Powered by Deep Web Technologies
Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008  

Broader source: Energy.gov [DOE]

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008

2

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah,  

Broader source: Energy.gov (indexed) [DOE]

Dispersivity Testing of Zero-Valent Iron Treatment Cells: Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 More Documents & Publications Final Report Phase II: Performance Evaluation of Permeable Reactive Barriers and Potential for Rejuvenation by Chemical Flushing Phase II: Performance Evaluation of Permeable Reactive Barriers and Potential for Rejuvenation by Chemical Flushing Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable

3

Iron oxide red wastewater treatment and recycling of iron-containing sludge  

Science Journals Connector (OSTI)

Abstract The paper presents a wastewater treatment process and recycling of iron sludge from wastewater treatment for iron oxide red production. Results show that: (1) Sludge from wastewater treatment process under the operating parameters: 1.84 g/L of NaOH dosage, 10 mins of aeration with flow rate of 1 L/min and 150 mins of sediment time is potential for seed crystal preparation and excellent iron oxide red product can be obtained in the secondary oxidation under condition of 85 °C, 68 h of reaction time and 150 mL/min of airflow rate, (2) In practical engineering, the average removal rate of Fe2+ and SS and chroma of effluent is 99.75%, 86.7% and less than 40 times, respectively, and all items of product satisfy demands of industrial standards, (3) Compared with the original wastewater treatment, the new process can save the cost of wastewater treatment and earn extra 20.0 dollars for a ton of iron oxide red product and then both economic benefit and environmental protection can be realized by this process. It is proved that the novel method is reliable, economical and promising in iron oxide red industry and cleaner production of iron oxide red is feasible.

Zhenguo Chen; Xiaojun Wang; Qilong Ge; Guanchao Guo

2015-01-01T23:59:59.000Z

4

Simulation of iron impurity gettering in crystalline silicon solar cells  

E-Print Network [OSTI]

This work discusses the Impurity-to-Efficiency (12E) simulation tool and applet. The 12E simulator models the physics of iron impurity gettering in silicon solar cells during high temperature processing. The tool also ...

Powell, Douglas M. (Douglas Michael)

2012-01-01T23:59:59.000Z

5

Aging of Iron (Hydr)oxides by Heat Treatment and Effects on Heavy  

E-Print Network [OSTI]

)oxides are used to remove heavy metals from wastewater and in the treatment of air pollution control residuesAging of Iron (Hydr)oxides by Heat Treatment and Effects on Heavy Metal Binding M E T T E A . S Ã? R generated in waste incineration. In this study, iron oxides containing heavy metals (e.g., Pb, Hg, Cr

Frenkel, Anatoly

6

Effect of thermal treatment on coke reactivity and catalytic iron mineralogy  

SciTech Connect (OSTI)

Iron minerals in coke can catalyze its gasification and may affect coke behavior in the blast furnace. The catalytic behavior of iron depends largely upon the nature of the iron-bearing minerals. To determine the mineralogical changes that iron could undergo in the blast furnace, cokes made from three coals containing iron present in different mineral forms (clays, carbonates, and pyrite) were examined. All coke samples were heat-treated in a horizontal furnace at 1373, 1573, and 1773 K and then gasified with CO{sub 2} at 1173 K in a fixed bed reactor (FBR). Coke mineralogy was characterized using quantitative X-ray diffraction (XRD) analysis of coke mineral matter prepared by low-temperature ashing (LTA) and field emission scanning electron microscopy combined with energy dispersive X-ray analysis (FESEM/EDS). The mineralogy of the three cokes was most notably distinguished by differing proportions of iron-bearing phases. During heat treatment and subsequent gasification, iron-containing minerals transformed to a range of minerals but predominantly iron-silicides and iron oxides, the relative amounts of which varied with heat treatment temperature and gasification conditions. The relationship between initial apparent reaction rate and the amount of catalytic iron minerals - pyrrhotite, metallic iron, and iron oxides - was linear and independent of heat treatment temperature at total catalyst levels below 1 wt %. The study showed that the coke reactivity decreased with increasing temperature of heat treatment due to decreased levels of catalytic iron minerals (largely due to formation of iron silicides) as well as increased ordering of the carbon structure. The study also showed that the importance of catalytic mineral matter in determining reactivity declines as gasification proceeds. 37 refs., 13 figs., 7 tabs.

Byong-chul Kim; Sushil Gupta; David French; Richard Sakurovs; Veena Sahajwalla [University of New South Wales, Sydney, NSW (Australia). Centre for Sustainable Materials Research and Technology

2009-07-15T23:59:59.000Z

7

Thermal treatment for increasing magnetostrictive response of rare earth-iron alloy rods  

DOE Patents [OSTI]

Magnetostrictive rods formed from rare earth-iron alloys are subjected to a short time heat treatment to increase their magnetostrictive response under compression. The heat treatment is preferably carried out at a temperature of from 900 to 1,000 C for 20 minutes to six hours.

Verhoeven, J.D.; McMasters, O.D.

1989-07-18T23:59:59.000Z

8

Performance and cycling of the iron-ion/hydrogen redox flow cell with  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Performance and cycling of the iron-ion/hydrogen redox flow cell with Performance and cycling of the iron-ion/hydrogen redox flow cell with various catholyte salts Title Performance and cycling of the iron-ion/hydrogen redox flow cell with various catholyte salts Publication Type Journal Article Year of Publication 2013 Authors Tucker, Michael C., Venkat Srinivasan, Philip N. Ross, and Adam Z. Weber Journal Journal of Applied Electrochemistry Volume 43 Issue 7 Pagination 637 - 644 Date Published 7/2013 ISSN 0021-891X Keywords battery, Flow battery, iron hydrogen cell, progress, redox flow cell Abstract A redox flow cell utilizing the Fe2+/Fe3+ and H-2/H+ couples is investigated as an energy storage device. A conventional polymer electrolyte fuel cell anode and membrane design is employed, with a cathode chamber containing a carbon felt flooded with aqueous acidic solution of iron salt. The maximum power densities achieved for iron sulfate, iron chloride, and iron nitrate are 148, 207, and 234 mW cm(-2), respectively. It is found that the capacity of the iron nitrate solution decreases rapidly during cycling. Stable cycling is observed for more than 100 h with iron chloride and iron sulfate solutions. Both iron sulfate and iron chloride solutions display moderate discharge polarization and poor charge polarization; therefore, voltage efficiency decreases dramatically with increasing current density. A small self-discharge current occurs when catholyte is circulating through the cathode chamber. As a result, a current density above 100 mA cm(-2) is required to achieve high Coulombic efficiency (> 0.9).

9

Plutonium Tricks Cells by "Pretending" to be Iron | Advanced Photon Source  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A Chemical Detour to Quantum Criticality A Chemical Detour to Quantum Criticality Metallic Glass: A Crystal at Heart Brain Iron as an Early Predictor of Alzheimer's Disease Osmosis in Colloidal Suspensions Building a Better Battery Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed Plutonium Tricks Cells by "Pretending" to be Iron JULY 14, 2011 Bookmark and Share Structural models of bovine serum transferrins derived from x-ray studies at the Advanced Photon Source. Natural di-iron transferrin (yellow) and one mixed iron plutonium transferrin (green) are recognized and taken in by cells, while the other mixed plutonium iron transferrin (red) and di-plutonium transferrin (blue) are not recognized.

10

Application of iron nanaoparticles in landfill leachate treatment - case study: Hamadan landfill leachate  

Science Journals Connector (OSTI)

This study was performed with the objective of determining the efficiency of iron nanoparticles for reducing chemical oxygen demand (COD), 5-day biological oxygen demand (BOD5...), total solids (TS) and color of ...

Zahra Esfahani Kashitarash…

2012-12-01T23:59:59.000Z

11

Optimizing Treatment Performance of Microbial Fuel Cells by Reactor Staging  

Science Journals Connector (OSTI)

Optimizing Treatment Performance of Microbial Fuel Cells by Reactor Staging ... Multi-unit optimization is a recently proposed method that uses multiple similar units to optimize process performance. ...

Roberto P. Pinto; Boris Tartakovsky; Michel Perrier; Bala Srinivasan

2010-08-18T23:59:59.000Z

12

Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3-0501 3-0501 Unlimited Release Printed February 2013 Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility Joseph W. Pratt and Aaron P. Harris Prepared by Sandia National Laboratories Albuquerque, New Mexico 87185 and Livermore, California 94550 Sandia National Laboratories is a multi-program laboratory managed and operated by Sandia Corporation, a wholly owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Approved for public release; further dissemination unlimited. 2 Issued by Sandia National Laboratories, operated for the United States Department of Energy by Sandia Corporation. NOTICE: This report was prepared as an account of work sponsored by an agency of the

13

Modeling of Immobilized Cell Columns for Bioconversion and Wastewater Treatment  

E-Print Network [OSTI]

Modeling of Immobilized Cell Columns for Bioconversion and Wastewater Treatment Tingyue Gu* and Mei used in bioconversions to produce biological products as well as in wastewater treatment such as solvent removal from wastewater streams. In this work, a rate model is proposed to simulate this kind

Gu, Tingyue

14

The inhibitory effect of superparamagnetic iron oxide nanoparticle (Ferucarbotran) on osteogenic differentiation and its signaling mechanism in human mesenchymal stem cells  

SciTech Connect (OSTI)

Superparamagnetic iron oxide (SPIO) nanoparticles are very useful for monitoring cell trafficking in vivo and distinguish whether cellular regeneration originated from an exogenous cell source, which is a key issue for developing successful stem cell therapies. However, the impact of SPIO labeling on stem cell behavior remains uncertain. Here, we show the inhibitory effect of Ferucarbotran, an ionic SPIO, on osteogenic differentiation and its signaling mechanism in human mesenchymal stem cells. Ferucarbotran caused a dose-dependent inhibition of osteogenic differentiation, abolished the differentiation at high concentration, promoted cell migration, and activated the signaling molecules, {beta}-catenin, a cancer/testis antigen, SSX, and matrix metalloproteinase 2 (MMP2). An iron chelator, desferrioxamine, suppressed all the above Ferucarbotran-induced actions, demonstrating an important role of free iron in the inhibition of osteogenic differentiation that is mediated by the promotion of cell mobilization, involving the activation of a specific signaling pathway.

Chen, Ying-Chun [Center for Nanomedicine Research, National Health Research Institutes, Zhunan, Miaoli County 350, Taiwan (China); Hsiao, Jong-Kai; Liu, Hon-Man [Department of Medical Imaging, National Taiwan University Hospital and College of Medicine, National Taiwan University, Taipei 106, Taiwan (China); Lai, I-Yin [Center for Nanomedicine Research, National Health Research Institutes, Zhunan, Miaoli County 350, Taiwan (China); Yao, Ming [Department of Internal Medicine, National Taiwan University Hospital and College of Medicine, National Taiwan University, Taipei 106, Taiwan (China); Hsu, Szu-Chun [Department of Laboratory Medicine, National Taiwan University Hospital and College of Medicine, National Taiwan University, Taipei 106, Taiwan (China); Ko, Bor-Sheng [Department of Internal Medicine, National Taiwan University Hospital and College of Medicine, National Taiwan University, Taipei 106, Taiwan (China); Chen, Yao-Chang [Department of Laboratory Medicine, National Taiwan University Hospital and College of Medicine, National Taiwan University, Taipei 106, Taiwan (China); Yang, Chung-Shi [Center for Nanomedicine Research, National Health Research Institutes, Zhunan, Miaoli County 350, Taiwan (China); Huang, Dong-Ming, E-mail: dmhuang@nhri.org.t [Center for Nanomedicine Research, National Health Research Institutes, Zhunan, Miaoli County 350, Taiwan (China)

2010-06-01T23:59:59.000Z

15

Biophysical Probes of Iron Metabolism in Yeast Cells, Mitochondria, and Mouse Brains  

E-Print Network [OSTI]

Iron is essential in nearly all organisms. It is a cofactor in many proteins and enzymes. This transition metal can also be toxic because it participates in reactions which produce reactive oxygen species. To avoid these toxic effects while still...

Holmes-Hampton, Gregory

2012-10-19T23:59:59.000Z

16

Time-Resolved Synchrotron X-ray Diffraction on Pulse Laser Heated Iron in Diamond Anvil Cell  

SciTech Connect (OSTI)

The authors present time-resolved synchrotron x-ray diffraction to probe the {var_epsilon}-{delta} phase transition of iron during pulse-laser heating in a diamond anvil cell. The system utilizes a monochromatic synchrotron x-ray beam, a two-dimensional pixel array x-ray detector and a dual beam, double side laser-heating system. Multiple frames of the diffraction images are obtained in real-time every 22 ms over 500 ms of the entire pulse heating period. The results show the structural evolution of iron phases at 17 GPa, resulting in thermal expansion coefficient 1/V({Delta}V/{Delta}T){sub p} = 7.1 * 10{sup -6}/K for {var_epsilon}-Fe and 2.4 * 10{sup -5}/K for {gamma}-Fe, as well as the evidence for metastability of {gamma}-Fe at low temperatures below the {var_epsilon}-{gamma} phase boundary.

Yoo, C S; Wei, H; Dias, R; Shen, G; Smith, J; Chen, J Y; Evans, W

2011-09-21T23:59:59.000Z

17

Magnetosome-like ferrimagnetic iron oxide nanocubes for highly sensitive MRI of single cells and transplanted pancreatic islets  

Science Journals Connector (OSTI)

...Contrast Agent. Ferrimagnetic iron oxide nanocubes were synthesized via thermal decomposition of iron (III) acetylacetonate in a mixture composed of oleic...PEG-phospholipid-encapsulated ferrimagnetic iron oxide nanocubes, designated as...

Nohyun Lee; Hyoungsu Kim; Seung Hong Choi; Mihyun Park; Dokyoon Kim; Hyo-Cheol Kim; Yoonseok Choi; Shunmei Lin; Byung Hyo Kim; Hye Seung Jung; Hyeonjin Kim; Kyong Soo Park; Woo Kyung Moon; Taeghwan Hyeon

2011-01-01T23:59:59.000Z

18

Iron Absorption  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Absorption Iron Absorption Name: Mary Location: N/A Country: N/A Date: N/A Question: I wrote before to Steve and got a answer back. I would like more information. The cirmcustances were that I first had anaemia and then I went for a gastroscopy. The results of which were I had insufficient acid been produced in the stomach. I was told that acid was nessary for the absorbion of iron and it was because of this that I became anaemic. I was told to eat plently of red meat not too many vegetables. Is there any other information you can give me? Replies: It is very difficult to say for sure without seeing you chart and I am not your doctor. But it sounds to me like you are deficient in the vitamin B12. In your stomach you have 3 basic types of cells. One is called chief cells which secrete the precursor of the enzyme pepsin which begins the breakdown of protein. Another is called the parietal cells which secrete your stomach acid and a substance called intrinsic factor. Now-switch to your bone marrow which is where your red blood cells are made. In order for your red blood cells to mature in the bone marrow, vitamin B12 is necessary. B12 can only be obtained from animal food sources such as meat, milk and eggs. Unfortunately, B12 cannot be absorbed in the stomach without intrinsic factor. If there is sufficient B12 present in the diet, it can be stored in the liver. If you aren't eating enough animal sources your B12 will be taken from your liver until you run out. You could also be deficient in intrinsic factor. So while the outcome is anemia (not enough red blood cells) the problem could be from a few different things. Follow your doctor's recommendations and eat more sources of B12

19

The influence of load and surface treatment on the corrosive wear of cast iron in oil-sulphuric acid environments  

Science Journals Connector (OSTI)

An investigation into the influence of load and surface finish on the reciprocating corrosive wear of grey cast iron in oil-10 ... between cylinder-lining and piston-ring materials from marine diesel engines. In ...

A. G. Macdonald; F. H. Stott

1988-02-01T23:59:59.000Z

20

Towards Plasma Surgery: Plasma Treatment of Living Cells  

Science Journals Connector (OSTI)

The physical biological and technical background for high?precision plasma surgery is prepared in a multi?disciplinary team. The aim of the research is to achieve controlled removal of diseased cells and bacteria without harming the healthy rest of the tissue. For this purpose a small cold flexible and non?toxic plasma is developed (the plasma needle) and tested on cultured cells and bacterial samples. The needle is an atmospheric discharge induced by a radio?frequency voltage applied to a metal pin. This plasma operates at room temperature in the milliwatt power regime; it poses no risk of thermal or electrical damage to living tissues. Several beneficial responses of living cells to plasma treatment have been already identified. Plasma does not cause accidental cell death (necrosis) which leads to inflammation and tissue damage. Instead it allows to detach cells from each other and from the scaffold and thus to remove them in a non?destructive way. Moreover plasma is capable of bacterial inactivation. I parallel we have determined the electrical and optical properties of the plasma and found a method of precise positioning of the plasma needle with respect to the treated tissue.

E. Stoffels; I. E. Kieft; R. E. J. Sladek; D. W. Slaaf; E. P. van der Laan; P. Jimenez?Moreno; M. Steinbuch

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Towards Plasma Surgery: Plasma Treatment of Living Cells  

SciTech Connect (OSTI)

The physical, biological and technical background for high-precision plasma surgery is prepared in a multi-disciplinary team. The aim of the research is to achieve controlled removal of diseased cells and bacteria without harming the healthy rest of the tissue. For this purpose, a small, cold, flexible and non-toxic plasma is developed (the plasma needle) and tested on cultured cells and bacterial samples. The needle is an atmospheric discharge induced by a radio-frequency voltage applied to a metal pin. This plasma operates at room temperature, in the milliwatt power regime; it poses no risk of thermal or electrical damage to living tissues. Several beneficial responses of living cells to plasma treatment have been already identified. Plasma does not cause accidental cell death (necrosis), which leads to inflammation and tissue damage. Instead, it allows to detach cells from each other and from the scaffold, and thus to remove them in a non-destructive way. Moreover, plasma is capable of bacterial inactivation. I parallel, we have determined the electrical and optical properties of the plasma and found a method of precise positioning of the plasma needle with respect to the treated tissue.

Stoffels, E.; Kieft, I.E.; Sladek, R.E.J.; Slaaf, D.W.; Laan, E.P. van der; Jimenez-Moreno, P.; Steinbuch, M. [Department of Biomedical Engineering, Eindhoven University of Technology, PO Box 513, 5600 MB, Eindhoven (Netherlands); Department of Mechanical Engineering, Eindhoven University of Technology, PO Box 513, 5600 MB, Eindhoven (Netherlands)

2004-12-01T23:59:59.000Z

22

Iron chelators ICL670 and 311 inhibit HIV-1 transcription  

SciTech Connect (OSTI)

HIV-1 replication is induced by an excess of iron and iron chelation by desferrioxamine (DFO) inhibits viral replication by reducing proliferation of infected cells. Treatment of cells with DFO and 2-hydroxy-1-naphthylaldehyde isonicotinoyl hydrazone (311) inhibit expression of proteins that regulate cell-cycle progression, including cycle-dependent kinase 2 (CDK2). Our recent studies showed that CDK2 participates in HIV-1 transcription and viral replication suggesting that inhibition of CDK2 by iron chelators might also affect HIV-1 transcription. Here we evaluated the effect of a clinically approved orally effective iron chelator, 4-[3,5-bis-(hydroxyphenyl)-1,2,4-triazol-1-yl]-benzoic acid (ICL670) and 311 on HIV-1 transcription. Both ICL670 and 311 inhibited Tat-induced HIV-1 transcription in CEM-T cells, 293T and HeLa cells. Neither ICL670 nor 311 induced cytotoxicity at concentrations that inhibited HIV-1 transcription. The chelators decreased cellular activity of CDK2 and reduced HIV-1 Tat phosphorylation by CDK2. Neither ICL670A or 311 decreased CDK9 protein level but significantly reduced association of CDK9 with cyclin T1 and reduced phosphorylation of Ser-2 residues of RNA polymerase II C-terminal domain. In conclusion, our findings add to the evidence that iron chelators can inhibit HIV-1 transcription by deregulating CDK2 and CDK9. Further consideration should be given to the development of iron chelators for future anti-retroviral therapeutics.

Debebe, Zufan; Ammosova, Tatyana [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Jerebtsova, Marina [Children's National Medical Center, CRI Center for Cancer and Immunology, 111 Michigan Ave., N.W., Washington, DC 20060 (United States); Kurantsin-Mills, Joseph [Department of Biophysics and Physiology, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Niu, Xiaomei; Charles, Sharroya [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Richardson, Des R. [Iron Metabolism and Chelation Program, Department of Pathology, Blackburn Building (D06), University of Sydney, Sydney, New South Wales, 2006 Australia (Australia); Ray, Patricio E. [Children's National Medical Center, CRI Center for Cancer and Immunology, 111 Michigan Ave., N.W., Washington, DC 20060 (United States); Gordeuk, Victor R. [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Nekhai, Sergei [Center for Sickle Cell Disease, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States); Department of Biochemistry and Molecular Biology, Howard University College of Medicine, 520 W. St., N.W., Washington, DC 20060 (United States)], E-mail: snekhai@howard.edu

2007-10-25T23:59:59.000Z

23

Iron-Based Catalysts with Improved Oxygen Reduction Activity in Polymer Electrolyte Fuel Cells  

Science Journals Connector (OSTI)

...26 See supporting material on Science Online. 27 U. S. Department of Energy, Technical Plan: Fuel Cells, 2007 (www1.eere.energy.gov/hydrogenandfuelcells/mypp/pdfs/fuel_cells.pdf). 28 F. Charreteur , S. Ruggeri, F. Jaouen, J...

Michel Lefèvre; Eric Proietti; Frédéric Jaouen; Jean-Pol Dodelet

2009-04-03T23:59:59.000Z

24

Synchrotron-based investigations of the nature and impact of iron contamination in multicrystalline silicon solar cells  

E-Print Network [OSTI]

particles, either oxidized and/or present with multiple other metal species reminiscent of stainless steels equipment, or feedstock, and b the more numerous, homogeneously distributed, and smaller iron silicide involving atomically dissolved iron in the melt or in the crystal. It was found that iron silicide

25

Process for the synthesis of iron powder  

DOE Patents [OSTI]

A process for preparing iron powder suitable for use in preparing the iron-potassium perchlorate heat-powder fuel mixture used in thermal batteries, comprises preparing a homogeneous, dense iron oxide hydroxide precipitate by homogeneous precipitation from an aqueous mixture of a ferric salt, formic or sulfuric acid, ammonium hydroxide and urea as precipitating agent; and then reducing the dense iron oxide hydroxide by treatment with hydrogen to prepare the iron powder. 2 figs.

Welbon, W.W.

1983-11-08T23:59:59.000Z

26

Process for the synthesis of iron powder  

DOE Patents [OSTI]

A process for preparing iron powder suitable for use in preparing the iron-potassium perchlorate heat-powder fuel mixture used in thermal batteries, comprises preparing a homogeneous, dense iron oxide hydroxide precipitate by homogeneous precipitation from an aqueous mixture of a ferric salt, formic or sulfuric acid, ammonium hydroxide and urea as precipitating agent; and then reducing the dense iron oxide hydroxide by treatment with hydrogen to prepare the iron powder.

Not Available

1982-03-06T23:59:59.000Z

27

Modeling the Variability of Single-Cell Lag Times for Listeria innocua Populations after Sublethal and Lethal Heat Treatments  

Science Journals Connector (OSTI)

...the shift of the distribution assumed to be...cell). After heat treatments in...resulted in a loss of viability...the preceding heat treatment. This...single-cell lag time distributions of Listeria cells exposed to heat treatments of...treatment in which no loss of viability occurred...

A. Métris; S. M. George; B. M. Mackey; J. Baranyi

2008-09-26T23:59:59.000Z

28

Prediction of Sickle Cell Anemia Patient's Response to Hydroxyurea Treatment Using ARTMAP Network  

E-Print Network [OSTI]

Prediction of Sickle Cell Anemia Patient's Response to Hydroxyurea Treatment Using ARTMAP Network distance-based ARTMAP (MART) network to the predication of sickle cell anemia patients' response In the United States, about 1 in 500 African Ameri- cans develops sickle cell anima [5]. In Africa, about 1

Valafar, Faramarz

29

An overview of sickle cell disease: analysis of the sickling process and current treatments  

E-Print Network [OSTI]

An overview of sickle cell disease: analysis of the sickling process and current treatments Biol126 resulting in the characteristic sickling of a red blood cell. In this paper I will attempt to provide analysis of sickle cell anemia's molecular underpinnings as opposed to its genetic basis will provide

Wang, Yan Mei

30

Vessel Cold-Ironing Using a Barge Mounted PEM Fuel Cell: Project Scoping and Feasibility.  

SciTech Connect (OSTI)

A barge-mounted hydrogen-fueled proton exchange membrane (PEM) fuel cell system has the potential to reduce emissions and fossil fuel use of maritime vessels in and around ports. This study determines the technical feasibility of this concept and examines specific options on the U.S. West Coast for deployment practicality and potential for commercialization.The conceptual design of the system is found to be straightforward and technically feasible in several configurations corresponding to various power levels and run times.The most technically viable and commercially attractive deployment options were found to be powering container ships at berth at the Port of Tacoma and/or Seattle, powering tugs at anchorage near the Port of Oakland, and powering refrigerated containers on-board Hawaiian inter-island transport barges. Other attractive demonstration options were found at the Port of Seattle, the Suisun Bay Reserve Fleet, the California Maritime Academy, and an excursion vessel on the Ohio River.

Pratt, Joseph William; Harris, Aaron P

2013-01-01T23:59:59.000Z

31

Microbial reduction of iron ore  

DOE Patents [OSTI]

A process is provided for reducing iron ore by treatment with microorganisms which comprises forming an aqueous mixture of iron ore, microorganisms operable for reducing the ferric iron of the iron ore to ferrous iron, and a substrate operable as an energy source for the microbial reduction; and maintaining the aqueous mixture for a period of time and under conditions operable to effect the reduction of the ore. Preferably the microorganism is Pseudomonas sp. 200 and the reduction conducted anaerobically with a domestic wastewater as the substrate. An aqueous solution containing soluble ferrous iron can be separated from the reacted mixture, treated with a base to precipitate ferrous hydroxide which can then be recovered as a concentrated slurry.

Hoffmann, Michael R. (Pasadena, CA); Arnold, Robert G. (Pasadena, CA); Stephanopoulos, Gregory (Pasadena, CA)

1989-01-01T23:59:59.000Z

32

Microbial reduction of iron ore  

DOE Patents [OSTI]

A process is provided for reducing iron ore by treatment with microorganisms which comprises forming an aqueous mixture of iron ore, microorganisms operable for reducing the ferric iron of the iron ore to ferrous iron, and a substrate operable as an energy source for the microbial reduction; and maintaining the aqueous mixture for a period of time and under conditions operable to effect the reduction of the ore. Preferably the microorganism is Pseudomonas sp. 200 and the reduction conducted anaerobically with a domestic wastewater as the substrate. An aqueous solution containing soluble ferrous iron can be separated from the reacted mixture, treated with a base to precipitate ferrous hydroxide which can then be recovered as a concentrated slurry. 11 figs.

Hoffmann, M.R.; Arnold, R.G.; Stephanopoulos, G.

1989-11-14T23:59:59.000Z

33

Efficient recovery of nano-sized iron oxide particles from synthetic acid-mine drainage (AMD) water using fuel cell  

E-Print Network [OSTI]

Efficient recovery of nano-sized iron oxide particles from synthetic acid-mine drainage (AMD) water electricity. Here we show that this approach can also be used as a technique to generate spherical nano

34

Altered Composition of Membrane Glycoconjugates in Rat Hepatoma Tissue Culture Cells after Dexamethasone Treatment or in Vivo Growth  

Science Journals Connector (OSTI)

...Dexamethasone Treatment or in Vivo...two-dimensional gel electrophoresis. Tumor tissue...tissue. Treatment of HTC cells...Dexamethasone treatment, however...followed by dialysis against distilled water for 24 hr...chromatography (3). Electrophoretic Separations...

Heinz Baumann and Fong-Fong Chu

1979-09-01T23:59:59.000Z

35

Lack of iron | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lack of iron Lack of iron Iron-bearing minerals in sediments naturally reduce contaminant levels The Science The release of wastes associated with nuclear reprocessing from storage...

36

Combined treatment with fenretinide and indomethacin induces AIF-mediated, non-classical cell death in human acute T-cell leukemia Jurkat cells  

SciTech Connect (OSTI)

Highlights: Black-Right-Pointing-Pointer The combination of fenretinide and indomethacin induces a high level of cell death. Black-Right-Pointing-Pointer Apoptotic pathway is caspase-independent. Black-Right-Pointing-Pointer Jurkat cells undergo AIF-mediated cell death. -- Abstract: Currently used cytotoxic drugs in cancer therapy have a similar mechanism of action and low specificity. Applied simultaneously, they show an additive effect with strong side effects. Clinical trials with the use of different agents in cancer therapy show that the use of these compounds alone is not very effective in fighting cancer. An alternative solution could be to apply a combination of these agents, because their combination has a synergistic effect on some cancer cells. Therefore, in our investigations we examined the effects of a synthetic retinoid-fenretinide when combined with a non-steroidal anti-inflammatory drug-indomethacin on the process of apoptosis in the acute human T-cell leukemia cell line Jurkat. We demonstrate that treatment with the combination of the tested compounds induces the death of cells, that is peculiar and combines features of apoptosis as well as non-apoptotic cell death. In detail we observed, cell membrane permeabilization, phosphatydylserine exposure, no oligonucleosomal DNA fragmentation, no caspase-3 activation, but apoptosis inducing factor (AIF) nuclear translocation. Taken together these results indicate, that Jurkat cells after treatment with a combination of fenretinide and indomethacin undergo AIF-mediated programmed cell death.

Hojka-Osinska, Anna, E-mail: hojka@immuno.iitd.pan.wroc.pl [Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, 53-114 Wroclaw (Poland)] [Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, 53-114 Wroclaw (Poland); Ziolo, Ewa, E-mail: ziolo@immuno.iitd.pan.wroc.pl [Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, 53-114 Wroclaw (Poland)] [Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, 53-114 Wroclaw (Poland); Rapak, Andrzej, E-mail: rapak@immuno.iitd.pan.wroc.pl [Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, 53-114 Wroclaw (Poland)] [Laboratory of Tumor Molecular Immunobiology, Ludwik Hirszfeld Institute of Immunology and Experimental Therapy, 53-114 Wroclaw (Poland)

2012-03-16T23:59:59.000Z

37

Microbial fuel cell treatment of ethanol fermentation process water  

DOE Patents [OSTI]

The present invention relates to a method for removing inhibitor compounds from a cellulosic biomass-to-ethanol process which includes a pretreatment step of raw cellulosic biomass material and the production of fermentation process water after production and removal of ethanol from a fermentation step, the method comprising contacting said fermentation process water with an anode of a microbial fuel cell, said anode containing microbes thereon which oxidatively degrade one or more of said inhibitor compounds while producing electrical energy or hydrogen from said oxidative degradation, and wherein said anode is in electrical communication with a cathode, and a porous material (such as a porous or cation-permeable membrane) separates said anode and cathode.

Borole, Abhijeet P. (Knoxville, TN)

2012-06-05T23:59:59.000Z

38

Public good dynamics drive evolution of iron acquisition strategies in natural bacterioplankton populations  

E-Print Network [OSTI]

A common strategy among microbes living in iron-limited environments is the secretion of siderophores, which can bind poorly soluble iron and make it available to cells via active transport mechanisms. Such siderophore–iron ...

Cordero, Otto X.

39

Plasma Treatment of Single-Cell Niobium SRF Cavities  

SciTech Connect (OSTI)

Superconducting radio frequency cavities of bulk Niobium are integral components of particle accelerators based on superconducting technology. Wet chemical processing is the commonly used procedure for impurities and surface defects removal and surface roughness improvement , both required to improve the RF performance of the cavity. We are studying plasma etching as an alternate technique to process these cavities. The uniformity of the plasma sheath at the inner wall of the cavity is one prerequisite for its uniform etching. We are developing electro-optic diagnostic techniques to assess the plasma uniformity. Multiple electro-optical probes are placed at different locations of the single cell cavity to diagnose the electrical and optical properties of the plasma. The electrical parameters are required to understand the kinetic nature of the plasma and the optical emission spectroscopy provides the spatial distribution of radicals in the plasma. The spatial variation of the plasma parameters inside the cavity and their effect on the etching of niobium samples placed at different locations in the cavity will be presented.

J. Upadhyay, M. Nikoli?, S. Popovi?, L. Vuškovi?, H.L. Phillips, A-M. Valente-Feliciano

2011-03-01T23:59:59.000Z

40

Determination of 10B in lymphoma human cells after boron carrier treatment: comparison of 10BPA and immuno-nanoparticles  

Science Journals Connector (OSTI)

Current cancer treatments lead to insufficient distribution of therapeutic agents in tumor cells due to their lack of selectivity often causing adverse effects in the normal cell uptake of the drug. The challe...

Marco Giovanni Persico; Patrizia Chiari; Raffaela Biesuz…

2014-02-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

A Hybrid Microbial Fuel Cell Membrane Bioreactor with a Conductive Ultrafiltration Membrane Biocathode for Wastewater Treatment  

E-Print Network [OSTI]

Biocathode for Wastewater Treatment Lilian Malaeb,,§ Krishna P. Katuri,,§ Bruce E. Logan, Husnul Maab, S. P-biocathode microbial fuel cell- membrane bioreactor (MFC-MBR) system was developed to achieve simultaneous wastewater and the membrane for wastewater filtration. The MFC-MBR used an air-biocathode, and it was shown to have good

42

In vitro magnetic hyperthermia response of iron oxide MNP’s incorporated in DA3, MCF-7 and HeLa cancer cell lines  

Science Journals Connector (OSTI)

In the current work, iron oxide magnetic nanoparticles (MNP’s) were...3-(iron acetylacetonate) compounds in high-boiling organic solvents containing...in vitro hyperthermia results, very fast thermal response was...

Evangelos I. Gkanas

2013-07-01T23:59:59.000Z

43

Drinking Water Problems: Iron and Manganese  

E-Print Network [OSTI]

Iron and manganese can give water an unpleasant taste, odor and color. In this publication you'll learn how to know whether your water contains iron or manganese and how to eliminate these contaminants with various treatment methods such as aeration...

Dozier, Monty; McFarland, Mark L.

2004-02-20T23:59:59.000Z

44

Formation and Reactivity of Biogenic Iron Microminerals  

SciTech Connect (OSTI)

The overall purpose of the project is to explore and quantify the processes that control the formation and reactivity of biogenic iron microminerals and their impact on the solubility of metal contaminants. The research addresses how surface components of bacterial cells, extracellular organic material, and the aqueous geochemistry of the DIRB microenvironment impacts the mineralogy, chemical state and micromorphology of reduced iron phases.

Beveridge, Terrance J.; Glasauer, Susan; Korenevsky, Anton; Ferris, F. Grant

2000-08-08T23:59:59.000Z

45

Solid-phase synthesis of high-alumina cements by high-temperature treatment on the surface of molten cast iron  

SciTech Connect (OSTI)

The use of block and monolithic concreting technology in the construction of thermal power plants together with the technical and economic advantages arising from the use of high-alumina cements in the production of refractory concretes have made the development of new methods for the production of high-alumina cement clinkers mandatory. To this end the authors of this paper study the kinetics of synthesis of such clinkers obtained by their firing on the surface of molten cast iron as the heat transfer agent. Among the results presented are a structural and quantitative analysis of the clinker along with phase and activation energy studies.

Fedorov, N.F.; Gavrilov, A.P.; Ivanov, N.I.; Khalina, O.M.

1986-09-10T23:59:59.000Z

46

Comparison of demographics, treatment patterns, health care utilization, and costs among elderly patients with extensive-stage small cell and metastatic non-small cell lung cancers  

Science Journals Connector (OSTI)

Limited data exist regarding real-world treatment patterns, resource utilization, and costs of extensive-stage small cell lung cancer (esSCLC) among elderly patients in the United States. While abundant data a...

