Energy, Solar Product String representation "At Solergy Powe ... ade and beyond." is too long. References Solergy Power[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solergy Power is a company located in London, United Kingdom . References ↑ "Solergy Power" Retrieved from "http://en.openei.org/w/index.php?title=Solergy_Power&oldid=351469" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties 429 Throttled (bot load)


Plane Tree Capital LLP | Open Energy Information  

Open Energy Info (EERE)

Plane Tree Capital LLP Plane Tree Capital LLP Jump to: navigation, search Name Plane Tree Capital LLP Place London, United Kingdom Zip W1J 8DY Sector Carbon Product London-based investment management firm established in to provide investors with well managed exposure to the clean energy and carbon sectors. References Plane Tree Capital LLP[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Plane Tree Capital LLP is a company located in London, United Kingdom . References ↑ "Plane Tree Capital LLP" Retrieved from "http://en.openei.org/w/index.php?title=Plane_Tree_Capital_LLP&oldid=349778" Categories: Clean Energy Organizations Companies Organizations Stubs What links here


Impax Group Plc | Open Energy Information  

Open Energy Info (EERE)

Impax Group Plc Impax Group Plc Jump to: navigation, search Name Impax Group Plc Place London, United Kingdom Zip W1S 3EH Product A UK-based financial advisory and asset management company quoted on the Alternative Investment Market of the London Stock Exchange. References Impax Group Plc[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Impax Group Plc is a company located in London, United Kingdom . References ↑ "Impax Group Plc" Retrieved from "http://en.openei.org/w/index.php?title=Impax_Group_Plc&oldid=346815" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link


Cowal Wind Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Cowal Wind Energy Ltd Cowal Wind Energy Ltd Jump to: navigation, search Name Cowal Wind Energy Ltd Place Flintshire, Wales, United Kingdom Zip CH7 4EW Sector Wind energy Product Wind Farm developer with its office in north Wales. References Cowal Wind Energy Ltd[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Cowal Wind Energy Ltd is a company located in Flintshire, Wales, United Kingdom . References ↑ "Cowal Wind Energy Ltd" Retrieved from "http://en.openei.org/w/index.php?title=Cowal_Wind_Energy_Ltd&oldid=343949" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties


The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]



Molecular Characterization of the PEND Protein, a Novel bZIP Protein Present in the Envelope Membrane That Is the Site of Nucleoid Replication in Developing Plastids  

Science Journals Connector (OSTI)

...migrates as a 130-kD polypeptide during lithium dodecyl sulfate (LDS)-PAGE and binds...Bedford, MA). The protein was analyzed by lithium dodecyl sulfate (LDS)-PAGE and then...as indicated. x8 indicates eightfold excess over the probe. Plus and minus signs...

Naoki Sato; Kimihisa Ohshima; Ai Watanabe; Niji Ohta; Yoshitaka Nishiyama; Jacques Joyard; Roland Douce


The Arabidopsis NPR1/NIM1 Protein Enhances the DNA Binding Activity of a Subgroup of the TGA Family of bZIP Transcription Factors  

Science Journals Connector (OSTI)

...the LS5 probe and a 10-fold excess of various mutant oligonucleotides...binding specificity, a 10-fold excess of cold wild-type or mutant...cells were transformed using a lithium acetate-based protocol and...to 3). A 10-fold molar excess of mutant as-1 (lane 2...

Charles Després; Catherine DeLong; Sarah Glaze; Enwu Liu; Pierre R. Fobert


UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...response to UV-B are unclear. In order to test whether UV-B specifically affects the...and Is Negatively Regulated by RUP2 To test whether the UV-B-enhanced association...We performed two lines of experiments to test our hypothesis that HY5 and/or its homolog...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Development and comparison of algorithms for generating a scan sequence for a random access scanner. [ZAP (and flow charts for ZIP and SCAN), in FORTRAN for DEC-10  

SciTech Connect (OSTI)

Many data acquisition systems incorporate high-speed scanners to convert analog signals into digital format for further processing. Some systems multiplex many channels into a single scanner. A random access scanner whose scan sequence is specified by a table in random access memory will permit different scan rates on different channels. Generation of this scan table can be a tedious manual task when there are many channels (e.g. 50), when there are more than a few scan rates (e.g. 5), and/or when the ratio of the highest scan rate to the lowest scan rate becomes large (e.g. 100:1). An algorithm is developed which will generate these scan sequences for the random access scanner and implements the algorithm on a digital computer. Application of number theory to the mathematical statement of the problem led to development of several algorithms which were implemented in FORTRAN. The most efficient of these algorithms operates by partitioning the problem into a set of subproblems. Through recursion they solve each subproblem by partitioning it repeatedly into even smaller parts, continuing until a set of simple problems is created. From this process, a pictorial representation or wheel diagram of the problem can be constructed. From the wheel diagram and a description of the original problem, a scan table can be constructed. In addition, the wheel diagram can be used as a method of storing the scan sequence in a smaller amount of memory. The most efficient partitioning algorithm solved most scan table problems in less than a second of CPU time. Some types of problems, however, required as much as a few minutes of CPU time. 26 figures, 2 tables.

Eason, R. O.



UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Plant Biology, University of Geneva, Sciences III, CH-1211 Geneva 4, Switzerland...Research Centre of the Hungarian Academy of Sciences, H-6726 Szeged, Hungary c Department...Ghent, Belgium e School of Biological Sciences, University of Edinburgh, EH9 3JR Edinburgh...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm



Physician Name Phone Fax Street Suite City State Zip Specialty ABACI,ASLI 585-271-0444 585-271-1464 980 WESTFALL RD ROCHESTER NY 14619  

E-Print Network [OSTI]

-000-0000 955 E 11400 S SANDY UT 84094 ABBISI,SAIFY A 814-642-7205 814-642-9189 45 PINE STREET PORT ALLEGANY PA

Goldman, Steven A.


The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom  

E-Print Network [OSTI]

three fragments of painted mud plaster near the entrance offound remnants of white plaster applied over mud and paintedof a figure painted on plaster survived on the back wall of

Kroenke, Karin Roberta



The Provincial Cemeteries of Naga ed-Deir: A Comprehensive Study of Tomb Models Dating from the Late Old Kingdom to the Late Middle Kingdom  

E-Print Network [OSTI]

Newberry, Percy E. 1893. Beni Hasan. Part I. London: Egypt1904. ?Excavations at Beni Hasan (1902-1903-1904). ? Annalesmade in the Necropolis of Beni Hasan during1902-3-4. London:

Kroenke, Karin Roberta



Magnetic Quadrupole Decay of (1s2s2p) 4p05/2-(1s)22s2se1/2 Transition of Lithium Isoelectronic Sequence  

E-Print Network [OSTI]

for the individual electron operator is j. /2q'~(rl= ( (qr'. r. (r. )1 (q 'r q.), (q) where &?f)?and s, are the coordinate, orbital an- gular momentum, and spin angular momentum of the vth electron and Y? (7, ) is the spherical har- monic. Following Drake' Eq...

Onello, J. S.; Ford, A. Lewis.



2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter


2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang


Development Of Strategy For The Management Of LLW In The United Kingdom  

SciTech Connect (OSTI)

The Nuclear Decommissioning Authority (NDA) is a UK non-departmental public body with a remit to clean up the civil public sector nuclear legacy. Much work has been done to date on developing contractor competition for the management of NDA-owned sites, including the UK's principal disposal facility: the Low Level Waste Repository (LLWR) in Cumbria. The competition goals and principles are integrated with the framework for the development of a UK Low Level Waste (LLW) management plan, through which the NDA will deliver its commitments to UK Government and stakeholders. Nexia Solutions has undertaken work for the NDA in assessing strategic options and scenarios for the management and disposal of current UK LLW. The volumetric, radiological and strategic limitations of existing disposition routes have been assessed against the inventories and characteristics of LLW forecast to arise. A number of potential alternative scenarios and variants for future LLW management have been modelled and assessed. (authors)

Wareing, A.S. [Nexia Solutions Ltd, Risley, Warrington, Cheshire, WA (United Kingdom); Fisher, J. [Nuclear Decommissioning Authority, Herdus House, Westlakes Science and Technology Park, Moor Row, Cumbria, CA24 3HU (United Kingdom)



Gods Who Hear Prayers: Popular Piety or Kingship in Three Theban monuments of New Kingdom Egypt  

E-Print Network [OSTI]

Search for God in Ancient Egypt. Translated by David Lorton.Press. , 2002. The Mind of Egypt. History and Meaning inIn Temples of Ancient Egypt. Edited by Byron E. Schafer.

Ausec, Cindy Lee



Disaster policy and nuclear liability: Insights from post-Chernobyl agriculture in the United Kingdom  

Science Journals Connector (OSTI)

The recent events at Chernobyl have again brought the issues of nuclear safety to the forefront of the nuclear power debate. Fortunately, our experience with such incidents has been very limited, but it is imp...

William A. Kerr; Adrienne S. Kwaczek; Sian Mooney


The Greening of the Middle Kingdom: The Story of Energy Efficiency in China  

E-Print Network [OSTI]

1/2/a7612e71ef7f84b4cade01abbd34106b. Sinton, J. , and M.promote energy efficiency see Sinton and Levine (1998). It

Zhou, Nan



Black carbon emissions in the United Kingdom during the past four decades: An empirical analysis  

SciTech Connect (OSTI)

We use data from a unique 40-year record of 150 urban and rural stations in the ''Black Smoke and SO2 Network'' in Great Britain to infer information about sources of atmospheric black carbon (BC). The data show a rapid decline of ambient atmospheric BC between 1962 and the early 1990s that exceeds the decline in official estimates of BC emissions based only on amount of fuel use and mostly fixed emission factors. This provides empirical confirmation of the existence and large impact of a time-dependent ''technology factor'' that must multiply the rate of fossil fuel use. Current ambient BC amounts in Great Britain comparable to those in western and central Europe, with diesel engines being the principal present source. From comparison of BC and SO2 data we infer that current BC emission inventories understate true emissions in the U.K. by about a factor of two. The results imply that there is the potential for improved technology to achieve large reduction of global ambient BC. There is a need for comparable monitoring of BC in other countries.

