Powered by Deep Web Technologies
Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

DOE - Office of Legacy Management -- Rogers Iron Works Co - MO 10  

Office of Legacy Management (LM)

Rogers Iron Works Co - MO 10 Rogers Iron Works Co - MO 10 FUSRAP Considered Sites Site: ROGERS IRON WORKS CO. (MO.10 ) Elimination from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Rogers Iron Co. MO.10-1 Location: Joplin , Missouri MO.10-1 Evaluation Year: 1990 MO.10-2 MO.10-3 Site Operations: Tested C-liner crushing methods. MO.10-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material handled MO.10-3 MO.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Trace Amounts) MO.10-2 Radiological Survey(s): None Indicated Site Status: Elimination from consideration under FUSRAP Also see Documents Related to ROGERS IRON WORKS CO. MO.10-1 - National Lead Company of Ohio Analytical Data Sheet 9908;

2

Re: RE: RE: FW: kink BilLlehr 0 Marcia K McNutt  

E-Print Network [OSTI]

to let you know that I am working on this while both Steve > > > and Jasper are out. I will get you : Haden, Steven K > > Sent: Monday, May 31, 2010 4:35 AM > > To: Peijs, Jasper > > Cc: Benko , Brittany D > > Subj ect: FW: kink > > > > > > Jasper, > > > > I'm back i n the UK until t omorrow. Grateful if you

Fleskes, Joe

3

EP Exploration Place Lot FW Far West Lot  

E-Print Network [OSTI]

PARKING EP Exploration Place Lot W West Lot FW Far West Lot N North Lot NW North West Lot E East FOR THE ARTS (W) University Drive to City Centre Valley Road Coulee Trail Aperture Drive LIBRARY (L) N TURCOTTE

Morris, Joy

4

550 FW 3 Documenting and Implementing Decisions | Open Energy...  

Open Energy Info (EERE)

and Implementing Decisions Jump to: navigation, search OpenEI Reference LibraryAdd to library Legal Document- OtherOther: 550 FW 3 Documenting and Implementing DecisionsLegal...

5

FW204 -INTRODUCTION TO FISHERY BIOLOGY (3 CREDITS) COURSE OUTLINE FALL 2012  

E-Print Network [OSTI]

that will be developed in greater detail in subsequent classes (e.g., FW400, FW401, FW402, FW405). Second, students edition1 · Supplemental readings (website or handed out in class)2 · Warner College of Natural Resources to reflect overall class performance. 1 Available at the Campus Bookstore ($86 used/$114.75 new) or online

6

FW405 FISH PHYSIOLOGY (3 CREDITS) COURSE OUTLINE SPRING 2011  

E-Print Network [OSTI]

1 FW405 ­ FISH PHYSIOLOGY (3 CREDITS) COURSE OUTLINE ­ SPRING 2011 I. Lecture: Time: Place: Monday, or by appointment. II. Required Materials o Fishes: An Introduction to Ichthyology, 5th edition (at CSU bookstore, or by appointment. VI. Course Description Physiological ecology of fishes, focusing on the diverse range

7

DESIGN OF FISH AND WILDLIFE PROJECTS (FW 370) Fall Semester, 2010  

E-Print Network [OSTI]

DESIGN OF FISH AND WILDLIFE PROJECTS (FW 370) Fall Semester, 2010 INSTRUCTOR: Dr. Will Clements in fish, wildlife and conservation biology. The course format will include lectures, group discussion Assignments and Homework......................................... 15% #12;FW 370- DESIGN OF FISH AND WILDLIFE

8

ORIGINAL PAPER Fine mapping of fw3.2 controlling fruit weight in tomato  

E-Print Network [OSTI]

ORIGINAL PAPER Fine mapping of fw3.2 controlling fruit weight in tomato Na Zhang · Marin Talbot in the Solanaceae family. One of the key traits selected during domestication is fruit mass which is con- trolled by many quantitative trait loci. The fruit weight locus fw3.2 is one of the major loci responsible

van der Knaap, Esther

9

F2k : GLAST Hartmut F.-W. Sadrozinski , SCIPP, UC Santa Cruz Radiation Issues  

E-Print Network [OSTI]

F2k : GLAST Hartmut F.-W. Sadrozinski , SCIPP, UC Santa Cruz Radiation Issues in GLAST Si Science Design of Challenges Radiation Issues Hartmut F.-W. Sadrozinski Santa Cruz Institute for Particle Physics of modular design · NASA, DoE, DoD, INFN/ASI, Japan, CEA, IN2P3, Sweden Challenges of Science in Space

California at Santa Cruz, University of

10

FY 2008-2018 F&W Program Project Solicitation Section 10. Narrative  

E-Print Network [OSTI]

FY 2008-2018 F&W Program Project Solicitation Section 10. Narrative Project ID: 2008-301-00 Lead Transport Inc. 1999 gasoline spill settlement fund. It is anticipated that over the next ten years (2008

11

FW204 -INTRODUCTION TO FISHERY BIOLOGY (3 CREDITS) COURSE OUTLINE FALL 2010  

E-Print Network [OSTI]

concepts of fisheries biology that will be developed in greater detail in subsequent classes (e.g., FW400nd edition1 · Supplemental readings (website or handed out in class)2 · Warner College of Natural using the scale on the following page. Final grades may be adjusted to reflect overall class performance

12

Property maps for abrasion resistance of materials F.W. Zok *, A. Miserez  

E-Print Network [OSTI]

Property maps for abrasion resistance of materials F.W. Zok *, A. Miserez Materials Department and tangential loads, a mechanistic framework has been developed for assessing material resistance to initiation the plastic zone at sharp contacts. Material property groups that characterize abrasion resistance emerge from

Zok, Frank

13

work  

Broader source: Energy.gov (indexed) [DOE]

THE THE U.S. DEPARTMENT OF ENERGY'S WORKING CAPITAL FUND U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL OFFICE OF AUDIT SERVICES OCTOBER 1998 AUDIT REPORT CR-B-99-01 MEMORANDUM FOR THE DIRECTOR, BUSINESS MANAGEMENT STAFF FROM: William S. Maharay Acting Manager, Capital Regional Audit Office, Office of Inspector General SUBJECT: INFORMATION : Audit Report on the Department's Working Capital Fund BACKGROUND The Department established the Working Capital Fund (Fund) in January 1996 as a financial management tool for charging the costs of common services provided at Headquarters to Departmental program offices. The objectives in establishing the Fund were to increase efficiency of the Department's operations, improve management of administrative services

14

FW 400 Conservation of Fish in Aquatic Ecosystems Lectures: TR 10-10:50 am 132 Wagar Building  

E-Print Network [OSTI]

FW 400 Conservation of Fish in Aquatic Ecosystems Fall 2011 Lectures: TR 10-10:50 am 132 Wagar Building Field trips: Two Saturday field trips are required: 24 Sept. or October 1 (plains fishes); 8 October (native trout and transition zone fishes) Instructor: Dr. James Roberts 102 Wagar Building 491

15

FW 400 Conservation of Fish in Aquatic Ecosystems Lectures: TR 10-10:50 am 132 Wagar Building  

E-Print Network [OSTI]

FW 400 Conservation of Fish in Aquatic Ecosystems Fall 2012 Lectures: TR 10-10:50 am 132 Wagar to understanding and restoring global aquatic biodiversity and fishery resources. Island Press, Covello, CA. Course aquatic organisms and the aquatic ecosystems that sustain them, 2) physical and biotic processes

16

REL-1001/6-001 FW MW 14:30-15:45 Religion & Identity in Contemporary Canada Colorado REL-1002/6-050 FW MW 17:30-18:45 Exploring Religion: The World s Religions Janzen  

E-Print Network [OSTI]

Colorado REL-3/4940/3-001 W TH 14:30-17:15 Topics in Modern Western Culture Colorado ( &( &( &( & REL-2703REL-1001/6-001 FW MW 14:30-15:45 Religion & Identity in Contemporary Canada Colorado REL-1002:30-11:20 Religion & Pop Culture Colorado REL-2402/3-001 F MWF 10:30-11:20 Fundamentalisms in Global Perspective

Martin, Jeff

17

FW Response to Notice of Inquire on Questions Concerning Technology Transfer Tractices at DOE Laboratories.txt - Notepad  

Broader source: Energy.gov (indexed) [DOE]

esponse to Notice of Inquire on Questions Concerning Technology Transfer Tractices at DOE Laboratories. esponse to Notice of Inquire on Questions Concerning Technology Transfer Tractices at DOE Laboratories. From: Malozemoff, Alex [AMalozemoff@amsc.com] Sent: Tuesday, January 27, 2009 4:09 PM To: GC-62 Cc: Ballard, Thomas B.; McGahn, Daniel Subject: FW: Response to Notice of Inquire on Questions Concerning Technology Transfer Tractices at DOE Laboratories > Response to Fed Register 73, no. 229, Nov. 26, 2008 Notices > > DOE Questions Concerning Technology Transfer Practices at DOE > Laboratories > > Answer by > > Dr. Alexis P. Malozemoff > Executive V. P. and Chief Technical Officer > American Superconductor > 64 Jackson Rd., Devens MA 01434 USA > ph: 978-842-3331 > cell: 508-243-9693 > amalozemoff@amsc.com > > 1. American Superconductor (AMSC), a leader in alternative energy

18

Iron Pots and Kettles  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Pots and Kettles Iron Pots and Kettles Nature Bulletin No. 544-A November 16, 1974 Forest Preserve District of Cook County George W. Dunne, President Roland F. Eisenbeis, Supt. of Conservation IRON POTS AND KETTLES At Possum Trot Hill, on US 150 west of Danville, a huge iron kettle squats as a monument to what was once an important industry in Illinois. It is one of 80 used from 1824 to 1831 for boiling down brine from salt springs in that vicinity. Salt was a luxury then. About a bushel was produced from one kettleful (100 gallons) of brine and that was worth more than 100 bushels of oats. Those 80 monsters came from Kentucky where iron works had been established to make the utensils and implements desperately needed by pioneer families. About half of them had come up through the Cumberland Gap, on horseback, with only a rifle, an ax, a pot for cooking, some bedding and the clothes on their backs. Every family, in addition to a skillet or spider, and a Dutch oven, coveted a big kettle for making salt, soap, candles and maple syrup, butchering hogs, rendering lard, boiling clothes on wash day, and dyeing homespun material for garments.

19

Lack of iron | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lack of iron Lack of iron Iron-bearing minerals in sediments naturally reduce contaminant levels The Science The release of wastes associated with nuclear reprocessing from storage...

20

Impact of mine closure and access facilities on gas emissions from old mine workings to surface: examples of French iron and coal  

E-Print Network [OSTI]

with a vent to enable mine gas outflow in specific conditions. Measurements stations were installed on mine conditions. Some parts of the basin are under gas capture stations influence. This is not the case in "La1 Impact of mine closure and access facilities on gas emissions from old mine workings to surface

Boyer, Edmond

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Iron Absorption  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Absorption Iron Absorption Name: Mary Location: N/A Country: N/A Date: N/A Question: I wrote before to Steve and got a answer back. I would like more information. The cirmcustances were that I first had anaemia and then I went for a gastroscopy. The results of which were I had insufficient acid been produced in the stomach. I was told that acid was nessary for the absorbion of iron and it was because of this that I became anaemic. I was told to eat plently of red meat not too many vegetables. Is there any other information you can give me? Replies: It is very difficult to say for sure without seeing you chart and I am not your doctor. But it sounds to me like you are deficient in the vitamin B12. In your stomach you have 3 basic types of cells. One is called chief cells which secrete the precursor of the enzyme pepsin which begins the breakdown of protein. Another is called the parietal cells which secrete your stomach acid and a substance called intrinsic factor. Now-switch to your bone marrow which is where your red blood cells are made. In order for your red blood cells to mature in the bone marrow, vitamin B12 is necessary. B12 can only be obtained from animal food sources such as meat, milk and eggs. Unfortunately, B12 cannot be absorbed in the stomach without intrinsic factor. If there is sufficient B12 present in the diet, it can be stored in the liver. If you aren't eating enough animal sources your B12 will be taken from your liver until you run out. You could also be deficient in intrinsic factor. So while the outcome is anemia (not enough red blood cells) the problem could be from a few different things. Follow your doctor's recommendations and eat more sources of B12

22

The early development of iron-working  

Science Journals Connector (OSTI)

... no previous tradition of metallurgy but the ready availability of high-grade ores and the pyrotechnic skill demonstrated by the Nok clay figurines fulfil some of the necessary preconditions.

T.C. Champion

1980-04-10T23:59:59.000Z

23

FW370 -Design of Fish and Wildlife Projects -Spring 2012 Course Meeting Times/Places: Tu/Th 10-11:40, Wagar 107 (Lecture & Discussion) or NR 232, CLL West (Lab)  

E-Print Network [OSTI]

FW370 - Design of Fish and Wildlife Projects - Spring 2012 Course Meeting Times/Places: Tu/Th 10 of this course is to introduce you to the principles of conducting sound scientific research in fish, wildlife of the scientific method in fish, wildlife, and conservation biology research (from asking good questions

24

FW370 Design of Fish and Wildlife Projects Spring 2011 Course Meeting Times/Places: Tu/Th 1011:40, Wagar 107 (Lecture & Discussion) or NR 232, CLL West (Lab)  

E-Print Network [OSTI]

FW370 Design of Fish and Wildlife Projects Spring 2011 Course Meeting Times/Places: Tu/Th 1011 is to introduce you to the principles of conducting sound scientific research in fish, wildlife, and conservation of the scientific method in fish & wildlife research (from asking good questions to designing experiments

25

Orchestration of Iron Homeostasis  

Science Journals Connector (OSTI)

...act simultaneously, and some are interrelated. Intestinal iron absorption increases with decreased iron stores, increased erythropoietic activity, anemia, or hypoxemia. Conversely, intestinal iron absorption decreases in the presence of inflammation a process that contributes to the anemia of inflammation... The characterization of newly identified genes has led investigators to challenge previous models of the regulation of iron homeostasis in health and its dysregulation in disease. Drs. Robert Fleming and Bruce Bacon describe hepcidin and iron homeostasis.

Fleming R.E.; Bacon B.R.

2005-04-28T23:59:59.000Z

26

Columbia River Basin Accords -Narrative Proposal Form 1 FY 2008-2009 F&W Program Accords (MOA) Proposal Review  

E-Print Network [OSTI]

will work closely and in collaboration with the Upper Columbia Salmon Recovery Board, BPA, Washington State&W Program Accords (MOA) Proposal Review Narrative Table 1. Proposal Metadata Project Number 2009-002-00 Proposer Bob Rose; Yakama Nation Fisheries Resources Program Short Description A Status and Trend Annual

27

Simulation of iron impurity gettering in crystalline silicon solar cells  

E-Print Network [OSTI]

This work discusses the Impurity-to-Efficiency (12E) simulation tool and applet. The 12E simulator models the physics of iron impurity gettering in silicon solar cells during high temperature processing. The tool also ...

Powell, Douglas M. (Douglas Michael)

2012-01-01T23:59:59.000Z

28

The Rusting of Iron  

Science Journals Connector (OSTI)

... glass tubes instead of flasks, and the surface of the metal was in some cases roughened with a coarse file. After the admission of the iron, the tubes were drawn ...

J. NEWTON FRIEND

1906-09-27T23:59:59.000Z

29

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

30

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

31

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

32

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

33

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

34

It's Elemental - The Element Iron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Manganese Manganese Previous Element (Manganese) The Periodic Table of Elements Next Element (Cobalt) Cobalt The Element Iron [Click for Isotope Data] 26 Fe Iron 55.845 Atomic Number: 26 Atomic Weight: 55.845 Melting Point: 1811 K (1538°C or 2800°F) Boiling Point: 3134 K (2861°C or 5182°F) Density: 7.874 grams per cubic centimeter Phase at Room Temperature: Solid Element Classification: Metal Period Number: 4 Group Number: 8 Group Name: none What's in a name? From the Anglo-Saxon word iron. Iron's chemical symbol comes from the Latin word for iron, ferrum. Say what? Iron is pronounced as EYE-ern. History and Uses: Archaeological evidence suggests that people have been using iron for at least 5000 years. Iron is the cheapest and one of the most abundant of all metals, comprising nearly 5.6% of the earth's crust and nearly all of the

35

In vitro magnetic hyperthermia response of iron oxide MNPs incorporated in DA3, MCF-7 and HeLa cancer cell lines  

Science Journals Connector (OSTI)

In the current work, iron oxide magnetic nanoparticles (MNPs) were...3-(iron acetylacetonate) compounds in high-boiling organic solvents containing...in vitro hyperthermia results, very fast thermal response was...

Evangelos I. Gkanas

2013-07-01T23:59:59.000Z

36

Availability of iron from iron-storage proteins to marine phytoplankton  

Science Journals Connector (OSTI)

Genes coding for iron-storage proteins are common in DNA samples from seawater. In iron-deprived marine ecosystems, iron-storage proteins may be important...

37

Magnetism of iron. II  

Science Journals Connector (OSTI)

A previously developed theory of the magnetism of iron, based upon the notion of a randomized exchange field, is modified and extended. It is shown that Coulomb fields arise in association with the randomized exchange field; the modification allows one to take into account these fields, which are found to change the details of the previous results without affecting the main conclusions. The theory has been extended to calculate the properties of the model at finite temperatures: the Curie temperature (1840 K), the magnetization curve, the paramagnetic susceptibility (a Curie-Weiss law), and the effective interatomic exchange coupling are calculated for iron. The magnitudes of the atomic spin moments were found to vary little up to 1.5 times the Curie temperature.

J. Hubbard

1979-12-01T23:59:59.000Z

38

The magnetism of iron  

Science Journals Connector (OSTI)

A type of theory capable of reconciling the localized- and itinerant-electron models of a ferromagnetic metal is discussed. This kind of theory contemplates a distribution of "exchange field" configurations which correspond very roughly to the spin configurations of the localized model. Computations involve thermal averages over these configurations, each configuration V having an effective energy E(V). Starting from the band structure for ferromagnetic iron, the E(V) have been estimated for certain configurations V. The results are reasonably consistent with the observed Curie temperature of iron, in spite of the presence of exchange fields ?1-2 eV, and give some suggestion of behavior characteristic of the Heisenberg model.

J. Hubbard

1979-03-01T23:59:59.000Z

39

Microbial reduction of iron ore  

DOE Patents [OSTI]

A process is provided for reducing iron ore by treatment with microorganisms which comprises forming an aqueous mixture of iron ore, microorganisms operable for reducing the ferric iron of the iron ore to ferrous iron, and a substrate operable as an energy source for the microbial reduction; and maintaining the aqueous mixture for a period of time and under conditions operable to effect the reduction of the ore. Preferably the microorganism is Pseudomonas sp. 200 and the reduction conducted anaerobically with a domestic wastewater as the substrate. An aqueous solution containing soluble ferrous iron can be separated from the reacted mixture, treated with a base to precipitate ferrous hydroxide which can then be recovered as a concentrated slurry.

Hoffmann, Michael R. (Pasadena, CA); Arnold, Robert G. (Pasadena, CA); Stephanopoulos, Gregory (Pasadena, CA)

1989-01-01T23:59:59.000Z

40

Microbial reduction of iron ore  

DOE Patents [OSTI]

A process is provided for reducing iron ore by treatment with microorganisms which comprises forming an aqueous mixture of iron ore, microorganisms operable for reducing the ferric iron of the iron ore to ferrous iron, and a substrate operable as an energy source for the microbial reduction; and maintaining the aqueous mixture for a period of time and under conditions operable to effect the reduction of the ore. Preferably the microorganism is Pseudomonas sp. 200 and the reduction conducted anaerobically with a domestic wastewater as the substrate. An aqueous solution containing soluble ferrous iron can be separated from the reacted mixture, treated with a base to precipitate ferrous hydroxide which can then be recovered as a concentrated slurry. 11 figs.

Hoffmann, M.R.; Arnold, R.G.; Stephanopoulos, G.

1989-11-14T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

MECS 2006- Iron and Steel  

Broader source: Energy.gov [DOE]

Manufacturing Energy and Carbon Footprint for Iron and Steel Sector (NAICS 3311, 3312) with Total Energy Input, October 2012 (MECS 2006)

42

Iron and Steel (2010 MECS)  

Broader source: Energy.gov [DOE]

Manufacturing Energy and Carbon Footprint for Iron and Steel Sector (NAICS 3311, 3312) Energy use data source: 2010 EIA MECS (with adjustments) Footprint Last Revised: February 2014

43

Climate VISION: Private Sector Initiatives: Iron and Steel: Work...  

Office of Scientific and Technical Information (OSTI)

measurement and reporting protocols; 2) identifying and implementing near-term, cost-effective opportunities to reduce greenhouse gas emission intensity; 3) developing...

44

Transcriptional and translational regulatory responses to iron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Candidatus Pelagibacter ubique cultures to iron limitation in natural seawater media supplemented with a siderophore to chelate iron. MethodologyPrincipal Findings:...

45

Kumba Iron Ore | Open Energy Information  

Open Energy Info (EERE)

Kumba Iron Ore Jump to: navigation, search Name: Kumba Iron Ore Place: Pretoria, South Africa Zip: 175 Sector: Solar Product: South Africa based mining company. The firm is...

46

Microstructure evolution in irons and steels: a tribute to David V. Edmonds  

E-Print Network [OSTI]

as cementite and cast iron, and in a variety of non-ferrous fields including high-density tungsten and uranium for his work, including the Vana- dium Award from the Institute of Materials, Minerals and Mining in both

Cambridge, University of

47

Residual stress measurement on ductile cast iron using critically refracted longitudinal (Lcr) wave technique  

E-Print Network [OSTI]

using ultrasonics was approached. Residual stresses in castings are developed for various reasons. The presence of these stresses, coupled with applied stresses in service, sometimes results in the yield of material and subsequent failure of component.... Present work was focussed on development of an ultrasonic technique using critically refracted longitudinal (L g waves for evaluating residual stresses in ductile cast iron. An L probe suitable to work with ductile cast iron was designed and fabricated...

Chundu, Srinivasulu Naidu

2012-06-07T23:59:59.000Z

48

Going To Work: Work Relationships  

E-Print Network [OSTI]

One of a worker's top goals should be to develop good relationships with coworkers and supervisers. This publication discusses five general rules for building good relationships at work and offers advice on handling criticism....

Hoffman, Rosemarie

2000-07-20T23:59:59.000Z

49

Method for reducing iron losses in an iron smelting process  

DOE Patents [OSTI]

A process of smelting iron that comprises the steps of: a) introducing a source of iron oxide, oxygen, nitrogen, and a source of carbonaceous fuel to a smelting reactor, at least some of said oxygen being continuously introduced through an overhead lance; b) maintaining conditions in said reactor to cause (i) at least some of the iron oxide to be chemically reduced, (ii) a bath of molten iron to be created and stirred in the bottom of the reactor, surmounted by a layer of slag, and (iii) carbon monoxide gas to rise through the slag; c) causing at least some of said carbon monoxide to react in the reactor with the incoming oxygen, thereby generating heat for reactions taking place in the reactor; and d) releasing from the reactor an offgas effluent, is run in a way that keeps iron losses in the offgas relatively low. After start-up of the process is complete, steps (a) and (b) are controlled so as to: e) keep the temperature of the molten iron at or below about 1550.degree. C. and f) keep the slag weight at or above about 0.8 tonne per square meter.

Sarma, Balu (Airmont, NY); Downing, Kenneth B. (Greenville, SC)

1999-01-01T23:59:59.000Z

50

Method for reducing iron losses in an iron smelting process  

DOE Patents [OSTI]

A process of smelting iron that comprises the steps of: (a) introducing a source of iron oxide, oxygen, nitrogen, and a source of carbonaceous fuel to a smelting reactor, at least some of said oxygen being continuously introduced through an overhead lance; (b) maintaining conditions in said reactor to cause (1) at least some of the iron oxide to be chemically reduced, (2) a bath of molten iron to be created and stirred in the bottom of the reactor, surmounted by a layer of slag, and (3) carbon monoxide gas to rise through the slag; (c) causing at least some of said carbon monoxide to react in the reactor with the incoming oxygen, thereby generating heat for reactions taking place in the reactor; and (d) releasing from the reactor an offgas effluent, is run in a way that keeps iron losses in the offgas relatively low. After start-up of the process is complete, steps (a) and (b) are controlled so as to: (1) keep the temperature of the molten iron at or below about 1550 C and (2) keep the slag weight at or above about 0.8 ton per square meter. 13 figs.

Sarma, B.; Downing, K.B.

1999-03-23T23:59:59.000Z

51

Iron Edison Battery Company | Open Energy Information  

Open Energy Info (EERE)

Iron Edison Battery Company Iron Edison Battery Company Jump to: navigation, search Logo: Iron Edison Battery Company Name Iron Edison Battery Company Place Lakewood, Colorado Sector Bioenergy, Carbon, Efficiency, Hydro, Renewable Energy, Solar, Wind energy Product Nickel Iron (Ni-Fe) battery systems Year founded 2011 Number of employees 1-10 Phone number 202-681-4766 Website http://ironedison.com Region Rockies Area References Iron Edison Battery Company[1] Nickel Iron Battery Specifications[2] About the company and the owners[3] Nickel Iron Battery Association[4] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Iron Edison Battery Company is a company based in Lakewood, Colorado. Iron Edison is redefining off-grid energy storage using advanced

52

Process for the synthesis of iron powder  

DOE Patents [OSTI]

A process for preparing iron powder suitable for use in preparing the iron-potassium perchlorate heat-powder fuel mixture used in thermal batteries, comprises preparing a homogeneous, dense iron oxide hydroxide precipitate by homogeneous precipitation from an aqueous mixture of a ferric salt, formic or sulfuric acid, ammonium hydroxide and urea as precipitating agent; and then reducing the dense iron oxide hydroxide by treatment with hydrogen to prepare the iron powder. 2 figs.

Welbon, W.W.

1983-11-08T23:59:59.000Z

53

Process for the synthesis of iron powder  

DOE Patents [OSTI]

A process for preparing iron powder suitable for use in preparing the iron-potassium perchlorate heat-powder fuel mixture used in thermal batteries, comprises preparing a homogeneous, dense iron oxide hydroxide precipitate by homogeneous precipitation from an aqueous mixture of a ferric salt, formic or sulfuric acid, ammonium hydroxide and urea as precipitating agent; and then reducing the dense iron oxide hydroxide by treatment with hydrogen to prepare the iron powder.

Not Available

1982-03-06T23:59:59.000Z

54

Working Copy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 Effective Date: 11/05/13 WP 12-IS.01-6 Revision 10 Industrial Safety Program - Visitor, Vendor, User, Tenant, and Subcontractor Safety Controls Cognizant Section: Industrial Safety/Industrial Hygiene Approved By: Tom Ferguson Working Copy Industrial Safety Program - Visitor, Vendor, User, Tenant, and Subcontractor Safety Controls WP 12-IS.01-6, Rev. 10 2 TABLE OF CONTENTS CHANGE HISTORY SUMMARY ..................................................................................... 7 ACRONYMS AND ABBREVIATIONS ............................................................................. 8 1.0 INTRODUCTION 1 ............................................................................................... 10 2.0 VISITORS ........................................................................................................... 11

55

Working Copy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DOE/WIPP-99-2286 Waste Isolation Pilot Plant Environmental Notification or Reporting Implementation Plan Revision 7 U.S. Department of Energy December 2013 This document supersedes DOE/WIPP-99-2286, Rev. 6. Working Copy Waste Isolation Pilot Plant Environmental Notification or Reporting Implementation Plan DOE/WIPP-99-2286, Rev. 7 2 TABLE OF CONTENTSCHANGE HISTORY SUMMARY .............................................. 3 ACRONYMS AND ABBREVIATIONS ............................................................................ 4 1.0 INTRODUCTION .................................................................................................. 6 2.0 NOTIFICATION OR REPORTING REQUIREMENTS AND COMMITMENTS ..... 7

56

Work Address:  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BO SAULSBURY BO SAULSBURY Work Address: Home Address: Oak Ridge National Laboratory 12952 Buckley Road National Transportation Research Center Knoxville, TN 37934 Building NTRC-2, Room 118 (865) 288-0750 Oak Ridge, TN 37831-6479 (865) 574-4694 saulsburyjw@ornl.gov Technical Specialties: Land use planning Environmental and socioeconomic impact assessment National Environmental Policy Act (NEPA) project management Vehicle fuel economy Education: 1986 B. A., History (minors in English and Business), The University of Tennessee 1989 M. S., Planning, The University of Tennessee (Thesis title: Land Use Compatibility Planning for Airfield Environs: Intergovernmental Cooperation to Protect Land Users From the Effects of Aircraft Operations)

57

Absorption of Iron from Ferritin Is Independent of Heme Iron and Ferrous Salts in Women and Rat Intestinal Segments .  

E-Print Network [OSTI]

??Ferritin iron from food is readily bioavailable to humans and has the potential for treating iron deficiency. Whether ferritin iron absorption is mechanistically different from (more)

Theil, Elizabeth C.

2012-01-01T23:59:59.000Z

58

Iron supported clay as catalysts for oxidation of cyclooctane  

Science Journals Connector (OSTI)

Iron supported bentonite clay catalysts have been prepared by the ion exchange of bentonite with iron2+ and iron3+ solution and immobilization with iron compounds using ligands: acetylacetonate, picolinate, pyraz...

W. Trakarnpruk; P. Dumrongpong

2006-05-01T23:59:59.000Z

59

Microsoft Word - IronCore  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

November/December 2013 November/December 2013 Percolation Explains How Earth's Iron Core Formed The formation of Earth's metallic core, which makes up a third of our planet's mass, represents the most significant differentiation event in Earth's history. Earth's present layered structure with a metallic core and an overlying silicate mantle would have required mechanisms to separate iron alloy from a silicate phase. Percolation of liquid iron alloy moving through a solid silicate matrix (much as water percolates through porous rock, or even coffee grinds) has been proposed as a possible model for core formation (Figure 1). Many previous experimental results have ruled out percolation as a major core formation mechanism for Earth at the relatively lower pressure conditions in the upper mantle, but

60

Ligand effects on bioinspired iron complexes  

E-Print Network [OSTI]

THE HYDROPHILIC PHOSPHATRIAZAADAMANTANE LIGAND IN THE DEVELOPMENT OF H2-PRODUCTION ELECTROCATALYSTS: IRON HYDROGENASE MODEL COMPLEXES ............................................................................................. 44 Results... THE HYDROPHILIC PHOSPHATRIAZAADAMANTANE LIGAND IN THE DEVELOPMENT OF H2-PRODUCTION ELECTROCATALYSTS: IRON HYDROGENASE MODEL COMPLEXES ............................................................................................. 44 Results...

Mejia Rodriguez, Ma. del Rosario

2005-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Rare Iron Oxide in Ancient Chinese Pottery  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Rare Iron Oxide in Ancient Chinese Pottery Rare Iron Oxide in Ancient Chinese Pottery Print Friday, 26 September 2014 14:37 Jian ware (or Tenmoku) ceramic bowls, famous for their...

62

Synthesis of monodisperse iron oxide nanocrystals by thermal decomposition of iron carboxylate salts{  

E-Print Network [OSTI]

's group12 recently published a study of c-Fe2O3 nanocrystals with different shapes. Iron acetylacetonateSynthesis of monodisperse iron oxide nanocrystals by thermal decomposition of iron carboxylate September 2004 Iron oxide (Fe3O4, magnetite) nanocrystals of 6 to 30 nm with narrow size distributions (s

Richards-Kortum, Rebecca

63

Computational study: Reduction of iron corrosion in lead coolant of fast nuclear reactor  

SciTech Connect (OSTI)

In this paper we report molecular dynamics simulation results of iron (cladding) corrosion in interaction with lead coolant of fast nuclear reactor. The goal of this work is to study effect of oxygen injection to the coolant to reduce iron corrosion. By evaluating diffusion coefficients, radial distribution functions, mean-square displacement curves and observation of crystal structure of iron before and after oxygen injection, we concluded that a significant reduction of corrosion can be achieved by issuing about 2% of oxygen atoms into lead coolant.

Arkundato, Artoto; Su'ud, Zaki; Abdullah, Mikrajuddin; Widayani [Physics Department, ITB, Bandung (Indonesia) and Physics Department, University of Jember, Jl. Kalimantan III/25, Jember (Indonesia); Physics Department, ITB Jl. Ganesha 10, Bandung (Indonesia)

2012-06-20T23:59:59.000Z

64

Technology development for iron F-T catalysts. Final report  

SciTech Connect (OSTI)

The objectives of this work were twofold. The first objective was to design and construct a pilot plant for preparing precipitated iron oxide F-T precursors and demonstrate that the rate of production from this plant is equivalent to 100 lbs/day of dried metal oxide. Secondly, these precipitates were to be used to prepare catalysts capable of achieving 88% CO + H{sub 2} conversion with {le} 5 mole percent selectivity to methane + ethane.

Frame, R.R.; Gala, H.B.

1994-08-01T23:59:59.000Z

65

Wastewater Ozonation Catalyzed by Iron  

Science Journals Connector (OSTI)

Another attempt to improve ozonation removal efficiency is the use of metals or their oxides to catalyze ozonation. ... The waveforms were generated by a potentiostat BAS model Epsilon-2. ... Sreethawong, T.; Chavadej, S.Color removal of distillery wastewater by ozonation in the absence and presence of immobilized iron oxide catalyst J. Hazard. ...

Anaid Cano Quiroz; Carlos Barrera-Di?az; Gabriela Roa-Morales; Patricia Balderas Herna?ndez; Rubi? Romero; Reyna Natividad

2010-09-23T23:59:59.000Z

66

Fischer-Tropsch synthesis over iron-rhodium alloy catalysts  

SciTech Connect (OSTI)

To investigate the nature of iron-rhodium alloy catalysts during the Fischer-Tropsch synthesis, a combination of experimental techniques were applied. Infrared spectroscopy was mainly used to extract direct information on the surface of catalysts under the reaction conditions. In addition, Mossbauer spectroscopy was employed to study the iron alloy catalysts. Further characterization of the catalysts was performed by chemisorption measurements. Hydrocarbon products of the CO + H/sub 2/ synthesis reaction were analyzed by gas chromatography. The working surface of a silica-supported rhodium catalyst was found to be saturated with molecular carbon monoxide. The intensity of the linear carbonyl absorption band remained constant compared to that for room temperature CO adsorption, while that of the bridge-bonded carbonyl absorption band was drastically reduced during the Fischer-Tropsch synthesis. The bridge-bonded adsorption sites are assumed to be the active sites for dissociating carbon monoxide. The hydrogenation rate of the linearly adsorbed carbon monoxide was much slower than the steady state reaction rate. The alloy catalyst did not form a bulk carbide, but the presence of surface carbon was suggested by the large shift of the linear carbonyl absorption band. On the other hand, infrared spectra on an iron catalyst showed only weak bands, indicating a high degree of CO dissociation. On a silica-supported iron-rhodium alloy catalyst, surface analysis by infrared spectroscopy presents evidence of well-mixed alloy formation. Three models of carbon monoxide adsorption were identified.

Choi, S.

1983-01-01T23:59:59.000Z

67

Formation of Iron Oxyfluoride Phase on the Surface of Nano-Fe3O4 Conversion Compound for Electrochemical Energy Storage  

Science Journals Connector (OSTI)

Formation of Iron Oxyfluoride Phase on the Surface of Nano-Fe3O4 Conversion Compound for Electrochemical Energy Storage ... (21) In this work we aim to follow an alternate route for converting iron oxides to oxyfluorides using a controlled fluorination process. ... The FBR method used in this study for conversion of iron oxide to oxyfluorides using low pressure fluorine gas mixed with an inert carrier gas (He) is a relatively simple and safe process used routinely for fluorination studies. ...

Hui Zhou; Jagjit Nanda; Surendra K. Martha; Jamie Adcock; Juan C. Idrobo; Loc Baggetto; Gabriel M. Veith; Sheng Dai; Sreekanth Pannala; Nancy J. Dudney

2013-10-21T23:59:59.000Z

68

Economic analysis of transportation directly reduced iron (DRI) through ship  

Science Journals Connector (OSTI)

Directly reduced iron (DRI) is a major source of iron units in cases of low scrap availability and/or hot metal. Its main advantage is it is low content of phosphorus and sulphur. Removal of phosphorus and sulphur demands high energy consumption in steel making process. With fast depleting sources of cooking coal, the availability of hot metal will decrease in the coming years. Also, scrap availability is already on the declining trend. Hence, DRI is going to be the main source of iron units in the future, especially in electric arc furnace (EAF steel making). The disadvantage of DRI usages lies in it is high reactivity. Freshly produced DRI possesses high susceptibility to oxidation whenever it comes in contact with air. The generated heat in the oxidation reaction increases the tendency to oxidation, thereby, starting a short of chain reaction and ultimately leading to the burning of DRI. This phenomenon makes storage and handling of DRI a concern. The problem caused loss of one cargo in Delta steel company, Nigeria. The authors of this dissertation were given the responsibility to work out the solution in the minimum possible time for implementing it to the next shipments. It is heartening that the problem could be successfully solved and implemented in the next shipments in November '06. Hence, after above work implementation of the recommendations for a $45 risk/ton of DRI, only $1 is to be spent for protection against the risk.

Manikant K. Paswan; Chinmoy Mukherjee

2012-01-01T23:59:59.000Z

69

How Minds Work Working & Episodic Memory  

E-Print Network [OSTI]

1 How Minds Work Working & Episodic Memory Stan Franklin Computer Science Division & Institute for Intelligent Systems The University of Memphis #12;HMW: Working and Episodic Memory 2 Memory Systems #12;HMW: Working and Episodic Memory 3 #12;HMW: Working and Episodic Memory 4 Percept · Result of filtering

Memphis, University of

70

IRON-PHOSPHATE GLASS FOR IMMOBILIZATION OF RADIOACTIVE TECHNETIUM  

SciTech Connect (OSTI)

Technetium-99 (Tc-99) can bring a serious environmental threat because of its high fission yield, long half-life, and high solubility and mobility in the ground water. The present work investigated the immobilization of Tc-99 (surrogated by Re) by heat-treating mixtures of an iron-phosphate glass with 1.5 to 6 wt.% KReO{sub 4} at {approx}1000 C. The Re retention in the glass was as high as {approx}1.2 wt. % while the loss of Re by evaporation during melting was {approx}50%. Re was uniformly distributed within the glass. The normalized Re release by the 7-day Product Consistency Test was {approx}0.39 g/m{sup 2}, comparable with that in phosphate-bonded ceramics and borosilicate glasses. These results suggest that iron-phosphate glass can provide a good matrix for immobilizing Tc-99.

KRUGER AA; HRMA PR; XU K; CHOI J; UM W; HEO J

2012-03-19T23:59:59.000Z

71

Nanostructure, Chemistry and Crystallography of Iron Nitride...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Nanostructure, Chemistry and Crystallography of Iron Nitride Magnetic Materials by Ultra-High-Resolution Electron Microscopy and Related Methods Nanostructure, Chemistry and...

72

Characterization and Reactivity of Iron Nanoparticles Prepared...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

as solute within the iron core of the HRCO particles. Kinetic batch experiments of carbon tetrachloride (CT) degradation were performed to quantitatively compare the redox...

73

Minnesota Jobs to Come with Efficient Iron Plant | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Minnesota Jobs to Come with Efficient Iron Plant Minnesota Jobs to Come with Efficient Iron Plant Minnesota Jobs to Come with Efficient Iron Plant October 22, 2009 - 11:24am Addthis Eric Barendsen Energy Technology Program Specialist, Office of Energy Efficiency and Renewable Energy In 1957, Marlene Pospeck moved to the town of Hoyt Lakes, Minnesota, a small, quiet community surrounded by forests and lakes where just about everyone knows everyone else. Little did she know she'd become mayor in 1996 and have to lead the town through economic calamity. Marlene's father worked for the local mining company, which opened its doors in the mid-1950s. Her husband worked at the company's plant for 37 years as a machinist, and the couple raised three daughters in Hoyt Lakes. So when Mayor Pospeck heard the mining company was bankrupt in December

74

Electrochemical Studies of Packed Iron Powder Electrodes: Effects...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Packed Iron Powder Electrodes: Effects of Common Constituents of Natural Waters on Corrosion Electrochemical Studies of Packed Iron Powder Electrodes: Effects of Common...

75

Bioreduction of hematite nanoparticles by the dissimilatory iron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

nanoparticles by the dissimilatory iron reducing bacterium Shewanella oneidensis MR-1. Bioreduction of hematite nanoparticles by the dissimilatory iron reducing bacterium...

76

Formation of iron complexs from trifluoroacetic acid based liquid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of iron complexs from trifluoroacetic acid based liquid chromatography mobile phases as interference ions in liquid Formation of iron complexs from trifluoroacetic acid based...

77

Influence of Iron Redox Transformations on Plutonium Sorption...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

state of iron in the system. Experiments were conducted to examine the effect of sediment iron mineral composition and oxidation state on plutonium sorption and oxidation...