Sudeep J Karve; Gregory L Price; Keith L Davis…

2014-11-01T23:59:59.000Z

47

Hydrogen Storage in Diamond Powder Utilizing Plasma NaF Surface Treatment for Fuel Cell Applications  

SciTech Connect (OSTI)

Hydrogen Fuel Cells offer the vital solution to the world's socio-political dependence on oil. Due to existing difficulty in safe and efficient hydrogen storage for fuel cells, storing the hydrogen in hydrocarbon compounds such as artificial diamond is a realistic solution. By treating the surface of the diamond powder with a Sodium Fluoride plasma exposure, the surface of the diamond is cleaned of unwanted molecules. Due to fluorine's electro negativity, the diamond powder is activated and ready for hydrogen absorption. These diamond powder pellets are then placed on a graphite platform that is heated by conduction in a high voltage circuit made of tungsten wire. Then, the injection of hydrogen gas into chamber allows the storage of the Hydrogen on the surface of the diamond powder. By neutron bombardment in the nuclear reactor, or Prompt Gamma Neutron Activation Analysis, the samples are examined for parts per million amounts of hydrogen in the sample. Sodium Fluoride surface treatment allows for higher mass percentage of stored hydrogen in a reliable, resistant structure, such as diamond for fuel cells and permanently alters the diamonds terminal bonds for re-use in the effective storage of hydrogen. The highest stored amount utilizing the NaF plasma surface treatment was 22229 parts per million of hydrogen in the diamond powder which amounts to 2.2229% mass increase.

Leal, David A.; Leal-Quiros, E. [Mechanical Engineering, Polytechnic University of Puerto Rico (Puerto Rico); Velez, Angel; Prelas, Mark A.; Gosh, Tushar [University of Missouri-Columbia, Nuclear Science and Engineering Institute (United States)

2006-12-04T23:59:59.000Z

48

Hydrogen Storage in Diamond Powder Utilizing Plasma NaF Surface Treatment for Fuel Cell Applications  

Science Journals Connector (OSTI)

Hydrogen Fuel Cells offer the vital solution to the world’s socio?political dependence on oil. Due to existing difficulty in safe and efficient hydrogen storage for fuel cells storing the hydrogen in hydrocarbon compounds such as artificial diamond is a realistic solution. By treating the surface of the diamond powder with a Sodium Fluoride plasma exposure the surface of the diamond is cleaned of unwanted molecules. Due to fluorine’s electro negativity the diamond powder is activated and ready for hydrogen absorption. These diamond powder pellets are then placed on a graphite platform that is heated by conduction in a high voltage circuit made of tungsten wire. Then the injection of hydrogen gas into chamber allows the storage of the Hydrogen on the surface of the diamond powder. By neutron bombardment in the nuclear reactor or Prompt Gamma Neutron Activation Analysis the samples are examined for parts per million amounts of hydrogen in the sample. Sodium Fluoride surface treatment allows for higher mass percentage of stored hydrogen in a reliable resistant structure such as diamond for fuel cells and permanently alters the diamonds terminal bonds for re?use in the effective storage of hydrogen. The highest stored amount utilizing the NaF plasma surface treatment was 22229 parts per million of hydrogen in the diamond powder which amounts to 2.2229% mass increase.

David A. Leal; Angel Velez; Mark A. Prelas; Tushar Gosh; E. Leal?Quiros

2006-01-01T23:59:59.000Z

49

Orchestration of Iron Homeostasis  

Science Journals Connector (OSTI)

...act simultaneously, and some are interrelated. Intestinal iron absorption increases with decreased iron stores, increased erythropoietic activity, anemia, or hypoxemia. Conversely, intestinal iron absorption decreases in the presence of inflammation — a process that contributes to the anemia of inflammation... The characterization of newly identified genes has led investigators to challenge previous models of the regulation of iron homeostasis in health and its dysregulation in disease. Drs. Robert Fleming and Bruce Bacon describe hepcidin and iron homeostasis.

Fleming R.E.; Bacon B.R.

2005-04-28T23:59:59.000Z

50

In situ investigation of tubular microbial fuel cells deployed in an aeration tank at a municipal wastewater treatment plant  

E-Print Network [OSTI]

wastewater treatment plant Fei Zhang a , Zheng Ge a , Julien Grimaud b , Jim Hurst b , Zhen He a: Microbial fuel cells Wastewater treatment Organic removal Aeration Activated sludge a b s t r a c of wastewater quality, and other operating conditions. Unlike prior lab stud- ies by others, the results

51

Marine Diatoms Survive Iron Droughts in the Ocean by Storing Iron in  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Marine Diatoms Survive Iron Droughts in Marine Diatoms Survive Iron Droughts in the Ocean by Storing Iron in Ferritin Almost all organisms require iron as a co-factor in numerous metalloproteins and enzymes. In particular, phytoplankton, which are aquatic, free-drifting, single-celled organisms that can harvest energy from the sun, have an elevated demand for iron due to the large role it plays in their photosynthetic machinery. In 30-40% of the world's oceans iron concentrations are low enough to limit the growth of phytoplankton (Martin and Fitzwater 1988; Moore et al. 2002). New sources of iron to these regions are sporadic and typically include atmospheric dust deposition or weak upwelling of deep waters. figure 1 Figure 1: A light micrograph of the marine pennate diatom Pseudo-nitzschia multiseries. Shown are one whole cell and two partial cells connected at the cell tips in a chain. The brown components of the cells are the chloroplasts. Scale bar = 5 mm. (Image courtesy of K. Holtermann)

52

Scientists Identify New Family of Iron-Based Absorber Materials for Solar Cells (Fact Sheet), NREL Highlights, Science  

SciTech Connect (OSTI)

Use of Earth-abundant materials in solar absorber films is critical for expanding the reach of photovoltaic (PV) technologies. The use of Earth-abundant and inexpensive Fe in PV was proposed more than 25 years ago in the form of FeS{sub 2} pyrite - fool's gold. Unfortunately, the material has been plagued by performance problems that to this day are both persistent and not well understood. Researchers from the National Renewable Energy Laboratory (NREL) and Oregon State University, working collaboratively in the Center for Inverse Design, an Energy Frontier Research Center, have uncovered several new insights into the problems of FeS{sub 2}. They have used these advances to propose and implement design rules that can be used to identify new Fe-containing materials that can circumvent the limitations of FeS{sub 2} pyrite. The team has identified that it is the unavoidable metallic secondary phases and surface defects coexisting near the FeS{sub 2} thin-film surfaces and grain boundaries that limit its open-circuit voltage, rather than the S vacancies in the bulk, which has long been commonly assumed. The materials Fe{sub 2}SiS{sub 4} and Fe{sub 2}GeS{sub 4} hold considerable promise as PV absorbers. The ternary Si compound is especially attractive, as it contains three of the more abundant low-cost elements available today. The band gap (E{sub g} = 1.5 eV) from both theory and experiment is higher than those of c-Si and FeS{sub 2}, offering better absorption of the solar spectrum and potentially higher solar cell efficiencies. More importantly, these materials do not have metallic secondary phase problems as seen in FeS{sub 2}. High calculated formation energies of donor-type defects are consistent with p-type carriers in thin films and are prospects for high open-circuit voltages in cells.

Not Available

2011-10-01T23:59:59.000Z

53

Effect of simultaneous electrical and thermal treatment on the performance of bulk heterojunction organic solar cell blended with organic salt  

SciTech Connect (OSTI)

This work presents the influence of simultaneous electrical and thermal treatment on the performance of organic solar cell blended with organic salt. The organic solar cells were composed of indium tin oxide as anode, poly[2-methoxy-5-(2-ethylhexyloxy)-1,4-phenylenevinylene]: (6,6)-phenyl-C61 butyric acid methyl ester: tetrabutylammonium hexafluorophosphate blend as organic active layer and aluminium as cathode. The devices underwent a simultaneous fixed-voltage electrical and thermal treatment at different temperatures of 25, 50 and 75 °C. It was found that photovoltaic performance improved with the thermal treatment temperature. Accumulation of more organic salt ions in the active layer leads to broadening of p-n doped regions and hence higher built-in electric field across thin intrinsic layer. The simultaneous electrical and thermal treatment has been shown to be able to reduce the electrical treatment voltage.

Sabri, Nasehah Syamin; Yap, Chi Chin; Yahaya, Muhammad [School of Applied Physics, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia); Salleh, Muhamad Mat [Institute of Microengineering and Nanoelectronics (IMEN), Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2013-11-27T23:59:59.000Z

54

Persistence of gamma-H2AX and 53BP1 foci in proliferating and nonproliferating human mammary epithelial cells after exposure to gamma-rays or iron ions  

SciTech Connect (OSTI)

To investigate {gamma}-H2AX (phosphorylated histone H2AX) and 53BP1 (tumour protein 53 binding protein No. 1) foci formation and removal in proliferating and non-proliferating human mammary epithelial cells (HMEC) after exposure to sparsely and densely ionizing radiation under different cell culture conditions. HMEC cells were grown either as monolayers (2D) or in extracellular matrix to allow the formation of acinar structures in vitro (3D). Foci numbers were quantified by image analysis at various time points after exposure. Our results reveal that in non-proliferating cells under 2D and 3D cell culture conditions, iron-ion induced {gamma}-H2AX foci were still present at 72 h after exposure, although 53BP1 foci returned to control levels at 48 h. In contrast in proliferating HMEC, both {gamma}-H2AX and 53BP1 foci decreased to control levels during the 24-48 h time interval after irradiation under 2D conditions. Foci numbers decreased faster after {gamma}-ray irradiation and returned to control levels by 12 h regardless of marker, cell proliferation status, and cell culture condition. Conclusions: The disappearance of radiation induced {gamma}-H2AX and 53BP1 foci in HMEC have different dynamics that depend on radiation quality and proliferation status. Notably, the general patterns do not depend on the cell culture condition (2D versus 3D). We speculate that the persistent {gamma}-H2AX foci in iron-ion irradiated non-proliferating cells could be due to limited availability of double strand break (DSB) repair pathways in G0/G1-phase, or that repair of complex DSB requires replication or chromatin remodeling.

Groesser, Torsten; Chang, Hang; Fontenay, Gerald; Chen, James; Costes, Sylvain V.; Barcellos-Hoff, Mary Helen; Parvin, Bahram; Rydberg, Bjorn

2010-12-22T23:59:59.000Z

55

Characterization of temperature profile in furnace and solubility of iron in silicon  

E-Print Network [OSTI]

A better understanding of the behavior of impurities, such as iron, in silicon can lead to increases in solar cell efficiency. The purpose of this thesis was to study the behavior of iron in silicon via three sub-tasks: ...

Modi, Vrajesh Y

2011-01-01T23:59:59.000Z

56

Alkyl Surface Treatments of Planar Zinc Oxide in Hybrid Organic/Inorganic Solar Cells  

SciTech Connect (OSTI)

Hybrid organic/inorganic solar cells have not lived up to their potential because of poor interface properties. Interfacial molecular layers provide a way of adjusting these devices to improve their performance. We have studied a prototypical system involving poly(3-hexylthiophene) (P3HT) on planar zinc oxide (ZnO) films that have been modified with two types of molecules having identical 18-carbon alkyl chain termination and different surface attachments: octadecanethiol (ODT) and octadecyltriethoxysilane (OTES). We examined the functionalized surfaces using water contact angle measurements, Kelvin probe measurements, infrared absorbance spectroscopy, and atomic force microscopy. These have shown that OTES forms disordered incomplete monolayers, while ODT is prone to develop multilayered islands. Both treatments enhance polymer ordering. However, inverted solar cell devices fabricated with these treated interfaces performed very differently. ODT improves the short circuit current (J{sub SC}), open circuit voltage (V{sub OC}), and power conversion efficiency ({eta}), while these parameters all decrease in devices constructed from OTES-treated ZnO. The differences in V{sub OC} are related to modifications of the surface dipole associated with deposition of the two types of alkyl molecules, while changes in J{sub SC} are attributed to a balance between charge transfer blocking caused by the saturated hydrocarbon and the improved hole mobility in the polymer.

Allen, C. G.; Baker, D. J.; Brenner, T. M.; Weigand, C. C.; Albin, J. M.; Steirer, K. X.; Olson, D. C.; Ladam, C.; Ginley, D. S.; Collins, R. T.; Furtak, T. E.

2012-04-26T23:59:59.000Z

57

A Cell-Based High-Throughput Screen for Novel Chemical Inducers of Fetal Hemoglobin for Treatment of Hemoglobinopathies  

E-Print Network [OSTI]

treatment for sickle cell disease (SCD) is increased fetal hemoglobin (HbF). Identification of a drug specific for inducing c-globin expression in pediatric and adult patients, with minimal off-target effects, continues to be an elusive goal. One hurdle has..., Kansas, United States of America ¤c Current address: SRI International, Harrisonburg, Virginia, United States of America Introduction Sickle cell disease (SCD) is the most common monogenetic disease diagnosed in the United States, affecting approximately...

Peterson, Kenneth R.; Costa, Flá via C.; Fedosyuk, Halyna; Neades, Renee Y.; Chazelle, Allen M.; Zelenchuk, Lesya; Fonteles, Andrea H.; Dalal, Parmita; Roy, Anuradha; Chaguturu, Rathnam; Li, Biaoru; Pace, Betty S.

2014-09-16T23:59:59.000Z

58

Construction Summary and As-Built Report for Ground Water Treatment System  

Broader source: Energy.gov (indexed) [DOE]

Construction Summary and As-Built Report for Ground Water Treatment Construction Summary and As-Built Report for Ground Water Treatment System Monticello, Utah, Permeable Reactive Barrier Site Construction Summary and As-Built Report for Ground Water Treatment System Monticello, Utah, Permeable Reactive Barrier Site Construction Summary and As-Built Report for Ground Water Treatment System Monticello, Utah, Permeable Reactive Barrier Site Construction Summary and As-Built Report for Ground Water Treatment System Monticello, Utah, Permeable Reactive Barrier Site More Documents & Publications Dispersivity Testing of Zero-Valent Iron Treatment Cells: Monticello, Utah, November 2005 Through February 2008 Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable Reactive Barrier, Monticello, Utah Performance Assessment and Recommendations for Rejuvenation of a Permeable

59

Iron-air battery development program  

SciTech Connect (OSTI)

The progress and status of the research and development program on the iron-air advanced technology battery system at the Westinghouse Electric Corporation during the period June 1978-December 1979 are described. This advanced battery system is being developed for electric vehicle propulsion applications. Testing and evaluation of 100 cm/sup 2/ size cells was undertaken while individual iron and air electrode programs continued. Progress is reported in a number of these study areas. Results of the improvements made in the utilization of the iron electrode active material coupled with manufacturing and processing studies related to improved air electrodes continue to indicate that a fully developed iron-air battery system will be capable of fulfilling the performance requirements for commuter electric vehicles.

Buzzelli, E.S.; Liu, C.T.; Bryant, W.A.

1980-05-01T23:59:59.000Z

60

A New Method for Quantitative Marking of Deposited Lithium via Chemical Treatment on Graphite Anodes in Lithium-Ion Cells  

E-Print Network [OSTI]

A New Method for Quantitative Marking of Deposited Lithium via Chemical Treatment on Graphite Anodes in Lithium-Ion Cells Yvonne Krämer*[a] , Claudia Birkenmaier[b] , Julian Feinauer[a,c] , Andreas*[e] and Thomas Schleid[f] Abstract: A novel approach for the marking of deposited lithium on graphite anodes from

Schmidt, Volker

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Iron oxide nanoparticle-based theranostics for cancer imaging and therapy  

Science Journals Connector (OSTI)

Theranostic platform, which is equipped with both diagnostic and therapeutic functions, is a promising approach in cancer treatment. From various nanotheranostics studied, iron oxide nanoparticles have advantages...

Xiaoqing Ren; Hongwei Chen; Victor Yang…

2014-09-01T23:59:59.000Z

62

E-Print Network 3.0 - assessing iron stores Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

stored iron in the cells was utilized and its concentration decreased (Fig. 6). By late exponential phase... was assessed (Supplemental Table II). Figure 6. ... Source: Pakrasi,...

63

Human metastatic melanoma cell lines express high levels of growth hormone receptor and respond to GH treatment  

SciTech Connect (OSTI)

Highlights: •Most cancer types of the NCI60 have sub-sets of cell lines with high GHR expression. •GHR is highly expressed in melanoma cell lines. •GHR is elevated in advanced stage IV metastatic tumors vs. stage III. •GH treatment of metastatic melanoma cell lines alters growth and cell signaling. -- Abstract: Accumulating evidence implicates the growth hormone receptor (GHR) in carcinogenesis. While multiple studies show evidence for expression of growth hormone (GH) and GHR mRNA in human cancer tissue, there is a lack of quantification and only a few cancer types have been investigated. The National Cancer Institute’s NCI60 panel includes 60 cancer cell lines from nine types of human cancer: breast, CNS, colon, leukemia, melanoma, non-small cell lung, ovarian, prostate and renal. We utilized this panel to quantify expression of GHR, GH, prolactin receptor (PRLR) and prolactin (PRL) mRNA with real-time RT qPCR. Both GHR and PRLR show a broad range of expression within and among most cancer types. Strikingly, GHR expression is nearly 50-fold higher in melanoma than in the panel as a whole. Analysis of human metastatic melanoma biopsies confirmed GHR gene expression in melanoma tissue. In these human biopsies, the level of GHR mRNA is elevated in advanced stage IV tumor samples compared to stage III. Due to the novel finding of high GHR in melanoma, we examined the effect of GH treatment on three NCI60 melanoma lines (MDA-MB-435, UACC-62 and SK-MEL-5). GH increased proliferation in two out of three cell lines tested. Further analysis revealed GH-induced activation of STAT5 and mTOR in a cell line dependent manner. In conclusion, we have identified cell lines and cancer types that are ideal to study the role of GH and PRL in cancer, yet have been largely overlooked. Furthermore, we found that human metastatic melanoma tumors express GHR and cell lines possess active GHRs that can modulate multiple signaling pathways and alter cell proliferation. Based on this data, GH could be a new therapeutic target in melanoma.

Sustarsic, Elahu G. [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States) [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States); Department of Biological Sciences, Ohio University, Athens, OH (United States); Junnila, Riia K. [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States)] [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States); Kopchick, John J., E-mail: kopchick@ohio.edu [Edison Biotechnology Institute, 1 Watertower Drive, Athens, OH (United States); Department of Biological Sciences, Ohio University, Athens, OH (United States); Department of Biomedical Sciences, Heritage College of Osteopathic Medicine, Ohio University, Athens, OH (United States)

2013-11-08T23:59:59.000Z

64

Carbonate fuel cell anodes  

DOE Patents [OSTI]

A molten alkali metal carbonates fuel cell porous anode of lithium ferrite and a metal or metal alloy of nickel, cobalt, nickel/iron, cobalt/iron, nickel/iron/aluminum, cobalt/iron/aluminum and mixtures thereof wherein the total iron content including ferrite and iron of the composite is about 25 to about 80 percent, based upon the total anode, provided aluminum when present is less than about 5 weight percent of the anode. A process is described for production of the lithium ferrite containing anode by slipcasting.

Donado, R.A.; Hrdina, K.E.; Remick, R.J.

1993-04-27T23:59:59.000Z

65

Cell treatment and surface functionalization using the atmospheric pressure glow discharge plasma torch (APGD-t).  

E-Print Network [OSTI]

??The atmospheric pressure glow discharge plasma torch (APGD-t ) was used to treat cell cultures to investigate potential reactions with biological tissue. The plasma jet… (more)

Yonson, Sara.

2006-01-01T23:59:59.000Z

66

The Rusting of Iron  

Science Journals Connector (OSTI)

... glass tubes instead of flasks, and the surface of the metal was in some cases roughened with a coarse file. After the admission of the iron, the tubes were drawn ...

J. NEWTON FRIEND

1906-09-27T23:59:59.000Z

67

Ceramide Generation in Response to Photodynamic Treatment of L5178Y Mouse Lymphoma Cells  

Science Journals Connector (OSTI)

...N-acetyl-dihydrosphingosine; DAG, diacylglycerol; DETAPAC, diethylenetriamine pentaacetic acid; LED, light-emitting diode; LSM, low-serum medium; LY-R, L5178Y-R; PDT, photodynamic treatment; SAPK, stress-activated protein...

Duska Separovic; Jin He; Nancy L. Oleinick

1997-05-01T23:59:59.000Z

68

Expression of EGFR Under Tumor Hypoxia: Identification of a Subpopulation of Tumor Cells Responsible for Aggressiveness and Treatment Resistance  

SciTech Connect (OSTI)

Purpose: Overexpression of epidermal growth factor receptor (EGFR) and tumor hypoxia have been shown to correlate with worse outcome in several types of cancer including head-and-neck squamous cell carcinoma. Little is known about the combination and possible interactions between the two phenomena. Methods and Materials: In this study, 45 cases of histologically confirmed squamous cell carcinomas of the head and neck were analyzed. All patients received intravenous infusions of the exogenous hypoxia marker pimonidazole prior to biopsy. Presence of EGFR, pimonidazole binding, and colocalization between EGFR and tumor hypoxia were examined using immunohistochemistry. Results: Of all biopsies examined, respectively, 91% and 60% demonstrated EGFR- and pimonidazole-positive areas. A weak but significant association was found between the hypoxic fractions of pimonidazole (HFpimo) and EGFR fractions (F-EGFR) and between F-EGFR and relative vascular area. Various degrees of colocalization between hypoxia and EGFR were found, increasing with distance from the vasculature. A high fraction of EGFR was correlated with better disease-free and metastasis-free survival, whereas a high degree of colocalization correlated with poor outcome. Conclusions: Colocalization of hypoxia and EGFR was demonstrated in head-and-neck squamous cell carcinomas, predominantly at longer distances from vessels. A large amount of colocalization was associated with poor outcome, which points to a survival advantage of hypoxic cells that are also able to express EGFR. This subpopulation of tumor cells might be indicative of tumor aggressiveness and be partly responsible for treatment resistance.

Hoogsteen, Ilse J., E-mail: i.hoogsteen@rther.umcn.nl [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Marres, Henri A.M.; Hoogen, Franciscus J.A. van den [Department of Otorhinolaryngology/Head-Neck Surgery, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Rijken, Paul F.J.W.; Lok, Jasper; Bussink, Johan; Kaanders, Johannes H.A.M. [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)

2012-11-01T23:59:59.000Z

69

Biofuels from Bacteria, Electricity, and CO2: Biofuels from CO2 Using Ammonia or Iron-Oxidizing Bacteria in Reverse Microbial Fuel Cells  

SciTech Connect (OSTI)

Electrofuels Project: Electrofuels Project: Columbia University is using carbon dioxide (CO2) from ambient air, ammonia—an abundant and affordable chemical, and a bacteria called N. europaea to produce liquid fuel. The Columbia University team is feeding the ammonia and CO2 into an engineered tank where the bacteria live. The bacteria capture the energy from ammonia and then use that energy to convert CO2 into a liquid fuel. When the bacteria use up all the ammonia, renewable electricity can regenerate it and pump it back into the system—creating a continuous fuel-creation cycle. In addition, Columbia University is also working with the bacteria A. ferrooxidans to capture and use energy from ferrous iron to produce liquid fuels from CO2.

None

2010-07-01T23:59:59.000Z

70

On the possible benefits of a hybrid VMAT technique in the treatment of non–small cell lung cancer  

SciTech Connect (OSTI)

To assess, using clinical cases, the potential of a hybrid technique for the treatment of non–small cell lung cancer (NSCLC)-blending volumetric-modulated arc therapy (VMAT) and conformal radiation therapy (CRT) fields, and to consider potential issues with implementation of such a technique. Eight clinical cases already treated with CRT were used for a planning study comparing target coverage and organs at risk (OAR) sparing between CRT and hybrid VMAT (VMATh). Quality assurance (QA) implications of the resultant hybrid plans are discussed. The hybrid technique resulted in superior target conformity or improved sparing of OAR or both. The hybrid technique shows promise, but the QA implications of motion at treatment need careful consideration.

Agapito, John, E-mail: john_agapito@wrh.on.ca

2013-01-01T23:59:59.000Z

71

Iron Pots and Kettles  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Pots and Kettles Iron Pots and Kettles Nature Bulletin No. 544-A November 16, 1974 Forest Preserve District of Cook County George W. Dunne, President Roland F. Eisenbeis, Supt. of Conservation IRON POTS AND KETTLES At Possum Trot Hill, on US 150 west of Danville, a huge iron kettle squats as a monument to what was once an important industry in Illinois. It is one of 80 used from 1824 to 1831 for boiling down brine from salt springs in that vicinity. Salt was a luxury then. About a bushel was produced from one kettleful (100 gallons) of brine and that was worth more than 100 bushels of oats. Those 80 monsters came from Kentucky where iron works had been established to make the utensils and implements desperately needed by pioneer families. About half of them had come up through the Cumberland Gap, on horseback, with only a rifle, an ax, a pot for cooking, some bedding and the clothes on their backs. Every family, in addition to a skillet or spider, and a Dutch oven, coveted a big kettle for making salt, soap, candles and maple syrup, butchering hogs, rendering lard, boiling clothes on wash day, and dyeing homespun material for garments.

72

Retinoblastoma 94 Enhances Radiation Treatment of Esophageal Squamous Cell Carcinoma in Vitro and in Vivo  

Science Journals Connector (OSTI)

......ionizing radiation (IR) was car- ried out both in vitro and...head and neck squamous cell car- cinoma and bladder cancer...we constructed replication-defective adenoviral vector containing...with tumor invasion in gastric car- cinoma. World J Gastroenterol......

Heng Zhang; Jin Li; Yue-ying Wang; Ai-min Meng; Qiang Liu; Lei Wang; Feng-hua Chen; Xiao-chun Wang; Zhi-bin Zhai; Yue Fu; Qin Wang

2012-01-01T23:59:59.000Z

73

Response of zinc, iron and copper status parameters to supplementation with zinc or zinc and iron in women  

SciTech Connect (OSTI)

Supplementation with zinc at levels available over-the-counter may compromise iron or copper status. This study examined the effects of zinc(50mg/day) or zinc and iron(50 mg each/day) on 18 women aged 25-40. Subjects were matched on initial levels of serum ferritin(SF) and erythrocyte superoxide dismutase(ESOD) and randomly assigned to Group Z (zinc) or F-Z (iron and zinc). The following were measured pretreatment and after 6 and 10 weeks treatment: serum zinc (BZ), salivary sediment zinc (SSZ), hemoglobin (Hgb), hematocrit (Hct), SF, serum ceruloplasmin (Cp) and ESOD. Effects of treatment and weeks of treatment on changes from initial blood and saliva levels were analyzed using AOV. BZ increased (P=0.0144) and ESOD decreased (P=0.0001) with weeks of treatment. Differences due to treatment are presented. No effects were noted on Hgb, Hct or Cp. Intakes of zinc supplements at about 4X RDA appear to decrease copper(ESOD) and iron(SF) status. Use of iron w/zinc may be protective for FE but not Cu, and may compromise zinc (SSZ) status.

Yadrick, K.; Kenney, M.A.; Winterfeldt, E.

1986-03-05T23:59:59.000Z

74

It's Elemental - The Element Iron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Manganese Manganese Previous Element (Manganese) The Periodic Table of Elements Next Element (Cobalt) Cobalt The Element Iron [Click for Isotope Data] 26 Fe Iron 55.845 Atomic Number: 26 Atomic Weight: 55.845 Melting Point: 1811 K (1538°C or 2800°F) Boiling Point: 3134 K (2861°C or 5182°F) Density: 7.874 grams per cubic centimeter Phase at Room Temperature: Solid Element Classification: Metal Period Number: 4 Group Number: 8 Group Name: none What's in a name? From the Anglo-Saxon word iron. Iron's chemical symbol comes from the Latin word for iron, ferrum. Say what? Iron is pronounced as EYE-ern. History and Uses: Archaeological evidence suggests that people have been using iron for at least 5000 years. Iron is the cheapest and one of the most abundant of all metals, comprising nearly 5.6% of the earth's crust and nearly all of the

75

Effect of hydrophilic treatment of microporous layer on fuel cell performance  

SciTech Connect (OSTI)

The gas diffusion layer in a polymer electrolyte fuel cell is the component primarily responsible for effective water management under a wide variety of conditions. The incorporation of hydrophilic alumosilicate fibers in the microporous layer leads to an improvement in the fuel cell performance associated with a decrease in the mass transport resistance especially under high RH operation. This improvement in performance is obtained without sacrificing performance under low RH conditions. The alumosilicate fibers create domains that wick liquid water away from the catalyst layer. The improved mass transport performance is corroborated by AC impedance and neutron radiography analysis and is consistent with an increase in the average pore diameter inside the microporous layer.

Mukundan, Rangachary [Los Alamos National Laboratory; Davey, John R [Los Alamos National Laboratory; Fairweather, Joseph D [Los Alamos National Laboratory; Borup, Rodney L [Los Alamos National Laboratory; Spernjak, Dusan [Los Alamos National Laboratory; Spendelow, Jacob [Los Alamos National Laboratory; Hussey, Daniel S [NIST; Jacobson, David L [NIST; Wilde, Peter [GERMANY; Schweiss, Ruediger [GERMANY

2010-01-01T23:59:59.000Z

76

Fabrication, Tuning, Treatment and Testing of Two 3.5 Cell Photo-Injector Cavities for the ELBE Linac  

SciTech Connect (OSTI)

As part of a CRADA (Cooperative Research and Development Agreement) between Helmholtz-Zentrum Dresden-Rossendorf (HZDR) and Thomas Jefferson Lab National Accelerator Facility (TJNAF) we have fabricated and tested two 1.3 GHz 3.5 cell photo-injector cavities from polycrystalline RRR niobium and large grain RRR niobium, respectively. The cavity with the better performance will replace the presently used injector cavity in the ELBE linac. The cavities have been fabricated and pre-tuned at TJNAF, while the more sophisticated final field tuning, the adjustment of the external couplings and the field profile measurement of transverse electric modes for RF focusing was done at HZDR. The following standard surface treatment and the vertical test was carried out at TJNAF's production facilities. A major challenge turned out to be the rinsing of the cathode cell, which has small opening (O-slash10mm) to receive the cathode stalk. Another unexpected problem encountered after etching, since large visible defects appeared in the least accessible cathode cell. This contribution reports about our experiences, initial results and the on-going diagnostic work to understand and fix the problems.

Arnold, A. [HZDR, Dresden (Germany); Murcek, P. [HZDR, Dresden (Germany); Teichert, J. [HZDR, Dresden (Germany); Xiang, R. [HZDR, Dresden (Germany); Eremeev, G. V. [Thomas Jefferson National Accelerator Facility, Newport News, VA (United States); Kneisel, P. [Thomas Jefferson National Accelerator Facility, Newport News, VA (United States); Stirbet, M. [Thomas Jefferson National Accelerator Facility, Newport News, VA (United States); Turlington, L. [Thomas Jefferson National Accelerator Facility, Newport News, VA (United States)

2011-07-01T23:59:59.000Z

77

The Iron Chelator Dp44mT Causes DNA Damage and Selective Inhibition of Topoisomerase II? in Breast Cancer Cells  

Science Journals Connector (OSTI)

...mononuclear cells. Invest New Drugs 2008;26:169-73. 37 Attia S, Kolesar J, Mahoney MR, et al. A phase 2 consortium (P2C) trial of 3-aminopyridine-2-carboxaldehyde thiosemicarbazone (3-AP) for advanced adenocarcinoma of the pancreas...

V. Ashutosh Rao; Sarah R. Klein; Keli K. Agama; Eriko Toyoda; Noritaka Adachi; Yves Pommier; Emily B. Shacter

2009-02-01T23:59:59.000Z

78

Availability of iron from iron-storage proteins to marine phytoplankton  

Science Journals Connector (OSTI)

Genes coding for iron-storage proteins are common in DNA samples from seawater. In iron-deprived marine ecosystems, iron-storage proteins may be important ...

79

Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Charge Dosage Rate Title Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Charge Dosage Rate Publication Type Journal Article Refereed Designation Refereed LBNL Report Number LBNL-6221E Year of Publication 2013 Authors Amrose, Susan, Ashok J. Gadgil, Venkat Srinivasan, Kristin Kowolik, Marc Muller, Jessica Huang, and Robert Kostecki Journal Joournal of Environmental Science and Health, Part A: Toxic/Hazardous Substances and Environmental Engineering Volume 48 Issue 9 Pagination 1019-1030 Date Published 04/2013 Keywords arsenic, bangladesh, Cambodia, dosage rate, electrocoagulation, india, water treatment Abstract We demonstrate that electrocoagulation (EC) using iron electrodes can reduce arsenic below 10 μg/L in synthetic Bangladesh groundwater and in real groundwater from Bangladesh and Cambodia while investigating the effect of operating parameters that are often overlooked, such as charge dosage rate. We measure arsenic removal performance

80

Treatment Outcomes, Growth Height, and Neuroendocrine Functions in Patients With Intracranial Germ Cell Tumors Treated With Chemoradiation Therapy  

SciTech Connect (OSTI)

Purpose: We carried out a retrospective review of patients receiving chemoradiation therapy (CRT) for intracranial germ cell tumor (GCT) using a lower dose than those previously reported. To identify an optimal GCT treatment strategy, we evaluated treatment outcomes, growth height, and neuroendocrine functions. Methods and Materials: Twenty-two patients with GCT, including 4 patients with nongerminomatous GCT (NGGCT) were treated with CRT. The median age at initial diagnosis was 11.5 years (range, 6-19 years). Seventeen patients initially received whole brain irradiation (median dose, 19.8 Gy), and 5 patients, including 4 with NGGCT, received craniospinal irradiation (median dose, 30.6 Gy). The median radiation doses delivered to the primary site were 36 Gy for pure germinoma and 45 Gy for NGGCT. Seventeen patients had tumors adjacent to the hypothalamic-pituitary axis (HPA), and 5 had tumors away from the HPA. Results: The median follow-up time was 72 months (range, 18-203 months). The rates of both disease-free survival and overall survival were 100%. The standard deviation scores (SDSs) of final heights recorded at the last assessment tended to be lower than those at initial diagnosis. Even in all 5 patients with tumors located away from the HPA, final height SDSs decreased (p = 0.018). In 16 patients with tumors adjacent to the HPA, 8 showed metabolic changes suggestive of hypothalamic obesity and/or growth hormone deficiency, and 13 had other pituitary hormone deficiencies. In contrast, 4 of 5 patients with tumors away from the HPA did not show any neuroendocrine dysfunctions except for a tendency to short stature. Conclusions: CRT for GCT using limited radiation doses resulted in excellent treatment outcomes. Even after limited radiation doses, insufficient growth height was often observed that was independent of tumor location. Our study suggests that close follow-up of neuroendocrine functions, including growth hormone, is essential for all patients with GCT.

Odagiri, Kazumasa, E-mail: t086016a@yokohama-cu.ac.jp [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan) [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan); Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan); Omura, Motoko [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan) [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan); Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan); Hata, Masaharu [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan)] [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan); Aida, Noriko; Niwa, Tetsu [Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan)] [Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan); Ogino, Ichiro [Department of Radiology, Yokohama City University Medical Center, Yokohama (Japan)] [Department of Radiology, Yokohama City University Medical Center, Yokohama (Japan); Kigasawa, Hisato [Division of Hemato-oncology/Regeneration Medicine, Kanagawa Children's Medical Center, Yokohama (Japan)] [Division of Hemato-oncology/Regeneration Medicine, Kanagawa Children's Medical Center, Yokohama (Japan); Ito, Susumu [Department of Neurosurgery, Kanagawa Children's Medical Center, Yokohama (Japan)] [Department of Neurosurgery, Kanagawa Children's Medical Center, Yokohama (Japan); Adachi, Masataka [Department of Endocrinology, Kanagawa Children's Medical Center, Yokohama (Japan)] [Department of Endocrinology, Kanagawa Children's Medical Center, Yokohama (Japan); Inoue, Tomio [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan)] [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan)

2012-11-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Surface Treatment of NiO Hole Transport Layers for Organic Solar Cells  

SciTech Connect (OSTI)

Recent advances in the power-conversion efficiency of organic photovoltaics (OPVs) has largely been realized through the development of conjugated polymer absorber materials that provide for increased overlap with the solar spectrum as well as proper energy level offset with the electron acceptor. These allow for increased photocurrent and photovoltage, thus resulting in increased performance. Such systems could further be improved through the application of contact materials that have been tuned to minimize losses in carrier and potential losses at the charge-extraction interfaces. To date, these devices continue to use contacts that have not been optimized for the specific active layer components employed. Here, we demonstrate that the electrical and contact properties of NiO can be tuned through careful control of the deposition parameters as well as through surface treatments. The effects of the NiO thin-film processing and properties are investigated for application as a hole transport layer (HTL) in poly(3-hexylthiophene):[6,6]-phenyl-C61-butyric acid methyl ester OPV devices. Devices based on the NiO HTLs demonstrate equal performance to those employing poly(3,4-ethylenedioxythiophene):poly(styrenesulfonate) HTLs. Furthermore, the NiO HTLs enable the application of zinc-oxide-based materials as transparent electrodes.