Novakov, T.; Hansen, J.E.



An assessment of using oil shale for power production in the Hashemite Kingdom of Jordan  

SciTech Connect (OSTI)

This report addresses the oil shale-for-power-production option in Jordan. Under consideration are 20- and 50-MW demonstration units and a 400-MW, commercial-scale plant with, at the 400-MW scale, a mining operation capable of supplying 7.8 million tonnes per year of shale fuel and also capable of disposal of up to 6.1 million tonnes per year of wetted ash. The plant would be a direct combustion facility, burning crushed oil shale through use of circulating fluidized bed combustion technology. The report emphasizes four areas: (1) the need for power in Jordan, (2) environmental aspects of the proposed oil shale-for-power plant(s), (3) the engineering feasibility of using Jordan's oil shale in circulating fluidized bed combustion (CFBC) boiler, and (4) the economic feasibility of the proposed plant(s). A sensitivity study was conducted to determine the economic feasibility of the proposed plant(s) under different cost assumptions and revenue flows over the plant's lifetime. The sensitivity results are extended to include the major extra-firm benefits of the shale-for-power option: (1) foreign exchange savings from using domestic energy resources, (2) aggregate income effects of using Jordan's indigenous labor force, and (3) a higher level of energy security. 14 figs., 47 tabs.

Hill, L.J.; Holcomb, R.S.; Petrich, C.H.; Roop, R.D.



U.S. Department of Energy Welcomes the United Kingdom as 21st...  

Office of Environmental Management (EM)

the GNEP Statement of Principles, along with Australia, Bulgaria, Ghana, Hungary, Jordan, Kazakhstan, Lithuania, Poland, Romania, Slovenia, and the Ukraine. "The UK shares in...


Surveillance and quality improvement in the United Kingdom: Is there a meeting point?  

Science Journals Connector (OSTI)

Abstract Recent high profile failures within the National Health Service of England and Wales have highlighted the need for surveillance of quality and performance. Mortality is the most commonly used metric, assessed at the hospital or trust level. However overall mortality can mask where the failures lie and even if they exist. Continuous surveillance at a granular level is needed, especially in surgery where interventions need to be safe, reliable and efficacious but so does the coordination of care along the entire patient pathway with robust protocols and mechanisms in place to prevent failure to rescue and to optimise patient outcomes. There is an expanding body of surveillance tools available for surgical practice and these are beginning to show merit. The Care Quality Commission, who monitor services, increasingly through ongoing surveillance as well as inspections, should work more closely with local quality improvement efforts and become a vector for care excellence, actively involved with spreading best practice throughout the entire NHS and not just for identifying the bad apples.

Alexander J. Fowler; Riaz A. Agha; Nick Sevdalis



Current Directions in the Practice of Environmental Risk Assessment in the United Kingdom  

Science Journals Connector (OSTI)

Environmental risk assessment, where applied to these situations, must be able to inform and improve regulatory and business decisions on how best to manage risks from environmental hazards. ... The handling of risk by governments and their agencies has moved up the political agenda in the last 10 years. ... The Environment Agency and DEFRA have put significant investment into understanding environmental extremes. ...

Simon J. Pollard; Roger Yearsley; Nick Reynard; Ian C. Meadowcroft; Raquel Duarte-Davidson; Susan L. Duerden



Bringing Ecosystem Services into Economic Decision-Making: Land Use in the United Kingdom  

Science Journals Connector (OSTI)

...that increase GHG storage and recreation values typically...between economic valuation of ecosystem services...with a very powerful tool through which to...39 Department of Energy and Climate Change...Department of Energy and Climate Change...2020 package . Energy Policy 49 , 288...

Ian J. Bateman; Amii R. Harwood; Georgina M. Mace; Robert T. Watson; David J. Abson; Barnaby Andrews; Amy Binner; Andrew Crowe; Brett H. Day; Steve Dugdale; Carlo Fezzi; Jo Foden; David Hadley; Roy Haines-Young; Mark Hulme; Andreas Kontoleon; Andrew A. Lovett; Paul Munday; Unai Pascual; James Paterson; Grischa Perino; Antara Sen; Gavin Siriwardena; Daan van Soest; Mette Termansen



Fire-Fountains; the Kingdom of Hawaii, its Volcanoes, and the History of its Missions  

Science Journals Connector (OSTI)

... have formed in and around the lake, each a distinct fire-fountain, yet all flameless-only merrily flinging about the molten metal: a bouquet of rare fireworks."These ...



United Kingdom The University of Strathclyde is a charitable body, registered in Scotland (number SC015263)  

E-Print Network [OSTI]

; rising oil prices and commodity/food prices; and the Scottish government's economic strategy. Growth borrowing and lending to an as yet unknown degree. · Rising oil prices and commodity/food prices are a major impediment to the growth of the world economy. Since last July oil prices have risen from $75 to $139

Mottram, Nigel


Energy implications of the thermal recovery of biodegradable municipal waste materials in the United Kingdom  

SciTech Connect (OSTI)

Highlights: > Energy balances were calculated for the thermal treatment of biodegradable wastes. > For wood and RDF, combustion in dedicated facilities was the best option. > For paper, garden and food wastes and mixed waste incineration was the best option. > For low moisture paper, gasification provided the optimum solution. - Abstract: Waste management policies and legislation in many developed countries call for a reduction in the quantity of biodegradable waste landfilled. Anaerobic digestion, combustion and gasification are options for managing biodegradable waste while generating renewable energy. However, very little research has been carried to establish the overall energy balance of the collection, preparation and energy recovery processes for different types of wastes. Without this information, it is impossible to determine the optimum method for managing a particular waste to recover renewable energy. In this study, energy balances were carried out for the thermal processing of food waste, garden waste, wood, waste paper and the non-recyclable fraction of municipal waste. For all of these wastes, combustion in dedicated facilities or incineration with the municipal waste stream was the most energy-advantageous option. However, we identified a lack of reliable information on the energy consumed in collecting individual wastes and preparing the wastes for thermal processing. There was also little reliable information on the performance and efficiency of anaerobic digestion and gasification facilities for waste.

Burnley, Stephen, E-mail: s.j.burnley@open.ac.uk [Open University, Walton Hall, Milton Keynes MK7 6AA (United Kingdom); Phillips, Rhiannon, E-mail: rhiannon.jones@environment-agency.gov.uk [Strategy Unit, Welsh Assembly Government, Ty Cambria, 29 Newport Road, Cardiff CF24 0TP (United Kingdom); Coleman, Terry, E-mail: terry.coleman@erm.com [Environmental Resources Management Ltd, Eaton House, Wallbrook Court, North Hinksey Lane, Oxford OX2 0QS (United Kingdom); Rampling, Terence, E-mail: twa.rampling@hotmail.com [7 Thurlow Close, Old Town Stevenage, Herts SG1 4SD (United Kingdom)



Review of green electricity products in the United Kingdom, Germany and Finland  

Science Journals Connector (OSTI)

Abstract In liberalized electricity markets, environmental aspects are often used in marketing in addition to price competition and a wide variety of green electricity products marketed as environmentally friendly is available for customers. We study these green electricity markets in the UK, Germany and Finland and discuss possible problems between voluntary markets and renewable energy policies in particular. We find that products are claimed to support new renewable capacity building and to offer other environmental benefits through different kinds of mechanisms. Demand is relative high in Germany but has remained modest in the UK. In Finland, many passive private customers have automatically been sold green electricity products. Price premiums depend on several factors but typically they are in the range of 05%. The interface between voluntary markets and renewable energy policies can create problems; in the UK there are concerns that some suppliers double count renewable energy so that they assign the already required renewable energy to green tariff customers. We found that the share of imported hydropower is very large in green electricity products in Germany, which is why real additional benefits can be small. In Finland green electricity usually originates from hydro and wind power. As hydropower capacity is large in the Nordic countries, the additional impacts on new capacity can remain modest. For consumers, being a shareholder in companies devoted only to building new capacity, and products where price premiums are transparently directed to specific funds, carry the least risk of buying green products with false expectations.

A. Hast; S. Syri; J. Jokiniemi; M. Huuskonen; S. Cross



Offshore Outsourcing Practices of United Kingdom Engineering Services Companies: Focused on Oil and Gas Sector.  

E-Print Network [OSTI]

??This investigate an important options of cost reductions, offshore outsourcing is found interesting, these days phenomenon of economic downturn, decreasing oil prices and credit crunch (more)

Ahsan, Kamran



A Century of Forestry: Forestry in the United Kingdom Over the Last Century  

Science Journals Connector (OSTI)

... The afforestation of new land was to be the task mainly of the State ; private planting was to be helped and encouraged by grants. It was recommended that a ... up which would have the care of all forestry matters, would administer the grants for private planting and would carry out directly the afforestation programme. These, very briefly, were ...




A review of "Swordsmen: The Martial Ethos in the Three Kingdoms." by Roger B. Manning  

E-Print Network [OSTI]

of the records of the Earl Marshal?s court (housed at the College of Arms in London and are being calendared by Richard Cust and Andrew Hopper), established in 1623 specifically to check the spiralling problem of duelling in London and at Court. The most... tendencies of the early modern state (this is probably more true of France than England, although the 2 nd Earl of Essex was a natural- born frondeur). On the basis of these assumptions, he speculates that the martial ethos, when combined with classical...

Simon Healy



Fish and mammals in the economy of an ancient Peruvian kingdom  

Science Journals Connector (OSTI)

...cold current (10C in places), with winds picking up little moisture as they pass over...did not fish and fishermen who did not farm (12). Such community specialization...technology for taking fish from deep water offshore. As a result, the Pacific hake Merluccius...

