Powered by Deep Web Technologies
Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Brazil 2 Chapada Diamantina and Rio de Janeiro Chapada Diamantina Happy Trekking  

E-Print Network [OSTI]

Brazil 2 ­ Chapada Diamantina and Rio de Janeiro Chapada Diamantina ­ Happy Trekking The plateau offers a terrific natural shower with no water pressure problems ­ is a happy trekking experience. Enough, Valley, Cave, Mountain - in this order Day 3 - The Very Very Wet Mosquito Fall and the Paridas Rock Day 4

Beimel, Amos

2

Analysis of potential for reducing emissions of greenhouse gases in municipal solid waste in Brazil, in the state and city of Rio de Janeiro  

SciTech Connect (OSTI)

Highlights: ? We constructed future scenarios of emissions of greenhouse gases in waste. ? Was used the IPCC methodology for calculating emission inventories. ? We calculated the costs of abatement for emissions reduction in landfill waste. ? The results were compared to Brazil, state and city of Rio de Janeiro. ? The higher the environmental passive, the greater the possibility of use of biogas. - Abstract: This paper examines potential changes in solid waste policies for the reduction in GHG for the country of Brazil and one of its major states and cities, Rio de Janeiro, from 2005 to 2030. To examine these policy options, trends in solid waste quantities and associated GHG emissions are derived. Three alternative policy scenarios are evaluated in terms of effectiveness, technology, and economics and conclusions posited regarding optimal strategies for Brazil to implement. These scenarios are been building on the guidelines for national inventories of GHG emissions (IPCC, 2006) and adapted to Brazilian states and municipalities boundaries. Based on the results, it is possible to say that the potential revenue from products of solid waste management is more than sufficient to transform the current scenario in this country into one of financial and environmental gains, where the negative impacts of climate change have created a huge opportunity to expand infrastructure for waste management.

Loureiro, S.M., E-mail: saulo@lima.coppe.ufrj.br [Department of Energy Planning, Federal University of Rio de Janeiro, C.P. 68565, CEP 21949-972 Rio de Janeiro, RJ (Brazil); Rovere, E.L.L., E-mail: emilio@ppe.ufrj.br [Department of Energy Planning, Federal University of Rio de Janeiro, C.P. 68565, CEP 21949-972 Rio de Janeiro, RJ (Brazil); Mahler, C.F., E-mail: mahler0503@yahoo.com [Department of Civil Engineering, Federal University of Rio de Janeiro, C.P. 68506, CEP 21945-970, Rio de Janeiro, RJ (Brazil)

2013-05-15T23:59:59.000Z

3

Carbon emissions in energy production and use in the tropical region: The case of the state of Rio de Janeiro - Brazil  

SciTech Connect (OSTI)

The Brasil is one of the most important region in the tropics. An efficient management in energy use and production in this state of Rio de Janeiro could be an excellent model to others development regions in the tropics. In 1994, the State of the Rio de Janeiro represented around 13 millions of inhabitants, an economy of 42 billions US$ (gross national products), the biggest brazilian producer in petroleum and natural gas and a large market to energy products (electric power and fossil fuels). This state was responsible for 8.6 millions tonnes of carbon in CO2 emissions in 1994, issue to combustion of petroleum products (65.9%), coal (27.8%), natural gas (3.7%), charcoal and fuelwood (2.6%). The principals responsibles to these carbon emissions are the industrial activities (40%), the transport (35.7%) and energy production (12%). The main objectives of this work are analyze the carbon emissions in energy production and use in Rio de Janeiro between 1980 and 1994, the possibilities to reduction this amount and the perspectives to renewable energy.

Freitas, M.A.V. de; Porto, R.M.G. Jr.; Peres, F.M. Jr.; Cecchi, J.C.

1997-12-31T23:59:59.000Z

4

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

5

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

6

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

7

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

8

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

9

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

10

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

17

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

18

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

19

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

20

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

22

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

23

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

24

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

25

GE Global Research in Rio de Janeiro, Brazil  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickr Flickr Editor's note:ComputingFusion

26

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

27

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

28

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

29

20 a 23 de Maio 2012 RIO DE JANEIRO -BRASIL  

E-Print Network [OSTI]

SP082 XII SEPOPE 20 a 23 de Maio 2012 May ­ 20th to 23th ­ 2012 RIO DE JANEIRO - BRASIL XI SIMP?SIO

30

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

31

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

32

Networks of recyclable material waste-pickers cooperatives: An alternative for the solid waste management in the city of Rio de Janeiro  

SciTech Connect (OSTI)

Highlights: ? In the marketing of recyclable materials, the waste-pickers are the least wins. ? It is proposed creating a network of recycling cooperatives to achieve viability. ? The waste-pickers contribute to waste management to the city. - Abstract: The objective of this study is to discuss the role of networks formed of waste-picker cooperatives in ameliorating problems of final disposal of solid waste in the city of Rio de Janeiro, since the citys main landfill will soon have to close because of exhausted capacity. However, it is estimated that in the city of Rio de Janeiro there are around five thousand waste-pickers working in poor conditions, with lack of physical infrastructure and training, but contributing significantly by diverting solid waste from landfills. According to the Sustainable Development Indicators (IBGE, 2010a,b) in Brazil, recycling rates hover between 45% and 55%. In the municipality of Rio de Janeiro, only 1% of the waste produced is collected selectively by the government (COMLURB, 2010), demonstrating that recycling is mainly performed by waste-pickers. Furthermore, since the recycling market is an oligopsony that requires economies of scale to negotiate directly with industries, the idea of working in networks of cooperatives meets the demands for joint marketing of recyclable materials. Thus, this work presents a method for creating and structuring a network of recycling cooperatives, with prior training for working in networks, so that the expected synergies and joint efforts can lead to concrete results. We intend to demonstrate that it is first essential to strengthen the waste-pickers cooperatives in terms of infrastructure, governance and training so that solid waste management can be environmentally, socially and economically sustainable in the city of Rio de Janeiro.

Tirado-Soto, Magda Martina, E-mail: magda@pep.ufrj.br [Program of Production Engineering, School and Research in Engineering, Federal University of Rio de Janeiro (Brazil); Zamberlan, Fabio Luiz, E-mail: fabio@pep.ufrj.br [Program of Production Engineering, School and Research in Engineering, Federal University of Rio de Janeiro (Brazil)

2013-04-15T23:59:59.000Z

33

Potential Geographic Distribution of Hantavirus Reservoirs in Brazil  

E-Print Network [OSTI]

meteorological stations over 30-50 (1950-2000) years, depending on data availability at stations [49]. To summarize aspects of vegetation and land cover, we used multitemporal (monthly) normalized difference vegetation index values (NDVI, a greenness index... lineage in Oligoryzomys nigripes in Rio de Janeiro, Brazil. Acta Trop 112: 212-218. doi:10.1016/j.actatropica.2009.07.029. PubMed: 19660427. 46. Raboni SM, de Borba L, Hoffmann FG, de Noronha L, Azevedo ML (2009) Evidence of circulation of Laguna Negra...

Oliveira, Stefan Vilges de; Escobar, Luis E.; Peterson, A. Townsend; Gurgel-Gonç alves, Rodrigo

2013-12-31T23:59:59.000Z

34

Boundaries to membranes : the urban project revisited : an urban strategy for Rio de Janeiro, Zona Norte  

E-Print Network [OSTI]

This thesis investigates urban boundaries in the North Zone of Rio de Janeiro. The Zona Norte transitioned in the last hundred years from a rural outskirts area of Rio, into its industrial hinterland, into a fully urbanized ...

Dudek, Phebe (Phebe Helena Melania)

2014-01-01T23:59:59.000Z

35

Rio de Janeiro, Brasil Pontifcia Universidade Catlica do Rio dePontifcia Universidade Catlica do Rio dePontifcia Universidade Catlica do Rio dePontifcia Universidade Catlica do Rio de  

E-Print Network [OSTI]

Patrocínio Rio de Janeiro, Brasil Pontifícia Universidade Católica do Rio dePontifícia Universidade JaneiroJaneiroJaneiroJaneiro Rua Marquês de São Vicente 225 Gávea - Rio de Janeiro, RJ - Brasil Telefone. OttingerRichard L. Ottinger, Reitor Emérito da Pace Law School, Superintendente do Programa de Energia da

36

Estrada Dona Castorina, 110 Rio de Janeiro -Brasil 22460-320 Fone: 55 21 2529 5000/5284 Fax: 55 21 2512 4115 http://www.impa.br  

E-Print Network [OSTI]

Estrada Dona Castorina, 110 Rio de Janeiro - Brasil 22460-320 Fone: 55 21 2529 5000/5284 Fax: 55 21 Atividades Científicas #12;Estrada Dona Castorina, 110 Rio de Janeiro - Brasil 22460-320 Fone: 55 21 2529 Atividades Científicas #12;Estrada Dona Castorina, 110 Rio de Janeiro - Brasil 22460-320 Fone: 55 21 2529

Solodov, Mikhail V.

37

Wind power in Brazil.  

E-Print Network [OSTI]

?? As welfare and industry production gets higher the demand for electricity increases. Almost 90 % of the electricity generated in Brazil is from renewable (more)

Elin, Karlsson

2009-01-01T23:59:59.000Z

38

Effective gamma-ray doses due to natural radiation from soils of southeastern Brazil  

SciTech Connect (OSTI)

We have used gamma-ray spectrometry to study the distribution of natural radiation from soils of southeastern Brazil: Billings reservoir, Sao Bernardo do Campo Parks, Diadema Parks, Interlagos region, Sao Paulo, and soil from Sao Paulo and Rio de Janeiro beaches. In most of the regions studied we have found that the dose due the external exposure to gamma-rays, proceeding from natural terrestrial elements, are between the values 0.3 and 0.6 mSv/year, established by the United Nations Scientific Committee on the Effects of Atomic Radiation.

Silveira, M. A. G.; Moreira, R. H.; Bellini, B. S. [Centro Universitario da FEI, Sao Bernardo do Campo, Sao Paulo (Brazil); Medina, N. H.; Aguiar, V. A. P. [Instituto de Fisica da Universidade de Sao Paulo, Sao Paulo (Brazil)

2010-08-04T23:59:59.000Z

39

Alunos do TADS apresentam trabalhos no IX Workshop de Viso Computacional no Rio de Janeiro  

E-Print Network [OSTI]

Alunos do TADS apresentam trabalhos no IX Workshop de Visão Computacional no Rio de Janeiro Nos Superior em Tecnologia em Análise e Desenvolvimento de Sistemas (TADS), do Setor de Educação Profissional TADS, orientados pelo Prof. Neves, com a participação do Prof. Dr. Gilson Giraldi, do LNCC (Laboratório

Paraná, Universidade Federal do

40

EngOpt 2008 -International Conference on Engineering Optimization Rio de Janeiro, Brazil, 01 -05 June 2008.  

E-Print Network [OSTI]

of the design of an airborne system whose function is to solve the problem of allocation of transportation to the load alleviation function, is to control the bending and flexion moments of the wings while performing and elevator; Clail, Cnail ­ yawing torque and inverse yawing torque due to drag aileron; Cnrud, Clrud ­ roll

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Uranium deposits of Brazil  

SciTech Connect (OSTI)

Brazil is a country of vast natural resources, including numerous uranium deposits. In support of the country`s nuclear power program, Brazil has developed the most active uranium industry in South America. Brazil has one operating reactor (Angra 1, a 626-MWe PWR), and two under construction. The country`s economic challenges have slowed the progress of its nuclear program. At present, the Pocos de Caldas district is the only active uranium production. In 1990, the Cercado open-pit mine produced approximately 45 metric tons (MT) U{sub 3}O{sub 8} (100 thousand pounds). Brazil`s state-owned uranium production and processing company, Uranio do Brasil, announced it has decided to begin shifting its production from the high-cost and nearly depleted deposits at Pocos de Caldas, to lower-cost reserves at Lagoa Real. Production at Lagoa Real is schedules to begin by 1993. In addition to these two districts, Brazil has many other known uranium deposits, and as a whole, it is estimated that Brazil has over 275,000 MT U{sub 3}O{sub 8} (600 million pounds U{sub 3}O{sub 8}) in reserves.

NONE

1991-09-01T23:59:59.000Z

42

Perspectives Computational Biology in Brazil  

E-Print Network [OSTI]

Investment Brazil is a country with almost 190 million inhabitants that occupies an area equal to 81, including targeted investment in supporting science and technology. As a consequence, Brazil became, Petrobras, provides Brazil self- sufficiency in oil, and is a major catalyst for the widespread use

Neshich, Goran

43

PRODUCCI ON DE AEROSOLES PRIMARIOS, SECUNDARIOS Y OZONO EN LA REGI ON METROPOLITANA DE RIO DE JANEIRO ENFOCADO EN EMISIONES  

E-Print Network [OSTI]

JANEIRO ENFOCADO EN EMISIONES VEHICULARES, UN ESTUDIO NUM ´ERICO CON WRF-CHEM Wilmer D´iaz1,2 y Henrique M. INTRODUCCI ´ON Las emisiones vehiculares e industriales son las principales responsables de los poluentes en, gasolina y diesel). Los poluentes pueden tener su origen atreves de emisiones directas de las fuentes o

Barbosa, Henrique

44

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

45

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

46

Brazil: desafios de las politicas para las familias  

E-Print Network [OSTI]

essa Relaco para o Brasil? En Camarano. A.A. (organizadora)Andr (1997). Traballio. Brasil em Nmeros. Rio de Janeiro,Chagas), Mary Castro (UNESCO Brasil/ Universidad Catlica de

Goldani, Ana Maria; Lazo, Aida Verdugo

2007-01-01T23:59:59.000Z

47

2006/3/13 IVIGIVIG --Instituto Virtual Internacional de MudanInstituto Virtual Internacional de Mudanas Globaisas Globais Centro de Tecnologia, Bloco I, Sala 129 CEP: 21945-970 Rio de Janeiro RJ  

E-Print Network [OSTI]

Mudanas Globaisas Globais Centro de Tecnologia, Bloco I, Sala 129 CEP: 21945-970 Rio de Janeiro RJ Mudanas Globaisas Globais Centro de Tecnologia, Bloco I, Sala 129 CEP: 21945-970 Rio de Janeiro RJ MudanInstituto Virtual Internacional de Mudanas Globaisas Globais Centro de Tecnologia, Bloco I, Sala

Columbia University

48

Money Reconstructed: Argentina and Brazil after Hyperinflation  

E-Print Network [OSTI]

Money Reconstructed: Argentina and Brazil after Hyperinflation Jérôme Sgard (Sciences Po / CERI and transferred on alternate supports--either a foreign currency (as in Argentina) or domestic indices (as empirical material and an extended analytical discussion. Keywords: Argentina, Brazil, hyperinflation

Paris-Sud XI, Université de

49

Cad. Sade Pblica, Rio de Janeiro, 24(7):1493-1508, jul, 2008 Mapeamento do risco de homicdio com base na  

E-Print Network [OSTI]

homicídio com base na co-krigeagem binomial e simulação: um estudo de caso para São Paulo, Brasil Mapping têm incorporado o espaço e o tempo como variáveis de análise, com base na possibilidade de localização para os dados de ARTIGO ARTICLE #12;Camargo ECG et al.1494 Cad. Saúde Pública, Rio de Janeiro, 24

Camara, Gilberto

50

Corporate Clean Energy Investment Trends in Brazil, China, India...  

Open Energy Info (EERE)

Brazil, China, India and South Africa Jump to: navigation, search Name Corporate Clean Energy Investment Trends in Brazil, China, India and South Africa AgencyCompany...

51

Submitted on February 16, 2007. Accepted on May 8, 2007. Universidade Federal do Rio de Janeiro, CCS, IB, Departamento de Zoologia. Ilha do Fundo, 21941-590, Rio de Janeiro, RJ, Brasil.  

E-Print Network [OSTI]

: POLYCHAETA) FROM ROCAS ATOLL, NORTHEASTERN BRAZIL 1 (With 3 figures) R?MULO BARROSO 2, 3 PAULO CESAR PAIVA 3, 1995). This paper describes the amphinomids species #12;358 R.BARROSO & P.C.PAIVA Arq. Mus. Nac., Rio

Paiva, Paulo Cesar de

52

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

53

The Politics of Access to Higher Education in Argentina and Brazil: A comparative analysis  

E-Print Network [OSTI]

education ?? In Argentina and Brazil, policies to grantpopulation. In Argentina and Brazil these policies changedto look at the policies adopted by Argentina and Brazil to

Fernandes Nogueira, Jaana Flavia

2013-01-01T23:59:59.000Z

54

Property Rights and Land Conflicts in Brazil: The Case of Mongangua's Growers' Association  

E-Print Network [OSTI]

A questo do territrio no Brasil. So Paulo, Hucitec, p.54,B. A propriedade rural no Brasil. Rio de Janeiro: OAB, 1985.no. 5, p. 903-937, oct. 1995. BRASIL. Instituto Nacional de

Nascimento, Viviam Ester de Souza; Saes, Maria Sylvia Macchione

2007-01-01T23:59:59.000Z

55

Intergenerational Relations and Welfare State Restructuring. Why Should We Re-think This Relationship in Brazil  

E-Print Network [OSTI]

e previdencia social: o Brasil e o mundo. Rio de Janeiro,do governo federal no Brasil desde 1980/85. Econmica, v. 5,n. 1, p. 101-110, 2003. BRASIL. Constituifo da Repblica

Goldani, Ana Maria

2007-01-01T23:59:59.000Z

56

Policy support activities Brazil Rural Energy  

E-Print Network [OSTI]

1 Policy support activities Brazil Rural Energy Enterprise Development (B-REED) Juan Zak UNEP Risoe makers implement Electricity Law 10.438 in ways that enable small rural energy enterprises to coexist with distribution utilities. ·The Law, approved in April 2002, dealt with key issues for rural energy enterprises

57

1DANGEROUS CLIMATE CHANGE IN BRAZIL Dangerous Climate  

E-Print Network [OSTI]

1DANGEROUS CLIMATE CHANGE IN BRAZIL Dangerous Climate A BrAzil-UK AnAlysis of ClimAte ChAnge And deforestAtion impACts in the AmAzon Change in Brazil #12;3DANGEROUS CLIMATE CHANGE IN BRAZIL April 2011Alysis of ClimAte ChAnge And deforestAtion impACts in the AmAzon Change in Brazil #12;4 DANGEROUS CLIMATE CHANGE

58

Waste management experience at IPEN-Brazil  

SciTech Connect (OSTI)

The Institute for Energy and Nuclear Research (Instituto de Pesquisas Energeticas e Nucleares--IPEN) is the biggest nuclear research center in Brazil. Located in the campus of the University of Sao Paulo, it is maintained and operated by the National Commission on Nuclear Energy (Comissao Nacional de Energia Nuclear--CNEN). Its objectives are the development of nuclear energy and its fuel cycle, the applications of radiation and radioisotopes in industry, medicine, agriculture, research, education, and environmental preservation, and the realization of basic and applied research in related fields. This paper describes the history and the practices of the waste management at a nuclear research center in Brazil where research on the nuclear fuel cycle and on the applications of radioisotopes are in progress.