Berry, Joseph J.; Widjonarko, N. Edwin; Bailey, Brian A.; Sigdel, Ajaya K.; Ginley, David S.; Olson, Dana C.

2010-01-01T23:59:59.000Z

82

Formation Damage due to Iron Precipitation in Acidizing Operations and Evaluating GLDA as a Chelating Agent  

E-Print Network [OSTI]

Iron control during acidizing plays a key role in the success of matrix treatment. Ferric ion precipitates in the formation once the acid is spent and the pH exceeds 1-2. Precipitation of iron (III) within the formation can cause formation damage...

Mittal, Rohit

2012-02-14T23:59:59.000Z

83

Magnetism of iron. II  

Science Journals Connector (OSTI)

A previously developed theory of the magnetism of iron, based upon the notion of a randomized exchange field, is modified and extended. It is shown that Coulomb fields arise in association with the randomized exchange field; the modification allows one to take into account these fields, which are found to change the details of the previous results without affecting the main conclusions. The theory has been extended to calculate the properties of the model at finite temperatures: the Curie temperature (1840 K), the magnetization curve, the paramagnetic susceptibility (a Curie-Weiss law), and the effective interatomic exchange coupling are calculated for iron. The magnitudes of the atomic spin moments were found to vary little up to 1.5 times the Curie temperature.

J. Hubbard

1979-12-01T23:59:59.000Z

84

The magnetism of iron  

Science Journals Connector (OSTI)

A type of theory capable of reconciling the localized- and itinerant-electron models of a ferromagnetic metal is discussed. This kind of theory contemplates a distribution of "exchange field" configurations which correspond very roughly to the spin configurations of the localized model. Computations involve thermal averages over these configurations, each configuration V having an effective energy E(V). Starting from the band structure for ferromagnetic iron, the E(V) have been estimated for certain configurations V. The results are reasonably consistent with the observed Curie temperature of iron, in spite of the presence of exchange fields ?1-2 eV, and give some suggestion of behavior characteristic of the Heisenberg model.

J. Hubbard

1979-03-01T23:59:59.000Z

85

MECS 2006- Iron and Steel  

Broader source: Energy.gov [DOE]

Manufacturing Energy and Carbon Footprint for Iron and Steel Sector (NAICS 3311, 3312) with Total Energy Input, October 2012 (MECS 2006)

86

Iron and Steel (2010 MECS)  

Broader source: Energy.gov [DOE]

Manufacturing Energy and Carbon Footprint for Iron and Steel Sector (NAICS 3311, 3312) Energy use data source: 2010 EIA MECS (with adjustments) Footprint Last Revised: February 2014

87

Seal welded cast iron nuclear waste container  

DOE Patents [OSTI]

This invention identifies methods and articles designed to circumvent metallurgical problems associated with hermetically closing an all cast iron nuclear waste package by welding. It involves welding nickel-carbon alloy inserts which are bonded to the mating plug and main body components of the package. The welding inserts might be bonded in place during casting of the package components. When the waste package closure weld is made, the most severe thermal effects of the process are restricted to the nickel-carbon insert material which is far better able to accommodate them than is cast iron. Use of nickel-carbon weld inserts should eliminate any need for pre-weld and post-weld heat treatments which are a problem to apply to nuclear waste packages. Although the waste package closure weld approach described results in a dissimilar metal combination, the relative surface area of nickel-to-iron, their electrochemical relationship, and the presence of graphite in both materials will act to prevent any galvanic corrosion problem.

Filippi, Arthur M. (Pittsburgh, PA); Sprecace, Richard P. (Murrysville, PA)

1987-01-01T23:59:59.000Z

88

Transcriptional and translational regulatory responses to iron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Candidatus Pelagibacter ubique cultures to iron limitation in natural seawater media supplemented with a siderophore to chelate iron. MethodologyPrincipal Findings:...

89

Kumba Iron Ore | Open Energy Information  

Open Energy Info (EERE)

Kumba Iron Ore Jump to: navigation, search Name: Kumba Iron Ore Place: Pretoria, South Africa Zip: 175 Sector: Solar Product: South Africa based mining company. The firm is...

90

Phytoestrogens in menopausal supplements induce ER-dependent cell proliferation and overcome breast cancer treatment in an in vitro breast cancer model  

SciTech Connect (OSTI)

Breast cancer treatment by the aromatase inhibitor Letrozole (LET) or Selective Estrogen Receptor Modulator Tamoxifen (TAM) can result in the onset of menopausal symptoms. Women often try to relieve these symptoms by taking menopausal supplements containing high levels of phytoestrogens. However, little is known about the potential interaction between these supplements and breast cancer treatment, especially aromatase inhibitors. In this study, interaction of phytoestrogens with the estrogen receptor alpha and TAM action was determined in an ER-reporter gene assay (BG1Luc4E2 cells) and human breast epithelial tumor cells (MCF-7). Potential interactions with aromatase activity and LET were determined in human adrenocorticocarcinoma H295R cells. We also used the previously described H295R/MCF-7 co-culture model to study interactions with steroidogenesis and tumor cell proliferation. In this model, genistein (GEN), 8-prenylnaringenin (8PN) and four commercially available menopausal supplements all induced ER-dependent tumor cell proliferation, which could not be prevented by physiologically relevant LET and 4OH-TAM concentrations. Differences in relative effect potencies between the H295R/MCF-7 co-culture model and ER-activation in BG1Luc4E2 cells, were due to the effects of the phytoestrogens on steroidogenesis. All tested supplements and GEN induced aromatase activity, while 8PN was a strong aromatase inhibitor. Steroidogenic profiles upon GEN and 8PN exposure indicated a strong inhibitory effect on steroidogenesis in H295R cells and H295R/MCF-7 co-cultures. Based on our in vitro data we suggest that menopausal supplement intake during breast cancer treatment should better be avoided, at least until more certainty regarding the safety of supplemental use in breast cancer patients can be provided. - Highlights: • Supplements containing phytoestrogens are commonly used by women with breast cancer. • Phytoestrogens alter steroidogenesis in a co-culture breast cancer model. • Letrozole or tamoxifen treatment is used to inhibit ER-dependent breast tumor growth. • Phytoestrogens induce in vitro tumor cell growth, even in combination with LET or TAM. • Use of phytoestrogens during breast cancer treatment should better be avoided.

Duursen, Majorie B.M. van, E-mail: M.vanDuursen@uu.nl [Endocrine Toxicology, Institute for Risk Assessment Sciences, Utrecht University, Yalelaan 104, PO Box 80177, 3508 TD, Utrecht (Netherlands); Smeets, Evelien E.J.W. [Endocrine Toxicology, Institute for Risk Assessment Sciences, Utrecht University, Yalelaan 104, PO Box 80177, 3508 TD, Utrecht (Netherlands); Rijk, Jeroen C.W. [RIKILT - Institute for Food Safety, Wageningen UR, P.O. Box 230, 6700 AE, Wageningen (Netherlands); Nijmeijer, Sandra M.; Berg, Martin van den [Endocrine Toxicology, Institute for Risk Assessment Sciences, Utrecht University, Yalelaan 104, PO Box 80177, 3508 TD, Utrecht (Netherlands)

2013-06-01T23:59:59.000Z

91

Multifunctional superparamagnetic iron oxide nanoparticles: Promising tools in cancer theranostics  

Science Journals Connector (OSTI)

Abstract Iron-oxide nanoparticles of small dimensions that have superparamagnetic properties show immense potential to revolutionize the future of cancer theranostics, the combinatorial diagnosis and therapeutic approach towards cancer. Superparamagnetic iron-oxide nanoparticles (SPIONs) have unique magnetic properties, due to which they show excellent tumor-targeting efficiency, and this paves the way for effective personalized cancer treatment. The aim of this review is to focus on the ability of \\{SPIONs\\} to perform multiple roles in the field of cancer biology, such as in diagnosis, monitoring, targeting and therapy. Also, other topics are discussed, including the synthesis of SPIONs, the challenges and recent advances.

Poornima Budime Santhosh; Nataša Poklar Ulrih

2013-01-01T23:59:59.000Z

92

Characterization of Urinary Iron Loss in the fsn (flaky skin) Anemia Mouse Mutant  

E-Print Network [OSTI]

Iron overloading is a serious medical problem for blood transfusion-dependent diseases such as sickle cell disease, ?–Thalassemia Major, and Myelodysplastic syndromes which require chronic blood transfusions to treat their related...

Kress, Robert Lee

2014-08-31T23:59:59.000Z

93

Electrochemical cell  

DOE Patents [OSTI]

An improved secondary electrochemical cell is disclosed having a negative electrode of lithium aluminum, a positive electrode of iron sulfide, a molten electrolyte of lithium chloride and potassium chloride, and the combination that the fully charged theoretical capacity of the negative electrode is in the range of 0.5-1.0 that of the positive electrode. The cell thus is negative electrode limiting during discharge cycling. Preferably, the negative electrode contains therein, in the approximate range of 1-10 volume % of the electrode, an additive from the materials of graphitized carbon, aluminum-iron alloy, and/or magnesium oxide.

Kaun, Thomas D. (New Lenox, IL)

1984-01-01T23:59:59.000Z

94

Verification of Steelmaking Slags Iron Content Final Technical Progress Report  

SciTech Connect (OSTI)

The steel industry in the United States generates about 30 million tons of by-products each year, including 6 million tons of desulfurization and BOF/BOP slag. The recycling of BF (blast furnace) slag has made significant progress in past years with much of the material being utilized as construction aggregate and in cementitious applications. However, the recycling of desulfurization and BOF/BOP slags still faces many technical, economic, and environmental challenges. Previous efforts have focused on in-plant recycling of the by-products, achieving only limited success. As a result, large amounts of by-products of various qualities have been stockpiled at steel mills or disposed into landfills. After more than 50 years of stockpiling and landfilling, available mill site space has diminished and environmental constraints have increased. The prospect of conventionally landfilling of the material is a high cost option, a waste of true national resources, and an eternal material liability issue. The research effort has demonstrated that major inroads have been made in establishing the viability of recycling and reuse of the steelmaking slags. The research identified key components in the slags, developed technologies to separate the iron units and produce marketable products from the separation processes. Three products are generated from the technology developed in this research, including a high grade iron product containing about 90%Fe, a medium grade iron product containing about 60% Fe, and a low grade iron product containing less than 10% Fe. The high grade iron product contains primarily metallic iron and can be marketed as a replacement of pig iron or DRI (Direct Reduced Iron) for steel mills. The medium grade iron product contains both iron oxide and metallic iron and can be utilized as a substitute for the iron ore in the blast furnace. The low grade iron product is rich in calcium, magnesium and iron oxides and silicates. It has a sufficient lime value and can be utilized for acid mine drainage treatment. Economic analysis from this research demonstrates that the results are favorable. The strong demand and the increase of price of the DRI and pig iron in recent years are particularly beneficial to the economics. The favorable economics has brought commercial interests. ICAN Global has obtained license agreement on the technology from Michigan Tech. This right was later transferred to the Westwood Land, Inc. A demonstration pilot plant is under construction to evaluate the technology. Steel industry will benefit from the new supply of the iron units once the commercial plants are constructed. Environmental benefits to the public and the steel industry will be tremendous. Not only the old piles of the slag will be removed, but also the federal responsible abandoned mines from the old mining activities can be remediated with the favorable product generated from the process. Cost can be reduced and there will be no lime required, which can avoid the release of carbon dioxide from lime production process.

J.Y. Hwang

2006-10-04T23:59:59.000Z

95

Computer Simulation and Comparison of Proton and Carbon Ion Treatment of Tumor Cells Using Particle and Heavy Ion Transport Code System  

E-Print Network [OSTI]

COMPUTER SIMULATION AND COMPARISON OF PROTON AND CARBON ION TREATMENT OF TUMOR CELLS USING PARTICLE AND HEAVY ION TRANSPORT CODE SYSTEM A Thesis by KEEL BRANDON CURTIS Submitted to the Office of Graduate Studies of Texas A... AND HEAVY ION TRANSPORT CODE SYSTEM A Thesis by KEEL BRANDON CURTIS Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved by: Chair...

Curtis, Keel Brandon

2011-02-22T23:59:59.000Z

96

Predictive Treatment Management: Incorporating a Predictive Tumor Response Model Into Robust Prospective Treatment Planning for Non-Small Cell Lung Cancer  

SciTech Connect (OSTI)

Purpose: We hypothesized that a treatment planning technique that incorporates predicted lung tumor regression into optimization, predictive treatment planning (PTP), could allow dose escalation to the residual tumor while maintaining coverage of the initial target without increasing dose to surrounding organs at risk (OARs). Methods and Materials: We created a model to estimate the geometric presence of residual tumors after radiation therapy using planning computed tomography (CT) and weekly cone beam CT scans of 5 lung cancer patients. For planning purposes, we modeled the dynamic process of tumor shrinkage by morphing the original planning target volume (PTV{sub orig}) in 3 equispaced steps to the predicted residue (PTV{sub pred}). Patients were treated with a uniform prescription dose to PTV{sub orig}. By contrast, PTP optimization started with the same prescription dose to PTV{sub orig} but linearly increased the dose at each step, until reaching the highest dose achievable to PTV{sub pred} consistent with OAR limits. This method is compared with midcourse adaptive replanning. Results: Initial parenchymal gross tumor volume (GTV) ranged from 3.6 to 186.5 cm{sup 3}. On average, the primary GTV and PTV decreased by 39% and 27%, respectively, at the end of treatment. The PTP approach gave PTV{sub orig} at least the prescription dose, and it increased the mean dose of the true residual tumor by an average of 6.0 Gy above the adaptive approach. Conclusions: PTP, incorporating a tumor regression model from the start, represents a new approach to increase tumor dose without increasing toxicities, and reduce clinical workload compared with the adaptive approach, although model verification using per-patient midcourse imaging would be prudent.

Zhang, Pengpeng, E-mail: zhangp@mskcc.org [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Yorke, Ellen; Hu, Yu-Chi; Mageras, Gig [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Rimner, Andreas [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Deasy, Joseph O. [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)

2014-02-01T23:59:59.000Z

97

Microsoft Word - S03840_MNT ZVI Treat Cells_Feb08.doc  

Broader source: Energy.gov (indexed) [DOE]

Ground-Water Table and Chemical Changes Ground-Water Table and Chemical Changes in an Alluvial Aquifer During Sustained Pumping at the Monticello, Utah, Zero-Valent Iron Treatment Cells January 2008 DOE LM/1560 2008 - - ESL RPT 2008-01 - - Work Performed nder DOE Contract No. for the U.S. Department of Energy Office of Legacy Management. by the S.M. Stoller Corporation u DE AC01 02GJ79491 - - Approved for public release; distribution is unlimited. Environmental Sciences Laboratory Environmental Sciences Laboratory Environmental Sciences Laboratory Environmental Sciences Laboratory Environmental Sciences Laboratory This page intentionally left blank DOE-LM/1560-2007 ESL-RPT-2008-01 Ground-Water Table and Chemical Changes in an Alluvial Aquifer During Sustained Pumping at the Monticello, Utah, Zero-Valent Iron Treatment Cells

98

Method for reducing iron losses in an iron smelting process  

DOE Patents [OSTI]

A process of smelting iron that comprises the steps of: a) introducing a source of iron oxide, oxygen, nitrogen, and a source of carbonaceous fuel to a smelting reactor, at least some of said oxygen being continuously introduced through an overhead lance; b) maintaining conditions in said reactor to cause (i) at least some of the iron oxide to be chemically reduced, (ii) a bath of molten iron to be created and stirred in the bottom of the reactor, surmounted by a layer of slag, and (iii) carbon monoxide gas to rise through the slag; c) causing at least some of said carbon monoxide to react in the reactor with the incoming oxygen, thereby generating heat for reactions taking place in the reactor; and d) releasing from the reactor an offgas effluent, is run in a way that keeps iron losses in the offgas relatively low. After start-up of the process is complete, steps (a) and (b) are controlled so as to: e) keep the temperature of the molten iron at or below about 1550.degree. C. and f) keep the slag weight at or above about 0.8 tonne per square meter.

Sarma, Balu (Airmont, NY); Downing, Kenneth B. (Greenville, SC)

1999-01-01T23:59:59.000Z

99

Method for reducing iron losses in an iron smelting process  

DOE Patents [OSTI]

A process of smelting iron that comprises the steps of: (a) introducing a source of iron oxide, oxygen, nitrogen, and a source of carbonaceous fuel to a smelting reactor, at least some of said oxygen being continuously introduced through an overhead lance; (b) maintaining conditions in said reactor to cause (1) at least some of the iron oxide to be chemically reduced, (2) a bath of molten iron to be created and stirred in the bottom of the reactor, surmounted by a layer of slag, and (3) carbon monoxide gas to rise through the slag; (c) causing at least some of said carbon monoxide to react in the reactor with the incoming oxygen, thereby generating heat for reactions taking place in the reactor; and (d) releasing from the reactor an offgas effluent, is run in a way that keeps iron losses in the offgas relatively low. After start-up of the process is complete, steps (a) and (b) are controlled so as to: (1) keep the temperature of the molten iron at or below about 1550 C and (2) keep the slag weight at or above about 0.8 ton per square meter. 13 figs.

Sarma, B.; Downing, K.B.

1999-03-23T23:59:59.000Z

100

Induction of Cells with a Chondrocyte-like Phenotype by Treatment with 1?,25-Dihydroxyvitamin D3 in a Human Salivary Acinar Cell Line  

Science Journals Connector (OSTI)

...the initial treatment was changed...transmission electron microscope...in a viscous water-clear solution...recovered by dialysis and lyophilization...ice-cold distilled water and homogenized...cold distilled water and the homogenates...exhaustive dialysis against 0...days after treatment of HSG-AZA3...

Masayuki Azuma; Hitoshi Kawamata; Yasuo Kasai; Tetsuo Yanagawa; Hideo Yoshida; and Mitsunobu Sato

1989-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Iron Edison Battery Company | Open Energy Information  

Open Energy Info (EERE)

Iron Edison Battery Company Iron Edison Battery Company Jump to: navigation, search Logo: Iron Edison Battery Company Name Iron Edison Battery Company Place Lakewood, Colorado Sector Bioenergy, Carbon, Efficiency, Hydro, Renewable Energy, Solar, Wind energy Product Nickel Iron (Ni-Fe) battery systems Year founded 2011 Number of employees 1-10 Phone number 202-681-4766 Website http://ironedison.com Region Rockies Area References Iron Edison Battery Company[1] Nickel Iron Battery Specifications[2] About the company and the owners[3] Nickel Iron Battery Association[4] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Iron Edison Battery Company is a company based in Lakewood, Colorado. Iron Edison is redefining off-grid energy storage using advanced

102

Treatment of produced water by simultaneous removal of heavy metals and dissolved polycyclic aromatic hydrocarbons in a photoelectrochemical cell.  

E-Print Network [OSTI]

??Early produced water treatment technologies were developed before carbon dioxide emissions and hazardous waste discharge were recognised as operational priority. These technologies are deficient in… (more)

Igunnu, Ebenezer Temitope

2014-01-01T23:59:59.000Z

103

Fissile sample worths in the Uranium/Iron Benchmark  

SciTech Connect (OSTI)

One of the long-standing problems from LMFBR critical experiments is the central worth discrepancy, the consistent overprediction of the reactivity associated with introducing a small material sample near the center of an assembly. Reactivity (sample worth) experiments in ZPR-9, assembly 34, the Uranium/Iron Benchmark (U/Fe), were aimed at investigating this discrepancy. U/Fe had a large, single-region core whose neutronics was governed almost entirely by /sup 235/U and iron. The essentially one-dimensional plate unit cell had one 1.6 mm-wide column of 93% enriched uranium (U(93)) near the center, imbedded in about 50 mm of iron and stainless steel. The neutron spectrum was roughly comparable to that of an LMFBR, but the adjoint spectrum was much flatter than an LMFBR's. The worths of four different fissile materials were measured and the worth of U(93) was measured using several different experimental techniques.

Schaefer, R.W.; Bucher, R.G.

1983-01-01T23:59:59.000Z

104

Critical Appraisal of Acuros XB and Anisotropic Analytic Algorithm Dose Calculation in Advanced Non-Small-Cell Lung Cancer Treatments  

SciTech Connect (OSTI)

Purpose: To assess the clinical impact of the Acuros XB algorithm (implemented in the Varian Eclipse treatment-planning system) in non-small-cell lung cancer (NSCLC) cases. Methods and Materials: A CT dataset of 10 patients presenting with advanced NSCLC was selected and contoured for planning target volume, lungs, heart, and spinal cord. Plans were created for 6-MV and 15-MV beams using three-dimensional conformal therapy, intensity-modulated therapy, and volumetric modulated arc therapy with RapidArc. Calculations were performed with Acuros XB and the Anisotropic Analytical Algorithm. To distinguish between differences coming from the different heterogeneity management and those coming from the algorithm and its implementation, all the plans were recalculated assigning Hounsfield Unit (HU) = 0 (Water) to the CT dataset. Results: Differences in dose distributions between the two algorithms calculated in Water were <0.5%. This suggests that the differences in the real CT dataset can be ascribed mainly to the different heterogeneity management, which is proven to be more accurate in the Acuros XB calculations. The planning target dose difference was stratified between the target in soft tissue, where the mean dose was found to be lower for Acuros XB, with a range of 0.4% {+-} 0.6% (intensity-modulated therapy, 6 MV) to 1.7% {+-} 0.2% (three-dimensional conformal therapy, 6 MV), and the target in lung tissue, where the mean dose was higher for 6 MV (from 0.2% {+-} 0.2% to 1.2% {+-} 0.5%) and lower for 15 MV (from 0.5% {+-} 0.5% to 2.0% {+-} 0.9%). Mean doses to organs at risk presented differences up to 3% of the mean structure dose in the worst case. No particular or systematic differences were found related to the various modalities. Calculation time ratios between calculation time for Acuros XB and the Anisotropic Analytical Algorithm were 7 for three-dimensional conformal therapy, 5 for intensity-modulated therapy, and 0.2 for volumetric modulated arc therapy with RapidArc. Conclusion: The availability of Acuros XB could improve patient dose estimation, increasing the data consistency of clinical trials.

Fogliata, Antonella, E-mail: afc@iosi.ch [Medical Physics Unit, Oncology Institute of Southern Switzerland, Bellinzona (Switzerland)] [Medical Physics Unit, Oncology Institute of Southern Switzerland, Bellinzona (Switzerland); Nicolini, Giorgia; Clivio, Alessandro; Vanetti, Eugenio; Cozzi, Luca [Medical Physics Unit, Oncology Institute of Southern Switzerland, Bellinzona (Switzerland)] [Medical Physics Unit, Oncology Institute of Southern Switzerland, Bellinzona (Switzerland)

2012-08-01T23:59:59.000Z

105

Studies of magnetite nanoparticles synthesized by thermal decomposition of iron (III) acetylacetonate in tri(ethylene glycol)  

Science Journals Connector (OSTI)

In this paper, water-soluble magnetite nanoparticles have been directly synthesized by thermal decomposition of iron (III) acetylacetonate, Fe(acac)3 in tri(ethyleneglycol). Size and morphology of the nanoparticles are determined by transmission electron microscopy (TEM) and dynamic light scattering (DLS) measurements while the crystal structure is identified using X-ray diffraction (XRD). Surface charge and surface coating of the nanoparticles are recognized using Fourier transform infrared spectroscopy (FTIR), X-ray photoelectron spectra (XPS) and zeta potential measurements. Magnetic properties are determined using vibrating sample magnetometer (VSM) and superconducting quantum interference device (SQUID) measurements. The results show that as-prepared magnetite nanoparticles are relatively monodisperse, single crystalline and superparamagnetic in nature with the blocking temperature at around 100 K. The magnetite nanoparticles are found to be highly soluble in water due to steric and electrostatic interactions between the particles arising by the surface adsorbed tri(ethyleneglycol) molecules and associated positive charges, respectively. Cytotoxicity studies on human cervical (SiHa), mouse melanoma (B16F10) and mouse primary fibroblast cells demonstrate that up to a dose of 80 ?g/ml, the magnetic nanoparticles are nontoxic to the cells. Specific absorption rate (SAR) value has been calculated to be 885 and 539 W/gm for samples with the iron concentration of 1 and 0.5 mg/ml, respectively. The high SAR value upon exposure to 20 MHz radiofrequency signifies the applicability of as-prepared magnetite nanoparticles for a feasible magnetic hyperthermia treatment.

Dipak Maity; S.N. Kale; Ruchika Kaul-Ghanekar; Jun-Min Xue; Jun Ding

2009-01-01T23:59:59.000Z

106

Fabrication and processing of iron aluminides  

SciTech Connect (OSTI)

The Fe{sub 3}Al-based alloys have been shown to exhibit room-temperature ductility values of 15 to 19% by the control of composition and thermomechanical processing steps. The scale-up of one of the compositions to 2270-kg (5000-lb) electroslag-remelted (ESR) round ingot and 3272-kg (7200-lb) vacuum-induction-melted (VIM) slab ingot is described. Microstructural and mechanical property data are presented on small pieces sectioned from these ingots. The effects of final rolling temperature and the final annealing treatment on room-temperature ductility were investigated for the ESR ingot. A study of iron-aluminide binary alloys revealed that the environmental effects on room-temperature ductility values were absent for {le}8.5 wt % Al. The increasing aluminum content and the development of ordered structure resulted in increased environmental effects. Applications and a brief description of their status are described. Based on the combined property and cost advantage, continued development of iron aluminide is recommended.

Sikka, V.K.; Viswanathan, S.

1992-01-01T23:59:59.000Z

107

Fabrication and processing of iron aluminides  

SciTech Connect (OSTI)

The Fe{sub 3}Al-based alloys have been shown to exhibit room-temperature ductility values of 15 to 19% by the control of composition and thermomechanical processing steps. The scale-up of one of the compositions to 2270-kg (5000-lb) electroslag-remelted (ESR) round ingot and 3272-kg (7200-lb) vacuum-induction-melted (VIM) slab ingot is described. Microstructural and mechanical property data are presented on small pieces sectioned from these ingots. The effects of final rolling temperature and the final annealing treatment on room-temperature ductility were investigated for the ESR ingot. A study of iron-aluminide binary alloys revealed that the environmental effects on room-temperature ductility values were absent for {le}8.5 wt % Al. The increasing aluminum content and the development of ordered structure resulted in increased environmental effects. Applications and a brief description of their status are described. Based on the combined property and cost advantage, continued development of iron aluminide is recommended.

Sikka, V.K.; Viswanathan, S.

1992-07-01T23:59:59.000Z

108

Absorption of Iron from Ferritin Is Independent of Heme Iron and Ferrous Salts in Women and Rat Intestinal Segments .  

E-Print Network [OSTI]

??Ferritin iron from food is readily bioavailable to humans and has the potential for treating iron deficiency. Whether ferritin iron absorption is mechanistically different from… (more)

Theil, Elizabeth C.

2012-01-01T23:59:59.000Z

109

(Iron regulation of gene expression in the Bradyrhizobium japonicum/soybean symbiosis)  

SciTech Connect (OSTI)

We wish to address the question of whether iron plays a regulatory role in the Bradyrhizobium japonicum/soybeam symbiosis. Iron may be an important regulatory signal in planta as the bacteria must acquire iron from their plant hosts and iron-containing proteins figure prominently in all nitrogen-fixing symbioses. For example, the bacterial partner is believed to synthesize the heme moiety of leghemoglobin, which may represent as much as 25--30% of the total soluble protein in an infected plant cell. For this reason, we have focused our attention on the regulation by iron of the first step in the bacterial heme biosynthetic pathway. The enzyme which catalyzes this step, 5-aminolevulinic acid synthase, is encoded by the hemA gene which we had previously cloned and sequenced. Specific objectives include: to define the cis-acting sequences which confer iron regulation on the B. japonicum hemA gene; to identify trans-acting factors which regulate the expression of hemA by iron; to identify new loci which are transcriptionally responsive to changes in iron availability; and to examine the effects of mutations in various known regulatory genes for their effect on the expression of hemA.

Guerinot, M.L.

1992-01-01T23:59:59.000Z

110

[Iron regulation of gene expression in the Bradyrhizobium japonicum/soybean symbiosis]. Progress report  

SciTech Connect (OSTI)

We wish to address the question of whether iron plays a regulatory role in the Bradyrhizobium japonicum/soybeam symbiosis. Iron may be an important regulatory signal in planta as the bacteria must acquire iron from their plant hosts and iron-containing proteins figure prominently in all nitrogen-fixing symbioses. For example, the bacterial partner is believed to synthesize the heme moiety of leghemoglobin, which may represent as much as 25--30% of the total soluble protein in an infected plant cell. For this reason, we have focused our attention on the regulation by iron of the first step in the bacterial heme biosynthetic pathway. The enzyme which catalyzes this step, 5-aminolevulinic acid synthase, is encoded by the hemA gene which we had previously cloned and sequenced. Specific objectives include: to define the cis-acting sequences which confer iron regulation on the B. japonicum hemA gene; to identify trans-acting factors which regulate the expression of hemA by iron; to identify new loci which are transcriptionally responsive to changes in iron availability; and to examine the effects of mutations in various known regulatory genes for their effect on the expression of hemA.

Guerinot, M.L.

1992-06-01T23:59:59.000Z

111

Iron supported clay as catalysts for oxidation of cyclooctane  

Science Journals Connector (OSTI)

Iron supported bentonite clay catalysts have been prepared by the ion exchange of bentonite with iron2+ and iron3+ solution and immobilization with iron compounds using ligands: acetylacetonate, picolinate, pyraz...

W. Trakarnpruk; P. Dumrongpong

2006-05-01T23:59:59.000Z

112

Microsoft Word - IronCore  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

November/December 2013 November/December 2013 Percolation Explains How Earth's Iron Core Formed The formation of Earth's metallic core, which makes up a third of our planet's mass, represents the most significant differentiation event in Earth's history. Earth's present layered structure with a metallic core and an overlying silicate mantle would have required mechanisms to separate iron alloy from a silicate phase. Percolation of liquid iron alloy moving through a solid silicate matrix (much as water percolates through porous rock, or even coffee grinds) has been proposed as a possible model for core formation (Figure 1). Many previous experimental results have ruled out percolation as a major core formation mechanism for Earth at the relatively lower pressure conditions in the upper mantle, but

113

Ligand effects on bioinspired iron complexes  

E-Print Network [OSTI]

THE HYDROPHILIC PHOSPHATRIAZAADAMANTANE LIGAND IN THE DEVELOPMENT OF H2-PRODUCTION ELECTROCATALYSTS: IRON HYDROGENASE MODEL COMPLEXES ............................................................................................. 44 Results... THE HYDROPHILIC PHOSPHATRIAZAADAMANTANE LIGAND IN THE DEVELOPMENT OF H2-PRODUCTION ELECTROCATALYSTS: IRON HYDROGENASE MODEL COMPLEXES ............................................................................................. 44 Results...

Mejia Rodriguez, Ma. del Rosario

2005-11-01T23:59:59.000Z

114

Rare Iron Oxide in Ancient Chinese Pottery  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Rare Iron Oxide in Ancient Chinese Pottery Rare Iron Oxide in Ancient Chinese Pottery Print Friday, 26 September 2014 14:37 Jian ware (or Tenmoku) ceramic bowls, famous for their...

115

Synthesis of monodisperse iron oxide nanocrystals by thermal decomposition of iron carboxylate salts{  

E-Print Network [OSTI]

's group12 recently published a study of c-Fe2O3 nanocrystals with different shapes. Iron acetylacetonateSynthesis of monodisperse iron oxide nanocrystals by thermal decomposition of iron carboxylate September 2004 Iron oxide (Fe3O4, magnetite) nanocrystals of 6 to 30 nm with narrow size distributions (s

Richards-Kortum, Rebecca

116

Central ghrelin treatment stimulates ACTH cells in normal-fed, food-restricted and high-fed rats: An immunohistomorphometric and hormonal study  

Science Journals Connector (OSTI)

Abstract Changes in feeding regime represent serious stress, while ghrelin is considered a key player in energy balance. We investigated the effects of intracerebroventricular (ICV) ghrelin application on pituitary adrenocorticotropic (ACTH) cells in rats fed diets differing in energy content. Before the ICV treatment, male Wistar rats were subjected to three different feeding regimes for 4 weeks: normal-fed (NF), food-restricted (FR) or high-fed (HF) (n = 3 × 14). At the age of 8 weeks, rats from each group were divided into two subgroups and given ICV, either ghrelin (G; 1 ?g ghrelin/5 ?l PBS, n = 7) or solvent alone (5 ?l PBS, n = 7) every 24 h for 5 days. The immunohistochemical appearance and quantitative morphology of pituitary ACTH cells were evaluated, as well as peripheral ACTH and corticosterone levels. Central ghrelin administration increased (p < 0.05) ACTH cell volumes in GNF, GFR and GHF rats by 8.1%, 11.8% and 9.1%, respectively, compared to the controls, while significant increases in ACTH cell volume density were observed in GNF and GHF rats. Circulating ACTH and corticosterone levels were elevated (p < 0.05) in GNF and GFR rats by 72.8% and 80.8%, respectively, when compared to the corresponding controls. Thus, central ghrelin administration stimulated the pituitary-adrenal axis under preserved and negative energy balance states.

Verica Miloševi?; Vladimir Ajdžanovi?; Dejan Neši?; Vesna Star?evi?; Branko Filipovi?; Rastko Rako?evi?; Darko Stevanovi?

2013-01-01T23:59:59.000Z

117

Influence of Iron Redox Transformations on Plutonium Sorption to Sediments  

SciTech Connect (OSTI)

Plutonium subsurface mobility is primarily controlled by its oxidation state, which in turn is loosely coupled to the oxidation state of iron in the system. Experiments were conducted to examine the effect of sediment iron mineral composition and oxidation state on plutonium sorption and oxidation state. A pH 6.3 vadose zone sediment containing iron oxides and iron-containing phyllosilicates was treated with various complexants (ammonium oxalate) and reductants (dithionite-citrate-bicarbonate) to selectively leach and/or reduce iron oxide and phyllosilicate phases. Mössbauer spectroscopy was used to identify initial iron mineral composition of the sediment and monitor dissolution and reduction of iron oxides. Sorption of Pu(V) was monitored over one week for each of six treated sediment fractions. Plutonium oxidation state speciation in the aqueous and solid phases was monitored using solvent extraction, coprecipitation, and XANES. Mössbauer spectroscopy showed that the sediment contained 25-30% hematite, 60-65% Al-goethite, and <10%Fe(III) in phyllosilicate; there was no detectable Fe(II). Upon reduction with a strong chemical reductant (dithionite-citrate buffer, DCB), much of the hematite and goethite disappeared and the Fe in the phyllosilicate reduced to Fe(II). The rate of sorption was found to correlate with the 1 fraction of Fe(II) remaining within each treated sediment phase. Pu(V) was the only oxidation state measured in the aqueous phase, irrespective of treatment, whereas Pu(IV) and much smaller amounts of Pu(V) and Pu(VI) were measured in the solid phase. Surface-mediated reduction of Pu(V) to Pu(IV) occurred in treated and untreated sediment samples; Pu(V) remained on untreated sediment surface for two days before reducing to Pu(IV). Similar to the sorption kinetics, the reduction rate was correlated with sediment Fe(II) concentration. The correlation between Fe(II) concentrations and Pu(V) reduction demonstrates the potential impact of changing iron mineralogy on plutonium subsurface transport through redox transition areas. These findings should influence the conceptual models of long-term stewardship of Pu contaminated sites that have fluctuating redox conditions, such as vadose zones or riparian zones.