Joyce Marcus; Jeffrey D. Sommer; Christopher P. Glew


Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


J. Mar. Biol. Ass. U.K. (2007), 87, 327338 Printed in the United Kingdom  

E-Print Network [OSTI]

that include by-catch in fishing operations (Berggren, 1994; Kinze et al., 1997; Vinther, 1999; Kaschner, 2003), pollution (Aguilar & Borrell, 1995), over-fishing of prey species (Evans, 1990; Jackson et al., 2001), and disturbance from sound sources such as shipping, seismic surveys, sonar and acoustic deterrents (Evans, 1996

Pierce, Graham


The Greening of the Middle Kingdom: The Story of Energy Efficiency in China  

E-Print Network [OSTI]

Elasticity =1 Mtce Total Energy Consumption Coal Consumptionpercent of total energy consumption in China. The Top 1,000percent of total industrial-sector energy consumption and 30

Zhou, Nan



The Greening of the Middle Kingdom: The Story of Energy Efficiency in China  

E-Print Network [OSTI]

China View. 2009. Chinas energy intensity down 2.9% in Q1:demand at constant energy intensity, 19802006. Source: NBS,percent reduction in energy intensity (defined as energy use

Zhou, Nan



Engineering geological mapping for civil engineering practice in the United Kingdom  

Science Journals Connector (OSTI)

...b "*" .qyi~ ..... 0'dJeqs'OdolS to >leOJg ..... ~---'1 1 '.'~* ~" /'/ * 'X~, ./. ~ / S)INIS / "--3." .~. /~ "~ xa^uoo'papunoJ'adolsj.oHeojg .~..~..~ "~ Ill~/ i ~-~ ~ i~ .~ , \\ I ix...

William Robert Dearman; Peter George Fookes


Bayesian Decision Analysis: Principle and Practice, Jim Q. Smith (Warwick University, United Kingdom), Cambridge University  

E-Print Network [OSTI]

involved quite a lot in consulting experiences, in particular in connection with nuclear energy (hence analyst, decision maker, expert and auditor). The final chapter of the first part on Bayesian inference

Robert, Christian P.


Gods Who Hear Prayers: Popular Piety or Kingship in Three Theban monuments of New Kingdom Egypt  

E-Print Network [OSTI]

caps or baldachins. Brand believes the images with specialshrines over the images; while Brand (2007) believes theywritten by Brand, which discussed an image, believed to have

Ausec, Cindy Lee



Atmospheric Environment 38 (2004) 41554163 Black carbon emissions in the United Kingdom during the  

E-Print Network [OSTI]

Britain comparable to those in western and central Europe, with diesel engines being the principal present as it is responsible for the brown appearance of urban hazes and soiling of buildings. Soot in general and BC


Four kingdoms on glacier ice: convergent energetic processes boost energy levels as temperatures fall  

Science Journals Connector (OSTI)

...pp. 573577. New York: Academic. Atkinson, D. E. 1968 The energy charge of the adenylate...hypoxia on anaerobic energy metabolism in iso...enzymatic analysis. New York: Academic. Marshall...cellular pH and energy metabolism in the...



The Greening of the Middle Kingdom: The Story of Energy Efficiency in China  

E-Print Network [OSTI]

defined as energy use per unit of GDP) from 2005 levels. Tomeasured as energy consumption per RMB 5 of GDP). The

Zhou, Nan



J. Mar. Biol. Ass. U.K. (2007), 87, 14 Printed in the United Kingdom  

E-Print Network [OSTI]

of `Marine mammals and man in coastal ecosystems: can they co-exist?' Many of the papers contained range of pressures--habitat modification, pollution, disturbance, and conflicts with fisheries through--either stranded specimens or a by- product of the whaling industry, a range of techniques has now been developed

Pierce, Graham


Nitrogen Cycling in United Kingdom Forests: The Relevance of Basic Ecological Research [and Discussion  

Science Journals Connector (OSTI)

...cycling characteristics. The Pinus nigra plantation on Culbin Sands is functioning on a low...contrast, the mixed deciduous Meathop Wood has a much larger capital of N and higher...proportion of added fertilizer N in the biomass and forest floor, and increased growth...



Joint Statement by Sir John Beddington, United Kingdom (UK) Government Chief Scientific Adviser  

E-Print Network [OSTI]

, aviation operation and security of satellites. Our respective key organizations have numerous common and Head of the Government Office for Science and Dr. Kathryn D. Sullivan, Deputy Administrator National


The EC Carbon Tax and Energy Demand in the United Kingdom  

Science Journals Connector (OSTI)

This paper deals with some of the general issues raised by the introduction of a carbon/energy tax in the UK. The analysis focuses on a tax of the sort currently being suggested by the European Commission, but...

Derek Hodgson




Science Journals Connector (OSTI)

......Computers Reviewers, 2011 Stefan Agamanolis, United Kingdom Rosa Alarcon, Chile Frances Aldrich, United Kingdom Jason Alexander, United Kingdom Norman Alm, United Kingdom Analia Amandi, Argentina Chee Siang Ang, United Kingdom Alissa Antle......

Reviewers; Editors Appreciation 2011



Enviros Consulting | Open Energy Information  

Open Energy Info (EERE)

Enviros Consulting Enviros Consulting Jump to: navigation, search Name Enviros Consulting Place London, United Kingdom Zip EC1N 8SS Sector Efficiency Product Enviros is a Smart Building consultation company covering all aspects of energy efficiency for both new building projects and regeneration projects. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Seawind Marine | Open Energy Information  

Open Energy Info (EERE)

Seawind Marine Seawind Marine Jump to: navigation, search Name Seawind Marine Place Plymouth, England, United Kingdom Zip PL1 5NE Sector Services, Wind energy Product Focused on project management, engineering, construction and operations services for the wind energy industry. Coordinates 43.75681°, -87.984809° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.75681,"lon":-87.984809,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Adelan UK Ltd | Open Energy Information  

Open Energy Info (EERE)

Adelan UK Ltd Adelan UK Ltd Jump to: navigation, search Name Adelan UK Ltd Place Birmingham, United Kingdom Zip B15 2SQ Product A small solid oxide fuel cell (SOFC) which has developed an innovative microtubular fuel cell unit design. Coordinates 40.647112°, -78.197678° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.647112,"lon":-78.197678,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Beinn Mhor Power | Open Energy Information  

Open Energy Info (EERE)

Beinn Mhor Power Beinn Mhor Power Jump to: navigation, search Name Beinn Mhor Power Place Edinburgh, Scotland, United Kingdom Zip EH2 3BH Sector Wind energy Product Edinburgh-based power company developing wind power projects in Beinn Mhor in the Western Isles of Scotland. Coordinates 55.954155°, -3.202774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.954155,"lon":-3.202774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


2degrees | Open Energy Information  

Open Energy Info (EERE)

degrees degrees Jump to: navigation, search Name 2degrees Place Oxford, England, United Kingdom Zip OX2 7HT Product Oxford-based collaborative network provider for sustainability professionals. Coordinates 43.781517°, -89.571699° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.781517,"lon":-89.571699,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AEA Battery Systems Ltd | Open Energy Information  

Open Energy Info (EERE)

AEA Battery Systems Ltd AEA Battery Systems Ltd Jump to: navigation, search Name AEA Battery Systems Ltd Place Caithness, United Kingdom Zip KW14 7XW Product Designs, manufactures and supplies specialist lithium-ion high performance cells and batteries. Coordinates 36.482929°, -94.323563° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.482929,"lon":-94.323563,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RWE npower renewables | Open Energy Information  

Open Energy Info (EERE)

npower renewables npower renewables Jump to: navigation, search Name RWE npower renewables Place Wiltshire, England, United Kingdom Zip SN5 6PB Sector Hydro, Wind energy Product Develops wind generating assets in the UK which are then sold to Zephyr Investments. Operates a number of hydro plants in Scotland and Wales. Coordinates 51.324131°, -1.9257° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.324131,"lon":-1.9257,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


West Coast Wind Farms Scotland Ltd | Open Energy Information  

Open Energy Info (EERE)

Scotland Ltd Scotland Ltd Jump to: navigation, search Name West Coast Wind Farms (Scotland) Ltd Place Ilfracombe, United Kingdom Zip EX34 8NJ Sector Wind energy Product Wind farm developer. Coordinates 51.20816°, -4.12355° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.20816,"lon":-4.12355,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SEPCO Plc | Open Energy Information  

Open Energy Info (EERE)

Plc Plc Jump to: navigation, search Name SEPCO Plc Place London, United Kingdom Zip SW9 6DE Product Sustainable Energy Products Co (SEPCO) makes PV lighting systems for bus stops, phone booths, streets and advertising in Britain. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The Energy Crops Company | Open Energy Information  

Open Energy Info (EERE)

Crops Company Crops Company Jump to: navigation, search Name The Energy Crops Company Place Cobham, United Kingdom Zip KT11 2LA Sector Biomass Product Distributor of pellets and installer of biomass heating equipment in Surrey, UK. Coordinates 41.739891°, -79.322189° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.739891,"lon":-79.322189,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wind Energy Hearthstanes Ltd | Open Energy Information  

Open Energy Info (EERE)

Hearthstanes Ltd Hearthstanes Ltd Jump to: navigation, search Name Wind Energy (Hearthstanes) Ltd Place LONDON, England, United Kingdom Zip EC4R 9HA Sector Wind energy Product Special purpose vehicle created specifically for the development of the Hearthstanes Wind Farm in Dumfries & Galloway in Scotland, UK. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


2OC | Open Energy Information  

Open Energy Info (EERE)

OC OC Jump to: navigation, search Name 2OC Place Bath, England, United Kingdom Zip BA1 7AB Product Bath-based, geo-pressure energy company. 2OC helps organisations in the UK and elsewhere harvest clean electricity from the waste energy produced from their gas pressure reduction stations. Coordinates 45.467055°, -98.329279° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.467055,"lon":-98.329279,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Airtricity Developments NI Ltd | Open Energy Information  

Open Energy Info (EERE)

NI Ltd NI Ltd Jump to: navigation, search Name Airtricity Developments NI Ltd Place Belfast, Northern Ireland, United Kingdom Zip BT2 7AF Sector Wind energy Product Focused on construction of wind farms in Northern Ireland. Coordinates 54.595295°, -5.934524° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.595295,"lon":-5.934524,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tidal Electric | Open Energy Information  