Vicente, R. [Inst. de Pesquisas Energeticas e Nucleaires, Sao Paulo (Brazil)

1993-12-31T23:59:59.000Z

60

Bulk Power System Dynamics and Control VIII, August 1-6, 2010, Buzios, Rio de Janeiro, Brazil Impact of Delays on a Consensus-based Primary Frequency Control Scheme  

E-Print Network [OSTI]

by a Multi-Terminal HVDC Grid Jing Dai, Yannick Phulpin Sup´elec, France {jing.dai, yannick systems connected by a multi-terminal HVDC grid. We focus on a control scheme that mod- ifies the power current (HVDC) systems for bulk power transmission over long distances [3] and underground cable cross

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

To be presented at the Seventh International IBPSA Conference Building Simulation 2001, August 13-15, 2001 in Rio de Janeiro, Brazil and to be published in the Proceedings.  

E-Print Network [OSTI]

these environments. First we describe the key features of an integrated simulation environment designed to encourage the widespread design of energy- efficient, comfortable buildings. During the past 10 years, the building simulation industry has also attempted to integrate various building tools into one software

62

Brasilia, Brazil: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGEFairfield(CTI PFAN)Brasilia, Brazil: Energy

63

Energy Efficiency Standards for Refrigerators in Brazil: A Methodology...  

Open Energy Info (EERE)

for Impact Evaluation Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Energy Efficiency Standards for Refrigerators in Brazil: A Methodology for Impact Evaluation Focus...

64

Solar energy for domestic use in southern Brazil.  

E-Print Network [OSTI]

?? Almost all the domestic water in Brazil is heated with an electrical heater directly by the end consumer. A typical heater has an effect (more)

Hedenberg, Ola

2008-01-01T23:59:59.000Z

65

U.S. Energy Deputy Secretary Poneman, Brazil's Deputy Minister...  

Broader source: Energy.gov (indexed) [DOE]

Secretary Daniel Poneman and Brazil's Deputy Minister of Mines and Energy Mrcio Pereira Zimmermann this week co-chaired the second meeting of the Strategic Energy Dialogue...

66

N 6, quinta-feira, 9 de janeiro de 2014 3ISSN 1677-7050 Este documento pode ser verificado no endereo eletrnico http://www.in.gov.br/autenticidade.html,  

E-Print Network [OSTI]

Públicas Brasileira - ICP-Brasil. 2 RETIFICA??O Na Portaria MCTI nº 13, de 7 de janeiro de 2014, publicada no Diário Oficial da União. FERNANDO LÁZARO FREIRE JR. COMISS?O NACIONAL DE ENERGIA NUCLEAR DIRETORIA DE Nacional de Energia Nuclear (CNEN), no uso da atribuição que lhe foi conferida pela Portaria CNEN/PR nº 33

67

Testing the Subsistence Model for the Adoption of Ceramic Technology Among Coastal Sambaqui Foragers of Southern Brazil  

E-Print Network [OSTI]

vessels for elite group members. To test the subsistence model, I conducted a stable carbon and nitrogen isotope analysis and a dental microwear texture analysis using skeletal remains from sambaqui sites located in Santa Catarina and Rio de Janeiro...

Crouch, Maria Shannon Parks

2013-12-10T23:59:59.000Z

68

Brazils Biofuels Scenario: What are the Main Drivers Which will Shape Investments in the Long Term?  

Broader source: Energy.gov [DOE]

Breakout Session 3CFostering Technology Adoption III: International Market Opportunities in Bioenergy Brazils Biofuels Scenario: What are the Main Drivers Which will Shape Investments in the Long Term? Artur Milanez, Manager of Biofuels Department, Brazilian Development Bank

69

BRAZILS QUEST TO ALSO FOSTER WIND ENERGY IN THE DEREGULATED MARKET: WILL IT WORK? Authors:  

E-Print Network [OSTI]

Brazil began fostering wind energy in 2004 through a feed-in incentive program named Proinfa, with limited success. In 2009 wind energy began to be contracted through a series of government auctions within the regulated market, known in Brazil as ACR, with the objective of increasing the current 1.8GW in installed capacity to over 8 GW by 2016.

Marta Corra Dalbem Unigranrio; Luiz Eduardo Teixeira Brando Puc-rio; Leonardo Lima Gomes Puc-rio

70

ForeignForeign DirectDirect InvestmentInvestment inin ArgentinaArgentina andand BrazilBrazil..  

E-Print Network [OSTI]

value chain. In Argentina this trend is even more pronounced. #12;Policy suggestions Although FDI mayForeignForeign DirectDirect InvestmentInvestment inin ArgentinaArgentina andand Brazil in MERCOSUR 1991-2004 (Argentina-Brazil) 2439 2555 2763 3490 5315 6522 8755 7291 23988 10418 2166 2149 1887

71

E-Print Network 3.0 - area se brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Plasma Physics and Fusion 3 Brazil is a major international player in the carbon markets that function under the UN Framework Summary: Brazil is a major international...

72

E-Print Network 3.0 - amazonia brazil physical Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

search results for: amazonia brazil physical Page: << < 1 2 3 4 5 > >> 1 1DANGEROUS CLIMATE CHANGE IN BRAZIL Dangerous Climate Summary: in rainfall over large swathes of...

73

E-Print Network 3.0 - atlantic forest brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

LAW Summary: 3212011 1 BIODIVERSITY AND DEVELOPMENT: EUCALYPTUS & FOREST LAW IN RURAL MINAS GERAIS, BRAZIL... in Brazil. Specializations include: Wood construction,...

74

OAS Support for the Implementation of the US-Brazil Biofuels...  

Open Energy Info (EERE)

Implementation of the US-Brazil Biofuels Bilateral Agreement Jump to: navigation, search Name OAS Support for the Implementation of the US-Brazil Biofuels Bilateral Agreement...

75

Solidarity at the margins : literature, film, and justice in neoliberal Argentina, Brazil and Chile  

E-Print Network [OSTI]

Ricardo Carciofi. Argentina: Social Policy and Adjustmentin Argentina: Postwar Counterrevolutionary Policies anda critique of free market policy in Argentinas and Brazils

Daniels, Jennie Irene

2012-01-01T23:59:59.000Z

76

Opportunities for technological and economic development policy in Brazil  

E-Print Network [OSTI]

Brazil's transformation from an agriculturally-based colonial economy to an industrial republic spans seven decades - from the 1930s to the present - with three rapid growth phases which were each followed by economic and ...

Dalquist, Stephanie K. (Stephanie Kay), 1981-

2005-01-01T23:59:59.000Z

77

An analysis of commercial opportunities between Brazil and Russian Federation  

E-Print Network [OSTI]

This paper begins with the assumption that trade between Brazil and the Russian Federation is underdeveloped. It thus takes the view that there are other product categories, which presents great chances for further development ...

Wiczer, Nicholas Vana Ferenczi Semelman

2013-01-01T23:59:59.000Z

78

N 9, quinta-feira, 12 de janeiro de 2012 17ISSN 1677-7042 Este documento pode ser verificado no endereo eletrnico http://www.in.gov.br/autenticidade.html,  

E-Print Network [OSTI]

: Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES/MEC) Assunto: Aprecia a proposta de://portal.mec.gov.br/cne/). Brasília, 11 de janeiro de 2012. ATAÍDE ALVES Secretário Executivo COORDENA??O DE APERFEI?OAMENTO DE docentes. O Presidente da Coordenação de Aperfeiçoamento de Pes- soal de Nível Superior - Capes, no uso das

Floeter, Sergio Ricardo

79

PHYSICAL REVIEW E 87, 033017 (2013) Wavelet methods to eliminate resonances in the Galerkin-truncated Burgers and Euler equations  

E-Print Network [OSTI]

68528, 21945-970 Rio de Janeiro, Rio de Janeiro, Brazil, Divis~ao de Metrologia em Din^amica de Fluidos, Instituto Nacional de Metrologia, Normalizac¸~ao e Qualidade Industrial, Avenida Nossa Senhora das Grac

?cole Normale Supérieure

80

A special report on physics in Brazil New horizons for  

E-Print Network [OSTI]

of deep offshore oil fields is creating a hub for industrial R&D, while research investment is opening upLLABoRAtions Alltheworld'sastage 25 Extra investment in international projects is opening up new opportunities for BrazilA Womenstillface`leakypipeline' 34 Marcia Barbosa says more women must rise to the top Optics star Katiùscia

Barbosa, Marcia C. B.

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Bioenergy and land-use competition in Northeast Brazil  

E-Print Network [OSTI]

Bioenergy and land-use competition in Northeast Brazil Christian Azar Department of Physical policies are warranted if use of degraded lands for bioenergy plantations is desired. 1. Introduction There are two main categories of bioenergy: residues and dedicated plantations. In this paper, we exclusively

82

Contributed Paper Identification of Areas in Brazil that Optimize  

E-Print Network [OSTI]

biodiversity conservation in tropical countries. We identified municipalities in Brazil that are priorities for the conservation of forest carbon stocks and biodiversity conservation under a range of scenarios with different biodiversity conservation. We concluded that REDD+ strategies could be an efficient tool for biodiversity

Malhi, Yadvinder

83

Our engagement with Brazil Nosso compromisso com o Brasil  

E-Print Network [OSTI]

Our engagement with Brazil Nosso compromisso com o Brasil #12;2 A STRATEGIC PARTNERSHIP A strategic-Chancellor of The University of Nottingham #12;3A STRATEGIC PARTNERSHIP Uma parceria estratégica Nosso compromisso com o Brasil

Birmingham, University of

84

E-Print Network 3.0 - affecting northeastern brazil Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Guy- ana, known as the Guianas-Brazil... of northeastern Brazil, French Guiana, Suriname and Guyana (1975-77). In A. C. Jones and L. Villegas (Editors... working group met in...

85

The point of Corumbau : a case study in emerging market (Brazil) real estate development feasibility analysis  

E-Print Network [OSTI]

In 2003, Renata Oliveira, a young Portuguese architect, has re-discovered the Point of Corumbau in Bahia, Brazil, and, like the Portuguese adventurers who had discovered Brazil 500 years earlier in the same location, found ...

Clayton, Paul B., S.M. Massachusetts Institute of Technology

2007-01-01T23:59:59.000Z

86

Gendering Representation: Parties, Institutions, and the Under-Representation Of Women In Brazil's State Legislatures  

E-Print Network [OSTI]

This dissertation provides insights on what influences women's descriptive representation in state legislatures in Brazil. The study of female representation in Brazil provides for a good case study as the country uses a ...

dos Santos, Pedro G.

2012-12-31T23:59:59.000Z

87

Interannual variability in water storage over 2003-2007 in the Amazon Basin2 from GRACE space gravimetry, in situ river level3  

E-Print Network [OSTI]

Hidrologia, Ilha do Fundão, Zip Code:9 21945-970, Rio de Janeiro-RJ, Brasil , Phone: +552125627837, Fax - 118, Route de Narbonne - F-31062 Toulouse cedex 912 3 CEPEL (Centro de Pesquisa em Energia Eletrica) ­ Av. Horácio Macedo, 354- Cidade Universitária - Ilha13 do Fundão, Rio de Janeiro - RJ - Brasil - Cep

Boyer, Edmond

88

PROPOSAL OF A FINANCING SCHEME FOR A THIRD NPP IN BRAZIL  

SciTech Connect (OSTI)

This presentation discusses a proposal of a financing scheme for a third nuclear power plant in Brazil.

Filho, Z.D.T.

2004-10-06T23:59:59.000Z

89

Surveillance and Control: Legislative Power in Argentina and Brazil* Charles Pessanha**  

E-Print Network [OSTI]

1 Surveillance and Control: Legislative Power in Argentina and Brazil* Charles Pessanha and Control: Legislative Power in Argentina and Brazil "La société a le droit de demander compte à tout agent countries. Key-words: Accountability; External Control; Legislative Power; Brazil; Argentina Introduction

Paris-Sud XI, Université de

90

Call for expression of interest EU-Brazil Technology and Innovation Forum  

E-Print Network [OSTI]

for Brazilian SMEs, Technological Parks and other innovation actors for cooperation with Europe (Tour of BrazilCall for expression of interest EU-Brazil Technology and Innovation Forum Participation to B2B targeting research and innovation actors. Among them, this year the EU-Brazil Technology and Innovation

91

Surface and Subsurface Geochemical Monitoring of an EOR-CO2 Field: Buracica, Brazil  

E-Print Network [OSTI]

Surface and Subsurface Geochemical Monitoring of an EOR-CO2 Field: Buracica, Brazil C. Magnier1, V Monitoring of an EOR-CO2 Field: Buracica, Brazil -- This paper presents a surface and subsurface geochemical survey of the Buracica EOR-CO2 field onshore Brazil. We adopted a methodology coupling the stable

Paris-Sud XI, Université de

92

Nuclear rapprochement in Argentina and Brazil: Workshop summary  

SciTech Connect (OSTI)

On October 21 and 22, 1998, the Center for International Security Affairs at Los Alamos National Laboratory and the Center for Global Security and Cooperation at Science Applications International Corporation hosted the first of a series of work-shops on states that have chosen to roll back their pursuit of nuclear arms. The objective of the workshop series is to conduct a systematic evaluation of the roles played by U.S. nonproliferation policy in cases of nuclear rollback or restraint and to provide recommendations for future nonproliferation efforts based on lessons learned. Key attendees at the workshop included officials and former officials from the foreign ministries of Argentina and Brazil, and current and former officials from the U.S. Department of State, the Arms Control and Disarmament Agency (ACDA), and the Department of Energy (DOE). Scholars and independent researchers who have examined nuclear policy in Argentina and Brazil also participated. This workshop report includes important background information that helps set the stage for assessing nuclear policies in Argentina and Brazil. It describes national perspectives and areas of consensus and debate among the participants, particularly on the questions of lessons learned and their salience to proliferation challenges in other states. It also summarizes key questions and propositions regarding the roles played in these cases by U.S. nonproliferation policy.

James E. Doyle

1999-10-01T23:59:59.000Z

93

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

94

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

95

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

96

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

97

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

98

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

99

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

100

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

102

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

103

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

104

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

105

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

106

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

107

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

108

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

109

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

110

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

111

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

112

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

113

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

114

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

115

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

116

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

117

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

118

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

119

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

120

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

122

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

123

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

124

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

125

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

126

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

127

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

128

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

129

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

130

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

131

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

132

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

133

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

134

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

135

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

136

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

137

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

138

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

139

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

140

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

142

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

143

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

144

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

145

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

146

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

147

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

148

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

149

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

150

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

151

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

152

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

153

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

154

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

155

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

156

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

157

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

158

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

159

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

160

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

162

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

163

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

164

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

165

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

166

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

167

Brazil 1 Buzius and Salvador Brazil is one of those countries that have a very distinctive feel and a vivid image. Each one  

E-Print Network [OSTI]

Brazil 1 ­ Buzius and Salvador Brazil is one of those countries that have a very distinctive feel-Ipanema-Corcovado- poverty-favelas, Salvador-Bahia-Dona Flor-Jorge Amado, sensual food, amazing variety of tropical fruits the energy to figure out how to reverse the order) Salvador ­ Happy City Salvador ­ the first capital

Beimel, Amos

168

Conservation potential of compact fluorescent lamps in India and Brazil  

SciTech Connect (OSTI)

We evaluate the conservation potential of compact fluorescent lamps (CFLs) for managing the rapidly increasing electrical energy and peak demand in India and Brazil. Using very conservative assumptions, we find that the cost of conserved energy using 16 W CFLs is 4 and 6 times less than the long range marginal cost of electricity for the two countries. The cost of avoided peak installed capacity is 6 and 9.5 times less than the cost of new installed capacity for India and Brazil. The analysis is undertaken from the three separate perspectives of the national economies, the consumers, and the utilities. We find that because residential electricity is subsidized, the consumers have little or no incentive to purchase and install the CFLs, unless they too are subsidized. However, the benefits of CFL installation to the utility are so large that subsidizing them is a paying proposition for the utility are so large that subsidizing them is a paying proposition for the utility in almost all cases. As an illustration of a gradual introduction strategy for CFLs, we calculate a scenario where national savings of the order of US $1.2 million per day for India and US $2.5 million per day for Brazil are reached in 10 years by a small and gradual transfer of subsidy from residential electricity to CFLs. We then explore the barriers to immediate large scale introduction of these lamps in the two countries. Specific technical and marketing problems are identified and discussed, which would require solution before such an introduction can be attempted. Lastly, we discuss the range of policy instruments, in addition to a subsidy scheme, that can be used for promoting the diffusion of these lamps in the domestic and commercial sector. 47 refs., 15 figs., 2 tabs.