Hixon, Amy E.; Hu, Yung-Jin; Kaplan, Daniel I.; Kukkadapu, Ravi K.; Nitsche, Heino; Qafoku, Odeta; Powell, Brian A.

2010-10-01T23:59:59.000Z

118

Latest developments in the large-scale production of adeno-associated virus vectors in insect cells toward the treatment of neuromuscular diseases  

Science Journals Connector (OSTI)

Adeno-associated viral (AAV) vectors are gene vectors of choice for the development of gene therapy treatments for many rare diseases affecting various tissues including retina, central nervous system, liver, and muscle. The AAV based gene therapy approach became conceivable only after the development of easily scalable production systems including the Sf9 cell/baculovirus expression system. Since the establishment of the production of AAV in the Sf9/baculovirus system by the group of Rob Kotin, this new production system has largely been developed for optimizing the large scale production of different serotypes of AAV for preclinical and clinical purposes. Today this manufacturing system allows for the production of purified vector genome (vg) quantities of up to 2 × 1015 for AAV1 using a 50 L reactor and the scale up to larger reactor volumes is paralleled by a corresponding increase in the vector yield. This review presents the principles and achievements of the Sf9/baculovirus system for the production of AAV in comparison to other expression systems based on mammalian cells. In addition, new developments and improvements, which have not yet been implemented at a large scale, and perspectives for further optimization of this production system will be discussed. All of these achievements as well as further process intensifications are urgently needed for the production of clinical doses for the treatment of neuromuscular diseases for which estimated doses of up to 1014 vg/kg body mass are required.

Lionel Galibert; Otto-Wilhelm Merten

2011-01-01T23:59:59.000Z

119

Altered Telomere Nuclear Matrix Interactions and Nucleosomal Periodicity in Ataxia Telangiectasia Cells before and after Ionizing Radiation Treatment  

Science Journals Connector (OSTI)

...mean P/mean S Mean () Range () Mean () Range () RKO 71 67-75 29 25-33...significant. Influence of ionizing radiation on telomere-nuclear matrix...cells were treated with a dose of 5 Gy of ionizing radiation, and proportions of S...

Lubomir B. Smilenov; Sonu Dhar; Tej K. Pandita

1999-10-01T23:59:59.000Z

120

Wastewater Ozonation Catalyzed by Iron  

Science Journals Connector (OSTI)

Another attempt to improve ozonation removal efficiency is the use of metals or their oxides to catalyze ozonation. ... The waveforms were generated by a potentiostat BAS model Epsilon-2. ... Sreethawong, T.; Chavadej, S.Color removal of distillery wastewater by ozonation in the absence and presence of immobilized iron oxide catalyst J. Hazard. ...

Anaid Cano Quiroz; Carlos Barrera-Di?az; Gabriela Roa-Morales; Patricia Balderas Herna?ndez; Rubi? Romero; Reyna Natividad

2010-09-23T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Treatment with UDP-glucose, GDNF, and memantine promotes SVZ and white matter self-repair by endogenous glial progenitor cells in neonatal rats with ischemic PVL  

Science Journals Connector (OSTI)

Abstract Periventricular leukomalacia (PVL) is one of the foremost neurological conditions leading to long-term abnormalities in premature infants. Since it is difficult to prevent initiation of this damage in utero, promoting the innate regenerative potential of the brain after birth may provide a more feasible, prospective therapy for PVL. Treatment with UDP-glucose (UDPG), an endogenous agonist of G protein-coupled receptor 17 (GPR17) that may enhance endogenous self-repair potentiality, glial cell line-derived neurotrophic factor (GDNF), a neurotrophic factor associated with the growth and survival of nerve cells, and memantine, a noncompetitive antagonist of N-methyl-d-aspartate (NMDA) receptors that block ischemia-induced glutamate signal transduction, has been reported to achieve functional, neurological improvement in neonatal rats with PVL. The aim of the present study was to further explore whether UDPG, GDNF and/or memantine could promote corresponding self-repair of the subventricular zone (SVZ) and white matter (WM) in neonatal rats with ischemia-induced PVL. SVZ or WM tissue samples and cultured glial progenitor cells derived from a 5 day-old neonatal rat model of PVL were utilized for studying response to UDPG, GDNF and memantine in vivo and in vitro, respectively. Labeling with 5?-bromo-2?-deoxyuridine and immunofluorescent cell lineage markers after hypoxia–ischemia or oxygen–glucose deprivation (OGD) revealed that UDPG, GDNF and memantine each significantly increased glial progenitor cells and preoligodendrocytes (preOLs), as well as more differentiated immature and mature oligodendrocyte (OL), in both the SVZ and WM in vivo or in vitro. SVZ and WM glial cell apoptosis was also significantly reduced by UDPG, GDNF or memantine, both in vivo and in vitro. These results indicated that UDPG, GDNF or memantine may promote endogenous self-repair by stimulating proliferation of glial progenitor cells derived from both the SVZ and WM, activating their differentiation into more mature OLs, and raising the survival rate of these newly generated glial cells in neonatal rats with ischemic PVL.

W. Li; F. Mao; H. Chen; L. Qian; J.S. Buzby

2014-01-01T23:59:59.000Z

122

Cisplatin Treatment Induces a Transient Increase in Tumorigenic Potential Associated with High Interleukin-6 Expression in Head and Neck Squamous Cell Carcinoma  

Science Journals Connector (OSTI)

...following injection versus nontreated HNSCC cells. The CFE of the cells provided a surrogate marker for cell...calculated by dividing colony forming efficiency (CFE) of nontreated cells by CFE of treated cells and, where relevant, multiplying...

Kim J. Poth; Alexander D. Guminski; Gethin P. Thomas; Paul J. Leo; Ibtissam A. Jabbar; Nicholas A. Saunders

2010-08-01T23:59:59.000Z

123

Fuel cell and hydrogen economy  

Science Journals Connector (OSTI)

This article reviews some of the recent developments in the materials, design, and concepts for bipolar/end plates in the polymer electrolyte membrane fuel cell stack. Experimental results for the use of iron- an...

Ramana G. Reddy

2006-08-01T23:59:59.000Z

124

Performance Optimization of Metallic Iron and Iron Oxide Nanomaterials for Treatment of Impaired Water Supplies  

E-Print Network [OSTI]

S.J. ; Livi, K.J.T. ; Fairbrother, D.H. ; Roberts, A.L. ,Ball, W.P. ; O'Melia, C. ; Fairbrother, D.H. , ColloidalB.A. ; Bitter, J.L. ; Fairbrother, D.H. , Chemical and

Xie, Yang

2011-01-01T23:59:59.000Z

125

Nanostructure, Chemistry and Crystallography of Iron Nitride...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Nanostructure, Chemistry and Crystallography of Iron Nitride Magnetic Materials by Ultra-High-Resolution Electron Microscopy and Related Methods Nanostructure, Chemistry and...

126

Characterization and Reactivity of Iron Nanoparticles Prepared...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

as solute within the iron core of the HRCO particles. Kinetic batch experiments of carbon tetrachloride (CT) degradation were performed to quantitatively compare the redox...

127

Effects of austempering temperature on fatigue crack rate propagation in a series of modified (Cu, Ni, and/or Mo) nodular irons  

Science Journals Connector (OSTI)

Studies on austempered nodular cast irons were carried out to establish the optimum isothermic heat treatment at a given chemical composition that rendered the highest fatigue crack propagation resistance. Sev...

M. Martínez-Madrid; R. Rodríguez-T…

2002-12-01T23:59:59.000Z

128

Perchlorate Reduction by Autotrophic Bacteria in the Presence of Zero-Valent Iron  

Science Journals Connector (OSTI)

In a recent report by Shrout et al. (19), perchlorate removal was achieved using iron and a mixed culture obtained from the anaerobic digester sludge of a wastewater treatment plant in Iowa. ... Till et al. (26) studied nitrate reduction by steel wool in the presence of a denitrifier (Paracoccus) and noted that N2 was the main end product of the nitrate reduction. ...

Xueyuan Yu; Christopher Amrhein; Marc A. Deshusses; Mark R. Matsumoto

2006-01-14T23:59:59.000Z

129

Annealing effects on magnetic properties of silicone-coated iron-based soft magnetic composites  

E-Print Network [OSTI]

Annealing effects on magnetic properties of silicone-coated iron-based soft magnetic composites , Alex A. Volinsky b a School of Material Science and Engineering, University of Science and Technology Available online 1 October 2011 Keywords: Silicone resin Soft magnetic composites Annealing treatment

Volinsky, Alex A.

130

Degradation of polychlorinated biphenyls (PCBs) using palladized iron  

SciTech Connect (OSTI)

Contamination from polychlorinated biphenyls (PCBs) is a persistent problem within the Department of Energy complex, as well as in numerous industrial sites around the US. To date, commercially available technologies for destroying these highly stable compounds involve degradation at elevated temperatures either through incineration or base-catalyzed dehalogenation at 300{degrees}C. Since the heating required with these processes substantially increases the costs for treatment of PCB-contaminated wastes, there is a need for finding an alternative approach where PCB can be degraded at ambient temperatures. This report describes the degradation of PCB`s utilizing the bimetallic substrate of iron/palladium.

West, O.R.; Liang, L.; Holden, W.L. [and others

1996-06-01T23:59:59.000Z

131

Dose-dependent folic acid and memantine treatments promote synergistic or additive protection against A?(25–35) peptide-induced apoptosis in SH-SY5Y cells mediated by mitochondria stress-associated death signals  

Science Journals Connector (OSTI)

Abstract Increased dietary folic acid (FA) is associated with reduced risks of Alzheimer’s disease (AD). The AD drug memantine (Mn) has had limited therapeutic effects for the treatment of patients with moderate to severe AD. This study investigated whether and the underlying mechanisms by which the combination of Mn and FA may have synergistic or additive effects in protecting against amyloid-?(25–35) peptide (A?)-induced neurocytotoxicity. A? treatment of human neuroblastoma SH-SY5Y cells significantly induced a 6-fold increase of apoptotic cells compared with the A?-untreated group. Preincubation of A?-exposed cells with FA (500 ?M) or Mn (20 ?M) caused a 22% and 10% reduction of apoptotic cells, respectively, whereas the combo-treatments at such doses synergistically alleviated A?-induced apoptosis by 60% (P < 0.05). The apoptotic protection by the combo-treatments coincided with attenuating A?-elicited mitochondrial (mt) membrane depolarization and abolishing A?-induced mt cytochrome c release to the cytosol. Increased levels of FA at 1000 ?M in combination with 20 ?M Mn exerted an additive protection against A?(25–35)-induced-apoptosis as compared to the isolate Mn group (P < 0.05). The combo-treatments reversed A?-elicited mt membrane depolarization, attenuated A?-elicited mt cytochrome c release to the cytosol, and diminished A?-promoted superoxide generation. The apoptotic-protection by such combo-treatments was partially abolished by carbonyl cyanide 3-chlorophenylhydrazone (mt membrane potential uncoupler) and sodium azide (mt cytochrome c oxidase inhibitor). Taken together, the data demonstrated that dose-dependent FA and Mn synergistically or additively protected SH-SY5Y cells against A?-induced apoptosis, which was partially, if not completely, mediated by mt stress-associated death signals.

Ta-Fu Chen; Ming-Chi Tang; Chia-Hui Chou; Ming-Jang Chiu; R.-F.S. Huang

2013-01-01T23:59:59.000Z

132

Electrochemical Studies of Packed Iron Powder Electrodes: Effects...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Packed Iron Powder Electrodes: Effects of Common Constituents of Natural Waters on Corrosion Electrochemical Studies of Packed Iron Powder Electrodes: Effects of Common...

133

Bioreduction of hematite nanoparticles by the dissimilatory iron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

nanoparticles by the dissimilatory iron reducing bacterium Shewanella oneidensis MR-1. Bioreduction of hematite nanoparticles by the dissimilatory iron reducing bacterium...

134

Formation of iron complexs from trifluoroacetic acid based liquid...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of iron complexs from trifluoroacetic acid based liquid chromatography mobile phases as interference ions in liquid Formation of iron complexs from trifluoroacetic acid based...

135

Influence of Iron Redox Transformations on Plutonium Sorption...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

state of iron in the system. Experiments were conducted to examine the effect of sediment iron mineral composition and oxidation state on plutonium sorption and oxidation...

136

Biostimulation of Iron Reduction and Subsequent Oxidation of...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Biostimulation of Iron Reduction and Subsequent Oxidation of Sediment Containing Fe-silicates and Fe-oxides: Effect of Redox Biostimulation of Iron Reduction and Subsequent...

137

Demonstration of Combined Zero-Valent Iron and Electrical Resistance...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Demonstration of Combined Zero-Valent Iron and Electrical Resistance Heating for In Situ Trichloroethene Remediation. Demonstration of Combined Zero-Valent Iron and Electrical...

138

Watermelon-like iron nanoparticles: Cr doping effect on magnetism...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Watermelon-like iron nanoparticles: Cr doping effect on magnetism and magnetization interaction reversal. Watermelon-like iron nanoparticles: Cr doping effect on magnetism and...

139

Neutron Spin Resonance in Iron-based Superconductors | The Ames...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Neutron Spin Resonance in Iron-based Superconductors The propagation of a novel magnetic excitation in the superconducting state, called a spin resonance, has been observed in iron...

140

Iron is the Key to Preserving Dinosaur Soft Tissue  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

the iron associated with fossil tissues, which occurred primarily as the mineral goethite. They then employed experiments to show that iron, derived from hemoglobin lysate,...

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Microbial Reduction of Uranium under Iron- and Sulfate-reducing...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Uranium under Iron- and Sulfate-reducing Conditions: Effect of Amended Goethite on Microbial Community Microbial Reduction of Uranium under Iron- and Sulfate-reducing Conditions:...

142

Production of iron from metallurgical waste  

DOE Patents [OSTI]

A method of recovering metallic iron from iron-bearing metallurgical waste in steelmaking comprising steps of providing an iron-bearing metallurgical waste containing more than 55% by weight FeO and FeO equivalent and a particle size of at least 80% less than 10 mesh, mixing the iron-bearing metallurgical waste with a carbonaceous material to form a reducible mixture where the carbonaceous material is between 80 and 110% of the stoichiometric amount needed to reduce the iron-bearing waste to metallic iron, and as needed additions to provide a silica content between 0.8 and 8% by weight and a ratio of CaO/SiO.sub.2 between 1.4 and 1.8, forming agglomerates of the reducible mixture over a hearth material layer to protect the hearth, heating the agglomerates to a higher temperature above the melting point of iron to form nodules of metallic iron and slag material from the agglomerates by melting.

Hendrickson, David W; Iwasaki, Iwao

2013-09-17T23:59:59.000Z

143

Magnetism in iron and nickel  

Science Journals Connector (OSTI)

The fluctuating local band theory of itinerant electron ferromagnetism in nickel and iron is investigated with the use of first-principles numerical calculations. In this theory the excitations predominantly responsible for the phase transition are fluctuations in the direction of local magnetization. The free energy in the presence of a fluctuation is evaluated numerically in the approximation that this direction changes in time and space slowly enough to justify the use of the static approximation and second-order perturbation theory. The energies and wave functions used to incorporate the band and wavevector dependence of the relevant interaction matrix elements were obtained by Slater-Koster fits to earlier ab initio self-consistent energy bands. Results for nickel and iron are obtained in terms of an effective classical Heisenberg exchange. This is compared with other theoretical calculations and available experimental data. From the numerical results, it is concluded that both quantum effects (the time dependence of the exchange field) and local-field effects are important to account for the transition temperature TC.

C. S. Wang; R. E. Prange; V. Korenman

1982-05-01T23:59:59.000Z

144

The FRD3 Citrate Effluxer Promotes Iron Nutrition between Symplastically Disconnected Tissues throughout Arabidopsis Development  

Science Journals Connector (OSTI)

...vicinity by rhizodermic cells through the proton ATPase AHA2 (Santi and Schmidt, 2009...587-593. Rellan-Alvarez, R. , Giner-Martinez-Sierra, J., Orduna, J...Dissecting iron deficiency-induced proton extrusion in Arabidopsis roots. New Phytol...

Hannetz Roschzttardtz; Mathilde Séguéla-Arnaud; Jean-François Briat; Grégory Vert; Catherine Curie

2011-07-08T23:59:59.000Z

145

ENVIRONMENTAL BIOTECHNOLOGY Electricity generation and treatment of paper recycling  

E-Print Network [OSTI]

ENVIRONMENTAL BIOTECHNOLOGY Electricity generation and treatment of paper recycling wastewater production and treatment of a paper recycling plant wastewater using microbial fuel cells. Treatment. Keywords Microbial fuel cell . Paper recycling wastewater. Cellulose . Solution conductivity. Power

146

Cell Penetrating Peptide (CPP)-Conjugated Desferrioxamine for Enhanced Neuroprotection: Synthesis and in Vitro Evaluation  

Science Journals Connector (OSTI)

Enhanced access to intracellular labile iron compared to the parent siderophore was achieved in HeLa and RBE4 (a model of blood-brain-barrier) cell lines. ... DFO antioxidant and iron binding properties were preserved and its bioavailability was increased upon CPP conjugation, which opens new therapeutic possibilities for neurodegenerative processes associated with brain iron overload. ...

Dibakar Goswami; M. Teresa Machini; Daniel M. Silvestre; Cassiana S. Nomura; Breno Pannia Esposito

2014-10-09T23:59:59.000Z

147

Novel in vivo imaging techniques for trafficking the behavior of subventricular zone neural stem cells (SVZSC) and SVZSC induced functional repair  

SciTech Connect (OSTI)

Adult progenitor cells hold promise for therapeutic treatment where there has been a disabling loss of function due to death of cells from trauma, disease or aging. However, it will be essential in clinical application to be able to follow the fate of the transplanted cells over time using in vivo tracking methods. We have developed protocol for labeling of progenitor cells to monitor cell trafficking by high resolution magnetic resonance imaging (MRI) and super high resolution positron emission tomography (PET). We have transfected rat subventricular zone stem cells (SVZ, progenitor cell line) and another control cell line (PC12, pheochromocytoma cells) utilizing super paramagnetic iron oxide and poly-L-lysine complex for MR imaging or radiolabeling with 18F-fluor deoxy-D- glucose for PET imaging. The labeled cells were transplanted into the rostral migratory stream (RMS) or striatum of normal or 6-hydroxydopamine lesioned Spraque-Dawley rats. Longitudinal MRI studies (up to 40 days) showed that transplantation site has significant impact to the fate of the cells; when SVZ cells were transplanted into the RMS, cells migrated several centimeter into the olfactory bulb; after transplantation into the striatum, the migration was minimal, only 2 mm. PC 12 cells grew a massive tumor after the striatal implantation and significantly smaller tumor after the RMS implantation. PET studies conducted immediately after transplantation verified the transplantation site. MRI studies were able to show the whole path of migration in one image, since part of the cells die during migration and will get detected because of iron content. Endpoint histological studies verified the cell survival and immunohistochemical studies revealed the differentiation of the transplanted cells into astrocytes and neurons.

Anna-Liisa Brownell

2003-11-28T23:59:59.000Z

148

KINETIC CONDENSATION AND EVAPORATION OF METALLIC IRON AND IMPLICATIONS FOR METALLIC IRON DUST FORMATION  

SciTech Connect (OSTI)

Metallic iron is one of the most abundant condensing materials in systems of solar abundance. Because metallic iron is responsible for the continuum opacity of dust particles, it has a large contribution to the thermal structure of circumstellar environments and hence to dust evolution itself. In order to understand the formation processes of metallic iron in circumstellar environments, condensation and evaporation kinetics of metallic iron were studied experimentally. Metallic iron condenses at the maximum rate with the condensation coefficient (a parameter ranging from 0 to 1 to represent kinetic hindrance for surface reaction) of unity under high supersaturation conditions, and evaporates nearly ideally (evaporation coefficient of unity) in vacuum. On the other hand, evaporation of metallic iron takes place with more kinetic hindrance in the presence of metallic iron vapor. It is also found that metallic iron atoms nucleate heterogeneously on Al{sub 2}O{sub 3}. Metallic iron does not necessarily condense homogeneously in circumstellar environments, but might condense through heterogeneous nucleation on pre-existing dust. Metallic iron formation proceeds with little kinetic hindrance for highly unequilibrated conditions, but the effects of kinetic hindrance may appear for evaporation and condensation occurring near equilibrium with a timescale of months to years in protoplanetary disks.

Tachibana, Shogo; Nagahara, Hiroko; Ozawa, Kazuhito; Ikeda, Youhei; Nomura, Ryuichi; Tatsumi, Keisuke; Joh, Yui, E-mail: tachi@eps.s.u-tokyo.ac.jp [Department of Earth and Planetary Science, University of Tokyo, 7-3-1 Hongo, Tokyo 113-0033 (Japan)

2011-07-20T23:59:59.000Z

149

Refractory lining for electrochemical cell  

DOE Patents [OSTI]

Apparatus for processing a metallic fluid containing iron oxide, container for a molten metal including an electrically conductive refractory disposed for contact with the molten metal which contains iron oxide, an electrolyte in the form of a basic slag on top of the molten metal, an electrode in the container in contcat with the slag electrically separated from the refractory, and means for establishing a voltage across the refractory and the electrode to reduce iron oxide to iron at the surface of the refractory in contact with the iron oxide containing fluid. A process is disclosed for refining an iron product containing not more than about 10% by weight oxygen and not more than about 10% by weight sulfur, comprising providing an electrolyte of a slag containing one or more of calcium oxide, magnesium oxide, silica or alumina, providing a cathode of the iron product in contact with the electrolyte, providing an anode in contact with the electrolyte electrically separated from the cathode, and operating an electrochemical cell formed by the anode, the cathode and the electrolyte to separate oxygen or sulfur present in the iron product therefrom.

Blander, Milton (Palos Park, IL); Cook, Glenn M. (Naperville, IL)

1987-01-01T23:59:59.000Z

150

Iron and Steel Energy Intensities  

U.S. Energy Information Administration (EIA) Indexed Site

If you are having trouble, call 202-586-8800 for help. Home > >Energy Users > Energy Efficiency Page > Iron and Steel Energy Intensities First Use of Energy Blue Bullet First Use/Value of Production Blue Bullet First Use/Ton of steel End Uses of Consumption Blue Bullet Total End Use/Value of Production Blue Bullet Total End Use/Ton of Steel Boiler Fuel as End Use Blue Bullet Boiler Fuel /Value of Production Blue Bullet Boiler Fuel /Ton of Steel Process Heating as End Use Blue Bullet Process Heating Fuel /Ton of Steel Blue Bullet Process Heating /Value of Production Machine Drive as End Use Blue Bullet Machine Drive Fuel/Ton of Steel Blue Bullet Machine Drive Fuel /Value of Production Expenditures Blue Bullet Purchased Fuel /Ton of Steel Blue Bullet Purchased Fuel /Value of Production

151

Implementation of fluidized granulated iron reactors in a chromate remediation process  

Science Journals Connector (OSTI)

Abstract A new approach concerning in-situ remediation on source (‘hot-spot’) decontamination of a chromate damage in connection with an innovative pump-and-treat-technique has been developed. Iron granulates show significant higher reduction rates, using fluidized bed conditions, than a literature study with a fixed bed installation of small-sized iron granules. First results from an abandoned tannery site concerning injections of sodium dithionite as a chromate reductant for the vadose zone in combination with a pump-and-treat-method, allying the advantages of granulated zero valent iron (ZVI), are reported. Reduction amounts of chromate have been found up to 88% compared with initial values in the soil after a soil water exchange of 8 pore volumes within 2.5 months. Chromate concentrations in the pumped effluent have been reduced to under the detection limit of 0.005 mg/L by treatment with ZVI in the pilot plant.

P. Müller; K.E. Lorber; R. Mischitz; C. Weiß

2014-01-01T23:59:59.000Z

152

Abstract 296: Pre-treatment clinical laboratory tests indicative of metabolic status are associated with survival in patients with non-small cell lung cancer  

Science Journals Connector (OSTI)

...296: Pre-treatment clinical laboratory tests indicative of metabolic status are associated...value of serum pre-treatment laboratory tests for prognostic purposes in non-small...identify pre-treatment routine laboratory tests indicative of a patient's overall metabolic...

Fanmao Zhang; Qing H. Meng; Yuanqing Ye; Michelle AT Hildebrandt; Maosheng Huang; Xifeng Wu

2014-10-01T23:59:59.000Z

153

Sulfur-Modified Zero-Valent Iron for Remediation Applications at DOE Sites - 13600  

SciTech Connect (OSTI)

Many DOE remediation sites have chemicals of concern that are compounds in higher oxidation states, which make them both more mobile and more toxic. The chemical reduction of these compounds both prevents the migration of these chemicals and in some cases reduces the toxicity. It has also been shown that zero-valent iron is a very effective substance to use in reducing oxygenated compounds in various treatment processes. These have included the treatment of halogenated hydrocarbons in the form volatile organic compounds used as solvents and pesticides. Zero-valent iron has also been used to reduce various oxidized metals such as chromium, arsenic, and mercury in order to immobilize them, decrease their toxicity, and prevent further transport. In addition, it has been used to immobilize or break down other non-metallic species such as selenium compounds and nitrates. Of particular interest at several DOE remediation sites is the fact that zero-valent iron is very effective in immobilizing several radioactive metals which are mobile in their oxidized states. These include both technetium and uranium. The main difficulty in using zero-valent iron has been its tendency to become inactive after relatively short periods of time. While it is advantageous to have the zero-valent iron particles as porous as possible in order to provide maximum surface area for reactions to take place, these pores can become clogged when the iron is oxidized. This is due to the fact that ferric oxide has a greater volume for a given mass than metallic iron. When the surfaces of the iron particles oxidize to ferric oxide, the pores become narrower and will eventually shut. In order to minimize the degradation of the chemical activity of the iron due to this process, a modification of zero-valent iron has been developed which prevents or slows this process, which decreases its effectiveness. It is called sulfur-modified iron, and it has been produced in high purity for applications in municipal water treatment applications. Sulfur-modified iron has been found to not only be an extremely economical treatment technology for municipal water supplies, where very large quantities of water must be treated economically, but it has also been demonstrated to immobilize technetium. It has the added benefit of eliminating several other harmful chemicals in water supplies. These include arsenic and selenium. In one large-scale evaluation study an integrated system implemented chemical reduction of nitrate with sulfur-modified iron followed by filtration for arsenic removal. The sulfur-modified iron that was used was an iron-based granular medium that has been commercially developed for the removal of nitrate, co-contaminants including uranium, vanadium and chromium, and other compounds from water. The independent study concluded that 'It is foreseen that the greatest benefit of this technology (sulfur-modified iron) is that it does not produce a costly brine stream as do the currently accepted nitrate removal technologies of ion exchange and reverse osmosis. This investigation confirmed that nitrate reduction via sulfur-modified iron is independent of the hydraulic loading rate. Future sulfur-modified iron treatment systems can be designed without restriction of the reactor vessel dimensions. Future vessels can be adapted to existing site constraints without being limited to height-to-width ratios that would exist if nitrate reduction were to depend on hydraulic loading rate'. Sulfur-modified iron was studied by the Pacific Northwest National Laboratory (PNNL) for its effectiveness in the reduction and permanent sequestration of technetium. The testing was done using Hanford Site groundwater together with sediment. The report stated, 'Under reducing conditions, TcO{sub 4} is readily reduced to TcIV, which forms highly insoluble oxides such at TcO{sub 2}.nH{sub 2}O. However, (re)oxidation of TcIV oxides can lead to remobilization. Under sulfidogenic conditions, most TcIV will be reduced and immobilized as Tc{sub 2}S{sub 7}, which is less readily re-mobilized, ev

Fogwell, Thomas W. [Fogwell Consulting, P.O. Box 20221, Piedmont, CA 94620 (United States)] [Fogwell Consulting, P.O. Box 20221, Piedmont, CA 94620 (United States); Santina, Pete [SMI-PS, Inc., 2073 Prado Vista, Lincoln, CA 95648 (United States)] [SMI-PS, Inc., 2073 Prado Vista, Lincoln, CA 95648 (United States)

2013-07-01T23:59:59.000Z

154

CdCl{sub 2} treatment related diffusion phenomena in Cd{sub 1?x}Zn{sub x}S/CdTe solar cells  

SciTech Connect (OSTI)

Utilisation of wide bandgap Cd{sub 1?x}Zn{sub x}S alloys as an alternative to the CdS window layer is an attractive route to enhance the performance of CdTe thin film solar cells. For successful implementation, however, it is vital to control the composition and properties of Cd{sub 1?x}Zn{sub x}S through device fabrication processes involving the relatively high-temperature CdTe deposition and CdCl{sub 2} activation steps. In this study, cross-sectional scanning transmission electron microscopy and depth profiling methods were employed to investigate chemical and structural changes in CdTe/Cd{sub 1?x}Zn{sub x}S/CdS superstrate device structures deposited on an ITO/boro-aluminosilicate substrate. Comparison of three devices in different states of completion—fully processed (CdCl{sub 2} activated), annealed only (without CdCl{sub 2} activation), and a control (without CdCl{sub 2} activation or anneal)—revealed cation diffusion phenomena within the window layer, their effects closely coupled to the CdCl{sub 2} treatment. As a result, the initial Cd{sub 1?x}Zn{sub x}S/CdS bilayer structure was observed to unify into a single Cd{sub 1?x}Zn{sub x}S layer with an increased Cd/Zn atomic ratio; these changes defining the properties and performance of the Cd{sub 1?x}Zn{sub x}S/CdTe device.

Kartopu, G., E-mail: giray.kartopu@glyndwr.ac.uk; Clayton, A. J.; Barrioz, V.; Lamb, D. A.; Irvine, S. J. C. [Centre for Solar Energy Research (CSER), Glynd?r University, OpTIC, St. Asaph Business Park, St. Asaph LL17 0JD (United Kingdom); Taylor, A. A. [Physics Department, Durham University, Durham DH1 3LE (United Kingdom)

2014-03-14T23:59:59.000Z

155

Why Sequence Freshwater Iron-Oxidizing Bacteria?  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Freshwater Iron-Oxidizing Bacteria? Freshwater Iron-Oxidizing Bacteria? The goal of this project is to obtain complete genome sequences for six different freshwater iron (Fe)-oxidizing bacteria (FeOB). Four of these are oxygen-dependent iron-oxidizing β-proteobacteria, and three of these, Sideroxydans lithotrophicus, Gallionella capsiferriformans, and strain TW-2, are capable of chemolithoautotrophic growth (that is, obtaining energy by the oxidation of inorganic compounds) using Fe(II) as sole energy source under microaerobic (low-oxygen) conditions. The fourth organism, Leptothrix cholodnii, is a sheath-forming heterotrophic (i.e., using complex organic compounds for nutrition) organism that oxidizes both Fe(II) and Mn(II) and deposits a ferromanganic coating on its sheath. In addition,

156

System and method for producing metallic iron  

DOE Patents [OSTI]

A method of production of metallic iron nodules comprises assembling a hearth furnace having a moveable hearth comprising refractory material and having a conversion zone and a fusion zone, providing a hearth material layer comprising carbonaceous material on the refractory material, providing a layer of reducible material comprising and iron bearing material arranged in discrete portions over at least a portion of the hearth material layer, delivering oxygen gas into the hearth furnace to a ratio of at least 0.8:1 ponds of oxygen to pounds of iron in the reducible material to heat the conversion zone to a temperature sufficient to at least partially reduce the reducible material and to heat the fusion zone to a temperature sufficient to at least partially reduce the reducible material, and heating the reducible material to form one or more metallic iron nodules and slag.

Englund, David J.; Schlichting, Mark; Meehan, John; Crouch, Jeremiah; Wilson, Logan

2014-07-29T23:59:59.000Z

157

Iron and the ecology of marine microbes  

E-Print Network [OSTI]

Iron is a cofactor of a number biochemical reactions that are essential for life. In the marine environment, this micronutrient is a scarce resource that limits processes of global importance such as photosynthesis and ...

Ventouras, Laure-Anne

2013-01-01T23:59:59.000Z

158

C:\Eco-SSLs\Final Guidance November 2003\Contaminant Specific\Iron\Eco-SSL for Iron.wpd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Iron Interim Final OSWER Directive 9285.7-69 U. S. Environmental Protection Agency Office of Solid Waste and Emergency Response 1200 Pennsylvania Avenue, N.W. Washington, DC 20460 November 2003 This page intentionally left blank TABLE OF CONTENTS SUMMARY OF ECO-SSLs FOR IRON . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ES - 1 1.0 INTRODUCTION . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 - 1 2.0 IRON GEOCHEMISTRY . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 - 1 2.1 Weathering Processes Affect on Iron . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 - 3 2.2 Soil Conditions Affect on Iron . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 - 4 3.0 EFFECTS OF IRON ON PLANTS . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 - 1 3.1 Essentiality . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 - 1 3.2 General Effects

159

Elastic moduli of nickel and iron aluminides  

E-Print Network [OSTI]

ELASTIC MODULI OF NICKEL AND IRON ALUMINIDES A Thesis by SREEDHAR MAN JIGANI Submitted to the Oifice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 1993... Major Subject: Mechanical Engineering ELASTIC MODULI OF NICKEL AND IRON ALUMINIDES A Thesis by SREEDHAR MAN JIGANI Submitted to Texas AkM University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE Approved...

Manjigani, Sreedhar

2012-06-07T23:59:59.000Z

160

Muon trapping at monovacancies in iron  

Science Journals Connector (OSTI)

Positive-muon—spin-rotation experiments were performed on electron irradiated iron. A new defect-associated frequency is observed which is assigned to muons trapped at monovacancies. The hyperfine field at the vacancy site is -0.956 T at 140 K. The diffusion constant for ?+ in iron deduced from the trapping rate follows an Arrhenius law with an activation energy of 38±3 meV between 90 and 190 K.

A. Möslang; H. Graf; G. Balzer; E. Recknagel; A. Weidinger; Th. Wichert; R. I. Grynszpan

1983-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Iron Availability in the Southern Ocean  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Availability in the Southern Ocean Print Iron Availability in the Southern Ocean Print The Southern Ocean, circling the Earth between Antarctica and the southernmost regions of Africa, South America, and Australia, is notorious for its high-nutrient, low-chlorophyll areas, which are rich in nutrients-but poor in essential iron. Sea life is less abundant in these regions because the growth of phytoplankton-the marine plants that form the base of the food chain-is suppressed. A study by scientists from South Africa's Stellenbosch University, Princeton University, and the Advanced Light Source (ALS) suggests that it is not just a lack of iron, but a lack of iron in an easy-to-use form, that is affecting the ecosystems. The researchers sampled two north-south corridors across the Southern Ocean, traveling an easterly transect between the base of the South African National Antarctic Expeditions (SANAE IV) in Queen Maud Land and Cape Town, and a westerly transect between SANAE IV and South Georgia Island. Along the way they collected particles containing solid iron from a series of ocean systems with different characteristics.

162

Iron Availability in the Southern Ocean  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Availability in the Southern Ocean Print Iron Availability in the Southern Ocean Print The Southern Ocean, circling the Earth between Antarctica and the southernmost regions of Africa, South America, and Australia, is notorious for its high-nutrient, low-chlorophyll areas, which are rich in nutrients-but poor in essential iron. Sea life is less abundant in these regions because the growth of phytoplankton-the marine plants that form the base of the food chain-is suppressed. A study by scientists from South Africa's Stellenbosch University, Princeton University, and the Advanced Light Source (ALS) suggests that it is not just a lack of iron, but a lack of iron in an easy-to-use form, that is affecting the ecosystems. The researchers sampled two north-south corridors across the Southern Ocean, traveling an easterly transect between the base of the South African National Antarctic Expeditions (SANAE IV) in Queen Maud Land and Cape Town, and a westerly transect between SANAE IV and South Georgia Island. Along the way they collected particles containing solid iron from a series of ocean systems with different characteristics.