Open Energy Info (EERE)

Electric Electric Jump to: navigation, search Name Tidal Electric Place London, Greater London, United Kingdom Zip SW19 8UY Product Developed a technology named 'tidal lagoons' to build tidal electric projects. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EPR Ely Power Limited | Open Energy Information  

Open Energy Info (EERE)

EPR Ely Power Limited EPR Ely Power Limited Jump to: navigation, search Name EPR Ely Power Limited Place London, Greater London, United Kingdom Zip SW1Y 5AU Sector Biomass Product Owns and operates the Ely biomass power plant. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Itochu Europe Plc | Open Energy Information  

Open Energy Info (EERE)

Itochu Europe Plc Itochu Europe Plc Jump to: navigation, search Name Itochu Europe Plc Place London, Greater London, United Kingdom Zip EC4A 3PJ Sector Efficiency, Solar Product European HQ of Itochu Corporation; invests in solar and is interested in energy efficiency sectors. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tidal Energy Limited | Open Energy Information  

Open Energy Info (EERE)

Tidal Energy Limited (TEL) Tidal Energy Limited (TEL) Place Cardiff, Wales, United Kingdom Zip CF23 8RS Product Tidal stream device developer. Coordinates 51.48125°, -3.180734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.48125,"lon":-3.180734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


First Windfarm Holdings Ltd | Open Energy Information  

Open Energy Info (EERE)

Windfarm Holdings Ltd Windfarm Holdings Ltd Jump to: navigation, search Name First Windfarm Holdings Ltd Place Bristol, England, United Kingdom Zip BS8 1HG Sector Wind energy Product Britsol-based developer & owner of wind power generation assets. Coordinates 42.55678°, -88.050449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.55678,"lon":-88.050449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Bio Energy Investments BEI | Open Energy Information  

Open Energy Info (EERE)

Investments BEI Investments BEI Jump to: navigation, search Name Bio Energy Investments (BEI) Place Chinnor, United Kingdom Zip OX39 4TW Sector Biomass Product UK-based company involved in the design and building of biomass plants. Coordinates 51.702702°, -0.910879° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.702702,"lon":-0.910879,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Black Emerald Group | Open Energy Information  

Open Energy Info (EERE)

Group Group Jump to: navigation, search Name Black Emerald Group Address 4 Park Place Place London, United Kingdom Zip SW1A 1LP Product Investment banking firm specializing in renewable energy and environmental technology corporate and project finance Year founded 1994 Website http://www.blackemerald.com/ Coordinates 51.5063321°, -0.1401519° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5063321,"lon":-0.1401519,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Biocaldol | Open Energy Information  

Open Energy Info (EERE)

Biocaldol Biocaldol Jump to: navigation, search Name Biocaldol Place London, England, United Kingdom Zip NW1 0NH Sector Biomass Product Biocaldol uses thermophilic microorganisms to ferment inaccessible biomass sugars into ethanol. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Midaz Lasers Ltd | Open Energy Information  

Open Energy Info (EERE)

Midaz Lasers Ltd Midaz Lasers Ltd Jump to: navigation, search Name Midaz Lasers Ltd Place London, United Kingdom Zip SW7 2AZ Sector Solar Product Startup developing diode-pumped solid state (DPSS) lasers with potential applications to solar cell manufacture. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Beetle Capital Partners BCP | Open Energy Information  

Open Energy Info (EERE)

BCP BCP Jump to: navigation, search Name Beetle Capital Partners (BCP) Place London, United Kingdom Zip W1S 1UA Sector Carbon Product London-based asset management company focussed on investment opportunities created by the transition to a low carbon economy. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AccountAbility | Open Energy Information  

Open Energy Info (EERE)

AccountAbility AccountAbility Jump to: navigation, search Name AccountAbility Place London, England, United Kingdom Zip EC1V 7EB Product London-based not-for-profit organisation working with partners in business, the public sector and civil society to promote accountability for sustainable development. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Keld Energy | Open Energy Information  

Open Energy Info (EERE)

Keld Energy Keld Energy Jump to: navigation, search Name Keld Energy Place Cumbria, England, United Kingdom Zip CA10 1NN Sector Biomass Product Keld Energy has developed a novel highly efficient biomass fired co-generation process technology based upon gasification coupled with gas turbine technology. Coordinates 54.63044°, -2.89984° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.63044,"lon":-2.89984,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alderney Renewable Energy ARE | Open Energy Information  

Open Energy Info (EERE)

Alderney Renewable Energy ARE Alderney Renewable Energy ARE Jump to: navigation, search Name Alderney Renewable Energy (ARE) Place Alderney, Channel Islands, United Kingdom Zip GY9 3XY Product AREl develops Alderneyâ€(tm)s marine resource, including tidal and wave power. Coordinates 49.72303°, -2.20238° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":49.72303,"lon":-2.20238,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Agni UK Inc | Open Energy Information  

Open Energy Info (EERE)

Agni UK Inc Agni UK Inc Jump to: navigation, search Name Agni UK Inc Place London, United Kingdom Zip EC2Y 8AD Sector Biofuels Product Focused on design and development of fuel cells, co(tri)generation technology, biofuels and CO2 sequestration technology. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ambient Hydro Ltd | Open Energy Information  

Open Energy Info (EERE)

Ambient Hydro Ltd Ambient Hydro Ltd Place Corsham, United Kingdom Zip SN13 9TZ Sector Hydro, Services Product Ambient Hydro Ltd develops small Hydroelectric projects. It also offers a range of technical and financial consultancy services. Coordinates 51.431505°, -2.187229° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.431505,"lon":-2.187229,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


New Energy Finance | Open Energy Information  

Open Energy Info (EERE)

Logo: New Energy Finance Name New Energy Finance Address 283-288 High Holborn Place London, United Kingdom Zip WC1V 7HP Number of employees 51-200 Year founded 2004 Phone number +44 207 092 8800 Coordinates 51.5181577°, -0.1150875° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5181577,"lon":-0.1150875,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Viking Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Viking Energy Ltd Viking Energy Ltd Place Lerwick, United Kingdom Zip ZE1 0JL Sector Wind energy Product Company formed to represent Shetland Islands Councilâ€(tm)s interests in large-scale wind energy development in Shetland, particularly by developing wind farms. Coordinates 60.15183°, -1.145224° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":60.15183,"lon":-1.145224,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Advanced Leds | Open Energy Information  

Open Energy Info (EERE)

Leds Leds Jump to: navigation, search Name Advanced Leds Place Coventry, England, United Kingdom Zip CV5 6SP Product Advanced Leds develops LED technology for outdoor lighting, including street lighting applications. Coordinates 44.866737°, -72.263927° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.866737,"lon":-72.263927,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eccleshall Biomass Ltd | Open Energy Information  

Open Energy Info (EERE)

Eccleshall Biomass Ltd Eccleshall Biomass Ltd Jump to: navigation, search Name Eccleshall Biomass Ltd Place Eccleshall, United Kingdom Zip ST21 6JL Sector Biomass Product Developing a 2.2MW biomass plant. Coordinates 52.857769°, -2.24958° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.857769,"lon":-2.24958,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Advanced Plasma Power APP | Open Energy Information  

Open Energy Info (EERE)

Power APP Power APP Jump to: navigation, search Name Advanced Plasma Power (APP) Place London, Greater London, United Kingdom Zip EC2A 1BR Product London-based geoplasma process technology developer for waste-to-energy systems. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oceanflow Development Ltd | Open Energy Information  

Open Energy Info (EERE)

Oceanflow Development Ltd Oceanflow Development Ltd Address 12 Yeoman Street Place North Shields Zip NE29 6NL Sector Marine and Hydrokinetic Year founded 2010 Number of employees 1 Phone number +44 191 296 6339 Website http://www.oceanflowenergy.com Region United Kingdom LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: Evopod E1 1 10 scale grid connected demonstrator Evopod E35 35kW grid connected demonstrator This company is involved in the following MHK Technologies: Evopod E35 This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Oceanflow_Development_Ltd&oldid=678405


Feilden Clegg Bradley Studios | Open Energy Information  

Open Energy Info (EERE)

Feilden Clegg Bradley Studios Feilden Clegg Bradley Studios Jump to: navigation, search Name Feilden Clegg Bradley Studios Place Bath, United Kingdom Zip BA1 7DE Sector Biomass Product UK-based contractor for Biomass projects. Coordinates 45.467055°, -98.329279° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.467055,"lon":-98.329279,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ost Energy | Open Energy Information  

Open Energy Info (EERE)

Ost Energy Ost Energy Jump to: navigation, search Name Ost Energy Place London, United Kingdom Zip NW11 7TJ Product Provides engineering and technical consultancy for PV and STEG projects in Italy and Spain. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Exus Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Exus Energy Ltd Exus Energy Ltd Jump to: navigation, search Name Exus Energy Ltd Place Derry, United Kingdom Zip BT48 0LD Sector Biomass Product Exus Energy Ltd has been developing markets for electricity and heat from biomass. Coordinates 40.334201°, -79.303205° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.334201,"lon":-79.303205,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aspen Clean Fuels Ltd ACF Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd ACF Ltd Ltd ACF Ltd Jump to: navigation, search Name Aspen Clean Fuels Ltd (ACF Ltd) Place London, United Kingdom Zip EC4M 7BA Product UK mother company of Aspen Invest AB. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Biodiesel Energy Trading Limited | Open Energy Information  

Open Energy Info (EERE)

Limited Limited Jump to: navigation, search Name Biodiesel Energy Trading Limited Place London, United Kingdom Zip W1J 8DY Product London-based company focused on trading of biodiesel. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eco2 Ltd | Open Energy Information  

Open Energy Info (EERE)