Gadgil, A.; Martino Jannuzzi, G. de (Lawrence Berkeley Lab., CA (USA); Universidade Estadual de Campinas, SP (Brazil). Faculdade de Engenharia)

1989-07-01T23:59:59.000Z

169

Brazil-CCAP Developing Country Project | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump to: navigation,Brazil-Developing

170

Brazil-US EPA Environmental Management Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and Name Brazil-US EPA

171

Brazil-US Lab Consortium Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and Name Brazil-US EPA

172

Brazil-USAID Climate Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and Name Brazil-US

173

Biofuel Research at Brazil Center of Excellence | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCouldBiofuel Research at Brazil Center of

174

Genetic and environmental factors affecting growth and reproduction characters of Morada Nova sheep in Northeastern Brazil  

E-Print Network [OSTI]

concern in sheep produc- tion in Northeast Brazil are meat and skins. Despite the overwhelming social and economic importance of sheep production in Northeast Brazil, it is still practiced, on the average, through a very extensive and traditional... in the systems employed in that area of Brazil. This study involved an analysis of body weight records up to 12 months age and records of reproduction from a Morada Nova sheep flock maintained under grazing pasture conditions from 1979 to 1983 at the Fazenda...

Fernandes, Antonio Amaury Oria

1985-01-01T23:59:59.000Z

175

E-Print Network 3.0 - amazon central brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and distribution ISSN 1809-127X (online edition) Summary: , French Guyana, Peru, Suriname and Venezuela. In Brazil, Amazon includes Tropical Rain Forest areas... stictoides...

176

E-Print Network 3.0 - amapa state brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Natural History (USNM). Distributions of se- renaand... - name), to the interior of Suriname and French Guiana, southto near Manaus, Brazil and south- em Amapl... the range of...

177

E-Print Network 3.0 - aracaju northeast brazil Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alain - Laboratoire Geosciences, Universit Montpellier II Collection: Geosciences 22 Bioenergy and land-use competition in Northeast Brazil Summary: Bioenergy and land-use...

178

E-Print Network 3.0 - andre sp brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de So Paulo Collection: Mathematics 68 REGISTRATION NOW OPEN 6th Frontiers in Bioenergy Summary: ), Purdue University Dr. Andr Nassar, CEO of ICONE, SP, Brazil Dr....

179

E-Print Network 3.0 - amazon state brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

"Logging in Brazilian Amazon: production, revenues and markets" (A ... Source: Louisiana Forest Products Development Center Collection: Renewable Energy 3 Brazil closes down...

180

E-Print Network 3.0 - alagoas northeast brazil Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Grenoble-I Collection: Mathematics 33 Resource Assessment of Three Candidate Biomass Feedstocks for Hydrogen Production Summary: . Brazil, India, and the People's Republic of...

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

E-Print Network 3.0 - angra brazil applications Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Physics 45 Atualizado em 11052010. CURRICULUM VITAE Summary: Spaces". Summer School on Enviromental Modelling of Amazonia, Angra dos Reis, Brazil, Abril de 2005. 12......

182

E-Print Network 3.0 - australia brazil canada Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Commerce Placement Report -Class of 2010 Summary: Australia International Brazil China Egypt Japan Singapore Taiwan United States United Kingdom... 'sBachelorofCommerceisafour-yea...

183

E-Print Network 3.0 - activityin southern brazil Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biology and Medicine 32 Dr. David Kemp Australian Minister of Summary: - Southern StatesThailand - sustainable industry development - Southern StatesBrazil - clean coal power......

184

E-Print Network 3.0 - amazonas state brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Capanaparo, Cinaruco, Caura and Casiquiare in Apure, Bolivar and Amazonas states of Venezuela... in Monagas state, Venezuela, and the upper Ro Negro in Brazil that probably are...

185

Renewable energy in Brazil: opportunities, barriers, and remedies  

SciTech Connect (OSTI)

An overview of the major conclusions is presented according to the goals of the study; and contents of the various chapters of the report are outlined. All major energy planning organizations in Brazil at the federal and state level perceive an urgent need for petroleum substitution by means of energy-efficient technology, coal, hydroelectricity, biomass, solar, and wind. Technologies and applications considered of high priority for US/Brazilian cooperative efforts are the following: Energy-efficient technology, used with indigenous hydroelectricity, especially heat pumps to provide (1) low temperature hot water for industrial applications, and (2) air conditioning and hot water for residential and commercial applications; solar thermal technology for low and intermediate temperature industrial process heat, and for crop drying; and small wind turbines and photovoltaic power systems for irrigation pumping and other rural applications. Certain technologies were excluded from the scope of the study by mutual agreement because a great deal of activity in such technologies was already taking place in Brazil, or because commercialization prospects seemed remote, or because of regulatory barriers. Energy conversion systems employing biomass, small- and large-scale hydropower, ocean thermal energy gradients, and cogeneration systems are not examined.

Jhirad, D.J.; Rutter, W.

1982-03-01T23:59:59.000Z

186

Preliminary assessment of potential CDM early start projects in Brazil  

SciTech Connect (OSTI)

The Brazil/US Aspen Global Forum on Climate Change Policies and Programs has facilitated a dialogue between key Brazil and US public and private sector leaders on the subject of the Clean Development Mechanism (CDM). With support from the US government, a cooperative effort between Lawrence Berkeley National Laboratory and the University of Sao Paulo conducted an assessment of a number of projects put forth by Brazilian sponsors. Initially, we gathered information and conducted a screening assessment for ten projects in the energy sector and six projects in the forestry sector. Some of the projects appeared to offer greater potential to be attractive for CDM, or had better information available. We then conducted a more detailed assessment of 12 of these projects, and two other projects that were submitted after the initial screening. An important goal was to assess the potential impact of Certified Emission Reductions (CERs) on the financial performance of projects. With the exception of the two forestry-based fuel displacement projects, the impact of CERs on the internal rate of return (IRR) is fairly small. This is true for both the projects that displace grid electricity and those that displace local (diesel-based) electricity production. The relative effect of CERs is greater for projects whose IRR without CERs is low. CERs have a substantial effect on the IRR of the two short-rotation forestry energy substitution projects. One reason is that the biofuel displaces coke and oil, both of which are carbon-intensive. Another factor is that the product of these projects (charcoal and woodfuel, respectively) is relatively low value, so the revenue from carbon credits has a strong relative impact. CERs also have a substantial effect on the NPV of the carbon sequestration projects. Financial and other barriers pose a challenge for implementation of most of the projects. In most cases, the sponsor lacks sufficient capital, and loans are available only at high interest rate and with substantial guarantee. A few of the projects might go ahead without the benefit of CERs, but most probably would not. Whether the projected revenue from CERs would be sufficient to induce sponsors to proceed with the projects is an important issue that requires further investigation. All of the projects contribute to economic development in Brazil. The forestry projects in particular would create a significant number of rural jobs, and contribute income to rural communities. Some of the carbon sequestration projects would provide environmental benefits with respect to protection of biodiversity and soil.

Meyers, S.; Sathaye, J.; Lehman, B.; Schumacher, K.; van Vliet, O.; Moreira, J.R.

2000-11-01T23:59:59.000Z

187

The Caribbean spiny lobster, Panuli-rus argus, is distributed from Brazil  

E-Print Network [OSTI]

870 The Caribbean spiny lobster, Panuli- rus argus, is distributed from Brazil throughout the Caribbean and the Gulf of Mexico to approximately North Car- olina and Bermuda (Holthius, 1991). It supports major commercial fisheries in Florida, the Caribbean and Brazil. Commercially, P. argus is especially

188

Developing Financial Intermediation Mechanisms for Energy Efficiency Investments in Brazil, China and India  

E-Print Network [OSTI]

· financing, renewables and efficiency, institutional reform, energy access and rural energy, and general1 Developing Financial Intermediation Mechanisms for Energy Efficiency Investments in Brazil, China and India Brazil-China-India Workshop on Energy Efficiency Financing Cross country exchange, outreach

189

. International Conference on Nuclear Knowledge Management INAC 2005 international Conference on Nuclear Knowledge Management, INAC 2005, Santos (Brazil)  

E-Print Network [OSTI]

Institute (IPEN-Brazil) barroso@ipen.br c Ph D., Head of Information Science Department Telecommunication Nuclear Atlantic Conference, Santos : Brazil (2005)" #12;R. I. RICCIARDI, A. C. O. BARROSO and J. O. BARROSO and J.-

Paris-Sud XI, Université de

190

Intergenerational mobility in earnings in Brazil spanning three generations and optimal investment in electricity generation in Texas  

E-Print Network [OSTI]

This dissertation contains three essays. The first and second essays examine intergenerational mobility in earnings in Brazil using a data set spanning three generations. I use data from PNAD{a nationally representative household survey in Brazil. I...

Marchon, Cassia Helena

2008-10-10T23:59:59.000Z

191

Methanol market slowly tightens as Brazil starts soaking up material  

SciTech Connect (OSTI)

Although the US methanol market's response to mandated oxygen requirements in reformulated gasoline has been disappointing, the European market has surprisingly been tightening in recent weeks and looks set for a price rise in first-quarter 1993. The tightness is being felt mainly in the Mediterranean market, where the Libyan methanol plant is running at only 70% because of problems with gas feedstock supplies. More significantly, the Brazilian government has now given the go-ahead for a yearlong extension on imports of methanol for use as an ethanol replacement in fuel blending. The new authorization sets a monthly import limit of 48,000 m.t. during that period. Libya is an important supplier of methanol to the Brazilian market and has already shipped about 20,000 m.t. since the authorization was given. Another major supplier to Brazil is Russia, from its two giant 750,000-m.t./year plants at Gubakha and Tomsk. The material is shipped from the terminal at Yuzhnyy on the Black Sea, in Ukrainian territory since the collapse of the Soviet Union.

Young, I.

1992-11-25T23:59:59.000Z

192

THE IMPACT OF THE GLOBAL NUCLEAR SAFETY REGIME IN BRAZIL  

SciTech Connect (OSTI)

A turning point of the world nuclear industry with respect to safety occurred due to the accident at Chernobyl, in 1986. A side from the tragic personal losses and the enormous financial damage, the Chernobyl accident has literally demonstrated that ''a nuclear accident anywhere is an accident everywhere''. The impact was felt immediately by the nuclear industry, with plant cancellations (e.g. Austria), elimination of national programs (e.g. Italy) and general construction delays. However, the reaction of the nuclear industry was equally immediate, which led to the proposal and establishment of a Global Nuclear Safety Regime. This regime is composed of biding international safety conventions, globally accepted safety standard, and a voluntary peer review system. In a previous work, the author has presented in detail the components of this Regime, and briefly discussed its impact in the Brazilian nuclear power organizations, including the Regulatory Body. This work, on the opposite, briefly reviews the Global Nuclear Safety Regime, and concentrates in detail in the discussion of its impact in Brazil, showing how it has produced some changes, and where the peer pressure regime has failed to produce real results.

Almeida, C.

2004-10-06T23:59:59.000Z

193

E-Print Network 3.0 - america brazil leads Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

China's deliveries to USA jumped by 50%, Brazil equally strong, and Indonesia gains markets... in Germany and the UK Profiled wood imports run steady, the US is the leading...

194

All that glitters is not gold : unexpected lessons from a slum upgrading program in Brazil  

E-Print Network [OSTI]

This paper looks at the Ribeira Azul Slum Upgrading Program in Salvador de Bahia Brazil, implemented by the development agency of the state of Bahia, CONDER, and the Italian NGO Associazione Volontari per il Servizio ...

Zuin, Valentina

2005-01-01T23:59:59.000Z

195

E-Print Network 3.0 - alegre rs brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Sample search results for: alegre rs brazil Page: << < 1 2 3 4 5 > >> 1 Curriculum Vitae Ana M. R. Liedke Summary: Mdio "Dolores Alcaraz Caldas" - 2004 , Porto Alegre,...

196

MINERALOGY AND GENESIS OF SMECTITES IN AN ALKALINE-SALINE ENVIRONMENT OF PANTANAL WETLAND, BRAZIL  

E-Print Network [OSTI]

MINERALOGY AND GENESIS OF SMECTITES IN AN ALKALINE-SALINE ENVIRONMENT OF PANTANAL WETLAND, BRAZIL of this work was to investigate the mineralogy of smectites in the soils surrounding a representative alkaline

Ahmad, Sajjad

197

Mineralogy of Latosols along a regional toposequence across the Central Plateau (Brazil): First results.  

E-Print Network [OSTI]

Mineralogy of Latosols along a regional toposequence across the Central Plateau (Brazil): First results of the mineralogical characterization of Brazilian Latosols located along a regional topossequence estimated using the soil color (hue, value and chrome). The mineralogical composition of the

Paris-Sud XI, Universit de

198

On the use of Chandrasekhar's basis for helium and its isoelectronic Marcia T. Foytenelle  

E-Print Network [OSTI]

Laboratbrio de Optica Qu&tica da UFSC, 88049 Florianbpolis, Brazil and Departamento de Fkica da PVC, 22451 Rio de Janeiro, Brazil Jason A. C. qallas Laboratbrio de Optica Qu&tica da UFSC, 88049 Florianbpolis

Gallas, Jason

199

Affirmative Action in Higher Education and Afro-Descendant Women in Bahia, Brazil  

E-Print Network [OSTI]

excluded from the 34 Fay Haussman and Jerry Haar in Education in Brazil, 1978: 30-31. 20 labor market and replaced by European immigrants. Afro-descendants were widely marginalized... 35 Nascimento, 2007: 52-53 and Jones-Oliveira, 2003: 103 36 Fay Haussman and Jerry Haar in Education in Brazil, 1978: 33. 21 status, black women were determined to change their positions as economic possessions and to gain their citizenship...

Aubel, Maraci G.

2011-05-31T23:59:59.000Z

200

Julia van Drunen has been granted a FAPESP postdoctoral fellowship to pursue research at the Universidade de So Paulo (USP) in Brazil. The proposed research focuses on the  

E-Print Network [OSTI]

. This research project fits in well with Brazil's booming biofuel industry and the global initiative towards

Abolmaesumi, Purang

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Theatre in Rio de Janeiro, 1968  

E-Print Network [OSTI]

, and that again produced some more very good songs). The set, incidentally, was designed by the architect Oscar Niemeyer, creator of all the buildings in Brasilia. The next to use it, in a much more Brechtian sense, was Augusto Boal in Sao Paulo, with his...

Heliodora, Barbara

1969-10-01T23:59:59.000Z

202

From International Idea to Domestic Policy: Explaining the Emergence of Same-Sex Partnership Recognition in Argentina and Brazil  

E-Print Network [OSTI]

into domestic policy in Argentina and Brazil. It begins byConstructing Policy Innovation in Argentina: From GenderNot Possible Argentina DV: Possible SSPR Policy Adoption In

Schulenberg, Shawn Richard

2010-01-01T23:59:59.000Z

203

Role of fault rejuvenation in hydrocarbon accumulation and structural evolution of Reconcavo Basin, Northeastern Brazil  

SciTech Connect (OSTI)

From a geometric analysis of the fault pattern in the Reconcavo basin, Brazil, supported by a reinterpretation of the early opening history of the South Atlantic Ocean, it is inferred that the basin formed as a result of Valanginian (Early Cretaceous) motion on a major N40/sup 0/E-striking left-lateral transform fault located offshore between Salvador and Recife. This left-lateral motion was due to the location of the Valanginian pole of South American - African plate rotation within northern Brazil, at 2.5 /sup 0/S, 45.0/sup 0/W, rather than farther north as interpreted previously. 13 figures, 2 tables.

Cohen, C.R.

1985-12-01T23:59:59.000Z

204

Private governance in royalty collection Effectiveness and limitations in tracing GM soybean in Brazil  

E-Print Network [OSTI]

Private governance in royalty collection Effectiveness and limitations in tracing GM soybean the implementation of a new Project called GICOGM1 . 2. Institutional innovation in royalties collection in Brazil simply called "royalties" in the country. In the opposite of the common fee recovery system2 , Monsanto

Paris-Sud XI, Université de

205

Short-rotation eucalypt plantations in Brazil: Social and environmental issues  

SciTech Connect (OSTI)

This report presents an overview of the historical and current legislative, social, and environmental aspects of the establishment of large-scale eucalypt plantations in Brazil. The report consolidates the vast experience and knowledge relating to these forest plantation systems and highlights lessons learned and new trends. The overview should prove useful to those interested in comparing or beginning similar endeavors.

Couto, L. [Universidade Federal de Vicosa, Minas Gerais (Brasil). Dept. de Engenharia Florestal; Betters, D.R. [Colorado State Univ., Fort Collins, CO (United States). Dept. of Forest Sciences

1995-02-01T23:59:59.000Z

206

POLITICAL SCIENCE 2013 SCHOLARSHIP APPLICATION (Includes Alumni, Brazil, Francis, Glickman, Hubbard, Young, and Rinn Scholarships)  

E-Print Network [OSTI]

POLITICAL SCIENCE 2013 SCHOLARSHIP APPLICATION (Includes Alumni, Brazil, Francis, Glickman, Hubbard. _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ _____________________________________________________________________________________ Please have a member of the SJSU Political Science faculty who is willing to provide a reference sign this application. Faculty sponsor's signature: Applicant's signature: You can apply for as many Political Science

Su, Xiao

207

O P I N I O N Ethanol from sugarcane in Brazil: a `midway' strategy for  

E-Print Network [OSTI]

O P I N I O N Ethanol from sugarcane in Brazil: a `midway' strategy for increasing ethanol of Illinois, Urbana, IL 61801, USA Abstract This article reviews the history and current state of ethanol. We propose that it is possible to produce ethanol from sugarcane while maintaining or even recovering

DeLucia, Evan H.