163

Review of the Hanford Waste Treatment and Immobilization Project Black-Cell and Hard-to-Reach Pipe Spools Procurement Process and the Office of River Protection Audit of That Process  

Broader source: Energy.gov (indexed) [DOE]

Independent Oversight Review of the Independent Oversight Review of the Hanford Waste Treatment and Immobilization Plant Black-Cell and Hard-To-Reach Pipe Spools Procurement Process and the Office of River Protection Audit of That Process January 2013 Office of Safety and Emergency Management Evaluations Office of Enforcement and Oversight Office of Health, Safety and Security U. S. Department of Energy Table of Contents 1.0 Purpose................................................................................................................................................... 1 2.0 Scope...................................................................................................................................................... 1 3.0 Background ............................................................................................................................................ 2

164

Review of the Hanford Waste Treatment and Immobilization Project Black-Cell and Hard-to-Reach Pipe Spools Procurement Process and the Office of River Protection Audit of That Process  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Independent Oversight Review of the Independent Oversight Review of the Hanford Waste Treatment and Immobilization Plant Black-Cell and Hard-To-Reach Pipe Spools Procurement Process and the Office of River Protection Audit of That Process January 2013 Office of Safety and Emergency Management Evaluations Office of Enforcement and Oversight Office of Health, Safety and Security U. S. Department of Energy Table of Contents 1.0 Purpose................................................................................................................................................... 1 2.0 Scope...................................................................................................................................................... 1 3.0 Background ............................................................................................................................................ 2

165

Effect of Neuraminidase and Papain Treatment on Lectin-induced Agglutination of Novikoff Tumor Cells and Assay of Lectin Receptor Activity of the Glycopeptides Released from the Cell Surface by Papain  

Science Journals Connector (OSTI)

...upon neuraminidase treatment. This conclusion...that neuraminidase treatment exposed cryp tic...Neuraminidase and Papain Treatment on Lectin induced...Polyacrylamide gel electraphoresis of RCA, and RCA...heated in a bailing water bath far 1 to 2...approximately 3 ml by dialysis against poly ethylene...

Giovanni Neri; M. Christina Giuliano; Sylvia Capetillo; Ellen B. Gilliam; Douglas C. Hixson; and Earl F. Walborg, Jr.

1976-01-01T23:59:59.000Z

166

E-Print Network 3.0 - assembly cellular iron Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: , iron storage function and cellular regulation. Biochim. Biophys. Acta Bioenerg. 1275: 161-203. HOFMANN... Availability of iron from iron-storage proteins to marine...

167

A Comparison of Iron and Steel Production Energy Intensity in China and the U.S  

E-Print Network [OSTI]

of Iron and Steel Production Energy Use and Energy Intensityof Iron and Steel Production Energy Intensity in China andof Iron and Steel Production Energy Intensity in China and

Price, Lynn

2014-01-01T23:59:59.000Z

168

Microfluidic Microbial Fuel Cells for Microstructure Interrogations  

E-Print Network [OSTI]

treatment, sedi- ment or marine fuel cells for fieldmicrobial fuel cells demonstrating marine (left) and soil (1]. Sediment and Marine Microbial fuel cells can also

Parra, Erika Andrea

2010-01-01T23:59:59.000Z

169

Predictive Parameters of CyberKnife Fiducial-less (XSight Lung) Applicability for Treatment of Early Non-Small Cell Lung Cancer: A Single-Center Experience  

SciTech Connect (OSTI)

Purpose: To determine which parameters allow for CyberKnife fiducial-less tumor tracking in stereotactic body radiation therapy (SBRT) for early-stage non-small cell lung cancer. Methods and Materials: A total of 133 lung SBRT patients were preselected for direct soft-tissue tracking based on manufacturer recommendations (peripherally located tumors ?1.5 cm with a dense appearance) and staff experience. Patients underwent a tumor visualization test to verify adequate detection by the tracking system (orthogonal radiographs). An analysis of potential predictors of successful tumor tracking was conducted looking at: tumor stage, size, histology, tumor projection on the vertebral column or mediastinum, distance to the diaphragm, lung-to-soft tissue ratio, and patient body mass index. Results: Tumor visualization was satisfactory for 88 patients (66%) and unsatisfactory for 45 patients (34%). Median time to treatment start was 6 days in the success group (range, 2-18 days) and 15 days (range, 3-63 days) in the failure group. A stage T2 (P=.04), larger tumor size (volume of 15.3 cm{sup 3} vs 6.5 cm{sup 3} in success and failure group, respectively) (P<.0001), and higher tumor density (0.86 g/cm{sup 3} vs 0.79 g/cm{sup 3}) were predictive of adequate detection. There was a 63% decrease in failure risk with every 1-cm increase in maximum tumor dimension (relative risk for failure = 0.37, CI=0.23-0.60, P=.001). A diameter of 3.6 cm predicted a success probability of 80%. Histology, lung-to-soft tissue ratio, distance to diaphragm, patient's body mass index, and tumor projection on vertebral column and mediastinum were not found to be predictive of success. Conclusions: Tumor size, volume, and density were the most predictive factors of a successful XSight Lung tumor tracking. Tumors >3.5 cm have ?80% chance of being adequately visualized and therefore should all be considered for direct tumor tracking.

Bahig, Houda; Campeau, Marie-Pierre; Vu, Toni; Doucet, Robert; Béliveau Nadeau, Dominic [Radiation Oncology Department, Centre Hospitalier de l'Université de Montréal, Montréal, Quebec (Canada); Fortin, Bernard [Radiation Oncology Department, Maisonneuve-Rosemont Hospital, Montréal, Quebec (Canada); Roberge, David; Lambert, Louise; Carrier, Jean-François [Radiation Oncology Department, Centre Hospitalier de l'Université de Montréal, Montréal, Quebec (Canada); Filion, Edith, E-mail: edith.filion.chum@ssss.gouv.qc.ca [Radiation Oncology Department, Centre Hospitalier de l'Université de Montréal, Montréal, Quebec (Canada)

2013-11-01T23:59:59.000Z

170

Iron-based soft magnetic composites with MnZn ferrite nanoparticles coating obtained by solgel method  

E-Print Network [OSTI]

­gel method Shen Wu a , Aizhi Sun a,n , Wenhuan Xu a , Qian Zhang a , Fuqiang Zhai a , Philip Logan b , Alex A-ray spectroscopy and distribution maps show that the iron particle surface is covered with a thin layer of Mn compared with the epoxy resin coated samples at 10 kHz. The effects of heat treatment temperature

Volinsky, Alex A.

171

Thermal treatment  

Science Journals Connector (OSTI)

Thermal treatment can be regarded as either a pre-treatment of waste prior to final disposal, or as a means of valorising waste by recovering energy. It includes both the burning of mixed MSW in municipal inciner...

Dr. P. White; Dr. M. Franke; P. Hindle

1995-01-01T23:59:59.000Z

172

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

173

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

174

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

175

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

176

Electron Correlation in Iron-Based Superconductors  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Electron Correlation in Iron-Based Superconductors Print Electron Correlation in Iron-Based Superconductors Print In 2008, the discovery of iron-based superconductors stimulated a worldwide burst of activity, leading to about two preprints per day ever since. With a maximum superconducting transition temperature (so far) of 55 K, it is natural to wonder if studying the new materials will help uncover one of the deepest mysteries in modern physics-the mechanism of superconductivity in the copper-based "high-temperature superconductors." One clue lies in whether the electrons in the new superconductors are as highly correlated as they are in the high-temperature superconductors. A truly international North American/European/Asian collaboration working at the ALS has now reported results from a combination of x-ray absorption spectroscopy, resonant inelastic x-ray scattering, and systematic theoretical simulations of iron-based superconductors. The team was able to settle the correlations debate by showing that electrons in the iron-based families that were studied favor itinerant (delocalized) states with only moderate correlations.

177

Iron-based alloys with corrosion resistance to oxygen-sulfur mixed gases  

DOE Patents [OSTI]

An iron-based alloy with improved performance with exposure to oxygen-sulfur mixed gases with the alloy containing about 9--30 wt. % Cr and a small amount of Nb and/or Zr implanted on the surface of the alloy to diffuse a depth into the surface portion, with the alloy exhibiting corrosion resistance to the corrosive gases without bulk addition of Nb and/or Zr and without heat treatment at temperatures of 1000--1100 C. 7 figs.

Natesan, K.

1992-11-17T23:59:59.000Z

178

Iron-based alloys with corrosion resistance to oxygen-sulfur mixed gases  

DOE Patents [OSTI]

An iron-based alloy with improved performance with exposure to oxygen-sulfur mixed gases with the alloy containing about 9-30 wt. % Cr and a small amount of Nb and/or Zr implanted on the surface of the alloy to diffuse a depth into the surface portion, with the alloy exhibiting corrosion resistance to the corrosive gases without bulk addition of Nb and/or Zr and without heat treatment at temperatures of 1000.degree.-1100.degree. C.

Natesan, Krishnamurti (Naperville, IL)

1992-01-01T23:59:59.000Z

179

Method of increasing magnetostrictive response of rare earth-iron alloy rods  

DOE Patents [OSTI]

This invention comprises a method of increasing the magnetostrictive response of rare earth-iron (RFe) magnetostrictive alloy rods by a thermal-magnetic treatment. The rod is heated to a temperature above its Curie temperature, viz. from 400 to 600 C; and, while the rod is at that temperature, a magnetic field is directionally applied and maintained while the rod is cooled, at least below its Curie temperature. 2 figs.

Verhoeven, J.D.; McMasters, O.D.; Gibson, E.D.; Ostenson, J.E.; Finnemore, D.K.

1989-04-04T23:59:59.000Z

180

Mixed polyanion glass cathodes: Iron phosphate vanadate glasses  

SciTech Connect (OSTI)

Mixed polyanion (MP) glasses have been investigated for use as cathodes in lithium ion batteries. MP glass cathodes are similar in composition to theoretically promising crystalline polyanionic (CP) cathodes (e.g., lithium cobalt phosphate, lithium manganese silicate), but with proper polyanion substitution, they can be designed to overcome the key shortcomings of CP cathodes, such as poor electrical conductivity and irreversible phase changes. Iron phosphate/vanadate glasses were chosen as a first demonstration of the MP glass concept. Polyanion substitution with vanadate was shown to improve the intercalation capacity of an iron phosphate glass from almost zero to full theoretical capacity. In addition, the MP glass cathodes also exhibited an unexpected second high-capacity electrochemical reaction. X-ray absorption near-edge structure (XANES) and x-ray diffraction (XRD) of cathodes from cells having different states of charge suggested that this second electrochemical reaction is a glass-state conversion reaction. With a first demonstration established, MP glass materials utilizing an intercalation and/or glass-state conversion reaction are promising candidates for future high-energy cathode research.

Kercher, Andrew K [ORNL; Ramey, Joanne Oxendine [ORNL; Carroll, Kyler J [Massachusetts Institute of Technology (MIT); Kiggans Jr, James O [ORNL; Veith, Gabriel M [ORNL; Meisner, Roberta [Oak Ridge National Laboratory (ORNL); Boatner, Lynn A [ORNL; Dudney, Nancy J [ORNL

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Fate of As, Se, and Hg in a Passive Integrated System for Treatment of Fossil Plant Wastewater  

SciTech Connect (OSTI)

TVA is collaborating with EPRI and DOE to demonstrate a passive treatment system for removing SCR-derived ammonia and trace elements from a coal-fired power plant wastewater stream. The components of the integrated system consist of trickling filters for ammonia oxidation, reaction cells containing zero-valent iron (ZVI) for trace contaminant removal, a settling basin for storage of iron hydroxide floc, and anaerobic vertical-flow wetlands for biological denitrification. The passive integrated treatment system will treat up to 0.25 million gallons per day (gpd) of flue gas desulfurization (FGD) pond effluent, with a configuration requiring only gravity flow to obviate the need for pumps. The design of the system will enable a comparative evaluation of two parallel treatment trains, with and without the ZVI extraction trench and settling/oxidation basin components. One of the main objectives is to gain a better understanding of the chemical transformations that species of trace elements such as arsenic, selenium, and mercury undergo as they are treated in passive treatment system components with differing environmental conditions. This progress report details the design criteria for the passive integrated system for treating fossil power plant wastewater as well as performance results from the first several months of operation. Engineering work on the project has been completed, and construction took place during the summer of 2005. Monitoring of the passive treatment system was initiated in October 2005 and continued until May 18 2006. The results to date indicate that the treatment system is effective in reducing levels of nitrogen compounds and trace metals. Concentrations of both ammonia and trace metals were lower than expected in the influent FGD water, and additions to increase these concentrations will be done in the future to further test the removal efficiency of the treatment system. In May 2006, the wetland cells were drained of FGD water, refilled with less toxic ash pond water, and replanted due to low survival rates from the first planting the previous summer. The goals of the TVA-EPRI-DOE collaboration include building a better understanding of the chemical transformations that trace elements such as arsenic, selenium, and mercury undergo as they are treated in a passive treatment system, and to evaluate the performance of a large-scale replicated passive treatment system to provide additional design criteria and economic factors.

Terry Yost; Paul Pier; Gregory Brodie

2007-12-31T23:59:59.000Z

182

Carbon Emissions: Iron and Steel Industry  

U.S. Energy Information Administration (EIA) Indexed Site

Iron and Steel Industry Iron and Steel Industry Carbon Emissions in the Iron and Steel Industry The Industry at a Glance, 1994 (SIC Code: 3312) Total Energy-Related Emissions: 39.9 million metric tons of carbon (MMTC) -- Pct. of All Manufacturers: 10.7% -- Nonfuel Emissions: 22.2 MMTC Total First Use of Energy: 1,649 trillion Btu -- Pct. of All Manufacturers: 7.6% Nonfuel Use of Energy: 886 trillion Btu (53.7%) -- Coal: 858 trillion Btu (used to make coke) Carbon Intensity: 24.19 MMTC per quadrillion Btu Energy Information Administration, "1994 Manufacturing Energy Consumption Survey" and Emissions of Greenhouse Gases in the United States 1998 Energy-Related Carbon Emissions, 1994 Source of Carbon Carbon Emissions (million metric tons) All Energy Sources 39.9 Coal 22.7

183

Patterns of Iron Use in Societal Evolution  

Science Journals Connector (OSTI)

The iron stock needed to sustain people’s lives tends to saturate in industrialized countries around 8?12 tons per capita, indicating a long-term potential for the steel industry to dramatically shift resource use from primary (ore) to secondary (scrap) raw materials and thereby significantly save energy and greenhouse gas emissions. ... Figure 3. Per capita iron stocks in use versus per capita GDP PPP (1990 international dollars). ... Speculations about an absolute decoupling in steel demand, however, cannot be supported by this study: none of the analyzed countries shows a shrinking per-capita iron stock in use, which would be needed for long-term absolute decoupling of steel demand. ...

Daniel B. Müller; Tao Wang; Benjamin Duval

2010-12-01T23:59:59.000Z

184

Importance of Iron Mineralogy to Aerosol Solubility: Potential Effects of  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Importance of Iron Mineralogy to Importance of Iron Mineralogy to Aerosol Solubility: Potential Effects of Aerosol Source on Ocean Photosynthesis figure 1 Figure 1. Dust storm blowing glacial dusts from the Copper River Basin of southeast Alaska into the North Pacific Ocean, which depends on this and other external iron sources to support its biological communities. (Image: NASA MODIS satellite image, Nov. 1, 2006. http://earthobservatory.nasa.gov/IOTD/view.php?id=7094) Iron is one of the most important elements to life. Despite its paramount importance and relative abundance, dissolved iron concentrations are often very low, in part due to the formation of very stable iron minerals in most oxidizing environments. Since soluble iron is available to living organisms, iron deficiencies are widespread, and the factors that influence

185

Decoupling of Iron and Phosphate in the Global Payal Parekh  

E-Print Network [OSTI]

with weaker wind stresses leads to a decrease in surface [PO4] and [Fe] in the Southern Ocean due (reviewed by Karl et al., 2002; Mills et al., 2004) have a greater iron requirement and iron availability

Follows, Mick

186

Iron oxide nanoparticles as a contrast agent for thermoacoustic tomography  

E-Print Network [OSTI]

radiation. The addition of an exogenous contrast agent improves image quality by more effectively converting microwave energy to heat. The use of iron oxide nanoparticles in MRI applications has been explored but super paramagnetic iron oxide nanoparticles...

Keho, Aaron Lopez

2009-06-02T23:59:59.000Z

187

Steam reforming utilizing iron oxide catalyst  

SciTech Connect (OSTI)

High activity steam reforming iron oxide catalysts are described. Such catalysts can be unsupported utilizing at least 90% by weight iron oxide and various modifiers (Ai/sub 2/O/sub 3/, K/sub 2/O, CaO, SiO/sub 2/) or unmodified and supported on such things as alumina, CaO impregnated alumina, and lanthanum stabilized alumina. When used in steam reformers such as autothermal and tubular steam reformers, these catalysts demonstrate much improved resistance to carbon plugging.

Setzer, H. T.; Bett, J. A. S.

1985-06-11T23:59:59.000Z

188

Preventing hypoxia-induced cell death in beta cells and islets via hydrolytically activated, oxygen-generating biomaterials  

Science Journals Connector (OSTI)

...Dimethylpolysiloxanes 0 Oxides 1305-78-8 lime 7782-44-7 Oxygen 9012-36-6...of naturally occurring iron minerals (1 ZZQQhy3). Hydroxyl...microscope for live cells (green) (excitation, 494 nm; emission...Monsen R (2009) Use of iron minerals in optimizing the peroxide...

Eileen Pedraza; Maria M. Coronel; Christopher A. Fraker; Camillo Ricordi; Cherie L. Stabler

2012-01-01T23:59:59.000Z

189

Lithium Iron Phosphate Composites for Lithium Batteries | Argonne...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Lithium Iron Phosphate Composites for Lithium Batteries Technology available for licensing: Inexpensive, electrochemically active phosphate compounds with high functionality for...

190

A Review of Iron Phosphate Glasses and Recommendations for Vitrifying Hanford Waste  

SciTech Connect (OSTI)

This report contains a comprehensive review of the research conducted, world-wide, on iron phosphate glass over the past ~30 years. Special attention is devoted to those iron phosphate glass compositions which have been formulated for the purpose of vitrifying numerous types of nuclear waste, with special emphasis on the wastes stored in the underground tanks at Hanford WA. Data for the structural, chemical, and physical properties of iron phosphate waste forms are reviewed for the purpose of understanding their (a) outstanding chemical durability which meets all current DOE requirements, (b) high waste loadings which can exceed 40 wt% (up to 75 wt%) for several Hanford wastes, (c) low melting temperatures, can be as low as 900°C for certain wastes, and (d) high tolerance for “problem” waste components such as sulfates, halides, and heavy metals (chromium, actinides, noble metals, etc.). Several recommendations are given for actions that are necessary to smoothly integrate iron phosphate glass technology into the present waste treatment plans and vitrification facilities at Hanford.

Delbert E. Ray; Chandra S. Ray

2013-11-01T23:59:59.000Z

191

PKC412 inhibits the zinc finger 198-fibroblast growth factor receptor 1 fusion tyrosine kinase and is active in treatment of stem cell myeloproliferative disorder  

Science Journals Connector (OSTI)

...of stem cell myeloproliferative disorder 10.1073/pnas.0404438101 Jing Chen Daniel J. DeAngelo Jeffery L. Kutok Ifor R. Williams Benjamin H. Lee Martha Wadleigh Nicole Duclos Sarah Cohen Jennifer Adelsperger Rachel Okabe Allison Coburn...

Jing Chen; Daniel J. DeAngelo; Jeffery L. Kutok; Ifor R. Williams; Benjamin H. Lee; Martha Wadleigh; Nicole Duclos; Sarah Cohen; Jennifer Adelsperger; Rachel Okabe; Allison Coburn; Ilene Galinsky; Brian Huntly; Pamela S. Cohen; Thomas Meyer; Doriano Fabbro; Johannes Roesel; Lolita Banerji; James D. Griffin; Sheng Xiao; Jonathan A. Fletcher; Richard M. Stone; D. Gary Gilliland

2004-01-01T23:59:59.000Z

192

Effect of sanitizer treatments on Salmonella enterica serotype Poona on the surface of cantaloupe and cell transfer to the internal tissue during cutting practices  

E-Print Network [OSTI]

AND CELL TRANSFER TO THE INTERNAL TISSUE DURING CUTTING PRACTICES A Thesis by SASI VADLAMUDI Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... ON SALMONELLA ENTERICA SEROTYPE POONA ON THE SURFACE OF CANTALOUPE AND CELL TRANSFER TO THE INTERNAL TISSUE DURING CUTTING PRACTICES A Thesis by SASI VADLAMUDI Submitted to Texas A&M University in partial fulfillment of the requirements for the degree...

Vadlamudi, Sasi

2005-02-17T23:59:59.000Z

193

Steel refining with an electrochemical cell  

DOE Patents [OSTI]

Apparatus for processing a metallic fluid containing iron oxide, container for a molten metal including an electrically conductive refractory disposed for contact with the molten metal which contains iron oxide, an electrolyte in the form of a basic slag on top of the molten metal, an electrode in the container in contact with the slag electrically separated from the refractory, and means for establishing a voltage across the refractory and the electrode to reduce iron oxide to iron at the surface of the refractory in contact with the iron oxide containing fluid. A process is disclosed for refining an iron product containing not more than about 10% by weight oxygen and not more than about 10% by weight sulfur, comprising providing an electrolyte of a slag containing one or more of calcium oxide, magnesium oxide, silica or alumina, providing a cathode of the iron product in contact with the electrolyte, providing an anode in contact with the electrolyte electrically separated from the cathode, and operating an electrochemical cell formed by the anode, the cathode and the electrolyte to separate oxygen or sulfur present in the iron product therefrom.

Blander, Milton (Palos Park, IL); Cook, Glenn M. (Naperville, IL)

1988-01-01T23:59:59.000Z

194

Zero-valent iron nanoparticles preparation  

SciTech Connect (OSTI)

Graphical abstract: Zero-valent iron nanoparticles were synthesized by hydrogenating [Fe[N(Si(CH{sub 3}){sub 3}){sub 2}]{sub 2}] at room temperature and a pressure of 3 atm. The synthesized nanoparticles were spherical and had diameters less than 5 nm. Highlights: ? Zero-valent iron nanoparticles were synthesized by hydrogenating [Fe[N(Si(CH{sub 3}){sub 3}){sub 2}]{sub 2}]. ? The conditions of reaction were at room temperature and a pressure of 3 atm. ? The synthesized nanoparticles were spherical and had diameters less than 5 nm. -- Abstract: Zero-valent iron nanoparticles were synthesized by hydrogenating [Fe[N(Si(CH{sub 3}){sub 3}){sub 2}]{sub 2}] at room temperature and a pressure of 3 atm. To monitor the reaction, a stainless steel pressure reactor lined with PTFE and mechanically stirred was designed. This design allowed the extraction of samples at different times, minimizing the perturbation in the system. In this way, the shape and the diameter of the nanoparticles produced during the reaction were also monitored. The results showed the production of zero-valent iron nanoparticles that were approximately 5 nm in diameter arranged in agglomerates. The agglomerates grew to 900 nm when the reaction time increased up to 12 h; however, the diameter of the individual nanoparticles remained almost the same. During the reaction, some byproducts constituted by amino species acted as surfactants; therefore, no other surfactants were necessary.

Oropeza, S. [Instituto Politécnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, México D.F. (Mexico)] [Instituto Politécnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, México D.F. (Mexico); Corea, M., E-mail: mcoreat@yahoo.com.mx [Instituto Politécnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, México D.F. (Mexico); Gómez-Yáñez, C. [Instituto Politécnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, México D.F. (Mexico)] [Instituto Politécnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, México D.F. (Mexico); Cruz-Rivera, J.J. [Universidad Autónoma de San Luis Potosí, Instituto de Metalurgia, Sierra Leona 550, San Luis Potosí, C.P. 78210 (Mexico)] [Universidad Autónoma de San Luis Potosí, Instituto de Metalurgia, Sierra Leona 550, San Luis Potosí, C.P. 78210 (Mexico); Navarro-Clemente, M.E., E-mail: mnavarroc@ipn.mx [Instituto Politécnico Nacional, ESIQIE, UPALM, Edificio Z-6, Primer Piso, C.P. 07738, Col. San Pedro Zacatenco, México D.F. (Mexico)

2012-06-15T23:59:59.000Z

195

2, 537549, 2005 Dissolved iron input  

E-Print Network [OSTI]

the semblance of a dissolved load are coagulated and settled as their freshwater carrier is mixed with seawater of the iron load from the suspended and dissolved mobile fraction to storage in the sediments was measured masses beyond the mixing zone, a process known as the "marine biological carbon pump". This export5

Paris-Sud XI, Université de

196

Synthesis and consolidation of iron nanopowders  

Science Journals Connector (OSTI)

A microwave plasma processing technique was used to synthesize iron nanopowders. The average particle size of these powders was ~10 nm and the surface area was measured to be 42m2/g. Powder production rates as high as 50 gm/hour were achieved. Magnetic property measurements on iron nanopowders yielded coercivities as high as 60 kA/m at 4 K, which decreased to ~0 A/m (a superparamagnetic transition) at room temperature. In this paper, the microwave plasma processing technique has been compared with other nanopowder synthesis techniques. Since the successful application of nanomaterials depends highly on the processing technology, results from consolidation studies on iron nanopowders are also presented. Iron nanopowders were consolidated to study performance parameters such as density, grain growth and other morphological changes. The nanopowder was consolidated using Plasma Pressure Consolidation (P2C) technique to 95% density, at a temperature and pressure of 850 °C and 63 \\{MPa\\} respectively. Microwave plasma synthesis is capable of producing metallic and ceramic nanopowders, which will sustain interest in research areas including magnetic storage, nano-fabrication of electronic materials and nanoglass, besides the field of catalysis.

R. Kalyanaraman; Sang Yoo; M.S. Krupashankara; T.S. Sudarshan; R.J. Dowding

1998-01-01T23:59:59.000Z

197

Correlation Between the Antiviral Effect of Interferon Treatment and the Inhibition of In Vitro mRNA Translation in Noninfected L cells  

Science Journals Connector (OSTI)

...Correlation Between the Antiviral Effect of Interferon Treatment and...SDS-polyacrylamide gels. Effects of interferon on in vitro mRNA...Mengo virus RNA. The relation- ship between this inactivation of translation and the antiviral effect of interferon was studied in...

E. Falcoff; R. Falcoff; B. Lebleu; M. Revel

1973-09-01T23:59:59.000Z

198

Modeling Human Neural Development Using Pluripotent Stem Cells  

E-Print Network [OSTI]

Jaenisch R. Treatment of sickle cell anemia mouse model withharboring the mutation for sickle cell disease 20 . Despite

Patterson, Michaela Cyr

2012-01-01T23:59:59.000Z

199

Developer Installed Treatment Plants  

E-Print Network [OSTI]

-installed treatment plants. These treatment plants are more commonly known as package wastewater treatment plants. 1

unknown authors

2008-01-01T23:59:59.000Z

200

A study on the oxidation characteristics of cast irons containing aluminum  

SciTech Connect (OSTI)

Isothermal-oxidation characteristics of cast irons containing aluminum (5-15% Al) from 700 to 1000{degrees}C in air have been studied. In addition to mass-gain measurements, the morphology and composition of the oxide scales have been examined by SEM-EDX system and XRD analysis. A normal Fe-5Al-C alloy does not develop protective, adherent scales. Even the addition of misch metal and calcium silicide to such an alloy does not improve its oxidation resistance. But aluminum cast iron develops considerable oxidation resistance only when a sufficient quantity of silicon is also present in the alloy. Treatment of the alloy with misch metal and calcium silicide together assists in protective scale formation. Among the alloys investigated Fe-15Al-Si-C treated with misch metal and calcium silicide shows minimum oxidation at 1000{degrees}C.

Ghosh, S.; Prodhan, A. [National Metallurigical Laboratory, Jamshedpur (India); Mohanty, O.N. [Tata Steel, Jamshedpur (India)] [and others

1996-02-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Fish scale deformation analysis using scanning electron microscope: New potential biomarker in aquatic environmental monitoring of aluminum and iron contamination  

SciTech Connect (OSTI)

Fish scale has the potential to be a rapid biomarker due to its structure and high possibility to come into contact with any pollutant in the aquatic environment. The scale structure consists of osteoblastic cells and other bone materials such as collagen where it is possible to form a molecular complex with heavy metals such as aluminum and iron. Hence, aluminum and iron in water could possibly destroy the scale material and marked as a scale deformation that quantitatively could be analyzed by comparing it to the normal scale structure. Water sampling and fish cage experiment were performed between June and July 2011 in Porong river which represented the water body that has high aluminum and iron contamination. The filtered water samples were preserved and extracted using the acid-mixture procedure prior to measurement of the aluminum and iron concentrations using Inductively Coupled Plasma Atomic Emission Spectroscopy (ICP-AES), while samples for total suspended solid (TSS) analysis were kept at 4 °C in cool-boxes. The scales were cleaned with sterile water, then dehydrated in 30, 50, 70, and 90% ethanol and dried on filter papers. They were then mounted on an aluminum stub and coated with gold in a sputter coater prior to Scanning Electron Microscope (SEM) observation. According to the SEM analysis, it was found that there were several deformations on the scale samples taken from sites that have high concentrations of aluminum and iron i.e. the increasing number of pits, deformation and decreasing number of spherules and ridges while the control scale exhibited the normal features. However, the site with higher TSS and pH indicated lower aluminum effect. A moderate correlation was found between the number of pits with aluminum (r=0.43) and iron (r=0.41) concentrations. Fish scale deformation using SEM analysis can potentially be a rapid biomarker in aquatic monitoring of aluminum and iron contamination. However, the measurement must be accompanied by pH and TSS observations.

Hidayati, Dewi; Sulaiman, Norela; Othman, Shuhaimi; Ismail, B. S. [School of Environmental and Natural Resource Sciences, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, 43600 Bangi, Selangor (Malaysia)

2013-11-27T23:59:59.000Z

202

Iron-57 nuclear magnetic resonance chemical shifts of hindered iron porphyrins. Ruffling as a possible mechanism for d-orbital energy level inversion  

Science Journals Connector (OSTI)

Iron-57 nuclear magnetic resonance chemical shifts of hindered iron porphyrins. ... Ruffling as a possible mechanism for d-orbital energy level inversion ...

Lars Baltzer; Marie Landergren

1990-03-01T23:59:59.000Z

203

Magnetism in Iron at High Temperatures  

Science Journals Connector (OSTI)

Magnetism in iron at high temperature is investigated by calculating the total electronic band-structure energy for four types of spin arrangements. A slow smooth spatial variation of spin direction costs relatively little energy and the atomic moment m is reduced only ? 10%. More rapid variations have considerably higher energy, which may explain the high degree of short-range order and small ?m observed at T?TC. Other aspects are also discussed.

M. V. You; V. Heine; A. J. Holden; P. J. Lin-Chung

1980-05-12T23:59:59.000Z

204

Magnetism and Superconductivity in Iron Pnictides  

SciTech Connect (OSTI)

The discovery of high temperature superconductivity in iron pnictides and chalcogenides has resulted in surprising new insights into high temperature superconductivity and its relationship with magnetism. Here we provide an overview of some of what is known about these materials and in particular about the interplay of magnetism and superconductivity in them. Similarities and contrasts with cuprate superconductors are emphasized and the superconducting pairing is discussed within the framework of spin fluctuation induced pairing.

Singh, David J [ORNL

2012-01-01T23:59:59.000Z

205

The iron abundance of the Magellanic Bridge  

E-Print Network [OSTI]

High-resolution HST ultra-violet spectra for five B-type stars in the Magellanic Bridge and in the Large and Small Magellanic Clouds have been analysed to estimate their iron abundances. Those for the Clouds are lower than estimates obtained from late-type stars or the optical lines in B-type stars by approximately 0.5 dex. This may be due to systematic errors possibly arising from non-LTE effects or from errors in the atomic data as similar low Fe abundances having previously been reported from the analysis of the ultra-violet spectra of Galactic early-type stars. The iron abundance estimates for all three Bridge targets appear to be significantly lower than those found for the SMC and LMC by approximately -0.5 dex and -0.8 dex respectively and these differential results should not be affected by any systematic errors present in the absolute abundance estimates. These differential iron abundance estimates are consistent with the underabundances for C, N, O, Mg and Si of approximately -1.1 dex relative to our Galaxy previously found in our Bridge targets. The implications of these very low metal abundances for the Magellanic Bridge are discussed in terms of metal deficient material being stripped from the SMC.

P. L. Dufton; R. S. I. Ryans; H. M. A. Thompson; R. A. Street

2008-02-01T23:59:59.000Z

206

Correlation effects in the iron pnictides  

SciTech Connect (OSTI)

One of the central questions about the iron pnictides concerns the extent to which their electrons are strongly correlated. Here we address this issue through the phenomenology of the charge transport and dynamics, single-electron excitation spectrum, and magnetic ordering and dynamics. We outline the evidence that the parent compounds, while metallic, have electron interactions that are sufficiently strong to produce incipient Mott physics. In other words, in terms of the strength of electron correlations compared to the kinetic energy, the iron pnictides are closer to intermediately-coupled systems lying at the boundary between itinerancy and localization, such as V{sub 2}O{sub 3} a or Se-doped NiS{sub 2} , rather than to simple antiferromagnetic metals like Cr. This level of electronic correlations produces a new small parameter for controlled theoretical analyses, namely the fraction of the single-electron spectral weight that lies in the coherent part. Using this expansion parameter, we construct the effective low-energy Hamiltonian and discuss its implications for the magnetic order and magnetic quantum criticality. Finally, this approach sharpens the notion of magnetic frustration for such a metallic system, and brings about a multi band matrix t-J{sub 1}-J{sub 2} model for the carrier-doped iron pnictides.

Zhu, Jian-xin [Los Alamos National Laboratory; Si, Qimiao [RICE UNIV; Abrahams, Elihu [RUTGERS UNIV; Dai, Jianhui [ZHEJIANG UNIV

2009-01-01T23:59:59.000Z

207

Optimization of low-cost phosphorus removal from wastewater using co-treatments with constructed  

E-Print Network [OSTI]

treatment residual; iron; lime sludge; municipal wastewater Introduction The US-EPA has identified for removing P from wastewater (US-EPA, 1993). However, questions of mechanisms, predictabilityOptimization of low-cost phosphorus removal from wastewater using co-treatments with constructed

Florida, University of

208

Time-dependent release of iron from soot particles by acid extraction and the reduction of fe3+ by elemental carbon  

E-Print Network [OSTI]

, iron release, and DNA damage and toxicity in rat lung epithelial cells. Inhalation Toxicolog. 11:1123-1141. Veranth, J., Smith, K., Aust, A., Dansie, S., Griffin, J., Hu, A. A., Huggins, M., and Lightly, J. (2000). Coal fly ash and mineral dust..., iron release, and DNA damage and toxicity in rat lung epithelial cells. Inhalation Toxicolog. 11:1123-1141. Veranth, J., Smith, K., Aust, A., Dansie, S., Griffin, J., Hu, A. A., Huggins, M., and Lightly, J. (2000). Coal fly ash and mineral dust...

Drake, Stephen James

2009-05-15T23:59:59.000Z

209

Simultaneous wastewater treatment and biological electricity generation  

E-Print Network [OSTI]

Simultaneous wastewater treatment and biological electricity generation B.E. Logan Department accomplishing wastewater treatment in processes based on microbial fuel cell technologies. When bacteria oxidize.4 £ 106 L of wastewater, a wastewater treatment plant has the potential to become a 2.3 MW power plant

210

Enhanced photovoltaic performance of nanocrystalline CdTe/ZnO solar cells using sol-gel ZnO and positive bias treatment  

SciTech Connect (OSTI)

The effect of doping and porosity of the n-type ZnO layer on the performance of solution-processed, sintered p-CdTe/n-ZnO nanocrystal photovoltaic (PV) devices is investigated. Amorphous sol-gel ZnO is found to be the best candidate with overall energy conversion efficiencies above 8% obtained if the ZnO is also indium doped. We demonstrate that when such PV devices are left under forward bias (in dark or light), the device efficiency values are raised to at least 9.8%, due to a substantially increased open-circuit voltage and fill-factor. This drastic enhancement is attributed to improved band alignment at the ITO/CdTe interface. The forward-bias treatment is slowly reversed over a period of days to weeks on standing under open circuit conditions, but is readily restored with further voltage treatment. The moderate processing conditions and high efficiency of such devices demonstrate that nanocrystal-based systems are a promising technology for photovoltaics.