78

Biostimulation of Iron Reduction and Subsequent Oxidation of...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biostimulation of Iron Reduction and Subsequent Oxidation of Sediment Containing Fe-silicates and Fe-oxides: Effect of Redox Biostimulation of Iron Reduction and Subsequent...

79

Demonstration of Combined Zero-Valent Iron and Electrical Resistance...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Demonstration of Combined Zero-Valent Iron and Electrical Resistance Heating for In Situ Trichloroethene Remediation. Demonstration of Combined Zero-Valent Iron and Electrical...

80

Watermelon-like iron nanoparticles: Cr doping effect on magnetism...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Watermelon-like iron nanoparticles: Cr doping effect on magnetism and magnetization interaction reversal. Watermelon-like iron nanoparticles: Cr doping effect on magnetism and...

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Neutron Spin Resonance in Iron-based Superconductors | The Ames...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Neutron Spin Resonance in Iron-based Superconductors The propagation of a novel magnetic excitation in the superconducting state, called a spin resonance, has been observed in iron...

82

Iron is the Key to Preserving Dinosaur Soft Tissue  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the iron associated with fossil tissues, which occurred primarily as the mineral goethite. They then employed experiments to show that iron, derived from hemoglobin lysate,...

83

Microbial Reduction of Uranium under Iron- and Sulfate-reducing...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Uranium under Iron- and Sulfate-reducing Conditions: Effect of Amended Goethite on Microbial Community Microbial Reduction of Uranium under Iron- and Sulfate-reducing Conditions:...

84

Solid-solid phase transition measurements in iron  

SciTech Connect (OSTI)

Previously, dynamic experiments on iron have observed a non-zero transition time and width in the solid-solid {alpha}-{var_epsilon} phase transition. Using Proton Radiography at the Los Alamos Neutron Science Center, we have performed plate impact experiments on iron to further study the {alpha}-{var_epsilon} phase transition which occurs at 13GPa. A 40mm bore powder gun was coupled to a proton radiography beam line and imaging system and synchronized to the impact of the projectile on the target sample with the proton beam pattern. A typical experimental configuration for the iron study, as shown below in 3 color-enhanced radiographs, is a 40mm diameter aluminum sabot impacting a 40mm diameter of polycrystalline ARMCO iron. The iron is backed by a sapphire optical window for velocimetry measurements. The aluminum flyer on the left of the iron is barely visible for visual display purposes. Direct density jumps were measured which corresponded to calculations to within 1% using a Wondy mUlti-phase equation of state model. In addition, shock velocities were measured using an edge fitting technique and followed that edge movement from radiograph to radiograph, where radiographs are separated in time by 500 ns. Preliminary measurements give a shock velocity (P1 wave) of 5.251 km/s. The projectile velocity was 0.725 km/s which translate to a peak stress of 17.5 GPa. Assuming the P1 wave is instantaneous, we are able to calibrate the chromatic, motion, object and camera blur by measuring the width of the P1 wave. This approximation works in this case since each of the two density jumps are small compared to the density of the object. Subtracting the measured width of the P1 wave in quadrature from the width of the P2 wave gives a preliminary measurement of the transition length of 265 {mu}m. Therefore, a preliminary measured phase transition relaxation time {tau} = transition length/u{sub s} = 265 {mu}m/5.251 km/s = 50 ns. Both Boettger and Jensen conclude that the transition rate and likely the transition mechanisms depend on the impact stress and the sample thickness. Since Proton Radiography can measure directly the transition length as well as the shock velocity, a transition time can be directly calculated. With higher higher energy protons we have better resolution of the measured width and edge locations. This will allow a more precise measurement of phase transition relaxation time. We propose to perform a series of experiments to measure the phase transition relaxation time, {tau}, as a function of drive and sample size.

Schwartz, Cynthia Louise [Los Alamos National Laboratory

2010-01-01T23:59:59.000Z

85

Production of iron from metallurgical waste  

DOE Patents [OSTI]

A method of recovering metallic iron from iron-bearing metallurgical waste in steelmaking comprising steps of providing an iron-bearing metallurgical waste containing more than 55% by weight FeO and FeO equivalent and a particle size of at least 80% less than 10 mesh, mixing the iron-bearing metallurgical waste with a carbonaceous material to form a reducible mixture where the carbonaceous material is between 80 and 110% of the stoichiometric amount needed to reduce the iron-bearing waste to metallic iron, and as needed additions to provide a silica content between 0.8 and 8% by weight and a ratio of CaO/SiO.sub.2 between 1.4 and 1.8, forming agglomerates of the reducible mixture over a hearth material layer to protect the hearth, heating the agglomerates to a higher temperature above the melting point of iron to form nodules of metallic iron and slag material from the agglomerates by melting.

Hendrickson, David W; Iwasaki, Iwao

2013-09-17T23:59:59.000Z

86

Formation and Reactivity of Biogenic Iron Microminerals  

SciTech Connect (OSTI)

The overall purpose of the project is to explore and quantify the processes that control the formation and reactivity of biogenic iron microminerals and their impact on the solubility of metal contaminants. The research addresses how surface components of bacterial cells, extracellular organic material, and the aqueous geochemistry of the DIRB microenvironment impacts the mineralogy, chemical state and micromorphology of reduced iron phases.

Beveridge, Terrance J.; Glasauer, Susan; Korenevsky, Anton; Ferris, F. Grant

2000-08-08T23:59:59.000Z

87

Drinking Water Problems: Iron and Manganese  

E-Print Network [OSTI]

Iron and manganese can give water an unpleasant taste, odor and color. In this publication you'll learn how to know whether your water contains iron or manganese and how to eliminate these contaminants with various treatment methods such as aeration...

Dozier, Monty; McFarland, Mark L.

2004-02-20T23:59:59.000Z

88

Magnetism in iron and nickel  

Science Journals Connector (OSTI)

The fluctuating local band theory of itinerant electron ferromagnetism in nickel and iron is investigated with the use of first-principles numerical calculations. In this theory the excitations predominantly responsible for the phase transition are fluctuations in the direction of local magnetization. The free energy in the presence of a fluctuation is evaluated numerically in the approximation that this direction changes in time and space slowly enough to justify the use of the static approximation and second-order perturbation theory. The energies and wave functions used to incorporate the band and wavevector dependence of the relevant interaction matrix elements were obtained by Slater-Koster fits to earlier ab initio self-consistent energy bands. Results for nickel and iron are obtained in terms of an effective classical Heisenberg exchange. This is compared with other theoretical calculations and available experimental data. From the numerical results, it is concluded that both quantum effects (the time dependence of the exchange field) and local-field effects are important to account for the transition temperature TC.

C. S. Wang; R. E. Prange; V. Korenman

1982-05-01T23:59:59.000Z

89

Iron phosphate glass for immobilization of 99Tc  

SciTech Connect (OSTI)

Technetium-99 (99Tc) can bring serious environmental threats because of its long half-life (t1/2 = ~2.1 x 105 years), high fission yield (~6%), and high solubility and mobility in the ground water. The high volatility makes it difficult to immobilize 99Tc in continuous melters vitrifying 99Tc-containing nuclear wastes in borosilicate glasses. This work explores a possibility of incorporating a high concentration of 99Tc, surrogated by the non-radioactive Re, in an iron phosphate glass by melting mixtures of iron phosphate glass frits with 1.5-6 mass% KReO4 at ~1000 C. The retention of Re achieved was ~1.1 mass%. The normalized Re release by the 7-day Product Consistency Test was <10*2 g/m2. Surprisingly, the Re escaped from the melt within a short time of heating, especially when the temperature was increased. Therefore, 99Tc volatilization would still be a challenging task for its immobilization in iron phosphate glasses.

Xu, Kai; Hrma, Pavel R.; Um, Wooyong; Heo, Jong

2013-06-15T23:59:59.000Z

90

NO release during chemical looping combustion with iron ore as an oxygen carrier  

Science Journals Connector (OSTI)

Abstract Chemical looping combustion (CLC) is one of the promising technologies to capture CO2 with low cost. Owing to the existence of nitrogen in fuel, the emission of fuel-NOx is a significant concern during the CLC process. This work evaluated NO release in the CLC process of bituminous coal and petcoke using iron ore as an oxygen carrier in a fluidized bed. The effect of several factors was evaluated, including bed material, fuel type, temperature and gasification medium. The results indicate that in the fuel reactor (FR), fuel-NOx due to the reaction between NH3/HCN and iron ore was supported only when the iron ore was reduced from Fe2O3 to Fe3O4. Compared with the case of an inert bed material, NO yield during the gasification in an iron ore bed material was relatively higher due to the enhanced char-gasification and the oxidization effect of iron ore. For the bituminous coal, NO release in FR was mainly due to the volatile release and subsequent oxidation by iron ore. For the petcoke process, NO release in FR could mainly be ascribed to the char-gasification and subsequent oxidization of NOx-precursors by iron ore. The elevated temperature and the use of H2O/N2 in comparison to CO2 could efficiently enhance the fuel conversion and \\{NOx\\} precursors release in FR. Thus, NO yield in FR increased, whereas that in AR correspondingly decreased. Furthermore, the NO release during continuous coal CLC was investigated in a 1 kWth CLC prototype based on the iron ore oxygen carrier. Overall, the elevated fuel reactor temperature and the use of H2O as gasification medium are beneficial to reduce NO release in the CLC system.

Haiming Gu; Laihong Shen; Zhaoping Zhong; Xin Niu; Huijun Ge; Yufei Zhou; Shen Xiao; Shouxi Jiang

2014-01-01T23:59:59.000Z

91

Towards improved iron-based catalysts for direct coal liquefaction  

SciTech Connect (OSTI)

Iron-based catalysts for direct coal liquefaction (DCL) have several advantages: they are cheap and environmentally benign, and have a reasonable activity in the sulfide form. Work in this area has recently been collected and published. work in our laboratory has focussed on catalysts made with ferric sulfide as a precursor. This material is unstable even at room temperature, and disproportionates to form pyrite (FeS{sub x}; PY) , non-stoichiometric pyrrhotite (FeS{sub x}, x {approx} 1; PH) , and elemental S. The value of x and the relative amounts of PY and PH depend upon the time and temperature of disproportionation. Materials from hydrothermal disproportionation at 200{degrees}C for 1 h have roughly equal amounts of PH and PY (on an iron basis), and these materials appear to make the most active and selective catalysts for DCL. These catalyst precursors and catalyst materials have been characterized by atomic adsorption spectroscopy (AA), Auger electron spectroscopy (AES) and x-ray diffraction (XRD). The characterizations have been correlated to the reactions of Fe during disproportionation and to the performance of the catalysts. Improvements in these catalysts can be made in two ways: by altering the active sites, and by decreasing the particle sizes. In the present work, we present examples of both types. The active sites are altered by using small amounts of a second metal. The particle sizes are reduced by using an aerosol technique for preparation.

Dadyburjor, D.B.; Stiller, A.H.; Stinespring, C.D. [West Virginia Univ., Morgantown, WV (United States)] [and others

1994-12-31T23:59:59.000Z

92

Work Force Retention Work Group Charter  

Broader source: Energy.gov [DOE]

The Work force Retention Work Group is established to support the Departments critical focus on maintaining a high-performing work force at a time when a significant number of the workers needed to support DOEs national security mission are reaching retirement age.

93

Effect of Iron Species and Calcium Hydroxide on High-Sulfur Petroleum Coke CO2 Gasification  

Science Journals Connector (OSTI)

The effect of iron species on petroleum coke CO2 gasification was studied in the present work. The effects of the temperature (11731673 K), the catalyst types, catalyst loading (ranging from 0 to 5 wt %), and composition during the gasification of ...

Zhi-jie Zhou; Qi-jing Hu; Xin Liu; Guang-suo Yu; Fu-chen Wang

2012-01-24T23:59:59.000Z

94

KINETIC CONDENSATION AND EVAPORATION OF METALLIC IRON AND IMPLICATIONS FOR METALLIC IRON DUST FORMATION  

SciTech Connect (OSTI)

Metallic iron is one of the most abundant condensing materials in systems of solar abundance. Because metallic iron is responsible for the continuum opacity of dust particles, it has a large contribution to the thermal structure of circumstellar environments and hence to dust evolution itself. In order to understand the formation processes of metallic iron in circumstellar environments, condensation and evaporation kinetics of metallic iron were studied experimentally. Metallic iron condenses at the maximum rate with the condensation coefficient (a parameter ranging from 0 to 1 to represent kinetic hindrance for surface reaction) of unity under high supersaturation conditions, and evaporates nearly ideally (evaporation coefficient of unity) in vacuum. On the other hand, evaporation of metallic iron takes place with more kinetic hindrance in the presence of metallic iron vapor. It is also found that metallic iron atoms nucleate heterogeneously on Al{sub 2}O{sub 3}. Metallic iron does not necessarily condense homogeneously in circumstellar environments, but might condense through heterogeneous nucleation on pre-existing dust. Metallic iron formation proceeds with little kinetic hindrance for highly unequilibrated conditions, but the effects of kinetic hindrance may appear for evaporation and condensation occurring near equilibrium with a timescale of months to years in protoplanetary disks.

Tachibana, Shogo; Nagahara, Hiroko; Ozawa, Kazuhito; Ikeda, Youhei; Nomura, Ryuichi; Tatsumi, Keisuke; Joh, Yui, E-mail: tachi@eps.s.u-tokyo.ac.jp [Department of Earth and Planetary Science, University of Tokyo, 7-3-1 Hongo, Tokyo 113-0033 (Japan)

2011-07-20T23:59:59.000Z

95

Iron and Steel Energy Intensities  

U.S. Energy Information Administration (EIA) Indexed Site

If you are having trouble, call 202-586-8800 for help. Home > >Energy Users > Energy Efficiency Page > Iron and Steel Energy Intensities First Use of Energy Blue Bullet First Use/Value of Production Blue Bullet First Use/Ton of steel End Uses of Consumption Blue Bullet Total End Use/Value of Production Blue Bullet Total End Use/Ton of Steel Boiler Fuel as End Use Blue Bullet Boiler Fuel /Value of Production Blue Bullet Boiler Fuel /Ton of Steel Process Heating as End Use Blue Bullet Process Heating Fuel /Ton of Steel Blue Bullet Process Heating /Value of Production Machine Drive as End Use Blue Bullet Machine Drive Fuel/Ton of Steel Blue Bullet Machine Drive Fuel /Value of Production Expenditures Blue Bullet Purchased Fuel /Ton of Steel Blue Bullet Purchased Fuel /Value of Production

96

Why Sequence Freshwater Iron-Oxidizing Bacteria?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Freshwater Iron-Oxidizing Bacteria? Freshwater Iron-Oxidizing Bacteria? The goal of this project is to obtain complete genome sequences for six different freshwater iron (Fe)-oxidizing bacteria (FeOB). Four of these are oxygen-dependent iron-oxidizing β-proteobacteria, and three of these, Sideroxydans lithotrophicus, Gallionella capsiferriformans, and strain TW-2, are capable of chemolithoautotrophic growth (that is, obtaining energy by the oxidation of inorganic compounds) using Fe(II) as sole energy source under microaerobic (low-oxygen) conditions. The fourth organism, Leptothrix cholodnii, is a sheath-forming heterotrophic (i.e., using complex organic compounds for nutrition) organism that oxidizes both Fe(II) and Mn(II) and deposits a ferromanganic coating on its sheath. In addition,

97

Iron-air battery development program  

SciTech Connect (OSTI)

The progress and status of the research and development program on the iron-air advanced technology battery system at the Westinghouse Electric Corporation during the period June 1978-December 1979 are described. This advanced battery system is being developed for electric vehicle propulsion applications. Testing and evaluation of 100 cm/sup 2/ size cells was undertaken while individual iron and air electrode programs continued. Progress is reported in a number of these study areas. Results of the improvements made in the utilization of the iron electrode active material coupled with manufacturing and processing studies related to improved air electrodes continue to indicate that a fully developed iron-air battery system will be capable of fulfilling the performance requirements for commuter electric vehicles.

Buzzelli, E.S.; Liu, C.T.; Bryant, W.A.

1980-05-01T23:59:59.000Z

98

System and method for producing metallic iron  

DOE Patents [OSTI]

A method of production of metallic iron nodules comprises assembling a hearth furnace having a moveable hearth comprising refractory material and having a conversion zone and a fusion zone, providing a hearth material layer comprising carbonaceous material on the refractory material, providing a layer of reducible material comprising and iron bearing material arranged in discrete portions over at least a portion of the hearth material layer, delivering oxygen gas into the hearth furnace to a ratio of at least 0.8:1 ponds of oxygen to pounds of iron in the reducible material to heat the conversion zone to a temperature sufficient to at least partially reduce the reducible material and to heat the fusion zone to a temperature sufficient to at least partially reduce the reducible material, and heating the reducible material to form one or more metallic iron nodules and slag.

Englund, David J.; Schlichting, Mark; Meehan, John; Crouch, Jeremiah; Wilson, Logan

2014-07-29T23:59:59.000Z

99

Iron and the ecology of marine microbes  

E-Print Network [OSTI]

Iron is a cofactor of a number biochemical reactions that are essential for life. In the marine environment, this micronutrient is a scarce resource that limits processes of global importance such as photosynthesis and ...

Ventouras, Laure-Anne

2013-01-01T23:59:59.000Z

100

C:\Eco-SSLs\Final Guidance November 2003\Contaminant Specific\Iron\Eco-SSL for Iron.wpd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Iron Interim Final OSWER Directive 9285.7-69 U. S. Environmental Protection Agency Office of Solid Waste and Emergency Response 1200 Pennsylvania Avenue, N.W. Washington, DC 20460 November 2003 This page intentionally left blank TABLE OF CONTENTS SUMMARY OF ECO-SSLs FOR IRON . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ES - 1 1.0 INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 - 1 2.0 IRON GEOCHEMISTRY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 - 1 2.1 Weathering Processes Affect on Iron . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 - 3 2.2 Soil Conditions Affect on Iron . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 - 4 3.0 EFFECTS OF IRON ON PLANTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 - 1 3.1 Essentiality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 - 1 3.2 General Effects

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Elastic moduli of nickel and iron aluminides  

E-Print Network [OSTI]

ELASTIC MODULI OF NICKEL AND IRON ALUMINIDES A Thesis by SREEDHAR MAN JIGANI Submitted to the Oifice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 1993... Major Subject: Mechanical Engineering ELASTIC MODULI OF NICKEL AND IRON ALUMINIDES A Thesis by SREEDHAR MAN JIGANI Submitted to Texas AkM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved...

Manjigani, Sreedhar

2012-06-07T23:59:59.000Z

102

Muon trapping at monovacancies in iron  

Science Journals Connector (OSTI)

Positive-muonspin-rotation experiments were performed on electron irradiated iron. A new defect-associated frequency is observed which is assigned to muons trapped at monovacancies. The hyperfine field at the vacancy site is -0.956 T at 140 K. The diffusion constant for ?+ in iron deduced from the trapping rate follows an Arrhenius law with an activation energy of 383 meV between 90 and 190 K.

A. Mslang; H. Graf; G. Balzer; E. Recknagel; A. Weidinger; Th. Wichert; R. I. Grynszpan

1983-03-01T23:59:59.000Z

103

DOE - Office of Legacy Management -- Armco-Rustless Iron and Steel - MD 03  

Office of Legacy Management (LM)

Armco-Rustless Iron and Steel - MD Armco-Rustless Iron and Steel - MD 03 FUSRAP Considered Sites Site: Armco-Rustless Iron & Steel (MD.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: ARMCO Baltimore Works MD.03-1 Location: Baltimore , Maryland MD.03-2 Evaluation Year: 1987 MD.03-1 Site Operations: Test rolling of uranium billets. MD.03-2 MD.03-3 Site Disposition: Eliminated - Potential for contamination remote due to limited quantity of material and duration of test MD.03-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MD.03-2 Radiological Survey(s): Health and safety monitoring conducted during operations MD.03-2 Site Status: Eliminated from consideration under FUSRAP MD.03-1 Also see

104

Dopant Site Determination in Iron Oxide Nanoparticles Utilizing X-ray  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Dopant Site Determination in Iron Oxide Nanoparticles Utilizing X-ray Dopant Site Determination in Iron Oxide Nanoparticles Utilizing X-ray Absorption Techniques Monday, September 9, 2013 - 11:00am SLAC, Conference Room 137-322 Presented by Dr. Vanessa Pool The dopant behavior of spinels has been investigated for over half a century and yet new insight into this class of materials is still being made today. In this work, the question of dopant site preference is explored for the nanoparticle regime. Iron oxide nanoparticles have numerous exciting applications. To realize these applications, controlling the preferred dopant site and valence within the host material is important. X-ray Absorption Spectroscopy (XAS) and X-ray Magnetic Circular Dichroism (XMCD) are element specific techniques with magnetic contrast that give insights into the material composition. Using both

105

Iron Availability in the Southern Ocean  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Availability in the Southern Ocean Print Iron Availability in the Southern Ocean Print The Southern Ocean, circling the Earth between Antarctica and the southernmost regions of Africa, South America, and Australia, is notorious for its high-nutrient, low-chlorophyll areas, which are rich in nutrients-but poor in essential iron. Sea life is less abundant in these regions because the growth of phytoplankton-the marine plants that form the base of the food chain-is suppressed. A study by scientists from South Africa's Stellenbosch University, Princeton University, and the Advanced Light Source (ALS) suggests that it is not just a lack of iron, but a lack of iron in an easy-to-use form, that is affecting the ecosystems. The researchers sampled two north-south corridors across the Southern Ocean, traveling an easterly transect between the base of the South African National Antarctic Expeditions (SANAE IV) in Queen Maud Land and Cape Town, and a westerly transect between SANAE IV and South Georgia Island. Along the way they collected particles containing solid iron from a series of ocean systems with different characteristics.

106

Iron Availability in the Southern Ocean  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Availability in the Southern Ocean Print Iron Availability in the Southern Ocean Print The Southern Ocean, circling the Earth between Antarctica and the southernmost regions of Africa, South America, and Australia, is notorious for its high-nutrient, low-chlorophyll areas, which are rich in nutrients-but poor in essential iron. Sea life is less abundant in these regions because the growth of phytoplankton-the marine plants that form the base of the food chain-is suppressed. A study by scientists from South Africa's Stellenbosch University, Princeton University, and the Advanced Light Source (ALS) suggests that it is not just a lack of iron, but a lack of iron in an easy-to-use form, that is affecting the ecosystems. The researchers sampled two north-south corridors across the Southern Ocean, traveling an easterly transect between the base of the South African National Antarctic Expeditions (SANAE IV) in Queen Maud Land and Cape Town, and a westerly transect between SANAE IV and South Georgia Island. Along the way they collected particles containing solid iron from a series of ocean systems with different characteristics.

107

OSCARS Collaborative Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

OSCARS Collaborative Work Engineering Services The Network OSCARS How It Works Who's Using OSCARS? OSCARS and Future Tech OSCARS Standard and Open Grid Forum OSCARS Developers...

108

How It Works  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How It Works Engineering Services The Network OSCARS How It Works Who's Using OSCARS? OSCARS and Future Tech OSCARS Standard and Open Grid Forum OSCARS Developers Community Read...

109

E-Print Network 3.0 - assembly cellular iron Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: , iron storage function and cellular regulation. Biochim. Biophys. Acta Bioenerg. 1275: 161-203. HOFMANN... Availability of iron from iron-storage proteins to marine...

110

A Comparison of Iron and Steel Production Energy Intensity in China and the U.S  

E-Print Network [OSTI]

of Iron and Steel Production Energy Use and Energy Intensityof Iron and Steel Production Energy Intensity in China andof Iron and Steel Production Energy Intensity in China and

Price, Lynn

2014-01-01T23:59:59.000Z

111

Work with Biological Materials  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Work with Biological Materials Print Planning A complete Experiment Safety Sheet (ESS) is required before work can be done at the ALS. This ESS is either a part of the proposal...

112

Electrical Safe Work Practices  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electrical Safe Work Practices Electrical Safe Work Practices July 15, 2005 NOTE: Working hot is a last alternative All activities on or near electrically energized systems having live parts shall be conducted in accordance with the limitations and procedures specified in the latest version of NFPA 70E and with the safe work practices and conditions that follow. Only qualified personnel {as defined in NFPA 70E Article 110.6(D)} as authorized by supervisor can perform such work. Safe Work Practices: Know the equipment and potential hazards - Define the scope of work. Submit the scope of work to your supervisor for approval. Analyze the hazards use engineered methods to mitigate hazards. Establish procedures as necessary. Use barricades or other means to prevent unqualified persons crossing approach boundaries.

113

Carbon Emissions: Iron and Steel Industry  

U.S. Energy Information Administration (EIA) Indexed Site

Iron and Steel Industry Iron and Steel Industry Carbon Emissions in the Iron and Steel Industry The Industry at a Glance, 1994 (SIC Code: 3312) Total Energy-Related Emissions: 39.9 million metric tons of carbon (MMTC) -- Pct. of All Manufacturers: 10.7% -- Nonfuel Emissions: 22.2 MMTC Total First Use of Energy: 1,649 trillion Btu -- Pct. of All Manufacturers: 7.6% Nonfuel Use of Energy: 886 trillion Btu (53.7%) -- Coal: 858 trillion Btu (used to make coke) Carbon Intensity: 24.19 MMTC per quadrillion Btu Energy Information Administration, "1994 Manufacturing Energy Consumption Survey" and Emissions of Greenhouse Gases in the United States 1998 Energy-Related Carbon Emissions, 1994 Source of Carbon Carbon Emissions (million metric tons) All Energy Sources 39.9 Coal 22.7

114

Patterns of Iron Use in Societal Evolution  

Science Journals Connector (OSTI)

The iron stock needed to sustain peoples lives tends to saturate in industrialized countries around 8?12 tons per capita, indicating a long-term potential for the steel industry to dramatically shift resource use from primary (ore) to secondary (scrap) raw materials and thereby significantly save energy and greenhouse gas emissions. ... Figure 3. Per capita iron stocks in use versus per capita GDP PPP (1990 international dollars). ... Speculations about an absolute decoupling in steel demand, however, cannot be supported by this study: none of the analyzed countries shows a shrinking per-capita iron stock in use, which would be needed for long-term absolute decoupling of steel demand. ...

Daniel B. Mller; Tao Wang; Benjamin Duval

2010-12-01T23:59:59.000Z

115

Marine Diatoms Survive Iron Droughts in the Ocean by Storing Iron in  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Marine Diatoms Survive Iron Droughts in Marine Diatoms Survive Iron Droughts in the Ocean by Storing Iron in Ferritin Almost all organisms require iron as a co-factor in numerous metalloproteins and enzymes. In particular, phytoplankton, which are aquatic, free-drifting, single-celled organisms that can harvest energy from the sun, have an elevated demand for iron due to the large role it plays in their photosynthetic machinery. In 30-40% of the world's oceans iron concentrations are low enough to limit the growth of phytoplankton (Martin and Fitzwater 1988; Moore et al. 2002). New sources of iron to these regions are sporadic and typically include atmospheric dust deposition or weak upwelling of deep waters. figure 1 Figure 1: A light micrograph of the marine pennate diatom Pseudo-nitzschia multiseries. Shown are one whole cell and two partial cells connected at the cell tips in a chain. The brown components of the cells are the chloroplasts. Scale bar = 5 mm. (Image courtesy of K. Holtermann)

116

Interagency Sustainability Working Group  

Broader source: Energy.gov [DOE]

The Interagency Sustainability Working Group (ISWG) is the coordinating body for sustainable buildings in the federal government.

117

QEP WORKING GROUP CHARGES Assessment Working Group  

E-Print Network [OSTI]

. (Standard 2.12) During Phase I of the planning process, members of the Assessment Working Group with the institution's strategic plan, a review of the literature, definition of student learning appropriate related to goals. (Handbook for Review Committees, Standards 2.12 and 3.3.2) During Phase I

Liu, Paul

118

Work Permit # 51012MZ5 Work Order# '  

E-Print Network [OSTI]

Confined Space· 0 Ergonomics· 0 Material Handling o ,Beryllium· 0 Electrical 0 Hydraulic o Safety Harness o Electrical Working Hot o Electrical Noise 0 Potential to Cause aFalse Alarm o QiCombustible Gas o IHSurvey Dosimeter o LockoutITagout o Spill potential o Self-reading Pencil Dosimeter o Impair Fire Protection

Homes, Christopher C.

119

Working Group 7 Summary  

SciTech Connect (OSTI)

The primary subject of working group 7 at the 2012 Advanced Accelerator Concepts Workshop was muon accelerators for a muon collider or neutrino factory. Additionally, this working group included topics that did not fit well into other working groups. Two subjects were discussed by more than one speaker: lattices to create a perfectly integrable nonlinear lattice, and a Penning trap to create antihydrogen.

Nagaitsev S.; Berg J.

2012-06-10T23:59:59.000Z

120

Importance of Iron Mineralogy to Aerosol Solubility: Potential Effects of  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Importance of Iron Mineralogy to Importance of Iron Mineralogy to Aerosol Solubility: Potential Effects of Aerosol Source on Ocean Photosynthesis figure 1 Figure 1. Dust storm blowing glacial dusts from the Copper River Basin of southeast Alaska into the North Pacific Ocean, which depends on this and other external iron sources to support its biological communities. (Image: NASA MODIS satellite image, Nov. 1, 2006. http://earthobservatory.nasa.gov/IOTD/view.php?id=7094) Iron is one of the most important elements to life. Despite its paramount importance and relative abundance, dissolved iron concentrations are often very low, in part due to the formation of very stable iron minerals in most oxidizing environments. Since soluble iron is available to living organisms, iron deficiencies are widespread, and the factors that influence

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Decoupling of Iron and Phosphate in the Global Payal Parekh  

E-Print Network [OSTI]

with weaker wind stresses leads to a decrease in surface [PO4] and [Fe] in the Southern Ocean due (reviewed by Karl et al., 2002; Mills et al., 2004) have a greater iron requirement and iron availability

Follows, Mick

122

Iron oxide nanoparticles as a contrast agent for thermoacoustic tomography  

E-Print Network [OSTI]

radiation. The addition of an exogenous contrast agent improves image quality by more effectively converting microwave energy to heat. The use of iron oxide nanoparticles in MRI applications has been explored but super paramagnetic iron oxide nanoparticles...

Keho, Aaron Lopez

2009-06-02T23:59:59.000Z

123

Steam reforming utilizing iron oxide catalyst  

SciTech Connect (OSTI)

High activity steam reforming iron oxide catalysts are described. Such catalysts can be unsupported utilizing at least 90% by weight iron oxide and various modifiers (Ai/sub 2/O/sub 3/, K/sub 2/O, CaO, SiO/sub 2/) or unmodified and supported on such things as alumina, CaO impregnated alumina, and lanthanum stabilized alumina. When used in steam reformers such as autothermal and tubular steam reformers, these catalysts demonstrate much improved resistance to carbon plugging.

Setzer, H. T.; Bett, J. A. S.

1985-06-11T23:59:59.000Z

124

Lithium Iron Phosphate Composites for Lithium Batteries | Argonne...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lithium Iron Phosphate Composites for Lithium Batteries Technology available for licensing: Inexpensive, electrochemically active phosphate compounds with high functionality for...

125

Zero-valent iron nanoparticles preparation  

SciTech Connect (OSTI)

Graphical abstract: Zero-valent iron nanoparticles were synthesized by hydrogenating [Fe[N(Si(CH{sub 3}){sub 3}){sub 2}]{sub 2}] at room temperature and a pressure of 3 atm. The synthesized nanoparticles were spherical and had diameters less than 5 nm. Highlights: ? Zero-valent iron nanoparticles were synthesized by hydrogenating [Fe[N(Si(CH{sub 3}){sub 3}){sub 2}]{sub 2}]. ? The conditions of reaction were at room temperature and a pressure of 3 atm. ? The synthesized nanoparticles were spherical and had diameters less than 5 nm. -- Abstract: Zero-valent iron nanoparticles were synthesized by hydrogenating [Fe[N(Si(CH{sub 3}){sub 3}){sub 2}]{sub 2}] at room temperature and a pressure of 3 atm. To monitor the reaction, a stainless steel pressure reactor lined with PTFE and mechanically stirred was designed. This design allowed the extraction of samples at different times, minimizing the perturbation in the system. In this way, the shape and the diameter of the nanoparticles produced during the reaction were also monitored. The results showed the production of zero-valent iron nanoparticles that were approximately 5 nm in diameter arranged in agglomerates. The agglomerates grew to 900 nm when the reaction time increased up to 12 h; however, the diameter of the individual nanoparticles remained almost the same. During the reaction, some byproducts constituted by amino species acted as surfactants; therefore, no other surfactants were necessary.

Oropeza, S. [Instituto Politcnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, Mxico D.F. (Mexico)] [Instituto Politcnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, Mxico D.F. (Mexico); Corea, M., E-mail: mcoreat@yahoo.com.mx [Instituto Politcnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, Mxico D.F. (Mexico); Gmez-Yez, C. [Instituto Politcnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, Mxico D.F. (Mexico)] [Instituto Politcnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, Mxico D.F. (Mexico); Cruz-Rivera, J.J. [Universidad Autnoma de San Luis Potos, Instituto de Metalurgia, Sierra Leona 550, San Luis Potos, C.P. 78210 (Mexico)] [Universidad Autnoma de San Luis Potos, Instituto de Metalurgia, Sierra Leona 550, San Luis Potos, C.P. 78210 (Mexico); Navarro-Clemente, M.E., E-mail: mnavarroc@ipn.mx [Instituto Politcnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, Mxico D.F. (Mexico)

2012-06-15T23:59:59.000Z

126

2, 537549, 2005 Dissolved iron input  

E-Print Network [OSTI]

the semblance of a dissolved load are coagulated and settled as their freshwater carrier is mixed with seawater of the iron load from the suspended and dissolved mobile fraction to storage in the sediments was measured masses beyond the mixing zone, a process known as the "marine biological carbon pump". This export5

Paris-Sud XI, Université de

127

Synthesis and consolidation of iron nanopowders  

Science Journals Connector (OSTI)

A microwave plasma processing technique was used to synthesize iron nanopowders. The average particle size of these powders was ~10 nm and the surface area was measured to be 42m2/g. Powder production rates as high as 50 gm/hour were achieved. Magnetic property measurements on iron nanopowders yielded coercivities as high as 60 kA/m at 4 K, which decreased to ~0 A/m (a superparamagnetic transition) at room temperature. In this paper, the microwave plasma processing technique has been compared with other nanopowder synthesis techniques. Since the successful application of nanomaterials depends highly on the processing technology, results from consolidation studies on iron nanopowders are also presented. Iron nanopowders were consolidated to study performance parameters such as density, grain growth and other morphological changes. The nanopowder was consolidated using Plasma Pressure Consolidation (P2C) technique to 95% density, at a temperature and pressure of 850 C and 63 \\{MPa\\} respectively. Microwave plasma synthesis is capable of producing metallic and ceramic nanopowders, which will sustain interest in research areas including magnetic storage, nano-fabrication of electronic materials and nanoglass, besides the field of catalysis.

R. Kalyanaraman; Sang Yoo; M.S. Krupashankara; T.S. Sudarshan; R.J. Dowding

1998-01-01T23:59:59.000Z

128

Work/Life Balance  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Work/Life Balance Work/Life Balance /careers/_assets/images/careers-icon.jpg Work/Life Balance Explore the multiple dimensions of a career at LANL: work with the best minds on the planet in an inclusive environment that is rich in intellectual vitality and opportunities for growth. What our employees say: Health & Wellness "The Lab pays 80 percent of my family's medical premiums with Blue Cross Blue Shield of New Mexico." Retirement & Savings "With the Lab matching my 401K contributions of six percent, I'm making good progress in saving for my retirement." Time Off "Like many of my colleagues here, I work nine hours on most work days so that I can take every other Friday off." Tax Savings "My flexible spending accounts allow me to set aside pre-tax dollars for

129

Photoelectrochemical Working Group  

Broader source: Energy.gov [DOE]

The Photoelectrochemical Working Group meets regularly to review technical progress, develop synergies, and collaboratively develop common tools and processes for photoelectrochemical (PEC) water...

130

Hydrogen Pipeline Working Group  

Broader source: Energy.gov [DOE]

The Hydrogen Pipeline Working Group of research and industry experts focuses on issues related to the cost, safety, and reliability of hydrogen pipelines. Participants represent organizations...

131

Iron oxide red wastewater treatment and recycling of iron-containing sludge  

Science Journals Connector (OSTI)

Abstract The paper presents a wastewater treatment process and recycling of iron sludge from wastewater treatment for iron oxide red production. Results show that: (1) Sludge from wastewater treatment process under the operating parameters: 1.84g/L of NaOH dosage, 10mins of aeration with flow rate of 1L/min and 150mins of sediment time is potential for seed crystal preparation and excellent iron oxide red product can be obtained in the secondary oxidation under condition of 85C, 68h of reaction time and 150mL/min of airflow rate, (2) In practical engineering, the average removal rate of Fe2+ and SS and chroma of effluent is 99.75%, 86.7% and less than 40 times, respectively, and all items of product satisfy demands of industrial standards, (3) Compared with the original wastewater treatment, the new process can save the cost of wastewater treatment and earn extra 20.0 dollars for a ton of iron oxide red product and then both economic benefit and environmental protection can be realized by this process. It is proved that the novel method is reliable, economical and promising in iron oxide red industry and cleaner production of iron oxide red is feasible.

Zhenguo Chen; Xiaojun Wang; Qilong Ge; Guanchao Guo

2015-01-01T23:59:59.000Z

132

STATEMENT OF WORK  

National Nuclear Security Administration (NNSA)

PART III - SECTION J APPENDIX B STATEMENT OF WORK Table of Contents 1.0 General.................................................................................................................... 273 2.0 Laboratory Mission and Scope of Work. ................................................................ 274 3.0 Science & Technology. ........................................................................................... 275 3.1 Defense Programs. .................................................................................................. 276 3.1.1 Stewardship of United States Nuclear Weapons. ................................................ 276 3.1.1.1 Stockpile Certification. .......................................................................................

133

Work Authorization System  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

It establishes a work authorization and control process for work performed by designated management and operating (M&O), management and integrating (M&I), environmental restoration management contracts (ERMC) and other contracts determined by the Procurement Executive (hereafter referred to as M&O contractors). Cancels DOE O 5700.7C. Canceled by DOE O 412.1A.

1999-04-20T23:59:59.000Z

134

Work Authorization System  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's (DOE's) Planning, Programming, Budgeting, and Evaluation process. Cancels DOE O 412.1.

2005-04-21T23:59:59.000Z

135

Work Authorization System  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's Planning, Programming, Budgeting, and Evaluation process. Admin Chg 1, dated 5-21-2014, cancels DOE O 412.1A.

2005-04-21T23:59:59.000Z

136

The interaction of hydrogen and dislocations in iron  

Science Journals Connector (OSTI)

The effusion of hydrogen from deformed iron wires has been measured by combining low temperature internal friction measurements of the cold-work peak with a thermal cycling procedure. Diffusion constants have been calculated by a modification of the technique developed by Armstrong, for conditions where diffusion takes place over a range of temperatures at a constant hsating rate. The activation energy for effusion between 200 and 300K is 78 kcal/g-mole, in good agreement with previous work based on other methods. A linear variation of the cold-work peak with the percentage of hydrogen suggests that dislocations act as the major trapping sites when the deformation level (16 per cent R.A.) is insufficient to produce internal voids, and when the hydrogen content is low (~1 ppm). A binding energy of 46 kcal/g-mole can be derived by taking into account current values for the basic lattice diffusion of hydrogen. This is consistent with a basic elastic interaction energy model based on a partial molar volume for hydrogen of~2 cc/g-mole, and supports the location of lattice hydrogen in octahedral interstices. The similarity between the dislocation binding energy, and the energy involved in adsorption at free surfaces, may account for the conflict which exists regarding the predominant location of hydrogen in alloys containing both internal voids and a high dislocation density.

C.M Sturges; A.P Miodownik

1969-01-01T23:59:59.000Z

137

Trails Working Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Trails Working Group Trails Working Group Trails Working Group Our mission is to inventory, map, and prepare historical reports on the many trails used at LANL. Contact Environmental Communication & Public Involvement P.O. Box 1663 MS M996 Los Alamos, NM 87545 (505) 667-0216 Email The LANL Trails Working Group inventories, maps, and prepares historical reports on the many trails used at LANL. Some of these trails are ancient pueblo footpaths that continue to be used for recreational hiking today. Some serve as quiet and non-motorized alternatives between the Townsite and LANL or between technical areas. The Trails Working Group, established in December 2003, includes representatives from local citizen hiking groups, Los Alamos County, Forest Service, Park Service, Los Alamos National Laboratory and the NNSA Los

138

Interagency Working Groups (IWGs)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Interagency Working Groups (IWGs) Print E-mail Interagency Working Groups (IWGs) Print E-mail Interagency Working Groups (IWGs) are the primary USGCRP vehicles for implementing and coordinating research activities within and across agencies. These groups are critical to Program integration and in assessing the Program's progress. The working groups span a wide range of interconnected issues of climate and global change, and address major components of the Earth's environmental and human systems, as well as cross-disciplinary approaches for addressing these issues. IWGs correspond to program functions and are designed to bring agencies together to plan and develop coordinated activities, implement joint activities, and identify and fill gaps in the Program's plans. They allow public officials to communicate with each other on emerging directions within their agencies, on their stakeholder needs, and on best practices learned from agency activities. Together, these functions allow the agencies to work in a more coordinated and effective manner.