Eco2 Ltd Eco2 Ltd Jump to: navigation, search Name Eco2 Ltd Place Cardiff, United Kingdom Zip CF23 8RS Sector Biomass, Hydro, Wind energy Product Project developer and operator focusing on wind, hydropower, biomass and waste projects. Coordinates 51.48125°, -3.180734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.48125,"lon":-3.180734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EDF Energy Renewables | Open Energy Information  

Open Energy Info (EERE)

EDF Energy Renewables EDF Energy Renewables Jump to: navigation, search Name EDF Energy Renewables Place London, England, United Kingdom Zip WC2R 0PT Sector Renewable Energy, Wind energy Product UK-based renewable energy arm of EDF Energy, developing wind projects in the UK. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sindicatum Carbon Capital SCC | Open Energy Information  

Open Energy Info (EERE)

Sindicatum Carbon Capital SCC Sindicatum Carbon Capital SCC Jump to: navigation, search Name Sindicatum Carbon Capital (SCC) Place London, United Kingdom Zip W1S 1HX Product SCC is a specialist end-to-end developer of climate change related projects, from conception to operation. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nevis Engine Company | Open Energy Information  

Open Energy Info (EERE)

Nevis Engine Company Nevis Engine Company Jump to: navigation, search Name Nevis Engine Company Place London, Greater London, United Kingdom Zip WIT IDG Sector Efficiency Product Developer of an internal combustion engine that hopes to double fuel efficiency. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aloe Private Equity | Open Energy Information  

Open Energy Info (EERE)

Aloe Private Equity Aloe Private Equity Jump to: navigation, search Name Aloe Private Equity Place London, United Kingdom Zip W1K 1QT Product Small VC managing a Sustainable Environment Fund. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


O Gen UK Ltd | Open Energy Information  

Open Energy Info (EERE)

O Gen UK Ltd O Gen UK Ltd Jump to: navigation, search Name O-Gen UK Ltd Place Stone, United Kingdom Zip ST15 8XU Sector Biomass Product Power generator from biomass. Coordinates 37.582998°, -82.270862° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.582998,"lon":-82.270862,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


IQE | Open Energy Information  

Open Energy Info (EERE)

IQE IQE Jump to: navigation, search Name IQE Place Cardiff, Wales, United Kingdom Zip CF3 0LW Sector Solar Product UK-headquartered global supplier of advanced semiconductor wafers. Applications include solar PV cells. Coordinates 51.48125°, -3.180734° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.48125,"lon":-3.180734,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


North British Windpower Ltd | Open Energy Information  

Open Energy Info (EERE)

British Windpower Ltd British Windpower Ltd Jump to: navigation, search Name North British Windpower Ltd Place Edinburgh, Scotland, United Kingdom Zip EH12 9DT Sector Wind energy Product NBW is a Scottish company established to build, own and operate windfarms in Scotland. Coordinates 55.954155°, -3.202774° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.954155,"lon":-3.202774,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Novensys | Open Energy Information  

Open Energy Info (EERE)

Novensys Novensys Jump to: navigation, search Name Novensys Place Penrith, United Kingdom Zip CA10 1NN Sector Biomass Product Developer of a process technology for biomass gasification coupled with gas turbine technology. Coordinates 48.150021°, -117.101163° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.150021,"lon":-117.101163,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ecotricity | Open Energy Information  

Open Energy Info (EERE)

Ecotricity Ecotricity Jump to: navigation, search Name Ecotricity Place Stroud, United Kingdom Zip GL5 3AP Sector Wind energy Product Ecotricity is a company dedicated to building and supplying wind energy. Coordinates 35.749035°, -96.655764° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.749035,"lon":-96.655764,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Edwards Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Edwards Ltd Place Crawley, United Kingdom Zip RH10 9LW Sector Solar Product UK capital equipment manufacturer for semiconductors, LEDs, flat panel displays, and solar cells; for solar, offers vacuum and abatement systems. Coordinates 37.935555°, -80.650889° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.935555,"lon":-80.650889,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Agrinergy Ltd | Open Energy Information  

Open Energy Info (EERE)

Agrinergy Ltd Agrinergy Ltd Jump to: navigation, search Name Agrinergy Ltd Place Cheltenham, England, United Kingdom Zip GL50 1TA Sector Carbon, Services Product Agrinergy is a provider of carbon credit services with a focus on the Clean Development Mechanism (CDM). Coordinates 40.05868°, -75.107854° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.05868,"lon":-75.107854,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Innovations Ltd | Open Energy Information  

Open Energy Info (EERE)

Innovations Ltd Innovations Ltd Jump to: navigation, search Name Energy Innovations Ltd. Place Suffolk, United Kingdom Zip IP13 0AT Sector Biomass, Renewable Energy Product Energy Innovations is focused on the design and installation of renewable heating systems among other things biomass heating systems. Coordinates 36.731157°, -76.588952° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.731157,"lon":-76.588952,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auriga Energy | Open Energy Information  

Open Energy Info (EERE)

Auriga Energy Auriga Energy Jump to: navigation, search Name Auriga Energy Place Bristol, United Kingdom Zip BS1 5UB Sector Solar, Vehicles Product String representation "Auriga Energy i ... of the market." is too long. Coordinates 42.55678°, -88.050449° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.55678,"lon":-88.050449,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Powertech Solar Ltd | Open Energy Information  

Open Energy Info (EERE)

Powertech Solar Ltd Powertech Solar Ltd Place Dorset, United Kingdom Zip BH21 7RZ Sector Solar Product Agent and manufacturer of solar hot water systems. Coordinates 43.253785°, -73.097705° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.253785,"lon":-73.097705,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AWS Ocean Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

AWS Ocean Energy Ltd AWS Ocean Energy Ltd Jump to: navigation, search Name AWS Ocean Energy Ltd Place Inverness, Scotland, United Kingdom Zip IV17 1SN Product Inverness-based company established to commercialise the Archimedes Wave Swing. Coordinates 48.55324°, -110.689764° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.55324,"lon":-110.689764,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Environmental Finance | Open Energy Information  

Open Energy Info (EERE)

Finance Finance Place London, United Kingdom Zip N1 6DR Product London-based monthly magazine covering environmental issues and their impacts on financial activities. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eco Sustainable Solutions Ltd | Open Energy Information  

Open Energy Info (EERE)

Sustainable Solutions Ltd Sustainable Solutions Ltd Jump to: navigation, search Name Eco Sustainable Solutions Ltd Place Dorset, United Kingdom Zip BH23 6BG Sector Biomass Product Focused on organics recycling; setting up a biomass plant. Coordinates 43.253785°, -73.097705° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.253785,"lon":-73.097705,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


World Renewable Energy Network WREN | Open Energy Information  

Open Energy Info (EERE)

WREN WREN Jump to: navigation, search Name World Renewable Energy Network (WREN) Place Brighton, United Kingdom Zip BN2 1YH Sector Renewable Energy Product WREN is an NGO focused on supporting the utilisation and implementation of renewable energy sources that are environmentally safe and economically sustainable. Coordinates 44.81454°, -71.881084° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.81454,"lon":-71.881084,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aeolus Wind Ltd | Open Energy Information  

Open Energy Info (EERE)

Aeolus Wind Ltd Aeolus Wind Ltd Jump to: navigation, search Name Aeolus Wind Ltd Place London, United Kingdom Zip W1J 8DY Sector Wind energy Product London-based firm specializing in the development and implementation of wind power projects. It owns subsidiaries in Brazil. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Fenpower Ltd | Open Energy Information  

Open Energy Info (EERE)

Fenpower Ltd Fenpower Ltd Jump to: navigation, search Name Fenpower Ltd Place Cambridge, United Kingdom Zip PE15 0TY Sector Wind energy Product Developing 6.0MW wind farm in Cambridge. Coordinates 43.003745°, -89.017499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.003745,"lon":-89.017499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ScottishPower Renewable Energy Holdings | Open Energy Information  

Open Energy Info (EERE)

ScottishPower Renewable Energy Holdings ScottishPower Renewable Energy Holdings Jump to: navigation, search Name ScottishPower Renewable Energy Holdings Place Glasgow, Scotland, United Kingdom Zip G2 8SP Sector Wind energy Product Developer & owner of wind energy generation assets in both the UK & US. Coordinates 55.857809°, -4.242511° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.857809,"lon":-4.242511,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ESD Biomass Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name ESD Biomass Ltd Place Neston, United Kingdom Zip SN13 9TZ Sector Biomass Product Acts as advisor to firms developing biomass plants, with regard to planning applications and securing fuel supplies. Coordinates 53.29039°, -3.064554° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.29039,"lon":-3.064554,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eufinium Finance Ltd | Open Energy Information  

Open Energy Info (EERE)

Eufinium Finance Ltd Eufinium Finance Ltd Jump to: navigation, search Name Eufinium Finance Ltd Place London, Greater London, United Kingdom Zip EC1M 3LN Sector Hydro, Hydrogen, Renewable Energy, Wind energy Product Eufinium specialises in the equity financing of Wind Power, Marine Renewables and Hydrogen Technologies. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AlphaWatt Ltd | Open Energy Information  

Open Energy Info (EERE)

AlphaWatt Ltd AlphaWatt Ltd Jump to: navigation, search Name AlphaWatt Ltd Place London, United Kingdom Zip EC1V 4PY Sector Solar Product Solar project developer, plans to become an independent power provider. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Euromoney Energy Events | Open Energy Information  

Open Energy Info (EERE)

Euromoney Energy Events Euromoney Energy Events Jump to: navigation, search Name Euromoney Energy Events Place London, United Kingdom Zip EC4V 5EX Product London-based organiser of conferences for clean energy professionals worldwide. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Arbuthnott Wood Pellets Ltd | Open Energy Information  

Open Energy Info (EERE)

Arbuthnott Wood Pellets Ltd Arbuthnott Wood Pellets Ltd Jump to: navigation, search Name Arbuthnott Wood Pellets Ltd Place Kincardineshire, Scotland, United Kingdom Zip AB30 1PA Product Wood pellet producer. Coordinates 56.932781°, -2.42531° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":56.932781,"lon":-2.42531,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thermomax Ltd | Open Energy Information  