208

Long-Term Mitigation Strategies and Marginal Abatement Cost Curves: A Case Study on Brazil  

E-Print Network [OSTI]

Long-Term Mitigation Strategies and Marginal Abatement Cost Curves: A Case Study on Brazil Adrien abatement targets need to decide which abatement mea- sures to implement, and in which order. This paper investigates the ability of marginal abatement cost (MAC) curves to inform this decision, reanalyzing a MAC

Paris-Sud XI, Université de

209

Technology transfer by CDM projects: a comparison of Brazil, China, India and Mexico  

E-Print Network [OSTI]

Technology transfer by CDM projects: a comparison of Brazil, China, India and Mexico Antoine (Dechezleprêtre et al., 2008), we gave a general description of technology transfers by CDM projects and we important role in facilitating international technology transfers through the CDM. International transfers

210

A simplified physical model for assessing solar radiation over Brazil using GOES 8 visible imagery  

E-Print Network [OSTI]

A simplified physical model for assessing solar radiation over Brazil using GOES 8 visible imagery; published 30 January 2004. [1] Solar radiation assessment by satellite is constrained by physical Composition and Structure: Transmission and scattering of radiation; KEYWORDS: solar radiation, satellite

211

The social determinants of female employment in Brazil: an analysis of the service sector in 1950  

E-Print Network [OSTI]

in women's labor force participation in Brazil have focused mainly in the secondary sector. Most of these studies did not emphasize the process of occupational sex typing within the tertiary sector, which has been always a noteworthy employment area... responsibilities and family commitments motivate women to select jobs from a relatively restricted range. These theorists suggest that women will be more likely to move into employment areas where the demand for firm-specific human capital is low. Those...

Simao, Andrea Branco

1999-01-01T23:59:59.000Z

212

U.S. and Brazil Bilateral Collaboration on Biofuels | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: AlternativeEnvironment,Institutes and1TeleworkAgriculture U.S. DepartmentofDepartmentand Brazil

213

The local knowledge bank : uncovering the processes and networks of social innovation at Brazil's first community bank  

E-Print Network [OSTI]

In this thesis, I apply a case study method to examine the processes of knowledge management both within the neighborhood, and in institutional partnerships, by Banco Palmas, Brazil's first community development bank, as ...

Gao, Ying, M.C.P. Massachusetts Institute of Technology

2014-01-01T23:59:59.000Z

214

Circulation of Different Lineages of Dengue Virus 2, Genotype American/Asian in Brazil: Dynamics and Molecular and Phylogenetic Characterization  

E-Print Network [OSTI]

The American/Asian genotype of Dengue virus type 2 (DENV-2) was introduced into the Americas in the 80?s. Although there is no data showing when this genotype was first introduced into Brazil, it was first detected in ...

Drumond, Betnia Paiva

215

UNIVERSIT DE NICE -SOPHIA-ANTIPOLIS  

E-Print Network [OSTI]

UNIVERSIT? DE NICE - SOPHIA-ANTIPOLIS ?COLE DOCTORALE DES SCIENCES ET TECHNOLOGIES DE L COMPUTA??O P H D T H E S I S to obtain the title of Docteur en Sciences de l'Université de Nice - Sophia. Federal do Rio de Janeiro (Rio de Janeiro, Brazil) Examinators: David Coudert - Univ. Nice Sophia

Paris-Sud XI, Université de

216

Protein Science (1998),7:2301-2313.CambridgeUniversityPress.Printed in the USA. Copyright 0 1998TheProteinSociety  

E-Print Network [OSTI]

Federal do Espirito Santo, Vitoria, ES, 29060-900,Brazil 3Departamento de Fisico-Quimica, Instituto de Quimica, Universidade Federal do Rio de Janeiro, 21949-900. 4Departamento de Bioquimica, Instituto de Quimica, Universidade Federal do Rio de Janeiro, 21949-900. California Institute of Technology, Pasadena

Goddard III, William A.

217

Sulfur determination in blood from inhabitants of Brazil using neutron activation analysis  

SciTech Connect (OSTI)

In this study the NAA technique was applied to analyze sulfur in blood from inhabitants of Brazil for the proposition of an indicative interval. The measurements were performed considering lifestyle factors (non-smokers, non-drinkers and no history of toxicological exposure) of Brazilian inhabitants. The influence of gender was also investigated considering several age ranges (18-29, 30-39, 40-49, >50 years). These data are useful in clinical investigations, to identify or prevent diseases caused by inadequate sulfur ingestion and for nutritional evaluation of Brazilian population.

Oliveira, Laura C.; Zamboni, Cibele B. [Instituto de Pesquisas Energeticas e Nucleares (IPEN-CNEN/SP) Av. Professor Lineu Prestes 2242 05508-000 Sao Paulo, SP (Brazil)

2013-05-06T23:59:59.000Z

218

Liquefied U.S. Natural Gas Exports to Brazil (Million Cubic Feet)  

Gasoline and Diesel Fuel Update (EIA)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) " ,"ClickPipelines About U.S.30Natural Gas Glossary529 6330 0 14343 342 328 370 396After8986Brazil (Million

219

Brazil-GTZ Renewable Energy and Energy Efficiency Programme | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump to:Information Name Brazil-GTZ

220

Sabine Pass, LA Exports to Brazil Liquefied Natural Gas (Million Cubic  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet) Brazil Liquefied Natural Gas

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

U.S. and Brazil Launch Strategic Energy Dialogue | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. of Energy, Office ofNuclear WeaponstoU.S.0:WindofBrazil

222

03/06/13 13:03Ovid: Jet-like features near the nucleus of Chiron. Page 1 sur 6http://ovidsp.tx.ovid.com.biblioplanets.gate.inist.fr/sp-3.8.1a/ovidweb.cgi  

E-Print Network [OSTI]

.; Gilmore, D. K.; Kurtz, D.; Lazzaro, D.; Rank, D. M.; Temi, P.; Bandyopadhyay, R. M.; Barroso, J.; Barucci, 20921 Rio de Janeiro, Brazil (D. Lazzaro, J. Barroso, D. Lopes); Observatoire de Paris, 92195 Meudon

Demoulin, Pascal

223

Tropical Forests in the Anthropocene  

E-Print Network [OSTI]

for Sustainability, Rio de Janeiro, 22460-320, Brazil 5 Center for Energy, Environment, and Sustainability Stockholm Environment Institute, Stockholm 104 51, Sweden; email: toby.gardner@sei-international.org 3

Goldsmith, Greg

224

How Are We Doing? A Self-Assessment of the Quality of Services and Systems at NERSC, 2005-2006  

E-Print Network [OSTI]

Rio de Janeiro, Brazil. LBNL-58243. R. Ryne, D. Abell, A.WA. http://www-library.lbl.gov/docs/LBNL/574/93/PDF/LBNL-57493.pdf LBNL-57500. J. A. Greenough, B. R. de Supinski, R.

Kramer, William T.C.; Hules, John

2007-01-01T23:59:59.000Z

225

A Redistributed Proximal Bundle Method for Nonconvex Optimization  

E-Print Network [OSTI]

Mar 31, 2009 ... CEPEL, Electric Energy Research Center, Rio de Janeiro, Brazil. On leave from INRIA ... value of the linearization error (see [30] for a general study on this subject). In this work we ...... World Scientific Publishing Co. Inc.,.

2009-03-31T23:59:59.000Z

226

Natural Gas Politics in the Southern Cone : A comparative study of goal attainment in the gas sector in Argentina, Bolivia and Brazil.  

E-Print Network [OSTI]

??The Southern Cone region consists of the six southernmost countries in South America. Three of these countries, Argentina, Bolivia and Brazil have great natural gas (more)

Aamodt, Solveig

2010-01-01T23:59:59.000Z

227

{sup 222}Rn Measurements at Federal University of Technology (UTFPR, Curitiba, PR, Brazil)  

SciTech Connect (OSTI)

Numerous studies and reports indicate that the indoor radon inhalation by humans has to be considered as the main source of radiological hazard and probably the second most important cause of lung cancer after that of smoking. During the last decades, many countries have put considerable efforts into direct measurements and monitoring of {sup 222}Rn and its progeny exposure, as well as {sup 222}Rn concentration mapping. Present measurements were performed with an aim to study possible correlation between used construction materials and {sup 222}Rn indoor concentration levels. For this purpose, 50 Lexan track detectors were exposed in the air (indoor as well as outdoor) during two months (June and July) within the central region of Curitiba and Campo Largo (Parana St., Brazil). Since this period of the year is usually rather cold in the South of Brazil, exposition time was chosen to prevent possible saturation of alpha tracks. The second step of measurements was performed during the months of November, December and January, when 50 Lexan track detectors were exposed in the air (indoor and outdoor) within the same urban area. Achieved results are being compared with other experimental data.

Correa, Janine Nicolosi; Paschuk, Sergei A.; Fior, Loriane; Schelin, Hugo R.; Flores da Silva, Ruben D.; Poettker, Fabiana [Federal University of Technology-Paran, UTFPR, Av. Sete de Setembro, 3165, Curitiba, PR, 80230-901 (Brazil); Paula Melo, Vicente de [Institute of Radioprotection, IRD, CNEN, Av. Salvador Allende, Rio de Janeiro, RJ (Brazil)

2008-08-07T23:59:59.000Z

228

Economic and Non-proliferation Policy Considerations of Uranium Enrichment in Brazil and Argentina  

SciTech Connect (OSTI)

The nuclear development programs of both Argentina and Brazil have, since the 1970s, been premised on the desire for self-sufficiency and assurance of nuclear fuel supply. While military rivalry and mutual distrust led to nuclear weapons related development programs in the 1970s and 1980s, both countries have since terminated these programs. Furthermore, the governments of both countries have pledged their commitment to exclusively non-explosive use of nuclear energy and have signed the Non Proliferation Treaty (NPT). Utilizing rights provided for under the NPT, both Argentina and Brazil have nuclear fuel production facilities, with the notable exception of enrichment plants, that provide much of the current indigenous fuel requirements for their nuclear power plants. However, both countries are actively developing enrichment capability to fill this gap. The purpose of this report is to assess the economic basis and non-proliferation policy considerations for indigenous enrichment capability within the context of their desired self-sufficiency and to evaluate possible United States Government policy options.

Short, Steven M.; Phillips, Jon R.; Weimar, Mark R.; Mahy, Heidi A.

2008-09-01T23:59:59.000Z

229

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

230

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

231

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

232

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

233

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

234

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

235

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

236

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

237

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

238

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schfer, Eberhard

239

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

240

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

242

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

243

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

244

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

245

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

246

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

247

POTENTIAL AND FUTURE TRENDS ON INDUSTRIAL RADIATION PROCESSING TECHNOLOGY APPLICATION IN EMERGING COUNTRY - BRAZIL  

SciTech Connect (OSTI)

Brazil started the use of radiation technology in the seventies on crosslinking polyethylene for insulation of wire and electronic cables and sterilization of medical care devices. The present status of industrial applications of radiation shows that the use of this technology is increasing according to the economical development and the necessity to become the products manufactured in the local industries competitive in quality and price for internal and external market. The on going development activities in this area are concentrated on polymers processing (materials modification), foodstuff treatment and environmental protection. The development, the promotion and the technical support to consolidate this technology to the local industries is the main attribution of Institute for Energetic and Nuclear Research-IPEN, a governmental Institution.

Sampa, M.H.O.; Omi, N.M.; Rela, C.S.; Tsai, D.

2004-10-06T23:59:59.000Z

248

Studying Brazil-Nut Effect History Line using Disk-Formed Objects, Scanner, and Web Browser  

E-Print Network [OSTI]

Grains configuration snapshots of Brazil-nut effect (BNE) in two-dimension are physically modeled using disk-formed objects, e.g., buttons and magnetic pin. These BNE configurations are artificially designed to mimic the real ones observed in experiments. A computer scanner is used to capture the configurations. Obtained images are then digitized using web browser running a HTML equipped with a JavaScript code, which is built mainly only for this work. From digitization process all grains positions (granular bed and intruder) are obtained, which is later analyzed using the simplest model, i.e., potential energy. Since the minimum energy principle (MEP) suggests that a closed system should go to its state with minimum internal energy, our BNE system must also obey it. Evolution of only the intruder seems to violate MEP but not for the whole system. Grains compaction plays important role, so that the system can achieve its configuration with minimum potential energy.

Sparisoma Viridi; Siti Nurul Khotimah; Novitrian; Widayani; Luman Haris; Dimas Praja Purwa Aji

2014-08-07T23:59:59.000Z

249

Atmospheric Radiation Measurement (ARM) Data from Manacapuru, Brazil for the Green Ocean Amazon (GOAMAZON) Field Campaign  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The Amazon rain forest in Brazil is the largest broadleaf forest in the world, covering 7 million square kilometers of the Amazon Basin in South America. It represents over half of the planets remaining rain forests, and comprises the most biodiverse tract of tropical rain forest on the planet. Due to the sheer size of the Amazon rain forest, the area has a strong impact on the climate in the Southern Hemisphere. To understand the intricacies of the natural state of the Amazon rain forest, the Green Ocean Amazon, or GOAMAZON, field campaign is a two-year scientific collaboration among U.S. and Brazilian research organizations. They are conducting a variety of different experiments with dozens of measurement tools, using both ground and aerial instrumentation, including the ARM Aerial Facility's G-1 aircraft. For more information on the holistic view of the campaign, see the Department of Energys GOAMAZON website. As a critical component of GOAMAZON, the ARM Mobile Facility (AMF) will obtain measurements near Manacapuru, south of Manaus, Brazil, from January to December 2014. The city of Manaus, with a population of 3 million, uses high-sulfur oil as their primary source of electricity. The AMF site is situated to measure the atmospheric extremes of a pristine atmosphere and the nearby cities pollution plume, as it regularly intersects with the site. Along with other instrument systems located at the Manacapuru site, this deployment will enable scientists to study how aerosol and cloud life cycles are influenced by pollutant outflow from a tropical megacity.

250

INCT FOR CLIMATE CHANGE | 2009.2010 | ACTIVITY REPORT | BRAzIL National Institute of Science and  

E-Print Network [OSTI]

1 INCT FOR CLIMATE CHANGE | 2009.2010 | ACTIVITY REPORT | BRAzIL National Institute of Science and Technology for Climate Change December 2010 ISSN 2179-5754 #12;2 Overall coordination Carlos Programa FAPESP de Pesquisa sobre Mudanças Climáticas Globais Executive Board of INCT for Climate Change

251

Dynamic Analysis of Moisture Transport Through Walls and Associated Cooling Loads in the Hot/Humid Climate of Florianopolis, Brazil  

E-Print Network [OSTI]

on sunny and cloudy days. The weather used was a hot/humid summer period in Florian6polis (South Brazil). It is shown that neglecting moisture migration or assuming that the physical properties of wall materials do not depend on moisture content can result...

Mendes, N.; Winkelmann, F. C.; Lamberts, R.; Philippi, P. C.; Da Cunha, Neto, J. A. B.

1996-01-01T23:59:59.000Z

252

UV degradation of hdpe and pvc geomembranes in laboratory exposure So Paulo State University (UNESP) -Ilha Solteira (Brazil)  

E-Print Network [OSTI]

UV degradation of hdpe and pvc geomembranes in laboratory exposure Lodi, P.C. São Paulo State (Brazil) Zornberg, J.G. University of Texas (UT) at Austin (USA) Keywords: UV degradation, weathering, geomembranes, mechanical properties ABSTRACT: This article evaluates the effects of UV degradation in HDPE

Zornberg, Jorge G.

253

Geophysical modeling of two willemite deposits, Vazante (Brazil) and Beltana (Australia) Richard A. Krahenbuhl* and Murray Hitzman  

E-Print Network [OSTI]

of ore bodies or through imaging of associated hydrothermal alteration. Introduction Due to recent technological advances in developing solvent-extraction and electro-winning processes for treatment of zinc by conventional processing techniques and geophysical inversion. Vazante deposit in Brazil The Vazante willemite

254

CFL Labeling Harmonization in the United States, China, Brazil andELI Member Countries: Specifications, Testing, and MutualRecognition  

SciTech Connect (OSTI)

This report examines critical differences among energy-efficient labeling programs for CFLs in Brazil, China, the United States, and the seven members of the international Efficient Lighting Initiative (ELI) in terms of technical specifications and test procedures, and review issues related to international harmonization of these standards.

Fridley, David; Lin, Jiang; Denver, Andrea; Biermayer, Peter; Dillavou, Tyler

2005-07-20T23:59:59.000Z

255

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

256

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

257

Cadmium concentrations in blood of children living near a lead smelter in Bahia, Brazil  

SciTech Connect (OSTI)

A prevalence study of cadmium absorption was carried out among 396 children aged 1 to 9 years living at less than 900 m from a primary lead smelter in Santo Amaro City, northeast Brazil. Geometric mean and geometric standard deviation of cadmium concentrations in blood (CdB) were 0.087 and 2.5 mumole/liter, respectively, ranging from 0.004 to 0.511 units. Ninety-six per cent of these children presented CdB higher than 0.0089 mumole/liter (or 1.0 microgram/liter) which is usually taken as a reference level. Higher CdB levels were significantly associated with shorter distance from child's home to smelter chimney, residence time in the area greater than 7 months, racial groups Light and Medium, and heavy infection by hookworm. The variation in CdB levels was not associated with child's age, nutritional status, iron status, family per capita income, blood lead level, being a child of a lead worker, the habit of pica, and contamination of child's peridomiciliar environment by smelter dross.

Carvalho, F.M.; Tavares, T.M.; Silvany-Neto, A.M.; Lima, M.E.; Alt, F.

1986-08-01T23:59:59.000Z

258

Energy-substitution in the paper industry in Brazil: A translog function approach  

SciTech Connect (OSTI)

Unlike the majority of studies, this study focuses at the micro level instead of the aggregate. The method employed involves the use of econometric techniques to estimate translog cost and production functions, and the estimation of the Allen Elasticities of Substitution (AES) from the coefficients. The data used come from firms in the paper industry of Brazil during January, 1982 to December, 1987. When using aggregated data, findings concerning energy-capital substitution are often controversial. Some authors find substitutability, while others find complementarity between energy and capital. This study found that this ambiguity also appears at the micro level. Even when the firms belong to the same industry, two inputs can be complements in one firm and substitutes in another. The basic findings are: (1) Energy demand is found to be responsive to price changes, (2) Fossil fuels and biomass are substitutes, (3) Biomass and capital are substitutes, (4) Fossil fuels and hydroelectricity are complements, (5) Hydroelectricity and capital are complements, (6) Labor and materials are substitutes, and (7) Capital and labor are substitutes. The other elasticities are ambiguous, varying from firm to firm, or not significant at the 5% level.