139

ORISE: Working with ORISE  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oak Ridge Institute for Science Education Oak Ridge Institute for Science Education Working with ORISE If you are interested in learning about how your agency can utilize the capabilities of the Oak Ridge Institute for Science and Education (ORISE) through a Work for Others agreement or a procurement contract, or if you are looking for career opportunities, the following information provides an explanation of how to work with ORISE. If you do not see an option that applies to your needs, please contact ORISE General Information. Work for Others For organizations and agencies that are not affiliated with U.S. Department of Energy (DOE), such groups still have the opportunity to partner with the Oak Ridge Institute for Science and Education (ORISE) through the DOE Work For Others (WFO) program. DOE's WFO program allows ORISE to support

140

An Advanced Lithium-Ion Battery Based on a Graphene Anode and a Lithium Iron Phosphate Cathode  

Science Journals Connector (OSTI)

An Advanced Lithium-Ion Battery Based on a Graphene Anode and a Lithium Iron Phosphate Cathode ... To the best of our knowledge, complete, graphene-based, lithium ion batteries having performances comparable with those offered by the present technology are rarely reported; hence, we believe that the results disclosed in this work may open up new opportunities for exploiting graphene in the lithium-ion battery science and development. ... A full Li-ion battery (Figure 4a) is obtained by coupling the Cu-supported graphene nanoflake anode with a lithium iron phosphate, LiFePO4, that is, a cathode commonly used in commercial batteries. ...

Jusef Hassoun; Francesco Bonaccorso; Marco Agostini; Marco Angelucci; Maria Grazia Betti; Roberto Cingolani; Mauro Gemmi; Carlo Mariani; Stefania Panero; Vittorio Pellegrini; Bruno Scrosati

2014-07-15T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

PHASE II CALDERON PROCESS TO PRODUCE DIRECT REDUCED IRON RESEARCH AND DEVELOPMENT PROJECT  

SciTech Connect (OSTI)

The commercialization path of the Calderon technology for making a feedstock for steelmaking with assistance from DOE initially focused on making coke and work was done which proved that the Calderon technology is capable of making good coke for hard driving blast furnaces. U.S. Steel which participated in such demonstration felt that the Calderon technology would be more meaningful in lowering the costs of making steel by adapting it to the making of iron--thus obviating the need for coke. U.S. Steel and Calderon teamed up to jointly work together to demonstrate that the Calderon technology will produce in a closed system iron units from iron concentrate (ore) and coal competitively by eliminating pelletizing, sintering, coking and blast furnace operation. If such process steps could be eliminated, a huge reduction in polluting emissions and greenhouse gases (including CO{sub 2}) relating to steelmaking would ensue. Such reduction will restructure the steel industry away from the very energy-intensive steelmaking steps currently practiced and drastically reduce costs of making steel. The development of a technology to lower U.S. steelmaking costs and become globally competitive is a priority of major importance. Therefore, the development work which Calderon is conducting presently under this Agreement with the U.S. Department of Energy becomes more crucial than ever. During the 3rd quarter of 2005 which the present report covers, virtually all the effort to advance the Calderon technology to make iron units was concentrated towards forming a team with a steelmaker who needs both iron units in the form of hot metal and a substitute for natural gas (SNG), both being major contributors to higher costs in steelmaking. Calderon felt that a very good candidate would be Steel Dynamics (SDI) by virtue that it operates a rotary hearth facility in Butler, Indiana that uses large amounts of natural gas to reduce briquettes made from ore and coal that they subsequently melt in a submerged arc furnace that is a large consumer of electric power. This facility is operated as a division of SDI under the name of Iron Dynamics (IDI). It is no secret that IDI has had and still has a great number of operational problems, including high cost for natural gas.

Albert Calderon

2005-10-14T23:59:59.000Z

142

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Working Catalyst Print Nanoscale Chemical Imaging of a Working Catalyst Print The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

143

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Working Catalyst Print Nanoscale Chemical Imaging of a Working Catalyst Print The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

144

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Nanoscale Chemical Imaging of a Working Catalyst Nanoscale Chemical Imaging of a Working Catalyst Print Wednesday, 28 January 2009 00:00 The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

145

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Working Catalyst Print Nanoscale Chemical Imaging of a Working Catalyst Print The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

146

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Working Catalyst Print Nanoscale Chemical Imaging of a Working Catalyst Print The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

147

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Working Catalyst Print Nanoscale Chemical Imaging of a Working Catalyst Print The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

148

Nanoscale Chemical Imaging of a Working Catalyst  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Nanoscale Chemical Imaging of a Working Catalyst Print Nanoscale Chemical Imaging of a Working Catalyst Print The heterogeneous catalysts used in most chemical processes typically consist of nanoscale metal or metal oxide particles dispersed on high-surface-area supports. While these particles are the active elements of the catalyst, the overall performance depends not only on their size and composition but also on their multiple interactions with the support, reactants, and products. Probing this chemical soup in real time under realistic reaction conditions is such a tall order that in some cases even the catalytically active chemical species is not known. A Dutch team working at the ALS has combined scanning transmission x-ray microscopy with a reaction chamber adapted from electron microscopy to identify the chemical species present for an iron-based Fischer-Tropsch synthesis catalyst and to image their distribution on the nanoscale. When developed further, this new tool may give chemists the ability to design and tailor catalysts for maximum selectivity and efficiency in a wide range of chemical processes.

149

Work Authorization System  

Broader source: Energy.gov (indexed) [DOE]

Washington, D.C. DOE O 412.1A Approved: 4-21-05 This directive was reviewed and certified as current and necessary by Susan J. Grant, Director, Office of Management, Budget and Evaluation/Chief Financial Officer, 4-21-05. SUBJECT: WORK AUTHORIZATION SYSTEM 1. OBJECTIVES. To establish a work authorization and control process for work performed by designated site and facility management contractors, and other contractors as determined by the procurement executive, consistent with the budget execution and program evaluation requirements of the Department of Energy's (DOE's) Planning, Programming, Budgeting, and Evaluation process. 2. CANCELLATIONS. DOE O 412.1 Work Authorization System, dated 4-20-99. Cancellation of a directive does not, by itself, modify or otherwise affect any contractual

150

NREL: Working for NREL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Working for NREL Working for NREL We're always on the lookout for talented people who believe in our mission and support our values. NREL's inclusive work environment benefits from diversity throughout the organization, values individual differences, and encourages employees to develop and contribute to their full potential. Working for NREL is a challenging and exciting experience for nearly 2,300 staff members of all backgrounds. We offer competitive salaries and excellent benefits. NREL Mission While our cultures and creeds, and lifestyles and languages may differ, we share a common desire to carry out our mission- To develop renewable energy and energy efficiency technologies and practices, To advance related science and engineering, and To transfer knowledge and innovations to address the nation's energy

151

How Hybrids Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How Hybrids Work How Hybrids Work Diagram of full hybrid vehicle components, including (1) an internal combustion engine, (2) an electric motor, (3) a generator, (4) a power split device, and (5) a high-capacity battery. Flash Animation: How Hybrids Work (Requires Flash 6.0 or higher) HTML Version: How Hybrids Work Hybrid-electric vehicles (HEVs) combine the benefits of gasoline engines and electric motors and can be configured to obtain different objectives, such as improved fuel economy, increased power, or additional auxiliary power for electronic devices and power tools. Some of the advanced technologies typically used by hybrids include Regenerative Braking. The electric motor applies resistance to the drivetrain causing the wheels to slow down. In return, the energy from the

152

Strategic Initiatives Work Group  

Broader source: Energy.gov [DOE]

The Work Group, comprised of members representing DOE, contractor and worker representatives, provides a forum for information sharing; data collection and analysis; as well as, identifying best practices and initiatives to enhance safety performance and safety culture across the Complex.

153

How NIF Works  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How NIF Works A weak laser pulse-about 1 billionth of a joule-is created, split, and carried on optical fibers to 48 preamplifiers that increase the pulse's energy by a factor of...

154

Clean Energy Works (Oregon)  

Broader source: Energy.gov [DOE]

Clean Energy Works began in 2009 as a pilot program run by the City of Portland. In 2010, the US department of Energy awarded $20 million to create a statewide nonprofit to expand the program...

155

Fermilab: Science at Work  

ScienceCinema (OSTI)

Six days. Three frontiers. One amazing lab. From 2010 to 2012, a film crew followed a group of scientists at the Department of Energy's Fermilab and filmed them at work and at home. This 40-minute documentary shows the diversity of the people, research and work at Fermilab. Viewers catch a true behind-the-scenes look of the United States' premier particle physics laboratory while scientists explain why their research is important to them and the world.

Brendan Casey; Herman White; Craig Hogan; Denton Morris; Mary Convery; Bonnie Fleming; Deborah Harris; Dave Schmitz; Brenna Flaugher; Aron Soha

2013-02-14T23:59:59.000Z

156

Iron-57 nuclear magnetic resonance chemical shifts of hindered iron porphyrins. Ruffling as a possible mechanism for d-orbital energy level inversion  

Science Journals Connector (OSTI)

Iron-57 nuclear magnetic resonance chemical shifts of hindered iron porphyrins. ... Ruffling as a possible mechanism for d-orbital energy level inversion ...

Lars Baltzer; Marie Landergren

1990-03-01T23:59:59.000Z

157

SEPARATION OF FISCHER-TROPSCH WAX PRODUCTS FROM ULTRAFINE IRON CATALYST PARTICLES  

SciTech Connect (OSTI)

In this reporting period, a fundamental filtration study was continued to investigate the separation of Fischer-Tropsch Synthesis (FTS) liquids from iron-based catalyst particles. The overall focus of the program is with slurry-phase FTS in slurry bubble column reactor systems. Hydrocarbon products must be separated from catalyst particles before being removed from the reactor system. An efficient wax product/catalyst separation system is a key factor for optimizing operating costs for iron-based slurry-phase FTS. Previous work has focused on catalyst particle attrition and the formation of ultra-fine iron carbide and/or carbon particles. With the current study, we are investigating how the filtration properties are affected by these chemical and physical changes of the catalyst slurry during activation/synthesis. In this reporting period, a series of crossflow filtration experiments were initiated to study the effect of olefins and oxygenates on the filtration flux and membrane performance. Iron-based FTS reactor waxes contain a significant amount of oxygenates, depending on the catalyst formulation and operating conditions. Mono-olefins and aliphatic alcohols were doped into an activated iron catalyst slurry (with Polywax) to test their influence on filtration properties. The olefins were varied from 5 to 25 wt% and oxygenates from 6 to 17 wt% to simulate a range of reactor slurries reported in the literature. The addition of an alcohol (1-dodecanol) was found to decrease the permeation rate while the olefin added (1-hexadecene) had no effect on the permeation rate. A passive flux maintenance technique was tested that can temporarily increase the permeate rate for 24 hours.

James K. Neathery; Gary Jacobs; Burtron H. Davis

2005-03-31T23:59:59.000Z

158

SEPARATION OF FISCHER-TROPSCH WAX PRODUCTS FROM ULTRAFINE IRON CATALYST PARTICLES  

SciTech Connect (OSTI)

In this reporting period, a fundamental filtration study was continued to investigate the separation of Fischer-Tropsch Synthesis (FTS) liquids from iron-based catalyst particles. The overall focus of the program is with slurry-phase FTS in slurry bubble column reactor systems. Hydrocarbon products must be separated from catalyst particles before being removed from the reactor system. An efficient wax product/catalyst separation system is a key factor for optimizing operating costs for iron-based slurry-phase FTS. Previous work has focused on catalyst particle attrition and the formation of ultra-fine iron carbide and/or carbon particles. With the current study, we are investigating how the filtration properties are affected by these chemical and physical changes of the catalyst slurry during activation/synthesis. The shakedown phase of the pilot-scale filtration platform was completed at the end of the last reporting period. A study of various molecular weight waxes was initiated to determine the effect of wax physical properties on the permeation rate without catalyst present. As expected, the permeation flux was inversely proportional to the nominal average molecular weight of the polyethylene wax. Even without catalyst particles present in the filtrate, the filtration membranes experience fouling during an induction period on the order of days on-line. Another long-term filtration test was initiated using a batch of iron catalyst that was previously activated with CO to form iron carbide in a separate continuous stirred tank reactor (CSTR) system. The permeation flux stabilized more rapidly than that experienced with unactivated catalyst tests.

James K. Neathery; Gary Jacobs; Burtron H. Davis

2004-09-30T23:59:59.000Z

159

Magnetism in Iron at High Temperatures  

Science Journals Connector (OSTI)

Magnetism in iron at high temperature is investigated by calculating the total electronic band-structure energy for four types of spin arrangements. A slow smooth spatial variation of spin direction costs relatively little energy and the atomic moment m is reduced only ? 10%. More rapid variations have considerably higher energy, which may explain the high degree of short-range order and small ?m observed at T?TC. Other aspects are also discussed.

M. V. You; V. Heine; A. J. Holden; P. J. Lin-Chung

1980-05-12T23:59:59.000Z

160

Magnetism and Superconductivity in Iron Pnictides  

SciTech Connect (OSTI)

The discovery of high temperature superconductivity in iron pnictides and chalcogenides has resulted in surprising new insights into high temperature superconductivity and its relationship with magnetism. Here we provide an overview of some of what is known about these materials and in particular about the interplay of magnetism and superconductivity in them. Similarities and contrasts with cuprate superconductors are emphasized and the superconducting pairing is discussed within the framework of spin fluctuation induced pairing.

Singh, David J [ORNL

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

The iron abundance of the Magellanic Bridge  

E-Print Network [OSTI]

High-resolution HST ultra-violet spectra for five B-type stars in the Magellanic Bridge and in the Large and Small Magellanic Clouds have been analysed to estimate their iron abundances. Those for the Clouds are lower than estimates obtained from late-type stars or the optical lines in B-type stars by approximately 0.5 dex. This may be due to systematic errors possibly arising from non-LTE effects or from errors in the atomic data as similar low Fe abundances having previously been reported from the analysis of the ultra-violet spectra of Galactic early-type stars. The iron abundance estimates for all three Bridge targets appear to be significantly lower than those found for the SMC and LMC by approximately -0.5 dex and -0.8 dex respectively and these differential results should not be affected by any systematic errors present in the absolute abundance estimates. These differential iron abundance estimates are consistent with the underabundances for C, N, O, Mg and Si of approximately -1.1 dex relative to our Galaxy previously found in our Bridge targets. The implications of these very low metal abundances for the Magellanic Bridge are discussed in terms of metal deficient material being stripped from the SMC.

P. L. Dufton; R. S. I. Ryans; H. M. A. Thompson; R. A. Street

2008-02-01T23:59:59.000Z

162

Correlation effects in the iron pnictides  

SciTech Connect (OSTI)

One of the central questions about the iron pnictides concerns the extent to which their electrons are strongly correlated. Here we address this issue through the phenomenology of the charge transport and dynamics, single-electron excitation spectrum, and magnetic ordering and dynamics. We outline the evidence that the parent compounds, while metallic, have electron interactions that are sufficiently strong to produce incipient Mott physics. In other words, in terms of the strength of electron correlations compared to the kinetic energy, the iron pnictides are closer to intermediately-coupled systems lying at the boundary between itinerancy and localization, such as V{sub 2}O{sub 3} a or Se-doped NiS{sub 2} , rather than to simple antiferromagnetic metals like Cr. This level of electronic correlations produces a new small parameter for controlled theoretical analyses, namely the fraction of the single-electron spectral weight that lies in the coherent part. Using this expansion parameter, we construct the effective low-energy Hamiltonian and discuss its implications for the magnetic order and magnetic quantum criticality. Finally, this approach sharpens the notion of magnetic frustration for such a metallic system, and brings about a multi band matrix t-J{sub 1}-J{sub 2} model for the carrier-doped iron pnictides.

Zhu, Jian-xin [Los Alamos National Laboratory; Si, Qimiao [RICE UNIV; Abrahams, Elihu [RUTGERS UNIV; Dai, Jianhui [ZHEJIANG UNIV

2009-01-01T23:59:59.000Z

163

Seal welded cast iron nuclear waste container  

DOE Patents [OSTI]

This invention identifies methods and articles designed to circumvent metallurgical problems associated with hermetically closing an all cast iron nuclear waste package by welding. It involves welding nickel-carbon alloy inserts which are bonded to the mating plug and main body components of the package. The welding inserts might be bonded in place during casting of the package components. When the waste package closure weld is made, the most severe thermal effects of the process are restricted to the nickel-carbon insert material which is far better able to accommodate them than is cast iron. Use of nickel-carbon weld inserts should eliminate any need for pre-weld and post-weld heat treatments which are a problem to apply to nuclear waste packages. Although the waste package closure weld approach described results in a dissimilar metal combination, the relative surface area of nickel-to-iron, their electrochemical relationship, and the presence of graphite in both materials will act to prevent any galvanic corrosion problem.

Filippi, Arthur M. (Pittsburgh, PA); Sprecace, Richard P. (Murrysville, PA)

1987-01-01T23:59:59.000Z

164

Microsoft Word - 09 FW Program SA memo Final_100509.doc  

Broader source: Energy.gov (indexed) [DOE]

5, 2009 5, 2009 REPLY TO ATTN OF: KEC-4 SUBJECT: Supplement Analysis for the Fish and Wildlife Implementation Plan EIS (DOE/EIS-0312/SA-03) Greg Delwiche Vice President, Environment, Fish & Wildlife The attached Supplement Analysis for BPA's Fish and Wildlife Implementation Plan Environmental Impact Statement (FWIP EIS) provides a review of whether BPA should prepare a new or supplemental FWIP EIS in light of the the Northwest Power and Conservation Council's (Council) newly amended 2009 Fish and Wildlife Program (2009 Program). The Supplement Analysis finds that actions that BPA may take to follow the guidance in the Council's 2009 Program are withing the scope of the FWIP EIS and were considered in, and are consistent with, the Preferred Alternative (PA 2002) Policy Direction that BPA adopted in the

165

FW Response to Notice of Inquire on Questions Concerning Technology...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

esponse to Notice of Inquire on Questions Concerning Technology Transfer Tractices at DOE Laboratories. From: Malozemoff, Alex AMalozemoff@amsc.com Sent: Tuesday, January 27,...

166

Mon Valley work plan  

Office of Legacy Management (LM)

GWSHP 1.8 GWSHP 1.8 U.S. Department of Energy UMTRA Ground Water Project Work Plan for Characterization Activities at the Shiprock UMTRA Project Site June 1998 Prepared by U.S. Department of Energy Albuquerque Operations Office Grand Junction Office Project Number UGW-511-0020-01-000 Document Number U0013400 Work Performed under DOE Contract No. DE-AC13-96GJ87335 Note: Some of the section page numbers in the Table of Contents may not correspond to the page on which the section appears when viewing them in Adobe Acrobat. Document Number U0013400 Contents DOE/Grand Junction Office Work Plan for Characterization Activities at Shiprock Project Site June 1998 Draft Final Page v Contents Acronyms . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . xi 1.0 Introduction .

167

How Fuel Cells Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How Fuel Cells Work How Fuel Cells Work Diagram: How a PEM fuel cell works. 1. Hydrogen fuel is channeled through field flow plates to the anode on one side of the fuel cell, while oxygen from the air is channeled to the cathode on the other side of the cell. 2. At the anode, a platinum catalyst causes the hydrogen to split into positive hydrogen ions (protons) and negatively charged electrons. 3. The Polymer Electrolyte Membrane (PEM) allows only the positively charged ions to pass through it to the cathode. The negatively charged electrons must travel along an external circuit to the cathode, creating an electrical current. 4. At the cathode, the electrons and positively charged hydrogen ions combine with oxygen to form water, which flows out of the cell.

168

ORISE: Work Smart Standards  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Work Smart Standards Work Smart Standards ORISE Work Smart Standards Set for Environment, Safety, and Health Revision #1, March 21, 2000 Revision #2, Sept. 29, 2000 Revision #3, June 28, 2001 Revision #4, Nov. 9, 2001 Revision #5, Nov. 30, 2001 Revision #6, Jan. 31, 2002 Revision #7, June 28, 2002 Revision #8, Oct. 17, 2002 Revision #9, Nov. 21, 2002 Revision #10, Feb. 28, 2003 Revision #11, May 23, 2003 Revision #12, May 30, 2003 Revision #13, Oct. 30, 2003 Revision #14, Jan. 21, 2004 Revision #15, May 24, 2004 Revision #16, Aug. 17, 2004 Revision #17, Aug. 27, 2004 Revision #18, Oct. 14, 2004 Revision #19, March 28, 2005 Revision #20, May 31, 2005 Revision #21, Aug. 24, 2005 Revision #22, Feb. 17, 2006 Revision #23, March 22, 2006 Revision #24, May 19, 2006 Revision #25, July 26, 2006 Revision #26, Nov. 28, 2006

169

Iron phosphate compositions for containment of hazardous metal waste  

DOE Patents [OSTI]

An improved iron phosphate waste form for the vitrification, containment and long-term disposition of hazardous metal waste such as radioactive nuclear waste is provided. The waste form comprises a rigid iron phosphate matrix resulting from the cooling of a melt formed by heating a batch mixture comprising the metal waste and a matrix-forming component. The waste form comprises from about 30 to about 70 weight percent P.sub.2 O.sub.5 and from about 25 to about 50 weight percent iron oxide and has metals present in the metal waste chemically dissolved therein. The concentration of iron oxide in the waste form along with a high proportion of the iron in the waste form being present as Fe.sup.3+ provide a waste form exhibiting improved chemical resistance to corrosive attack. A method for preparing the improved iron phosphate waste forms is also provided.

Day, Delbert E. (Rolla, MO)

1998-01-01T23:59:59.000Z

170

Working with NIST  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NIST NIST Terry Lynch Office of Technology Partnerships How to Work with NIST How to Work with NIST „ „ Standards Standards „ „ Collaborative Research & Technology Devolvement Collaborative Research & Technology Devolvement Programs Programs „ „ Invention Licensing Invention Licensing Collaborative Research & Technology Collaborative Research & Technology Development Programs Development Programs „ „ Informal collaboration involving intramural research programs Informal collaboration involving intramural research programs „ „ Guest Research Agreements Guest Research Agreements „ „ Facility Use Agreements Facility Use Agreements „ „ Material Transfer Agreements Material Transfer Agreements „ „ Cooperative Research and Development Agreements (CRADA

171

Classic work on astronomy  

Science Journals Connector (OSTI)

... A History of Ancient Mathematical Astronomy. Part 1: Pp. xxi + 1?555. Part 2: Pp. 556?1 ... a magnificent work that will surely become a major classic in the historiography of ancient astronomy, a three-volume treatise devoted almost entirely to the mathematical ...

G. J. Whitrow

1976-03-18T23:59:59.000Z

172

Moulinath Banerjee Work Address  

E-Print Network [OSTI]

.Stat.(Honors) 1995, in First Division with Distinction. Employment Associate Professor of Statistics, UniversityMoulinath Banerjee Work Address University of Michigan Department of Statistics 439, West Hall 1085 estimation, Statistical Methods in Astronomy, Biomedical studies and Epidemiology, Threshold and boundary

Banerjee, Moulinath

173

Moulinath Banerjee Work Address  

E-Print Network [OSTI]

.Stat.(Honors) 1995, in First Division with Distinction. Employment Associate Professor of Statistics, University Methods in Non­standard Problems. Currently employed as Tenure-track Assistant Professor of StatisticsMoulinath Banerjee Work Address University of Michigan Department of Statistics 439, West Hall 1085

Banerjee, Moulinath

174

Help for Working Capital  

Science Journals Connector (OSTI)

Help for Working Capital ... It takes a sharp pencil to figure out ways and means of all eviating the constant pressure for new money for capital expenditure needed by our steadily expanding industry ... These funds not only must now absorb higher operating costs, but also must be counted upon heavily for capital expenditure as well. ...

HARRIS MCASHAN

1950-12-18T23:59:59.000Z

175

Work Force Discipline  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

The order provides guidance and procedures and states responsibilities for maintaining work force discipline in DOE. Chg 1, dated 3-11-85; Chg 2, dated 1-6-86; Chg 3, dated 3-21-89; Chg 4, dated 8-2-90; Chg 5, dated 3-9-92; Chg 6, dated 8-21-92, cancels Chg 5.

1983-03-23T23:59:59.000Z

176

COLLOQUIUM: How Trenton Iron and Steel Innovations Reshaped America...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mr. Clifford Zink Independent Historian Iron and steel innovations in Trenton helped transform modern life with new methods of transportation, construction, and communications....

177

Iron-based Superconductor Simulations Spin Out New Possibilities...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron-based Superconductor Simulations Spin Out New Possibilities on Titan Rutgers team develops computational model for predicting superconductivity The 15 boxes in this image show...

178

Iron Cycling and Redox Evolution in the Precambrian  

E-Print Network [OSTI]

I use compilations of phosphorous and iron data in ironused upwelling dissolved phosphorous and ammonium as well asand adsorption of dissolved phosphorous onto microbial Fe

Planavsky, Noah John

2012-01-01T23:59:59.000Z

179

Iron(III)-doped, silica : biodegradable, self-targeting nanoparticles  

E-Print Network [OSTI]

of calcium and phosphorous, which can be attributed toamount of calcium and phosphorous increase. The iron(III)-composed of calcium and phosphorous were in the recovered

Mitchell, Kristina Kalani Pohaku

2011-01-01T23:59:59.000Z

180

Iron Oxide Waste Form for Stabilizing 99Tc. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stabilizing 99Tc. Iron Oxide Waste Form for Stabilizing 99Tc. Abstract: Crystals of goethite were synthesized with reduced technetium 99Tc(IV) incorporated within the solid...

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Zero Valent Iron: Impact of Anions Present during Synthesis on...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

iron nanoparticles was quantified by monitoring the kinetics as well as products of carbon tetrachloride reduction, and significant differences in reactivity and chloroform...

182

Ferredoxin and flavodoxin as biochemical indicators of iron ...  

Science Journals Connector (OSTI)

search Agreement RP8021-05 from the Electric Power Research. Institute ... equatorial Pacific Ocean was enriched with iron and moni- ..... The first identifi-.

1999-10-04T23:59:59.000Z

183

Comparison of gleptoferron iron compound to two commonly used iron supplements for the prevention of baby pig anemia  

E-Print Network [OSTI]

Ig"5 Thesis H763 c. Z J COMPARISON OF GLEPTOFERRON IRON COMPOUND TO TWO COMMONLY USED IRON SUPPLEMENTS FOR THE PREVENTION OF BABY PIG ANEMIA A Professional Paper Ervin R. Homann Submitted as Partial Fulfillment of the Professional... OF LITERATURE EXPERIMENTAL PROCEDURE RESULTS AND DISCUSSION SUMMARY AND CONCLUSIONS LITERATURE CITED VITA TABLE OF CONTENTS Page 12 13 15 LIST OF TABLES Table 1. EFFECT OF IRON SOURCE AND TIME OF ADMINISTRATION ON PIG SURVIVAL AND PIG HEIGHTS...

Homann, Ervin R.

2012-06-07T23:59:59.000Z

184

Unconventional temperature enhanced magnetism in iron telluride  

SciTech Connect (OSTI)

Discoveries of copper and iron-based high-temperature superconductors (HTSC)1-2 have challenged our views of superconductivity and magnetism. Contrary to the pre-existing view that magnetism, which typically involves localized electrons, and superconductivity, which requires freely-propagating itinerant electrons, are mutually exclusive, antiferromagnetic phases were found in all HTSC parent materials3,4. Moreover, highly energetic magnetic fluctuations, discovered in HTSC by inelastic neutron scattering (INS) 5,6, are now widely believed to be vital for the superconductivity 7-10. In two competing scenarios, they either originate from local atomic spins11, or are a property of cooperative spin-density-wave (SDW) behavior of conduction electrons 12,13. Both assume clear partition into localized electrons, giving rise to local spins, and itinerant ones, occupying well-defined, rigid conduction bands. Here, by performing an INS study of spin dynamics in iron telluride, a parent material of one of the iron-based HTSC families, we have discovered that this very assumption fails, and that conduction and localized electrons are fundamentally entangled. In the temperature range relevant for the superconductivity we observe a remarkable redistribution of magnetism between the two groups of electrons. The effective spin per Fe at T 10 K, in the2 antiferromagnetic phase, corresponds to S 1, consistent with the recent analyses that emphasize importance of Hund s intra-atomic exchange15-16. However, it grows to S 3/2 in the disordered phase, a result that profoundly challenges the picture of rigid bands, broadly accepted for HTSC.

Zalinznyak, I. [Brookhaven National Laboratory (BNL); Xu, Zhijun [ORNL; Tranquada, John M. [Brookhaven National Laboratory (BNL); Gu, G. D. [Brookhaven National Laboratory (BNL); Tsvelik, A. [Brookhaven National Laboratory (BNL); Stone, Matthew B [ORNL

2011-01-01T23:59:59.000Z

185

A Comparison of Iron and Steel Production Energy Intensity in China and the U.S  

E-Print Network [OSTI]

pdf Association for Iron and Steel Technology (AIST). 2010a.American BOF Roundup. Iron & Steel Technology. November.for Iron and Steel Technology (AIST). 2010b. 2010 EAF

Price, Lynn

2014-01-01T23:59:59.000Z

186

THE EFFECT OF SMECTITE ON THE CORROSION OF IRON METAL. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

THE EFFECT OF SMECTITE ON THE CORROSION OF IRON METAL. THE EFFECT OF SMECTITE ON THE CORROSION OF IRON METAL. Abstract: The combination of zero-valent iron and a clay-type...

187

Public good dynamics drive evolution of iron acquisition strategies in natural bacterioplankton populations  

E-Print Network [OSTI]

A common strategy among microbes living in iron-limited environments is the secretion of siderophores, which can bind poorly soluble iron and make it available to cells via active transport mechanisms. Such siderophoreiron ...

Cordero, Otto X.

188

Tricking Iron into Acting like a Rare-earth Element | The Ames...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Tricking Iron into Acting like a Rare-earth Element By slipping iron between two nitrogen atoms in a lithium matrix, researchers are able to trick iron into having magnetic...

189

Arsenic remediation of drinking water using iron-oxide coated coal bottom ash  

E-Print Network [OSTI]

using Iron-oxide Coated Coal Ash. In Arsenic Contaminationwaterusing iron?oxidecoatedcoalbottomash JohannaL. using iron-oxide coated coal bottom ash JOHANNA L. MATHIEU

MATHIEU, JOHANNA L.

2010-01-01T23:59:59.000Z

190

Working With Berkeley Lab  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Working with the Lab Working with the Lab A-Z Index Search Phone Book Comments Ernest Orlando Lawrence Berkeley National Laboratory Technology Transfer Patent Department Sponsored Projects Office Procurement: Doing Business with the Lab Visitor Information Scientififc Divisions and National User Facilities UC Campus-Labs Collaboration Programs Berkeley Lab stresses collaboration in everything we do. The Laboratory is involved in many research partnerships with private industry. Our mission also includes the transfer of Laboratory inventions to the private sector for rapid commercialization. The role of the Technology Transfer Office is to make technology and expertise developed here available to industry. Contact the Technology Transfer Office to pinpoint research areas of common interest, negotiate rights to Laboratory intellectual property, and to discuss current patent and copyright licensing opportunities.

191

Working Group Reports  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 5 Working Group Reports Special Working Session on the Role of Buoy Observations in the Tropical Western Pacific Measurement Scheme J. Downing Marine Sciences Laboratory Sequim, Washington R. M. Reynolds Brookhaven National Laboratory Upton, New York Attending W. Clements (TWPPO) F. Barnes (TWPPO) T. Ackerman (TWP Site Scientist) M. Ivey (ARCS Manager) H. Church J. Curry J. del Corral B. DeRoos S. Kinne J. Mather J. Michalsky M. Miller P. Minnett B. Porch J. Sheaffer P. Webster M. Wesely K. Zorika G. Zhang Focus of Discussion The session convened on March 2, with brief introductions by Bill Clements. The purpose of the session was to discuss the scientific merits of retrofitting TOGA/TAO buoys with shortwave radiometers. Three questions were posed at the outset of the session to focus the discussion.

192

HANFORD ENGINEER WORKS  

Office of Legacy Management (LM)

HANFORD ENGINEER WORKS HANFORD ENGINEER WORKS IJd *P-t - - ~~~ssiticatiC+n cwcetted rat G.E. NUCLEONICS PROJECT xi I ~@L.%&~--G-ENERAI,@ ELECTRIC z ,m ._.__.-. _ I--..-. By Authority of. COMPANY ._ Atmic Energy Commission Office of Hanford Dire&xl Operations Riohland, Washington Attention; Mr. Carleton Shugg, Manager ./ ALPKA-ROLLED EL'GIL%I jw -879 ' . *_ a. f' Richland, Washington February 6, 1948 , Thla Dclc.Jv-

193

Putting Dollars to Work  

E-Print Network [OSTI]

the extent to which bacteria are present. If these data demonstrate the need for an assessment of total maximum daily loads, experts in bacterial source tracking will help plan and imple- ment appropriate follow-up. Dairy Compost Utilization... This project addresses the elevated concentrations of ammonia, nitrogen, phosphorus and fecal bacteria found in parts of the North Bosque River, Upper North Bosque River and Leon River. Texas A&M agricultural scientists are working with composters...

Wythe, Kathy

2006-01-01T23:59:59.000Z

194

SEWAGE: Algae at Work  

Science Journals Connector (OSTI)

SEWAGE: Algae at Work ... Taking their cue from the successful use of bacteria to rid sewage of biodegradable wastes, engineers at the University of Kansas and Trans Union Corp. have a process that uses algae to remove inorganic nitrogen, phosphorus, and carbon compounds from secondary treatment plant effluent. ... Though it has long been known that algae feed on inorganic wastes, the phenomenon had not been thought to hold much promise for sewage treatment. ...

1969-09-01T23:59:59.000Z

195

Pertechnetate (TcO4-) reduction by reactive ferrous iron forms...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

reduction by reactive ferrous iron forms in naturally anoxic, redox transition zone sediments from the Pertechnetate (TcO4-) reduction by reactive ferrous iron forms in naturally...

196

E-Print Network 3.0 - anthropogenic iron cycles Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

iron cycle control atmospheric CO ? 12;The Global Carbon Cycle 70 times more carbon in ocean than... on ocean biological activity Iron cycle processes Modeling ... Source:...

197

Calcite precipitation dominates the electrical signatures of zero valent iron columns under simulated field conditions  

E-Print Network [OSTI]

iron media using Tafel analysis and Electrochemicalzerovalent iron using tafel analysis and electrochemicalAt the micro-scale, Tafel scan and electrochemical impedance

Wu, Yuxin

2009-01-01T23:59:59.000Z

198

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network [OSTI]

of iron de?ciency on photosynthesis Aimee M. Terauchi rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

199

Neutron Scattering Studies of Cuprates and Iron Pnictides.  

E-Print Network [OSTI]

??Presented within are neutron scattering studies of several different high temperature superconducting materials: BaFe1.9Ni0.1As2 [Barium Iron Nickel Arsenic], BaFe1.85Ni0.15As2 [Barium Iron Nickel Arsenic], Ba0.67K0.33Fe2As2 [Barium (more)

Liu, Mengshu

2014-01-01T23:59:59.000Z

200

Enhanced Superconducting Properties of Iron Chalcogenide Thin Films  

E-Print Network [OSTI]

Among the newly discovered iron-based superconductor, FeSe with the simplest structure and a transition temperature (T_c) around 8 K arouses much research interest. Although its Tc is much lower than that of the cuprates, iron chalcogenide has low...

Chen, Li

2013-07-26T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Next Generation Metallic Iron Nodule Technology in Electric Furnace Steelmaking  

Broader source: Energy.gov [DOE]

This factsheet describes a research project whose objective is to investigate reducing processing temperature, controlling the gas temperature and gas atmosphere over metalized iron nodules, and effectively using sub-bituminous coal as a reductant for producing high quality metalized iron nodules at low cost.

202

Fabrication and processing of iron aluminides  

SciTech Connect (OSTI)

The Fe{sub 3}Al-based alloys have been shown to exhibit room-temperature ductility values of 15 to 19% by the control of composition and thermomechanical processing steps. The scale-up of one of the compositions to 2270-kg (5000-lb) electroslag-remelted (ESR) round ingot and 3272-kg (7200-lb) vacuum-induction-melted (VIM) slab ingot is described. Microstructural and mechanical property data are presented on small pieces sectioned from these ingots. The effects of final rolling temperature and the final annealing treatment on room-temperature ductility were investigated for the ESR ingot. A study of iron-aluminide binary alloys revealed that the environmental effects on room-temperature ductility values were absent for {le}8.5 wt % Al. The increasing aluminum content and the development of ordered structure resulted in increased environmental effects. Applications and a brief description of their status are described. Based on the combined property and cost advantage, continued development of iron aluminide is recommended.

Sikka, V.K.; Viswanathan, S.

1992-01-01T23:59:59.000Z

203

Fabrication and processing of iron aluminides  

SciTech Connect (OSTI)

The Fe{sub 3}Al-based alloys have been shown to exhibit room-temperature ductility values of 15 to 19% by the control of composition and thermomechanical processing steps. The scale-up of one of the compositions to 2270-kg (5000-lb) electroslag-remelted (ESR) round ingot and 3272-kg (7200-lb) vacuum-induction-melted (VIM) slab ingot is described. Microstructural and mechanical property data are presented on small pieces sectioned from these ingots. The effects of final rolling temperature and the final annealing treatment on room-temperature ductility were investigated for the ESR ingot. A study of iron-aluminide binary alloys revealed that the environmental effects on room-temperature ductility values were absent for {le}8.5 wt % Al. The increasing aluminum content and the development of ordered structure resulted in increased environmental effects. Applications and a brief description of their status are described. Based on the combined property and cost advantage, continued development of iron aluminide is recommended.

Sikka, V.K.; Viswanathan, S.

1992-07-01T23:59:59.000Z

204

INL's '@work' Scientific Glassblower  

SciTech Connect (OSTI)

INL's '@work' segments feature INL employees and the jobs they perform. This edition features INL's Russell Lewis, a skilled glassblower. Learn more at http://www.facebook.com/idahonationallaboratory. Prepared by Battelle Energy Alliance, LLC under Contract NO.DE-AC07-05ID14517 with the U.S. Department of Energy. The United States Government retains a nonexclusive paid-up, irrevocable, world-wide license to publish or reproduce this video, or allow others to do so, for United States Government Purposes.

Lewis, Russel

2008-01-01T23:59:59.000Z

205

Magnetic properties and loss separation in iron-silicone-MnZn ferrite soft magnetic composites  

SciTech Connect (OSTI)

This paper investigates the magnetic and structural properties of iron-based soft magnetic composites coated with silicone-MnZn ferrite hybrid. The organic silicone resin was added to improve the flexibility of the insulated iron powder and causes better adhesion between particles to increase the mechanical properties. Scanning electron microscopy and distribution maps show that the iron particle surface is covered with a thin layer of silicone-MnZn ferrite. Silicone-MnZn ferrite coated samples have higher permeability when compared with the non-magnetic silicone resin coated compacts. The real part of permeability increases by 34.18% when compared with the silicone resin coated samples at 20 kHz. In this work, a formula for calculating the total loss component by loss separation method is presented and finally the different parts of total losses are calculated. The results show that the eddy current loss coefficient is close to each other for the silicone-MnZn ferrite, silicone resin and MnZn ferrite coated samples (0.0078

Wu, Shen; Sun, Aizhi; Xu, Wenhuan; Zou, Chao; Yang, Jun; Dong, Juan [School of Materials Science and Engineering, University of Science and Technology Beijing, Beijing (China)

2013-12-16T23:59:59.000Z

206

The iron powder test for naphthenic acid corrosion studies  

SciTech Connect (OSTI)

In the course of an ongoing investigation into the phenomenon of naphthenic acid corrosion, a new test method has evolved and is currently being further developed to substitute the total acid number (TAN or neutralization number) as an indicator for naphthenic acid corrosion potential. It can also be used to complement conventional autoclave corrosion tests in high temperature environments, which are based on weight loss of steel coupons. In this new method an oil sample reacts with pure iron powder within an autoclave heated to the testing temperature. The result is based on the amount of dissolved iron found in the oil sample. The oil sample can dissolve an amount of iron for a given time at a given temperature, depending on the naphthenic acid corrosion, since these acids react with iron to produce oil soluble iron naphthenates. This paper describes the method, compares it with conventional crude corrosiveness testing, and proposes it as a new way of measuring naphthenic acid corrosion potential.