Open Energy Info (EERE)

Thermomax Ltd Thermomax Ltd Jump to: navigation, search Name Thermomax Ltd Place Bangor, United Kingdom Zip BT19 7UP Sector Solar Product Thermomax manufactures vacuum tubes for solar passive water heating systems. Coordinates 43.892445°, -90.990484° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.892445,"lon":-90.990484,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Biomass Fuels Ltd BFL | Open Energy Information  

Open Energy Info (EERE)

BFL BFL Jump to: navigation, search Name Biomass Fuels Ltd (BFL) Place London, United Kingdom Zip EC1Y 2BJ Sector Renewable Energy Product London-based company that secures fuels for emerging markets in the renewable fuels sector. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Atraverda Ltd | Open Energy Information  

Open Energy Info (EERE)

Atraverda Ltd Atraverda Ltd Jump to: navigation, search Name Atraverda Ltd Place Mansfield, United Kingdom Zip NG18 5BR Product Materials development company applying electrically conductive ceramic technology to lead acid batteries. Coordinates 47.81181°, -119.637599° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.81181,"lon":-119.637599,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AMEC Wind Energy | Open Energy Information  

Open Energy Info (EERE)

AMEC Wind Energy AMEC Wind Energy Place Cheshire, England, United Kingdom Zip WA16 8QZ Sector Wind energy Product A UK-based commercial wind farm developer. Coordinates 44.18318°, -123.304654° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.18318,"lon":-123.304654,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aberdeen Renewable Energy Group AREG | Open Energy Information  

Open Energy Info (EERE)

AREG AREG Jump to: navigation, search Name Aberdeen Renewable Energy Group (AREG) Place Aberdeen, Scotland, United Kingdom Zip AB25 1GN Sector Renewable Energy Product A not for profit company which seeks to encourage public/ private cooperation in developing renewable energy in Aberdeen. Coordinates 46.975867°, -123.81598° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.975867,"lon":-123.81598,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Platina Partners | Open Energy Information  

Open Energy Info (EERE)

Platina Partners Platina Partners Jump to: navigation, search Logo: Platina Partners Name Platina Partners Address 40, George Street Place London, United Kingdom Zip W1U 7DW Product Fund Website http://www.platinapartners.com Coordinates 51.5174444°, -0.1554961° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5174444,"lon":-0.1554961,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


WindSave Ltd | Open Energy Information  

Open Energy Info (EERE)

WindSave Ltd WindSave Ltd Jump to: navigation, search Name WindSave Ltd Place Glasgow, United Kingdom Zip G32 7QL Sector Wind energy Product Manufacturer of a small wind turbine generator, designed for residential use. Coordinates 55.857809°, -4.242511° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.857809,"lon":-4.242511,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Osmosis Capital | Open Energy Information  

Open Energy Info (EERE)

Osmosis Capital Osmosis Capital Jump to: navigation, search Name Osmosis Capital Place London, United Kingdom Zip EC4M 9DN Sector Carbon Product An investment firm seeking low carbon economy opportunity investments through its Osmosis Capital Fund. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Yorkshire Windpower | Open Energy Information  

Open Energy Info (EERE)

Yorkshire Windpower Yorkshire Windpower Jump to: navigation, search Name Yorkshire Windpower Place Leeds, United Kingdom Zip LS14 3H5 Sector Wind energy Product Formed to develop and own wind farms in the UK. Coordinates 37.239525°, -113.357839° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.239525,"lon":-113.357839,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Events UK Ltd | Open Energy Information  

Open Energy Info (EERE)

UK Ltd UK Ltd Jump to: navigation, search Name Energy Events UK Ltd Place London, United Kingdom Zip SW19 1EX Product e² - Energy Solutions Expo is an event organiser dedicated to clean, efficient, sustainable energy consumption within the corporate world. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sustainable Development Capital LLP | Open Energy Information  

Open Energy Info (EERE)

LLP LLP Jump to: navigation, search Name Sustainable Development Capital LLP Place London, United Kingdom Zip W1S 3AT Product Investment bank working with financial institutions, governments, developers and corporates on large scale sustainable development projects. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Armaec Energy Limited | Open Energy Information  

Open Energy Info (EERE)

Armaec Energy Limited Armaec Energy Limited Jump to: navigation, search Name Armaec Energy Limited Place Uxbridge, Greater London, United Kingdom Zip UB10 9NA Sector Wind energy Product London based wind farm developer with a focus on emerging markets such as Armenia, South Africa and India. Coordinates 42.060711°, -71.622467° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.060711,"lon":-71.622467,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EM Energy Solutions Ltd | Open Energy Information  

Open Energy Info (EERE)

EM Energy Solutions Ltd EM Energy Solutions Ltd Jump to: navigation, search Name EM Energy Solutions Ltd Place London, United Kingdom Zip NW3 5QY Product Consultant specialising in the development and financing of REE businesses, in Europe and the Emerging Markets. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Emerging Edge Capital EEC | Open Energy Information  

Open Energy Info (EERE)

Edge Capital EEC Edge Capital EEC Jump to: navigation, search Name Emerging Edge Capital (EEC) Place London, United Kingdom Zip SW1Y 4RS Sector Renewable Energy Product London-based company which sources and develops projects in renewable energy and other strategic sectors in emerging markets. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Abbey Publishing Exhibitions UK Ltd | Open Energy Information  

Open Energy Info (EERE)

Publishing Exhibitions UK Ltd Publishing Exhibitions UK Ltd Jump to: navigation, search Name Abbey Publishing & Exhibitions UK Ltd Place Essex, England, United Kingdom Zip EN9 3BP Product UK publishing house responsible for Sustainable FM Magazine. Coordinates 44.511005°, -73.058204° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.511005,"lon":-73.058204,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Electratech | Open Energy Information  

Open Energy Info (EERE)

Electratech Electratech Jump to: navigation, search Name Electratech Place Leeds, United Kingdom Zip LS17 6HZ Product Developer of a multi-way extension lead for use with all electrical equipment. Coordinates 37.239525°, -113.357839° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.239525,"lon":-113.357839,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


4Energy | Open Energy Information  

Open Energy Info (EERE)

4Energy 4Energy Place Nottingham, United Kingdom Zip NG 12 5HN Product UK-based cooling systems company. Coordinates 52.949225°, -1.143924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.949225,"lon":-1.143924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mid Wales Energy Agency | Open Energy Information  

Open Energy Info (EERE)

Wales Energy Agency Wales Energy Agency Jump to: navigation, search Name Mid Wales Energy Agency Place Aberystwyth, United Kingdom Zip SY23 2AZ Sector Efficiency, Renewable Energy Product Mid Wales Energy Agency is here to promote energy efficiency and appropriately scaled renewable energy throughout Mid Wales. Coordinates 52.41605°, -4.077869° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.41605,"lon":-4.077869,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ensign Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

Ensign Energy Ltd Ensign Energy Ltd Jump to: navigation, search Name Ensign Energy Ltd. Place Burnley, United Kingdom Zip BB11 1SF Sector Solar, Wind energy Product Company installs microgeneration equipment on residential housing - solar, heating pumps, wind turbines Coordinates 53.78801°, -2.243809° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.78801,"lon":-2.243809,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eurowind Developments Ltd | Open Energy Information  

Open Energy Info (EERE)

Eurowind Developments Ltd Eurowind Developments Ltd Jump to: navigation, search Name Eurowind Developments Ltd Place Newhaven, United Kingdom Zip BN9 0NA Sector Wind energy Product Small vertical axis wind turbines for the urban environment. Coordinates 38.98653°, -81.972794° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.98653,"lon":-81.972794,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Axeon Power Limited formerly Advanced Batteries Ltd ABL | Open Energy  

Open Energy Info (EERE)

formerly Advanced Batteries Ltd ABL formerly Advanced Batteries Ltd ABL Jump to: navigation, search Name Axeon Power Limited (formerly Advanced Batteries Ltd (ABL)) Place Dundee, United Kingdom Zip DD2 4UH Product Lithium ion battery pack developer. Coordinates 45.27939°, -123.009669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.27939,"lon":-123.009669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Solar Energy Partners | Open Energy Information  

Open Energy Info (EERE)

Partners Partners Place London, United Kingdom Zip W1K 4ND Sector Solar Product London-based firm active in investments in photovoltaic and thermal solar energy projects for pension funds, private equity, specialist funds and corporate investors. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Absolut Energy Capital | Open Energy Information  

Open Energy Info (EERE)

Absolut Energy Capital Absolut Energy Capital Jump to: navigation, search Name Absolut Energy Capital Place London, England, United Kingdom Zip W1H - 6HN Sector Renewable Energy Product London-based private equity firm. The firm offers financing for renewable energy ventures. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Novera Energy Plc former Primergy | Open Energy Information  

Open Energy Info (EERE)

Plc former Primergy Plc former Primergy Jump to: navigation, search Name Novera Energy Plc (former Primergy) Place London, United Kingdom Zip WC2E 9ED Sector Biomass, Wind energy Product London-based project developer for wind, water, biomass and waste. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hydrogen Solar Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Hydrogen Solar Ltd Place Guildford, United Kingdom Zip GU2 7YG Sector Hydro, Hydrogen, Solar Product Hydrogen Solar Ltd is developing innovative technology to convert sunlight directly into hydrogen fuel for vehicle refueling and other applications. Coordinates 51.237086°, -0.570516° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.237086,"lon":-0.570516,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AG Wind Power Ltd | Open Energy Information  

Open Energy Info (EERE)

Wind Power Ltd Wind Power Ltd Place Sheffield, United Kingdom Zip S3 8EN Sector Wind energy Product UK-based company focused on wind turbine erection and maintenance. Coordinates 53.38311°, -1.464544° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.38311,"lon":-1.464544,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Viridian Concepts Ltd | Open Energy Information  

Open Energy Info (EERE)