MacDonald, B. I. [CSIRO Materials Science and Engineering, Bayview Avenue, Clayton, Victoria 3168 (Australia); School of Chemistry and Bio21 Institute, The University of Melbourne, Parkville, Victoria 3010 (Australia); Della Gaspera, E.; Watkins, S. E.; Jasieniak, J. J., E-mail: Jacek.Jasieniak@csiro.au [CSIRO Materials Science and Engineering, Bayview Avenue, Clayton, Victoria 3168 (Australia); Mulvaney, P. [School of Chemistry and Bio21 Institute, The University of Melbourne, Parkville, Victoria 3010 (Australia)

2014-05-14T23:59:59.000Z

211

Iron phosphate compositions for containment of hazardous metal waste  

DOE Patents [OSTI]

An improved iron phosphate waste form for the vitrification, containment and long-term disposition of hazardous metal waste such as radioactive nuclear waste is provided. The waste form comprises a rigid iron phosphate matrix resulting from the cooling of a melt formed by heating a batch mixture comprising the metal waste and a matrix-forming component. The waste form comprises from about 30 to about 70 weight percent P.sub.2 O.sub.5 and from about 25 to about 50 weight percent iron oxide and has metals present in the metal waste chemically dissolved therein. The concentration of iron oxide in the waste form along with a high proportion of the iron in the waste form being present as Fe.sup.3+ provide a waste form exhibiting improved chemical resistance to corrosive attack. A method for preparing the improved iron phosphate waste forms is also provided.

Day, Delbert E. (Rolla, MO)

1998-01-01T23:59:59.000Z

212

COLLOQUIUM: How Trenton Iron and Steel Innovations Reshaped America...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mr. Clifford Zink Independent Historian Iron and steel innovations in Trenton helped transform modern life with new methods of transportation, construction, and communications....

213

Iron-based Superconductor Simulations Spin Out New Possibilities...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron-based Superconductor Simulations Spin Out New Possibilities on Titan Rutgers team develops computational model for predicting superconductivity The 15 boxes in this image show...

214

Iron Cycling and Redox Evolution in the Precambrian  

E-Print Network [OSTI]

I use compilations of phosphorous and iron data in ironused upwelling dissolved phosphorous and ammonium as well asand adsorption of dissolved phosphorous onto microbial Fe

Planavsky, Noah John

2012-01-01T23:59:59.000Z

215

Iron(III)-doped, silica : biodegradable, self-targeting nanoparticles  

E-Print Network [OSTI]

of calcium and phosphorous, which can be attributed toamount of calcium and phosphorous increase. The iron(III)-composed of calcium and phosphorous were in the recovered

Mitchell, Kristina Kalani Pohaku

2011-01-01T23:59:59.000Z

216

Iron Oxide Waste Form for Stabilizing 99Tc. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stabilizing 99Tc. Iron Oxide Waste Form for Stabilizing 99Tc. Abstract: Crystals of goethite were synthesized with reduced technetium 99Tc(IV) incorporated within the solid...

217

Zero Valent Iron: Impact of Anions Present during Synthesis on...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

iron nanoparticles was quantified by monitoring the kinetics as well as products of carbon tetrachloride reduction, and significant differences in reactivity and chloroform...

218

Ferredoxin and flavodoxin as biochemical indicators of iron ...  

Science Journals Connector (OSTI)

search Agreement RP8021-05 from the Electric Power Research. Institute ... equatorial Pacific Ocean was enriched with iron and moni- ..... The first identifi-.

1999-10-04T23:59:59.000Z

219

Oil production enhancement through a standardized brine treatment. Final report  

SciTech Connect (OSTI)

In order to permit the environmentally safe discharge of brines produced from oil wells in Pennsylvania to the surface waters of the Commonwealth and to rapidly brings as many wells as possible into compliance with the law, the Pennsylvania Oil and Gas Association (POGAM) approached the Pennsylvania State University to develop a program designed to demonstrate that a treatment process to meet acceptable discharge conditions and effluent limitations can be standardized for all potential stripper wells brine discharge. After the initial studies, the first phase of this project was initiated. A bench-scale prototype model was developed for conducting experiments in laboratory conditions. The experiments pursued in the laboratory conditions were focused on the removal of ferrous iron from synthetically made brine. Iron was selected as the primary heavy metals for studying the efficiency of the treatment process. The results of a number of experiments in the lab were indicative of the capability of the proposed brine treatment process in the removal of iron. Concurrent with the laboratory experiments, a comprehensive and extensive kinetic study was initiated. This study was necessary to provide the required data base for process modeling. This study included the investigation of the critical pH as well as the rate and order of reactions of the studied elements: aluminum, lead, zinc, and copper. In the second phase of this project, a field-based prototype was developed to evaluate and demonstrate the treatment process effectiveness. These experiments were conducted under various conditions and included the testing on five brines from different locations with various dissolved constituents. The outcome of this research has been a software package, currently based on iron`s reactivity, to be used for design purposes. The developed computer program was refined as far as possible using the results from laboratory and field experiments.

Adewumi, A.; Watson, R.; Tian, S.; Safargar, S.; Heckman, S.; Drielinger, I.

1995-08-01T23:59:59.000Z

220

Iron sulfide oxidation and the chemistry of acid generation  

SciTech Connect (OSTI)

Acid mine drainage, produced from the oxidation of iron sulfides, often contains elevated levels of dissolved aluminum (Al), iron (Fe), and sulfate (SO{sub 4}) and low pH. Understanding the interactions of these elements associated with acid mine drainage is necessary for proper solid waste management planning. Two eastern oil shales were leached using humidity cell methods. This study used a New Albany Shale (4.6% pyrite) and a Chattanooga Shale (1.5% pyrite) were used. The leachates from the humidity cells were filtered, and the filtrates were analyzed for total concentrations of cations and anions. After correcting for significant solution species and complexes, ion activities were calculated from total concentrations. The results show that the activities of Fe{sup 3+}, Fe{sup 2+}, Al{sup 3+}, and SO{sub 4}{sup 2{minus}} increased due to the oxidation of pyrite. Furthermore, the oxidation of pyrite resulted in a decreased pH and an increased pe + pH (redox-potential). The Fe{sup 3+} and Fe{sup 2+} activities appeared to be controlled by amorphous Fe(OH){sub 3} solid phase above a pH of 6.0 and below pe + pH 11.0. The Fe{sup 3+}, Fe{sup 2+}, and SO{sub 4}{sup 2{minus}} activities reached saturation with respect to FeOHSO{sub 4} solid phase between pH 3.0 and 6.0 and below pe + pH 11.0. Below a pH of 3.0 and above a pe + pH of 11.0, Fe{sup 2+}, Fe{sup 3+}, and SO{sub 4}{sup 2{minus}} activities are supported by FeSO{sub 4}{center dot}7H{sub 2}O solid phase. Above a pH of 6.0, the Al{sup 3+} activity showed an equilibrium with amorphous Al(OH){sub 3} solid phase. Below pH 6.0, Al{sup 3+} and SO{sub 4}{sup 2{minus}} activities are regulated by the AlOHSO{sub 4} solid phase, irrespective of pe + pH. The results of this study suggest that under oxidizing conditions with low to high leaching potential, activities of Al and Fe can be predicted on the basis of secondary mineral formation over a wide range of pH and redox.

Sullivan, P.J.; Yelton, J.L. (Univ. of Wyoming Research Corp., Laramie (United States)); Reddy, K.J. (Univ. of Wyoming, Laramie (United States))

1988-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Comparison of gleptoferron iron compound to two commonly used iron supplements for the prevention of baby pig anemia  

E-Print Network [OSTI]

Ig"5 Thesis H763 c. Z J COMPARISON OF GLEPTOFERRON IRON COMPOUND TO TWO COMMONLY USED IRON SUPPLEMENTS FOR THE PREVENTION OF BABY PIG ANEMIA A Professional Paper Ervin R. Homann Submitted as Partial Fulfillment of the Professional... OF LITERATURE EXPERIMENTAL PROCEDURE RESULTS AND DISCUSSION SUMMARY AND CONCLUSIONS LITERATURE CITED VITA TABLE OF CONTENTS Page 12 13 15 LIST OF TABLES Table 1. EFFECT OF IRON SOURCE AND TIME OF ADMINISTRATION ON PIG SURVIVAL AND PIG HEIGHTS...

Homann, Ervin R.

2012-06-07T23:59:59.000Z

222

Efficient catalytic wet oxidation of phenol using iron acetylacetonate complexes anchored on carbon nanofibres  

Science Journals Connector (OSTI)

Iron acetylacetonate complexes anchored on oxidized carbon nanofibres (CNFs) were prepared by a three steps procedure: (i) oxidation of commercial \\{CNFs\\} by treatment with HNO3, (ii) synthesis of acetylacetonate (acac) functional groups on the oxidized \\{CNFs\\} surfaces (acac/CNFs) and (iii) iron ions complexation on the acac sites of the \\{CNFs\\} (Fe-acac/CNFs). The surface groups exposed on the functionalized \\{CNFs\\} were characterized by using attenuated total reflectance Fourier transform infrared spectroscopy, temperature programmed desorption, thermogravimetric analysis and X-ray photoelectron spectroscopy. The functionalized \\{CNFs\\} and the iron complexes anchored on the \\{CNFs\\} were tested as heterogeneous catalysts for the wet oxidation of phenol with pure oxygen. Complete phenol conversion and high mineralization values were achieved with fresh and reused Fe-acac/CNFs catalysts, which demonstrate the improved stability of the catalysts under the phenol degradation reaction conditions. Furthermore these conditions are comparatively mild, typically 413 K of reaction temperature and 2.0 MPa of oxygen pressure.

M. Soria-Sánchez; A. Maroto-Valiente; J. Álvarez-Rodríguez; I. Rodríguez-Ramos; A. Guerrero-Ruíz

2009-01-01T23:59:59.000Z

223

In-situ remediation of nitrate-contaminated ground water by electrokinetics/iron wall processes  

Science Journals Connector (OSTI)

The feasibility of using electrokinetics coupled with a zero valent iron (Fe0) treatment wall to abiotically remediate nitrate-contaminated soils was investigated. Upon completion of each test run, the contaminated soil specimen was sliced into five parts and analyzed for nitrate-nitrogen, ammonia-nitrogen and nitrite-nitrogen. Nitrogen mass balance was used to determine the major transformation products. In control experiments where only electrokinetics was used at various constant voltages, 25 to 37% of the nitrate-nitrogen was transformed. The amount of nitrate-nitrogen transformed improved when a Fe0 wall (20 g or about 8–10% by weight) was placed near the anode. For test runs at various constant voltages, the amount of nitrate-nitrogen transformed ranged from 54 to 87%. By switching to constant currents, the amount of nitrate-nitrogen — transformed was about 84 to 88%. The major transformation products were ammonia-nitrogen and nitrogen gases. Nitrite-nitrogen was less than 1% in all experimental runs. Two localized pH conditions exist in the system, a low pH region near the anode and a high pH region near the cathode. Placing of an iron wall near the anode increases the pH in that area as time increases. Movement of the acid front did not flush across the cathode. This research has demonstrated that the electrokinetics/iron wall process can be used to remediate nitrate-contaminated groundwater.

Chin F. Chew; Tian C. Zhang

1998-01-01T23:59:59.000Z

224

EPR and magnetic susceptibility investigation of iron-zinc-phosphate glass ceramics  

SciTech Connect (OSTI)

(Fe{sub 2}O{sub 3}){sub x}?(P{sub 2}O{sub 5}){sub 40}?(ZnO){sub 60?x} glass ceramics containing different concentrations of Fe{sub 2}O{sub 3} ranging from 1 to 20 mol% were obtained by heat treatment of glass samples at 650 °C for 2 h. The structural and magnetic properties of these glass ceramics were investigated by means of electron paramagnetic resonance (EPR) and magnetic susceptibility measurements. The EPR spectra of the studied samples revealed absorptions centered at g ? 2.0 and 4.3. The compositional variations of the intensity and line width of these absorption lines was interpreted in terms of the variation in Fe{sup 3+} and Fe{sup 2+} ions concentration in the glass ceramics as well as the interaction between the iron ions. The magnetic susceptibility data evidenced the presence of both Fe{sup 3+} and Fe{sup 2+} ions, with their relative content depending on the Fe{sub 2}O{sub 3} concentration. Dipolar and superexchange interactions involving iron ions were revealed depending on the iron content of the sample.

Popa, A. [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania)] [National Institute for Research and Development of Isotopic and Molecular Technologies, 65-103 Donath, 400293 Cluj-Napoca (Romania); Stefan, R. [Agricultural Science and Veterinary Medicine University, 3-5 Calea Manastur, 400372 Cluj-Napoca, Romania and Technical University, 28 Memorandumului, 400114 Cluj-Napoca (Romania)] [Agricultural Science and Veterinary Medicine University, 3-5 Calea Manastur, 400372 Cluj-Napoca, Romania and Technical University, 28 Memorandumului, 400114 Cluj-Napoca (Romania); Bosca, M.; Dan, V.; Pop, V.; Pascuta, P. [Technical University, 28 Memorandumului, 400114 Cluj-Napoca (Romania)] [Technical University, 28 Memorandumului, 400114 Cluj-Napoca (Romania)

2013-11-13T23:59:59.000Z

225

Chelating agent assisted heat treatment of carbon supported cobalt oxide nanoparticle for use as cathode catalyst of polymer electrolyte membrane fuel cell (PEMFC)  

Science Journals Connector (OSTI)

Cobalt-based catalysts for the oxygen reduction reaction (ORR) in polymer electrolyte membrane fuel cell (PEMFC) have been successfully incorporated cobalt oxide (Co3O4) onto Vulcan XC-72 carbon powder by thermal decomposition of Co–ethylenediamine complex (ethylenediamine, NH2CH2CH2NH2, denoted en) at 850 °C. The catalysts were prepared by adsorbing the cobalt complexes [Co(en)(H2O)4]3+, [Co(en)2(H2O)2]3+ and [Co(en)3]3+ on commercial XC-72 carbon black supports, loading amount of Co with respect to carbon black was about 2%, the resulting materials have been pyrolyzed under nitrogen atmosphere to create CoOx/C catalysts, donated as E1, E2, and E3, respectively. The composite materials were characterized using X-ray diffraction (XRD), high-resolution transmission electron microscopy (HRTEM) and X-ray photoelectron spectroscopy (XPS). Chemical compositions of prepared catalysts were determined using inductively-coupled plasma-atomic emission spectroscopy (ICP-AES). The catalytic activities for ORR have been analyzed by cyclic voltammetry (CV) and linear sweep voltammetry (LSV). The electrocatalytic activity for oxygen reduction of E2 is superior to that of E1 and E3. Membrane electrode assemblies (MEAs) containing the synthesized CoOx/C cathode catalysts were fabricated and evaluated by single cell tests. The E2 cathode performed better than that of E1 and E3 cathode. This can be attributed to the enhanced activity for ORR, in agreement with the composition of the catalyst that CoO co-existed with Co3O4. The maximum power density 73 mW cm?2 was obtained at 0.3 V with a current density of 240 mA cm?2 for E2 and the normalized power density of E2 is larger than that that of commercial 20 wt.% Pt/C-ETEK.

Chia-Hung Huang; Shyh-Jiun Liu; Weng-Sing Hwang

2011-01-01T23:59:59.000Z

226

Unconventional temperature enhanced magnetism in iron telluride  

SciTech Connect (OSTI)

Discoveries of copper and iron-based high-temperature superconductors (HTSC)1-2 have challenged our views of superconductivity and magnetism. Contrary to the pre-existing view that magnetism, which typically involves localized electrons, and superconductivity, which requires freely-propagating itinerant electrons, are mutually exclusive, antiferromagnetic phases were found in all HTSC parent materials3,4. Moreover, highly energetic magnetic fluctuations, discovered in HTSC by inelastic neutron scattering (INS) 5,6, are now widely believed to be vital for the superconductivity 7-10. In two competing scenarios, they either originate from local atomic spins11, or are a property of cooperative spin-density-wave (SDW) behavior of conduction electrons 12,13. Both assume clear partition into localized electrons, giving rise to local spins, and itinerant ones, occupying well-defined, rigid conduction bands. Here, by performing an INS study of spin dynamics in iron telluride, a parent material of one of the iron-based HTSC families, we have discovered that this very assumption fails, and that conduction and localized electrons are fundamentally entangled. In the temperature range relevant for the superconductivity we observe a remarkable redistribution of magnetism between the two groups of electrons. The effective spin per Fe at T 10 K, in the2 antiferromagnetic phase, corresponds to S 1, consistent with the recent analyses that emphasize importance of Hund s intra-atomic exchange15-16. However, it grows to S 3/2 in the disordered phase, a result that profoundly challenges the picture of rigid bands, broadly accepted for HTSC.

Zalinznyak, I. [Brookhaven National Laboratory (BNL); Xu, Zhijun [ORNL; Tranquada, John M. [Brookhaven National Laboratory (BNL); Gu, G. D. [Brookhaven National Laboratory (BNL); Tsvelik, A. [Brookhaven National Laboratory (BNL); Stone, Matthew B [ORNL

2011-01-01T23:59:59.000Z

227

Interstitial-phase precipitation in iron-base alloys: a comparative study  

SciTech Connect (OSTI)

Recent developments have elucidated the atomistic mechanisms of precipitation of interstitial elements in simple alloy systems. However, in the more technologically important iron base alloys, interstitial phase precipitation is generally not well understood. The present experimental study was therefore designed to test the applicability of these concepts to more complex ferrous alloys. Hence, a comparative study was made of interstitial phase precipitation in ferritic Fe-Si-C and in austenitic phosphorus-containing Fe-Cr-Ni steels. These systems were subjected to a variety of quench-age thermal treatments, and the microstructural development was subsequently characterized by transmission electron microscopy.

Pelton, A.R.

1982-06-01T23:59:59.000Z

228

A Comparison of Iron and Steel Production Energy Intensity in China and the U.S  

E-Print Network [OSTI]

pdf Association for Iron and Steel Technology (AIST). 2010a.American BOF Roundup. Iron & Steel Technology. November.for Iron and Steel Technology (AIST). 2010b. 2010 EAF

Price, Lynn

2014-01-01T23:59:59.000Z

229

THE EFFECT OF SMECTITE ON THE CORROSION OF IRON METAL. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

THE EFFECT OF SMECTITE ON THE CORROSION OF IRON METAL. THE EFFECT OF SMECTITE ON THE CORROSION OF IRON METAL. Abstract: The combination of zero-valent iron and a clay-type...

230

Tricking Iron into Acting like a Rare-earth Element | The Ames...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Tricking Iron into Acting like a Rare-earth Element By slipping iron between two nitrogen atoms in a lithium matrix, researchers are able to trick iron into having magnetic...

231

Arsenic remediation of drinking water using iron-oxide coated coal bottom ash  

E-Print Network [OSTI]

using Iron-oxide Coated Coal Ash. In Arsenic Contaminationwater using  iron?oxide coated coal bottom ash  Johanna L.  using iron-oxide coated coal bottom ash JOHANNA L. MATHIEU

MATHIEU, JOHANNA L.

2010-01-01T23:59:59.000Z

232

Iron Phosphate Glass-Containing Hanford Waste Simulant  

SciTech Connect (OSTI)

Resolution of the nation's high-level tank waste legacy requires the design, construction, and operation of large and technically complex one-of-a-kind processing waste treatment and vitrification facilities. While the ultimate limits for waste loading and melter efficiency have yet to be defined or realized, significant reductions in glass volumes for disposal and mission life may be possible with advancements in melter technologies and/or glass formulations. This test report describes the experimental results from a small-scale test using the research-scale melter (RSM) at Pacific Northwest National Laboratory (PNNL) to demonstrate the viability of iron-phosphate-based glass with a selected waste composition that is high in sulfate (4.37 wt% SO3). The primary objective of the test was to develop data to support a cost-benefit analysis related to the implementation of phosphate-based glasses for Hanford low-activity waste (LAW) and/or other high-level waste streams within the U.S. Department of Energy complex. The testing was performed by PNNL and supported by Idaho National Laboratory, Savannah River National Laboratory, Missouri University of Science and Technology, and Mo-Sci Corporation.

Sevigny, Gary J.; Kimura, Marcia L.; Fischer, Christopher M.; Schweiger, M. J.; Rodriguez, Carmen P.; Kim, Dong-Sang; Riley, Brian J.

2012-01-18T23:59:59.000Z

233

An iron complex with pendant amines as a molecular electrocatalyst for oxidation of hydrogen  

SciTech Connect (OSTI)

Addressing the worldwide problems of escalating energy demand and increasing emissions of CO2 requires an increase in utilization of carbon-neutral, sustainable energy sources. Electrocatalysts are needed for conversion between chemical energy (bonds such as the H-H bond of hydrogen) and electricity in future systems for storage and use of energy. Hydrogen is an attractive energy carrier, but a major barrier to more widespread use of hydrogen is the need for efficient, inexpensive catalysts. Electricity is produced from oxidation of hydrogen in low-temperature fuel cells, but the best catalyst is platinum, a precious metal of low abundance.1 Here we show that a synthetic iron complex is a catalyst for the oxidation of hydrogen. A burgeoning effort by chemists studying many areas of catalysis has focused on "Cheap Metals for Noble Tasks."2 Iron is particularly attractive because of its very high earth-abundance along with its low cost and toxicity, leading Bolm to suggest the advent of a "new iron age."3 Our results demonstrate that rationally designed catalysts based on abundant, inexpensive metals offer substantial promise as alternatives to precious metal catalysts. We thank the U.S. Department of Energy, Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences and Biosciences, for support of this research. Pacific Northwest National Laboratory is operated by Battelle for the U.S. Department of Energy.

Liu, Tianbiao L.; DuBois, Daniel L.; Bullock, R. Morris

2013-02-17T23:59:59.000Z

234

Engineering a single cell microarray platform for high throughput DNA damage and repair analysis  

E-Print Network [OSTI]

DNA damage contributes to cancer, aging, and heritable diseases. Ironically, DNA damaging agents are also commonly used in current cancer treatment. We therefore need robust, high throughput, and inexpensive tools for ...

Weingeist, David McGregor

2012-01-01T23:59:59.000Z

235

Effects of hydrochloric acid treatment of TiO{sub 2} nanoparticles/nanofibers bilayer film on the photovoltaic properties of dye-sensitized solar cells  

SciTech Connect (OSTI)

Highlights: ? The TiO{sub 2} nanoparticles/TiO{sub 2} nanofibers bilayer film was fabricated for DSSC. ? The effects of HCl treated TiO{sub 2} on the performance of DSSC were investigated. ? The potential methods of improving conversion efficiency are suggested. - Abstract: The TiO{sub 2} nanoparticles/nanofibers bilayer film has been fabricated via spin coating and electrospinning followed by calcination. The TiO{sub 2} bilayer film with thickness of about 6.0 ?m is composed of anatase TiO{sub 2} phase. Dye-sensitized solar cells (DSSC) were assembled by hydrochloric acid (HCl) treated TiO{sub 2} film. The results of the photocurrent action spectra, electrochemical impedance spectroscopy (EIS), and I–V curves showed that each photovoltaic parameter of DSSC increased with the concentration of HCl increasing, and reached a maximum value and afterwards decreased. The maximum incident monochromatic photo-to-electron conversion efficiency (at 350 nm) and maximum overall conversion efficiency (?) of 0.05 M HCl treated TiO{sub 2} based DSSC were enhanced to 48.0% and 4.75%, which were respectively increased by 14% and 6.3% than those of DSSC based on untreated TiO{sub 2} film.

Song, Lixin; Du, Pingfan; Shao, Xiaoli; Cao, Houbao; Hui, Quan [Key Laboratory of Advanced Textile Materials and Manufacturing Technology of Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China); Xiong, Jie, E-mail: jxiong@zstu.edu.cn [Key Laboratory of Advanced Textile Materials and Manufacturing Technology of Ministry of Education, Zhejiang Sci-Tech University, Hangzhou 310018 (China)

2013-03-15T23:59:59.000Z

236

Pertechnetate (TcO4-) reduction by reactive ferrous iron forms...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

reduction by reactive ferrous iron forms in naturally anoxic, redox transition zone sediments from the Pertechnetate (TcO4-) reduction by reactive ferrous iron forms in naturally...

237

E-Print Network 3.0 - anthropogenic iron cycles Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

iron cycle control atmospheric CO ? 12;The Global Carbon Cycle 70 times more carbon in ocean than... on ocean biological activity Iron cycle processes Modeling ... Source:...

238

Calcite precipitation dominates the electrical signatures of zero valent iron columns under simulated field conditions  

E-Print Network [OSTI]

iron media using Tafel analysis and Electrochemicalzerovalent iron using tafel analysis and electrochemicalAt the micro-scale, Tafel scan and electrochemical impedance

Wu, Yuxin

2009-01-01T23:59:59.000Z

239

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network [OSTI]

of iron de?ciency on photosynthesis Aimee M. Terauchi •rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

240

Neutron Scattering Studies of Cuprates and Iron Pnictides.  

E-Print Network [OSTI]

??Presented within are neutron scattering studies of several different high temperature superconducting materials: BaFe1.9Ni0.1As2 [Barium Iron Nickel Arsenic], BaFe1.85Ni0.15As2 [Barium Iron Nickel Arsenic], Ba0.67K0.33Fe2As2 [Barium… (more)

Liu, Mengshu

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Enhanced Superconducting Properties of Iron Chalcogenide Thin Films  

E-Print Network [OSTI]

Among the newly discovered iron-based superconductor, FeSe with the simplest structure and a transition temperature (T_c) around 8 K arouses much research interest. Although its Tc is much lower than that of the cuprates, iron chalcogenide has low...

Chen, Li

2013-07-26T23:59:59.000Z

242

Next Generation Metallic Iron Nodule Technology in Electric Furnace Steelmaking  

Broader source: Energy.gov [DOE]

This factsheet describes a research project whose objective is to investigate reducing processing temperature, controlling the gas temperature and gas atmosphere over metalized iron nodules, and effectively using sub-bituminous coal as a reductant for producing high quality metalized iron nodules at low cost.

243

The iron powder test for naphthenic acid corrosion studies  

SciTech Connect (OSTI)

In the course of an ongoing investigation into the phenomenon of naphthenic acid corrosion, a new test method has evolved and is currently being further developed to substitute the total acid number (TAN or neutralization number) as an indicator for naphthenic acid corrosion potential. It can also be used to complement conventional autoclave corrosion tests in high temperature environments, which are based on weight loss of steel coupons. In this new method an oil sample reacts with pure iron powder within an autoclave heated to the testing temperature. The result is based on the amount of dissolved iron found in the oil sample. The oil sample can dissolve an amount of iron for a given time at a given temperature, depending on the naphthenic acid corrosion, since these acids react with iron to produce oil soluble iron naphthenates. This paper describes the method, compares it with conventional crude corrosiveness testing, and proposes it as a new way of measuring naphthenic acid corrosion potential.

Hau, J.L.; Yepez, O.; Specht, M.I.; Lorenzo, R. [PDVSA-Intevep, Caracas (Venezuela)

1999-11-01T23:59:59.000Z

244

Electrochemical treatment of human waste coupled with molecular hydrogen production  

E-Print Network [OSTI]

in a hydrogen fuel cell. Herein, we report on the efficacy of a laboratory-scale wastewater electrolysis cell an electrolysis cell for on-site wastewater treatment coupled with molecular hydrogen production for useElectrochemical treatment of human waste coupled with molecular hydrogen production Kangwoo Cho

Heaton, Thomas H.

245

ITP Mining: Energy and Environmental Profile of the U.S. Mining Industry: Chapter 4: Iron  

Broader source: Energy.gov (indexed) [DOE]

4 4 Iron The chemical element iron is the fourth most common element in the Earth's crust and the second most abundant metal. About five percent of the Earth's crust is composed of iron. The metal is chemically active and is found in nature combined with other elements in rocks and soils. In its natural state, iron is chemically bonded with oxygen, water, carbon dioxide, or sulfur in a variety of minerals. Forms of Iron Minerals, Ores, and Rocks Iron occurs mainly in iron-oxide ores. Some ores are a mixture of minerals rich in iron. Other iron ores are less rich and have a large number of impurities. The most important iron ore- forming minerals are: * Magnetite - Magnetite (Fe 3 O 4 ) forms magnetic black iron ore. There are large deposits of

246

Theoretical Investigation of Hydrogen Adsorption and Dissociation on Iron and Iron Carbide Surfaces Using the ReaxFF Reactive Force Field Method  

SciTech Connect (OSTI)

We have developed a ReaxFF reactive force field to describe hydrogen adsorption and dissociation on iron and iron carbide surfaces relevant for simulation of Fischer–Tropsch (FT) synthesis on iron catalysts. This force field enables large system (>>1000 atoms) simulations of hydrogen related reactions with iron. The ReaxFF force field parameters are trained against a substantial amount of structural and energetic data including the equations of state and heats of formation of iron and iron carbide related materials, as well as hydrogen interaction with iron surfaces and different phases of bulk iron. We have validated the accuracy and applicability of ReaxFF force field by carrying out molecular dynamics simulations of hydrogen adsorption, dissociation and recombination on iron and iron carbide surfaces. The barriers and reaction energies for molecular dissociation on these two types of surfaces have been compared and the effect of subsurface carbon on hydrogen interaction with iron surface is evaluated. We found that existence of carbon atoms at subsurface iron sites tends to increase the hydrogen dissociation energy barrier on the surface, and also makes the corresponding hydrogen dissociative state relatively more stable compared to that on bare iron. These properties of iron carbide will affect the dissociation rate of H{sub 2} and will retain more surface hydride species, thus influencing the dynamics of the FT synthesis process.

Zou, Chenyu; van Duin, Adri C.T.; Sorescu, Dan C.

2012-06-01T23:59:59.000Z

247

System and method for producing metallic iron  

DOE Patents [OSTI]

A hearth furnace for producing metallic iron material has a furnace housing having a drying/preheat zone, a conversion zone, a fusion zone, and optionally a cooling zone, the conversion zone is between the drying/preheat zone and the fusion zone. A moving hearth is positioned within the furnace housing. A hood or separation barrier within at least a portion of the conversion zone, fusion zone or both separates the fusion zone into an upper region and a lower region with the lower region adjacent the hearth and the upper region adjacent the lower region and spaced from the hearth. An injector introduces a gaseous reductant into the lower region adjacent the hearth. A combustion region may be formed above the hood or separation barrier.

Bleifuss, Rodney L; Englund, David J; Iwasaki, Iwao; Fosnacht, Donald R; Brandon, Mark M; True, Bradford G

2013-09-17T23:59:59.000Z

248

Iron and steel industry process model  

SciTech Connect (OSTI)

The iron and steel industry process model depicts expected energy-consumption characteristics of the iron and steel industry and ancillary industries for the next 25 years by means of a process model of the major steps in steelmaking, from ore mining and scrap recycling to the final finishing of carbon, alloy, and stainless steel into steel products such as structural steel, slabs, plates, tubes, and bars. Two plant types are modeled: fully integrated mills and mini-mills. User-determined inputs into the model are as follows: projected energy and materials prices; projected costs of capacity expansion and replacement; energy-conserving options, both operating modes and investments; the internal rate of return required on investment; and projected demand for finished steel. Nominal input choices in the model for the inputs listed above are as follows: National Academy of Sciences Committee on Nuclear and Alternative Energy Systems Demand Panel nominal energy-price projections for oil, gas, distillates, residuals, and electricity and 1975 actual prices for materials; actual 1975 costs; new technologies added; 15% after taxes; and 1975 actual demand with 1.5%/y growth. The model reproduces the base-year (1975) actual performance of the industry; then, given the above nominal input choices, it projects modes of operation and capacity expansion that minimize the cost of meeting the given final demands for each of 5 years, each year being the midpoint of a 5-year interval. The output of the model includes the following: total energy use and intensity (Btu/ton) by type, by process, and by time period; energy conservation options chosen; utilization rates for existing capacity; capital-investment decisions for capacity expansion.

Sparrow, F.T.; Pilati, D.; Dougherty, T.; McBreen, E.; Juang, L.L.

1980-01-01T23:59:59.000Z

249

Performance of the SLD Warm Iron Calorimeter prototype  

SciTech Connect (OSTI)

A prototype hadron calorimeter, of similar design to the Warm Iron Calorimeter (WIC) planned for the SLD experiment, has been built and its performance has been studied in a test beam. The WIC is an iron sampling calorimeter whose active elements are plastic streamer tubes similar to those used for the Mont-Blanc proton decay experiment. The construction and operation of the tubes will be briefly described together with their use in an iron calorimeter - muon tracker. Efficiency, resolution and linearity have been measured in a hadron/muon beam up to 11 GeV. The measured values correspond to the SLD design goals.

Callegari, G.; Piemontese, L.; De Sangro, R.; Peruzzi, I., Piccolo, M.; Busza, W.; Friedman, J.; Johnson, A.; Kendall, H.; Kistiakowsky, V.

1986-03-01T23:59:59.000Z

250

The effects of copper and iron deficiencies in the chick  

E-Print Network [OSTI]

). Copper and iron content of all four diets were determined and the results reported in Table 2, III. Experiment 2. This experiment was carried out to determine the effects of adding cupric oxide to the diet in place of cupric sulfate as the copper... of Copper and Iron Deficiencies on Blood, Mortality and Weights of Four Week Old Chicks Analysis of Copper and Iron Content of Purified Diet" Experiment 3 Effects of Cupric Sulfate, Cupric Oxide, Ferrous Sul- fate and Ferric Oxide on Blood, Mortality...

McGhee, Flin Cameron

2012-06-07T23:59:59.000Z

251

Iron-carbon compacts and process for making them  

DOE Patents [OSTI]

The present invention includes iron-carbon compacts and a process for making them. The process includes preparing a slurry comprising iron powder, furfuryl alcohol, and a polymerization catalyst for initiating the polymerization of the furfuryl alcohol into a resin, and heating the slurry to convert the alcohol into the resin. The resulting mixture is pressed into a green body and heated to form the iron-carbon compact. The compact can be used as, or machined into, a magnetic flux concentrator for an induction heating apparatus.

Sheinberg, Haskell (Santa Fe, NM)

2000-01-01T23:59:59.000Z

252

Nickel and iron EXAFS of carbon monoxide dehydrogenase from Clostridium thermoaceticum strain DSM  

Science Journals Connector (OSTI)

Nickel and iron EXAFS of carbon monoxide dehydrogenase from Clostridium thermoaceticum strain DSM ...

Neil R. Bastian; Gabriele. Diekert; Eric C. Niederhoffer; Boon Keng. Teo; Christopher T. Walsh; William H. Orme-Johnson

1988-08-01T23:59:59.000Z

253

Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable Reactive Barrier, Monticello, Utah  

Broader source: Energy.gov [DOE]

Third (March 2006) Coring and Analysis of Zero-Valent Iron Permeable Reactive Barrier, Monticello, Utah

254

An Application of the Electric Resistance Furnace to the Determination of Oxygen in Iron and Steel.  

Science Journals Connector (OSTI)

An Application of the Electric Resistance Furnace to the Determination of Oxygen in Iron and Steel. ...

R. H. McMillen

1913-01-01T23:59:59.000Z

255

Maintenance and Operations study for K basins sludge treatment  

SciTech Connect (OSTI)

This study evaluates maintenance and operating concepts for the chemical treatment of sludge from the 100 K Basins at Hanford. The sludge treatment equipment that will require remote operation or maintenance was identified. Then various maintenance and operating concepts used in the nuclear industry were evaluated for applicability to sludge treatment. A hot cell or cells is recommended as the best maintenance and operating concept for a sludge treatment facility.

WESTRA, A.G.