Hau, J.L.; Yepez, O.; Specht, M.I.; Lorenzo, R. [PDVSA-Intevep, Caracas (Venezuela)

1999-11-01T23:59:59.000Z

207

TRU TeamWorks  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, 2004 , 2004 By the Numbers WIPP marks five-year anniversary Shipments scheduled to arrive at WIPP for the week of 4/4/04 - 4/10/04: 18 Total shipments received at WIPP: 2,456 Total volume disposed at WIPP: 19,042 m 3 FY04 Performance Metrics D E P A R T M E N T O F E N E R G Y U N I T E D S T A T ES O F A M E R I C A TeamWorks TeamWorks TRU A weekly e-newsletter for the Waste Isolation Pilot Plant team For those who endured the early morning cold of March 26, 1999, to witness WIPP's first shipment, it may seem like yesterday. Yet Friday marked five years of WIPP operations. Relative newcomer to WIPP - but not to the waste management industry - CBFO Deputy Manager Lloyd Piper observed, "The transformation from a facility in "standby" mode to operational mode has been nothing short of amazing."

208

WORKING PAPER N 2012 -11  

E-Print Network [OSTI]

. It is an extension of a report from the quantitative pillar of the WORKS project than can be accessed to the promotion of sustainable work and to workplace innovation. The relation between quality of work of quality of work with three main objectives: provide a general mapping of quality of work across European

Paris-Sud XI, Université de

209

ITP Mining: Energy and Environmental Profile of the U.S. Mining Industry: Chapter 4: Iron  

Broader source: Energy.gov (indexed) [DOE]

4 4 Iron The chemical element iron is the fourth most common element in the Earth's crust and the second most abundant metal. About five percent of the Earth's crust is composed of iron. The metal is chemically active and is found in nature combined with other elements in rocks and soils. In its natural state, iron is chemically bonded with oxygen, water, carbon dioxide, or sulfur in a variety of minerals. Forms of Iron Minerals, Ores, and Rocks Iron occurs mainly in iron-oxide ores. Some ores are a mixture of minerals rich in iron. Other iron ores are less rich and have a large number of impurities. The most important iron ore- forming minerals are: * Magnetite - Magnetite (Fe 3 O 4 ) forms magnetic black iron ore. There are large deposits of

210

Working With FEERC  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mechanisms For Partnering Mechanisms For Partnering with the Fuels, Engines, and Emissions Research Center at the Oak Ridge National Laboratory Oak Ridge National Laboratory (ORNL) has a program designed to provide technology-based solutions to organizations ranging from startups to Fortune 100 companies to academic institutions. Underlying this philosophy is our belief that strong partnerships with U.S. industry are the best way to share technological know-how with the private sector. Regardless of the activity-entering into a Cooperative Research and Development Agreement (CRADA) or Work for Others (WFO) agreement, or interacting with an industry or university through other means-we are committed to outcomes that create beneficial opportunities for the external organization as well as

211

End of Month Working  

Gasoline and Diesel Fuel Update (EIA)

The level of gas in storage at the end of the last heating season (March The level of gas in storage at the end of the last heating season (March 31, 2000) was 1,150 billion cubic feet (Bcf), just above the 1995-1999 average of 1,139 Bcf. Underground working gas storage levels are currently about 8-9 percent below year-ago levels. In large part, this is because injection rates since April 1 have been below average. Storage injections picked up recently due to warm weather in the last half of October. The month of November is generally the last month available in the year for injections into storage. A cold November would curtail net injections into storage. If net injections continue at average levels this winter, we project that storage levels will be low all winter, reaching a level of 818 Bcf at the end of March, the lowest level since 1996

212

Work Force Restructuring Activities  

Broader source: Energy.gov (indexed) [DOE]

Force Restructuring Activities Force Restructuring Activities December 10, 2008 Note: Current updates are in bold # Planned Site/Contractor HQ Approved Separations Status General * LM has finalized the compilation of contractor management team separation data for the end of FY07 actuals and end of FY08 and FY09 projections. LM has submitted to Congress the FY 2007 Annual Report on contractor work force restructuring activities. The report has been posted to the LM website. *LM conducted a DOE complex-wide data call to the Field and Operations offices for DOE Contractor Management teams to provide, by program, actual contractor separation data for the end of FY 2008 and projections for the end of FY 2009 and FY 2010. The data will be used to keep senior management informed of upcoming large WFR actions.

213

Statement of Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DE-SOL-0003174 1 FOR OFFICIAL USE ONLY - SOURCE SELECTION SENSITIVE, SEE FAR 3.104-3 PERFORMANCE WORK STATEMENT (PWS) Emergency Operations Training Academy (EOTA) Support Services May 27, 2011 Draft 1.0 Introduction The U.S. Department of Energy (DOE), National Nuclear Security Administration (NNSA), Office of Emergency Operations (NA-40) requires support services in the development and delivery of training, exercises, and other related technical and administrative support services at the Emergency Operations Training Academy (EOTA) in Albuquerque, New Mexico. 2.0 Background NA-40's mission is to ensure that capabilities are in place to respond to any NNSA and DOE facility emergency. NA-40 is the nation's premier responder to any nuclear or radiological

214

How NIF Works  

SciTech Connect (OSTI)

The National Ignition Facility, located at Lawrence Livermore National Laboratory, is the world's largest laser system... 192 huge laser beams in a massive building, all focused down at the last moment at a 2 millimeter ball containing frozen hydrogen gas. The goal is to achieve fusion... getting more energy out than was used to create it. It's never been done before under controlled conditions, just in nuclear weapons and in stars. We expect to do it within the next 2-3 years. The purpose is threefold: to create an almost limitless supply of safe, carbon-free, proliferation-free electricity; examine new regimes of astrophysics as well as basic science; and study the inner-workings of the U.S. stockpile of nuclear weapons to ensure they remain safe, secure and reliable without the need for underground testing. More information about NIF can be found at:

2009-07-30T23:59:59.000Z

215

Working Group Report: Sensors  

SciTech Connect (OSTI)

Sensors play a key role in detecting both charged particles and photons for all three frontiers in Particle Physics. The signals from an individual sensor that can be used include ionization deposited, phonons created, or light emitted from excitations of the material. The individual sensors are then typically arrayed for detection of individual particles or groups of particles. Mounting of new, ever higher performance experiments, often depend on advances in sensors in a range of performance characteristics. These performance metrics can include position resolution for passing particles, time resolution on particles impacting the sensor, and overall rate capabilities. In addition the feasible detector area and cost frequently provides a limit to what can be built and therefore is often another area where improvements are important. Finally, radiation tolerance is becoming a requirement in a broad array of devices. We present a status report on a broad category of sensors, including challenges for the future and work in progress to solve those challenges.

Artuso, M.; et al.,

2013-10-18T23:59:59.000Z

216

How NIF Works  

ScienceCinema (OSTI)

The National Ignition Facility, located at Lawrence Livermore National Laboratory, is the world's largest laser system... 192 huge laser beams in a massive building, all focused down at the last moment at a 2 millimeter ball containing frozen hydrogen gas. The goal is to achieve fusion... getting more energy out than was used to create it. It's never been done before under controlled conditions, just in nuclear weapons and in stars. We expect to do it within the next 2-3 years. The purpose is threefold: to create an almost limitless supply of safe, carbon-free, proliferation-free electricity; examine new regimes of astrophysics as well as basic science; and study the inner-workings of the U.S. stockpile of nuclear weapons to ensure they remain safe, secure and reliable without the need for underground testing. More information about NIF can be found at:

None

2010-09-01T23:59:59.000Z

217

TRU TeamWorks  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8, 2012 8, 2012 WIPP Quick Facts (As of 9-26-12) 10,849 Shipments received since opening (10,252 CH and 597 RH) 83,693 Cubic meters of waste disposed (82,394 CH and 299 RH) 162,472 Containers disposed in the underground (161,882 CH and 590 RH) Photo above right: CBFO Deputy Manager Ed Ziemianski presents a WIPP team with the Green Zia Program Silver Level Award from the New Mexico Environment Department on Aug. 15, 2012 in recognition of environmental initiatives. Shown right of Ziemianski is Farok Sharif, WTS President and General Manager. New WIPP Management and Operating Contractor to start October 1 Nuclear Waste Partnership LLC (NWP) will start work as the WIPP Management and Operating Contractor on Monday, October 1. WIPP receives Green Zia Award The Waste Isolation Pilot Plant (WIPP), the U.S. Department of Energy (DOE)

218

Theoretical Investigation of Hydrogen Adsorption and Dissociation on Iron and Iron Carbide Surfaces Using the ReaxFF Reactive Force Field Method  

SciTech Connect (OSTI)

We have developed a ReaxFF reactive force field to describe hydrogen adsorption and dissociation on iron and iron carbide surfaces relevant for simulation of FischerTropsch (FT) synthesis on iron catalysts. This force field enables large system (>>1000 atoms) simulations of hydrogen related reactions with iron. The ReaxFF force field parameters are trained against a substantial amount of structural and energetic data including the equations of state and heats of formation of iron and iron carbide related materials, as well as hydrogen interaction with iron surfaces and different phases of bulk iron. We have validated the accuracy and applicability of ReaxFF force field by carrying out molecular dynamics simulations of hydrogen adsorption, dissociation and recombination on iron and iron carbide surfaces. The barriers and reaction energies for molecular dissociation on these two types of surfaces have been compared and the effect of subsurface carbon on hydrogen interaction with iron surface is evaluated. We found that existence of carbon atoms at subsurface iron sites tends to increase the hydrogen dissociation energy barrier on the surface, and also makes the corresponding hydrogen dissociative state relatively more stable compared to that on bare iron. These properties of iron carbide will affect the dissociation rate of H{sub 2} and will retain more surface hydride species, thus influencing the dynamics of the FT synthesis process.

Zou, Chenyu; van Duin, Adri C.T.; Sorescu, Dan C.

2012-06-01T23:59:59.000Z

219

System and method for producing metallic iron  

DOE Patents [OSTI]

A hearth furnace for producing metallic iron material has a furnace housing having a drying/preheat zone, a conversion zone, a fusion zone, and optionally a cooling zone, the conversion zone is between the drying/preheat zone and the fusion zone. A moving hearth is positioned within the furnace housing. A hood or separation barrier within at least a portion of the conversion zone, fusion zone or both separates the fusion zone into an upper region and a lower region with the lower region adjacent the hearth and the upper region adjacent the lower region and spaced from the hearth. An injector introduces a gaseous reductant into the lower region adjacent the hearth. A combustion region may be formed above the hood or separation barrier.

Bleifuss, Rodney L; Englund, David J; Iwasaki, Iwao; Fosnacht, Donald R; Brandon, Mark M; True, Bradford G

2013-09-17T23:59:59.000Z

220

Iron and steel industry process model  

SciTech Connect (OSTI)

The iron and steel industry process model depicts expected energy-consumption characteristics of the iron and steel industry and ancillary industries for the next 25 years by means of a process model of the major steps in steelmaking, from ore mining and scrap recycling to the final finishing of carbon, alloy, and stainless steel into steel products such as structural steel, slabs, plates, tubes, and bars. Two plant types are modeled: fully integrated mills and mini-mills. User-determined inputs into the model are as follows: projected energy and materials prices; projected costs of capacity expansion and replacement; energy-conserving options, both operating modes and investments; the internal rate of return required on investment; and projected demand for finished steel. Nominal input choices in the model for the inputs listed above are as follows: National Academy of Sciences Committee on Nuclear and Alternative Energy Systems Demand Panel nominal energy-price projections for oil, gas, distillates, residuals, and electricity and 1975 actual prices for materials; actual 1975 costs; new technologies added; 15% after taxes; and 1975 actual demand with 1.5%/y growth. The model reproduces the base-year (1975) actual performance of the industry; then, given the above nominal input choices, it projects modes of operation and capacity expansion that minimize the cost of meeting the given final demands for each of 5 years, each year being the midpoint of a 5-year interval. The output of the model includes the following: total energy use and intensity (Btu/ton) by type, by process, and by time period; energy conservation options chosen; utilization rates for existing capacity; capital-investment decisions for capacity expansion.

Sparrow, F.T.; Pilati, D.; Dougherty, T.; McBreen, E.; Juang, L.L.

1980-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Will NIF Work  

E-Print Network [OSTI]

It is vital that new clean and abundant sources of energy be developed for the sustainability of modern society. Nuclear fusion of the hydrogen isotopes deuterium and tritium, if successful, might make a major contribution toward satisfying this need. The U.S. has an important effort aimed at achieving practical inertial confinement fusion, ICF, which has been under development for decades at the Lawrence Livermore National Laboratory. The National Ignition Facility (NIF) is a giant laser to multiply-shock and thus quasi-isentropically compress a capsule of deuterium-tritium (DT) to high density and temperature, where the fusion rate is proportional to density squared times temperature to the fourth power. The principal problem that must be solved for NIF to work successfully is elimination of the Rayleigh-Tailor (R-T) instability that originates from the interface between the solid shell and the DT fuel within it. The R-T instability poisons the fusion reaction by reducing the temperature of the DT achieved ...

Nellis, W J

2009-01-01T23:59:59.000Z

222

Performance of the SLD Warm Iron Calorimeter prototype  

SciTech Connect (OSTI)

A prototype hadron calorimeter, of similar design to the Warm Iron Calorimeter (WIC) planned for the SLD experiment, has been built and its performance has been studied in a test beam. The WIC is an iron sampling calorimeter whose active elements are plastic streamer tubes similar to those used for the Mont-Blanc proton decay experiment. The construction and operation of the tubes will be briefly described together with their use in an iron calorimeter - muon tracker. Efficiency, resolution and linearity have been measured in a hadron/muon beam up to 11 GeV. The measured values correspond to the SLD design goals.

Callegari, G.; Piemontese, L.; De Sangro, R.; Peruzzi, I., Piccolo, M.; Busza, W.; Friedman, J.; Johnson, A.; Kendall, H.; Kistiakowsky, V.

1986-03-01T23:59:59.000Z

223

The effects of copper and iron deficiencies in the chick  

E-Print Network [OSTI]

). Copper and iron content of all four diets were determined and the results reported in Table 2, III. Experiment 2. This experiment was carried out to determine the effects of adding cupric oxide to the diet in place of cupric sulfate as the copper... of Copper and Iron Deficiencies on Blood, Mortality and Weights of Four Week Old Chicks Analysis of Copper and Iron Content of Purified Diet" Experiment 3 Effects of Cupric Sulfate, Cupric Oxide, Ferrous Sul- fate and Ferric Oxide on Blood, Mortality...

McGhee, Flin Cameron

2012-06-07T23:59:59.000Z

224

Iron-carbon compacts and process for making them  

DOE Patents [OSTI]

The present invention includes iron-carbon compacts and a process for making them. The process includes preparing a slurry comprising iron powder, furfuryl alcohol, and a polymerization catalyst for initiating the polymerization of the furfuryl alcohol into a resin, and heating the slurry to convert the alcohol into the resin. The resulting mixture is pressed into a green body and heated to form the iron-carbon compact. The compact can be used as, or machined into, a magnetic flux concentrator for an induction heating apparatus.

Sheinberg, Haskell (Santa Fe, NM)

2000-01-01T23:59:59.000Z

225

Aerial Work Platform Safety Program  

E-Print Network [OSTI]

Aerial Work Platform Safety Program Updated: July 22, 2013 #12;Aerial Work Platform Safety Program ..........................................................................................................11 #12;Aerial Work Platform Safety Program 1 The official version of this information will only for establishing and maintaining the Aerial Work Platform Safety Program. Appropriate safety equipment (e

Holland, Jeffrey

226

Video Shoot Scope of Work  

Broader source: Energy.gov [DOE]

Video Shoot Scope of Work, from the Tool Kit Framework: Small Town University Energy Program (STEP).

227

High Temperature Membrane Working Group  

Broader source: Energy.gov [DOE]

This presentation provides an overview of the High Temperature Membrane Working Group Meeting in May 2007.

228

Nickel and iron EXAFS of carbon monoxide dehydrogenase from Clostridium thermoaceticum strain DSM  

Science Journals Connector (OSTI)

Nickel and iron EXAFS of carbon monoxide dehydrogenase from Clostridium thermoaceticum strain DSM ...

Neil R. Bastian; Gabriele. Diekert; Eric C. Niederhoffer; Boon Keng. Teo; Christopher T. Walsh; William H. Orme-Johnson

1988-08-01T23:59:59.000Z

229

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008  

Broader source: Energy.gov [DOE]

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008

230

Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable Reactive Barrier, Monticello, Utah  

Broader source: Energy.gov [DOE]

Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable Reactive Barrier, Monticello, Utah

231

An Application of the Electric Resistance Furnace to the Determination of Oxygen in Iron and Steel.  

Science Journals Connector (OSTI)

An Application of the Electric Resistance Furnace to the Determination of Oxygen in Iron and Steel. ...

R. H. McMillen

1913-01-01T23:59:59.000Z

232

ARM - Engineering Work Request & Engineering Work Order Guidelines  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Work Request & Engineering Work Request & Engineering Work Order Guidelines Page Contents: Introduction Discussion of the ARM Climate Research Facility Engineering Process: The Engineering Change Request (ECR) and the Engineering Change Order (ECO) Operations and Engineering Task Consulting: The Engineering Work Request (EWR) and the Engineering Work Order (EWO) Relationship of the ECR/ECO and EWR/EWO to the Engineering Task Tracking Tool Relationship of the ECR/ECO and EWR/EWO to the Existing Configuration Control Process in the ARM Climate Research Facility(PIF/CAR, PRR, ORR, and BCR) Glossary Frequently Asked Questions (PDF, 173K) Engineering Work Request & Engineering Work Order Guidelines Process Guidelines for the Engineering Change Request/Engineering Change Order and Engineering Work Request/Engineering Work Order

233

LANSCE | Lujan Center | Highlights | Local iron displacements and  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Local iron displacements and magnetoelastic coupling in a spin-ladder Local iron displacements and magnetoelastic coupling in a spin-ladder compound Hypothesis: Is magnetoelastic coupling in [FeX4]-based materials, an important ingredient in the emergence of superconductivity? Lujan Center: Combined Total Scattering and magnetic structure determination (HIPD-NPDF) The study of local, average and magnetic structure shows the existenceof highly correlated local iron (Fe) displacements in the spin-ladder iron chalcogenide BaFe2Se3. Built of ferromagnetic [Fe4] plaquettes, the magnetic ground state correlates with local displacements of the Fe atoms. Knowledge of these local displacements is essential for properly understanding the electronic structure of these systems. As with the copper oxide superconductors two decades ago, these

234

Percolation Explains How Earth's Iron Core Formed | Stanford Synchrotron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Percolation Explains How Earth's Iron Core Formed Percolation Explains How Earth's Iron Core Formed Wednesday, November 27, 2013 The formation of Earth's metallic core, which makes up a third of our planet's mass, represents the most significant differentiation event in Earth's history. Earth's present layered structure with a metallic core and an overlying silicate mantle would have required mechanisms to separate iron alloy from a silicate phase. Percolation of liquid iron alloy moving through a solid silicate matrix (much as water percolates through porous rock, or even coffee grinds) has been proposed as a possible model for core formation (Figure 1). Many previous experimental results have ruled out percolation as a major core formation mechanism for Earth at the relatively lower pressure conditions in the upper mantle, but until now experimental

235

Regenerable Mixed Copper-Iron-Inert Support Oxygen Carriers  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mixed Copper-Iron-Inert Support Oxygen Carriers Mixed Copper-Iron-Inert Support Oxygen Carriers for Solid Fuel Chemical Looping Combustion Process Contact NETL Technology Transfer Group techtransfer@netl.doe.gov December 2012 This patent-pending technology, "Regenerable Mixed Copper-Iron-Inert Support Oxygen Carriers for Solid Fuel Chemical Looping Combustion Process," provides a metal-oxide oxygen carrier for application in fuel combustion processes that use oxygen. This technology is available for licensing and/or further collaborative research with the U.S. Department of Energy's National Energy Technology Laboratory. Overview Patent Details U.S. Non-Provisional Patent Application No. 13/159,553; titled "Regenerable Mixed Copper-Iron-Inert Support Oxygen Carriers for Solid

236

Open Ocean Iron Fertilization for Scientific Study and Carbon Sequestration  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ocean Iron Fertilization for Scientific Study and Carbon Sequestration Ocean Iron Fertilization for Scientific Study and Carbon Sequestration K. Coale coale@mlml.calstate.edu (831) 632-4400 Moss Landing Marine Laboratories 8272 Moss Landing Road Moss Landing, California 95039 USA Abstract The trace element iron has been recently shown to play a critical role in nutrient utilization, phytoplankton growth and therefore the uptake of carbon dioxide from the surface waters of the global ocean. Carbon fixation in the surface waters, via phytoplankton growth, shifts the ocean/atmosphere exchange equilibrium for carbon dioxide. As a result, levels of atmospheric carbon dioxide (a greenhouse gas) and iron flux to the oceans have been linked to climate change (glacial to interglacial transitions). These recent findings have led some to suggest that large scale

237

DOE - Office of Legacy Management -- Knoxville Iron Co - TN 07  

Office of Legacy Management (LM)

Knoxville Iron Co - TN 07 Knoxville Iron Co - TN 07 FUSRAP Considered Sites Site: KNOXVILLE IRON CO. (TN.07 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Knoxville , Tennessee TN.07-1 Evaluation Year: 1994 TN.07-2 TN.07-3 Site Operations: Melted uranium contaminated scrap metal in order to test industrial hygiene procedures in the mid-1950s. TN.07-1 Site Disposition: Eliminated - AEC license TN.07-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Limited Quantities of Uranium Contained in Slag Material TN.07-4 Radiological Survey(s): Yes - health and safety monitoring during operations only TN.07-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to KNOXVILLE IRON CO.

238

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the The Iron Spin Transition in the Earth's Lower Mantle The Iron Spin Transition in the Earth's Lower Mantle Print Wednesday, 30 April 2008 00:00 It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

239

Decoupling of iron and phosphate in the global ocean  

E-Print Network [OSTI]

M increase in dissolved iron in deep waters. Forcing the model with weaker wind stresses leads to a decrease CO2. Additionally, nitrogen fixing organisms (reviewed by Karl et al. [2002] and Mills et al. [2004

Follows, Mick

240

Chapter 1.2 - The Direct Reduction of Iron  

Science Journals Connector (OSTI)

Abstract For the past 100 years, the dominant technology to produce iron from iron ores has been the blast furnace, which utilizes carbothermic reduction at elevated temperatures to make a molten iron product and a liquid slag. However, economic ironmaking in this fashion requires massive facilities for economy of scale, and is environmentally problematic with its sinter plants, coke ovens, and large production of carbon dioxide. Direct reduction (DR) is an alternate form of ironmaking that is economic at much smaller scales, generally uses natural gas as reductant instead of coke, and costs considerably less than a blast furnace facility. Worldwide production of Direct Reduced Iron has increased from less than one million tonnes per year in 1971 to over 70 million tonnes forty years later. DRI production is expected to continue this rapid increase for years to come.

Thomas Battle; Urvashi Srivastava; John Kopfle; Robert Hunter; James McClelland

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Iron and DHA in Relation to Early Cognitive Development  

E-Print Network [OSTI]

(SF), and body iron (BI); DHA by median split. Bayley Scales of Infant Development Index II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI) at 18 months (n=191) were assessed. A priori comparisons observed MDI...

Park, Loran Marie

2013-05-31T23:59:59.000Z

242

Surface modifications of iron oxide nanoparticles for biological applications  

E-Print Network [OSTI]

Iron oxides magnetic nanoparticles (MPs) of high crystallinity, high magnetization, and size-monodispersity were synthesized with oleic acid as their native ligands. These hydrophobic and non-functionalized MPs have magnetic ...

Insin, Numpon

2011-01-01T23:59:59.000Z

243

Polymer-coated iron oxide nanoparticles for medical imaging  

E-Print Network [OSTI]

One of the most versatile and safe materials used in medicine are polymer-coated iron oxide nanoparticles. This dissertation describes several formulations for in vivo imaging applications. The paramagnetic polymer-coated ...

Chen, Suelin, Ph.D. Massachusetts Institute of Technology

2010-01-01T23:59:59.000Z

244

Mechanism of iron catalysis of carbon monoxide decomposition in refractories  

SciTech Connect (OSTI)

The authors discuss the catalytic effects of selected iron phases (metals, oxides, sulfides, and carbides) on the Boudouard reaction studied in an effort to more fully understand the disintegration of refractories when exposed to CO for long periods of time. It was found that active Fe atoms generated from the reduction of the iron oxides, especially {alpha}-Fe/sub 2/O/sub 3/, are the actual catalysts for the Boudouard reaction. The catalytic process confirmed by thermodynamic calculations, kinetic data, and X-ray diffraction data, consists of adsorption and decomposition of CO simultaneously forming carbides of iron. The chemisorption and subsequent decomposition of the iron carbides, rather than diffusion, constitute the rate-controlling process for carbon deposition.

Xu, M.W.P.; Brown, J.J. Jr. (Virginia Polytechnic Inst. and State Univ., Blacksburg, VA (USA). Dept. of Materials Engineering)

1989-01-01T23:59:59.000Z

245

Evidence for a Weak Iron Core at Earth's Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Core at Earth's Center Print Seismic waves that pass through the center of the Earth travel faster going from pole to pole than along the equatorial plane-why? One theory...

246

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons....

247

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2008 00:00 It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons....

248

Brain Iron as an Early Predictor of Alzheimer's Disease | Advanced...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

| 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed Brain Iron as an Early Predictor of Alzheimer's Disease JUNE 15, 2011 Bookmark and Share (A)...

249

Momentum Distribution of Electrons in Chromium, Iron, and Nickel  

Science Journals Connector (OSTI)

The Compton profiles of the electron momentum distribution in chromium, iron, and nickel are calculated using the wave functions obtained from self-consistent linear-combination-of-atomic-orbitals energy-band calculations. The results are compared with experiment.

J. Rath, C. S. Wang, R. A. Tawil, and J. Callaway

1973-12-01T23:59:59.000Z

250

Energy intensity in China's iron and steel sector  

E-Print Network [OSTI]

In this study, I examine the spatial and economic factors that influence energy intensity in China's iron and steel sector, namely industrial value added, renovation investment, coke consumption, and local coke supply. ...

Xu, Jingsi, M.C.P. Massachusetts Institute of Technology

2011-01-01T23:59:59.000Z

251

Magnetism and Superconductivity Compete in Iron-based Superconductors...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Magnetism and Superconductivity Compete in Iron-based Superconductors Wednesday, April 30, 2014 HTSC Figure 1 Fig. 1. Measured electronic structure of underdoped Ba1-xKxFe2As2 in...

252

Laboratory and field studies of colloidal iron oxide dissolution as ...  

Science Journals Connector (OSTI)

Mechanisms that mediate the conversion of iron from the refractory pool to the ... lated to the extent of dissolution of the ferrihydrite carrier phase, even for .... totals was determined on a Canberra low-energy germanium detector. Replicate...

2000-06-05T23:59:59.000Z

253

Injection of Zero Valent Iron into an Unconfined Aquifer Using...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Zero Valent Iron into an Unconfined Aquifer Using Shear-Thinning Fluids."Ground Water Monitoring and Remediation 31(1):50-58. Authors: MJ Truex VR Vermeul DP Mendoza BG...

254

Mineral Precipitation Upgradient from a Zero-Valent Iron Permeable...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Precipitation Upgradient from a Zero-Valent Iron Permeable Reactive Barrier."Ground Water Monitoring and Remediation 28(3):56-64. doi:10.1111j.1745-6592.2008.00203.x Authors:...

255

Hepcidin Is Involved in Iron Regulation in the Ischemic Brain  

E-Print Network [OSTI]

Oxidative stress plays an important role in neuronal injuries caused by cerebral ischemia. It is well established that free iron increases significantly during ischemia and is responsible for oxidative damage in the brain. ...

Ding, Hui; Yan, Cai-Zhen; Shi, Honglian; Zhao, Ya-Shuo; Chang, Shi-Yang; Yu, Peng; Wu, Wen_Shuang; Zhao, Chen-Yang; Chang, Yan-Zhong; Duan, Xiang-Lin

2011-09-21T23:59:59.000Z

256

The industrial ecology of the iron casting industry  

E-Print Network [OSTI]

Metal casting is an energy and materials intensive manufacturing process, which is an important U.S. industry. This study analyzes iron casting, in particular, for possible improvements that will result in greater efficiencies ...

Jones, Alissa J. (Alissa Jean)

2007-01-01T23:59:59.000Z

257

Mixed valence of iron in minerals with cation clusters  

Science Journals Connector (OSTI)

The valence and distribution of iron in vivianite, lazulite, babingtonite, rockbridgeite, acmite, aegirine-augite, hedenbergite,...2+ and Fe3+ in neighboring sites through common edges or faces is observed in all...

Georg Amthauer; George R. Rossman

1984-06-01T23:59:59.000Z

258

Verification of Steelmaking Slags Iron Content Final Technical Progress Report  

SciTech Connect (OSTI)

The steel industry in the United States generates about 30 million tons of by-products each year, including 6 million tons of desulfurization and BOF/BOP slag. The recycling of BF (blast furnace) slag has made significant progress in past years with much of the material being utilized as construction aggregate and in cementitious applications. However, the recycling of desulfurization and BOF/BOP slags still faces many technical, economic, and environmental challenges. Previous efforts have focused on in-plant recycling of the by-products, achieving only limited success. As a result, large amounts of by-products of various qualities have been stockpiled at steel mills or disposed into landfills. After more than 50 years of stockpiling and landfilling, available mill site space has diminished and environmental constraints have increased. The prospect of conventionally landfilling of the material is a high cost option, a waste of true national resources, and an eternal material liability issue. The research effort has demonstrated that major inroads have been made in establishing the viability of recycling and reuse of the steelmaking slags. The research identified key components in the slags, developed technologies to separate the iron units and produce marketable products from the separation processes. Three products are generated from the technology developed in this research, including a high grade iron product containing about 90%Fe, a medium grade iron product containing about 60% Fe, and a low grade iron product containing less than 10% Fe. The high grade iron product contains primarily metallic iron and can be marketed as a replacement of pig iron or DRI (Direct Reduced Iron) for steel mills. The medium grade iron product contains both iron oxide and metallic iron and can be utilized as a substitute for the iron ore in the blast furnace. The low grade iron product is rich in calcium, magnesium and iron oxides and silicates. It has a sufficient lime value and can be utilized for acid mine drainage treatment. Economic analysis from this research demonstrates that the results are favorable. The strong demand and the increase of price of the DRI and pig iron in recent years are particularly beneficial to the economics. The favorable economics has brought commercial interests. ICAN Global has obtained license agreement on the technology from Michigan Tech. This right was later transferred to the Westwood Land, Inc. A demonstration pilot plant is under construction to evaluate the technology. Steel industry will benefit from the new supply of the iron units once the commercial plants are constructed. Environmental benefits to the public and the steel industry will be tremendous. Not only the old piles of the slag will be removed, but also the federal responsible abandoned mines from the old mining activities can be remediated with the favorable product generated from the process. Cost can be reduced and there will be no lime required, which can avoid the release of carbon dioxide from lime production process.

J.Y. Hwang

2006-10-04T23:59:59.000Z

259

Process for removing technetium from iron and other metals  

DOE Patents [OSTI]

A process for removing technetium from iron and other metals comprises the steps of converting the molten, alloyed technetium to a sulfide dissolved in manganese sulfide, and removing the sulfide from the molten metal as a slag. 4 figs.

Leitnaker, J.M.; Trowbridge, L.D.

1999-03-23T23:59:59.000Z

260

Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Charge Dosage Rate Title Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Charge Dosage Rate Publication Type Journal Article Refereed Designation Refereed LBNL Report Number LBNL-6221E Year of Publication 2013 Authors Amrose, Susan, Ashok J. Gadgil, Venkat Srinivasan, Kristin Kowolik, Marc Muller, Jessica Huang, and Robert Kostecki Journal Joournal of Environmental Science and Health, Part A: Toxic/Hazardous Substances and Environmental Engineering Volume 48 Issue 9 Pagination 1019-1030 Date Published 04/2013 Keywords arsenic, bangladesh, Cambodia, dosage rate, electrocoagulation, india, water treatment Abstract We demonstrate that electrocoagulation (EC) using iron electrodes can reduce arsenic below 10 μg/L in synthetic Bangladesh groundwater and in real groundwater from Bangladesh and Cambodia while investigating the effect of operating parameters that are often overlooked, such as charge dosage rate. We measure arsenic removal performance

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Neutron scattering study of the iron based superconductors.  

E-Print Network [OSTI]

??In most iron-based and copper-oxide superconductors, the Tc [superconducting critical temperature] gradually increases upon charge carrier doping or isovalent doping. In the under-doped regime of (more)

Wang, Miaoyin

2013-01-01T23:59:59.000Z

262

Stellar $?^{\\pm}$ decay rates of iron isotopes and its implications in astrophysics  

E-Print Network [OSTI]

$\\beta$-decay and positron decay are believed to play a consequential role during the late phases of stellar evolution of a massive star culminating in a supernova explosion. Recently the microscopic calculation of weak-interaction mediated rates on key isotopes of iron was introduced using the proton-neutron quasiparticle random phase approximation (pn-QRPA) theory with improved model parameters. Here I discuss in detail the improved calculation of $\\beta^{\\pm}$ decay rates for iron isotopes ($^{54,55,56}$Fe) in stellar environment. The pn-QRPA theory allows a microscopic "state-by-state" calculation of stellar rates as explained later in text. Excited state Gamow-Teller distributions are much different from ground state and a microscopic calculation of decay rates from these excited states greatly increases the reliability of the total decay rate calculation specially during the late stages of stellar evolution. The reported decay rates are also compared with earlier calculations. The positron decay rates are in reasonable agreement with the large-scale shell model calculation. The main finding of this work includes that the stellar $\\beta$-decay rates of $^{54,55,56}$Fe are around 3 -- 5 orders of magnitude smaller than previously assumed and hence irrelevant for the determination of the evolution of $Y_{e}$ during the presupernova phase of massive stars. The current work discourages the inclusion of $^{55,56}$Fe in the list of key stellar $\\beta$-decay nuclei as suggested by former simulation results.

Jameel-Un Nabi

2014-08-19T23:59:59.000Z

263

Slurry Phase Iron Catalysts for Indirect Coal Liquefaction  

SciTech Connect (OSTI)

This report describes research conducted to support the DOE program in indirect coal liquefaction. Specifically, we have studied the attrition behavior of Iron Fischer-Tropsch catalysts, their interaction with the silica binder and the evolution of iron phases in a synthesis gas conversion process. The results provide significant insight into factors that should be considered in the design of catalysts for the conversion of coal-derived synthesis gas into liquid fuels.

Abhaya K. Datye

1998-09-10T23:59:59.000Z

264

Sound speed and thermophysical properties of liquid iron and nickel  

Science Journals Connector (OSTI)

An electrical-pulse-heating technique has been used to heat iron and nickel to high temperatures to measure thermophysical properties in the liquid state. A dynamic technique was used because static techniques, which are capable of greater precision, fail at a relatively low temperature. Measurements have been made, and results are shown for enthalpy, temperature, density, electrical resistivity, and sound speed up to 3950 K in iron and 4250 K in nickel.

R. S. Hixson; M. A. Winkler; M. L. Hodgdon

1990-10-01T23:59:59.000Z

265

SLURRY PHASE IRON CATALYSTS FOR INDIRECT COAL LIQUEFACTION  

SciTech Connect (OSTI)

This report describes research conducted to support the DOE program in indirect coal liquefaction. Specifically, they have studied the attrition behavior of iron Fischer-Tropsch catalysts, their interaction with the silica binder and the evolution of iron phases in a synthesis gas conversion process. The results provide significant insight into factors that should be considered in the design of catalysts for converting coal based syngas into liquid fuels.

Abhaya K. Datye

1998-11-19T23:59:59.000Z

266

Polymorphous Transformations of Nanometric Iron(III) Oxide: A Review  

Science Journals Connector (OSTI)

Because of its polymorphism, iron(III) oxide (ferric oxide, Fe2O3) is one of the most interesting and potentially useful phases of the iron oxides. ... Structural and magnetic properties, methods of synthesis, and applications of seven Fe(III) oxide polymorphs, including rare beta, epsilon, amorphous, and high-pressure forms, are reviewed. ... Films of ?-Fe2O3 nanoparticles were synthesized by oxidizing Fe films rapidly in air. ...

Libor Machala; Ji? Tu?ek; Radek Zbo?il

2011-06-01T23:59:59.000Z

267

High-temperature fabricable nickel-iron aluminides  

DOE Patents [OSTI]

Nickel-iron aluminides are described that are based on Ni.sub.3 Al, and have significant iron content, to which additions of hafnium, boron, carbon and cerium are made resulting in Ni.sub.3 Al base alloys that can be fabricated at higher temperatures than similar alloys previously developed. Further addition of molybdenum improves oxidation and cracking resistance. These alloys possess the advantages of ductility, hot fabricability, strength, and oxidation resistance.

Liu, Chain T. (Oak Ridge, TN)

1988-02-02T23:59:59.000Z

268

Iron chelators ICL670 and 311 inhibit HIV-1 transcription  

SciTech Connect (OSTI)

HIV-1 replication is induced by an excess of iron and iron chelation by desferrioxamine (DFO) inhibits viral replication by reducing proliferation of infected cells. Treatment of cells with DFO and 2-hydroxy-1-naphthylaldehyde isonicotinoyl hydrazone (311) inhibit expression of proteins that regulate cell-cycle progression, including cycle-dependent kinase 2 (CDK2). Our recent studies showed that CDK2 participates in HIV-1 transcription and viral replication suggesting that inhibition of CDK2 by iron chelators might also affect HIV-1 transcription. Here we evaluated the effect of a clinically approved orally effective iron chelator, 4-[3,5-bis-(hydroxyphenyl)-1,2,4-triazol-1-yl]-benzoic acid (ICL670) and 311 on HIV-1 transcription. Both ICL670 and 311 inhibited Tat-induced HIV-1 transcription in CEM-T cells, 293T and HeLa cells. Neither ICL670 nor 311 induced cytotoxicity at concentrations that inhibited HIV-1 transcription. The chelators decreased cellular activity of CDK2 and reduced HIV-1 Tat phosphorylation by CDK2. Neither ICL670A or 311 decreased CDK9 protein level but significantly reduced association of CDK9 with cyclin T1 and reduced phosphorylation of Ser-2 residues of RNA polymerase II C-terminal domain. In conclusion, our findings add to the evidence that iron chelators can inhibit HIV-1 transcription by deregulating CDK2 and CDK9. Further consideration should be given to the development of iron chelators for future anti-retroviral therapeutics.

Debebe, Zufan; Ammosova, Tatyana [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Jerebtsova, Marina [Children's National Medical Center, CRI Center for Cancer and Immunology, 111 Michigan Ave., N.W., Washington, DC 20060 (United States); Kurantsin-Mills, Joseph [Department of Biophysics and Physiology, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Niu, Xiaomei; Charles, Sharroya [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Richardson, Des R. [Iron Metabolism and Chelation Program, Department of Pathology, Blackburn Building (D06), University of Sydney, Sydney, New South Wales, 2006 Australia (Australia); Ray, Patricio E. [Children's National Medical Center, CRI Center for Cancer and Immunology, 111 Michigan Ave., N.W., Washington, DC 20060 (United States); Gordeuk, Victor R. [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Nekhai, Sergei [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Department of Biochemistry and Molecular Biology, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States)], E-mail: snekhai@howard.edu

2007-10-25T23:59:59.000Z

269

Electrochemical behavior of reactively sputtered iron-doped nickel oxide  

SciTech Connect (OSTI)

Iron-doped nickel oxide films were deposited by reactive sputtering from elemental and alloy targets in a 20% oxygen/argon atmosphere and were characterized for use as oxygen evolution catalysts. The incorporation of iron reduced the overpotential required for oxygen evolution by as much as 300 mV at a current density of 100 mA/cm{sup 2} compared to undoped nickel oxide deposited under similar conditions. Tafel slopes were reduced from 95 mV/dec in undoped NiO{sub x} films to less than 40 mV/dec for films containing 1.6 to 5.6 mole percent (m/o) iron, indicating a change in the rate-limiting step from the primary discharge of OH{sup {minus}} ions to the recombination of oxygen radicals. Resistivity, structural, and compositional measurements indicate that high oxygen content is necessary to gain the full benefit of the iron dopant. Initial tests in KOH indicate excellent long-term stability. A film deposited from the FeNi alloy target, which exhibited low oxygen overpotentials and a Tafel slope of 35 mV/dec, had not degraded appreciably following more than 7,000 h of operation at an anodic current density of 20 mA/cm{sup 2}. Taken together, the low oxygen evolution reaction overpotentials, the excellent stability in KOH, and the relative insensitivity to iron content indicative that reactively sputtered iron-doped nickel oxide is promising as an oxygen catalyst.