Viridian Concepts Ltd Viridian Concepts Ltd Jump to: navigation, search Name Viridian Concepts Ltd Place Cambridge, United Kingdom Zip SG8 5NT Sector Solar Product Developing a low-cost solar thermal panel for household use. Coordinates 43.003745°, -89.017499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.003745,"lon":-89.017499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Doreen Walker Consulting | Open Energy Information  

Open Energy Info (EERE)

Doreen Walker Consulting Doreen Walker Consulting Jump to: navigation, search Name Doreen Walker Consulting Place Hertfordshire, England, United Kingdom Zip SC1 4BL Sector Wind energy Product England-based wind farm developer. Coordinates 51.84005°, -0.2751° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.84005,"lon":-0.2751,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Daly International UK Ltd | Open Energy Information  

Open Energy Info (EERE)

UK Ltd UK Ltd Jump to: navigation, search Name Daly International (UK) Ltd Place Berkshire, England, United Kingdom Zip RG14 1JX Sector Renewable Energy, Services Product String representation "Daly Internatio ... ect Management." is too long. Coordinates 44.975662°, -72.77043° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.975662,"lon":-72.77043,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Eurus Energy Europe BV | Open Energy Information  

Open Energy Info (EERE)

Europe BV Europe BV Jump to: navigation, search Name Eurus Energy Europe BV Place London, United Kingdom Zip SW1Y 4QT Sector Wind energy Product European arm of Japanese wind power project developer. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Symphony Energy Resources Limited | Open Energy Information  

Open Energy Info (EERE)

Symphony Energy Resources Limited Symphony Energy Resources Limited Jump to: navigation, search Name Symphony Energy Resources Limited Place Borehamwood, United Kingdom Zip WD6 1LE Product String representation "Symphony Energy ... dable plastics." is too long. Coordinates 51.65582°, -0.275754° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.65582,"lon":-0.275754,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


UK Climate Change Projects Office | Open Energy Information  

Open Energy Info (EERE)

Office Office Jump to: navigation, search Name UK Climate Change Projects Office Place London, United Kingdom Zip SW1W 9SS Product Government advisory office set up to assist UK businesses who wish to pursue opportunities arising from the Kyoto Protocol. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AgFe Management Ltd | Open Energy Information  

Open Energy Info (EERE)

AgFe Management Ltd AgFe Management Ltd Jump to: navigation, search Name AgFe Management Ltd Place London, England, United Kingdom Zip W11 1QF Product London-based, Financial Asset Management and Advisory firm. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Global Village Energy Partnership (GVEP) | Open Energy Information  

Open Energy Info (EERE)

Partnership (GVEP) Partnership (GVEP) Jump to: navigation, search Logo: Global Village Energy Project (GVEP) Name Global Village Energy Project (GVEP) Address 73 Wicklow Street Place London, United Kingdom Zip WC1X 9JY Phone number +44 (0) 207 713 8246 Coordinates 51.5294935°, -0.119228° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.5294935,"lon":-0.119228,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EcoGen Projects Ltd | Open Energy Information  

Open Energy Info (EERE)

Projects Ltd Projects Ltd Place Machynlleth, United Kingdom Zip SY20 8WE Sector Renewable Energy, Solar, Wind energy Product Renewable energy project developer involved in wind and solar. Coordinates 52.59096°, -3.846723° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.59096,"lon":-3.846723,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Talbotts Ltd | Open Energy Information  

Open Energy Info (EERE)

Talbotts Ltd Talbotts Ltd Jump to: navigation, search Name Talbotts Ltd Place Stafford, United Kingdom Zip ST16 3HJ Sector Biomass Product Talbott's is a biomass heater and boiler manufacturer. Coordinates 38.422885°, -77.408174° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":38.422885,"lon":-77.408174,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Saxon Windpower Ltd | Open Energy Information  

Open Energy Info (EERE)

Saxon Windpower Ltd Saxon Windpower Ltd Jump to: navigation, search Name Saxon Windpower Ltd Place Ipswich, United Kingdom Zip IP19 0LA Sector Wind energy Product Wind farm developer. Coordinates 45.443805°, -99.029314° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.443805,"lon":-99.029314,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Scott Wilson Oceans | Open Energy Information  

Open Energy Info (EERE)

Oceans Oceans Jump to: navigation, search Name Scott Wilson Oceans Place Chesterfield, United Kingdom Zip S30 1JF Sector Wind energy Product Specialist in the engineering of onshore and offshore wind farm technology. Coordinates 37.376844°, -77.508252° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.376844,"lon":-77.508252,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


B9 Energy O M Ltd | Open Energy Information  

Open Energy Info (EERE)

M Ltd M Ltd Jump to: navigation, search Name B9 Energy (O&M) Ltd Place Larne, United Kingdom Zip BT40 2SF Sector Services, Wind energy Product Operates and maintains wind farms developed by B9 Energy Services and others. Coordinates 54.85114°, -5.823019° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.85114,"lon":-5.823019,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aquafuel Research | Open Energy Information  

Open Energy Info (EERE)

Aquafuel Research Aquafuel Research Jump to: navigation, search Name Aquafuel Research Place Kent, England, United Kingdom Zip ME9 8HL Sector Renewable Energy Product England-based renewable energy company. Coordinates 41.150928°, -81.358223° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.150928,"lon":-81.358223,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MGT Power Ltd | Open Energy Information  

Open Energy Info (EERE)

MGT Power Ltd MGT Power Ltd Jump to: navigation, search Name MGT Power Ltd Place London, England, United Kingdom Zip SW1H 9HP Sector Biomass Product Vertically integrated biomass company; currently developing a 300MW project located at Tees Dock, NE England. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Zero Waste Plc | Open Energy Information  

Open Energy Info (EERE)

Plc Plc Jump to: navigation, search Name Zero Waste Plc Place London, United Kingdom Zip SW7 1EE Product Has acquired right to waste processing technology, which processes waste into high energy density fuel products. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Airtricity Energy Supply Ltd | Open Energy Information  

Open Energy Info (EERE)

Airtricity Energy Supply Ltd Airtricity Energy Supply Ltd Jump to: navigation, search Name Airtricity Energy Supply Ltd Place Belfast, United Kingdom Zip BT2 7AF Product Energy supplier owned by Airtricity Ltd. Coordinates 54.595295°, -5.934524° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.595295,"lon":-5.934524,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mistral Invest Limited | Open Energy Information  

Open Energy Info (EERE)

Mistral Invest Limited Mistral Invest Limited Jump to: navigation, search Name Mistral Invest Limited Place London, United Kingdom Zip W1U 7DW Sector Wind energy Product Private Equity Fund aiming to build a portfolio of wind farms in the UK and France, participating early in the project development phase. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Hammerfest Strom UK co owned by StatoilHydro | Open Energy Information  

Open Energy Info (EERE)

Hammerfest Strom UK co owned by StatoilHydro Hammerfest Strom UK co owned by StatoilHydro Jump to: navigation, search Name Hammerfest Strom UK co owned by StatoilHydro Address The Innovation Centre 1 Ainslie Road Hillington Business Park Place Glasgow Zip G52 4RU Sector Marine and Hydrokinetic Phone number +44 141 585 6447 Website http://www.hammerfeststrom.com Region United Kingdom LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: Hammerfest Strom UK Tidal Stream Kvalsundet This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Hammerfest_Strom_UK_co_owned_by_StatoilHydro&oldid=678328"


Alternative Energy Finance | Open Energy Information  

Open Energy Info (EERE)

Finance Finance Place London, United Kingdom Zip NW11 8BU Sector Renewable Energy Product String representation "Alternative Ene ... orms of energy." is too long. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Inquiring Minds  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Neutrino physics at Fermilab Neutrino physics at Fermilab MINOS Detector The MINOS Detector, 800 meters underground in Minnesota's Soudan Mine. The subatomic particles called neutrinos are among the most elusive in the particle kingdom. Scientists have built detectors underground, underwater, and at the South Pole to measure these ghostly particles that come from the sun, from supernovae and from many other celestial objects. Neutrinos fill the whole universe, with about 10 million of them per cubic foot, and most of them zip straight through the earth, and through particle detectors, without leaving a trace. Because they almost never interact with matter, only sophisticated experiments can catch and measure the properties of neutrinos. In addition to measuring neutrinos from the sky, physicists on earth use


Vigor Renewables Ltd | Open Energy Information  

Open Energy Info (EERE)

Vigor Renewables Ltd Vigor Renewables Ltd Jump to: navigation, search Name Vigor Renewables Ltd Place London, Greater London, United Kingdom Zip W1W7TH Sector Solar, Wind energy Product London-based wind and solar project developer. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alternergy | Open Energy Information  

Open Energy Info (EERE)

Alternergy Alternergy Jump to: navigation, search Name Alternergy Place London, England, United Kingdom Zip W4 1JT Sector Renewable Energy Product London-based project developer, design consultancy, wholesaler and distributor of renewable energy solutions. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Excess Group Ltd | Open Energy Information  

Open Energy Info (EERE)

Excess Group Ltd Excess Group Ltd Jump to: navigation, search Name Excess Group Ltd Place Chepstow, Wales, United Kingdom Zip NP16 6HN Sector Hydro, Hydrogen Product The Excess Group has developed and builds novel hydrogen generation systems for fuel cell power plants. Coordinates 39.617315°, -96.900768° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.617315,"lon":-96.900768,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SeaScape Energy Ltd | Open Energy Information  

Open Energy Info (EERE)

SeaScape Energy Ltd SeaScape Energy Ltd Jump to: navigation, search Name SeaScape Energy Ltd Place Lancaster, United Kingdom Zip LA1 4XQ Sector Wind energy Product Develops offshore wind farms - specifically the Burbo Bank project. Coordinates 42.847505°, -90.709634° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.847505,"lon":-90.709634,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ariane Environment | Open Energy Information  

Open Energy Info (EERE)

Ariane Environment Ariane Environment Jump to: navigation, search Name Ariane Environment Place London, United Kingdom Zip W8 6JL Product String representation "Ariane Environm ... onmental value." is too long. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rockfield Energy Investments | Open Energy Information  

Open Energy Info (EERE)