1998-11-30T23:59:59.000Z

256

Nanotechnology in Cancer Treatment and Detection Richard Acosta  

E-Print Network [OSTI]

Nanotechnology in Cancer Treatment and Detection Richard Acosta #12;Motivation ·Ineffectiveness or roughly 100 times smaller than most human cells Cancer Nanotechnology research is interdisciplinary

Fygenson, Deborah Kuchnir

257

LANSCE | Lujan Center | Highlights | Local iron displacements and  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Local iron displacements and magnetoelastic coupling in a spin-ladder Local iron displacements and magnetoelastic coupling in a spin-ladder compound Hypothesis: Is magnetoelastic coupling in [FeX4]-based materials, an important ingredient in the emergence of superconductivity? Lujan Center: Combined Total Scattering and magnetic structure determination (HIPD-NPDF) The study of local, average and magnetic structure shows the existenceof highly correlated local iron (Fe) displacements in the spin-ladder iron chalcogenide BaFe2Se3. Built of ferromagnetic [Fe4] plaquettes, the magnetic ground state correlates with local displacements of the Fe atoms. Knowledge of these local displacements is essential for properly understanding the electronic structure of these systems. As with the copper oxide superconductors two decades ago, these

258

Percolation Explains How Earth's Iron Core Formed | Stanford Synchrotron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Percolation Explains How Earth's Iron Core Formed Percolation Explains How Earth's Iron Core Formed Wednesday, November 27, 2013 The formation of Earth's metallic core, which makes up a third of our planet's mass, represents the most significant differentiation event in Earth's history. Earth's present layered structure with a metallic core and an overlying silicate mantle would have required mechanisms to separate iron alloy from a silicate phase. Percolation of liquid iron alloy moving through a solid silicate matrix (much as water percolates through porous rock, or even coffee grinds) has been proposed as a possible model for core formation (Figure 1). Many previous experimental results have ruled out percolation as a major core formation mechanism for Earth at the relatively lower pressure conditions in the upper mantle, but until now experimental

259

Regenerable Mixed Copper-Iron-Inert Support Oxygen Carriers  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mixed Copper-Iron-Inert Support Oxygen Carriers Mixed Copper-Iron-Inert Support Oxygen Carriers for Solid Fuel Chemical Looping Combustion Process Contact NETL Technology Transfer Group techtransfer@netl.doe.gov December 2012 This patent-pending technology, "Regenerable Mixed Copper-Iron-Inert Support Oxygen Carriers for Solid Fuel Chemical Looping Combustion Process," provides a metal-oxide oxygen carrier for application in fuel combustion processes that use oxygen. This technology is available for licensing and/or further collaborative research with the U.S. Department of Energy's National Energy Technology Laboratory. Overview Patent Details U.S. Non-Provisional Patent Application No. 13/159,553; titled "Regenerable Mixed Copper-Iron-Inert Support Oxygen Carriers for Solid

260

Open Ocean Iron Fertilization for Scientific Study and Carbon Sequestration  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ocean Iron Fertilization for Scientific Study and Carbon Sequestration Ocean Iron Fertilization for Scientific Study and Carbon Sequestration K. Coale coale@mlml.calstate.edu (831) 632-4400 Moss Landing Marine Laboratories 8272 Moss Landing Road Moss Landing, California 95039 USA Abstract The trace element iron has been recently shown to play a critical role in nutrient utilization, phytoplankton growth and therefore the uptake of carbon dioxide from the surface waters of the global ocean. Carbon fixation in the surface waters, via phytoplankton growth, shifts the ocean/atmosphere exchange equilibrium for carbon dioxide. As a result, levels of atmospheric carbon dioxide (a greenhouse gas) and iron flux to the oceans have been linked to climate change (glacial to interglacial transitions). These recent findings have led some to suggest that large scale

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

DOE - Office of Legacy Management -- Knoxville Iron Co - TN 07  

Office of Legacy Management (LM)

Knoxville Iron Co - TN 07 Knoxville Iron Co - TN 07 FUSRAP Considered Sites Site: KNOXVILLE IRON CO. (TN.07 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Knoxville , Tennessee TN.07-1 Evaluation Year: 1994 TN.07-2 TN.07-3 Site Operations: Melted uranium contaminated scrap metal in order to test industrial hygiene procedures in the mid-1950s. TN.07-1 Site Disposition: Eliminated - AEC license TN.07-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Limited Quantities of Uranium Contained in Slag Material TN.07-4 Radiological Survey(s): Yes - health and safety monitoring during operations only TN.07-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to KNOXVILLE IRON CO.

262

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the The Iron Spin Transition in the Earth's Lower Mantle The Iron Spin Transition in the Earth's Lower Mantle Print Wednesday, 30 April 2008 00:00 It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

263

Decoupling of iron and phosphate in the global ocean  

E-Print Network [OSTI]

M increase in dissolved iron in deep waters. Forcing the model with weaker wind stresses leads to a decrease CO2. Additionally, nitrogen fixing organisms (reviewed by Karl et al. [2002] and Mills et al. [2004

Follows, Mick

264

Chapter 1.2 - The Direct Reduction of Iron  

Science Journals Connector (OSTI)

Abstract For the past 100 years, the dominant technology to produce iron from iron ores has been the blast furnace, which utilizes carbothermic reduction at elevated temperatures to make a molten iron product and a liquid slag. However, economic ironmaking in this fashion requires massive facilities for economy of scale, and is environmentally problematic with its sinter plants, coke ovens, and large production of carbon dioxide. Direct reduction (DR) is an alternate form of ironmaking that is economic at much smaller scales, generally uses natural gas as reductant instead of coke, and costs considerably less than a blast furnace facility. Worldwide production of Direct Reduced Iron has increased from less than one million tonnes per year in 1971 to over 70 million tonnes forty years later. DRI production is expected to continue this rapid increase for years to come.

Thomas Battle; Urvashi Srivastava; John Kopfle; Robert Hunter; James McClelland

2014-01-01T23:59:59.000Z

265

Iron and DHA in Relation to Early Cognitive Development  

E-Print Network [OSTI]

(SF), and body iron (BI); DHA by median split. Bayley Scales of Infant Development Index II (BSID-II) Mental Developmental Index (MDI) and Psychomotor Developmental Index (PDI) at 18 months (n=191) were assessed. A priori comparisons observed MDI...

Park, Loran Marie

2013-05-31T23:59:59.000Z

266

Surface modifications of iron oxide nanoparticles for biological applications  

E-Print Network [OSTI]

Iron oxides magnetic nanoparticles (MPs) of high crystallinity, high magnetization, and size-monodispersity were synthesized with oleic acid as their native ligands. These hydrophobic and non-functionalized MPs have magnetic ...

Insin, Numpon

2011-01-01T23:59:59.000Z

267

Polymer-coated iron oxide nanoparticles for medical imaging  

E-Print Network [OSTI]

One of the most versatile and safe materials used in medicine are polymer-coated iron oxide nanoparticles. This dissertation describes several formulations for in vivo imaging applications. The paramagnetic polymer-coated ...

Chen, Suelin, Ph.D. Massachusetts Institute of Technology

2010-01-01T23:59:59.000Z

268

Mechanism of iron catalysis of carbon monoxide decomposition in refractories  

SciTech Connect (OSTI)

The authors discuss the catalytic effects of selected iron phases (metals, oxides, sulfides, and carbides) on the Boudouard reaction studied in an effort to more fully understand the disintegration of refractories when exposed to CO for long periods of time. It was found that active Fe atoms generated from the reduction of the iron oxides, especially {alpha}-Fe/sub 2/O/sub 3/, are the actual catalysts for the Boudouard reaction. The catalytic process confirmed by thermodynamic calculations, kinetic data, and X-ray diffraction data, consists of adsorption and decomposition of CO simultaneously forming carbides of iron. The chemisorption and subsequent decomposition of the iron carbides, rather than diffusion, constitute the rate-controlling process for carbon deposition.

Xu, M.W.P.; Brown, J.J. Jr. (Virginia Polytechnic Inst. and State Univ., Blacksburg, VA (USA). Dept. of Materials Engineering)

1989-01-01T23:59:59.000Z

269

Evidence for a Weak Iron Core at Earth's Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Iron Core at Earth's Center Print Seismic waves that pass through the center of the Earth travel faster going from pole to pole than along the equatorial plane-why? One theory...

270

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons....

271

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2008 00:00 It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons....

272

Brain Iron as an Early Predictor of Alzheimer's Disease | Advanced...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

| 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed Brain Iron as an Early Predictor of Alzheimer's Disease JUNE 15, 2011 Bookmark and Share (A)...

273

Momentum Distribution of Electrons in Chromium, Iron, and Nickel  

Science Journals Connector (OSTI)

The Compton profiles of the electron momentum distribution in chromium, iron, and nickel are calculated using the wave functions obtained from self-consistent linear-combination-of-atomic-orbitals energy-band calculations. The results are compared with experiment.

J. Rath, C. S. Wang, R. A. Tawil, and J. Callaway

1973-12-01T23:59:59.000Z

274

Energy intensity in China's iron and steel sector  

E-Print Network [OSTI]

In this study, I examine the spatial and economic factors that influence energy intensity in China's iron and steel sector, namely industrial value added, renovation investment, coke consumption, and local coke supply. ...

Xu, Jingsi, M.C.P. Massachusetts Institute of Technology

2011-01-01T23:59:59.000Z

275

Magnetism and Superconductivity Compete in Iron-based Superconductors...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Magnetism and Superconductivity Compete in Iron-based Superconductors Wednesday, April 30, 2014 HTSC Figure 1 Fig. 1. Measured electronic structure of underdoped Ba1-xKxFe2As2 in...

276

Laboratory and field studies of colloidal iron oxide dissolution as ...  

Science Journals Connector (OSTI)

Mechanisms that mediate the conversion of iron from the refractory pool to the ... lated to the extent of dissolution of the ferrihydrite carrier phase, even for .... totals was determined on a Canberra low-energy germanium detector. Replicate ...

2000-06-05T23:59:59.000Z

277

Injection of Zero Valent Iron into an Unconfined Aquifer Using...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Zero Valent Iron into an Unconfined Aquifer Using Shear-Thinning Fluids."Ground Water Monitoring and Remediation 31(1):50-58. Authors: MJ Truex VR Vermeul DP Mendoza BG...

278

Mineral Precipitation Upgradient from a Zero-Valent Iron Permeable...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Precipitation Upgradient from a Zero-Valent Iron Permeable Reactive Barrier."Ground Water Monitoring and Remediation 28(3):56-64. doi:10.1111j.1745-6592.2008.00203.x Authors:...

279

Hepcidin Is Involved in Iron Regulation in the Ischemic Brain  

E-Print Network [OSTI]

Oxidative stress plays an important role in neuronal injuries caused by cerebral ischemia. It is well established that free iron increases significantly during ischemia and is responsible for oxidative damage in the brain. ...

Ding, Hui; Yan, Cai-Zhen; Shi, Honglian; Zhao, Ya-Shuo; Chang, Shi-Yang; Yu, Peng; Wu, Wen_Shuang; Zhao, Chen-Yang; Chang, Yan-Zhong; Duan, Xiang-Lin

2011-09-21T23:59:59.000Z

280

The industrial ecology of the iron casting industry  

E-Print Network [OSTI]

Metal casting is an energy and materials intensive manufacturing process, which is an important U.S. industry. This study analyzes iron casting, in particular, for possible improvements that will result in greater efficiencies ...

Jones, Alissa J. (Alissa Jean)

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Mixed valence of iron in minerals with cation clusters  

Science Journals Connector (OSTI)

The valence and distribution of iron in vivianite, lazulite, babingtonite, rockbridgeite, acmite, aegirine-augite, hedenbergite,...2+ and Fe3+ in neighboring sites through common edges or faces is observed in all...

Georg Amthauer; George R. Rossman

1984-06-01T23:59:59.000Z

282

Process for removing technetium from iron and other metals  

DOE Patents [OSTI]

A process for removing technetium from iron and other metals comprises the steps of converting the molten, alloyed technetium to a sulfide dissolved in manganese sulfide, and removing the sulfide from the molten metal as a slag. 4 figs.

Leitnaker, J.M.; Trowbridge, L.D.

1999-03-23T23:59:59.000Z

283

Neutron scattering study of the iron based superconductors.  

E-Print Network [OSTI]

??In most iron-based and copper-oxide superconductors, the Tc [superconducting critical temperature] gradually increases upon charge carrier doping or isovalent doping. In the under-doped regime of… (more)

Wang, Miaoyin

2013-01-01T23:59:59.000Z

284

Slurry Phase Iron Catalysts for Indirect Coal Liquefaction  

SciTech Connect (OSTI)

This report describes research conducted to support the DOE program in indirect coal liquefaction. Specifically, we have studied the attrition behavior of Iron Fischer-Tropsch catalysts, their interaction with the silica binder and the evolution of iron phases in a synthesis gas conversion process. The results provide significant insight into factors that should be considered in the design of catalysts for the conversion of coal-derived synthesis gas into liquid fuels.

Abhaya K. Datye

1998-09-10T23:59:59.000Z

285

Sound speed and thermophysical properties of liquid iron and nickel  

Science Journals Connector (OSTI)

An electrical-pulse-heating technique has been used to heat iron and nickel to high temperatures to measure thermophysical properties in the liquid state. A dynamic technique was used because static techniques, which are capable of greater precision, fail at a relatively low temperature. Measurements have been made, and results are shown for enthalpy, temperature, density, electrical resistivity, and sound speed up to 3950 K in iron and 4250 K in nickel.

R. S. Hixson; M. A. Winkler; M. L. Hodgdon

1990-10-01T23:59:59.000Z

286

SLURRY PHASE IRON CATALYSTS FOR INDIRECT COAL LIQUEFACTION  

SciTech Connect (OSTI)

This report describes research conducted to support the DOE program in indirect coal liquefaction. Specifically, they have studied the attrition behavior of iron Fischer-Tropsch catalysts, their interaction with the silica binder and the evolution of iron phases in a synthesis gas conversion process. The results provide significant insight into factors that should be considered in the design of catalysts for converting coal based syngas into liquid fuels.

Abhaya K. Datye

1998-11-19T23:59:59.000Z

287

Polymorphous Transformations of Nanometric Iron(III) Oxide: A Review  

Science Journals Connector (OSTI)

Because of its polymorphism, iron(III) oxide (ferric oxide, Fe2O3) is one of the most interesting and potentially useful phases of the iron oxides. ... Structural and magnetic properties, methods of synthesis, and applications of seven Fe(III) oxide polymorphs, including rare beta, epsilon, amorphous, and high-pressure forms, are reviewed. ... Films of ?-Fe2O3 nanoparticles were synthesized by oxidizing Fe films rapidly in air. ...

Libor Machala; Ji?í Tu?ek; Radek Zbo?il

2011-06-01T23:59:59.000Z

288

High-temperature fabricable nickel-iron aluminides  

DOE Patents [OSTI]

Nickel-iron aluminides are described that are based on Ni.sub.3 Al, and have significant iron content, to which additions of hafnium, boron, carbon and cerium are made resulting in Ni.sub.3 Al base alloys that can be fabricated at higher temperatures than similar alloys previously developed. Further addition of molybdenum improves oxidation and cracking resistance. These alloys possess the advantages of ductility, hot fabricability, strength, and oxidation resistance.

Liu, Chain T. (Oak Ridge, TN)

1988-02-02T23:59:59.000Z

289

Lithotrophic iron-oxidizing bacteria produce organic stalks to control mineral growth: implications for biosignature formation  

SciTech Connect (OSTI)

Neutrophilic Fe-oxidizing bacteria (FeOB) are often identified by their distinctive morphologies, such as the extracellular twisted ribbon-like stalks formed by Gallionella ferruginea or Mariprofundus ferrooxydans. Similar filaments preserved in silica are often identified as FeOB fossils in rocks. Although it is assumed that twisted iron stalks are indicative of FeOB, the stalk's metabolic role has not been established. To this end, we studied the marine FeOB M. ferrooxydans by light, X-ray and electron microscopy. Using time-lapse light microscopy, we observed cells excreting stalks during growth (averaging 2.2 {micro}m h(-1)). Scanning transmission X-ray microscopy and near-edge X-ray absorption fine structure (NEXAFS) spectroscopy show that stalks are Fe(III)-rich, whereas cells are low in Fe. Transmission electron microscopy reveals that stalks are composed of several fibrils, which contain few-nanometer-sized iron oxyhydroxide crystals. Lepidocrocite crystals that nucleated on the fibril surface are much larger ({approx}100 nm), suggesting that mineral growth within fibrils is retarded, relative to sites surrounding fibrils. C and N 1s NEXAFS spectroscopy and fluorescence probing show that stalks primarily contain carboxyl-rich polysaccharides. On the basis of these results, we suggest a physiological model for Fe oxidation in which cells excrete oxidized Fe bound to organic polymers. These organic molecules retard mineral growth, preventing cell encrustation. This model describes an essential role for stalk formation in FeOB growth. We suggest that stalk-like morphologies observed in modern and ancient samples may be correlated confidently with the Fe-oxidizing metabolism as a robust biosignature.

Chan, Clara S; Fakra, Sirine C; Emerson, David; Fleming, Emily J; Edwards, Katrina J

2011-07-01T23:59:59.000Z

290

Electrochemical behavior of reactively sputtered iron-doped nickel oxide  

SciTech Connect (OSTI)

Iron-doped nickel oxide films were deposited by reactive sputtering from elemental and alloy targets in a 20% oxygen/argon atmosphere and were characterized for use as oxygen evolution catalysts. The incorporation of iron reduced the overpotential required for oxygen evolution by as much as 300 mV at a current density of 100 mA/cm{sup 2} compared to undoped nickel oxide deposited under similar conditions. Tafel slopes were reduced from 95 mV/dec in undoped NiO{sub x} films to less than 40 mV/dec for films containing 1.6 to 5.6 mole percent (m/o) iron, indicating a change in the rate-limiting step from the primary discharge of OH{sup {minus}} ions to the recombination of oxygen radicals. Resistivity, structural, and compositional measurements indicate that high oxygen content is necessary to gain the full benefit of the iron dopant. Initial tests in KOH indicate excellent long-term stability. A film deposited from the FeNi alloy target, which exhibited low oxygen overpotentials and a Tafel slope of 35 mV/dec, had not degraded appreciably following more than 7,000 h of operation at an anodic current density of 20 mA/cm{sup 2}. Taken together, the low oxygen evolution reaction overpotentials, the excellent stability in KOH, and the relative insensitivity to iron content indicative that reactively sputtered iron-doped nickel oxide is promising as an oxygen catalyst.

Miller, E.L.; Rocheleau, R.E. [Univ. of Hawaii, Honolulu, HI (United States)

1997-09-01T23:59:59.000Z

291

Onsite Wastewater Treatment Systems: Aerobic Treatment Unit  

E-Print Network [OSTI]

wastewater treatment systems use. They remove 85 to 98 percent of the organic matter and solids from the wastewater, producing effluent as clean as that from munici- pal wastewater treatment plants, and cleaner than that from conventional septic tanks.... Onsite wastewater treatment systems Single-compartment trash tank Chlorinator Aerobic treatment unit Spray heads Pump tank Bruce Lesikar Professor and Extension Agricultural Engineer The Texas A&M System Aerobic treatment units, which are certified...

Lesikar, Bruce J.

2008-10-31T23:59:59.000Z

292

Synthesis of iron oxides and the influence of organic acids on the resolubilization of iron minerals  

E-Print Network [OSTI]

of Organ1c Acids on the Resolubi1 izat1on of Iron M1neral s. (May 1984) Er1c Thacher Clarke, B. A. , Southwestern University Chairman of Advisory Committee: Dr. Richard H. Loeppert Equilibrium Fe concentrat1ons of calcareous soil are readily... and reducing agents, buffered in 1. 0 N NH4 acetate at pH 3. 5 and 4. 75, Dissolution rate in oxalic acid decreased in the following order: ferrihydrite, lep1docroc1te, and goeth1te. Rate of Fe ox1de dissolution 1n the presence of com- plexing and reducing...

Clarke, Eric Thacher

2012-06-07T23:59:59.000Z

293

The effect of iron dilution on strength of nickel/steel and Monel/steel welds  

SciTech Connect (OSTI)

The weld strength, as a function of iron content, for nickel/steel and Monel/steel welds was determined. Samples were prepared using a Gas Metal Arc (GMAW) automatic process to weld steel plate together with nickel or Monel to produce a range of iron contents typical of weld compositions. Tensile specimens of each iron content were tested to obtain strength and ductility measurements for that weld composition. Data indicate that at iron contents of less than 20% iron in a nickel/steel weld, the weld fails at the weld interface, due to a lack of fusion. Between 20% and 35% iron, the highest iron dilution that could be achieved in a nickel weld, the welds were stronger than the steel base metal. This indicates that a minimum amount of iron dilution (20%) is necessary for good fusion and optimum strength. On the other hand for Monel/steel welds, test results showed that the welds had good strength and integrity between 10% and 27% iron in the weld. Above 35% iron, the welds have less strength and are more brittle. The 35% iron content also corresponds to the iron dilution in Monel welds that has been shown to produce an increase in corrosion rate. This indicates that the iron dilution in Monel welds should be kept below 35% iron to maximize both the strength and corrosion resistance. 2 refs., 6 figs., 3 tabs.

Fout, S.L.; Wamsley, S.D.

1983-03-28T23:59:59.000Z

294

Transplantation of Adult Mouse iPS Cell-Derived Photoreceptor Precursors Restores Retinal Structure and Function in Degenerative Mice  

E-Print Network [OSTI]

al. ( 2007) Treatment of sickle cell anemia mouse model withan animal model of sickle cell anemia [36], or engraftment

2011-01-01T23:59:59.000Z

295

Waste Treatment Plant - 12508  

SciTech Connect (OSTI)

The Waste Treatment Plant (WTP) will immobilize millions of gallons of Hanford's tank waste into solid glass using a proven technology called vitrification. The vitrification process will turn the waste into a stable glass form that is safe for long-term storage. Our discussion of the WTP will include a description of the ongoing design and construction of this large, complex, first-of-a-kind project. The concept for the operation of the WTP is to separate high-level and low-activity waste fractions, and immobilize those fractions in glass using vitrification. The WTP includes four major nuclear facilities and various support facilities. Waste from the Tank Farms is first pumped to the Pretreatment Facility at the WTP through an underground pipe-in-pipe system. When construction is complete, the Pretreatment Facility will be 12 stories high, 540 feet long and 215 feet wide, making it the largest of the four major nuclear facilities that compose the WTP. The total size of this facility will be more than 490,000 square feet. More than 8.2 million craft hours are required to construct this facility. Currently, the Pretreatment Facility is 51 percent complete. At the Pretreatment Facility the waste is pumped to the interior waste feed receipt vessels. Each of these four vessels is 55-feet tall and has a 375,000 gallon capacity, which makes them the largest vessels inside the Pretreatment Facility. These vessels contain a series of internal pulse-jet mixers to keep incoming waste properly mixed. The vessels are inside the black-cell areas, completely enclosed behind thick steel-laced, high strength concrete walls. The black cells are designed to be maintenance free with no moving parts. Once hot operations commence the black-cell area will be inaccessible. Surrounded by black cells, is the 'hot cell canyon'. The hot cell contains all the moving and replaceable components to remove solids and extract liquids. In this area, there is ultrafiltration equipment, cesium-ion exchange columns, evaporator boilers and recirculation pumps, and various mechanical process pumps for transferring process fluids. During the first phase of pretreatment, the waste will be concentrated using an evaporation process. Solids will be filtered out, and the remaining soluble, highly radioactive isotopes will be removed using an ion-exchange process. The high-level solids will be sent to the High-Level Waste (HLW) Vitrification Facility, and the low activity liquids will be sent to the Low-Activity Waste (LAW) Vitrification Facility for further processing. The high-level waste will be transferred via underground pipes to the HLW Facility from the Pretreatment Facility. The waste first arrives at the wet cell, which rests inside a black-cell area. The pretreated waste is transferred through shielded pipes into a series of melter preparation and feed vessels before reaching the melters. Liquids from various facility processes also return to the wet cell for interim storage before recycling back to the Pretreatment Facility. (authors)

Harp, Benton; Olds, Erik [US DOE (United States)

2012-07-01T23:59:59.000Z

296

Dynamics of iron-acceptor-pair formation in co-doped silicon  

SciTech Connect (OSTI)

The pairing dynamics of interstitial iron and dopants in silicon co-doped with phosphorous and several acceptor types are presented. The classical picture of iron-acceptor pairing dynamics is expanded to include the thermalization of iron between different dopants. The thermalization is quantitatively described using Boltzmann statistics and different iron-acceptor binding energies. The proper understanding of the pairing dynamics of iron in co-doped silicon will provide additional information on the electronic properties of iron-acceptor pairs and may become an analytical method to quantify and differentiate acceptors in co-doped silicon.

Bartel, T.; Gibaja, F.; Graf, O.; Gross, D.; Kaes, M.; Heuer, M.; Kirscht, F. [Calisolar GmbH, Magnusstrasse 11, 12489 Berlin (Germany)] [Calisolar GmbH, Magnusstrasse 11, 12489 Berlin (Germany); Möller, C. [CiS Forschungsinstitut für Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany) [CiS Forschungsinstitut für Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany); TU Ilmenau, Institut für Physik, Weimarer Str. 32, 98693 Ilmenau (Germany); Lauer, K. [CiS Forschungsinstitut für Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany)] [CiS Forschungsinstitut für Mikrosensorik und Photovoltaik GmbH, Konrad-Zuse-Str. 14, 99099 Erfurt (Germany)

2013-11-11T23:59:59.000Z

297

Millihertz QPOs and broad iron line from LMC X-1  

E-Print Network [OSTI]

We study the temporal and energy spectral characteristics of the persistent black hole X-ray binary LMC X-1 using two XMM-Newton and a Suzaku observation. We report the discovery of low frequency (~ 26-29 mHz) quasi-periodic oscillations (QPOs). We also report the variablity of the broad iron K-alpha line studied earlier with Suzaku. The QPOs are found to be weak with fractional rms amplitude in the ~ 1-2 % range and quality factor Q~2-10 . They are accompanied by weak red noise or zero-centered Lorentzian components with rms variability at the ~ 1-3 % level. The energy spectra consists of three varying components - multicolour disk blackbody (kT_{in} ~ 0.7-0.9 keV), high energy power-law tail (Gamma ~ 2.4 - 3.3) and a broad iron line at 6.4-6.9 keV. The broad iron line, the QPO and the strong power-law component are not always present. The QPOs and the broad iron line appear to be clearly detected in the presence of a strong power-law component. The broad iron line is found to be weaker when the disk is like...

Alam, Md Shah; Belloni, T; Mukherjee, D; Jhingan, S

2014-01-01T23:59:59.000Z

298

Effect of coating time on corrosion behavior of electroless nickel-phosphorus coated powder metallurgy iron specimens  

SciTech Connect (OSTI)

Powder metallurgy iron specimens with porosities in the range 0% to 2% were electroless coated with nickel-phosphorus alloy from baths containing sodium hypophosphite (NaH{sub 2}PO{sub 2}{center_dot}H{sub 2}O). The effect of coating time on thickness and phosphorus content of the deposit was analyzed. The free corrosion potentials and corrosion rates of the coated specimens were obtained by the Tafel extrapolation method in 1.0 M hydrochloric acid (HCl) solution. Corrosion rates of the coated specimens after heat treatment also were studied. The observed corrosion characteristics were explained by the mixed-potential theory.

Singh, D.; Balasubramaniam, R.; Dube, R.K. [Indian Inst. of Tech., Kanpur (India). Dept. of Materials and Metallurgical Engineering

1995-08-01T23:59:59.000Z

299

A Comparison of Iron and Steel Production Energy Use and Energy Intensity in China and the U.S.  

E-Print Network [OSTI]

23 5. Comparison of Energy Intensity of Iron and Steelthe U.S. . 27 5.1. Energy Intensity of Iron and27 5.2. Energy Intensity of Iron and Steel Production in

Hasanbeigi, Ali

2012-01-01T23:59:59.000Z

300

Washing treatment of automotive shredder residue (ASR)  

Science Journals Connector (OSTI)

Abstract Worldwide, the amount of end-of-life vehicles (ELVs) reaches 50 million units per year. Once the ELV has been processed, it may then be shredded and sorted to recover valuable metals that are recycled in iron and steelmaking processes. The residual fraction, called automotive shredder residue (ASR), represents 25% of the ELV and is usually landfilled. In order to deal with the leachable fraction of ASR that poses a potential threat to the environment, a washing treatment before landfilling was applied. To assess the potential for full-scale application of washing treatment, tests were carried out in different conditions (L/S = 3 and 5 L/kgTS; t = 3 and 6 h). Moreover, to understand whether the grain size of waste could affect the washing efficiency, the treatment was applied to ground (<4 mm) and not-ground samples. The findings obtained revealed that, on average, washing treatment achieved removal rates of more than 60% for dissolved organic carbon (DOC), chemical oxygen demand (COD) and total Kjeldahl nitrogen (TKN). With regard to metals and chlorides, sulphates and fluoride leachable fraction, a removal efficiency of approximately 60% was obtained, as confirmed also by EC values. The comparison between the results for ground and not-ground samples did not highlight significant differences.

Raffaello Cossu; Tiziana Lai

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Arsenic remediation of drinking water using iron-oxide coated coal bottom  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Arsenic remediation of drinking water using iron-oxide coated coal bottom Arsenic remediation of drinking water using iron-oxide coated coal bottom ash Title Arsenic remediation of drinking water using iron-oxide coated coal bottom ash Publication Type Journal Article Year of Publication 2010 Authors Mathieu, Johanna L., Ashok J. Gadgil, Susan E. Addy, and Kristin Kowolik Journal Environmental Science and Health Keywords airflow and pollutant transport group, arsenic, bangladesh, coal bottom ash, drinking water, indoor environment department, water contaminants, water treatment Abstract We describe laboratory and field results of a novel arsenic removal adsorbent called 'Arsenic Removal Using Bottom Ash' (ARUBA). ARUBA is prepared by coating particles of coal bottom ash, a waste material from coal fired power plants, with iron (hydr)oxide. The coating process is simple and conducted at room temperature and atmospheric pressure. Material costs for ARUBA are estimated to be low (~$0.08 per kg) and arsenic remediation with ARUBA has the potential to be affordable to resource-constrained communities. ARUBA is used for removing arsenic via a dispersal-and-removal process, and we envision that ARUBA would be used in community-scale water treatment centers. We show that ARUBA is able to reduce arsenic concentrations in contaminated Bangladesh groundwater to below the Bangladesh standard of 50 ppb. Using the Langmuir isotherm (R2 = 0.77) ARUBA's adsorption capacity in treating real groundwater is 2.6×10-6 mol/g (0.20 mg/g). Time-to-90% (defined as the time interval for ARUBA to remove 90% of the total amount of arsenic that is removed at equilibrium) is less than one hour. Reaction rates (pseudo-second-order kinetic model, R2 ≥ 0.99) increase from 2.4×105 to 7.2×105 g mol-1 min-1 as the groundwater arsenic concentration decreases from 560 to 170 ppb. We show that ARUBA's arsenic adsorption density (AAD), defined as the milligrams of arsenic removed at equilibrium per gram of ARUBA added, is linearly dependent on the initial arsenic concentration of the groundwater sample, for initial arsenic concentrations of up to 1600 ppb and an ARUBA dose of 4.0 g/L. This makes it easy to determine the amount of ARUBA required to treat a groundwater source when its arsenic concentration is known and less than 1600 ppb. Storing contaminated groundwater for two to three days before treatment is seen to significantly increase ARUBA's AAD. ARUBA can be separated from treated water by coagulation and clarification, which is expected to be less expensive than filtration of micron-scale particles, further contributing to the affordability of a community-scale water treatment center

302

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the Earth's Lower Mantle Print The Iron Spin Transition in the Earth's Lower Mantle Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

303

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the Earth's Lower Mantle Print The Iron Spin Transition in the Earth's Lower Mantle Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

304

The Iron Spin Transition in the Earth's Lower Mantle  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Iron Spin Transition in the Earth's Lower Mantle Print The Iron Spin Transition in the Earth's Lower Mantle Print It is now known that the iron present in minerals of the lower mantle of the Earth undergoes a pressure-induced transition with pairing of the spins of its 3d electrons. A team from the University of California, Berkeley, Tel Aviv University, and Lawrence Livermore National Laboratory has used x-ray diffraction at very high pressure to investigate the effects of this transition on the elastic properties of magnesiowüstite (Mg1-xFex)O, the second most abundant mineral in the Earth's lower mantle. The new results suggest that the effect of the spin-pairing transition on magnesiowüstite can be large enough to require a partial revision of the most accepted model of the lower mantle composition.

305

Lithium/iron sulfide batteries for electric-vehicle propulsion and other applications. Progress report, October 1979-March 1980  

SciTech Connect (OSTI)

The research and development activities of the program at Argonne National Laboratory (ANL) on lithium/iron sulfide batteries during the period October 1979-March 1980 is described. Although the major emphasis is currently on batteries for electric-vehicle propulsion, stationary energy-storage applications are also under investigation. The individual battery cells, which operate at 400 to 500/sup 0/C, are of a vertically oriented, prismatic design with two or more positive electrodes of FeS or FeS/sub 2/, facing negative electrodes of lithium-aluminum or lithium-silicon alloy, and molten LiCl-KCl electrolyte. The ANL program consists of cell chemistry studies, materials engineering, and component and auxiliary systems development. Important elements of this program are studies of the effects of design modifications on cell performance and post-test examinations of cells. During the reporting period, cell and battery development work has been aimed primarily at the first phase of the Mark II electric-vehicle battery program, which consists of an effort to develop high-reliability cells having boron nitride felt separators. Later in the Mark II program, the cells will be tested in 10-cell modules. Work on stationary energy-storage batteries during this period has consisted mainly of conceptual design studies. 23 figures, 9 tables.

None

1980-08-01T23:59:59.000Z

306

Emerging Energy-efficiency and Carbon Dioxide Emissions-reduction Technologies for the Iron and Steel Industry  

E-Print Network [OSTI]

heat to smelt the iron. Coal gasification is the result of anew processes such as gasification, slow pyrolysis, and fastreaction ? Carbon gasification and iron ore reduction

Hasanbeigi, Ali

2014-01-01T23:59:59.000Z

307

A Comparison of Iron and Steel Production Energy Use and Energy Intensity in China and the U.S.  

E-Print Network [OSTI]

of Iron and Steel Production Energy Use and Energy Intensityof Iron and Steel Production Energy Use and Energy Intensitycomparisons of steel production energy efficiency and CO 2

Hasanbeigi, Ali

2012-01-01T23:59:59.000Z

308

How Godzilla Ate Pittsburgh: The Long Rise of the Japanese Iron and Steel Industry, 1900–1973  

E-Print Network [OSTI]

poorly endowed as Japan in coking coal and iron ore (WarrenYawata of iron ore for coking coal and the progressive in-

Bernard Elbaum

2007-01-01T23:59:59.000Z

309

Synthesis and characterization of superparamagnetic iron oxide nanoparticles for biomedical applications  

Science Journals Connector (OSTI)

Monodisperse iron oxide nanoparticles (NPs) of 4 nm ... obtained through high-temperature solution phase reaction of iron (III) acetylacetonate with 1, 2-hexadecanediol in the presence ... oleic acid and oleylami...

L. A. Cano; M. V. Cagnoli; S. J. Stewart; E. D. Cabanillas; E. L. Romero…

2009-01-01T23:59:59.000Z

310

Synthesis and characterization of superparamagnetic iron oxide nanoparticles for biomedical applications  

Science Journals Connector (OSTI)

Monodisperse iron oxide nanoparticles (NPs) of 4 nm ... obtained through high-temperature solution phase reaction of iron (III) acetylacetonate with 1, 2-hexadecanediol in the presence ... oleic acid and oleylami...

L. A. Cano; M. V. Cagnoli; S. J. Stewart; E. D. Cabanillas…

2010-01-01T23:59:59.000Z

311

Thermal Reactions of Fullerene C60 with Iron(III) Acetylacetonate  

Science Journals Connector (OSTI)

Thermal reaction of solid mixtures of fullerene C60 with iron(III) acetylacetonate proceeds in the combustion mode; the composition...60...ratio in the initial mixture. The magnetization of iron-fullerene complex...