Miller, E.L.; Rocheleau, R.E. [Univ. of Hawaii, Honolulu, HI (United States)

1997-09-01T23:59:59.000Z

270

Synthesis of iron oxides and the influence of organic acids on the resolubilization of iron minerals  

E-Print Network [OSTI]

of Organ1c Acids on the Resolubi1 izat1on of Iron M1neral s. (May 1984) Er1c Thacher Clarke, B. A. , Southwestern University Chairman of Advisory Committee: Dr. Richard H. Loeppert Equilibrium Fe concentrat1ons of calcareous soil are readily... and reducing agents, buffered in 1. 0 N NH4 acetate at pH 3. 5 and 4. 75, Dissolution rate in oxalic acid decreased in the following order: ferrihydrite, lep1docroc1te, and goeth1te. Rate of Fe ox1de dissolution 1n the presence of com- plexing and reducing...

Clarke, Eric Thacher

2012-06-07T23:59:59.000Z

271

Radiation Safety Work Control Form  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Radiation Safety Work Control Form Radiation Safety Work Control Form (see instructions on pg-2) Rev July-2012 Area: Form #: Date: Preliminary Applicability Screen: (a) Will closing the beam line injection stoppers mitigate the radiological hazards introduced by the proposed work? Yes No (b) Can the closed state of the beam line injection stoppers be assured during the proposed work (ie., work does NOT involve injection stoppers or associated HPS)? Yes No If the answers to both questions are yes, the work can be performed safely under an SSRL RSWCF. If the answer to either question is no, then the work must be performed under a SPEAR3 RSWCF. Section 1: Description of work to be done, including date and time. (Person Responsible completes section)

272

Who Works for NIF & PS?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

about Who Works for NIF & PS? The National Ignition Facility is the product of thousands of hours of work by some of the world's most creative and visionary scientists, engineers...

273

Coping with Hot Work Environments  

E-Print Network [OSTI]

E-340 04/05 Many Texans work under hot, humid conditions. Summer heat is a particular hazard to agricultural pro- ducers who work long hours under the sun. However, other people working in hot yards, gardens, kitchens or industry jobs are also... evaporation. Wiping sweat from the skin with a cloth also prevents cooling from evaporation. In hot, humid conditions, hard work becomes harder. The sweat glands release moisture and essential David W. Smith, Extension Safety Program The Texas A&M...

Smith, David

2005-04-28T23:59:59.000Z

274

Water Resources Working Group Report  

E-Print Network [OSTI]

Water Resources Working Group Report This report provided content for the Wisconsin Initiative in February 2011. #12;Water Resources Working Group Wisconsin Initiative on Climate Change Impacts October 2010 #12;Water Resources Working Group Members ­ WICCI Tim Asplund (Co-Chair) - Wisconsin Department

Sheridan, Jennifer

275

The effect of iron dilution on strength of nickel/steel and Monel/steel welds  

SciTech Connect (OSTI)

The weld strength, as a function of iron content, for nickel/steel and Monel/steel welds was determined. Samples were prepared using a Gas Metal Arc (GMAW) automatic process to weld steel plate together with nickel or Monel to produce a range of iron contents typical of weld compositions. Tensile specimens of each iron content were tested to obtain strength and ductility measurements for that weld composition. Data indicate that at iron contents of less than 20% iron in a nickel/steel weld, the weld fails at the weld interface, due to a lack of fusion. Between 20% and 35% iron, the highest iron dilution that could be achieved in a nickel weld, the welds were stronger than the steel base metal. This indicates that a minimum amount of iron dilution (20%) is necessary for good fusion and optimum strength. On the other hand for Monel/steel welds, test results showed that the welds had good strength and integrity between 10% and 27% iron in the weld. Above 35% iron, the welds have less strength and are more brittle. The 35% iron content also corresponds to the iron dilution in Monel welds that has been shown to produce an increase in corrosion rate. This indicates that the iron dilution in Monel welds should be kept below 35% iron to maximize both the strength and corrosion resistance. 2 refs., 6 figs., 3 tabs.

Fout, S.L.; Wamsley, S.D.

1983-03-28T23:59:59.000Z

276

July 2012, Work Force Retention Work Group Status Overview  

Broader source: Energy.gov (indexed) [DOE]

Work Force Retention Work Group Status Overview Work Force Retention Work Group Status Overview Accomplishments: 1. Progress on the completion of the 10 CFR 1046 modifications to address barriers to workforce retention. Written response to public comment is being drafted by HS-51. 2. Pro-Force (PF) union representative, Randy Lawson, identified this accomplishment as the single most significant step toward PF workforce retention in over 20 years. 3. Draft re-charter of PF Career Options Committee (PFCOC) to establish a PF Working Group approved by GC-63 and GC NNSA. Near Term Goals and Activities: 1. Publish 1046 as a final rule - anticipated completion no later than September, assuming timely OMB review and approval. 2. Draft PF Working Group charter final review by senior management to be

277

Project Work | Tobias Berger | July 2006Page 1 Project Work  

E-Print Network [OSTI]

........................................................................................ 6 1.1.3 Working on the Brand Image ................................................................................................... 6 1.1 Brand Communication in International Collaboration at the Vattenfall Group

278

Relationship between the properties of iron sulfides and their catalytic activity  

SciTech Connect (OSTI)

Iron sulfides, such as pyrite, are known catalysts in coal liquefaction and produce significant increases in both conversion and distillate (850 F/sup -/) yield. The main objective of this work is to increase the catalytic activity of iron sulfides by systematically changing the following properties: composition, source, particle size, surface area, morphology and defect level. Several iron sulfides have been synthesized including pyrite (FeS/sub 2/) with 46.6 wt % Fe, pyrrhotite (Fe/sub 1-x/S) with about 60 wt % Fe and mackinawite (Fe/sub 9/S/sub 8/) with 66.2 wt % Fe. The source variations have included commercial material and minerals. The pyrite particle sizes ranged from -350 to -5..mu..m, the pyrite surface areas varied from 2 to >10 m/sup 2//g, the mackinawite surface areas ranged from 40 to 80 m/sup 2//g, and pyrite morphologies included massive material and a concentrate of framboids from Iowa coal. Moessbauer studies of the pyrrhotites in coal liquefaction residues have shown that there is a direct correlation between conversion and the number of vacancies in the pyrrhotite. Pyrites with enhanced defect levels were prepared by explosively shock loading Robena pyrite at 15 GPa. All these materials have been tested in either tubing reactor or autoclave runs with West Virginia Blacksville No. 2 coal and SRC-II heavy distillate (550/sup 0/F/sup +/). The runs were carried out at 425/sup 0/C, 500 psi H/sub 2/ (cold charge) for 30 minutes with a 7.5 wt % catalyst loading. All these materials have shown catalytic effects as compared to uncatalyzed thermal runs.

Stohl, F.V.; Granoff, B.

1981-01-01T23:59:59.000Z

279

Separation of Fischer-Tropsch Wax Products from Ultrafine Iron Catalyst Particles  

SciTech Connect (OSTI)

In this reporting period, a study of ultra-fine iron catalyst filtration was initiated to study the behavior of ultra-fine particles during the separation of Fischer-Tropsch Synthesis (FTS) liquids filtration. The overall focus of the program is with slurry-phase FTS in slurry bubble column reactor systems. Hydrocarbon products must be separated from catalyst particles before being removed from the reactor system. An efficient wax product/catalyst separation system is a key factor for optimizing operating costs for iron-based slurry-phase FTS. Previous work has focused on catalyst particle attrition and the formation of ultra-fine iron carbide and/or carbon particles. With the current study, we are investigating how the filtration properties are affected by these chemical and physical changes of the catalyst slurry during activation/synthesis. The change of particle size during the slurry-phase FTS has monitored by withdrawing catalyst sample at different TOS. The measurement of dimension of the HRTEM images of samples showed a tremendous growth of the particles. Carbon rims of thickness 3-6 nm around the particles were observed. This growth in particle size was not due to carbon deposition on the catalyst. A conceptual design and operating philosophy was developed for an integrated wax filtration system for a 4 liter slurry bubble column reactor to be used in Phase II of this research program. The system will utilize a primary inertial hydroclone followed by a Pall Accusep cross-flow membrane. Provisions for cleaned permeate back-pulsing will be included to as a flux maintenance measure.

James K. Neathery; Gary Jacobs; Amitava Sarkar; Burtron H. Davis

2005-09-30T23:59:59.000Z

280

Dynamics of iron-acceptor-pair formation in co-doped silicon  

SciTech Connect (OSTI)

The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F. [Calisolar GmbH, Magnusstrasse 11, 12489 Berlin (Germany)] [Calisolar GmbH, Magnusstrasse 11, 12489 Berlin (Germany); Mller, C. [CiS Forschungsinstitut fr Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany) [CiS Forschungsinstitut fr Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany); TU Ilmenau, Institut fr Physik, Weimarer Str. 32, 98693 Ilmenau (Germany); Lauer, K. [CiS Forschungsinstitut fr Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany)] [CiS Forschungsinstitut fr Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany)

2013-11-11T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

FACT SHEET: BIOENERGY WORKING GROUP  

Broader source: Energy.gov (indexed) [DOE]

, 2010 , 2010 1 FACT SHEET: BIOENERGY WORKING GROUP At the Clean Energy Ministerial in Washington, D.C. on July 19 th and 20 th , ministers launched a Bioenergy Working Group, which will advance the deployment of bioenergy technologies by implementing recommendations of the Technology Action Plan on Bioenergy Technologies that was released by the Major Economies Forum Global Partnership in December 2009. The Working Group will work in close cooperation with the Global Bioenergy Partnership (GBEP), which is co-chaired by Brazil and Italy. Initial key activities of the Working Group include: 1. Global Bioenergy Atlas: The Working Group will combine and build upon existing databases of sustainably-developed bioenergy potential around the globe and make it available in an open web-

282

Work For Others (Non-Department of Energy Funded Work)  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

Work for Others (WFO) is the performance of work for non-Department of Energy (DOE) entities by DOE/National Nuclear Security Administration (NNSA) and/or their respective contractor personnel or the use of DOE/NNSA facilities that is not directly funded by DOE appropriations. Cancels DOE O 481.1A.

2001-09-28T23:59:59.000Z

283

Work For Others (Non-Department of Energy Funded Work)  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

Work for Others (WFO) is the performance of work for non-Department of Energy (DOE) entities by DOE/National Nuclear Security Administration (NNSA) and/or their respective contractor personnel or the use of DOE/NNSA facilities that is not directly funded by DOE appropriations. WFO has the following objectives. Cancels DOE O 481.1.

2001-01-03T23:59:59.000Z

284

Millihertz QPOs and broad iron line from LMC X-1  

E-Print Network [OSTI]

We study the temporal and energy spectral characteristics of the persistent black hole X-ray binary LMC X-1 using two XMM-Newton and a Suzaku observation. We report the discovery of low frequency (~ 26-29 mHz) quasi-periodic oscillations (QPOs). We also report the variablity of the broad iron K-alpha line studied earlier with Suzaku. The QPOs are found to be weak with fractional rms amplitude in the ~ 1-2 % range and quality factor Q~2-10 . They are accompanied by weak red noise or zero-centered Lorentzian components with rms variability at the ~ 1-3 % level. The energy spectra consists of three varying components - multicolour disk blackbody (kT_{in} ~ 0.7-0.9 keV), high energy power-law tail (Gamma ~ 2.4 - 3.3) and a broad iron line at 6.4-6.9 keV. The broad iron line, the QPO and the strong power-law component are not always present. The QPOs and the broad iron line appear to be clearly detected in the presence of a strong power-law component. The broad iron line is found to be weaker when the disk is like...

Alam, Md Shah; Belloni, T; Mukherjee, D; Jhingan, S

2014-01-01T23:59:59.000Z

285

September 2012, Work Force Retention Work Group Status Overview  

Broader source: Energy.gov (indexed) [DOE]

Work Force Retention Work Group Status Overview Work Force Retention Work Group Status Overview 2 Subgroups: Pro-Force and Non-Pro-Force Pro-Force Subgroup: Accomplishments: 1. Completion of 10 CFR 1046 [Protective Force Personnel Medical, Physical Readiness, Training, and Access Authorization Standards] as a final rule that includes modification efforts to address barriers to workforce retention. 2. Pro-Force (PF) union representative, Randy Lawson, identified this accomplishment as the single most significant step toward PF workforce retention in over 20 years. 3. Draft re-charter of PF Career Options Committee (PFCOC) to establish a PF Working Group approved by GC-63 and GC NNSA. Near Term Goals and Activities: 1. Publish 1046 as a final rule - publication anticipated this month.

286

Infrared Thermography (IRT) Working Group  

Broader source: Energy.gov (indexed) [DOE]

Infrared Thermography (IRT) Working Group Sco McWilliams U.S. Photovoltaic Manufacturing Consor;um (PVMC) Infrared Thermography Infrared Thermography (IRT) has been demonstrated...

287

Working with SRNL - Technology Transfer  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SRNL GO Tech Briefs Contacts Ombudsman Tech Home SRNL Home Working with SRNL Technology Transfer 2014 SRNL Research and Technology Recognition Reception Click to view the 2014...

288

Strategic Initiatives Work Group Charter  

Broader source: Energy.gov [DOE]

Strategic Initiatives Work Group promote excellence and continuous improvement in the implementation of worker health and safety programs across the DOE complex.

289

High Temperature Membrane Working Group  

Broader source: Energy.gov [DOE]

The High Temperature Membrane Working Group consists of government, industry, and university researchers interested in developing high temperature membranes for fuel cells.

290

Renewable Electricity Working Group Presentation  

U.S. Energy Information Administration (EIA) Indexed Site

Renewable Electricity Working Group Chris Namovicz, Renewable Electricity Analysis Team July 9, 2013 Agenda * Review status of AEO 2013 * Discuss new model updates and development...

291

INL @ work: Nuclear Reactor Operator  

ScienceCinema (OSTI)

INL @ work features jobs at the Idaho National Laboratory. Learn more about careers and energy research at INL's facebook site http://www.facebook.com/idahonationallaboratory

Russell, Patty

2013-05-28T23:59:59.000Z

292

Interagency Sustainability Working Group | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Sustainable Buildings & Campuses Interagency Sustainability Working Group Interagency Sustainability Working Group The Interagency Sustainability Working Group (ISWG) is the...

293

Transuranic Waste Transportation Working Group Agenda | Department...  

Office of Environmental Management (EM)

Transuranic Waste Transportation Working Group Agenda Transuranic Waste Transportation Working Group Agenda Transuranic Waste Transportation Working Group Agenda More Documents &...

294

Magnetosome-like ferrimagnetic iron oxide nanocubes for highly sensitive MRI of single cells and transplanted pancreatic islets  

Science Journals Connector (OSTI)

...Contrast Agent. Ferrimagnetic iron oxide nanocubes were synthesized via thermal decomposition of iron (III) acetylacetonate in a mixture composed of oleic...PEG-phospholipid-encapsulated ferrimagnetic iron oxide nanocubes, designated as...

Nohyun Lee; Hyoungsu Kim; Seung Hong Choi; Mihyun Park; Dokyoon Kim; Hyo-Cheol Kim; Yoonseok Choi; Shunmei Lin; Byung Hyo Kim; Hye Seung Jung; Hyeonjin Kim; Kyong Soo Park; Woo Kyung Moon; Taeghwan Hyeon

2011-01-01T23:59:59.000Z

295

A Comparison of Iron and Steel Production Energy Use and Energy Intensity in China and the U.S.  

E-Print Network [OSTI]

23 5. Comparison of Energy Intensity of Iron and Steelthe U.S. . 27 5.1. Energy Intensity of Iron and27 5.2. Energy Intensity of Iron and Steel Production in

Hasanbeigi, Ali

2012-01-01T23:59:59.000Z

296

Response of zinc, iron and copper status parameters to supplementation with zinc or zinc and iron in women  

SciTech Connect (OSTI)

Supplementation with zinc at levels available over-the-counter may compromise iron or copper status. This study examined the effects of zinc(50mg/day) or zinc and iron(50 mg each/day) on 18 women aged 25-40. Subjects were matched on initial levels of serum ferritin(SF) and erythrocyte superoxide dismutase(ESOD) and randomly assigned to Group Z (zinc) or F-Z (iron and zinc). The following were measured pretreatment and after 6 and 10 weeks treatment: serum zinc (BZ), salivary sediment zinc (SSZ), hemoglobin (Hgb), hematocrit (Hct), SF, serum ceruloplasmin (Cp) and ESOD. Effects of treatment and weeks of treatment on changes from initial blood and saliva levels were analyzed using AOV. BZ increased (P=0.0144) and ESOD decreased (P=0.0001) with weeks of treatment. Differences due to treatment are presented. No effects were noted on Hgb, Hct or Cp. Intakes of zinc supplements at about 4X RDA appear to decrease copper(ESOD) and iron(SF) status. Use of iron w/zinc may be protective for FE but not Cu, and may compromise zinc (SSZ) status.

Yadrick, K.; Kenney, M.A.; Winterfeldt, E.

1986-03-05T23:59:59.000Z

297

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the Earth's Lower Mantle Print The Iron Spin Transition in the Earth's Lower Mantle Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

298

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the Earth's Lower Mantle Print The Iron Spin Transition in the Earth's Lower Mantle Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

299

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the Earth's Lower Mantle Print The Iron Spin Transition in the Earth's Lower Mantle Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

300

Fissile sample worths in the Uranium/Iron Benchmark  

SciTech Connect (OSTI)

One of the long-standing problems from LMFBR critical experiments is the central worth discrepancy, the consistent overprediction of the reactivity associated with introducing a small material sample near the center of an assembly. Reactivity (sample worth) experiments in ZPR-9, assembly 34, the Uranium/Iron Benchmark (U/Fe), were aimed at investigating this discrepancy. U/Fe had a large, single-region core whose neutronics was governed almost entirely by /sup 235/U and iron. The essentially one-dimensional plate unit cell had one 1.6 mm-wide column of 93% enriched uranium (U(93)) near the center, imbedded in about 50 mm of iron and stainless steel. The neutron spectrum was roughly comparable to that of an LMFBR, but the adjoint spectrum was much flatter than an LMFBR's. The worths of four different fissile materials were measured and the worth of U(93) was measured using several different experimental techniques.

Schaefer, R.W.; Bucher, R.G.

1983-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

WORK PLAN FOR ENVIRONMENTAL WORK PLAN FOR ENVIRONMENTAL WORK PLAN FOR ENVIRONMENTAL  

Office of Legacy Management (LM)

WORK PLAN FOR ENVIRONMENTAL WORK PLAN FOR ENVIRONMENTAL WORK PLAN FOR ENVIRONMENTAL WORK PLAN FOR ENVIRONMENTAL WORK PLAN FOR ENVIRONMENTAL RESTORATION OF THE DOE MOUND RESTORATION OF THE DOE MOUND RESTORATION OF THE DOE MOUND RESTORATION OF THE DOE MOUND SITE, THE MOUND 2000 APPROACH SITE, THE MOUND 2000 APPROACH SITE, THE MOUND 2000 APPROACH SITE, THE MOUND 2000 APPROACH FEBRUARY 1999 Final (Revision 0) Department of Energy Babcock & Wilcox of Ohio Mr. Daniel Bird AICP, Planning Manager Miamisburg Mound Community Improvement Corporation 720 Mound Road Miamisburg, Ohio 45342-6714 Dear Mr. Bird: The Core Team, consisting of the U.S. Department of Energy Miamisburg Environmental Management Project (DOE-MEMP), U.S. Environmental Protection Agency (USEPA), and the Ohio Environmental Protection Agency (OEPA), appreciates your comments on the Work

302

Pressurized chemical-looping combustion of coal with an iron ore-based oxygen carrier  

SciTech Connect (OSTI)

Chemical-looping combustion (CLC) is a new combustion technology with inherent separation of CO{sub 2}. Most of the previous investigations on CLC of solid fuels were conducted under atmospheric pressure. A pressurized CLC combined cycle (PCLC-CC) system is proposed as a promising coal combustion technology with potential higher system efficiency, higher fuel conversion, and lower cost for CO{sub 2} sequestration. In this study pressurized CLC of coal with Companhia Valedo Rio Doce (CVRD) iron ore was investigated in a laboratory fixed bed reactor. CVRD iron ore particles were exposed alternately to reduction by 0.4 g of Chinese Xuzhou bituminous coal gasified with 87.2% steam/N{sub 2} mixture and oxidation with 5% O{sub 2} in N{sub 2} at 970 C. The operating pressure was varied between 0.1 MPa and 0.6 MPa. First, control experiments of steam coal gasification over quartz sand were performed. H{sub 2} and CO{sub 2} are the major components of the gasification products, and the operating pressure influences the gas composition. Higher concentrations of CO{sub 2} and lower fractions of CO, CH{sub 4}, and H{sub 2} during the reduction process with CVRD iron ore was achieved under higher pressures. The effects of pressure on the coal gasification rate in the presence of the oxygen carrier were different for pyrolysis and char gasification. The pressurized condition suppresses the initial coal pyrolysis process while it also enhances coal char gasification and reduction with iron ore in steam, and thus improves the overall reaction rate of CLC. The oxidation rates and variation of oxygen carrier conversion are higher at elevated pressures reflecting higher reduction level in the previous reduction period. Scanning electron microscope and energy-dispersive X-ray spectroscopy (SEM-EDX) analyses show that particles become porous after experiments but maintain structure and size after several cycles. Agglomeration was not observed in this study. An EDX analysis demonstrates that there is very little coal ash deposited on the oxygen carrier particles but no appreciable crystalline phases change as verified by X-ray diffraction (XRD) analysis. Overall, the limited pressurized CLC experiments carried out in the present work suggest that PCLC of coal is promising and further investigations are necessary. (author)

Xiao, Rui; Song, Min; Zhang, Shuai; Shen, Laihong [School of Energy and Environment, Southeast University, Sipailou No. 2, Nanjing 210096 (China); Song, Qilei [School of Energy and Environment, Southeast University, Sipailou No. 2, Nanjing 210096 (China); Department of Chemical Engineering and Biotechnology, University of Cambridge, Pembroke Street, Cambridge CB2 3RA (United Kingdom); Lu, Zuoji [School of Energy and Environment, Southeast University, Sipailou No. 2, Nanjing 210096 (China); GCL Engineering Limited, Zhujiang No. 1, Nanjing 210008 (China)

2010-06-15T23:59:59.000Z

303

Seismological Work in Japan1  

Science Journals Connector (OSTI)

... THE seismological work which has been accomplished in Japan is to a great extent described in fourteen small volumes published by a Society which ... study phenomena connected with earthquakes and volcanoes. This Society is called the Seismological Society of Japan. An epitome of a portion of this work is to be found in nine ...

1889-10-31T23:59:59.000Z

304

Emerging Energy-efficiency and Carbon Dioxide Emissions-reduction Technologies for the Iron and Steel Industry  

E-Print Network [OSTI]

heat to smelt the iron. Coal gasification is the result of anew processes such as gasification, slow pyrolysis, and fastreaction ? Carbon gasification and iron ore reduction

Hasanbeigi, Ali

2014-01-01T23:59:59.000Z

305

A Comparison of Iron and Steel Production Energy Use and Energy Intensity in China and the U.S.  

E-Print Network [OSTI]

of Iron and Steel Production Energy Use and Energy Intensityof Iron and Steel Production Energy Use and Energy Intensitycomparisons of steel production energy efficiency and CO 2

Hasanbeigi, Ali

2012-01-01T23:59:59.000Z

306

How Godzilla Ate Pittsburgh: The Long Rise of the Japanese Iron and Steel Industry, 19001973  

E-Print Network [OSTI]

poorly endowed as Japan in coking coal and iron ore (WarrenYawata of iron ore for coking coal and the progressive in-

Bernard Elbaum

2007-01-01T23:59:59.000Z

307

Synthesis and characterization of superparamagnetic iron oxide nanoparticles for biomedical applications  

Science Journals Connector (OSTI)

Monodisperse iron oxide nanoparticles (NPs) of 4nm ... obtained through high-temperature solution phase reaction of iron (III) acetylacetonate with 1, 2-hexadecanediol in the presence ... oleic acid and oleylami...

L. A. Cano; M. V. Cagnoli; S. J. Stewart; E. D. Cabanillas; E. L. Romero

2009-01-01T23:59:59.000Z

308

Synthesis and characterization of superparamagnetic iron oxide nanoparticles for biomedical applications  

Science Journals Connector (OSTI)

Monodisperse iron oxide nanoparticles (NPs) of 4nm ... obtained through high-temperature solution phase reaction of iron (III) acetylacetonate with 1, 2-hexadecanediol in the presence ... oleic acid and oleylami...

L. A. Cano; M. V. Cagnoli; S. J. Stewart; E. D. Cabanillas

2010-01-01T23:59:59.000Z

309

Thermal Reactions of Fullerene C60 with Iron(III) Acetylacetonate  

Science Journals Connector (OSTI)

Thermal reaction of solid mixtures of fullerene C60 with iron(III) acetylacetonate proceeds in the combustion mode; the composition...60...ratio in the initial mixture. The magnetization of iron-fullerene complex...

V. G. Isakova; E. A. Petrakovskaya; A. D. Balaev

2003-04-01T23:59:59.000Z

310

The nonlinear optical, magnetic, and Mssbauer spectral properties of some iron(III) doped silica xerogels  

Science Journals Connector (OSTI)

Iron(III) species dispersed in silica have been ... synthesized with a sol-gel process. The iron(III) was introduced as the acetylacetonate complex into a solution of tetraethoxysilane to...Z-scan experimental st...

L. Rebbouh; V. Rosso; Y. Renotte; Y. Lion; F. Grandjean

2006-05-01T23:59:59.000Z

311

Coal Fly Ash as a Source of Iron in Atmospheric Dust. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Coal Fly Ash as a Source of Iron in Atmospheric Dust. Coal Fly Ash as a Source of Iron in Atmospheric Dust. Abstract: Anthropogenic coal fly ash aerosols may represent a...

312

Characterization of the FNR Protein of Escherichid coli, an Iron-Binding Transcriptional Regulator  

Science Journals Connector (OSTI)

...coli, an Iron-Binding Transcriptional Regulator Jeffrey Green Martin Trageser Stephan...John R. Guest FNR is a transcriptional regulator mediating the activation or repression...coli, an iron-binding transcriptional regulator. | FNR is a transcriptional regulator...

1991-01-01T23:59:59.000Z

313

Sedimentary and mineral dust sources of dissolved iron to the world ocean  

E-Print Network [OSTI]

of the tropi- cal Pacific Ocean II. Iron biogeochemistry,in the Northeast Pacific Ocean Gyre: Aerosols, iron, and theF. M. M. : The equatorial Pacific Ocean: Grazer-controlled

Moore, J. K; Braucher, O.

2008-01-01T23:59:59.000Z

314

Direct production of light olefins from syngas over a carbon nanotube confined iron catalyst  

Science Journals Connector (OSTI)

Iron particles confined in carbon nanotube (CNT) channels have been used as a catalyst for the direct conversion of syngas to light olefins. Compared with iron catalysts supported on other materials such as Si...

ChuanFu Wang; XiuLian Pan; XinHe Bao

2010-04-01T23:59:59.000Z

315

A Radar-like Iron based Nanohybrid as an Efficient and Stable...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Radar-like Iron based Nanohybrid as an Efficient and Stable Electrocatalyst for Oxygen Reduction. A Radar-like Iron based Nanohybrid as an Efficient and Stable Electrocatalyst for...

316

V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti...  

Broader source: Energy.gov (indexed) [DOE]

1: Cisco IronPort Web Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities V-021: Cisco IronPort Web Email Security Appliance Sophos Anti-Virus Multiple...

317

Characterization of temperature profile in furnace and solubility of iron in silicon  

E-Print Network [OSTI]

A better understanding of the behavior of impurities, such as iron, in silicon can lead to increases in solar cell efficiency. The purpose of this thesis was to study the behavior of iron in silicon via three sub-tasks: ...

Modi, Vrajesh Y

2011-01-01T23:59:59.000Z

318

Influence of Iron Redox Transformations on Plutonium Sorption to Sediments  

SciTech Connect (OSTI)

Plutonium subsurface mobility is primarily controlled by its oxidation state, which in turn is loosely coupled to the oxidation state of iron in the system. Experiments were conducted to examine the effect of sediment iron mineral composition and oxidation state on plutonium sorption and oxidation state. A pH 6.3 vadose zone sediment containing iron oxides and iron-containing phyllosilicates was treated with various complexants (ammonium oxalate) and reductants (dithionite-citrate-bicarbonate) to selectively leach and/or reduce iron oxide and phyllosilicate phases. Mssbauer spectroscopy was used to identify initial iron mineral composition of the sediment and monitor dissolution and reduction of iron oxides. Sorption of Pu(V) was monitored over one week for each of six treated sediment fractions. Plutonium oxidation state speciation in the aqueous and solid phases was monitored using solvent extraction, coprecipitation, and XANES. Mssbauer spectroscopy showed that the sediment contained 25-30% hematite, 60-65% Al-goethite, and <10%Fe(III) in phyllosilicate; there was no detectable Fe(II). Upon reduction with a strong chemical reductant (dithionite-citrate buffer, DCB), much of the hematite and goethite disappeared and the Fe in the phyllosilicate reduced to Fe(II). The rate of sorption was found to correlate with the 1 fraction of Fe(II) remaining within each treated sediment phase. Pu(V) was the only oxidation state measured in the aqueous phase, irrespective of treatment, whereas Pu(IV) and much smaller amounts of Pu(V) and Pu(VI) were measured in the solid phase. Surface-mediated reduction of Pu(V) to Pu(IV) occurred in treated and untreated sediment samples; Pu(V) remained on untreated sediment surface for two days before reducing to Pu(IV). Similar to the sorption kinetics, the reduction rate was correlated with sediment Fe(II) concentration. The correlation between Fe(II) concentrations and Pu(V) reduction demonstrates the potential impact of changing iron mineralogy on plutonium subsurface transport through redox transition areas. These findings should influence the conceptual models of long-term stewardship of Pu contaminated sites that have fluctuating redox conditions, such as vadose zones or riparian zones.

Hixon, Amy E.; Hu, Yung-Jin; Kaplan, Daniel I.; Kukkadapu, Ravi K.; Nitsche, Heino; Qafoku, Odeta; Powell, Brian A.

2010-10-01T23:59:59.000Z

319

Recovery of iron oxide from coal fly ash  

DOE Patents [OSTI]

A high quality iron oxide concentrate, suitable as a feed for blast and electric reduction furnaces is recovered from pulverized coal fly ash. The magnetic portion of the fly ash is separated and treated with a hot strong alkali solution which dissolves most of the silica and alumina in the fly ash, leaving a solid residue and forming a precipitate which is an acid soluble salt of aluminosilicate hydrate. The residue and precipitate are then treated with a strong mineral acid to dissolve the precipitate leaving a solid residue containing at least 90 weight percent iron oxide.

Dobbins, Michael S. (Ames, IA); Murtha, Marlyn J. (Ames, IA)

1983-05-31T23:59:59.000Z

320

Multifunctional superparamagnetic iron oxide nanoparticles: Promising tools in cancer theranostics  

Science Journals Connector (OSTI)

Abstract Iron-oxide nanoparticles of small dimensions that have superparamagnetic properties show immense potential to revolutionize the future of cancer theranostics, the combinatorial diagnosis and therapeutic approach towards cancer. Superparamagnetic iron-oxide nanoparticles (SPIONs) have unique magnetic properties, due to which they show excellent tumor-targeting efficiency, and this paves the way for effective personalized cancer treatment. The aim of this review is to focus on the ability of \\{SPIONs\\} to perform multiple roles in the field of cancer biology, such as in diagnosis, monitoring, targeting and therapy. Also, other topics are discussed, including the synthesis of SPIONs, the challenges and recent advances.

Poornima Budime Santhosh; Nataa Poklar Ulrih

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Electrolytic photodissociation of chemical compounds by iron oxide photochemical diodes  

DOE Patents [OSTI]

Chemical compounds can be dissociated by contacting the same with a p/n type semi-conductor photochemical diode having visible light as its sole source of energy. The photochemical diode consists of low cost, readily available materials, specifically polycrystalline iron oxide doped with silicon in the case of the n-type semi-conductor electrode, and polycrystalline iron oxide doped with magnesium in the case of the p-type electrode. So long as the light source has an energy greater than 2.2 electron volts, no added energy source is needed to achieve dissociation.

Somorjai, Gabor A. (Berkeley, CA); Leygraf, Christofer H. (Berkeley, CA)

1985-01-01T23:59:59.000Z

322

Electrolytic photodissociation of chemical compounds by iron oxide electrodes  

DOE Patents [OSTI]

Chemical compounds can be dissociated by contacting the same with a p/n type semi-conductor diode having visible light as its sole source of energy. The diode consists of low cost, readily available materials, specifically polycrystalline iron oxide doped with silicon in the case of the n-type semi-conductor electrode, and polycrystalline iron oxide doped with magnesium in the case of the p-type electrode. So long as the light source has an energy greater than 2.2 electron volts, no added energy source is needed to achieve dissociation.

Somorjai, Gabor A. (Berkeley, CA); Leygraf, Christofer H. (Berkeley, CA)

1984-01-01T23:59:59.000Z

323

file://\\Bellview\TeamWorks\TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8/03 TRU TeamWorks will resume printing on January 8, 2004 | Shipments expected this we 8/03 TRU TeamWorks will resume printing on January 8, 2004 | Shipments expected this we December 18, 2003 The Big Story: It's a wrap - 2003 Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e- mail. WIPP Shipments (as of 12/18/03 at 8:14 a.m.) Shipments scheduled to arrive at WIPP this week 23 Total shipments received at WIPP 2,226 In 2003, the WIPP team delivered in every mission-essential area. TRU TeamWorks wraps up the calendar year with 2003's performance highlights. Steve Warren, Washington TRU Solutions (WTS) general manager, says, "I view

324

Work for Others (Non-Department of Energy Funded Work)  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

Work for Others is the performance of work for non-Department of Energy (DOE) entities by DOE/National Nuclear Security Administration (NNSA) and/or their respective contractor personnel or the use of DOE/NNSA facilities that is not directly funded by DOE appropriations. Cancels DOE O 481.1B. Certified 1-13-11. Admin Chg 1, dated 3-14-11.

2005-01-24T23:59:59.000Z

325

Work for Others (Non-Department of Energy Funded Work)  

Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

Work for Others is the performance of work for non-Department of Energy (DOE) entities by DOE/National Nuclear Security Administration (NNSA) and/or their respective contractor personnel or the use of DOE/NNSA facilities that is not directly funded by DOE appropriations. Cancels DOE O 481.1B. Certified 1-13-11. Admin Chg 1, dated 3-14-11, cancels DOE O 481.1C.

2005-01-24T23:59:59.000Z

326

Film-forming capacity of alcoholic solutions of iron(III) chloride with acetylacetone  

Science Journals Connector (OSTI)

Processes in which film-forming solutions based on acetylacetonate and iron(III) chloride are produced were subjected to...

S. A. Kuznetsova; I. A. Senokosova

2010-11-01T23:59:59.000Z

327

Manufacturing Energy and Carbon Footprint- Sector: Iron and Steel (NAICS 3311, 3312), October 2012 (MECS 2006)  

Broader source: Energy.gov [DOE]

Manufacturing Energy and Carbon Footprint for Iron and Steel Sector (NAICS 3311, 3312) with Total Energy Input

328

Consequence of total lepton number violation in strongly magnetized iron white dwarfs  

SciTech Connect (OSTI)

The influence of a neutrinoless electron to positron conversion on a cooling of strongly magnetized iron white dwarfs is studied.

Belyaev, V. B. [Bogolyubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Dubna 141980 (Russian Federation); Ricci, P. [Istituto Nazionale di Fisica Nucleare, Sezione di Firenze, I-50019 Sesto Fiorentino (Firenze) (Italy); imkovic, F. [Department of Nuclear Physics and Biophysics, Comenius University, Mlynsk dolina F1, SK-842 15, Bratislava, Slovakia and Bogolyubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Dubna 141980 (Russian Federation); Adam, J. Jr.; Tater, M.; Truhlk, E. [Institute of Nuclear Physics ASCR, CZ-250 68 ?e (Czech Republic)

2013-12-30T23:59:59.000Z

329

Atomic-Scale Design of Iron Fischer-Tropsch Catalysts; A Combined Computational Chemistry, Experimental, and Microkinetic Modeling Approach  

SciTech Connect (OSTI)

This work focuses on (1) searching/summarizing published Fischer-Tropsch synthesis (FTS) mechanistic and kinetic studies of FTS reactions on iron catalysts; (2) preparation and characterization of unsupported iron catalysts with/without potassium/platinum promoters; (3) measurement of H{sub 2} and CO adsorption/dissociation kinetics on iron catalysts using transient methods; (3) analysis of the transient rate data to calculate kinetic parameters of early elementary steps in FTS; (4) construction of a microkinetic model of FTS on iron, and (5) validation of the model from collection of steady-state rate data for FTS on iron catalysts. Three unsupported iron catalysts and three alumina-supported iron catalysts were prepared by non-aqueous-evaporative deposition (NED) or aqueous impregnation (AI) and characterized by chemisorption, BET, temperature-programmed reduction (TPR), extent-of-reduction, XRD, and TEM methods. These catalysts, covering a wide range of dispersions and metal loadings, are well-reduced and relatively thermally stable up to 500-600 C in H{sub 2} and thus ideal for kinetic and mechanistic studies. Kinetic parameters for CO adsorption, CO dissociation, and surface carbon hydrogenation on these catalysts were determined from temperature-programmed desorption (TPD) of CO and temperature programmed surface hydrogenation (TPSR), temperature-programmed hydrogenation (TPH), and isothermal, transient hydrogenation (ITH). A microkinetic model was constructed for the early steps in FTS on polycrystalline iron from the kinetic parameters of elementary steps determined experimentally in this work and from literature values. Steady-state rate data were collected in a Berty reactor and used for validation of the microkinetic model. These rate data were fitted to 'smart' Langmuir-Hinshelwood rate expressions derived from a sequence of elementary steps and using a combination of fitted steady-state parameters and parameters specified from the transient measurements. The results provide a platform for further development of microkinetic models of FTS on Fe and a basis for more precise modeling of FTS activity of Fe catalysts. Calculations using periodic, self-consistent Density Functional Theory (DFT) methods were performed on various realistic models of industrial, Fe-based FTS catalysts. Close-packed, most stable Fe(110) facet was analyzed and subsequently carbide formation was found to be facile leading to the choice of the FeC(110) model representing a Fe facet with a sub-surface C atom. The Pt adatom (Fe{sup Pt}(110)) was found to be the most stable model for our studies into Pt promotion and finally the role of steps was elucidated by recourse to the defected Fe(211) facet. Binding Energies(BEs), preferred adsorption sites and geometries for all FTS relevant stable species and intermediates were evaluated on each model catalyst facet. A mechanistic model (comprising of 32 elementary steps involving 19 species) was constructed and each elementary step therein was fully characterized with respect to its thermochemistry and kinetics. Kinetic calculations involved evaluation of the Minimum Energy Pathways (MEPs) and activation energies (barriers) for each step. Vibrational frequencies were evaluated for the preferred adsorption configuration of each species with the aim of evaluating entropy-changes, pre exponential factors and serving as a useful connection with experimental surface science techniques. Comparative analysis among these four facets revealed important trends in their relative behavior and roles in FTS catalysis. Overall the First Principles Calculations afforded us a new insight into FTS catalysis on Fe and modified-Fe catalysts.

Manos Mavrikakis; James Dumesic; Rahul Nabar; Calvin Bartholonew; Hu Zou; Uchenna Paul

2008-09-29T23:59:59.000Z

330

Interfacial Effects in Iron-Nickel HydroxidePlatinum Nanoparticles Enhance Catalytic Oxidation  

Science Journals Connector (OSTI)

...coordinatively unsaturated iron sites for activating O 2...the catalyst. To create the iron (hydr)oxide interface...acac) 2 (where acac is acetylacetonate) in the presence of CO...showed that this layer contained iron (fig. S3). Although the...

Guangxu Chen; Yun Zhao; Gang Fu; Paul N. Duchesne; Lin Gu; Yanping Zheng; Xuefei Weng; Mingshu Chen; Peng Zhang; Chih-Wen Pao; Jyh-Fu Lee; Nanfeng Zheng

2014-05-02T23:59:59.000Z

331

Reduction of Sintering during Annealing of FePt Nanoparticles Coated with Iron Oxide  

E-Print Network [OSTI]

are first obtained by reduction of iron(III) acetylacetonate and platinum(II) acetylacetonateReduction of Sintering during Annealing of FePt Nanoparticles Coated with Iron Oxide Chao LiuVised Manuscript ReceiVed October 12, 2004 FePt/iron oxide core/shell nanoparticles are synthesized by a two step

Laughlin, David E.

332

Iron Species in Argonne Premium Coal Samples:? An Investigation Using X-ray Absorption Spectroscopy  

Science Journals Connector (OSTI)

Iron Species in Argonne Premium Coal Samples:? An Investigation Using X-ray Absorption Spectroscopy ... Chemistry Division, Argonne National Laboratory, 9700 S. Cass Ave., Argonne, Illinois 60439 ... Iron K-edge X-ray absorption spectroscopy (XAS) has been used to examine the iron species that are present within the Argonne Premium Coal Samples. ...