Verillo, J.

1988-01-01T23:59:59.000Z

259

Assessment of oil-shale technology in Brazil. Final technical report, October 27, 1980-July 27, 1981  

SciTech Connect (OSTI)

The development of an oil shale industry in the United States will require the solution of a variety of technical, economic, environmental, and health and safety problems. This assessment investigates whether US oil shale developers might benefit from the experience gained by the Brazilians in the operation of their Usina Prototipo do Irati oil shale demonstration plant at Sao Mateus do Sul, and from the data generated from their oil shale research and development programs. A chapter providing background information on Brazil and the Brazilian oil shale deposits is followed by an examination of the potential recovery processes applicable to Brazilian oil shale. The evolution of the Brazilian retorting system is reviewed and compared with the mining and retorting proposed for US shales. Factors impacting on the economics of shale oil production in Brazil are reviewed and compared to economic analyses of oil shale production in the US. Chapters examining the consequences of shale development in terms of impact on the physical environment and the oil shale worker complete the report. Throughout the report, where data permits, similarities and differences are drawn between the oil shale programs underway in Brazil and the US. In addition, research areas in which technology or information transfer could benefit either or both countries' oil shale programs are identified.

Not Available

1981-07-27T23:59:59.000Z

260

14th International Heat Pipe Conference (14th IHPC), Florianpolis, Brazil, April 22-27, 2007. TWO-PHASE CLOSED THERMOSYPHON WITH NANOFLUIDS  

E-Print Network [OSTI]

14th International Heat Pipe Conference (14th IHPC), Florianópolis, Brazil, April 22-27, 2007. TWO Engineering Indian Institute of Technology Kanpur Kanpur 208016 India. Tel: +91-512-2597038, Fax: +91 transfer fluids due

Khandekar, Sameer

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

UNIVERSIDADE FEDERAL DO RIO DE JANEIRO INSTITUTO COPPEAD DE ADMINISTRAO  

E-Print Network [OSTI]

Finanças Negócios Internacionais Operações de Serviços em Organizações de Saúde Sustentabilidade dos

Liu, I-Shih

262

Before and after: video highlights advances in Rio de Janeiro's  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio JumpVentures Jump to:City Corporation

263

Work & Life at Rio de Janeiro | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear SecurityTensile Strain Switched FerromagnetismWaste and MaterialsWenjun1 Table 1.14 Sales of4) Monthly EnergyPWork

264

An investigation of the relationships between rainfall in northeast Brazil and sea surface temperatures of the equatorial regions of the Pacific and Atlantic Oceans  

E-Print Network [OSTI]

;"V IL FEST? GATION OF THE R). LATIONSHIPS BET))'EFN RATNFAI. L IN NOR'I'llL 'EST BRAZIL AND SEA SL'Rl'ACE TFI!PERAT)JRES CF TIIF. Eq?IA'I'ORIA), RFGIONS OF THE PACIFIC AVL' ATLANITIC OCEANS A TI?csiS OV M "u?'v'I N ARTIIL)R COCHRANE Suhrafr...Mcmli c r) / ~g. ember) (Member) May 1977 ABSTRACT An Investigation of the Relationships between Rainfall in Northeast Brazil and Sca Surface Temperatures of the Equatorial Rcgi. ons of the Pacific and Atlantic Oceans (IJay 1977) . Marvin Arthur...

Cochrane, Marvin Arthur

1977-01-01T23:59:59.000Z

265

Genetic and environmental factors affecting growth and reproductive performance of Santa Ines sheep in the semi-arid region of Brazil  

E-Print Network [OSTI]

GE?1ETIC AND ENVIRiONMENPAL FACTORS Ar FEC ING GROStTH AND REPRODUCTIVE PERFORYJ1jCE OF SAN A INES SHEEP IN THE SEMI-ARID REGIONi OF BRAZIL A T'ress s WANDRICX HAUSS DE SOUSA Submitted to the Graduate College of Tesas ARMi Unsversity... OF BRAZIL A Thesis by WANDRICK HAUSS DE SOUSA Approved as to style and content by: Thomas C. Cartwri t (Co-Chairman) (Co-Chairman) ( /'(' ~ t:. . \\ , Bo y J. Ragsdale (Member) Gary C. Smith (Head of Department) December 1987 ABSTRACT Genetic...

Sousa, Wandrick Hauss de

2012-06-07T23:59:59.000Z

266

How Stakeholder Engagement is Evolving at the Caldas Uranium Mining Site in Minas Gerais, Brazil - 13223  

SciTech Connect (OSTI)

The Caldas site is located in the Federal State of Minas Gerais in Brazil about 25 km from the city of Pocos de Caldas. While the city itself has 150,000 inhabitants there is a total population of around 0.5 million people living in an area that could potentially be influenced by the site. Uranium ore was mined and milled here between the years of 1982 and 1995, with ore extraction taking place from an open pit. Of the material removed, aside from that extracted for uranium, some was used on-site for road construction and building embankments while the remainder was disposed of onto two major rock piles. There are a number of potential historical and current environmental impacts to groundwater as a consequence of discharges into streams which then flow off site. The site is now undergoing a phase of decommissioning which includes the formulation and substantiation of a site remediation strategy. As part of a wider International Atomic Energy Agency (IAEA) Technical Cooperation Project aimed at providing practical guidance for implementing a decommissioning and remediation plan at the site, WSP E and E were invited to lead a mission in order to provide advice on the importance and merits of stakeholder engagement and how to ultimately build an engagement program. In November 2011, WSP E and E met with personnel from the site operators, the Brazilian regulatory bodies and representatives from the local stakeholder community and explained the principles of stakeholder engagement and how the process had internationally evolved principally from a decide-announce-defend approach to a more formal two way mechanism of engagement. Historically there had been insufficient liaison between the site operator, the nuclear regulator and the environmental regulator. All parties had recognized that greater interaction was necessary. There had also been very little engagement with local stakeholders about the various activities on the site and the potential implications of these activities on human health and the environment. The main concerns of the local stakeholders were in relation to potential environmental impacts on groundwater and surface water as well as their lack of knowledge about the site's activities and how it might evolve over time. There was a feeling that the site brought no real benefit to the local community as local labor was rarely utilized when work was being undertaken. WSP E and E were asked many questions about stakeholder engagement processes and had to address a number of concerns relating to being able to construct and control an engagement program. Advice was provided on how to construct a phased program in a manner that would allow the site operator to demonstrate increased transparency and allow as wide a range of stakeholders as possible the opportunity to become engaged. We provided an important message in that engagement often had to be culture and project specific and that what might work in one country could not necessarily purely be transposed to another. Since the WSP E and E mission there has been evidence of a number of positive steps in many of the areas of stakeholder engagement related to the Caldas site. The nuclear and environmental regulators work in a more open and transparent manner and continue to undertake joint inspections of the Caldas site. They have agreed to develop a written agreement that will enable them to jointly assess and discuss the issues on the site. Both regulatory bodies had previously accompanied the site operator on a visit to the Wismut uranium mining area in Germany and as well as providing useful learning had also allowed the regulators to discuss some common issues, thus bringing them closer together. A local stakeholder group under the auspices of the Water Commission had previously been set up but now they are starting to have more regular meetings with the site operator and nuclear regulator. They are now additionally considering the formation of a site specific advisory board (based on similar lines to those at US legacy sites) in order to gain some further tec

Booth, Peter M. [WSP Environment and Energy, Manchester (United Kingdom)] [WSP Environment and Energy, Manchester (United Kingdom); Da Silva, Nivaldo Carlos [CNEN, Pocos de Caldas (Brazil)] [CNEN, Pocos de Caldas (Brazil); Pereira de Oliveira, Alexandre; Cioffi Batagini, Regina Maria [CMPC, Pocos de Caldas (Brazil)] [CMPC, Pocos de Caldas (Brazil); Rangel, Heraldo Junior [INB, Pocos de Caldas (Brazil)] [INB, Pocos de Caldas (Brazil); Da Conceicao Estrella Abad, Maria [IBAMA, Brasilia (Brazil)

2013-07-01T23:59:59.000Z

267

9th World Wide Workshop for Young Environmental Scientists WWW-YES-Brazil-2009: Urban waters: resource or risks? 26-30 October 2009  

E-Print Network [OSTI]

director plans. Keywords Management; decision support systems; sustainable development; geopolitics; social9th World Wide Workshop for Young Environmental Scientists WWW-YES-Brazil-2009: Urban waters: resource or risks? 26-30 October 2009 Brazilian Regulatory Process: including groundwater in urban water

Paris-Sud XI, Université de

268

2010 IREP Symposium-Bulk Power System Dynamics and Control VIII (IREP), August 1-6, 2010, Buzios, RJ, Brazil Resource-Adequacy-Based Capacity Market Design  

E-Print Network [OSTI]

, RJ, Brazil Resource-Adequacy-Based Capacity Market Design Matias Negrete-Pincetic George Gross Abstract. - Today's capacity markets may be viewed as an additional source of income for generators analyze key aspects of today's capacity market designs. Our main finding is that some design elements help

Gross, George

269

Wood density in forests of Brazil's `arc of deforestation': Implications for biomass and flux of carbon from land-use change in Amazonia  

E-Print Network [OSTI]

Wood density in forests of Brazil's `arc of deforestation': Implications for biomass and flux of deforestation'', where most of the carbon flux from land-use change takes place. This paper presents new wood of deforestation, using locally collected species weighted by their volume in large local inventories. Mean wood

Camara, Gilberto

270

VI INTERNATIONAL TELECOMMUNICATIONS SYMPOSIUM (ITS2006), SEPTEMBER 3-6, 2006, FORTALEZA-CE, BRAZIL 1 Fringe Benefits of the H.264/AVC  

E-Print Network [OSTI]

of the Motion Picture Experts Groups (MPEG) from the International Standards Organization (ISO) and of the VideoVI INTERNATIONAL TELECOMMUNICATIONS SYMPOSIUM (ITS2006), SEPTEMBER 3-6, 2006, FORTALEZA-CE, BRAZIL, and Tiago A. Fonseca Abstract-- H.264/AVC is the newest, state-of-the-art, video compression standard

de Queiroz, Ricardo L.

271

Energy and materials savings from gases and solid waste recovery in the iron and steel industry in Brazil: An industrial ecology approach  

SciTech Connect (OSTI)

This paper attempts to investigate, from an entropic point of view, the role of selected technologies in the production, transformation, consumption and release of energy and materials in the Iron and Steel Industry in Brazil. In a quantitative analysis, the potential for energy and materials savings with recovery of heat, gases and tar are evaluated for the Iron and Steel Industry in Brazil. The technologies for heat recovery of gases include Coke Dry Quenching (CDQ), applied only in one of the five Brazilian coke integrated steel plants, Top Gas Pressure Recovery Turbines (TPRT), recovery of Coke Oven Gas (COG), recovery of Blast Furnace Gas (BFG), recovery of BOF gas, recovery of tar, and thermal plant. Results indicate that, in a technical scenario, some 5.1 TWh of electricity can be generated if these technologies are applied to recover these remaining secondary fuels in the Iron and Steel Industry in Brazil, which is equivalent to some 45% of current total electricity consumption in the integrated plants in the country. Finally, solid waste control technologies, including options available for collection and treatment, are discussed. Estimates using the best practice methodology show that solid waste generation in the Iron and Steel Industry in Brazil reached approximately 18 million metric tons in 1994, of which 28% can be recirculated if the best practice available in the country is applied thoroughly.

Costa, M.M.; Schaeffer, R.

1997-07-01T23:59:59.000Z

272

9th World Wide Workshop for Young Environmental Scientists WWW-YES-Brazil-2009: Urban waters: resource or risks? 26-30 October 2009  

E-Print Network [OSTI]

stormwater management; source control; hydrological models; sustainability; Best Management Practices, especially in U.S. literature, as Best Management Practices (BMPs). Other denominations exist, referring9th World Wide Workshop for Young Environmental Scientists WWW-YES-Brazil-2009: Urban waters

Paris-Sud XI, Université de

273

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

274

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

275

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

276

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

277

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

278

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

279

Model program for the control and eradication of pullorum-typhoid infection from breeding/multiplier flocks in selected areas in Brazil  

E-Print Network [OSTI]

surveillance sysiem based on data produced at various levels, the regu', ations pertaining to the control of Pullorum ? iyphoid infection and a public information service designed to bring in the cooperation of all paris -involved in the program also... the respiratory diseases and pullorum- gallinarum infection from commercial flocks. The model program developed and described herein is intended to be part of that nation- 'wide program. REVIEW OF THE LITERATURE ~Go h Brazil is a federal republic which...

Saraiva, Victor Emmanoel Vieira

1982-01-01T23:59:59.000Z

280

brazil.ps.gz  

E-Print Network [OSTI]

Jan 24, 2001 ... The objects of this paper are to describe an e ective and e cient ... a chain of radioactive waste products and to present the results of some ... The limit model is detailed in x3; its spatial discretiza- ..... Some data for the exper-.

2001-01-24T23:59:59.000Z

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Correspondence Brazil promotes  

E-Print Network [OSTI]

of the native macaw palm (Acrocomia aculeata), a potentially sustainable source of oil for producing biokerosene). Oil production from macaw palms, which could exceed the size of today's global palm- oil market, does. This tree can produce up to 6,200 kilograms of oil per hectare (see T. P. Pires et al. Ind. Crops Prod. 44

Silver, Whendee

282

AMF Deployment, Manacapuru, Brazil  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary)morphinanInformation InInformation InExplosion Monitoring:Home|PhysicsGasandArgonneALS in the NewsManacapuru,

283

BRAZIL RESEARCH INITIATIVES  

E-Print Network [OSTI]

Bioenergy Research Collaboration As a partner of the Great Lakes Bioenergy Research Center (GLBRC among agricultural researchers and stakeholders around the world. MSU's work with the GLBRC is organized

Liu, Taosheng

284

BIOGRAPHICAL SKETCH: ROGER FOSDICK (B. 11/18/36)  

E-Print Network [OSTI]

University of Rio de Janeiro COPPE, Brazil (2 months) 1980 Erskine Fellow Department of Civil Engineering Planta Piloto de Ingenieria Quimica Universidad Na¸cional del Sur Bahia Blanca, Argentina (2 months) 1 Bari Bari, Italy Department of Civil Engineering and Architecture Universita degli Studi di Parma Parma

Janssen, Michel

285

Globalization 300million ha forest area loss  

E-Print Network [OSTI]

on Sustainable Development, popularly known as the Rio Earth Summit, was convened in Rio de Janeiro, Brazil to address the state of the environment and sustainable development. The Earth Summit yielded several on Sustainable Development--governments agreed on the Johannesburg Plan of Implementation, reaffirming

286

On the Numerical Simulation of Waterflooding of Heterogeneous  

E-Print Network [OSTI]

On the Numerical Simulation of Waterflooding of Heterogeneous Petroleum Reservoirs Jim Douglas, Jr displacement in petroleum reservoirs. A very detailed description of the numerical method is presented. Follow, 22290 Rio de Janeiro, RJ, Brazil #12; On the Numerical Simulation of Waterflooding of Heterogeneous

Douglas Jr., Jim

287

Virtual Reality Engineering Workflow Ismael Santos  

E-Print Network [OSTI]

of Rio de Janeiro, Brazil {lpsoares,kamel,wagnerga,abraposo}@tecgraf.puc-rio.br Abstract--Oil & Gas graphics; 1. INTRODUCTION The oil & gas industry has increasing costs of finding and extracting. The extraction of oil & gas reserves constantly faces the challenge of reducing costs of its components

Barbosa, Alberto

288

Application In addition to the specific exchange program requirements and application process of the students home institution  

E-Print Network [OSTI]

to spend a semester or full year at PUC-Rio in Rio de Janeiro, Brazil, one of Latin Americas most diverse the renewal of the registration fee charged during the deadline for the Exchange Period Extension. VISA on Brazilian and Latin American culture, literature, business, design, civilization and history, etc. Along

Brinkmann, Peter

289

Shape memory alloy for vibration isolation and damping  

E-Print Network [OSTI]

ABSTRACT Shape Memory Alloys for Vibration Isolation and Damping. (December 2007) Luciano G. Machado, B.S., Federal Center of Technological Education of Rio de Janeiro - RJ, Brazil; M.S., Military Institute of Engineering - RJ, Brazil; Chair of Advisory... of the Transformation Hardening Function . . . . . . . . . 146 D. Comparison with Experimental Tests . . . . . . . . . . . . 148 E. Comparison of the Current Models Predictions with Calorimetric Results . . . . . . . . . . . . . . . . . . . . . 149 VIII CHAOTIC...

Machado, Luciano G

2008-10-10T23:59:59.000Z

290

Air kerma standard for calibration of well-type chambers in Brazil using {sup 192}Ir HDR sources and its traceability  

SciTech Connect (OSTI)

In Brazil there are over 100 high dose rate (HDR) brachytherapy facilities using well-type chambers for the determination of the air kerma rate of {sup 192}Ir sources. This paper presents the methodology developed and extensively tested by the Laboratorio de Ciencias Radiologicas (LCR) and presently in use to calibrate those types of chambers. The system was initially used to calibrate six well-type chambers of brachytherapy services, and the maximum deviation of only 1.0% was observed between the calibration coefficients obtained and the ones in the calibration certificate provided by the UWADCL. In addition to its traceability to the Brazilian National Standards, the whole system was taken to University of Wisconsin Accredited Dosimetry Calibration Laboratory (UWADCL) for a direct comparison and the same formalism to calculate the air kerma was used. The comparison results between the two laboratories show an agreement of 0.9% for the calibration coefficients. Three Brazilian well-type chambers were calibrated at the UWADCL, and by LCR, in Brazil, using the developed system and a clinical HDR machine. The results of the calibration of three well chambers have shown an agreement better than 1.0%. Uncertainty analyses involving the measurements made both at the UWADCL and LCR laboratories are discussed.