Rockfield Energy Investments Rockfield Energy Investments Jump to: navigation, search Name Rockfield Energy Investments Place London, United Kingdom Zip W1J ODS Product Rockfield invests in the development, construction and optimisation of companies and projects in the Energy Sector. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Microcab Industries Ltd | Open Energy Information  

Open Energy Info (EERE)

Microcab Industries Ltd Microcab Industries Ltd Jump to: navigation, search Name Microcab Industries Ltd Place Coventry, United Kingdom Zip CV1 2TT Sector Hydro, Hydrogen Product Urban taxi and light freight vehicle powered by a hydrogen fuel cell. Coordinates 44.866737°, -72.263927° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.866737,"lon":-72.263927,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Engyco | Open Energy Information  

Open Energy Info (EERE)

Engyco Engyco Jump to: navigation, search Name Engyco Place Jersey, Channel Islands, United Kingdom Zip JE2 4SU Sector Solar Product Jersey based firm aiming to acquire and repower Spanish solar assets. Coordinates 33.72091°, -83.801303° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.72091,"lon":-83.801303,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Whitfield Solar Ltd | Open Energy Information  

Open Energy Info (EERE)

Whitfield Solar Ltd Whitfield Solar Ltd Jump to: navigation, search Name Whitfield Solar Ltd Place Reading, United Kingdom Zip RG6 6AU Sector Renewable Energy, Solar Product Developing solar photovoltaic concentrators aimed at generating clean renewable energy for the world market. Coordinates 43.45529°, -72.537152° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.45529,"lon":-72.537152,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Southside Thermal Services Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Southside Thermal Services Ltd Place London, Greater London, United Kingdom Zip SW7 2AZ Product String representation "Southside Therm ... perial College." is too long. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Envirocapital | Open Energy Information  

Open Energy Info (EERE)

Envirocapital Envirocapital Jump to: navigation, search Name Envirocapital Place London, United Kingdom Zip EC4M 8BU Sector Renewable Energy Product Provides corporate finance advice to the renewable energy and environmental sector. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ascot Renewco | Open Energy Information  

Open Energy Info (EERE)

Ascot Renewco Ascot Renewco Jump to: navigation, search Name Ascot Renewco Place London, England, United Kingdom Zip EC3M 3BD Sector Renewable Energy Product London-based renewable energy division, specialising in the insurance of sustainable energy products. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


HelioDynamics Ltd | Open Energy Information  

Open Energy Info (EERE)

HelioDynamics Ltd HelioDynamics Ltd Jump to: navigation, search Name HelioDynamics Ltd Place Cambridge, United Kingdom Zip CB23 2SH Sector Solar Product Manufactures the HD211 product - a solar system which concentrates light onto crystalline silicon PV cells, and also produces hot water. Coordinates 43.003745°, -89.017499° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.003745,"lon":-89.017499,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "kingdom zip se1" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Eclectic Energy Limited | Open Energy Information  

Open Energy Info (EERE)

Eclectic Energy Limited Eclectic Energy Limited Jump to: navigation, search Name Eclectic Energy Limited Place Nottinghamshire, United Kingdom Zip NG21 9PR Sector Wind energy Product Design, manufacture D400, StealthGen micro wind, DuoGen wind and water generators. Coordinates 53.145962°, -1.00554° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":53.145962,"lon":-1.00554,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Vertax Wind | Open Energy Information  

Open Energy Info (EERE)

Vertax Wind Vertax Wind Jump to: navigation, search Name Vertax Wind Place Surrey, United Kingdom Zip RH2 7LD Sector Wind energy Product Vertax is a British company that develops vertical axis wind turbines Coordinates 48.231575°, -101.134114° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":48.231575,"lon":-101.134114,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oxara Energy Group | Open Energy Information  

Open Energy Info (EERE)

Oxara Energy Group Oxara Energy Group Jump to: navigation, search Name Oxara Energy Group Place London, United Kingdom Zip SW1Y 6QU Sector Renewable Energy Product London-based investment firm focusing on project finance, engineering, construction and operation of renewable energy ventures. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


First London Power FLP | Open Energy Information  

Open Energy Info (EERE)

First London Power FLP First London Power FLP Jump to: navigation, search Name First London Power (FLP) Place London, United Kingdom Zip E3 2PL Product London-based gasification developer operating a demonstration plant in East London. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Oxford Catalysts Group plc | Open Energy Information  

Open Energy Info (EERE)

Oxford Catalysts Group plc Oxford Catalysts Group plc Jump to: navigation, search Name Oxford Catalysts Group plc Place Oxford, United Kingdom Zip OX2 6UD Sector Hydro, Hydrogen Product Developer of catalysts for room-temperature hydrogen production, hot steam production and Fischer-Tropsch processes. Coordinates 43.781517°, -89.571699° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.781517,"lon":-89.571699,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Marine Current Turbines Ltd | Open Energy Information  

Open Energy Info (EERE)

Turbines Ltd Turbines Ltd Jump to: navigation, search Name Marine Current Turbines Ltd (MCT) Place Bristol, United Kingdom Zip BS34 8PD Sector Marine and Hydrokinetic Product Developer of tidal stream turbine technology for exploiting flowing water in general and tidal streams in particular. Coordinates 51.454513°, -2.58791° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.454513,"lon":-2.58791,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Nur Energie | Open Energy Information  

Open Energy Info (EERE)

Nur Energie Nur Energie Jump to: navigation, search Name Nur Energie Place London, United Kingdom Zip WC2A 1AL Sector Solar Product London-based solar development company. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


SolarStructure Ltd | Open Energy Information  

Open Energy Info (EERE)

SolarStructure Ltd SolarStructure Ltd Jump to: navigation, search Name SolarStructure Ltd Place London, Greater London, United Kingdom Zip SW7 2AZ Sector Solar Product Early stage solar company which aims to develop building integrated PV made of nanostructured cells. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Minoan Group | Open Energy Information  

Open Energy Info (EERE)

Minoan Group Minoan Group Jump to: navigation, search Name Minoan Group Place Kent, England, United Kingdom Zip BR5 1XB Sector Solar Product UK-based developer of resorts in Greece that has branched into solar power project development. Coordinates 41.150928°, -81.358223° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.150928,"lon":-81.358223,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Axeon Holdings | Open Energy Information  

Open Energy Info (EERE)

Holdings Holdings Place Aberdeen, United Kingdom Zip AB22 8GT Product Owns battery and battery power management system technologies, which it is commercialising for hybrid and electric vehicle applications. Coordinates 46.975867°, -123.81598° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":46.975867,"lon":-123.81598,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Aquascientific | Open Energy Information  

Open Energy Info (EERE)

Aquascientific Aquascientific Jump to: navigation, search Name Aquascientific Place London, England, United Kingdom Zip W1T 4SB Product A small team of highly qualified and experienced marine engineers and scientists who have been evolving solutions to marine based energy extraction over a number or years. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


ESV Group | Open Energy Information  

Open Energy Info (EERE)

ESV Group ESV Group Jump to: navigation, search Name ESV Group Place London, England, United Kingdom Zip W1K 4QH Sector Biofuels Product UK-based investment agri-business involved in biofuels, in particular jatropha. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


AFC Energy Plc | Open Energy Information  

Open Energy Info (EERE)

AFC Energy Plc AFC Energy Plc Jump to: navigation, search Name AFC Energy Plc Place Cranleigh, United Kingdom Zip GU6 8TB Product Alkaline fuel cell developer. Coordinates 51.14162°, -0.482819° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.14162,"lon":-0.482819,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Airtricity Developments Scotland | Open Energy Information  

Open Energy Info (EERE)

Scotland Scotland Jump to: navigation, search Name Airtricity Developments Scotland Place Greenock, Scotland, United Kingdom Zip PA16 8DD Sector Wind energy Product Scottish development arm of wind farm developer Airtricity. Coordinates 40.312171°, -79.796845° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.312171,"lon":-79.796845,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Alternative Fuel Systems Ltd | Open Energy Information  

Open Energy Info (EERE)

Ltd Ltd Jump to: navigation, search Name Alternative Fuel Systems Ltd Place Slinfold, United Kingdom Zip RH13 7SZ Product Supplier and installer of LPG conversions. Also develops Alkaline Fuel Cell systems. Coordinates 51.069°, -0.40602° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.069,"lon":-0.40602,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


B9 Energy Offshore Developments Ltd | Open Energy Information  

Open Energy Info (EERE)

Developments Ltd Developments Ltd Jump to: navigation, search Name B9 Energy Offshore Developments Ltd Place Larne, United Kingdom Zip BT40 2SF Sector Wind energy Product Established in 2002 to develop the offshore wind energy potential in Northern Ireland. Coordinates 54.85114°, -5.823019° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":54.85114,"lon":-5.823019,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NBGI Ventures | Open Energy Information  

Open Energy Info (EERE)

Ventures Ventures Jump to: navigation, search Name NBGI Ventures Place London, United Kingdom Zip EC4V 4BJ Product UK-based firm focused on investing in early stage, high growth and innovative companies. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Force 9 Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Energy Jump to: navigation, search Name Force 9 Energy Place Amersham, United Kingdom Zip HP7 0UT Sector Wind energy Product Joint owner of Abercairny windfarm development. Coordinates 36.530602°, -82.602203° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.530602,"lon":-82.602203,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Wind Direct Ltd | Open Energy Information  

Open Energy Info (EERE)

Wind Direct Ltd Wind Direct Ltd Place Solihull, United Kingdom Zip B91 2PQ Sector Wind energy Product Develops small wind farms (1-5MW) particularly for industrial customers. HgCapital provides working capital to the company and holds majority ownership of the wind assets. Coordinates 52.415065°, -1.777849° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":52.415065,"lon":-1.777849,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Absolute Energy Capital | Open Energy Information  

Open Energy Info (EERE)

Absolute Energy Capital Absolute Energy Capital Place London, United Kingdom Zip SW1Y 5NQ Product London-based private equity firm. Coordinates 51.506325°, -0.127144° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":51.506325,"lon":-0.127144,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}