Stephen R. Wasserman; Randall E. Winans; Robert McBeth

1996-03-20T23:59:59.000Z

333

Highpressure behavior of iron carbide (Fe7C3) at inner core conditions  

E-Print Network [OSTI]

Highpressure behavior of iron carbide (Fe7C3) at inner core conditions Mainak Mookherjee,1 Yoichi at high pressures have demonstrated that Fe7C3 iron carbide is a likely candidate for the Earth's inner behavior of iron carbide (Fe7C3) at inner core conditions, J. Geophys. Res., 116, B04201, doi:10

Steinle-Neumann, Gerd

334

Mineralogical and Microbial Controls on Iron Reduction in a Contaminated Aquifer-Wetland System  

E-Print Network [OSTI]

terminal electron accepting processes, iron reduction has the added complexity that its oxidized form (ferric iron) exists primarily as one of several solid phases in environments with pH greater than 3. Thus, the distribution and form of ferric iron...

Howson, Andrea Melissa

2011-02-22T23:59:59.000Z

335

Author's personal copy Hematite and iron carbonate precipitation-coexistence at the  

E-Print Network [OSTI]

Carbon dioxide The hydrothermal reactivity of swelling clays has relevant implications on the geological that the carbon dioxide increased the hydrothermal reactivity of montmorillonite because the hematite and ironAuthor's personal copy Hematite and iron carbonate precipitation-coexistence at the iron

Montes-Hernandez, German

336

The Continental Margin is a Key Source of Iron to the HNLC North Pacific Ocean  

E-Print Network [OSTI]

The Continental Margin is a Key Source of Iron to the HNLC North Pacific Ocean Phoebe J. Lam1 concentrations in the upper 500m of the Western Subarctic Pacific, an iron-limited High Nutrient Low Chlorophyll a key source of bioavailable Fe to the HNLC North Pacific. Keywords: iron, continental margin, HNLC 1

337

Role of Surface Precipitation in Copper Sorption by the Hydrous Oxides of Iron and Aluminum  

E-Print Network [OSTI]

Role of Surface Precipitation in Copper Sorption by the Hydrous Oxides of Iron and Aluminum K. G precipitation; sorption; isotherms; X-ray diffraction; hydrous iron oxide; hydrous aluminum oxide; copper. INTRODUCTION Hydrous oxides of iron (HFO) and aluminum (HAO) are important mineral components of natural

Chorover, Jon

338

HIGH TEMPERATURE SULFIDATION BEHAVIOR OF LOW Al IRON-ALUMINUM COMPOSITIONS  

E-Print Network [OSTI]

HIGH TEMPERATURE SULFIDATION BEHAVIOR OF LOW Al IRON-ALUMINUM COMPOSITIONS S.W. Banovic, J.N. Du (Received January 5, 1998) (Accepted March 23, 1998) Introduction Iron-aluminum weld overlay coatings, the application of iron-aluminum alloys is currently limited due to hydrogen cracking susceptibility subsequent

DuPont, John N.

339

Rhizosphere Microbial Community Structure in Relation to Root Location and Plant Iron Nutritional Status  

Science Journals Connector (OSTI)

...plant iron nutritional status were compared by performing...plant iron nutritional status during the iron-sufficient...only 24 samples, allowed us to compare root locations...BARD) program grant US-2668-95 and by a grant...U.S. Department of Energy. REFERENCES B. Assmus...

Ching-Hong Yang; David E. Crowley

2000-01-01T23:59:59.000Z

340

Studies of anisotropy of iron based superconductors  

SciTech Connect (OSTI)

To study the electronic anisotropy in iron based superconductors, the temperature dependent London penetration depth, {Delta}{lambda}#1;#21;(T), have been measured in several compounds, along with the angular dependent upper critical field, H{sub c2}(T). Study was undertaken on single crystals of Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} with x=0.108 and x=0.127, in the overdoped range of the doping phase diagram, characterized by notable modulation of the superconducting gap. Heavy ion irradiation with matching field doses of 6 T and 6.5 T respectively, were used to create columnar defects and to study their effect on the temperature {Delta}{lambda}#1;#21;(T). The variation of the low-temperature penetration depth in both pristine and irradiated samples was #12;tted with a power-law function {Delta}{lambda}#1;#21;(T) = AT{sup n}. Irradiation increases the magnitude of the pre-factor A and decreases the exponent n, similar to the effect on the optimally doped samples. This finding supports the universal s{sub {+-}}#6; scenario for the whole doping range. Knowing that the s{sub {+-}}#6; gap symmetry exists across the superconducting dome for the electron doped systems, we next looked at {lambda}#21;(T), in optimally - doped, SrFe{sub 2}(As{sub 1-x}P{sub x}){sub 2}, x =0.35. Both, as-grown (T{sub c} ~ #25;25 K) and annealed (T{sub c} ~ #25;35 K) single crystals of SrFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} were measured. Annealing decreases the absolute value of the London penetration depth from #21;{lambda}(0) = 300 {+-}#6; 10 nm in as-grown samples to {lambda}#21;(0) = 275{+-}#6;10 nm. At low temperatures, {lambda}#21;(T) #24;~ T indicates a superconducting gap with line nodes. Analysis of the full-temperature range superfluid density is consistent with the line nodes, but differs from the simple single-gap d-wave. The observed behavior is very similar to that of BaFe{sub 2}(As{sub 1-x}P{sub x}){sub 2}, showing that isovalently substituted pnictides are inherently different from the charge-doped materials. In-plane resistivity measurements as a function of temperature, magnetic field, and its orientation with respect to the crystallographic ab-plane were used to study the upper critical field, H{sub c2}, of two overdoped compositions of Ba(Fe{sub 1-x}Ni{sub x}){sub 2}As{sub 2}, x=0.054 and x=0.072. Measurements were performed using precise alignment (with accuracy less than 0.1{degree}) of the magnetic field with respect to the Fe-As plane. The dependence of the H{sub c2} on angle {theta}#18; between the field and the ab- plane was measured in isothermal conditions in a broad temperature range. We found that the shape of the H{sub c2} vs. {theta}#18; curve clearly deviates from the Ginzburg-Landau theory.

Murphy, Jason [Ames Laboratory

2013-05-15T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3-0501 3-0501 Unlimited Release Printed February 2013 Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility Joseph W. Pratt and Aaron P. Harris Prepared by Sandia National Laboratories Albuquerque, New Mexico 87185 and Livermore, California 94550 Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Approved for public release; further dissemination unlimited. 2 Issued by Sandia National Laboratories, operated for the United States Department of Energy by Sandia Corporation. NOTICE: This report was prepared as an account of work sponsored by an agency of the

342

Brittle Failure Design Criteria for Ductile Cast Iron Spent-Fuel  

Office of Scientific and Technical Information (OSTI)

r r Recommendations for Ductile and Brittle Failure Design Criteria for Ductile Cast Iron Spent-Fuel Shipping Containers This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsi- bility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Refer- ence herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily constitute or imply its endorsement, recom-

343

Effect of Sintering Temperature on Dielectric Properties of Iron Deficient Nickel-Ferrite  

SciTech Connect (OSTI)

Nickel Ferrite among all the magneto ceramic materials have been studied very much due to its large number of applications. But there is a large scope of modification of its properties. Thus people still working on it for improvisation of its properties via compositional and structural modifications. Present paper reporting the preparation and characterization of iron deficient Nickel ferrite for different sintering temperature. Ferrite samples having the general formula NiFe1.98O{sub 4} were prepared using the standard ceramic method. The phase formation was confirmed by X-ray diffraction technique. The effect of sintering temperature on the electrical properties and resistivity was studied. The data shows that dielectric properties are highly dependent on the sintering temperature.

Rani, Renu [Electroceramics Research Lab, GVM Girls College, Sonepat-131001 (India); School of Physics and Material Science, Thapar University, Patiala-147004 (India); Singh, Sangeeta [Department of Physics, GVM Girls College, Sonepat-131001 (India); Juneja, J. K. [Department of Physics, Hindu College, Sonepat-131001 (India); Prakash, Chandra [Directorate of ER and IPR, DRDO, DRDO Bhawan, New Delhi-110105 (India); Raina, K. K. [School of Physics and Material Science, Thapar University, Patiala-147004 (India)

2011-11-22T23:59:59.000Z

344

Dissipative Hamiltonian realisation and robust H? control of induction motor considering iron losses for electric vehicles  

Science Journals Connector (OSTI)

The dissipative Hamiltonian realisation and robust H? control of induction motor considering iron losses for electric vehicle are investigated in this paper. First, the dissipative Hamiltonian of the electric vehicle drive system is obtained based on the system's mathematical model in a synchronously rotating frame. Then, a robust co-ordinated tracking controller is designed based on the dissipative Hamiltonian form. One part of the controller is designed by using the method of interconnection and damping assignment to ensure the system's stability, and another part is designed by using the Hamiltonian system's robust H? technique to attenuate external disturbances. The simulation results show that the controller proposed in the paper works very well in robust tracking of induction motor.

Wenhui Pei; Chenghui Zhang; Naxin Cui; Ke Li

2013-01-01T23:59:59.000Z

345

CRYOGENIC SYSTEM FOR A 35 KV/90 MVA SATURATED IRON?CORE SUPERCONDUCTING FAULT CURRENT LIMITER  

Science Journals Connector (OSTI)

A cryogenic system was built as an open system for a 35 kV/90 MVA saturated iron?core superconducting fault current limiter. It consists of an annular cylindrical liquid nitrogen dewar cryogenic pipes sensors valves and a control unit. A HTS dc bias coil was immersed with liquid nitrogen in the dewar. The control circuit constantly monitors the liquid nitrogen level and controls the supply of liquid nitrogen in accordance with the liquid nitrogen level change. Nitrogen vapor was directly released into the environment. Heat loss under different working conditions such as no magnetization current 150 A magnetization current and on?grid condition was measured to evaluate the performance of the system. As compared with no magnetization current of the dc bias coil evaporation of liquid nitrogen increases about 20% under the on?grid condition.

H. Hong; W. Z. Gong; B. Tian; J. Y. Zhang; X. M. Hu; J. Z. Wang; X. Y. Niu; Y. Wang; L. F. Zhang; Y. W. Sun; T. Q. Wu; Y. Xin

2010-01-01T23:59:59.000Z

346

RHIC II Science Working Groups  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Workshops Workshops The series of RHIC II Science Workshops began in November 2004, at which time seven Working Groups were initiated. These groups met in workshops through 2005, with the purpose of providing an organized forum for the community to address and describe quantitatively the most important science issues for the proposed RHIC II luminosity upgrade, and corresponding detector upgrades. Each Working Group was led by three convenors representing theory and experiment, and each has produced a detailed report (except for the "New Directions" group, which provided a sounding board and input to the other groups). The Working Group reports are linked below. The summary "white paper" document, "Future Science at the Relativistic Heavy Ion Collider" (PDF), is based on these reports, and was prepared by a Writing Committee that included at least one convenor from each of the Working Groups.

347

Working with Modules within Python  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Working with Modules within Perl and Python Working with Modules within Perl and Python Working with Modules within Perl and Python It can often be convenient to work with the modules system from within perl or python scripts. You can do this! Using Modules within Python The EnvironmentModules python package gives access to the module system from within python. The EnvironmentModules python package has a single function: module. Using this function you can provide the same arguments you would to "module" on the command line. The module() function accepts a list of arguments, like ['load','']; or ['unload','']. >>> import EnvironmentModules as EnvMod >>> EnvMod.module(['load','blast+']) It is important to understand that this is most effective for scripts

348

Utility Security & Resiliency: Working Together  

Broader source: Energy.gov [DOE]

Presentationgiven at the Federal Utility Partnership Working Group (FUPWG) Fall 2008 meetingdiscusses Edison Electric Institute (EEI), including its key security objectives, key activities, cybersecurity activities, and spare transformer equipment program (STEP).

349

BEDES Strategic Working Group Recommendations  

Broader source: Energy.gov [DOE]

The BEDES Strategic Working Group Recommendations document is a guide to how the BEDES Dictionary can be brought to market and provide the services for which it was designed.

350

DOE Work Breakdown Structure Handbook  

Broader source: Energy.gov [DOE]

This handbook provides suggested guidance and best practices on the development of product-oriented Work Breakdown Structures (WBS) that should be used by all projects within DOE to organize and...

351

DOE Catalysis Working Group Meeting  

Broader source: Energy.gov (indexed) [DOE]

PEMFC Performance and Durability - Jim Waldecker (Ford) 9:45 - 10:00 Degradation of Nanoparticle Pt alloy and De-alloyed Pt Catalysts - Debbie Myers (ANL) Catalysis Working Group...

352

At Work in The World  

E-Print Network [OSTI]

the dis- cord created by dangerous health conditions was theDaum, Work Is Dangerous To Your Health, New York, Pantheon,health conditions of some ancient occupations. In particular, in the antiquity, one of the most dangerous and

Blanc, Paul D. MD; Dolan, Brian PhD

2012-01-01T23:59:59.000Z

353

Report of Working Group IV  

Science Journals Connector (OSTI)

This report summarizes the discussions of the Working Group on Resource Policy and East-West Relationships that were held as part of the NATO Advance Study Institute on Deposit and Geoenvironmental Models for...

Gabor Gal; Slavko olar

2002-01-01T23:59:59.000Z

354

Interagency Committees and Working Groups  

Broader source: Energy.gov [DOE]

DOE is actively involved with other Federal agencies that have responsibilities for the radiation protection of the public and the environment. This site provides the different committees and working groups that DOE is involved with.

355

Work Plan - U.S.-India Coal Working Group | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Work Plan - U.S.-India Coal Working Group Work Plan - U.S.-India Coal Working Group Work Plan - U.S.-India Coal Working Group More Documents & Publications Work Group Telecom...

356

The Oxidation State of Iron at High Pressure  

Science Journals Connector (OSTI)

...Fig. 3. In K vs. In P-Acetylacetonate and basic acetate. kilobars...for the basic acetate and acetylacetonate (4). Both of these ligands...molecule attaching to the iron through two oxygens. The...KFeCI4 * 323 393 0.07 Fe acetylacetonate 60 325 0.15 Fe acetylacetonate...

H. G. Drickamer; G. K. Lewis Jr.; S. C. Fung

1969-02-28T23:59:59.000Z

357

High Temperature Corrosion Behavior of Iron Aluminide Alloys and Coatings  

SciTech Connect (OSTI)

A multi-year effort has been focused on optimizing the long-term oxidation performance of ingot-processed (IP) and oxide-dispersion strengthened (ODS) Fe{sub 3}Al and iron aluminide-based coatings. Based on results from several composition iterations, a Hf-doped alloy (Fe-28Al-2Cr-0.05at.%Hf) has been developed with significantly better high temperature oxidation resistance than other iron aluminides. The scale adhesion is not significantly better; however, the {alpha}-Al{sub 2}O{sub 3} scale grows at a slower rate, approximately a factor of 10 less than undoped iron aluminide. The benefit of Hf is greatest at 1100-1200 C. Long-term oxidation resistance of commercially fabricated ODS Fe{sub 3}Al has been determined and compared to commercially available ODS FeCrAl. Scale spallation rates for ODS Fe{sub 3}Al are higher than for ODS FeCrAl. To complement studies of iron-aluminide weld-overlay coatings, carbon steel was coated with Fe-Al-Cr by thermal spraying. These specimens were then exposed in air at 900 and 1000 C and in air-1%SO{sub 2} at 800 C. Most likely due to an inadequate aluminum concentration in the coatings, continuous protective Al{sub 2}O{sub 3} could not be maintained and, consequently, the corrosion performance was significantly worse than what is normally observed for Fe{sub 3}Al.

Pint, B.A.

2001-10-22T23:59:59.000Z

358

Nanocrystalline Iron Oxide Aerogels as Mesoporous Magnetic Architectures  

Science Journals Connector (OSTI)

We have developed crystalline nanoarchitectures of iron oxide that exhibit superparamagnetic behavior while still retaining the desirable bicontinuous pore?solid networks and monolithic nature of an aerogel. ... The laser power was controlled using a series of optical density filters and kept below ?1 mW to avoid sample degradation. ...

Jeffrey W. Long; Michael S. Logan; Christopher P. Rhodes; Everett E. Carpenter; Rhonda M. Stroud; Debra R. Rolison

2004-12-04T23:59:59.000Z

359

Extracellular iron-sulfur precipitates from growth of Desulfovibrio desulfuricans  

SciTech Connect (OSTI)

The authors have examined extracellular iron-bearing precipitates resulting from the growth of Desulfovibrio desulfuricans in a basal medium with lactate as the carbon source and ferrous sulfate. Black precipitates were obtained when D. desulfuricans was grown with an excess of FeSO{sub 4}. When D. desulfuricans was grown under conditions with low amounts of FeSO{sub 4}, brown precipitates were obtained. The precipitates were characterized by iron K-edge XAFS (X-ray absorption fine structure), {sup 57}Fe Moessbauer-effect spectroscopy, and powder X-ray diffraction. Both were noncrystalline and nonmagnetic (at room temperature) solids containing high-spin Fe(III). The spectroscopic data for the black precipitates indicate the formation of an iron-sulfur phase with 6 nearest S neighbors about Fe at an average distance of 2.24(1) {angstrom}, whereas the brown precipitates are an iron-oxygen-sulfur phase with 6 nearest O neighbors about Fe at an average distance of 1.95(1) {angstrom}.

Antonio, M. R.; Tischler, M. L.; Witzcak, D.

1999-12-20T23:59:59.000Z

360

Versatile ferrofluids based on polyethylene glycol coated iron oxide nanoparticles  

E-Print Network [OSTI]

Versatile ferrofluids based on polyethylene glycol coated iron oxide nanoparticles W. Brullot a in revised form 20 December 2011 Available online 3 February 2012 Keywords: Ferrofluid Polyethylene glycol Magneto-optics Magnetite Rheology a b s t r a c t Versatile ferrofluids based on polyethylene glycol

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Iron Phosphate Glasses for Vitrifying DOE High Priority Nuclear Wastes  

SciTech Connect (OSTI)

Iron phosphate glasses have been studied as an alternative glass for vitrifying Department of Energy (DOE) high priority wastes. The high priority wastes were the Low Activity Waste (LAW) and the High Level Waste (HLW) with high chrome content stored at Hanford, WA, and the Sodium Bearing Waste (SBW) stored at the Idaho National Engineering and Environmental Laboratory. These wastes were recommended by Tanks Focus Area since they were expected to require special attention when vitrified in borosilicate glasses. All three of these wastes have been successfully vitrified in iron phosphate glasses at waste loadings ranging from a low of 32 wt% for the high sulfate LAW to 40 wt% for the SBW to a high of 75 wt% for the high chrome HLW. In addition to these desirable high waste loadings, the iron phosphate glasses were easily melted, typically between 950 and 1200 C, in less than 4 hours in commercial refractory oxide containers. It is noteworthy that the chemical durability of both glassy and deliberately crystallized iron phosphate wasteforms not only met, but significantly exceeded, all current DOE chemical durability requirements as measured by the Product Consistency Test (PCT) and Vapor Hydration Test (VHT). The high waste loading, low melting temperature, rapid furnace throughput (short melting time) and their outstanding chemical durability could significantly accelerate the clean up effort and reduce the time and cost of vitrifying these high priority wastes.

Kim, C.W.; Day, D.E.

2004-03-29T23:59:59.000Z

362

Carbonylation of (+)-2-carene induced by iron-pentacarbonyl.  

Science Journals Connector (OSTI)

(+)-2-carene heated neat with iron pentacarbonyl leads to ?-phellandrene-Fe(CO)3 complex ( ?15 % ), p. cymene ( ?15 % ), (-)-(1S)-3,8,8-trimethylbicyclo (4.1.1) oct-3-ene-7-one ( ?50 % ) and (+)-(1S,7S)-3,8,8-trimethylbicyclo (4.1.1.) oct-3-ene-7-ol ( ?20 % ).

Christiane Santelli-Rouvier; Maurice Santelli; Jean-Pierre Zahra

1985-01-01T23:59:59.000Z

363

The iron man phenomenon, participatory culture, & future augmented reality technologies  

Science Journals Connector (OSTI)

The Iron Man media franchise glorifies futuristic interfaces and devices like holographic screens, powerful mobile devices, and heads-up displays. Consequently, a mainstream audience has come to know about and discursively relate to Augmented Reality ... Keywords: augmented reality, human-centric design, social media

Isabel Pedersen; Luke Simcoe

2012-05-01T23:59:59.000Z

364

Reduction of Vinyl Chloride in Metallic Iron-Water Systems  

E-Print Network [OSTI]

residence time for contaminated ground- water to degrade VC to below its maximum contamination levelReduction of Vinyl Chloride in Metallic Iron-Water Systems B A O L I N D E N G * Department). Remediation of groundwater contaminated with chlori- nated ethylenes, including vinyl chloride, has been chal

Deng, Baolin

365

Sulfur Versus Iron Oxidation in an Iron-Thiolate Model Complex  

SciTech Connect (OSTI)

In the absence of base, the reaction of [Fe{sup II}(TMCS)]PF{sub 6} (1, TMCS = 1-(2-mercaptoethyl)-4,8,11-trimethyl-1,4,8,11-tetraazacyclotetradecane) with peracid in methanol at -20 C did not yield the oxoiron(IV) complex (2, [Fe{sup IV}(O)(TMCS)]PF{sub 6}), as previously observed in the presence of strong base (KO{sup t}Bu). Instead, the addition of 1 equiv of peracid resulted in 50% consumption of 1. The addition of a second equivalent of peracid resulted in the complete consumption of 1 and the formation of a new species 3, as monitored by UV-vis, ESI-MS, and Moessbauer spectroscopies. ESI-MS showed 3 to be formulated as [Fe{sup II}(TMCS) + 2O]{sup +}, while EXAFS analysis suggested that 3 was an O-bound iron(II)-sulfinate complex (Fe-O = 1.95 {angstrom}, Fe-S = 3.26 {angstrom}). The addition of a third equivalent of peracid resulted in the formation of yet another compound, 4, which showed electronic absorption properties typical of an oxoiron(IV) species. Moessbauer spectroscopy confirmed 4 to be a novel iron(IV) compound, different from 2, and EXAFS (Fe{double_bond}O = 1.64 {angstrom}) and resonance Raman ({nu}{sub Fe{double_bond}O} = 831 cm{sup -1}) showed that indeed an oxoiron(IV) unit had been generated in 4. Furthermore, both infrared and Raman spectroscopy gave indications that 4 contains a metal-bound sulfinate moiety ({nu}{sub s}(SO{sub 2}) {approx} 1000 cm{sup -1}, {nu}{sub as}(SO{sub 2}) {approx} 1150 cm{sup -1}). Investigations into the reactivity of 1 and 2 toward H{sup +} and oxygen atom transfer reagents have led to a mechanism for sulfur oxidation in which 2 could form even in the absence of base but is rapidly protonated to yield an oxoiron(IV) species with an uncoordinated thiol moiety that acts as both oxidant and substrate in the conversion of 2 to 3.

A McDonald; M Bukowski; E Farquhar; T Jackson; K Koehntop; M Seo; R De Hont; A Stubna; J Halfen; E Munck

2011-12-31T23:59:59.000Z

366

DOE Physicists at Work - Dr. Peter Beiersdorfer | OSTI, US Dept of Energy,  

Office of Scientific and Technical Information (OSTI)

Physicists at Work - Dr. Peter Beiersdorfer Physicists at Work - Dr. Peter Beiersdorfer DOE Physicists at Work Archive DOE Office of Science celebrates 2005 World Year of Physics DOE Physicists at Work Profiles of representative DOE-sponsored physicists doing research at universities and national laboratories Compiled by the Office of Scientific and Technical Information Dr. Peter Beiersdorfer It was just a simple iron wire, strung across the ceiling, that when heated by a current expanded and dropped lower. But that wire, along with a professor willing to take a different approach, confirmed in Peter Beiersdorfer's mind that experimental physics was the way to go. Dr. Peter Beiersdorfer "When trying to decide what field to study after high school, I simply faced too many possibilities," says Dr. Beiersdorfer, group leader of the

367

Fracture toughness studies of gray and ductile cast irons using a J-integral approach  

E-Print Network [OSTI]

, and silicon in which more carbon is present than can be retained in solid solution in austenite at the eutectic temperature. In gray cast iron, the iron and carbon solidify as a eutectic structure whose two phases are graphite and iron. Gray iron usually... contains from 1. 7 to 4. 5% carbon and 1 to 3% silicon. 27 The normal microstructure of gray iron is a matrix of pearlite (ferrite and cementite) with the graphite flakes dispersed throughout. Among the properties that the flake graphite 28 in gray...

Floyd, Donna Lynne Woodall

2012-06-07T23:59:59.000Z

368

WORK OF TIE U. S. GEOLOGICAL SURVEY  

Science Journals Connector (OSTI)

...Bayley, and the latter, 'The Crystal Falls Iron-bearing District of Michigan...surveys are being prose-cuted on the Klamath Mountains, where strata of early Paleozoic...confidently be expected to afford an interesting group of criteria for the elucida-tion of...

Bailey Willis

1899-08-18T23:59:59.000Z

369

Working Remotely | Argonne National Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Working Remotely Working Remotely Remote Access Use VPN to access Argonne resources Wake up your computer if power management policies have been applied Connect to your work computer by using Remote Desktop Communications Log into web-based e-mail Outlook Zimbra Send instant messages with Jabber Use Argonne's voice mail and teleconferencing services Use Adobe Connect for web conferencing E-Mail Client and Mobile Device Configuration Changes for Exchange 2010 Cyber Security Secure your home computers Passwords MyPassword Change your password Choosing a good password Other Tools Upload a file for retrieval by others (login required) Argonne SharePoint Server (login required) Inside Argonne (accessible onsite or through VPN) Focal Point Management Blog (accessible onsite or through VPN)

370

Energy Work | Open Energy Information  

Open Energy Info (EERE)

Work Work Jump to: navigation, search Name Energy Work Place Kelaniya, Sri Lanka Sector Biomass, Renewable Energy, Solar Product Dealing with renewable energy applications, specifically solar and biomass power generation Coordinates 6.95°, 79.916702° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":6.95,"lon":79.916702,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

371

CFN Ops Plan | Work Planning  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Operations Plan Operations Plan Work Planning & Control for Experiments and Operations All experimental work will be conducted in accordance with Work Planning and Control for Experiments and Operations, which ensures proper design and operation of all experiments prior to their commencement. CFN will use the SBMS provided standard form for the formal documentation. The Lead Experimenter/Responsible person will notify the Experimental Safety Review Committee of any new experiments or modifications to existing experiments. CFN will appoint an Experimental Safety Review Committee. This committee will consist of the Experiment Review Coordinator, CFN personnel, Facility Support Representative (FSR), Environmental Compliance Representative (ECR). Additional subject matter experts may be appointed on an ad-hoc

372

Surveillance Guides - Work Control Process  

Broader source: Energy.gov (indexed) [DOE]

Work Control Process Work Control Process 1.0 Objective The objective of this surveillance guide is to provide lines of inquiry for evaluating the effectiveness of the contractor's work control process. Users should be cognizant that the lines of inquiry need to be further tailored to fit specific facilities or activities in accordance with contractual mechanisms such as Maintenance Implementation Plans, Conduct of Operations Implementation Plans, and the Integrated Safety Management System Description. 2.0 References 2.1 DOE 4330.4B Maintenance Management Program 2.2 48 CFR 1970.5204-2 Department of Energy Acquisition Regulations 2.3 DOE O 5480.19, Conduct of Operations 2.4 10 CFR 830.120, Quality Assurance 3.0 Requirements Implemented This surveillance is conducted to verify implementation of Core

373

Perma Works | Open Energy Information  

Open Energy Info (EERE)

Perma Works Perma Works Jump to: navigation, search Name Perma Works Place Albuquerque, New Mexico Zip 87123 Sector Geothermal energy Product A company that focuses on producing enhanced geothermal systems through providing electronics and software. Coordinates 35.08418°, -106.648639° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.08418,"lon":-106.648639,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

374

Work Practices for Chemical Fumehoods  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Practices for Chemical Fumehoods Practices for Chemical Fumehoods (Reviewed May 16, 2011) Always use a chemical fumehood when working with toxic and/or volatile chemicals, not on an open bench. Chemical fumehoods are designed to provide protection for the user from chemical and radiological contaminants. However, they do not absolutely eliminate exposure, even under ideal conditions. Careless work practices can result in considerable exposure to users who may believe they are protected. To optimize the performance of the chemical hood, adhere to the following work practices: 1. Ensure that your chemical hood has a current inspection sticker (dated within the last year). The face velocity should be between 80 and 120 linear feet per minute (lfpm). 2. Verify that the chemical hood is drawing air.

375

V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus  

Broader source: Energy.gov (indexed) [DOE]

21: Cisco IronPort Web / Email Security Appliance Sophos 21: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities November 12, 2012 - 6:00am Addthis PROBLEM: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities PLATFORM: Cisco IronPort Email Security Appliances (C-Series and X-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. Cisco IronPort Web Security Appliances (S-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. ABSTRACT: Cisco Ironport Appliances Sophos Anti-Virus Vulnerabilities. REFERENCE LINKS: Cisco Security Advisory ID: cisco-sa-20121108-sophos Secunia Advisory SA51197 IMPACT ASSESSMENT: High DISCUSSION: Cisco has acknowledged some vulnerabilities in Cisco IronPort Web Security

376

V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus  

Broader source: Energy.gov (indexed) [DOE]

1: Cisco IronPort Web / Email Security Appliance Sophos 1: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities November 12, 2012 - 6:00am Addthis PROBLEM: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities PLATFORM: Cisco IronPort Email Security Appliances (C-Series and X-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. Cisco IronPort Web Security Appliances (S-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. ABSTRACT: Cisco Ironport Appliances Sophos Anti-Virus Vulnerabilities. REFERENCE LINKS: Cisco Security Advisory ID: cisco-sa-20121108-sophos Secunia Advisory SA51197 IMPACT ASSESSMENT: High DISCUSSION: Cisco has acknowledged some vulnerabilities in Cisco IronPort Web Security

377

Use of bimodal carbon distribution in compacts for producing metallic iron nodules  

DOE Patents [OSTI]

A method for use in production of metallic iron nodules comprising providing a reducible mixture into a hearth furnace for the production of metallic iron nodules, where the reducible mixture comprises a quantity of reducible iron bearing material, a quantity of first carbonaceous reducing material of a size less than about 28 mesh of an amount between about 65 percent and about 95 percent of a stoichiometric amount necessary for complete iron reduction of the reducible iron bearing material, and a quantity of second carbonaceous reducing material with an average particle size greater than average particle size of the first carbonaceous reducing material and a size between about 3 mesh and about 48 mesh of an amount between about 20 percent and about 60 percent of a stoichiometric amount of necessary for complete iron reduction of the reducible iron bearing material.

Iwasaki, Iwao

2014-04-08T23:59:59.000Z

378

Policy Memo: Working Effectively with Contractors | Department...  

Energy Savers [EERE]

Policy Memo: Working Effectively with Contractors Policy Memo: Working Effectively with Contractors Guidance on working effectively with contractors. MAPolicyMemoWorkingwContracto...

379

Kinetics of the steam reforming of methane with iron, nickel, and iron-nickel alloys as catalysts  

SciTech Connect (OSTI)

The steam reforming of methane on iron or nickel, CH/sub 4/ + H/sub 2/O ..-->.. CO + 3H/sub 2/, can be regarded as a sequence of two reactions with adsorbed carbon as an intermediate species: CH/sub 4/ ..-->.. C(ads) + 2H/sub 2/, C(ads) + H/sub 2/O ..-->.. CO + H/sub 2/. As the first reaction is rate limiting, the following rate law can be applied to methane reforming catalysed by iron: v = k/sub 2//sup Fe/ a/sub 0//sup -n/ p/sub CH/sub 4///P/sub H/sub 2///sup 1/2/, 0.6 less than or equal to n less than or equal to 1.0. The oxygen activity a/sub 0/ on the catalyst surface is virtually determined by the ratio P/sub H/sub 2/O//P/sub H/sub 2// in the gas atmosphere. The above rate equation was confirmed by measurements in a flow apparatus for the temperature range 700 to 900/sup 0/C. In agreement with the reaction model the steady-state carbon activity on the iron surface and the steady-state carbon concentration in the iron catalyst are very low. With nickel as catalyst the reaction rate is much higher and independent of the oxygen activity on the catalyst surface. The rate equation reads: v = k/sub 2//sup Ni/ P/sub CH/sub 4//. Different partial reaction steps of the methane decomposition are rate determining on iron and nickel.

Muenster, P.; Grabke, H.J.

1981-12-01T23:59:59.000Z

380

Effect of thermal treatment on coke reactivity and catalytic iron mineralogy  

SciTech Connect (OSTI)

Iron minerals in coke can catalyze its gasification and may affect coke behavior in the blast furnace. The catalytic behavior of iron depends largely upon the nature of the iron-bearing minerals. To determine the mineralogical changes that iron could undergo in the blast furnace, cokes made from three coals containing iron present in different mineral forms (clays, carbonates, and pyrite) were examined. All coke samples were heat-treated in a horizontal furnace at 1373, 1573, and 1773 K and then gasified with CO{sub 2} at 1173 K in a fixed bed reactor (FBR). Coke mineralogy was characterized using quantitative X-ray diffraction (XRD) analysis of coke mineral matter prepared by low-temperature ashing (LTA) and field emission scanning electron microscopy combined with energy dispersive X-ray analysis (FESEM/EDS). The mineralogy of the three cokes was most notably distinguished by differing proportions of iron-bearing phases. During heat treatment and subsequent gasification, iron-containing minerals transformed to a range of minerals but predominantly iron-silicides and iron oxides, the relative amounts of which varied with heat treatment temperature and gasification conditions. The relationship between initial apparent reaction rate and the amount of catalytic iron minerals - pyrrhotite, metallic iron, and iron oxides - was linear and independent of heat treatment temperature at total catalyst levels below 1 wt %. The study showed that the coke reactivity decreased with increasing temperature of heat treatment due to decreased levels of catalytic iron minerals (largely due to formation of iron silicides) as well as increased ordering of the carbon structure. The study also showed that the importance of catalytic mineral matter in determining reactivity declines as gasification proceeds. 37 refs., 13 figs., 7 tabs.

Byong-chul Kim; Sushil Gupta; David French; Richard Sakurovs; Veena Sahajwalla [University of New South Wales, Sydney, NSW (Australia). Centre for Sustainable Materials Research and Technology

2009-07-15T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Categorical Exclusion for Maintenance Work  

Broader source: Energy.gov (indexed) [DOE]

Maintenance Work Maintenance Work along the Electrical District 5 to Saguaro segment (41/4 to 58/5) of the Maricopa-Saguaro 115-kV Transmission Line, between Friendly Comers and Marana, Pinal County, Arizona RECORD OF CATEGORICAL EXCLUSION DETERMINATION A. Proposed Action: Western plans to conduct maintenance work to maintain or improve the reliability and safety of electrical transmission along 17 miles of the Test Track (formerly Maricopa)-Saguaro 115-kV Transmission Line between Electrical District 5 and Saguaro Steam Plant Substations. The work includes replacing wood poles, cross arms, and knee braces in-kind at 27 structures (41/4-8, 4214, 43/6, 4417, 45/4,46/6,47/2,49/2,49/6,50/2,50/6,50/8,51/4, 52/3, 54/3, 5517, 56/1 57/1-3, 57/8 & 58/2-3), because the wood poles failed stability tests, cross arms are beyond

382

Public Works Transportation Infrastructure Study  

E-Print Network [OSTI]

and Alleys · Street Lights · Traffic Signals #12;Public Works Transportation Infrastructure Study Minneapolis Infrastructure Study Minneapolis City of Lakes Infrastructure Included in Analysis: · Bridges · Streets Infrastructure Study Minneapolis City of Lakes Existing Inventory & Current Conditions Street Pavement Before

Minnesota, University of

383

Working Paper 6 October 2007  

E-Print Network [OSTI]

and innovation. Its constituent centres include the Research Centre for Social Sciences (RCSS), the ESRC Centre for Social and Economic Research on Innovation in Genomics (Innogen), the Science Studies Unit (SSU in innovation work Nils Markusson Abstract The literature on environmental champions tends to emphasise

384

Working fluid for Rankine cycle  

SciTech Connect (OSTI)

A Rankine cycle working fluid is disclosed containing a mixture of 2,2,3,3tetrafluoropropanol and water, which is low toxic, incombustible, nonexplosive, noncorrosive and stable, and also has a high critical temperature and forms azeotropic-like composition. It is suited for use in a rankine cycle using heat source of low temperature.

Aomi, H.; Enjo, N.

1980-11-11T23:59:59.000Z

385

working with industry Engineering and  

E-Print Network [OSTI]

of interests including: · laser physics · semiconductor optoelectronics · photonics in manufacturing · solar · micromechanics and condition monitoring · renewable energy modelling · carbon capture and storage Our institute to applied systems. We have a wide ranging programme of current work with many industrial companies in key

Painter, Kevin

386

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A weekly e-newsletter for the Waste Isolation Pilot Plant team September 18, 2003 The Big Story Characterization Operations completed at ANL-E Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e-mail. WIPP Shipments (as of 9-18-03 at 7:17 a.m.) 21 Shipments scheduled to arrive at WIPP this week 2,020 Total shipments received at WIPP Months of dedication and teamwork have paid off for WIPP Central Characterization Project (CCP) employees working at Argonne National Laboratory - East (ANL-E). Characterization activities at the site have

387

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

| NRC Officials Visit WIPP Tod | NRC Officials Visit WIPP Tod A weekly e-newsletter for the Waste Isolation Pilot Plant team September 25, 2003 The Big Story Recertification - a work in progress Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e-mail. WIPP Shipments (as of 9-25-03 at 7:16 a.m.) 21 Shipments scheduled to arrive at WIPP this week 2,044 Total shipments received at WIPP Without EPA approval, WIPP could not have received the first waste shipment in 1999. In 1998, EPA cleared the way for TRU waste disposal when it certified that the WIPP repository would safely contain

388

NETL: News Release - Clean Coal Technology Report Showcases Advanced Iron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

April 6, 2000 April 6, 2000 Clean Coal Technology Report Showcases Advanced Iron Making Process, Benefits for the Environment Topical Report Profiles Blast Furnace Granular Coal Injection System; Now Available on DOE's Fossil Energy Web Site An advanced iron making technology demonstrated in the U.S. Department of Energy's Clean Coal Technology Program stands out for its potential to provide major environmental and financial benefits to the United States steel industry. Bethlehem Steel Topical Report The Energy Department has profiled the project in a topical report entitled Blast Furnace Granular Coal Injection System Demonstration Project. The report describes the federal government's partnership demonstration project with Bethlehem Steel Corporation, which tested a new method for reducing

389

Arsenic Removal by Photochemical Methods: Nanoparticulate Zerovalent Iron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Arsenic Removal by Photochemical Methods: Nanoparticulate Zerovalent Iron Arsenic Removal by Photochemical Methods: Nanoparticulate Zerovalent Iron and Heterogeneous Photocatalysis with TiO2 Speaker(s): Marta Litter Date: November 19, 2010 - 11:00am Location: 90-3122 Seminar Host/Point of Contact: Hugo Destaillats Arsenic in groundwater is a dramatic global problem due to the high incidence of arsenicosis or HACRE (Chronic Endemic Regional Hydro-arsenicism, Hidroarsenicismo Crónico Regional Endémico in Spanish), a severe illness causing skin lesions and cancer in extended regions of the world. For this reason, research on low-cost technologies for As removal to be applied in isolated, poor, rural locations is mandatory. This seminar will present a brief overview of arsenic pollution issues and mitigation needs in Latin America. It will also present results on As(V) removal using

390

Parkers-Iron Springs, Arkansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Parkers-Iron Springs, Arkansas: Energy Resources Parkers-Iron Springs, Arkansas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.6081427°, -92.3320235° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.6081427,"lon":-92.3320235,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

391

What's in the Cage Matters in Iron Antimonide Thermoelectric Materials |  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Novel Experiments on Cement Yield Concrete Results Novel Experiments on Cement Yield Concrete Results Watching a Glycine Riboswitch "Switch" Polyamorphism in a Metallic Glass Under Pressure, Vanadium Won't Turn Down the Volume New Nanoscale Engineering Breakthrough Points to Hydrogen-Powered Vehicles Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed What's in the Cage Matters in Iron Antimonide Thermoelectric Materials MARCH 29, 2007 Bookmark and Share Crystal structure of EuFe4Sb12 showing the cage confined Eu atoms (red) and Fe atoms (brown) surrounded by Sb tilted octahedral (Sb atoms are not shown). Thermoelectric materials such as iron antimonide have drawn intense interest because they offer a pollution-free source of electricity and a

392

Iron beam acceleration using direct plasma injection scheme  

SciTech Connect (OSTI)

A new set of vanes of radio frequency quadrupole (RFQ) accelerator was commissioned using highly charged iron beam. To supply high intensity heavy ion beams to the RFQ, direct plasma injection scheme (DPIS) with a confinement solenoid was adopted. One of the difficulties to utilize the combination of DPIS and a solenoid field is a complexity of electro magnetic field at the beam extraction region, since biasing high static electric field for ion extraction, RFQ focusing field, and the solenoid magnetic field fill the same space simultaneously. To mitigate the complexity, a newly designed magnetic field clamps were used. The intense iron beam was observed with bunched structure and the total accelerated current reached 2.5 nC.