Di Prinzio, Renato; Almeida, Carlos Eduardo de [Laboratorio de Ciencias Radiologicas-Universidade do Estado do Rio de Janeiro (LCR/UERJ), R. Sao Francisco Xavier, 524, Pavilhao Haroldo Lisboa da Cunha, Terreo, Sala 136-Maracana, CEP 20550-900-Rio de Janeiro/RJ-Rio de Janeiro, RJ (Brazil) and Instituto de Radioprotecao e Dosimetria-Comissao Nacional de Energia Nuclear (IRD/CNEN), Av. Salvador Allende, s/n, Jacarepagua-CE22780-160-Rio de Janeiro, RJ (Brazil); Laboratorio de Ciencias Radiologicas-Universidade do Estado do Rio de Janeiro (LCR/UERJ), R. Sao Francisco Xavier, 524, Pavilhao Haroldo Lisboa da Cunha, Terreo, Sala 136-Maracana, CEP 20550-900-Rio de Janeiro/RJ-Rio de Janeiro, RJ (Brazil)

2009-03-15T23:59:59.000Z

291

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

292

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

293

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip...

294

Absorbed Dose Rate Due to Intake of Natural Radionuclides by Tilapia Fish (Tilapia nilotica,Linnaeus, 1758) Estimated Near Uranium Mining at Caetite, Bahia, Brazil  

SciTech Connect (OSTI)

The uranium mining at Caetite (Uranium Concentrate Unit--URA) is in its operational phase. Aiming to estimate the radiological environmental impact of the URA, a monitoring program is underway. In order to preserve the biota of the deleterious effects from radiation and to act in a pro-active way as expected from a licensing body, the present work aims to use an environmental protection methodology based on the calculation of absorbed dose rate in biota. Thus, selected target organism was the Tilapia fish (Tilapia nilotica, Linnaeus, 1758) and the radionuclides were: uranium (U-238), thorium (Th-232), radium (Ra-226 and Ra-228) and lead (Pb-210). As, in Brazil there are no radiation exposure limits adopted for biota the value proposed by the Department of Energy (DOE) of the United States of 3.5x10{sup 3} {mu}Gy y{sup -1} has been used. The derived absorbed dose rate calculated for Tilapia was 2.51x10{sup 0} {mu}Gy y{sup -1}, that is less than 0.1% of the dose limit established by DOE. The critical radionuclide was Ra-226, with 56% of the absorbed dose rate, followed by U-238 with 34% and Th-232 with 9%. This value of 0.1% of the limit allows to state that, in the operational conditions analyzed, natural radionuclides do not represent a radiological problem to biota.

Pereira, Wagner de S [Coordenacao de Protecao Radiologica, Unidade de Tratamento de Minerios, Caixa Postal 961, CEP 37701-970, Pocos de Caldas, MG, BR Industrias Nucleares do Brasil (Brazil); Universidade Federal Fluminense, Programa de Pos-graduacao em Biologia Marinha (Brazil); Kelecom, Alphonse [Universidade Federal Fluminense, Programa de Pos-graduacao em Biologia Marinha (Brazil); Universidade Federal Fluminense, Programa de Pos-graduacao em Ciencia Ambiental, Instituto de Geociencias, av. Litoranea s/no, Boa Viagem, 24210-340 Niteroi, RJ Caixa Postal 107.092, CEP 24360-970, Niteroi, RJ (Brazil); Azevedo Py Junior, Delcy de [Coordenacao de Protecao Radiologica, Unidade de Concentrado de Uranio. Caixa Postal 7, CEP 46.400-000 Caetite, Bahia, Brasil Industrias Nucleares do Brasil (Brazil)

2008-08-07T23:59:59.000Z

295

CO{sub 2} emissions from developing countries: Better understanding the role of Energy in the long term. Volume 2, Argentina, Brazil, Mexico, and Venezuela  

SciTech Connect (OSTI)

Recent years have witnessed a growing recognition of the link between emissions of carbon dioxide (CO{sub 2}) and changes in the global climate. Of all anthropogenic activities, energy production and use generate the single largest portion of these greenhouse gases. Although developing countries currently account for a small share of global carbon emissions, their contribution is increasing rapidly. Due to the rapid expansion of energy demand in these nations, the developing world`s share in global modern energy use rose from 16 to 27 percent between 1970 and 1990. If the growth rates observed over the past 20 years persist energy demand in developing will surpass that in the countries of the Organization for Economic Cooperation and Development (OECD) early in the 21st century. The study seeks to examine the forces that galvanize the growth of energy use and carbon emissions, to assess the likely future levels of energy and CO{sub 2} in selected developing nations and to identify opportunities for restraining this growth. The purpose of this report is to provide the quantitative information needed to develop effective policy options, not to identify the options themselves. These individual studies were conducted fro Argentina, Brazil, Mexico and Venezuela in Latin America.

Ketoff, A.; Sathaye, J.; Goldman, N. [eds.

1991-07-01T23:59:59.000Z

296

Rua Marqus de So Vicente, 255 Gvea Rio de Janeiro RJ-Brasil 22451-900  

E-Print Network [OSTI]

desafios contemporâneos. O Centro de Biologia Graziela Maciel Barroso, onde as aulas práticas acontecem

297

CONSTITUTIVE THEORIES: BASIC PRINCIPLES Instituto de Matematica, Universidade Federal do Rio de Janeiro, Brasil  

E-Print Network [OSTI]

of balance laws 6. Constitutive equations in material description 7. Principle of material frame, thermomechanical history, constitutive equation, material frame-indifference, material objectivity, simple materi-indifference 8. Constitutive equations in referential description 9. Simple materials 10. Material symmetry 11

Liu, I-Shih

298

7 de janeiro de 2009 EXPERIMENTO A BORDO DE BALO ESTRATOSFRICO DA NASA, QUE  

E-Print Network [OSTI]

medidas do céu em micro-ondas à procura da energia emitida pelas primeiras estrelas que se formaram qual o nosso Sistema Solar pertence. O Universo é permeado por um sinal residual do Big Bang, observado causados pelo decaimento de partículas primordiais ou pela injeção de energia no Universo produzida pela

Domingues, Margarete Oliveira

299

TEORIA E PESQUISA 44 E 45 JANEIRO E JULHO DE 2004  

E-Print Network [OSTI]

-econmicos desenvolvimentistas, em que o marco conceitual adotado pelo governo, fortemente marcado por um vis tecnocrtico, desconsidera o carter poltico das resistncias locais aos princpios de gesto impostos pelo governo. No novo panorama desenvolvimentista, prticas introduzidas pelo prprio governo no passado e que com o

Champagne, Frances A.

300

Universidade Federal do Rio de Janeiro Museu Nacional, Programa de Ps-Graduao em Zoologia  

E-Print Network [OSTI]

entidades: Fundação Coordenação de Aperfeiçoamento de Pessoal de Nível Superior ­ CAPES. Museu Nacional

Hammerton, James

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

MINISTRIO DA EDUCAO GABINETE DO MINISTRO PORTARIA N 27, DE 15 DE JANEIRO DE 2014  

E-Print Network [OSTI]

desenvolvimento profissional e aperfeiçoamento da gestão pública. diretrizes para o desenvolvimento dos Servidores Dimensionamento, Programa de Avaliação de Desempenho e Programa de Capacitação e Aperfeiçoamento. O Decreto nº 5

Floeter, Sergio Ricardo

302

33RD INTERNATIONAL COSMIC RAY CONFERENCE, RIO DE JANEIRO 2013 THE ASTROPARTICLE PHYSICS CONFERENCE  

E-Print Network [OSTI]

a good estimation of the energy of the primary cos- mic ray particle. The electromagnetic energy is proportional to the energy dissipated. Whereas the global process of energy deposit by charged particles a sizeable frac- tion of the primary electron energy may deposit their en- ergy at far distances from

Boyer, Edmond

303

The Royal Court in Rio de Janeiro and Napoleons Black Legend  

E-Print Network [OSTI]

Histria do Reino do Brasil, vol. 1, p.256. 13 ANRJ,p.189. 29 Idade dOuro do Brasil, n 42, 1812. 30 James32 Idade dOuro do Brasil, n 59, 1813. 33 Ibid. , n

Nizza da Silva, Maria Beatriz

2008-01-01T23:59:59.000Z

304

Oil and Gas Technology at Rio de Janeiro | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmosphericNuclear Security Administration the1 - September 2006 The 2002 WholesaleEnergy's 10 Office ofOffshoreTechnology &

305

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

306

In Brazil, For the World: Brazil Technology Center - GE Global...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

We Monitor Machines Augmented Reality: Changing The Way We Monitor Machines Using 3D Printing and 3D Inking to Enhance Manufacturing Using 3D Printing and 3D Inking to Enhance...

307

A Guide to Brazil's Agricultural  

E-Print Network [OSTI]

to the World Trade Organization (WTO) and acts as the national enquiry point under the WTO Agreement the National Health Surveillance Agency (ANVISA), Ministry of Agriculture, Livestock and Supply (MAPA), the National Petroleum Agency, Natural Gas and Biofuels (ANP), the Ministry of Mines and Energy (MME), as well

Perkins, Richard A.

308

A Guide to Brazil's Requirements  

E-Print Network [OSTI]

(INMETRO) is responsible for notifying the proposed technical regulations to the World Trade Organization Agency (ANVISA), Ministry of Agriculture, Livestock and Supply (MAPA), the National Petroleum Agency, Natural Gas and Biofuels (ANP), the Ministry of Mines and Energy (MME), as well as the National

Perkins, Richard A.

309

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

310

Essays on Municipal Public Finance in Brazil  

E-Print Network [OSTI]

of Revenue Generation Infrastructure IV-2SLS Coefficient onIV-2SLS estimates indicate a null relationship between transfers and per capita revenue generation.IV-2SLS fixed effects estimates without municipality fixed effects seem to indicate 0.2 cent increase in local revenue generation

Gardner, Rachel Elizabeth

2013-01-01T23:59:59.000Z

311

Repatriation of US sources from Brazil  

SciTech Connect (OSTI)

IAEA's interest in excess and unwanted sealed sources extends back to when radium sources were a problem throughout the world. Sta11ing in 1994, world wide IAEA member states inventoried and consolidated radium (Ra)-226 sources. IAEA then trained Regional Teams in the conditioning of Ra-226 sealed sources for long term storage, which resulted in the Regional Teams conditioning about 14,000 radium sources. These sources remained in their respective IAEA member state locations. Regional teams were seen as a way to encourage member state (local) management of a world wide problem, as well as a more cost effective solution.

Tompkins, Andrew J [Los Alamos National Laboratory

2008-01-01T23:59:59.000Z

312

ESSENTIALISM AND FOLKBIOLOGY: EVIDENCE FROM BRAZIL1  

E-Print Network [OSTI]

and methodological issues of cultural relativity. Introduction There are two competing accounts of how human beings causality (see Carey 1985, 1995; Carey & Spelke 1994; Johnson & Solomon 1997; Johnson & Carey 1998, Solomon between these two opposing views (see, e.g., Astuti 2001, Atran et al. 2001, Block et al. 2001, Solomon et

Paris-Sud XI, Université de

313

ISSN 0104-6632 Printed in Brazil  

E-Print Network [OSTI]

Ecosystem for sequestrating CO2 and consuming glycerol in a Chemical Complex with 15 integrated processes. The Complex is responsible for the production of methanol, ethylene oxide, ammonia, urea, dimethyl carbonate, ethylene glycol, glycerol carbonate, -carotene, 1,2-propanediol and olefins, and is simulated using UNISIM

Grossmann, Ignacio E.

314

A Guide to Brazil's Oil and Oil  

E-Print Network [OSTI]

(INMETRO) is responsible for notifying the proposed technical regulations to the World Trade Organization Agency (ANVISA), Ministry of Agriculture, Livestock and Supply (MAPA), the National Petroleum Agency, Natural Gas and Biofuels (ANP), the Ministry of Mines and Energy (MME), as well as the National

Perkins, Richard A.

315

Brazil: Into the Interior Jerry R. Hobbs  

E-Print Network [OSTI]

they let me pass. This was the border of Rondonia. The map of Rondonia looks like the skeleton of a fish remained, and white cattle grazed among them. In the west, approaching Porto Velho, we passed blackened to the boat captains. The boats were moored on the bank in a rather bad and very muddy part of town. I went

Hobbs, Jerry R.

316

The State and income inequality in Brazil  

E-Print Network [OSTI]

do gasto social no Brasil. In: Castro JA, Ferreira HRS,da Poltica Social no Brasil. Braslia: Ipea; 2010. p. 109R. Remunerao nos servios no Brasil: o contraste entre

Medeiros, Marcelo; Souza, Pedro H.G.F.

2013-01-01T23:59:59.000Z

317

Wild Brazil: Pantanal Wetlands & Iguaz Falls  

E-Print Network [OSTI]

, reptiles and fish, and the impacts of ranching and ecotourism. Discussion topics will include the natural

de Leon, Alex R.

318

Brazil LULUCF Modeling | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,Brayton Energy LLC Jump to:

319

Brazil Ethanol Inc | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGEFairfield(CTI PFAN)Brasilia,EnergyEthanol

320

Brazil: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGEFairfield(CTIAdvanced

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Green Skies of Brazil |GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFun with Big Sky LearningGetGraphene's 3D CounterpartDepartment of

322

Brazil Technology Center | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-Series to someone6 M.ExtracellularBradbury Science MuseumBrain

323

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

324

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

325

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

326

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

327

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip

328

The HAWC Gamma-Ray Observatory: Dark Matter, Cosmology, and Fundamental Physics  

E-Print Network [OSTI]

The High-Altitude Water Cherenkov Gamma Ray Observatory (HAWC) is designed to perform a synoptic survey of the TeV sky. The high energy coverage of the experiment will enable studies of fundamental physics beyond the Standard Model, and the large field of view of the detector will enable detailed studies of cosmologically significant backgrounds and magnetic fields. We describe the sensitivity of the full HAWC array to these phenomena in five contributions shown at the 33rd International Cosmic Ray Conference in Rio de Janeiro, Brazil (July 2013).

Abeysekara, A U; Alvarez, C; lvarez, J D; Arceo, R; Arteaga-Velzquez, J C; Solares, H A Ayala; Barber, A S; Baughman, B M; Bautista-Elivar, N; Belmont, E; BenZvi, S Y; Berley, D; Rosales, M Bonilla; Braun, J; Caballero-Lopez, R A; Caballero-Mora, K S; Carramiana, A; Castillo, M; Cotti, U; Cotzomi, J; de la Fuente, E; De Len, C; DeYoung, T; Hernandez, R Diaz; Daz-Vlez, J C; Dingus, B L; DuVernois, M A; Ellsworth, R W; Fernandez, A; Fiorino, D W; Fraija, N; Galindo, A; Garfias, F; Gonzlez, L X; Gonzlez, M M; Goodman, J A; Grabski, V; Gussert, M; Hampel-Arias, Z; Hui, C M; Hntemeyer, P; Imran, A; Iriarte, A; Karn, P; Kieda, D; Kunde, G J; Lara, A; Lauer, R J; Lee, W H; Lennarz, D; Vargas, H Len; Linares, E C; Linnemann, J T; Longo, M; Luna-GarcIa, R; Marinelli, A; Martinez, H; Martinez, O; Martnez-Castro, J; Matthews, J A J; Miranda-Romagnoli, P; Moreno, E; Mostaf, M; Nava, J; Nellen, L; Newbold, M; Noriega-Papaqui, R; Oceguera-Becerra, T; Patricelli, B; Pelayo, R; Prez-Prez, E G; Pretz, J; Rivire, C; Rosa-Gonzlez, D; Salazar, H; Salesa, F; Sanchez, F E; Sandoval, A; Santos, E; Schneider, M; Silich, S; Sinnis, G; Smith, A J; Sparks, K; Springer, R W; Taboada, I; Toale, P A; Tollefson, K; Torres, I; Ukwatta, T N; Villaseor, L; Weisgarber, T; Westerhoff, S; Wisher, I G; Wood, J; Yodh, G B; Younk, P W; Zaborov, D; Zepeda, A; Zhou, H

2013-01-01T23:59:59.000Z

329

Polarity characterization of crude oils predicts treatment trends in field development  

SciTech Connect (OSTI)

A method for determining crude oil polarity using inverse gas chromatography proved successful for classifying crudes as well as for assessing their ability to form stable emulsions with water. Polarity determinations have been applied to the formation test crude oil samples collected in Albacora and Marlim deepwater fields of the Campos Basin, Rio de Janeiro, Brazil. The results have been compared with the polarities of the first produced crudes of the Basin and showed that the emulsion separation problems tend to increase. Polarity results provided substantial data to help production field development decisions.

Andrade Bruening, I.M.R. de

1995-11-01T23:59:59.000Z

330

Search for Events with Leptonic Jets and Missing Transverse Energy in pp-bar Collisions at s?=1.96??TeV  

E-Print Network [OSTI]

,2 J. F. Bartlett,47 U. Bassler,18 S. Beale,6 A. Bean,55 M. Begalli,3 M. Begel,71 C. Belanger-Champagne,40 L. Bellantoni,47 J. A. Benitez,62 S. B. Beri,27 G. Bernardi,17 R. Bernhard,22 I. Bertram,41 M. Besancon,18 R. Beuselinck,42 V.A. Bezzubov,38 P.... Zhao,80 B. Zhou,61 J. Zhu,61 M. Zielinski,69 D. Zieminska,51 and L. Zivkovic68 (The D0 Collaboration) 1Universidad de Buenos Aires, Buenos Aires, Argentina 2LAFEX, Centro Brasileiro de Pesquisas F?sicas, Rio de Janeiro, Brazil 3Universidade do Estado...