Okamura, M., E-mail: okamura@bnl.gov [Brookhaven National Laboratory, Upton, New York 11973 (United States); RIKEN-BNL Research Center, Upton, New York 11973 (United States); Kanesue, T. [Brookhaven National Laboratory, Upton, New York 11973 (United States)] [Brookhaven National Laboratory, Upton, New York 11973 (United States); Yamamoto, T. [Waseda University, Shinjuku, Tokyo 169-8555 (Japan)] [Waseda University, Shinjuku, Tokyo 169-8555 (Japan); Fuwa, Y. [Kyoto University, Uji, Kyoto 611-0011 (Japan) [Kyoto University, Uji, Kyoto 611-0011 (Japan); RIKEN, Wako, Saitama 351-0198 (Japan)

2014-02-15T23:59:59.000Z

393

Iron aluminide useful as electrical resistance heating elements  

DOE Patents [OSTI]

The invention relates generally to aluminum containing iron-base alloys useful as electrical resistance heating elements. The aluminum containing iron-base alloys have improved room temperature ductility, electrical resistivity, cyclic fatigue resistance, high temperature oxidation resistance, low and high temperature strength, and/or resistance to high temperature sagging. The alloy has an entirely ferritic microstructure which is free of austenite and includes, in weight %, over 4% Al, .ltoreq.1% Cr and either .gtoreq.0.05% Zr or ZrO.sub.2 stringers extending perpendicular to an exposed surface of the heating element or .gtoreq.0.1% oxide dispersoid particles. The alloy can contain 14-32% Al, .ltoreq.2% Ti, .ltoreq.2% Mo, .ltoreq.1% Zr, .ltoreq.1% C, .ltoreq.0.1% B, .ltoreq.30% oxide dispersoid and/or electrically insulating or electrically conductive covalent ceramic particles, .ltoreq.1% rare earth metal, .ltoreq.1% oxygen, .ltoreq.3% Cu, balance Fe.

Sikka, Vinod K. (Oak Ridge, TN); Deevi, Seetharama C. (Oak Ridge, TN); Fleischhauer, Grier S. (Midlothian, VA); Hajaligol, Mohammad R. (Richmond, VA); Lilly, Jr., A. Clifton (Chesterfield, VA)

1999-01-01T23:59:59.000Z

394

Iron aluminide useful as electrical resistance heating elements  

DOE Patents [OSTI]

The invention relates generally to aluminum containing iron-base alloys useful as electrical resistance heating elements. The aluminum containing iron-base alloys have improved room temperature ductility, electrical resistivity, cyclic fatigue resistance, high temperature oxidation resistance, low and high temperature strength, and/or resistance to high temperature sagging. The alloy has an entirely ferritic microstructure which is free of austenite and includes, in weight %, over 4% Al, .ltoreq.1% Cr and either .gtoreq.0.05% Zr or ZrO.sub.2 stringers extending perpendicular to an exposed surface of the heating element or .gtoreq.0.1% oxide dispersoid particles. The alloy can contain 14-32% Al, .ltoreq.2% Ti, .ltoreq.2% Mo, .ltoreq.1% Zr, .ltoreq.1% C, .ltoreq.0.1% B, .ltoreq.30% oxide dispersoid and/or electrically insulating or electrically conductive covalent ceramic particles, .ltoreq.1% rare earth metal, .ltoreq.1% oxygen, .ltoreq.3% Cu, balance Fe.

Sikka, Vinod K. (Oak Ridge, TN); Deevi, Seetharama C. (Oak Ridge, TN); Fleischhauer, Grier S. (Midlothian, VA); Hajaligol, Mohammad R. (Richmond, VA); Lilly, Jr., A. Clifton (Chesterfield, VA)

1997-01-01T23:59:59.000Z

395

Substances of Abuse and Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SUBSTANCES OF ABUSE SUBSTANCES OF ABUSE AND WORK Mary L. Doyle, MPH, RN, COHN-5/CM DOE Headquarters January 16, 2002 Americans 12 Years and Older Using Dru s or Alcohol in the Past Month 1915 1995 1999 Substance Abuse in Industry * Drug use - associated with higher rates of )>absenteeism )>injury l> medical care utilization )> involuntary separation l> health care costs * Alcohol use in the workplace associated with l> absenteeism l> performance on specific tasks ::... mixed data on other outcomes Americans Over 12 Years Reporting Lifetime (Ever Used) Drug Use "'.11---------11--------l * Aloobol *Airf.Udruc 50.11---------11--------l * Mari- ODd ........ 40.11---------11----&.---l * Cocaiae *llalaciaogoal * Horoia Substance Abuse and Work

396

Working at ORNL | Careers | ORNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

View Open Positions View Open Positions View Postdoctoral Positions Create A Profile Internal applicants please apply here View or update your current application or profile. External applicants Internal applicants Internet Explorer Browser preferred for ORNL applicants. Chrome is not currently supported. For more information about browser compatibility please refer to the FAQs. If you have difficulty using the online application system or need an accommodation to apply due to a disability, please email ORNLRecruiting@ornl.gov or phone 1-866-963-9545 Careers Home | ORNL | Careers | Working at ORNL SHARE Working at ORNL Community and Culture Here at Oak Ridge National Lab we have over 4,000 employees representing more than 80 different countries. Our employees make a difference in the

397

Will our nuclear weapons work?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Will our nuclear weapons work? Will our nuclear weapons work? National Security Science magazine Latest Issue:April 2013 All Issues » submit Supercomputers are essential for assessing the health of the U.S. nuclear stockpile Supercomputers provide assurance by simulating nuclear weapons performance March 25, 2013 Graphic of a missile being tested through computer simulation Los Alamos uses supercomputers to make high-resolution 3D simulations that help to assess the health of nuclear weapons like this B-61 bomb. Contact Managing Editor Clay Dillingham Email The nuclear weapons in the U.S. stockpile were designed and built to be replaced with new designs and builds every 10 to 15 years. These weapons have lived beyond their expected lifespans. Supercomputers provide the high-resolution 3D simulations needed for

398

Coal Fly Ash as a Source of Iron in Atmospheric Dust  

SciTech Connect (OSTI)

Anthropogenic coal fly ash aerosols may represent a significant source of bioavailable iron in the open ocean. Few measurements have been made to compare the solubility of atmospheric iron from anthropogenic aerosols and other sources. We report an investigation of the iron dissolution of three fly ash samples in acidic aqueous solutions and compare the solubilities with that of Arizona test dust, a reference material of mineral dust. The effects of pH, cloud processing, and solar irradiation on Fe solubility were explored. Similar to previously reported results on mineral dust, iron in aluminosilicate phases provide predominant dissolved iron compared with iron in oxides. Iron solubility of fly ash is higher than Arizona test dust, especially at the higher pH conditions investigated. Simulated atmospheric processing elevates iron solubility due to significant changes in the morphology aluminosilicate glass, a dominantly material in fly ash particle. Iron continuously releases into the aqueous solution as fly ash particles break up into smaller fragments. The assessment of dissolved atmospheric iron deposition fluxes, and their effect on the biogeochemistry at ocean surface should be constrained by taking into account the source, environment pH, Fe speciation, and solar radiation.

Chen, Haihan; Laskin, Alexander; Baltrusaitis, Jonas; Gorski, Christopher A.; Scherer, Michelle; Grassian, Vicki H.

2012-01-18T23:59:59.000Z

399

Chapter 12 - Coal use in iron and steel metallurgy  

Science Journals Connector (OSTI)

Abstract: This chapter discusses the role of coal in iron and steel metallurgy. The chapter first gives information about routes for steel manufacture, current levels of steel production and forecasts for the future. It then discusses the use of coal in different metallurgical processes with emphasis on various ironmaking technologies as the most energy consuming step of the process chain. Alternatives to coal like biomass, hydrogen or waste plastics are discussed from the point of view of CO2 reduction.

A. Babich; D. Senk

2013-01-01T23:59:59.000Z

400

Zinc sorption by iron oxides and soil samples  

E-Print Network [OSTI]

(Head of Department) May 1989 ABSTRACT Zinc Sorption by Iron Oxides and Soil Samples. (May 1989) Markku Juhani Yli-Halla, M. S. University of Helsinki, Finland Chair of Advisory Committee: Dr. Richard H. Loeppert Zn sorption by synthetic Fe oxide... and soil samples was studied. The purpose was to examine the effect of crystallinity and adsorbed silica on Zn adsorption by synthetic Fe oxide using goethite and ferrihydrite as test materials. Zn sorption by acid soil samples from Finland and a...

Yli-Halla, Markku Juhani

1989-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Low resistivity contact to iron-pnictide superconductors  

DOE Patents [OSTI]

Method of making a low resistivity electrical connection between an electrical conductor and an iron pnictide superconductor involves connecting the electrical conductor and superconductor using a tin or tin-based material therebetween, such as using a tin or tin-based solder. The superconductor can be based on doped AFe.sub.2As.sub.2, where A can be Ca, Sr, Ba, Eu or combinations thereof for purposes of illustration only.

Tanatar, Makariy; Prozorov, Ruslan; Ni, Ni; Bud'ko, Sergey; Canfield, Paul

2013-05-28T23:59:59.000Z

402

Fouling of carbon steel heat exchanger caused by iron bacteria  

SciTech Connect (OSTI)

A carbon steel heat exchanger installed in a reverse osmosis unit failed after 1 1/2 years from start-up as a result of tubes, lids, tube sheets, and connection pipes clogging from rust deposits. Chemical analysis of cooling water and scraped precipitates, as well laboratory screening of the deposits for bacteria, revealed that activity of iron-oxidizing bacteria present in cooling water could lead to heat exchanger blockage.

Starosvetsky, J.; Armon, R.; Starosvetsky, D. (Technion-Israel Inst. of Tech. (Israel)); Groysman, A.

1999-01-01T23:59:59.000Z

403

PUREX facility preclosure work plan  

SciTech Connect (OSTI)

This preclosure work plan presents a description of the PUREX Facility, the history of the waste managed, and addresses transition phase activities that position the PUREX Facility into a safe and environmentally secure configuration. For purposes of this documentation, the PUREX Facility does not include the PUREX Storage Tunnels (DOE/RL-90/24). Information concerning solid waste management units is discussed in the Hanford Facility Dangerous Waste Permit Application, General Information Portion (DOE/RL-91-28, Appendix 2D).

Engelmann, R.H.

1997-04-24T23:59:59.000Z

404

Visualization and Modeling Working Group  

SciTech Connect (OSTI)

During the 2005 Hurricane season, many consequence predictions were available from 36 to 96 hours before landfalls, via the Department of Energys Visualization and Modeling Working Group (VMWG). Real-time data can be tapped by local officials and utilities, and can also be accessed for post-event regulatory audits. An overview of VMWGs models, results and uses will be presented.

Fernandez, S.J. (LANL); Dodrill, K.A.

2007-03-01T23:59:59.000Z

405

Performance and cycling of the iron-ion/hydrogen redox flow cell with  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Performance and cycling of the iron-ion/hydrogen redox flow cell with Performance and cycling of the iron-ion/hydrogen redox flow cell with various catholyte salts Title Performance and cycling of the iron-ion/hydrogen redox flow cell with various catholyte salts Publication Type Journal Article Year of Publication 2013 Authors Tucker, Michael C., Venkat Srinivasan, Philip N. Ross, and Adam Z. Weber Journal Journal of Applied Electrochemistry Volume 43 Issue 7 Pagination 637 - 644 Date Published 7/2013 ISSN 0021-891X Keywords battery, Flow battery, iron hydrogen cell, progress, redox flow cell Abstract A redox flow cell utilizing the Fe2+/Fe3+ and H-2/H+ couples is investigated as an energy storage device. A conventional polymer electrolyte fuel cell anode and membrane design is employed, with a cathode chamber containing a carbon felt flooded with aqueous acidic solution of iron salt. The maximum power densities achieved for iron sulfate, iron chloride, and iron nitrate are 148, 207, and 234 mW cm(-2), respectively. It is found that the capacity of the iron nitrate solution decreases rapidly during cycling. Stable cycling is observed for more than 100 h with iron chloride and iron sulfate solutions. Both iron sulfate and iron chloride solutions display moderate discharge polarization and poor charge polarization; therefore, voltage efficiency decreases dramatically with increasing current density. A small self-discharge current occurs when catholyte is circulating through the cathode chamber. As a result, a current density above 100 mA cm(-2) is required to achieve high Coulombic efficiency (> 0.9).

406

An Atomistic study of Helium Resolution in bcc Iron  

SciTech Connect (OSTI)

The evolution of gas-stabilized bubbles in irradiated materials can be a significant factor in the microstructural processes that lead to mechanical property and dimensional changes in structural materials exposed to high-energy neutrons. Helium generation and accumulation is particularly important under DT fusion irradiation conditions. Although the process of ballistic resolutioning of gas from bubbles has been long-discussed in the literature, there have been few computational studies of this mechanism. Resolutioning could limit bubble growth by ejecting gas atoms back into the metal matrix. A detailed atomistic study of ballistic He resolutioning from bubbles in bcc iron has been carried out using molecular dynamics. A newly-developed Fe-He interatomic potential was employed, with the iron matrix described by the potential of Ackland and co-workers from 1997. The primary variables examined were: irradiation temperature (100 and 600K), iron knock-on atom energy (5 and 20 keV), bubble radius (~0.5 and 1.0 nm), and He-to-vacancy ratio in the bubble (0.25, 0.5 and 1.0) in order to obtain an assessment of this dynamic resolutioning mechanism. The results presented here focus on the 5 keV cascades which indicate a modest, but potentially significant level of He removal by this process.

Stoller, Roger E [ORNL; Stewart, David M [ORNL

2011-01-01T23:59:59.000Z

407

Corrosion of iron in acid solutions with hydrogen sulfide  

SciTech Connect (OSTI)

The influence of pH and the concentration of hydrogen sulfide (H{sub 2}S) on corrosion of iron in acid solutions was studied using a potentiostatic polarization method. The alternating current (AC) impedance technique also was used to characterize the active dissolution process of iron. Results showed the dissolution process was accelerated by H{sub 2}S. The anodic dissolution current (i{sub a}) increased with pH and H{sub 2}S concentration with reaction orders of about n{sub pH} = n{sub H{sub 2}s} = 0.25 when the ratio of H{sub 2}S concentration and hydrogen ion (H{sub 3}O{sup +}) concentration was <10{sup 1.5} i{sub a} reached a maximum and became independent of pH and [H{sub 2}S] when [H{sub 2}S]/H{sub 3}O{sup +} > 10{sup 1.5}. The Nyquist diagram corresponding to the active dissolution process in the Tafel range exhibited two capacitive loops in addition to the well-known, high-frequency capacitive loop. A mechanism was proposed to explain the results in which H{sub 2}S chemisorbed first on the electrode surface and then catalyzed the anodic dissolution of iron in two discharging steps.

Cheng, X.L.; Ma, H.Y.; Zhang, J.P.; Chen, X.; Chen, S.H. [Shandong Univ., Jinan (China). Dept. of Chemistry; Yang, H.Q. [Peking Univ. (China). Dept. of Chemistry

1998-05-01T23:59:59.000Z

408

Kinetics of chromium(VI) reduction by ferrous iron  

SciTech Connect (OSTI)

Chromium is a primary inorganic contaminant of concern at the Pantex Plant. Chromium concentrations have been found to be two orders of magnitude higher than the drinking water standards, particularly in certain wells in the perched aquifer below Zone 12. In situ reduction of a mobile form of chromium, Cr(VI) to an immobile form, Cr(III), was examined as a viable option to active soil restoration. Successfully immobilizing chromium in the vadose zone as Cr(III) will reduce the amount of chromium that reaches the groundwater table. The results from the solution experiments indicated that chromium was rapidly and stoichiometrically reduced by Fe(II) in solution. Also, the slurry experiments showed that the aquifer solids removed Fe(II) from solution, but a portion of the iron removed remained available for reaction with Cr(VI), but at a slower rate. A model to predict different amounts of iron pseudo-components was developed, which allowed prediction of iron amounts required to reduce chromium under in situ conditions.

Batchelor, B.; Schlautman, M.; Hwang, I.; Wang, R. [Texas A and M Univ., College Station, TX (United States). Dept. of Civil Engineering

1998-09-01T23:59:59.000Z

409

Multilayer route to iron nanoparticle formation in an insulating matrix  

Science Journals Connector (OSTI)

Well-protected isolated bcc-iron nanoparticles embedded in silicon dioxide were prepared by e-beam evaporation and postannealing of multilayers in an ultrahigh vacuum system. The spherical shape and isolation of the particles were confirmed by plan-view and cross-sectional transmission electron microscopy.Oxidation was evaluated from the electron energy-loss near edge structure. In this technique a postedge peak of 40 eV above the iron L 3 threshold originating from backscattering of oxygen atoms provides a clear indication of iron oxide. The white-line ratio (WLR) measuring the 3 d -orbital occupancy is used to estimate the oxidation-layer thickness. In the samples of large ironnanoparticles (with average diameter larger than 10 nm ) a very thin surface layer appears to be the oxide maghemite approximately one atomic layer according to the WLR evaluations. The evolution of the coercivity with particle size as measured by the magneto-optical Kerr effect shows that the reversal process is dominated by the surfaceanisotropy and is also affected by the dipole interaction particularly in samples with large volume-filling factor.

Feng Wang; Marek Malac; Ray F. Egerton; Alkiviathes Meldrum; Xiaobin Zhu; Zhigang Liu; Nicole Macdonald; Peng Li; Mark R. Freeman

2007-01-01T23:59:59.000Z

410

Synthesis of metastable rare-earth-iron mixed oxide with the hexagonal crystal structure  

SciTech Connect (OSTI)

Rare-earth-iron mixed oxides with the rare earth/iron ratio=1 have either orthorhombic (o-REFeO{sub 3}) or hexagonal (h-REFeO{sub 3}) structure. h-REFeO{sub 3} is a metastable phase and the synthesis of h-REFeO{sub 3} is usually difficult. In this work, the crystallization process of the precursors obtained by co-precipitation and Pechini methods was investigated in detail to synthesize h-REFeO{sub 3}. It was found that the crystallization from amorphous to hexagonal phase and the phase transition from hexagonal to orthorhombic phase occurred at a similar temperature range for rare earth elements with small ionic radii (Er-Lu, Y). For both co-precipitation and Pechini methods, single-phase h-REFeO{sub 3} was obtained by shortening the heating time during calcination process. The hexagonal-to-orthorhombic phase transition took place by a nucleation growth mechanism and vermicular morphology of the thus-formed orthorhombic phase was observed. The hexagonal YbFeO{sub 3} had higher catalytic activity for C{sub 3}H{sub 8} combustion than orthorhombic YbFeO{sub 3}. - Graphical abstract: Although the synthesis of metastable hexagonal REFeO{sub 3} by the conventional method is difficult, we found that this phase is obtained by shortening the heating time of the precursor prepared by co-precipitation method. Highlights: Black-Right-Pointing-Pointer Synthesis of metastable REFeO{sub 3} with hexagonal structure by the co-precipitation method. Black-Right-Pointing-Pointer Hexagonal REFeO{sub 3} is obtained for the rare earth elements with small ionic radii. Black-Right-Pointing-Pointer Hexagonal-to-orthorhombic transformation of REFeO{sub 3}. Black-Right-Pointing-Pointer Catalytic activity of hexagonal REFeO{sub 3} for C{sub 3}H{sub 8} combustion.

Nishimura, Tatsuya [Department of Energy and Hydrocarbon Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Kyoto 615-8510 (Japan); Hosokawa, Saburo, E-mail: hosokawa@scl.kyoto-u.ac.jp [Department of Energy and Hydrocarbon Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Kyoto 615-8510 (Japan); Masuda, Yuichi; Wada, Kenji; Inoue, Masashi [Department of Energy and Hydrocarbon Chemistry, Graduate School of Engineering, Kyoto University, Katsura, Kyoto 615-8510 (Japan)

2013-01-15T23:59:59.000Z

411

Transportation External Coordination Working Group:  

Broader source: Energy.gov (indexed) [DOE]

Accomplishments and Future Accomplishments and Future Transportation External Coordination Working Group Meeting Phoenix, AZ Judith A. Holm, Office of National Transportation Office of Civilian Radioactive Waste Management April 4, 2005 TEC MEMBER ORGANIZATIONS American College of Emergency Physicians (ACEP) American Nuclear Society (ANS) Association of American Railroads (AAR) Brotherhood of Locomotive Engineers and Trainmen (BLET) Commercial Vehicle Safety Alliance (CVSA) Conference of Radiation Control Program Directors, Inc. (CRCPD) Council of Energy Resource Tribes (CERT) Council of State Governments-Eastern Regional Conference (CSG-ERC) Council of State Governments-Midwestern Office (CSG-MW) Council on Radionuclides and Radiopharmaceuticals (CORAR) Dangerous Goods Advisory Council (DGAC)

412

Transportation External Coordination Working Group:  

Broader source: Energy.gov (indexed) [DOE]

Study of Study of DOE FY03 SNF Shipments Judith Holm National Transportation Program Albuquerque, New Mexico April 21, 2004 Background Benchmarking * The goal of benchmarking is to identify, understand, and adapt outstanding practices from organizations anywhere in the world to help your organization improve its performance * Benchmarking looks outward to find best practice and high performance and then measures actual business operations against those goals Background Best Practices * Best practices are proven solutions that represent superior performance when adapted and implemented in one's own organization. This includes processes and procedures that others are using to transport radioactive materials Background Lessons Learned * Lessons learned are "good work practices" or

413

Transportation External Coordination Working Group:  

Broader source: Energy.gov (indexed) [DOE]

External Coordination External Coordination Working Group: Background and Process Judith Holm National Transportation Program Albuquerque, New Mexico April 21, 2004 TEC History * DOE's Office of Environmental Management (EM) and Office of Civilian Radioactive Waste Management (OCRWM) formed TEC in 1992 * EM & RW developed MOU and TEC charter in 1992 - Other DOE program offices joined in 1993-94 * Other agencies (DOT, FRA, NRC, EPA) have been active participants Meeting Locations 1992-present Some Founding Principles * TEC concept centered on unique stakeholder accountability principles - Participation by key responsible parties in technical/policy issue discussion and resolution results in increased confidence and more efficient business decisions * Ultimate goal: develop multi-year set of

414

QuarkNet at Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

QuarkNet at Work Information for Active Mentors & Teachers     QuarkNet Home - Information - Calendar - Contacts - Projects - Forms: EoI - Teachers Information Active Centers Calendar Contacts Expectations: for Teachers, for Mentors Information on Other Funding Sources Program Overview Support: for Teachers, for Centers Staff Job Description Activities Essential Practices - Teaching with Inquiry (word.doc) Classroom Activities e-Labs: CMS - Cosmic Ray Boot Camp Project Activities Databases: Data Entry (password only) 2012 Center Reporting Resources Important Findings from Previous Years Mentor Tips Associate Teacher Institute Toolkit Print Bibliography - Online Resources Imaging Detector Principles of Professionalism for Science Educators - NSTA position

415

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah,  

Broader source: Energy.gov (indexed) [DOE]

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 More Documents & Publications Final Report Phase II: Performance Evaluation of Permeable Reactive Barriers and Potential for Rejuvenation by Chemical Flushing Phase II: Performance Evaluation of Permeable Reactive Barriers and Potential for Rejuvenation by Chemical Flushing Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable

416

Solvent Tuning of Properties of Iron-Sulfur Clusters in Proteins  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Solvent Tuning of Properties of Solvent Tuning of Properties of Iron-Sulfur Clusters in Proteins Figure 1. Schematic repre-sentation of the common active-site iron-sulfur cluster structural motif. Proteins containing Fe4S4 iron-sulfur clusters are ubiquitous in nature and catalyze one-electron transfer processes. These proteins have evolved into two classes that have large differences in their electrochemical potentials: high potential iron-sulfur proteins (HiPIPs) and bacterial ferredoxins (Fds). The role of the surrounding protein environment in tuning the redox potential of these iron sulfur clusters has been a persistent puzzle in biological electron transfer [1]. Although HiPIPs and Fds have the same iron sulfur structural motif - a cubane-type structure - (Figure 1), there are large differences in their electrochemical

417

Method for the production of hydrocarbons using iron-carbon-based catalysts  

SciTech Connect (OSTI)

This patent describes a process for producing C/sub 2/+ aliphatic hydrocarbons from a CO and H/sub 2/ mixture comprising the step of contacting the mixture with a catalyst comprising finely divided nonpyrophoric iron-carbon catalyst particles comprising iron and carbon, in the substantial absence of silicon, a substantial portion of which is dementite, which was produced in a reaction zone in the presence of laser radiation under such conditions of laser flux density, power adsorption, concentration of iron compound reactants selected from the group consisting of iron carbonyls, iron acetylacetonate, and ferrocene, and pressure sufficient to produce non-pyrophoric iron-carbon particles having average diameters between 1 and 100 nm.

Rice, G.W.; Fiato, R.A.; Soled, S.L.

1988-11-29T23:59:59.000Z

418

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

16/03 16/03 | Shipments expected this week: ANL-E (2) , RFETS (11), SRS (6) | A weekly e-newsletter for the Waste Isolation Pilot Plant team October 16, 2003 The Big Story EM-6 to review WIPP baseline Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e-mail. WIPP Shipments (as of 10/16/03 at 7:05 a.m.) Shipments scheduled to arrive at WIPP this week 19 Total shipments received at WIPP 2,095 A team from the DOE Office of Project Management, EM-6, will be on site next week to review the WIPP baseline and the integration of that baseline with the National TRU

419

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3/03 3/03 | Shipments expected this week: RFETS (11), SRS (4), Hanford (2) | A weekly e-newsletter for the Waste Isolation Pilot Plant team October 23, 2003 Sealed sources: questions and answers Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e-mail. WIPP Shipments (as of 10/23/03 at 7:06 a.m.) Shipments scheduled to arrive at WIPP this week 17 Total shipments received at WIPP 2,115 Sealed sources have been a topic of discussion lately. Here are answers to some of the questions raised by this topic:

420

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Thursday, 9/11/03 | Total shipments received at WIPP: 2003 | Shipments expected this Thursday, 9/11/03 | Total shipments received at WIPP: 2003 | Shipments expected this A weekly e-newsletter for the Waste Isolation Pilot Plant team September 11, 2003 The Big Story 2003 in 2003 Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e-mail. WIPP Shipments (as of 9-11-03 at 10 a.m.) 21 Shipments scheduled to arrive at WIPP this week 2,003 Total shipments received at WIPP The 2003 rd waste shipment arrived at the WIPP site today (Thursday, September 11) from Hanford. It is highly fitting that

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9/04 9/04 Shipments expected this week: NTS (2), RFETS (13), SRS (6) January 29, 2004 The Big Story WTS restructures workforce Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e-mail. WIPP Shipments (as of 1/29/04 at 7:14 a.m.) Shipments scheduled to arrive at WIPP this week 21 Total shipments received at WIPP 2,309 Earlier this week WTS, the management and operating contractor at WIPP, announced a workforce restructuring plan to meet the current and future operational needs of the WIPP facility. It is anticipated

422

file://\\Bellview\TeamWorks\TRUTeamWorks.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Total shipments received at WIPP as of 8-25-03: 1,956 | Shipments expected this week: Hanford Total shipments received at WIPP as of 8-25-03: 1,956 | Shipments expected this week: Hanford A weekly e-newsletter for the Waste Isolation Pilot Plant team August 25, 2003 The Big Story INEEL drum fire and Senate Bill S. 1424: questions and answers Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e -mail. WIPP Shipments (as of 8-25-03) 19 Shipments scheduled to arrive at WIPP this week 1,956 Total shipments received at WIPP Some recent media coverage has created some confusion in the public about the

423

Electrochromic Glazings: How they Work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

How they Work How they Work Electrochromic glazings have great potential to improve the energy efficiency and occupant comfort afforded by architectural windows. These smart windows can dynamically control light transmission by windows in buildings, automobiles, and aircraft. Electrochromic glazings are the most significant members of a family of chromogenic light-control technologies that includes large-area dispersed liquid crystals, dispersed particle windows, and photochromic and thermochromic materials. Electrochromic devices represent the most versatile window technology of this type, exhibiting the best combination of switching properties for chromogenic window applications. Electrochromic glazings typically have a change in visible light transmission from 10% to 70%, moderately fast switching times, and low dc power consumption. These glazings have memory, so they only need power to make a change in transmission. Electrochromic technology can be coupled with smart control systems to give constant lighting levels, blending artificial lighting with daylighting for improved building energy efficiency. Energy simulations of office buildings indicate that smart windows with lighting controls in arid climates can provide 30-40% energy savings over conventional windows. Savings are realized in cooling, lighting, and peak utility electric loads. Other benefits include smaller heating, ventilating, and air-conditioning (HVAC) systems and greater thermal and visual comfort.

424

How the Artificial Retina Works  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the Artificial Retina Works the Artificial Retina Works Artificial Retina Diagram Normal vision begins when light enters and moves through the eye to strike specialized photoreceptor (light-receiving) cells in the retina called rods and cones. These cells convert light signals to electric impulses that are sent to the optic nerve and the brain. Retinal diseases like age-related macular degeneration and retinitis pigmentosa destroy vision by annihilating these cells. With the artificial retina device, a miniature camera mounted in eyeglasses captures images and wirelessly sends the information to a microprocessor (worn on a belt) that converts the data to an electronic signal and transmits it to a receiver on the eye. The receiver sends the signals through a tiny, thin cable to the microelectrode array, stimulating it to emit pulses. The artificial retina device thus bypasses defunct photoreceptor cells and transmits electrical signals directly to the retina's remaining viable cells. The pulses travel to the optic nerve and, ultimately, to the brain, which perceives patterns of light and dark spots corresponding to the electrodes stimulated. Patients learn to interpret these visual patterns.

425

Mixed Waste Working Group report  

SciTech Connect (OSTI)

The treatment of mixed waste remains one of this country`s most vexing environmental problems. Mixed waste is the combination of radioactive waste and hazardous waste, as defined by the Resource Conservation and Recovery Act (RCRA). The Department of Energy (DOE), as the country`s largest mixed waste generator, responsible for 95 percent of the Nation`s mixed waste volume, is now required to address a strict set of milestones under the Federal Facility Compliance Act of 1992. DOE`s earlier failure to adequately address the storage and treatment issues associated with mixed waste has led to a significant backlog of temporarily stored waste, significant quantities of buried waste, limited permanent disposal options, and inadequate treatment solutions. Between May and November of 1993, the Mixed Waste Working Group brought together stakeholders from around the Nation. Scientists, citizens, entrepreneurs, and bureaucrats convened in a series of forums to chart a course for accelerated testing of innovative mixed waste technologies. For the first time, a wide range of stakeholders were asked to examine new technologies that, if given the chance to be tested and evaluated, offer the prospect for better, safer, cheaper, and faster solutions to the mixed waste problem. In a matter of months, the Working Group has managed to bridge a gap between science and perception, engineer and citizen, and has developed a shared program for testing new technologies.

Not Available

1993-11-09T23:59:59.000Z

426

SEALING LARGE-DIAMETER CAST-IRON PIPE JOINTS UNDER LIVE CONDITIONS  

SciTech Connect (OSTI)

Utilities in the U.S. operate over 75,000 km (47,000 miles) of old cast-iron pipes for gas distribution. The bell-and-spigot joints that connect pipe sections together tend to leak as these pipes age. Current repair practices are costly and highly disruptive. The objective of this program is to design, test and commercialize a robotic system capable of sealing multiple cast-iron bell and spigot joints from a single pipe entry point. The proposed system will perform repairs while the pipe remains in service by traveling through the pipe, cleaning each joint surface, and installing a stainless-steel sleeve lined with an epoxy-impregnated felt across the joint. This approach will save considerable time and labor, avoid traffic disruption, and eliminate any requirement to interrupt service to customers (which would result in enormous expense to utilities). Technical challenges include: (1) repair sleeves must compensate for diametric variation and eccentricity of cast-iron pipes; (2) the assembly must travel long distances through pipes containing debris; (3) the pipe wall must be effectively cleaned in the immediate area of the joint to assure good bonding of the sleeve; and (4) an innovative bolt-on entry fitting is required to conduct repair operations on live mains. The development effort is divided into eleven tasks. Task 1 (Program Management) and Task 2 (Establishment of Detailed Design Specifications) were completed in prior quarters while Task 3 (Design and Fabricate Ratcheting Stainless-Steel Repair Sleeves) has progressed to installing prototype sleeves in cast-iron test pipe segments. Efforts in the current quarter continued to focus on Tasks 4-8. Highly valuable lessons were learned from field tests of the 4-inch gas pipe repair robot in cast-iron pipe at Public Service Electric & Gas. (These field tests were conducted and reported last quarter.) These tests identified several design issues which need to be implemented in both the small- and large-diameter repair robots for cast-iron pipe to assure their commercial success. For Task 4 (Design, Fabricate and Test Patch Setting Robotic Train), work has been directed on increasing the nitrogen bladder reservoir volume to allow at least two complete patch inflation/patch setting cycles in the event the sleeve does not set all ratchets in the same row on the first attempt. This problem was observed on a few of the repair sleeves that were recently installed during field tests with the small-diameter robotic system. For Task 5 (Design & Fabricate Pipe-Wall Cleaning Robot Train with Pan/Zoom/Tilt Camera), the recent field tests showed clearly that, in mains with low gas velocities, it will be necessary to improve the system's capacity to remove debris from the immediate vicinity of the bell and spigot joints. Otherwise, material removed by the cleaning flails (the flails were found to be very effective in cleaning bell and spigot joints) falls directly to the low side of the pipe and accumulates in a pile. This accumulation can prevent the sleeve from achieving a leak-free repair. Similarly, it is also deemed necessary to design an assembly to capture existing service-tap coupons and allow their removal from the inside of the pipe. These coupons were found to cause difficulty in launching and retrieving the small pipe repair robot; for example, one coupon lodged beneath the end of the guide shoe. Designs for new features to accomplish these goals for the large robotic system were pursued and are presented in this report. Task 6 (Design & Build Surface Control and Monitoring System) was previously completed with the control and computer display functions being operated through LabVIEW. However, this must now be revisited to add control routines for the coupon catcher to be added. This will most likely include a lift-off/place-on magnet translation function. Task 7 (Design & Fabricate Large Diameter Live Access System) progressed to completing the detailed design of the entry fitting for 12-inch diameter cast iron pipe in the previous quarter. Field tests with the 4-inch

Kiran M. Kothari; Gerard T. Pittard

2005-01-01T23:59:59.000Z

427

THE ROLE OF FERRIC IRON UPTAKE REGULATOR (FUR) PROTEIN ON IRON REGULATION IN COXIELLA BURNETII  

E-Print Network [OSTI]

;TCGTTTCCCTTCAGTCGCTG#7;#7;CBU2012 forward#7;CGAAGAACTGGATAGCGAAAG#7;#7; Beta-Galactosidase Assay C loned plasmids were electroporated into either BN4020 pMH15 or BN4020 pNP104 electrocompetent cells to form two plasmid heterolo ssay was performed...;#7;pMH15#7;pACYC184 with E. coli fur#7;#7;#7;pBlue TOPO#7;TA cloning vector, promoter trap#7;Invitrogen#7;#7;pNP104#7;pACYC184 with complete C. burnetii fur#7;This work#7;#7;BN4020#7;E. coli fur deletion strain#7;This work#7;#7; Table 2. List of all...

Wilson, Mary J

2006-08-16T23:59:59.000Z

428

E-Print Network 3.0 - arsenic rich iron Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 Processes conducive to the release and transport of arsenic into aquifers of Bangladesh Summary: then by reductive dissolution of iron and arsenic during the ensuing...

429

Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Charge Dosage Rate  

E-Print Network [OSTI]

iron-? containing adsorbents for arsenic removal. arsenate-selective adsorbent. [29] Electrochemical Reactorsof pre-synthesized HFO adsorbent (ps-HFO; i.e. HFO that was

Amrose, Susan E.

2014-01-01T23:59:59.000Z

430

E-Print Network 3.0 - advanced iron aluminide-clad Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Molecular to Field Scale Uranium... , Arsenic, and Iron Biogeochemistry at Abandoned Mining Sites Abandoned Uranium Mine Tailings in Harding Source: Borch, Thomas - Department...

431

E-Print Network 3.0 - assessing iron stores Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stored iron in the cells was utilized and its concentration decreased (Fig. 6). By late exponential phase... was assessed (Supplemental Table II). Figure 6. ... Source: Pakrasi,...

432

E-Print Network 3.0 - anaerobically corroding iron Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

This publication provides a general overview of anaero- Summary: . Scrubbing the biogas with iron-impregnated wood chips has been used in anaerobic digesters in municipal......

433

Layer-By-Layer Assembled Hybrid Film of Carbon Nanotubes/Iron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

By-Layer Assembled Hybrid Film of Carbon NanotubesIron Oxide Nanocrystals for Reagentless Electrochemical Detection of Layer-By-Layer Assembled Hybrid Film of Carbon Nanotubes...

434

Synthesis of the H-Cluster Framework of Iron-Only Hydrogenase...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for hydrogen production or uptake, pertinent to energy transduction technology and a hydrogen economy. Herein we report the assembly of the first materials with di-iron...

435

Promotion of atherogenesis by copper or iron-Which is more likely?  

SciTech Connect (OSTI)

Iron levels increase in atherosclerotic lesions in cholesterol fed-rabbits and play a role in atherosclerosis. We investigated whether copper also rises. Male New Zealand White rabbits were fed high-cholesterol diets for 8 weeks. After sacrifice, lesion sizes were determined, and elemental analyses of the lesion and unaffected artery wall performed using nuclear microscopy. Unlike iron, lesion copper is decreased by about half compared with the unaffected artery wall, and much less copper than iron is present. Our data suggest that iron may be more likely to play a role in the promotion of atherosclerosis than copper.

Rajendran, Reshmi [Centre for Ion Beam Applications, Department of Physics, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Department of Biochemistry, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Ren, Minqin [Centre for Ion Beam Applications, Department of Physics, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Ning, Pan [Department of Biochemistry, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Tan Kwong Huat, Benny [Department of Pharmacology, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Halliwell, Barry [Department of Biochemistry, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore)]. E-mail: bchbh@nus.edu.sg; Watt, Frank [Centre for Ion Beam Applications, Department of Physics, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore)

2007-02-02T23:59:59.000Z

436

Contribution of Iron-Reducing Bacteria to Mercury Methylation in Marine Sediments  

E-Print Network [OSTI]

in continental margin sediments off central Chile. Limnologyof microbial iron reduction in sediments of the Baltic-Northreducing bacteria from sediments of an acid stressed lake.

Fleming, Emily J.; Nelson, D C

2006-01-01T23:59:59.000Z

437

E-Print Network 3.0 - approved iron nanoparticles Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Standards and Technology (NIST), Materials Reliability Division Collection: Materials Science 2 Synthesis of Monodisperse Biotinylated p(NIPAAm)-Coated Iron Oxide Magnetic...

438

ORNL scientists uncover clues to role of magnetism in iron-based...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Media Relations (865) 574-7308 ORNL scientists uncover clues to role of magnetism in iron-based superconductors Oak Ridge National Laboratory scientists used scanning...

439

Quantification of liver iron content with CTadded value of dual-energy  

Science Journals Connector (OSTI)

To evaluate the value of dual-energy CT (DECT) with use of an ... decomposition algorithm for the quantification of liver iron content (LIC).

Michael A. Fischer; Caecilia S. Reiner; Dimitri Raptis; Olivio Donati

2011-08-01T23:59:59.000Z

440

FACTORS CONTROLLING SYNTHESIS OF IRON OXIDE NANOPARTICLES AND THE EFFECT OF SURFACE CHARGE ON MAGNETIC HYPERTHERMIA.  

E-Print Network [OSTI]

??ABSTRACT Iron oxide nanoparticles (IONPs) have been widely studied in the theranostics application due to their promising magnetic properties, low cytotoxicity and attractive biocompatibility. Despite (more)

Qi, Bin

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Iron oxide nanoparticle-based theranostics for cancer imaging and therapy  

Science Journals Connector (OSTI)

Theranostic platform, which is equipped with both diagnostic and therapeutic functions, is a promising approach in cancer treatment. From various nanotheranostics studied, iron oxide nanoparticles have advantages...