Baringer, Philip S.; Bean, Alice; Clutter, Justace Randall; McGivern, Carrie Lynne; Sekaric, Jadranka; Wilson, Graham Wallace; Abazov, V. M.; Abbott, B.; Abolins, M.; Acharya, B. S.; Adams, M.; Adams, T.

2010-11-19T23:59:59.000Z

331

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

332

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

333

Architecture and Public Space: Lessons From Sao Paulo  

E-Print Network [OSTI]

by Le Corbusier, Oscar Niemeyer, and Wallace N. Harrison;for City Form towers by Oscar NiemeyerRio de Janeiros

Lima, Zeuler R.M.A.

2007-01-01T23:59:59.000Z

334

E-Print Network 3.0 - aprendizado em cirurgia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de... DE JANEIRO RUA MARQUS DE SO VICENTE, 225 - CEP 22451-900 RIO DE JANEIRO - BRASIL 12;Monograas em Source: Endler, Markus - Departamento de Informtica, Pontifcia...

335

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada...

336

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

337

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

338

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

339

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

340

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

342

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

343

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

344

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

345

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

346

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

347

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

348

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

349

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

350

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

351

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

352

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

353

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

354

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

355

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

356

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

357

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

358

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

359

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

360

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


362

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

363

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

364

affect foreign bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

365

allied irish bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

366

affects higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...

367

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

368

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

369

Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

370

Wind: wind power density maps at 50 m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

371

Summary of ICTP activities in support of science in Brazil  

E-Print Network [OSTI]

, Sao Paulo Research Funding Agency (FAPESP) 10 8/5/13ICTP Public Information Office #12; 1 Affiliated, 2012 Joint ICTP-TWAS II Latin American School on Computational Materials Science for Energy Latin-American School and Conference on Statistical Physics and Interdisciplinary Applications, Bento

372

`With Grains in Her Hair': Rice in Colonial Brazil  

E-Print Network [OSTI]

and maroons commemorate rice as part of their African heritage. From Suriname to Cayenne and across the Amazon. Moreover it shares the rice origin legend of Cayenne and Suriname, with a crucial emendation, as it is told

373

Regulation and Moral Hazard in Forest Concessions in Brazil  

E-Print Network [OSTI]

E. M. Designing incentive regulation. Review of IndustrialAgent approach for incentive regulation can be defined,the theory of incentive regulation as a tool to solve the

Balbinotto Neto, Gicomo; Tillmann, Eduardo A; Ratnieks, Ianes

2012-01-01T23:59:59.000Z

374

Land reform, regional planning and socioeconomic development in Brazil  

E-Print Network [OSTI]

baseline study of PCT settings 96 4.1 Introduction 96 4.2 Access to land under the Land Bill Programme 99 4.3 Agriculture and livestock production on PCT settlements 111 4.4 The standard of living of PCT beneficiaries 119 4.5 The surveyed sites vis... of governance for plan-led land reform 145 Figure 5.3: An illustrative diagram for the regional planning cycle 180 10 ABBREVIATIONS CONTAG National Confederation of Agricultural Workers FUNDEB Basic Education Fund HDI...

Souza, Saulo

2011-01-11T23:59:59.000Z

375

area northern brazil: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

northern Argentina, was one of the first academic institutions to start research in the area of solar energy applications in the country. In 1982, a Non Conventional Energy...

376

Conservation Potential of Compact Fluorescent Lamps in India and Brazil  

E-Print Network [OSTI]

energia: 0 Horario de Verao) Proceedings, I Congres- so Brasileiro de Planejamento Energetico (forthcoming), Universidade Es- tadual de Campinas, Sao Paulo, Brasil,

Gadgil, A.J.

2008-01-01T23:59:59.000Z

377

Conservation Potential of Compact Fluorescent Lamps in India and Brazil  

E-Print Network [OSTI]

1.7% of in- stalled hydroelectric capacity. Op. cit. ref [in Ig86) based on hydroelectric generation, and most of thethe still abundant hydroelectric potential of the country.

Gadgil, A.J.

2008-01-01T23:59:59.000Z

378

Preliminary assessment of potential CDM early start projects in Brazil  

E-Print Network [OSTI]

consortium, coordinated by EOLICA (the Brazilian Wind Energyengineering firm, and EOLICA itself. Costs and Revenues

Meyers, S.; Sathaye, J.; Lehman, B.; Schumacher, K.; van Vliet, O.; Moreira, J.R.

2000-01-01T23:59:59.000Z

379

Cross-avenue politics : the case of Colombia and Brazil  

E-Print Network [OSTI]

pretexto. Se a lei contraria o governo, muda-se a lei, eis odos partidos que apiam o governo rejeitam a reabertura defuncionamiento dela. () O governo vai reeditar a MP como

Pachon Buitrago, Monica

2008-01-01T23:59:59.000Z

380

Brazil: desafios de las politicas para las familias  

E-Print Network [OSTI]

2003), O Gasto Social do Governo Central: 2001 e 2002.politica do gasto social do governo federal no Brasil desde2003), Gasto social do governo centrai: 2001 e 2002,

Goldani, Ana Maria; Lazo, Aida Verdugo

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Patent Bargains in NICs: The Case of Brazil  

E-Print Network [OSTI]

the Brazilian pharmaceutical industry, is ultimately relatedby the American pharmaceutical industry. 28 U.S. advocatesThe case of the pharmaceutical industry, Research Policy,

Salama, Bruno Meyerhof; Benoliel, Daniel

2008-01-01T23:59:59.000Z

382

Conservation Potential of Compact Fluorescent Lamps in India and Brazil  

E-Print Network [OSTI]

also additional benefits from avoided costs of environmentalpremium for India)) - (avoided annual cost of incandescents)electricity) + (avoided annual cost of incandescents) - (

Gadgil, A.J.

2008-01-01T23:59:59.000Z

383

Regulation and Moral Hazard in Forest Concessions in Brazil  

E-Print Network [OSTI]

DA MOTTA, R. Economic Incentives and Forest Concessions inin monitoring and economic incentives that may lead to theeconomic relationships involving risk sharing and incentives.

Balbinotto Neto, Gicomo; Tillmann, Eduardo A; Ratnieks, Ianes

2012-01-01T23:59:59.000Z

384

August 2012 Brazil is one of the great success stories  

E-Print Network [OSTI]

-makers including Henrique Meirelles, Persio Arida, Pedro Malan, and Nelson Barbosa- Filho, and with Brazilian

Oxford, University of

385

Was Brazil's recent growth acceleration the world's most overrated boom?  

E-Print Network [OSTI]

lower revenue on one side and higher bad debt charges on the other. (http://www.ft.com/cms/s/0/d208d83c-2769-11e2-abcb-00144feabdc0. html#axzz2BWN 3I99x). The difficulty in sustaining periods of productivity growth is also evident in the four Latin...

Palma, Jose Gabriel

2012-11-01T23:59:59.000Z

386

An Update on the Brazil Tech Center | GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

agencies. Our research areas cover biofuels, smart systems, systems integration and subsea technologies. We are currently operating from office and lab spaces at Federal...

387

Conservation Potential of Compact Fluorescent Lamps in India and Brazil  

E-Print Network [OSTI]

38 TWh, 10% of which was for incandescent lighting (Fig. 3).The electricity consumed in incandescent lighting can be300 and 400 million incandescent lamps in the country. Let

Gadgil, A.J.

2008-01-01T23:59:59.000Z

388

Oil, Development, and the Environment: Coastal Brazil at a Crossroads  

E-Print Network [OSTI]

­ key international player (technological advances in deep water drilling and ethanol production and technology Questions and discussion #12;www.worldatlas.com #12;Coastal Development and the Environment) ­ technology driven Diversified economy ­ leader in agriculture, aerospace, energy, mining, automotive Unique

New Hampshire, University of

389

LAND USE CHANGE IN BRAZIL: INTEGRATING ECOLOGY, ECONOMICS AND POLICY  

E-Print Network [OSTI]

for smaller farmers to buy land and increased the incentives for migrating to the frontier generating a race attracted migrants from others regions, searching for agricultural land ; It remains a frontier region the financial support to wait the advance of frontier to eventually begin any activity; #12;Also

390

LAND USE CHANGE IN BRAZIL: INTEGRATING ECOLOGY, ECONOMICS AND POLICY  

E-Print Network [OSTI]

for smaller farmers to buy land and increased the incentives for migrating to the frontier generating a race ; It remains a frontier region, mainly due to the long distance from main centers; Almost 85% of its original the financial support to wait the advance of frontier to eventually begin any activity; #12;Also

391

alegre pa brazil: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Grant Title: ACADEMIC CAREER AWARD (Parent K07) Funding Opportunity Number: PA-11-192. CFDA Number(s): 93.213, 93.866. Engineering Websites Summary: Grant Title: ACADEMIC CAREER...

392

Dual Protection, Relationship Dynamics, and Women's Empowerment in Brazil  

E-Print Network [OSTI]

de Classificacao Economica Brasil." ASSOCIAO BRASILEIRA DEvivendo com HIV/aids no Brasil." Cienc Saude Coletiva 14(4):Saude Publica 21(2): 499. Brasil (1996). Pesquisa Nacional

Tsuyuki, Kiyomi

2013-01-01T23:59:59.000Z

393

International Conference on Engineering and Computer Education So Paulo, Brazil  

E-Print Network [OSTI]

Learning Styles in Introductory Physics: Enhancing Student Motivation, Interest, & Learning Teresa Larkin-Hein 1 Abstract -- In this paper, successful approaches to teaching introductory physics students using employed with non-science majors enrolled in introductory physics at American University. The basic

Larkin, Teresa L.

394

Suzlon Energia Eolica do Brazil Ltda | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende NewSowitec do Brasil EnergiaSur de Renovables JumpSuzlon

395

Brazil-Low Carbon Growth Studies Program | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump to:Information NameStudies

396

Brazil-Making Energy Efficiency Real (MEER) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump to:Information NameStudiesMEER)

397

Brazil-Measurement and Performance Tracking (MAPT) Initiative | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump to:Information

398

Brazil-Mitigation Action Plans and Scenarios (MAPS) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump to:InformationInformation

399

Brazil-NETL Advanced Fossil Fuels Partnerships | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) Jump

400

Brazil-NREL Biofuels and EERE Cooperation | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and EERE Cooperation

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Brazil-Promoting Low Emission Urban Development Strategies in Emerging  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and EEREEconomy

402

Brazil-Quantifying Emission Reduction Opportunities in Emerging Economies |  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and EEREEconomyOpen

403

Brazil-REEEP Energy Activities | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and

404

Brazil-World Bank Climate Projects | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo FengBoulder, CO) JumpNREL Biofuels and Name

405

DOE Simulator Training to Brazil's Petrobas Advances Goal of Deploying  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana. DOCUMENTSof EnergyAlliance | Department

406

Preliminary assessment of potential CDM early start projects in Brazil  

E-Print Network [OSTI]

9 X. Small Hydro in the State ofIRR WITH CREDITS AT $20/tC SMALL HYDRO IN GOIAS WIND FARMSeffect on the IRR. For the small hydro project, for example,

Meyers, S.; Sathaye, J.; Lehman, B.; Schumacher, K.; van Vliet, O.; Moreira, J.R.

2000-01-01T23:59:59.000Z

407

Patent Bargains in NICs: The Case of Brazil  

E-Print Network [OSTI]

backdrop of an altogether weaker patent regime. As a policyProperty and Contract Laws21 III. NICs Patent Bargain22 B. Patent Compulsory Licensing Bargaining

Salama, Bruno Meyerhof; Benoliel, Daniel

2008-01-01T23:59:59.000Z

408

Brazil-Climate Technology Initiative Private Financing Advisory Network  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,Brayton Energy LLC Jump to:(CTI PFAN) |

409

Brazil-Danish Government Baseline Workstream | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,Brayton Energy LLC Jump to:(CTI PFAN) |

410

Brazil-Forest Investment Program (FIP) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,Brayton Energy LLC Jump to:(CTI PFAN)

411

Brazil-Green Growth Strategy Support | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: EnergyBoston Area Solar EnergyBradbury,Brayton Energy LLC Jump to:(CTI

412

São Paulo, Brazil: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACAOpenSummersideJumpSyria: Energy Resources Jumpo

413

Brazil National Plan on Climate Change (PNMC) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGEFairfield(CTI

414

Brazil-NETL Advanced Fossil Fuels Partnerships | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGEFairfield(CTIAdvanced Fossil Fuels

415

Brazil-The Mitigation Action Implementation Network (MAIN) | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCTBarre BiomassTHIS PAGEFairfield(CTIAdvanced Fossil

416

NREL-Brazil Bilateral Technical Coordination | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 -Energieprojekte3Information Exploration/DevelopmentLegalSolomonsNREL'sBilateral

417

U.S.-Brazil Strategic Energy Dialogue | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomenthe House Committee on EnergyEnergyThe sunCommerceEnergyandErnest MonizOn the

418

Wind Energy Atlas of Brazil | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place:ReferenceEdit JumpWill County, Illinois: NameGroup Place:of

419

Strategic Energy Dialogue With Brazil Promotes Mutual Prosperity and  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of Energyof theRestoration at Young - Rainey STAR Center18, 2014StorageofSecurity

420

Energy Efficiency Standards for Refrigerators in Brazil: A Methodology for  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revisionWind,Soilsfilesystem socket.pngFigure 55NAMAs

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

File:BrazilTMYst 238.pdf | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublicIDAPowerPlantSitingConstruction.pdf JumpApschem.pdf Jump to: navigation, searchBanglmetst 221.pdf

422

File:NREL-brazil-dir.pdf | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublicIDAPowerPlantSitingConstruction.pdf JumpApschem.pdfMarcelluswatermgmt.pdf Jumpdir.pdf Jumpdni.pdfBhutan -

423

File:NREL-brazil-glo.pdf | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublicIDAPowerPlantSitingConstruction.pdf JumpApschem.pdfMarcelluswatermgmt.pdf Jumpdir.pdf Jumpdni.pdfBhutan

424

US - Brazil Binational Energy Working Group Joint Action Plan | Department  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of EnergyofProject is on Track| Department of EnergyonNovember

425

US-Brazil Memoradum of Understanding | Department of Energy  

Energy Savers [EERE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartment of EnergyofProject is on Track| Department ofof EnergyTechnology

426

Meeting Energy Needs in Brazil |GE Global Research  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: VegetationEquipment Surfaces andMapping the NanoscaleMechanicalMedicine High EnergyJoniDeputyMeet

427

U.S. and Brazil Bilateral Collaboration on Biofuels  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. of Energy, Office ofNuclear WeaponstoU.S.0:Windof

428

Conservation Potential of Compact Fluorescent Lamps in India and Brazil  

E-Print Network [OSTI]

household income is a strong determinant of household electricity use, analysis for different prices

Gadgil, A.J.

2008-01-01T23:59:59.000Z

429

amazon region brazil: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Amazon Basin, Biology and Medicine Websites Summary: and LUIZ A. MARTINELLI1 1 Centro de Energia Nuclear na Agricultura, Av.Centenario 303, 13416 cycles in the Amazon Basin...

430

MAPSAR Simulation in Brazil: Current StatusMAPSAR Simulation in Brazil: Current Status Dr. Waldir Renato Paradella  

E-Print Network [OSTI]

/Geomorphology Disaster ManagementDisaster Management ForestryForestry Geology/Mineral ExplorationGeologyBUnB, CPRM, CPRM Disaster Management (Oil):Disaster Management (Oil): PolidutoPoliduto UrucuIgarap AAuu (AM)(AM) INPE, INPA, JPLINPE, INPA, JPL Geology:Geology: CarajCarajss (PA) e(PA) e Cura

Domingues, Margarete Oliveira

431

Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

432

Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

433

Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

434

Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

435

Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

436

STUDENT / PARENT INFORMATION MAIL DELIVERY ON CAMPUS The information below provides the basic information you need to send and receive United States  

E-Print Network [OSTI]

West Street Address (if applicable) 522 Thurstin Ave. Bowling Green State University Bowling Green State University City, State and Zip Code Bowling Green, OH 43403-4603 Please note that BGSU has its own zip code, 43403, which is unique from the city of Bowling Green (43402). Please ensure to include

Moore, Paul A.

437

Reference Buildings by Building Type: Secondary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

438

Reference Buildings by Building Type: Primary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

439

Sandia Group Medicare Advantage Plan Enrollment Form Senior Advantage Health Plan Choices (Choose One)  

E-Print Network [OSTI]

Home Phone: Cell: E-Mail Address: Permanent Residence Address: City: State: Zip Code: County: Mailing Address (only if different from your Permanent Residence Address): City: State: Zip Code: County drug coverage, including other private insurance, TRI- CARE, Federal employee health benefits coverage

Fuerschbach, Phillip

440

2011 ODU Game Development Summer Camp Registration Form Child's Name Date of Birth Sex  

E-Print Network [OSTI]

Contacts Primary Emergency Contact Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work or Cell Phone Home Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information's/Guardian's Name Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work Phone Home Phone Work Phone Address Address

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Finance Division Employee Status Form Finance Division  

E-Print Network [OSTI]

's Date: Employee Name: Home Address: City/State: Zip/Postal Code: Work Phone Home Phone: Cell Phone Phone: Work Phone: Cell Phone: Relationship: Name (2): Address: State/Province: Zip/Postal Code: Home Phone: Work Phone: Cell Phone: Relationship: Special Notes: Department New Employee Resignation Change

Crews, Stephen

442

University of Washington Transplant Services Rev. 5/23/02  

E-Print Network [OSTI]

.: City: State: Country: Zip Code: - Home Phone: Work Phone: Ext.: Cell Phone: Home Phone: Cell phone: Work Phone: DEMOGRAPHIC INFORMATION LIVING KIDNEY DONOR FORM #12;University to you: Street Address: Apt No: City, State, Zip: Home Phone: Cell phone: Work Phone: EMPLOYER Name

Borenstein, Elhanan

443

UCR 09/2014 Washington Academic Internship Program  

E-Print Network [OSTI]

: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if different from above: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 09/2014 Do you currently receive): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship: Address: City: State

444

#~i;:~~.:(' . AQUATIC PLANT CONTROL  

E-Print Network [OSTI]

-4 EFFECTS OF WATER CHEMISTRY ON SUBMERSED AQUATIC PLANTS: A SYNTHESIS by R. Michael Smart Environmental. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City. State, and ZIP Code) 3909 Halls Ferry Road IDENTIFICATION NUMBER ORGANIZATION (If applicable) US Army Corps of Engineers Be. ADDRESS (City, Stitte

US Army Corps of Engineers

445

LES VOYAGEURS College of Agriculture Ambassadors  

E-Print Network [OSTI]

. - Uphold the policies outlined by the LSU Code of Student Conduct. - Make a commitment of time and energy area of study, questions regarding the transition into college life, campus activities, and other address City State Zip Local phone number Home phone number Home address City State Zip Country E

446

Note: The State Clearinghouse will assign identification numbers for all new projects. If a SCH number already exists for a project (e.g. Notice of Preparation or previous draft document) please fill in.  