Xiaoqing Ren; Hongwei Chen; Victor Yang

2014-09-01T23:59:59.000Z

442

Preservation of iron(II) by carbon-rich matrices in a hydrothermal plume  

SciTech Connect (OSTI)

Hydrothermal venting associated with mid-ocean ridge volcanism is globally widespread. This venting is responsible for a dissolved iron flux to the ocean that is approximately equal to that associated with continental riverine runoff. For hydrothermal fluxes, it has long been assumed that most of the iron entering the oceans is precipitated in inorganic forms. However, the possibility of globally significant fluxes of iron escaping these mass precipitation events and entering open-ocean cycles is now being debated, and two recent studies suggest that dissolved organic ligands might influence the fate of hydrothermally vented metals. Here we present spectromicroscopic measurements of iron and carbon in hydrothermal plume particles at the East Pacific Rise mid-ocean ridge. We show that organic carbon-rich matrices, containing evenly dispersed iron(II)-rich materials, are pervasive in hydrothermal plume particles. The absence of discrete iron(II) particles suggests that the carbon and iron associate through sorption or complexation. We suggest that these carbon matrices stabilize iron(II) released from hydrothermal vents in the region, preventing its oxidation and/or precipitation as insoluble minerals. Our findings have implications for deep-sea biogeochemical cycling of iron, a widely recognized limiting nutrient in the oceans.

Toner, Brandy M.; Fakra, Sirine C.; Manganini, Steven J.; Santelli, Cara M.; Marcus, Matthew A.; Moffett, James W.; Rouxel, Olivier; German, Christopher R.; Edwards, Katrina J.

2008-09-20T23:59:59.000Z

443

Effect of PCI blending on combustion characteristics for iron-making.  

E-Print Network [OSTI]

??The PCI technology is well established for reducing the consumption of economic and environmentally expensive coke in blast furnace iron-making. Often, coal blends show unexpected (more)

Gill, Trilochan Singh

2009-01-01T23:59:59.000Z

444

Effect of copper and iron on the oxidative flavor deterioration of ice cream  

E-Print Network [OSTI]

for the degree of "ASTER CP SCIENCE Jhnuary I~ Nc )or Sub)catt Dairy &~actures EFFECT GF COFFER ARD IRON CR Tlm OXIDATIVE FLAVOR DETKRI/Z'TJ ' CF ICE CRE//P A Thesis Pi? Pbdul Hasid 'Pish Approved as to style and content by: I /'i'I /' ' / , r... Archihald (2? 3) reported results cf cariiar studies on the effect oi' feed and added coppex' or iron or. the coppex' and iron content of milk. Cn tne lamia of these earlier ?tudiss the effect of feeding supplemental copper and iron on the copper...

Miah, Md. Abdul Hamid

1961-01-01T23:59:59.000Z

445

Advances in Glass Formulations for Hanford High-Aluminum, High-Iron and Enhanced Sulphate Management in HLW Streams - 13000  

SciTech Connect (OSTI)

The current estimates and glass formulation efforts have been conservative in terms of achievable waste loadings. These formulations have been specified to ensure that the glasses are homogenous, contain essentially no crystalline phases, are processable in joule-heated, ceramic-lined melters and meet Hanford Tank Waste Treatment and Immobilization Plant (WTP) Contract terms. The WTP's overall mission will require the immobilization of tank waste compositions that are dominated by mixtures of aluminum (Al), chromium (Cr), bismuth (Bi), iron (Fe), phosphorous (P), zirconium (Zr), and sulphur (S) compounds as waste-limiting components. Glass compositions for these waste mixtures have been developed based upon previous experience and current glass property models. Recently, DOE has initiated a testing program to develop and characterize HLW glasses with higher waste loadings and higher throughput efficiencies. Results of this work have demonstrated the feasibility of increases in waste loading from about 25 wt% to 33-50 wt% (based on oxide loading) in the glass depending on the waste stream. In view of the importance of aluminum limited waste streams at Hanford (and also Savannah River), the ability to achieve high waste loadings without adversely impacting melt rates has the potential for enormous cost savings from reductions in canister count and the potential for schedule acceleration. Consequently, the potential return on the investment made in the development of these enhancements is extremely favorable. Glass composition development for one of the latest Hanford HLW projected compositions with sulphate concentrations high enough to limit waste loading have been successfully tested and show tolerance for previously unreported tolerance for sulphate. Though a significant increase in waste loading for high-iron wastes has been achieved, the magnitude of the increase is not as substantial as those achieved for high-aluminum, high-chromium, high-bismuth or sulphur. Waste processing rate increases for high-iron streams as a combined effect of higher waste loadings and higher melt rates resulting from new formulations have been achieved. (author)

Kruger, Albert A. [WTP Engineering Division, United States Department of Energy, Office of River Protection, Post Office Box 450, Richland, Washington 99352 (United States)] [WTP Engineering Division, United States Department of Energy, Office of River Protection, Post Office Box 450, Richland, Washington 99352 (United States)

2013-07-01T23:59:59.000Z

446

Advances in Glass Formulations for Hanford High-Alumimum, High-Iron and Enhanced Sulphate Management in HLW Streams - 13000  

SciTech Connect (OSTI)

The current estimates and glass formulation efforts have been conservative in terms of achievable waste loadings. These formulations have been specified to ensure that the glasses are homogenous, contain essentially no crystalline phases, are processable in joule-heated, ceramic-lined melters and meet Hanford Tank Waste Treatment and Immobilization Plant (WTP) Contract terms. The WTP?s overall mission will require the immobilization of tank waste compositions that are dominated by mixtures of aluminum (Al), chromium (Cr), bismuth (Bi), iron (Fe), phosphorous (P), zirconium (Zr), and sulphur (S) compounds as waste-limiting components. Glass compositions for these waste mixtures have been developed based upon previous experience and current glass property models. Recently, DOE has initiated a testing program to develop and characterize HLW glasses with higher waste loadings and higher throughput efficiencies. Results of this work have demonstrated the feasibility of increases in waste loading from about 25 wt% to 33-50 wt% (based on oxide loading) in the glass depending on the waste stream. In view of the importance of aluminum limited waste streams at Hanford (and also Savannah River), the ability to achieve high waste loadings without adversely impacting melt rates has the potential for enormous cost savings from reductions in canister count and the potential for schedule acceleration. Consequently, the potential return on the investment made in the development of these enhancements is extremely favorable. Glass composition development for one of the latest Hanford HLW projected compositions with sulphate concentrations high enough to limit waste loading have been successfully tested and show tolerance for previously unreported tolerance for sulphate. Though a significant increase in waste loading for high-iron wastes has been achieved, the magnitude of the increase is not as substantial as those achieved for high-aluminum, high-chromium, high-bismuth or sulphur. Waste processing rate increases for high-iron streams as a combined effect of higher waste loadings and higher melt rates resulting from new formulations have been achieved.

Kruger, Albert A.

2013-01-16T23:59:59.000Z

447

Toolbox Safety Talk Articulating Boom Work Platforms  

E-Print Network [OSTI]

Toolbox Safety Talk Articulating Boom Work Platforms Environmental Health & Safety Facilities sign-in sheet to Environmental Health & Safety for recordkeeping. Articulating boom work platforms Articulating Boom Work Platforms Environmental Health & Safety Facilities Safety & Health Section 395 Pine Tree

Pawlowski, Wojtek

448

How Fuel Cells Work | Department of Energy  

Energy Savers [EERE]

Fuel Cells Work How Energy Works 30 likes How Fuel Cells Work Fuel cells produce electrical power without any combustion and operate on fuels like hydrogen, natural gas and...

449

Covariance evaluation work at LANL  

SciTech Connect (OSTI)

Los Alamos evaluates covariances for nuclear data library, mainly for actinides above the resonance regions and light elements in the enUre energy range. We also develop techniques to evaluate the covariance data, like Bayesian and least-squares fitting methods, which are important to explore the uncertainty information on different types of physical quantities such as elastic scattering angular distribution, or prompt neutron fission spectra. This paper summarizes our current activities of the covariance evaluation work at LANL, including the actinide and light element data mainly for the criticality safety study and transmutation technology. The Bayesian method based on the Kalman filter technique, which combines uncertainties in the theoretical model and experimental data, is discussed.

Kawano, Toshihiko [Los Alamos National Laboratory; Talou, Patrick [Los Alamos National Laboratory; Young, Phillip [Los Alamos National Laboratory; Hale, Gerald [Los Alamos National Laboratory; Chadwick, M B [Los Alamos National Laboratory; Little, R C [Los Alamos National Laboratory

2008-01-01T23:59:59.000Z

450

Isotope Work at Oak Ridge  

Science Journals Connector (OSTI)

The special training division of the Oak Ridge Institute of Nuclear Studies has announced that three additional courses in the techniques of using radioisotopes in research have been scheduled during the winter and spring of 1951. They are to be held from January 8th to February 2nd from February 19th to March 16th and from April 16th to May 11th. Designed to acquaint research workers with the safe and efficient use of radioisotopes the courses include laboratory work lectures and special?topic seminars. Experiments cover such matters as the use and calibration of instruments purification and separation of radioactive materials from inert and other radioactive materials and pile activation technology. The seminars cover various biological and medical uses of radioisotopes and the design of radiochemical laboratories.

C. P. Keim; H. W. Savage; Boyd Weaver

1951-01-01T23:59:59.000Z

451

Chemical classification of iron meteoritesIX. A new group (IIF), revision of IAB and IIICD, and data on 57 additional irons  

Science Journals Connector (OSTI)

Structural observations and concentrations of Ni, Ga, Ge and Ir allow the classification of 57 iron meteorites in addition to those described in the previous papers in this series; the number of classified independent iron meteorites is now 535. INAA for an additional six elements indicates that five previously studied irons having very high GeGa ratios are compositionally closely related and can be gathered together as group IIF. A previously unstudied iron, Dehesa, has the highest GeGa ratio known in an iron meteorite, a ratio 18 higher than that in CI chondrites. Although such high GeGa ratios are found in the metal grains of oxidized unequilibrated chondrites, their preservation during core formation requires disequilibrium melting or significant compositional and temperature effects on metal/silicate distribution constants and/or activity coefficients. In terms of GeGa ratios and various other properties group IIF shows genetic links to the Eagle Station pallasites and COCV chondrites. Klamath Falls is a new high-Ni, low-Ir member of group IIIF that extends the concentration ranges in this group and makes these comparable to the ranges in large igneous groups such as IIIAB. Groups IAB and IIICD have been revised to extend the lower Ni boundary of group IIICD down to 62 mg/g. The iron having by far the highest known Ni concentration (585 mg/g), Oktibbeha County, is a member of group IAB and extends the concentration ranges of all elements in this nonmagmatic group. Morasko, a IAB iron associated with a crater field in Poland, is paired with the Seelsgen iron discovered 100 km away. All explosion craters from which meteorites have been recovered were produced by IAB and IIIAB irons.

Alfred Kracher; John Willis; John T Wasson

1980-01-01T23:59:59.000Z

452

http://bellview/TeamWorks/TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

9/03 | Shipments expected this week: Hanford (1), RFETS (11), SRS (6) | 9/03 | Shipments expected this week: Hanford (1), RFETS (11), SRS (6) | A weekly e-newsletter for the Waste Isolation Pilot Plant team October 9, 2003 The Big Story It's a whole new "WIPP Experience" Topics Characterization News Transportation News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e- mail. WIPP Shipments (as of 10/9/03 at 7:24 a.m.) Shipments scheduled to arrive at WIPP this week 18 Total shipments received at WIPP 2,081 If you haven't been to the SWB lately, you are in for a big surprise. The lobby sports a new look these days, complete with banners and updated exhibits. And the new look isn't just

453

file://\\Bellview\TeamWorks\TRUTeamWorks.htm  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

30/03 Shipments expected this week: RFETS (11), SRS (4), Hanford (2) 30/03 Shipments expected this week: RFETS (11), SRS (4), Hanford (2) A weekly e-newsletter for the Waste Isolation Pilot Plant team October 30, 2003 ARROW-PAK Topics Characterization News Transportation News Disposal News Safety News Working Smart Announcements Our Team Tools Acronym List Archives Back to Main Page WIPP Home Page Links Feedback Contact us with feedback or submit your e-mail address for updates. Click here to e- mail. WIPP Shipments (as of 10/30/03 at 6:59 a.m.) Shipments scheduled to arrive at WIPP this week 17 Total shipments received at WIPP 2,129 You've heard of the TRUPACT-II, the pipe overpack, the RH-72B and even the 10- 160B. But have you heard about the ARROW-PAK? ARROW-PAK is a transportation container designed to contain and transport high-wattage TRU waste.

454

Fuel Cell Technologies Office: Catalysis Working Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Catalysis Working Catalysis Working Group to someone by E-mail Share Fuel Cell Technologies Office: Catalysis Working Group on Facebook Tweet about Fuel Cell Technologies Office: Catalysis Working Group on Twitter Bookmark Fuel Cell Technologies Office: Catalysis Working Group on Google Bookmark Fuel Cell Technologies Office: Catalysis Working Group on Delicious Rank Fuel Cell Technologies Office: Catalysis Working Group on Digg Find More places to share Fuel Cell Technologies Office: Catalysis Working Group on AddThis.com... Key Activities Plans, Implementation, & Results Accomplishments Organization Chart & Contacts Quick Links Hydrogen Production Hydrogen Delivery Hydrogen Storage Fuel Cells Technology Validation Manufacturing Codes & Standards Education Systems Analysis

455

How Distributed Wind Works | Department of Energy  

Energy Savers [EERE]

Basics How Distributed Wind Works How Distributed Wind Works Residential Small wind turbines can be used in residential settings to directly offset electricity usage using net...

456

Transportation Protocols Working Group First Conference Call...  

Broader source: Energy.gov (indexed) [DOE]

Call March 1, 1999 Conference Call Summary The first conference call of the Transportation External Coordination Working Group (TECWG) DOE Transportation Protocols Working...

457

Working at EERE | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Employment Opportunities Working at EERE Working at EERE As a model employer and diversityinclusion leader, we treat people as our greatest asset at the Office of Energy...

458

Three small businesses selected for environmental work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

work Three small businesses selected for environmental work ARS Cavanagh Environmental Services, LLC; Portage, Inc.; and Navarro Research & Engineering, Inc. awarded a master...

459

Earth Day event showcases LANL energy work  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Earth Day showcases energy work Earth Day event showcases LANL energy work The public is invited to learn about projects in energy conservation, generation, research, and...

460

Training Work Group Charter | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Charter Training Work Group Charter The Training Work Group fosters improvements in the quality, efficacy, and delivery of DOE safety training, and realizes significant...

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

California Working Natural Gas Underground Storage Capacity ...  

Gasoline and Diesel Fuel Update (EIA)

Working Natural Gas Underground Storage Capacity (Million Cubic Feet) California Working Natural Gas Underground Storage Capacity (Million Cubic Feet) Year Jan Feb Mar Apr May Jun...

462

California Working Natural Gas Underground Storage Capacity ...  

U.S. Energy Information Administration (EIA) Indexed Site

Working Natural Gas Underground Storage Capacity (Million Cubic Feet) California Working Natural Gas Underground Storage Capacity (Million Cubic Feet) Decade Year-0 Year-1 Year-2...

463

Working with CFTF | ornl.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

CFTF Working with CFTF CFTF | Carbon Fiber Technology Facility Home | User Facilities | CFTF | Working with CFTF SHARE Low-Cost Carbon Fiber Available to US Manufacturers for...

464

Federal Utility Partnership Working Group Utility Partners  

Broader source: Energy.gov [DOE]

Federal Utility Partnership Working Group (FUPWG) utility partners are eager to work closely with Federal agencies to help achieve energy management goals.

465

Chemically Reactive Working Fluids | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Chemically Reactive Working Fluids for the Capture and Transport of Concentrated Solar Thermal Energy for Power Generation Chemically Reactive Working Fluids SunShot CSP...

466

NREL: Water Power Research - Working with Us  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Working with Us NREL works with industry in a public-private contracting environment to research, design, and build advanced water power technologies. NREL's National Wind...

467

Work Schedules | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

job performance, improve morale and help reduce work-related stress, as well as reduce air pollution and traffic congestion. Participation in either the alternate work schedule...

468

Phosphate influences cycling of iron and carbon in the environment |  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Science Science Computing, Environment & Life Sciences Energy Engineering & Systems Analysis Photon Sciences Physical Sciences & Engineering Energy Frontier Research Centers Science Highlights Postdoctoral Researchers Phosphate influences cycling of iron and carbon in the environment August 30, 2013 Tweet EmailPrint Aquatic and terrestrial environments are dynamic systems where coupled microbiological, geochemical, and hydrological processes define the complex interactions that drive the biogeochemical cycling of water and the major and minor elements. Therefore, a thorough understanding of these complex interactions is critical for predicting the biogeochemical cycling of carbon, nutrients, heavy metals, radionuclides, and other contaminants; managing water quality; and understanding the interactions between

469

Iron catalyst for preparation of polymethylene from synthesis gas  

DOE Patents [OSTI]

This invention relates to a process for synthesizing hydrocarbons; more particularly, the invention relates to a process for synthesizing long-chain hydrocarbons known as polymethylene from carbon monoxide and hydrogen or from carbon monoxide and water or mixtures thereof in the presence of a catalyst comprising iron and platinum or palladium or mixtures thereof which may be supported on a solid material, preferably an inorganic refractory oxide. This process may be used to convert a cabon monoxide containing gas to a product which could substitute for high density polyethylene.

Sapienza, Richard S. (Shoreham, NY); Slegeir, William A. (Hampton Bays, NY)

1990-01-01T23:59:59.000Z

470

Corrosion of Iron Stainless Steels in Molten Nitrate Salt  

Science Journals Connector (OSTI)

Abstract Energy storage for concentrating solar power (CSP) is a major area of research that seeks to lower the levelized cost of electricity within the aggressive SunShot goals of 6/kW-hrth[13]. One viable approach is sensible thermal energy storage (TES), which currently utilizes molten nitrate binary salt, stored at 575C in the hot tank of a two tank system [4,5]. Increasing the temperature limit within the hot tank requires a detailed understanding of materials corrosion behavior, in addition to salt thermal stability properties. High temperature nickel based alloys are the logical choice for strength and corrosion resistance as elevated temperatures will increase corrosion kinetics, however, the cost of nickel based alloys are nearly four times more expensive than iron based steels [6]. For this reason iron based stainless steels, specifically 321SS and 347SS (nominally Fe-17Cr-9Ni), were chosen for investigation at several temperatures in nitrate salt. 316SS, an elementally similar alloy, was susceptible to stress corrosion cracking while tested at Solar Two [4]. It was suggested that alloys with stabilizing additions of niobium (347SS) or titanium (321SS) would mitigate this deleterious behavior. Flat coupon samples were immersed in binary nitrate salts at temperatures of 400, 500, 600, and 680C, with air sparging on all tests. Samples were nominally removed at intervals of 500, 1000, 2000, and 3000hours to acquire data on time varying weight gain information while simultaneously employing metallography to identify corrosion mechanisms occurring within the melt. Corrosion rates varied dramatically with temperature according to an Arrhenius-type behavior. 347SS and 321SS had very little oxidation for 400 and 500C, indicative of a protective corrosion scale and low corrosion kinetics. Data at 600C showed that 321SS tended toward linear oxidation behavior based on oxide spallation which was observed on the samples upon removal. Corrosion products at 500C had phases of iron oxide, with obvious chromium depletion as observed in energy dispersive spectroscopy (EDS) scans. 600C corrosion layers were primarily iron oxide with obvious phases of sodium ferrite on the outer surface. 680C marked an excessive rate of corrosion with metal loss in both alloys.

Alan Kruizenga; David Gill

2014-01-01T23:59:59.000Z

471

New iron catalyst for preparation of polymethylene from synthesis gas  

DOE Patents [OSTI]

This invention relates to a process for synthesizing hydrocarbons; more particularly, the invention relates to a process for synthesizing long-chain hydrocarbons known as polymethylene from carbon monoxide and hydrogen or from carbon monoxide and water or mixtures thereof in the presence of a catalyst comprising iron and platinum or palladium or mixtures thereof which may be supported on a solid material, preferably an inorganic refractory oxide. This process may be used to convert a carbon monoxide containing gas to a product which could substitute for high density polyethylene.

Sapienza, R.S.; Slegeir, W.A.

1988-03-31T23:59:59.000Z

472

Degradation of polychlorinated biphenyls (PCBs) using palladized iron  

SciTech Connect (OSTI)

Contamination from polychlorinated biphenyls (PCBs) is a persistent problem within the Department of Energy complex, as well as in numerous industrial sites around the US. To date, commercially available technologies for destroying these highly stable compounds involve degradation at elevated temperatures either through incineration or base-catalyzed dehalogenation at 300{degrees}C. Since the heating required with these processes substantially increases the costs for treatment of PCB-contaminated wastes, there is a need for finding an alternative approach where PCB can be degraded at ambient temperatures. This report describes the degradation of PCB`s utilizing the bimetallic substrate of iron/palladium.

West, O.R.; Liang, L.; Holden, W.L. [and others

1996-06-01T23:59:59.000Z

473

Chemistry and Electronic Structure of Iron-Based Superconductors  

SciTech Connect (OSTI)

The solid state provides a richly varied fabric for intertwining chemical bonding, electronic structure, and magnetism. The discovery of superconductivity in iron pnictides and chalcogenides has revealed new aspects of this interplay, especially involving magnetism and superconductivity. Moreover, it has challenged prior thinking about high-temperature superconductivity by providing a set of materials that differ in many crucial aspects from the previously known cuprate superconductors. Here we review some of what is known about the superconductivity and its interplay with magnetism, chemistry, and electronic structure in Fe-based superconductors.

Safa-Sefat, Athena [ORNL; Singh, David J [ORNL

2011-01-01T23:59:59.000Z

474

The iron reduction ability of various rose rootstocks  

E-Print Network [OSTI]

's (Hoagland and Amon 1950) solution, without iron and with NO3 as the nitrogen source (see Appendix 2 for recipe). Solution pH was adjusted with 1N NaOH to 6. 3. All solutions were well aerated with a powerhead air/circulation pump (venturi type Rolf C... with six different Fe +EDTA solutions at the following concentrations: 0, 0. 05, 1, 4, 8, and 48 pM Fe +EDTA (0 to 2. 78 mg liter ). Plants were aerated with a powerhead venturi type air/circulation pump (Rolf C. Hagen Corp, Mansfield MA) to insure...

McDonald, Garry Vernon

2012-06-07T23:59:59.000Z

475

Atomic-Scale Design of Iron Fischer-Tropsch Catalysts: A Combined Computational Chemistry, Experimental, and Microkinetic Modeling Approach  

SciTech Connect (OSTI)

Work continued on the development of a microkinetic model of Fischer-Tropsch synthesis (FTS) on supported and unsupported Fe catalysts. The following aspects of the FT mechanism on unsupported iron catalysts were investigated on during this third year: (1) the collection of rate data in a Berty CSTR reactor based on sequential design of experiments; (2) CO adsorption and CO-TPD for obtaining the heat of adsorption of CO on polycrystalline iron; and (3) isothermal hydrogenation (IH) after Fischer Tropsch reaction to identify and quantify surface carbonaceous species. Rates of C{sub 2+} formation on unsupported iron catalysts at 220 C and 20 atm correlated well to a Langmuir-Hinshelwood type expression, derived assuming carbon hydrogenation to CH and OH recombination to water to be rate-determining steps. From desorption of molecularly adsorbed CO at different temperatures the heat of adsorption of CO on polycrystalline iron was determined to be 100 kJ/mol. Amounts and types of carbonaceous species formed after FT reaction for 5-10 minutes at 150, 175, 200 and 285 C vary significantly with temperature. Mr. Brian Critchfield completed his M.S. thesis work on a statistically designed study of the kinetics of FTS on 20% Fe/alumina. Preparation of a paper describing this work is in progress. Results of these studies were reported at the Annual Meeting of the Western States Catalysis and at the San Francisco AIChE meeting. In the coming period, studies will focus on quantitative determination of the rates of kinetically-relevant elementary steps on unsupported Fe catalysts with/without K and Pt promoters by SSITKA method. This study will help us to (1) understand effects of promoter and support on elementary kinetic parameters and (2) build a microkinetics model for FTS on iron. Calculations using periodic, self-consistent Density Functional Theory (DFT) methods were performed on models of defected Fe surfaces, most significantly the stepped Fe(211) surface. Binding Energies (BE's), preferred adsorption sites and geometries of all the FTS relevant stable species and intermediates were evaluated. Each elementary step of our reaction model was fully characterized with respect to its thermochemistry and comparisons between the stepped Fe(211) facet and the most-stable Fe(110) facet were established. In most cases the BE's on Fe(211) reflected the trends observed earlier on Fe(110), yet there were significant variations imposed on the underlying trends. Vibrational frequencies were evaluated for the preferred adsorption configurations of each species with the aim of evaluating the entropy-changes and preexponential factors for each elementary step. Kinetic studies were performed for the early steps of FTS (up to CH{sub 4} formation) and CO dissociation. This involved evaluation of the Minimum Energy Pathway (MEP) and activation energy barrier for the steps involved. We concluded that Fe(211) would allow for far more facile CO dissociation in comparison to other Fe catalysts studied so far, but the other FTS steps studied remained mostly unchanged.

Manos Mavrikakis; James A. Dumesic; Rahul P. Nabar

2006-09-29T23:59:59.000Z

476

Working Memory Overload: Fronto-Limbic Interactions and Effects on Subsequent Working Memory Function  

E-Print Network [OSTI]

involvement in human working memory. Neuroimage, 5(1), 49constraints in working memory as revealed by function- alin a nonspatial working memory task with functional MRI.

Yun, Richard J.; Krystal, John H.; Mathalon, Daniel H.

2010-01-01T23:59:59.000Z

477

Performance of a low-cost iron ore as an oxygen carrier for Chemical Looping Combustion of gaseous fuels  

Science Journals Connector (OSTI)

Abstract This work evaluates the performance of an iron ore, mainly composed of Fe2O3, as an oxygen carrier (OC) for Chemical Looping Combustion (CLC) with gaseous fuels. The OC was characterized by TGA and evaluated in a continuous 500Wth CLC unit, using CH4, syngas and a PSA off-gas as fuels. The OC was able to fully convert syngas at 880C. However, lower conversion rates were observed with methane-containing fuels. The addition of a Ni-based OC was evaluated in order to increase the reactivity of the OC with methane. In spite of this, an absence of catalytic effect was observed for the Ni-based OC. A deep analysis was carried out into the reasons for the absence of catalytic effect of the Ni-based OC. The performance of the iron ore with regard to attrition and fluidization behaviour was satisfactory throughout 50h of hot operation in the continuous CLC plant. Thus, this low cost material is a suitable OC for gaseous fuels mainly composed of H2 and CO.

Miguel A. Pans; Pilar Gayn; Luis F. de Diego; Francisco Garca-Labiano; Alberto Abad; Juan Adnez.

2014-01-01T23:59:59.000Z

478

Quality Work Plan Inspection and Monitoring Requirement  

Broader source: Energy.gov [DOE]

Inspection and monitoring requirements for Weatherization Assistance Program's comprehensive Quality Work Plan.

479

Work Force Planning for Public Power Utilities  

E-Print Network [OSTI]

Work Force Planning for Public Power Utilities: Ensuring Resources to Meet Projected Utilities Need to Do More to Prepare for Their Future Work Force Needs.............................................................................20 #12;ii Work Force Planning for Public Power Utilities #12;1 Work Force Planning for Public Power

480

Fuel Cell Technologies Office: Photoelectrochemical Working Group  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

About About Printable Version Share this resource Send a link to Fuel Cell Technologies Office: Photoelectrochemical Working Group to someone by E-mail Share Fuel Cell Technologies Office: Photoelectrochemical Working Group on Facebook Tweet about Fuel Cell Technologies Office: Photoelectrochemical Working Group on Twitter Bookmark Fuel Cell Technologies Office: Photoelectrochemical Working Group on Google Bookmark Fuel Cell Technologies Office: Photoelectrochemical Working Group on Delicious Rank Fuel Cell Technologies Office: Photoelectrochemical Working Group on Digg Find More places to share Fuel Cell Technologies Office: Photoelectrochemical Working Group on AddThis.com... Key Activities Plans, Implementation, & Results Accomplishments Organization Chart & Contacts

Note: This page contains sample records for the topic "iron works fw" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

NREL: Distributed Grid Integration - Working with Us  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Working with Us Working with Us NREL's electric infrastructure systems research involves industry, academia, other national laboratories, and various standards organizations through collaborative work and the use of our facilities. Collaborative Work To engage in collaborative work for NREL's distributed energy integration systems, you can: Work with NREL through Cooperative Research and Development Agreements (CRADAs). This is the most widely used means of industrial collaboration. Participate in subcontracted research. More than half of NREL's budget supports DOE-directed research conducted by large and small private companies, universities, research institutes, and consultants. Pay NREL to conduct research independently through Work for Others (WFOs) or Sponsored Research.

482

Synthesis and properties of Fe3O4 nanoparticles by sol-vothermal method using iron(III) acetylacetonate  

Science Journals Connector (OSTI)

Well dispersed Fe3O4...nanoparticles were synthesized at 180C by sol-vothermal method, using iron (III) acetylacetonate as iron source and poly-vinilpyrrolidone (PVP) as ... reaction temperature and time, the am...

Xiaojuan Liang; Guoyuan Ji; Liping Zhang; Yuxiang Yang

2011-08-01T23:59:59.000Z

483

Effect of iron acetylacetonate on physico-chemical properties of waterglass based aerogels by ambient pressure drying  

Science Journals Connector (OSTI)

The effect of iron acetylacetonate on the physico-chemical properties of waterglass ... has been investigated. Doping the gels with iron acetylacetonat (FeAA) facilitates in the diminution...2SiO3 molar ratio fro...

A. Venkateswara Rao; Uzma K. H. Bangi

2011-01-01T23:59:59.000Z

484

Water Gas Shift Catalysis Using Iron Aerogels Doped with Palladium by the Gas-Phase Incorporation Method  

Science Journals Connector (OSTI)

The WGS activity of 2% Pd iron aerogel was higher by 50% than that of 1% Pd incorporated iron aerogel. ... (30) The reactors were charged with 100 mg of fresh catalysts held in place with Whatman QMA quartz fiber filters. ...

Sumit Bali; Gregory C. Turpin; Richard D. Ernst; Ronald J. Pugmire; Vivek Singh; Mohindar S. Seehra; Edward M. Eyring

2008-03-28T23:59:59.000Z

485

Technology and form : iron construction and transformation of architectural ideals in nineteenth century France, 1830-1889.  

E-Print Network [OSTI]

This dissertation investigates the transformation of architectural ideals brought about by the development of iron construction during the nineteenth century in France. The emergence of iron construction paralleled the ...

Lee, Sanghun

1996-01-01T23:59:59.000Z

486

Emerging Energy-efficiency and Carbon Dioxide Emissions-reduction Technologies for the Iron and Steel Industry  

E-Print Network [OSTI]

effective use of non-coking coal and iron-bearing dust andfrom iron ore and non-coking coal. The process was developedBF production in using non-coking coal as reducing agent and

Hasanbeigi, Ali

2014-01-01T23:59:59.000Z

487

Raman studies of corrosion layers formed on archaeological irons in various media  

E-Print Network [OSTI]

147 Raman studies of corrosion layers formed on archaeological irons in various media Ludovic mandana.saheb@cea.fr, f philippe.dillmann@cea.fr Keywords: Raman spectroscopy, iron corrosion, ancient artefact, imaging. Abstract. The description and identification of corrosion products formed

488

Synthetic Analogues of Cysteinate-Ligated Non-Heme Iron and Non-Corrinoid Cobalt Enzymes  

E-Print Network [OSTI]

Synthetic Analogues of Cysteinate-Ligated Non-Heme Iron and Non-Corrinoid Cobalt Enzymes Julie A June 24, 2003 Contents 1. Introduction to Non-Heme Iron Enzymes 825 2. Nitrile Hydratase (NHase) 826 2.1. Enzyme Function 826 2.2. Enzyme Active Site Structure 826 2.3. Spectroscopic Properties 827 2

Kovacs, Julie

489

GrapheneNanotubeIron Hierarchical Nanostructure as Lithium Ion Battery Anode  

Science Journals Connector (OSTI)

GrapheneNanotubeIron Hierarchical Nanostructure as Lithium Ion Battery Anode ... In this study, we report a novel route via microwave irradiation to synthesize a bio-inspired hierarchical graphenenanotubeiron three-dimensional nanostructure as an anode material in lithium-ion batteries. ...

Si-Hwa Lee; Vadahanambi Sridhar; Jung-Hwan Jung; Kaliyappan Karthikeyan; Yun-Sung Lee; Rahul Mukherjee; Nikhil Koratkar; Il-Kwon Oh

2013-04-03T23:59:59.000Z

490

Structural and magnetic characterization of norbornenedeuterated norbornene dicarboxylic acid diblock copolymers doped with iron oxide  

E-Print Network [OSTI]

, Ag, Pd, Pt, Cu) [5­9] and semiconductor nanoclusters (PbS, CdS, ZnS) [10­12] were synthesized within diblock copolymers doped with iron oxide nanoparticles Pinar Akcoraa , Xin Zhangb , Bindhu Varughesec 2005 Available online 29 April 2005 Abstract A series of iron oxide doped norbornene (NOR

Rubloff, Gary W.

491

Formation Damage due to Iron Precipitation in Acidizing Operations and Evaluating GLDA as a Chelating Agent  

E-Print Network [OSTI]

Iron control during acidizing plays a key role in the success of matrix treatment. Ferric ion precipitates in the formation once the acid is spent and the pH exceeds 1-2. Precipitation of iron (III) within the formation can cause formation damage...

Mittal, Rohit

2012-02-14T23:59:59.000Z

492

(Iron regulation of gene expression in the Bradyrhizobium japonicum/soybean symbiosis)  

SciTech Connect (OSTI)

We wish to address the question of whether iron plays a regulatory role in the Bradyrhizobium japonicum/soybeam symbiosis. Iron may be an important regulatory signal in planta as the bacteria must acquire iron from their plant hosts and iron-containing proteins figure prominently in all nitrogen-fixing symbioses. For example, the bacterial partner is believed to synthesize the heme moiety of leghemoglobin, which may represent as much as 25--30% of the total soluble protein in an infected plant cell. For this reason, we have focused our attention on the regulation by iron of the first step in the bacterial heme biosynthetic pathway. The enzyme which catalyzes this step, 5-aminolevulinic acid synthase, is encoded by the hemA gene which we had previously cloned and sequenced. Specific objectives include: to define the cis-acting sequences which confer iron regulation on the B. japonicum hemA gene; to identify trans-acting factors which regulate the expression of hemA by iron; to identify new loci which are transcriptionally responsive to changes in iron availability; and to examine the effects of mutations in various known regulatory genes for their effect on the expression of hemA.

Guerinot, M.L.

1992-01-01T23:59:59.000Z

493

[Iron regulation of gene expression in the Bradyrhizobium japonicum/soybean symbiosis]. Progress report  

SciTech Connect (OSTI)

We wish to address the question of whether iron plays a regulatory role in the Bradyrhizobium japonicum/soybeam symbiosis. Iron may be an important regulatory signal in planta as the bacteria must acquire iron from their plant hosts and iron-containing proteins figure prominently in all nitrogen-fixing symbioses. For example, the bacterial partner is believed to synthesize the heme moiety of leghemoglobin, which may represent as much as 25--30% of the total soluble protein in an infected plant cell. For this reason, we have focused our attention on the regulation by iron of the first step in the bacterial heme biosynthetic pathway. The enzyme which catalyzes this step, 5-aminolevulinic acid synthase, is encoded by the hemA gene which we had previously cloned and sequenced. Specific objectives include: to define the cis-acting sequences which confer iron regulation on the B. japonicum hemA gene; to identify trans-acting factors which regulate the expression of hemA by iron; to identify new loci which are transcriptionally responsive to changes in iron availability; and to examine the effects of mutations in various known regulatory genes for their effect on the expression of hemA.

Guerinot, M.L.

1992-06-01T23:59:59.000Z

494

Photo-Fenton oxidation of phenol with magnetite as iron source Marco Minella,1  

E-Print Network [OSTI]

Photo-Fenton oxidation of phenol with magnetite as iron source Marco Minella,1 Giulia Marchetti,1 irradiation. Very interestingly, the photo-Fenton degradation of phenol was also observed under neutral to promote photo-Fenton reactions even under circumneutral pH conditions, the limited iron leaching and its

495

Aging of Iron (Hydr)oxides by Heat Treatment and Effects on Heavy  

E-Print Network [OSTI]

)oxides are used to remove heavy metals from wastewater and in the treatment of air pollution control residuesAging of Iron (Hydr)oxides by Heat Treatment and Effects on Heavy Metal Binding M E T T E A . S ? R generated in waste incineration. In this study, iron oxides containing heavy metals (e.g., Pb, Hg, Cr

Frenkel, Anatoly

496

Transcriptional Response of Leptospira interrogans to Iron Limitation and Characterization of a PerR Homolog  

Science Journals Connector (OSTI)

...upregulated in response to low iron...genome-wide frequency (18.6 and...upregulated in response to an increase...require an energy transduction...need for iron storage proteins and...or stress responses. FIG. 1...information storage and processing...includes C, energy production...

Miranda Lo; Gerald L. Murray; Chen Ai Khoo; David A. Haake; Richard L. Zuerner; Ben Adler

2010-08-30T23:59:59.000Z

497

Melting of Iron under Earth's Core Conditions from Diffusion Monte Carlo Free Energy Calculations  

E-Print Network [OSTI]

Melting of Iron under Earth's Core Conditions from Diffusion Monte Carlo Free Energy Calculations Ester Sola1 and Dario Alfe`1,2 1 Thomas Young Centre@UCL, and Department of Earth Sciences, UCL, Gower. Here we used quantum Monte Carlo techniques to compute the free energies of solid and liquid iron

Alfè, Dario

498

Competitive adsorption effects in the electrodeposition of iron-nickel alloys  

SciTech Connect (OSTI)

Two-step reaction mechanisms involving adsorbed monovalent intermediate ions for the electrodeposition of iron and nickel as single metals can be combined to form a predictive model for the codeposition of iron-nickel alloys. Inhibition of the more noble nickel in the presence of iron is caused by preferential surface coverage of the adsorbed iron intermediate resulting from a difference between the two elements in Tafel constant for the electrosorption step. The role of hydrolyzed cations and surface pH is investigated and methods for evaluating the influence of pH are explored. The analysis shows that changes in surface pH with potential are not necessary for iron-rich (anomalous) deposits, but that variations in pH from one electrolyte to another may influence deposit composition. The tendency toward iron-rich deposits with increasing overpotential exists in all systems, however, and can be prevented only by decreasing the iron concentration of the bath. An extension of the analysis to account for transport limitations in baths with low iron concentration is developed and calculations with the model are presented to illustrate the effects of current density and electrolyte convection under conditions similar to those investigated experimentally in the literature.

Matlosz, M. (Ecole Polytechnique Federale de Lausanne, (Switzerland). Dept. des materiaux)

1993-08-01T23:59:59.000Z

499

1. Introduction Copper, along with iron active sites dominate the field of  

E-Print Network [OSTI]

#12;1. Introduction Copper, along with iron active sites dominate the field of biological oxygen chemistry[1] and play important roles in homogeneous[2] and heterogeneous catalysis.[3, 4] Copper pro- teins heme ± iron centers).[8] The known copper proteins which are involved in dioxygen binding, activation

Chen, Peng

500

Mixed polyanion glass cathodes: Iron phosphate vanadate glasses  

SciTech Connect (OSTI)

Mixed polyanion (MP) glasses have been investigated for use as cathodes in lithium ion batteries. MP glass cathodes are similar in composition to theoretically promising crystalline polyanionic (CP) cathodes (e.g., lithium cobalt phosphate, lithium manganese silicate), but with proper polyanion substitution, they can be designed to overcome the key shortcomings of CP cathodes, such as poor electrical conductivity and irreversible phase changes. Iron phosphate/vanadate glasses were chosen as a first demonstration of the MP glass concept. Polyanion substitution with vanadate was shown to improve the intercalation capacity of an iron phosphate glass from almost zero to full theoretical capacity. In addition, the MP glass cathodes also exhibited an unexpected second high-capacity electrochemical reaction. X-ray absorption near-edge structure (XANES) and x-ray diffraction (XRD) of cathodes from cells having different states of charge suggested that this second electrochemical reaction is a glass-state conversion reaction. With a first demonstration established, MP glass materials utilizing an intercalation and/or glass-state conversion reaction are promising candidates for future high-energy cathode research.

Kercher, Andrew K [ORNL; Ramey, Joanne Oxendine [ORNL; Carroll, Kyler J [Massachusetts Institute of Technology (MIT); Kiggans Jr, James O [ORNL; Veith, Gabriel M [ORNL; Meisner, Roberta [Oak Ridge National Laboratory (ORNL); Boatner, Lynn A [ORNL; Dudney, Nancy J [ORNL

2014-01-01T23:59:59.000Z