E-Print Network [OSTI]

: City: Zip: County: Project Location: County: City/Nearest Community: Cross Streets: Zip Code: Longitude Waste Land Use Drainage/Absorption Population/Housing Balance Toxic/Hazardous Cumulative Effects For LCNG Fueling Facility California Energy Commission Donald Coe 1516 Ninth Street (916) 654

447

Reference Buildings by Building Type: Outpatient health care  

Broader source: Energy.gov [DOE]

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

448

Reference Buildings by Building Type: Hospital  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

449

Reference Buildings by Building Type: Full service restaurant  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

450

Reference Buildings by Building Type: Large office  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

451

Introduction to SAS Programming Registration Form  

E-Print Network [OSTI]

* Date of Birth Employer Job Title Work Address * Home Address City / State / Zip * City / State / Zip a certificate, you must complete at least 80% of the online quizzes and programming activities with scores of 70% or higher. Certificates of completion may take up to two weeks to process once your program has concluded

452

UPS, the UPS brandmark and the color brown are trademarks that are used with permission by the owner, United Parcel Service of America, Inc. All rights reserved. You may type directly into this form  

E-Print Network [OSTI]

UPS, the UPS brandmark and the color brown are trademarks that are used with permission VALUE Post / Zip Post / Zip UPS NEXT DAY AIR Most deliveries made by 10:30 a.m. UPS GROUND Delivery in 15 business days (in-state deliveries usually arrive next day) UPS WORLDWIDE SAVERSM Int'l Service

Jones, Michelle

453

A Second-Site Noncomplementation Screen for Modifiers of Rho1 Signaling during Imaginal Disc Morpogenesis in Drosophila  

E-Print Network [OSTI]

+/+ RhoGEF2 11-3b 21 31 (239) 25 75 (61) Rho1 E3.10 +/+ RhoGEF2 11-3b 21 20 (143) 25 20 (30) Rho1 k02107b +/+ RhoGEF2 11-3b 21 80 (5) 25 100 (9) Rho1 J3.8 +/+ RhoGEF2 11-3b 21 55 (62) 25 91 (22) Rho1 E(br)246 +/+ zip E(br) 21 50 (82) 25 66 (44) Rho1 E...(br)233 +/+ zip E(br) 21 20 (102) 25 66 (29) Rho1 E3.10 +/+ zip E(br) 21 ND 25 33 (12) Rho1 k02107b +/+ zip E(br) 21 ND 25 ND Rho1 J3.8 +/+ zip E(br) 21 95 (20) 25 97 (30) a Balanced, Rho heterozygous mutant virgin females were crossed to either w 1118...

Patch, Kistie; Stewart, Shannon; Welch, Aaron; Ward, Robert

2009-10-23T23:59:59.000Z

454

Materiais Didticos REORIENTAO  

E-Print Network [OSTI]

GEOGRAFIA Materiais Didticos REORIENTAO CURRICULAR #12;#12;GOVERNO DO ESTADO DO RIO DE JANEIRO PEDAGGICO Alba Rodrigues Cruz #12;#12;GOVERNO DO ESTADO DO RIO DE JANEIRO SECRETARIA DE ESTADO DE EDUCAO

Liu, I-Shih

455

Materiais Didticos REORIENTAO  

E-Print Network [OSTI]

HISTRIA Materiais Didticos REORIENTAO CURRICULAR #12;#12;GOVERNO DO ESTADO DO RIO DE JANEIRO PEDAGGICO Alba Rodrigues Cruz #12;#12;GOVERNO DO ESTADO DO RIO DE JANEIRO SECRETARIA DE ESTADO DE EDUCAO

Liu, I-Shih

456

REORIENTAO Materiais Didticos  

E-Print Network [OSTI]

REORIENTAO CURRICULAR Materiais Didticos FILOSOFIA #12;GOVERNO DO ESTADO DO RIO DE JANEIRO PEDAGGICO Alba Rodrigues Cruz #12;GOVERNO DO ESTADO DO RIO DE JANEIRO SECRETARIA DE ESTADO DE EDUCAO

Liu, I-Shih

457

Materiais Didticos REORIENTAO  

E-Print Network [OSTI]

SOCIOLOGIA Materiais Didticos REORIENTAO CURRICULAR #12;GOVERNO DO ESTADO DO RIO DE JANEIRO PEDAGGICO Alba Rodrigues Cruz #12;GOVERNO DO ESTADO DO RIO DE JANEIRO SECRETARIA DE ESTADO DE EDUCAO

Liu, I-Shih

458

Materiais Didticos REORIENTAO  

E-Print Network [OSTI]

CINCIAS Materiais Didticos REORIENTAO CURRICULAR #12;#12;GOVERNO DO ESTADO DO RIO DE JANEIRO PEDAGGICO Alba Rodrigues Cruz #12;#12;GOVERNO DO ESTADO DO RIO DE JANEIRO SECRETARIA DE ESTADO DE EDUCAO

Liu, I-Shih

459

Cartilha para Legalizao de Casas Religiosas  

E-Print Network [OSTI]

temtico, para que juntos pudssemos trabalhar para manter no Governo do Estado do Rio de Janeiro este Estadual de Assistncia Social e Direitos Humanos Governo do Estado do Rio de Janeiro #12;5 OGovernodo

460

Neoconcretism and the making of Brazilian national culture, 1954-1961  

E-Print Network [OSTI]

cultural da imprensa: Brasil 1900-2000. Rio de Janeiro:A dcada de 1950 no Brasil. Rio de Janeiro: Topbooksa Reforma do Jornal do Brasil. Dois Estudos de Comunicao

Alvarez, Mariola V.

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

E-Print Network 3.0 - annelida polychaeta del Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

do Rio de Janeiro CCS -Bloco A -Ilha do Fundo CEP 21940-590 -Rio de Janeiro -RJ -Brasil Summary: . Captulo 7 Filo Annelida Classe Polychaeta PAIVA, P.C. 2006. Captulo 7....

462

E-Print Network 3.0 - annelida polychaeta terebellida Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

do Rio de Janeiro CCS -Bloco A -Ilha do Fundo CEP 21940-590 -Rio de Janeiro -RJ -Brasil Summary: . Captulo 7 Filo Annelida Classe Polychaeta PAIVA, P.C. 2006. Captulo 7....

463

E-Print Network 3.0 - ao rio embu-mirim Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PUCRio Rua Marques de Sao Vicente 225... 110, 22460-320 Rio de Janeiro, RJ, Brasil ruben,jonas,lvelho@visgraf.impa.br 2TeCGraf Grupo de... , 22451041 Rio de Janeiro,...

464

Indoor air movement acceptability and thermal comfort in hot-humid climates  

E-Print Network [OSTI]

Instituto Nacional de Metrologia. Rio de Janeiro, DirioQ.I.I. Instituto Nacional de Metrologia; 2009. p. 27. [17]27, Instituto Nacio- nal de Metrologia, Rio de Janeiro.

Candido, Christhina Maria

2010-01-01T23:59:59.000Z

465

SIMULATION OF CROSS FLOW PAST A TUBE BANK EMPLOYING AN ADAPTIVE PARALLEL / VECTOR FINITE ELEMENT PROCEDURE  

E-Print Network [OSTI]

Engenharia Civil, COPPE Comissão Nacional de Energia Nuclear Universidade Federal do Rio de Janeiro 21945­970 ­ Rio de Janeiro ­ RJ ­ Brasil 21945­910 ­ Rio de Janeiro ­ RJ ­ Brasil SUMMARY The numerical simulation

Coutinho, Alvaro L. G. A.

466

Ambiente Integrado para Posicionamento em Operac~oes Militares GUSTAVO MOREIRA PIERRE1  

E-Print Network [OSTI]

Brasil, Rua Magno Martins, Rio de Janeiro, RJ, Brasil gustavopierre@uol.com.br 2 Tecgraf­Pontif´icia Universidade Cat´olica, Rua Marqu^es de S~ao Vicente, 225, 22453-900 - G´avea, Rio de Janeiro, RJ, Brasil, 22460 Rio de Janeiro, RJ, Brasil tron@impa.br Abstract. With technological development, we have been

467

N 4, quinta-feira, 5 de janeiro de 2012 27ISSN 1677-7042 Este documento pode ser verificado no endereo eletrnico http://www.in.gov.br/autenticidade.html,  

E-Print Network [OSTI]

abril de 2007, seção 2, página 6. JOS? HENRIQUE PAIM FERNANDES COORDENA??O DE APERFEI?OAMENTO DE PESSOAL docentes. O Presidente da Coordenação de Aperfeiçoamento de Pes- soal de Nível Superior - Capes, no uso das

Floeter, Sergio Ricardo

468

Dublin Oxford Portland New York Los Angeles Mexico City San Jose Santiago Rio de Janeiro Madrid The Hague Bern 1 of 17 Kiev Casablanca Johannesburg Amman Dubai Karachi Mumbai Tokyo Beijing Bangkok Kuala Lumpur Singapore  

E-Print Network [OSTI]

reduction mandates. This is precisely the reason emissions trading has received so much attention during the development of both domestic and international climate change policy. Properly structured, emissions trading can significantly cut the costs of achieving any given reduction target. Emissions trading can

469

Driving Demand for Home Energy Improvements: Motivating residential customers to invest in comprehensive upgrades that eliminate energy waste, avoid high utility bills, and spur the economy  

E-Print Network [OSTI]

Conservation Corporation (WECC). The projects goal was toConservation Corporation (WECC was contracted to support theRESNET RFP RPV SMUD VCEM WECC ZIP Baltimore Neighborhood

Fuller, Merrian C.

2011-01-01T23:59:59.000Z

470

Matlab-Kinect Interface Code  

E-Print Network [OSTI]

This .zip file contains code and installation instructions for acquiring 3d arm movements in Matlab using the Microsoft Kinect 3d camera. The provided code has been validated in 32-bit and 64-bit Matlab with 32-bit and ...

Kowalski, Kevin

2012-06-01T23:59:59.000Z

471

GT Human Resources PERSONAL DATA FORM  

E-Print Network [OSTI]

GT Human Resources PERSONAL DATA FORM Page 1 Updated: 05/01/2014 Student Employee? Yes No Print clearly using black or blue ink. Personal Information Name) __________________________________________________________________________________________ (City) (State) (Zip) (County) Personal Telephone #: (_______)________-__________ GT Work Telephone

Jacobs, Laurence J.

472

E-Print Network 3.0 - approaches reveal splicing Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RNA Structures... Structures at Mammalian Splice Sites Keywords: RNA secondary structure; looping-out; long-range; alternative... splicing; SF1; HNRNPK; ZFX; ZIP7; SLC39A7; ZNF384;...

473

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' Thursday, January 15, 2015  

E-Print Network [OSTI]

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' CONFERENCE Thursday, January 15, 2015 Maneeley. Connecticut Vegetable & Small Fruit Growers' Conference (We need folks to pre-register so Maneeley's has:______________________________________ ---- Town:______________ State:_____ Zip:____________ ---- Check off: Vegetable grower ___ Fruit grower

Alpay, S. Pamir

474

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name  

E-Print Network [OSTI]

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name Remit to Address City State Zip Code SECTION 2 INSTRUCTIONS Use the link to view approved categories. Vendor Number (if known) DP Requester AP Entry Check

de Lijser, Peter

475

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

1A Miami, Florida Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida In addition to the ZIP file for each building type, you can directly view the...

476

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Boulder, Colorado Reference Buildings by Climate Zone and Representative City: 5B Boulder, Colorado In addition to the ZIP file for each building type, you can directly view the...

477

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Chicago, Illinois Reference Buildings by Climate Zone and Representative City: 5A Chicago, Illinois In addition to the ZIP file for each building type, you can directly view the...

478

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Phoenix, Arizona Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona In addition to the ZIP file for each building type, you can directly view the...

479

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

7 Duluth, Minnesota Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota In addition to the ZIP file for each building type, you can directly view the...

480

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Baltimore, Maryland Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland In addition to the ZIP file for each building type, you can directly view...

Note: This page contains sample records for the topic "janeiro brazil zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C Seattle, Washington Reference Buildings by Climate Zone and Representative City: 4C Seattle, Washington In addition to the ZIP file for each building type, you can directly view...

482

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Atlanta, Georgia Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia In addition to the ZIP file for each building type, you can directly view the...

483

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

8 Fairbanks, Alaska Reference Buildings by Climate Zone and Representative City: 8 Fairbanks, Alaska In addition to the ZIP file for each building type, you can directly view the...

484

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Las Vegas, Nevada Reference Buildings by Climate Zone and Representative City: 3B Las Vegas, Nevada In addition to the ZIP file for each building type, you can directly view the...

485

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Houston, Texas Reference Buildings by Climate Zone and Representative City: 2A Houston, Texas In addition to the ZIP file for each building type, you can directly view the...

486

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Helena, Montana Reference Buildings by Climate Zone and Representative City: 6B Helena, Montana In addition to the ZIP file for each building type, you can directly view the...

487

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C San Francisco, California Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California In addition to the ZIP file for each building type, you can...

488

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Los Angeles, California Reference Buildings by Climate Zone and Representative City: 3B Los Angeles, California In addition to the ZIP file for each building type, you can...

489

APPLICATION FOR ADMISSION TO UNDECIDED-GRAD CLASSIFICATION For Office Use Only GRADUATE SCHOOL, WASHINGTON STATE UNIVERSITY  

E-Print Network [OSTI]

) (State) (Zip) (County if Washington) Gender M F Date of Birth Place of Birth Are you a citizen of the U State University: Fall (year) Spring (year) Summer (year) Location: Pullman Spokane Tri-Cities Vancouver

Collins, Gary S.

490

REQUEST FOR REENROLLMENT GRADUATE SCHOOL  

E-Print Network [OSTI]

-Mail Address Present address (Street) (City) (State) (Zip) (County if Washington) Telephone (Work) (Home 20 Location: Pullman Spokane Tri-Cities Vancouver Global Campus (On-line) I am stating

Collins, Gary S.

491

The Evolution of a Modular Software Network Miguel A. Fortuna  

E-Print Network [OSTI]

The Evolution of a Modular Software Network Miguel A. Fortuna , Juan A. Bonachela, and Simon A the website of this journal as a zip folder. To whom correspondence should be addressed. E-mail: fortuna

Fortuna, Miguel A.

492

U.S. DEPARTMENT OF ENERGY  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

YLARS 1 AM I'U*CHASQVO MY HOME BY ( )MORTGAGE () UND CONTRACT NAME ADDRESS CITY STATE ZIP PHONE (HOME )..... .. (CELL) (WORK). fF.ST TIME TO CALL ( 9 am to l pm) (I pm to S pm )...

493

Furman Graduate Studies Registration Form 2013 Spring Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

494

Furman Graduate Studies Registration Form 2013 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

495

PARENT INFORMATION FORM WWEELLCCOOMMEE PPRROOUUDD AANNTTEEAATTEERR PPAARREENNTTSS!!  

E-Print Network [OSTI]

: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status: Single Preferred Phone: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status Last Relationship to Student: Language Spoken at Home: Address: Street City State Zip Preferred Phone

Barrett, Jeffrey A.

496

Child Information: Our Little Village  

E-Print Network [OSTI]

/State/Zip Parent Information: Student ID #: _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email Insurance Information: Provider Provider Phone Policy Holder Policy

Escher, Christine

497

Schiefelbusch Hearing Clinic  

E-Print Network [OSTI]

_______ Zip_____________ E-Mail Cell Phone (____)_____________ Day Phone (____)_______________ Evening Phone to Jane Wegner by email at jwegner@ku.edu or by phone at 864-4690. Camper Information Camper Name

498

Furman Graduate Studies Registration Form 2014 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

499

UT EID# __________ Student ID #: __________ AY: 20____ -20____ School: ____________________________ Grade: ________________  

E-Print Network [OSTI]

: ___________________________________________ _________________________________________________________ CITY STATE ZIP Home Phone: ___________________ Cell#: __________________ Student Email _________________ ______________ ___________ __________ Parent(1)/Guardian Address Home Phone # Work Phone # Primary Language _________________ ______________ ___________ __________ Parent(2)/Guardian Address Home Phone # Work Phone # Primary Language In case of an emergency, contact

Texas at Austin, University of

500

Trends in template/fragment-free protein structure prediction  

E-Print Network [OSTI]

1998) Pathways to a protein folding intermediate observed instudy of all-atom protein folding and structure predic-JD, Dill KA (2007) Protein folding by zipping and assembly.

Zhou, Yaoqi; Duan, Yong; Yang, Yuedong; Faraggi, Eshel; Lei, Hongxing

2011-01-01T23:59:59.000Z