V. G. Isakova; E. A. Petrakovskaya; A. D. Balaev…

2003-04-01T23:59:59.000Z

312

The nonlinear optical, magnetic, and Mössbauer spectral properties of some iron(III) doped silica xerogels  

Science Journals Connector (OSTI)

Iron(III) species dispersed in silica have been ... synthesized with a sol-gel process. The iron(III) was introduced as the acetylacetonate complex into a solution of tetraethoxysilane to...Z-scan experimental st...

L. Rebbouh; V. Rosso; Y. Renotte; Y. Lion; F. Grandjean…

2006-05-01T23:59:59.000Z

313

Coal Fly Ash as a Source of Iron in Atmospheric Dust. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Coal Fly Ash as a Source of Iron in Atmospheric Dust. Coal Fly Ash as a Source of Iron in Atmospheric Dust. Abstract: Anthropogenic coal fly ash aerosols may represent a...

314

Characterization of the FNR Protein of Escherichid coli, an Iron-Binding Transcriptional Regulator  

Science Journals Connector (OSTI)

...coli, an Iron-Binding Transcriptional Regulator Jeffrey Green Martin Trageser Stephan...John R. Guest FNR is a transcriptional regulator mediating the activation or repression...coli, an iron-binding transcriptional regulator. | FNR is a transcriptional regulator...

1991-01-01T23:59:59.000Z

315

Sedimentary and mineral dust sources of dissolved iron to the world ocean  

E-Print Network [OSTI]

of the tropi- cal Pacific Ocean II. Iron biogeochemistry,in the Northeast Pacific Ocean Gyre: Aerosols, iron, and theF. M. M. : The equatorial Pacific Ocean: Grazer-controlled

Moore, J. K; Braucher, O.

2008-01-01T23:59:59.000Z

316

Direct production of light olefins from syngas over a carbon nanotube confined iron catalyst  

Science Journals Connector (OSTI)

Iron particles confined in carbon nanotube (CNT) channels have been used as a catalyst for the direct conversion of syngas to light olefins. Compared with iron catalysts supported on other materials such as Si...

ChuanFu Wang; XiuLian Pan; XinHe Bao

2010-04-01T23:59:59.000Z

317

A Radar-like Iron based Nanohybrid as an Efficient and Stable...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Radar-like Iron based Nanohybrid as an Efficient and Stable Electrocatalyst for Oxygen Reduction. A Radar-like Iron based Nanohybrid as an Efficient and Stable Electrocatalyst for...

318

V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti...  

Broader source: Energy.gov (indexed) [DOE]

1: Cisco IronPort Web Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities V-021: Cisco IronPort Web Email Security Appliance Sophos Anti-Virus Multiple...

319

Recovery of iron oxide from coal fly ash  

DOE Patents [OSTI]

A high quality iron oxide concentrate, suitable as a feed for blast and electric reduction furnaces is recovered from pulverized coal fly ash. The magnetic portion of the fly ash is separated and treated with a hot strong alkali solution which dissolves most of the silica and alumina in the fly ash, leaving a solid residue and forming a precipitate which is an acid soluble salt of aluminosilicate hydrate. The residue and precipitate are then treated with a strong mineral acid to dissolve the precipitate leaving a solid residue containing at least 90 weight percent iron oxide.

Dobbins, Michael S. (Ames, IA); Murtha, Marlyn J. (Ames, IA)

1983-05-31T23:59:59.000Z

320

Electrolytic photodissociation of chemical compounds by iron oxide photochemical diodes  

DOE Patents [OSTI]

Chemical compounds can be dissociated by contacting the same with a p/n type semi-conductor photochemical diode having visible light as its sole source of energy. The photochemical diode consists of low cost, readily available materials, specifically polycrystalline iron oxide doped with silicon in the case of the n-type semi-conductor electrode, and polycrystalline iron oxide doped with magnesium in the case of the p-type electrode. So long as the light source has an energy greater than 2.2 electron volts, no added energy source is needed to achieve dissociation.

Somorjai, Gabor A. (Berkeley, CA); Leygraf, Christofer H. (Berkeley, CA)

1985-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Electrolytic photodissociation of chemical compounds by iron oxide electrodes  

DOE Patents [OSTI]

Chemical compounds can be dissociated by contacting the same with a p/n type semi-conductor diode having visible light as its sole source of energy. The diode consists of low cost, readily available materials, specifically polycrystalline iron oxide doped with silicon in the case of the n-type semi-conductor electrode, and polycrystalline iron oxide doped with magnesium in the case of the p-type electrode. So long as the light source has an energy greater than 2.2 electron volts, no added energy source is needed to achieve dissociation.

Somorjai, Gabor A. (Berkeley, CA); Leygraf, Christofer H. (Berkeley, CA)

1984-01-01T23:59:59.000Z

322

Film-forming capacity of alcoholic solutions of iron(III) chloride with acetylacetone  

Science Journals Connector (OSTI)

Processes in which film-forming solutions based on acetylacetonate and iron(III) chloride are produced were subjected to...

S. A. Kuznetsova; I. A. Senokosova

2010-11-01T23:59:59.000Z

323

Manufacturing Energy and Carbon Footprint- Sector: Iron and Steel (NAICS 3311, 3312), October 2012 (MECS 2006)  

Broader source: Energy.gov [DOE]

Manufacturing Energy and Carbon Footprint for Iron and Steel Sector (NAICS 3311, 3312) with Total Energy Input

324

Consequence of total lepton number violation in strongly magnetized iron white dwarfs  

SciTech Connect (OSTI)

The influence of a neutrinoless electron to positron conversion on a cooling of strongly magnetized iron white dwarfs is studied.

Belyaev, V. B. [Bogolyubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Dubna 141980 (Russian Federation); Ricci, P. [Istituto Nazionale di Fisica Nucleare, Sezione di Firenze, I-50019 Sesto Fiorentino (Firenze) (Italy); Šimkovic, F. [Department of Nuclear Physics and Biophysics, Comenius University, Mlynská dolina F1, SK-842 15, Bratislava, Slovakia and Bogolyubov Laboratory of Theoretical Physics, Joint Institute for Nuclear Research, Dubna 141980 (Russian Federation); Adam, J. Jr.; Tater, M.; Truhlík, E. [Institute of Nuclear Physics ASCR, CZ-250 68 ?ež (Czech Republic)

2013-12-30T23:59:59.000Z

325

Energy and materials savings from gases and solid waste recovery in the iron and steel industry in Brazil: An industrial ecology approach  

SciTech Connect (OSTI)

This paper attempts to investigate, from an entropic point of view, the role of selected technologies in the production, transformation, consumption and release of energy and materials in the Iron and Steel Industry in Brazil. In a quantitative analysis, the potential for energy and materials savings with recovery of heat, gases and tar are evaluated for the Iron and Steel Industry in Brazil. The technologies for heat recovery of gases include Coke Dry Quenching (CDQ), applied only in one of the five Brazilian coke integrated steel plants, Top Gas Pressure Recovery Turbines (TPRT), recovery of Coke Oven Gas (COG), recovery of Blast Furnace Gas (BFG), recovery of BOF gas, recovery of tar, and thermal plant. Results indicate that, in a technical scenario, some 5.1 TWh of electricity can be generated if these technologies are applied to recover these remaining secondary fuels in the Iron and Steel Industry in Brazil, which is equivalent to some 45% of current total electricity consumption in the integrated plants in the country. Finally, solid waste control technologies, including options available for collection and treatment, are discussed. Estimates using the best practice methodology show that solid waste generation in the Iron and Steel Industry in Brazil reached approximately 18 million metric tons in 1994, of which 28% can be recirculated if the best practice available in the country is applied thoroughly.

Costa, M.M.; Schaeffer, R.

1997-07-01T23:59:59.000Z

326

Interfacial Effects in Iron-Nickel Hydroxide–Platinum Nanoparticles Enhance Catalytic Oxidation  

Science Journals Connector (OSTI)

...coordinatively unsaturated iron sites for activating O 2...the catalyst. To create the iron (hydr)oxide interface...acac) 2 (where acac is acetylacetonate) in the presence of CO...showed that this layer contained iron (fig. S3). Although the...

Guangxu Chen; Yun Zhao; Gang Fu; Paul N. Duchesne; Lin Gu; Yanping Zheng; Xuefei Weng; Mingshu Chen; Peng Zhang; Chih-Wen Pao; Jyh-Fu Lee; Nanfeng Zheng

2014-05-02T23:59:59.000Z

327

Reduction of Sintering during Annealing of FePt Nanoparticles Coated with Iron Oxide  

E-Print Network [OSTI]

are first obtained by reduction of iron(III) acetylacetonate and platinum(II) acetylacetonateReduction of Sintering during Annealing of FePt Nanoparticles Coated with Iron Oxide Chao LiuVised Manuscript ReceiVed October 12, 2004 FePt/iron oxide core/shell nanoparticles are synthesized by a two step

Laughlin, David E.

328

Iron Species in Argonne Premium Coal Samples:? An Investigation Using X-ray Absorption Spectroscopy  

Science Journals Connector (OSTI)

Iron Species in Argonne Premium Coal Samples:? An Investigation Using X-ray Absorption Spectroscopy ... Chemistry Division, Argonne National Laboratory, 9700 S. Cass Ave., Argonne, Illinois 60439 ... Iron K-edge X-ray absorption spectroscopy (XAS) has been used to examine the iron species that are present within the Argonne Premium Coal Samples. ...

Stephen R. Wasserman; Randall E. Winans; Robert McBeth

1996-03-20T23:59:59.000Z

329

Highpressure behavior of iron carbide (Fe7C3) at inner core conditions  

E-Print Network [OSTI]

Highpressure behavior of iron carbide (Fe7C3) at inner core conditions Mainak Mookherjee,1 Yoichi at high pressures have demonstrated that Fe7C3 iron carbide is a likely candidate for the Earth's inner behavior of iron carbide (Fe7C3) at inner core conditions, J. Geophys. Res., 116, B04201, doi:10

Steinle-Neumann, Gerd

330

Mineralogical and Microbial Controls on Iron Reduction in a Contaminated Aquifer-Wetland System  

E-Print Network [OSTI]

terminal electron accepting processes, iron reduction has the added complexity that its oxidized form (ferric iron) exists primarily as one of several solid phases in environments with pH greater than 3. Thus, the distribution and form of ferric iron...

Howson, Andrea Melissa

2011-02-22T23:59:59.000Z

331

Author's personal copy Hematite and iron carbonate precipitation-coexistence at the  

E-Print Network [OSTI]

Carbon dioxide The hydrothermal reactivity of swelling clays has relevant implications on the geological that the carbon dioxide increased the hydrothermal reactivity of montmorillonite because the hematite and ironAuthor's personal copy Hematite and iron carbonate precipitation-coexistence at the iron

Montes-Hernandez, German

332

The Continental Margin is a Key Source of Iron to the HNLC North Pacific Ocean  

E-Print Network [OSTI]

The Continental Margin is a Key Source of Iron to the HNLC North Pacific Ocean Phoebe J. Lam1 concentrations in the upper 500m of the Western Subarctic Pacific, an iron-limited High Nutrient Low Chlorophyll a key source of bioavailable Fe to the HNLC North Pacific. Keywords: iron, continental margin, HNLC 1

333

Role of Surface Precipitation in Copper Sorption by the Hydrous Oxides of Iron and Aluminum  

E-Print Network [OSTI]

Role of Surface Precipitation in Copper Sorption by the Hydrous Oxides of Iron and Aluminum K. G precipitation; sorption; isotherms; X-ray diffraction; hydrous iron oxide; hydrous aluminum oxide; copper. INTRODUCTION Hydrous oxides of iron (HFO) and aluminum (HAO) are important mineral components of natural

Chorover, Jon

334

HIGH TEMPERATURE SULFIDATION BEHAVIOR OF LOW Al IRON-ALUMINUM COMPOSITIONS  

E-Print Network [OSTI]

HIGH TEMPERATURE SULFIDATION BEHAVIOR OF LOW Al IRON-ALUMINUM COMPOSITIONS S.W. Banovic, J.N. Du (Received January 5, 1998) (Accepted March 23, 1998) Introduction Iron-aluminum weld overlay coatings, the application of iron-aluminum alloys is currently limited due to hydrogen cracking susceptibility subsequent

DuPont, John N.

335

Rhizosphere Microbial Community Structure in Relation to Root Location and Plant Iron Nutritional Status  

Science Journals Connector (OSTI)

...plant iron nutritional status were compared by performing...plant iron nutritional status during the iron-sufficient...only 24 samples, allowed us to compare root locations...BARD) program grant US-2668-95 and by a grant...U.S. Department of Energy. REFERENCES B. Assmus...

Ching-Hong Yang; David E. Crowley

2000-01-01T23:59:59.000Z

336

Studies of anisotropy of iron based superconductors  

SciTech Connect (OSTI)

To study the electronic anisotropy in iron based superconductors, the temperature dependent London penetration depth, {Delta}{lambda}#1;#21;(T), have been measured in several compounds, along with the angular dependent upper critical field, H{sub c2}(T). Study was undertaken on single crystals of Ba(Fe{sub 1-x}Co{sub x}){sub 2}As{sub 2} with x=0.108 and x=0.127, in the overdoped range of the doping phase diagram, characterized by notable modulation of the superconducting gap. Heavy ion irradiation with matching field doses of 6 T and 6.5 T respectively, were used to create columnar defects and to study their effect on the temperature {Delta}{lambda}#1;#21;(T). The variation of the low-temperature penetration depth in both pristine and irradiated samples was #12;tted with a power-law function {Delta}{lambda}#1;#21;(T) = AT{sup n}. Irradiation increases the magnitude of the pre-factor A and decreases the exponent n, similar to the effect on the optimally doped samples. This finding supports the universal s{sub {+-}}#6; scenario for the whole doping range. Knowing that the s{sub {+-}}#6; gap symmetry exists across the superconducting dome for the electron doped systems, we next looked at {lambda}#21;(T), in optimally - doped, SrFe{sub 2}(As{sub 1-x}P{sub x}){sub 2}, x =0.35. Both, as-grown (T{sub c} ~ #25;25 K) and annealed (T{sub c} ~ #25;35 K) single crystals of SrFe{sub 2}(As{sub 1-x}P{sub x}){sub 2} were measured. Annealing decreases the absolute value of the London penetration depth from #21;{lambda}(0) = 300 {+-}#6; 10 nm in as-grown samples to {lambda}#21;(0) = 275{+-}#6;10 nm. At low temperatures, {lambda}#21;(T) #24;~ T indicates a superconducting gap with line nodes. Analysis of the full-temperature range superfluid density is consistent with the line nodes, but differs from the simple single-gap d-wave. The observed behavior is very similar to that of BaFe{sub 2}(As{sub 1-x}P{sub x}){sub 2}, showing that isovalently substituted pnictides are inherently different from the charge-doped materials. In-plane resistivity measurements as a function of temperature, magnetic field, and its orientation with respect to the crystallographic ab-plane were used to study the upper critical field, H{sub c2}, of two overdoped compositions of Ba(Fe{sub 1-x}Ni{sub x}){sub 2}As{sub 2}, x=0.054 and x=0.072. Measurements were performed using precise alignment (with accuracy less than 0.1{degree}) of the magnetic field with respect to the Fe-As plane. The dependence of the H{sub c2} on angle {theta}#18; between the field and the ab- plane was measured in isothermal conditions in a broad temperature range. We found that the shape of the H{sub c2} vs. {theta}#18; curve clearly deviates from the Ginzburg-Landau theory.

Murphy, Jason [Ames Laboratory

2013-05-15T23:59:59.000Z

337

The Oxidation State of Iron at High Pressure  

Science Journals Connector (OSTI)

...Fig. 3. In K vs. In P-Acetylacetonate and basic acetate. kilobars...for the basic acetate and acetylacetonate (4). Both of these ligands...molecule attaching to the iron through two oxygens. The...KFeCI4 * 323 393 0.07 Fe acetylacetonate 60 325 0.15 Fe acetylacetonate...

H. G. Drickamer; G. K. Lewis Jr.; S. C. Fung

1969-02-28T23:59:59.000Z

338

High Temperature Corrosion Behavior of Iron Aluminide Alloys and Coatings  

SciTech Connect (OSTI)

A multi-year effort has been focused on optimizing the long-term oxidation performance of ingot-processed (IP) and oxide-dispersion strengthened (ODS) Fe{sub 3}Al and iron aluminide-based coatings. Based on results from several composition iterations, a Hf-doped alloy (Fe-28Al-2Cr-0.05at.%Hf) has been developed with significantly better high temperature oxidation resistance than other iron aluminides. The scale adhesion is not significantly better; however, the {alpha}-Al{sub 2}O{sub 3} scale grows at a slower rate, approximately a factor of 10 less than undoped iron aluminide. The benefit of Hf is greatest at 1100-1200 C. Long-term oxidation resistance of commercially fabricated ODS Fe{sub 3}Al has been determined and compared to commercially available ODS FeCrAl. Scale spallation rates for ODS Fe{sub 3}Al are higher than for ODS FeCrAl. To complement studies of iron-aluminide weld-overlay coatings, carbon steel was coated with Fe-Al-Cr by thermal spraying. These specimens were then exposed in air at 900 and 1000 C and in air-1%SO{sub 2} at 800 C. Most likely due to an inadequate aluminum concentration in the coatings, continuous protective Al{sub 2}O{sub 3} could not be maintained and, consequently, the corrosion performance was significantly worse than what is normally observed for Fe{sub 3}Al.

Pint, B.A.

2001-10-22T23:59:59.000Z

339

Nanocrystalline Iron Oxide Aerogels as Mesoporous Magnetic Architectures  

Science Journals Connector (OSTI)

We have developed crystalline nanoarchitectures of iron oxide that exhibit superparamagnetic behavior while still retaining the desirable bicontinuous pore?solid networks and monolithic nature of an aerogel. ... The laser power was controlled using a series of optical density filters and kept below ?1 mW to avoid sample degradation. ...

Jeffrey W. Long; Michael S. Logan; Christopher P. Rhodes; Everett E. Carpenter; Rhonda M. Stroud; Debra R. Rolison

2004-12-04T23:59:59.000Z

340

Extracellular iron-sulfur precipitates from growth of Desulfovibrio desulfuricans  

SciTech Connect (OSTI)

The authors have examined extracellular iron-bearing precipitates resulting from the growth of Desulfovibrio desulfuricans in a basal medium with lactate as the carbon source and ferrous sulfate. Black precipitates were obtained when D. desulfuricans was grown with an excess of FeSO{sub 4}. When D. desulfuricans was grown under conditions with low amounts of FeSO{sub 4}, brown precipitates were obtained. The precipitates were characterized by iron K-edge XAFS (X-ray absorption fine structure), {sup 57}Fe Moessbauer-effect spectroscopy, and powder X-ray diffraction. Both were noncrystalline and nonmagnetic (at room temperature) solids containing high-spin Fe(III). The spectroscopic data for the black precipitates indicate the formation of an iron-sulfur phase with 6 nearest S neighbors about Fe at an average distance of 2.24(1) {angstrom}, whereas the brown precipitates are an iron-oxygen-sulfur phase with 6 nearest O neighbors about Fe at an average distance of 1.95(1) {angstrom}.

Antonio, M. R.; Tischler, M. L.; Witzcak, D.

1999-12-20T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Versatile ferrofluids based on polyethylene glycol coated iron oxide nanoparticles  

E-Print Network [OSTI]

Versatile ferrofluids based on polyethylene glycol coated iron oxide nanoparticles W. Brullot a in revised form 20 December 2011 Available online 3 February 2012 Keywords: Ferrofluid Polyethylene glycol Magneto-optics Magnetite Rheology a b s t r a c t Versatile ferrofluids based on polyethylene glycol

342

Fischer-Tropsch synthesis over iron-rhodium alloy catalysts  

SciTech Connect (OSTI)

To investigate the nature of iron-rhodium alloy catalysts during the Fischer-Tropsch synthesis, a combination of experimental techniques were applied. Infrared spectroscopy was mainly used to extract direct information on the surface of catalysts under the reaction conditions. In addition, Mossbauer spectroscopy was employed to study the iron alloy catalysts. Further characterization of the catalysts was performed by chemisorption measurements. Hydrocarbon products of the CO + H/sub 2/ synthesis reaction were analyzed by gas chromatography. The working surface of a silica-supported rhodium catalyst was found to be saturated with molecular carbon monoxide. The intensity of the linear carbonyl absorption band remained constant compared to that for room temperature CO adsorption, while that of the bridge-bonded carbonyl absorption band was drastically reduced during the Fischer-Tropsch synthesis. The bridge-bonded adsorption sites are assumed to be the active sites for dissociating carbon monoxide. The hydrogenation rate of the linearly adsorbed carbon monoxide was much slower than the steady state reaction rate. The alloy catalyst did not form a bulk carbide, but the presence of surface carbon was suggested by the large shift of the linear carbonyl absorption band. On the other hand, infrared spectra on an iron catalyst showed only weak bands, indicating a high degree of CO dissociation. On a silica-supported iron-rhodium alloy catalyst, surface analysis by infrared spectroscopy presents evidence of well-mixed alloy formation. Three models of carbon monoxide adsorption were identified.

Choi, S.

1983-01-01T23:59:59.000Z

343

Iron Phosphate Glasses for Vitrifying DOE High Priority Nuclear Wastes  

SciTech Connect (OSTI)

Iron phosphate glasses have been studied as an alternative glass for vitrifying Department of Energy (DOE) high priority wastes. The high priority wastes were the Low Activity Waste (LAW) and the High Level Waste (HLW) with high chrome content stored at Hanford, WA, and the Sodium Bearing Waste (SBW) stored at the Idaho National Engineering and Environmental Laboratory. These wastes were recommended by Tanks Focus Area since they were expected to require special attention when vitrified in borosilicate glasses. All three of these wastes have been successfully vitrified in iron phosphate glasses at waste loadings ranging from a low of 32 wt% for the high sulfate LAW to 40 wt% for the SBW to a high of 75 wt% for the high chrome HLW. In addition to these desirable high waste loadings, the iron phosphate glasses were easily melted, typically between 950 and 1200 C, in less than 4 hours in commercial refractory oxide containers. It is noteworthy that the chemical durability of both glassy and deliberately crystallized iron phosphate wasteforms not only met, but significantly exceeded, all current DOE chemical durability requirements as measured by the Product Consistency Test (PCT) and Vapor Hydration Test (VHT). The high waste loading, low melting temperature, rapid furnace throughput (short melting time) and their outstanding chemical durability could significantly accelerate the clean up effort and reduce the time and cost of vitrifying these high priority wastes.

Kim, C.W.; Day, D.E.

2004-03-29T23:59:59.000Z

344

Carbonylation of (+)-2-carene induced by iron-pentacarbonyl.  

Science Journals Connector (OSTI)

(+)-2-carene heated neat with iron pentacarbonyl leads to ?-phellandrene-Fe(CO)3 complex ( ?15 % ), p. cymene ( ?15 % ), (-)-(1S)-3,8,8-trimethylbicyclo (4.1.1) oct-3-ene-7-one ( ?50 % ) and (+)-(1S,7S)-3,8,8-trimethylbicyclo (4.1.1.) oct-3-ene-7-ol ( ?20 % ).

Christiane Santelli-Rouvier; Maurice Santelli; Jean-Pierre Zahra

1985-01-01T23:59:59.000Z

345

The iron man phenomenon, participatory culture, & future augmented reality technologies  

Science Journals Connector (OSTI)

The Iron Man media franchise glorifies futuristic interfaces and devices like holographic screens, powerful mobile devices, and heads-up displays. Consequently, a mainstream audience has come to know about and discursively relate to Augmented Reality ... Keywords: augmented reality, human-centric design, social media

Isabel Pedersen; Luke Simcoe

2012-05-01T23:59:59.000Z

346

Reduction of Vinyl Chloride in Metallic Iron-Water Systems  

E-Print Network [OSTI]

residence time for contaminated ground- water to degrade VC to below its maximum contamination levelReduction of Vinyl Chloride in Metallic Iron-Water Systems B A O L I N D E N G * Department). Remediation of groundwater contaminated with chlori- nated ethylenes, including vinyl chloride, has been chal

Deng, Baolin

347

Sulfur Versus Iron Oxidation in an Iron-Thiolate Model Complex  

SciTech Connect (OSTI)

In the absence of base, the reaction of [Fe{sup II}(TMCS)]PF{sub 6} (1, TMCS = 1-(2-mercaptoethyl)-4,8,11-trimethyl-1,4,8,11-tetraazacyclotetradecane) with peracid in methanol at -20 C did not yield the oxoiron(IV) complex (2, [Fe{sup IV}(O)(TMCS)]PF{sub 6}), as previously observed in the presence of strong base (KO{sup t}Bu). Instead, the addition of 1 equiv of peracid resulted in 50% consumption of 1. The addition of a second equivalent of peracid resulted in the complete consumption of 1 and the formation of a new species 3, as monitored by UV-vis, ESI-MS, and Moessbauer spectroscopies. ESI-MS showed 3 to be formulated as [Fe{sup II}(TMCS) + 2O]{sup +}, while EXAFS analysis suggested that 3 was an O-bound iron(II)-sulfinate complex (Fe-O = 1.95 {angstrom}, Fe-S = 3.26 {angstrom}). The addition of a third equivalent of peracid resulted in the formation of yet another compound, 4, which showed electronic absorption properties typical of an oxoiron(IV) species. Moessbauer spectroscopy confirmed 4 to be a novel iron(IV) compound, different from 2, and EXAFS (Fe{double_bond}O = 1.64 {angstrom}) and resonance Raman ({nu}{sub Fe{double_bond}O} = 831 cm{sup -1}) showed that indeed an oxoiron(IV) unit had been generated in 4. Furthermore, both infrared and Raman spectroscopy gave indications that 4 contains a metal-bound sulfinate moiety ({nu}{sub s}(SO{sub 2}) {approx} 1000 cm{sup -1}, {nu}{sub as}(SO{sub 2}) {approx} 1150 cm{sup -1}). Investigations into the reactivity of 1 and 2 toward H{sup +} and oxygen atom transfer reagents have led to a mechanism for sulfur oxidation in which 2 could form even in the absence of base but is rapidly protonated to yield an oxoiron(IV) species with an uncoordinated thiol moiety that acts as both oxidant and substrate in the conversion of 2 to 3.

A McDonald; M Bukowski; E Farquhar; T Jackson; K Koehntop; M Seo; R De Hont; A Stubna; J Halfen; E Munck

2011-12-31T23:59:59.000Z

348

Influence of platelet-activating factor, lyso-platelet-activating factor and edelfosine on Langmuir monolayers imitating plasma membranes of cell lines differing in susceptibility to anti-cancer treatment: the effect of plasmalogen level  

Science Journals Connector (OSTI)

...Langmuir monolayers imitating plasma membranes of cell lines differing...lipids on monolayers mimicking plasma membranes of cell lines differing...lyso-PAF. In this work, we focus our attention on the influence...HL-60 and normal + PC-plasma model membranes) and strengthens...

2014-01-01T23:59:59.000Z

349

Fuel Cell Power Plants Biofuel Case Study- Tulare, CA  

Broader source: Energy.gov [DOE]

Success story about fuel cell power plants using wastewater treatment gas in Tulare, California. Presented by Frank Wolak, Fuel Cell Energy, at the NREL/DOE Biogas and Fuel Cells Workshop held June 11-13, 2012, in Golden, Colorado.

350

Fracture toughness studies of gray and ductile cast irons using a J-integral approach  

E-Print Network [OSTI]

, and silicon in which more carbon is present than can be retained in solid solution in austenite at the eutectic temperature. In gray cast iron, the iron and carbon solidify as a eutectic structure whose two phases are graphite and iron. Gray iron usually... contains from 1. 7 to 4. 5% carbon and 1 to 3% silicon. 27 The normal microstructure of gray iron is a matrix of pearlite (ferrite and cementite) with the graphite flakes dispersed throughout. Among the properties that the flake graphite 28 in gray...

Floyd, Donna Lynne Woodall

2012-06-07T23:59:59.000Z

351

Corrosion resistant positive electrode for high-temperature, secondary electrochemical cell  

DOE Patents [OSTI]

The corrosion rate of low carbon steel within a positive electrode of a high-temperature, secondary electrochemical cell that includes FeS as active material is substantially reduced by incorporating therein finely divided iron powder in stoichiometric excess to the amount required to form FeS in the fully charged electrode. The cell typically includes an alkali metal or alkaline earth metal as negative electrode active material and a molten metal halide salt as electrolyte. The excess iron permits use of inexpensive carbon steel alloys that are substantially free of the costly corrosion resistant elements chromium, nickel and molybdenum while avoiding shorten cell life resulting from high corrosion rates.

Otto, N.C.; Warner, B.T.; Smaga, J.A.; Battles, J.E.

1982-07-07T23:59:59.000Z

352

V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus  

Broader source: Energy.gov (indexed) [DOE]

21: Cisco IronPort Web / Email Security Appliance Sophos 21: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities November 12, 2012 - 6:00am Addthis PROBLEM: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities PLATFORM: Cisco IronPort Email Security Appliances (C-Series and X-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. Cisco IronPort Web Security Appliances (S-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. ABSTRACT: Cisco Ironport Appliances Sophos Anti-Virus Vulnerabilities. REFERENCE LINKS: Cisco Security Advisory ID: cisco-sa-20121108-sophos Secunia Advisory SA51197 IMPACT ASSESSMENT: High DISCUSSION: Cisco has acknowledged some vulnerabilities in Cisco IronPort Web Security

353

V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus  

Broader source: Energy.gov (indexed) [DOE]

1: Cisco IronPort Web / Email Security Appliance Sophos 1: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities V-021: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities November 12, 2012 - 6:00am Addthis PROBLEM: Cisco IronPort Web / Email Security Appliance Sophos Anti-Virus Multiple Vulnerabilities PLATFORM: Cisco IronPort Email Security Appliances (C-Series and X-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. Cisco IronPort Web Security Appliances (S-Series) running Sophos Engine versions 3.2.07.352_4.80 and prior. ABSTRACT: Cisco Ironport Appliances Sophos Anti-Virus Vulnerabilities. REFERENCE LINKS: Cisco Security Advisory ID: cisco-sa-20121108-sophos Secunia Advisory SA51197 IMPACT ASSESSMENT: High DISCUSSION: Cisco has acknowledged some vulnerabilities in Cisco IronPort Web Security

354

Use of bimodal carbon distribution in compacts for producing metallic iron nodules  

DOE Patents [OSTI]

A method for use in production of metallic iron nodules comprising providing a reducible mixture into a hearth furnace for the production of metallic iron nodules, where the reducible mixture comprises a quantity of reducible iron bearing material, a quantity of first carbonaceous reducing material of a size less than about 28 mesh of an amount between about 65 percent and about 95 percent of a stoichiometric amount necessary for complete iron reduction of the reducible iron bearing material, and a quantity of second carbonaceous reducing material with an average particle size greater than average particle size of the first carbonaceous reducing material and a size between about 3 mesh and about 48 mesh of an amount between about 20 percent and about 60 percent of a stoichiometric amount of necessary for complete iron reduction of the reducible iron bearing material.

Iwasaki, Iwao

2014-04-08T23:59:59.000Z

355

Kinetics of the steam reforming of methane with iron, nickel, and iron-nickel alloys as catalysts  

SciTech Connect (OSTI)

The steam reforming of methane on iron or nickel, CH/sub 4/ + H/sub 2/O ..-->.. CO + 3H/sub 2/, can be regarded as a sequence of two reactions with adsorbed carbon as an intermediate species: CH/sub 4/ ..-->.. C(ads) + 2H/sub 2/, C(ads) + H/sub 2/O ..-->.. CO + H/sub 2/. As the first reaction is rate limiting, the following rate law can be applied to methane reforming catalysed by iron: v = k/sub 2//sup Fe/ a/sub 0//sup -n/ p/sub CH/sub 4///P/sub H/sub 2///sup 1/2/, 0.6 less than or equal to n less than or equal to 1.0. The oxygen activity a/sub 0/ on the catalyst surface is virtually determined by the ratio P/sub H/sub 2/O//P/sub H/sub 2// in the gas atmosphere. The above rate equation was confirmed by measurements in a flow apparatus for the temperature range 700 to 900/sup 0/C. In agreement with the reaction model the steady-state carbon activity on the iron surface and the steady-state carbon concentration in the iron catalyst are very low. With nickel as catalyst the reaction rate is much higher and independent of the oxygen activity on the catalyst surface. The rate equation reads: v = k/sub 2//sup Ni/ P/sub CH/sub 4//. Different partial reaction steps of the methane decomposition are rate determining on iron and nickel.

Muenster, P.; Grabke, H.J.

1981-12-01T23:59:59.000Z

356

Visible-Light Responsive Photocatalytic Fuel Cell Based on Ag/TiO2-NTs Photoanode and Cu2O/TiO2 Photocathode for Simultaneous Wastewater Treatment and Electricity Generation  

Science Journals Connector (OSTI)

A visible-light driven photocatalytic fuel cell (PFC) system comprised of Ag/TiO2-NTs photoanode and Cu2O/TiO2/Ti photocathode was established for providing a self-sustained and...

Liao, Wenjuan

357

IEA Energy conservation in the iron and steel industry. [US and Western Europe  

SciTech Connect (OSTI)

The NATO Committee on the Challenges of Modern Society research program, under the auspices of the IEA, had the objectives of collecting data on material requirements and energy-consumption patterns in selected energy-intensive industries in the US and Western Europe, of identifying technologies and operating practices with the potential for energy conservation in those industries, and of recommending research projects that could lead to improved energy efficiency. The steel industry was selected for analysis and ideas for an international cooperative program were developed. Representatives from various countries conducted meetings and the form of an implementing agreement for a research and development program was finalized in December, 1980. The program includes three technical areas: hot-surface inspection, heat recovery, and coal gasification. Hot-surface inspection methods to be demonstrated are: optical, induction, electromagnetic ultrasonic, electromagnetic ultrasonic surface testing methods, and eddy current method for hot surface inspection and an infrared system (possibly). Three heat-recovery projects are: ceramic heat wheel development; demonstration of granular bed/heat pipe system for heat recovery; and demonstration of tubular ceramic recuperators. Processes in coal gasification are: converter process, gas treatment, and iron treatment. Each project is described in detail. (MCW)

Tunnah, B.G.

1981-01-01T23:59:59.000Z

358

Solid-solid phase transition measurements in iron  

SciTech Connect (OSTI)

Previously, dynamic experiments on iron have observed a non-zero transition time and width in the solid-solid {alpha}-{var_epsilon} phase transition. Using Proton Radiography at the Los Alamos Neutron Science Center, we have performed plate impact experiments on iron to further study the {alpha}-{var_epsilon} phase transition which occurs at 13GPa. A 40mm bore powder gun was coupled to a proton radiography beam line and imaging system and synchronized to the impact of the projectile on the target sample with the proton beam pattern. A typical experimental configuration for the iron study, as shown below in 3 color-enhanced radiographs, is a 40mm diameter aluminum sabot impacting a 40mm diameter of polycrystalline ARMCO iron. The iron is backed by a sapphire optical window for velocimetry measurements. The aluminum flyer on the left of the iron is barely visible for visual display purposes. Direct density jumps were measured which corresponded to calculations to within 1% using a Wondy mUlti-phase equation of state model. In addition, shock velocities were measured using an edge fitting technique and followed that edge movement from radiograph to radiograph, where radiographs are separated in time by 500 ns. Preliminary measurements give a shock velocity (P1 wave) of 5.251 km/s. The projectile velocity was 0.725 km/s which translate to a peak stress of 17.5 GPa. Assuming the P1 wave is instantaneous, we are able to calibrate the chromatic, motion, object and camera blur by measuring the width of the P1 wave. This approximation works in this case since each of the two density jumps are small compared to the density of the object. Subtracting the measured width of the P1 wave in quadrature from the width of the P2 wave gives a preliminary measurement of the transition length of 265 {mu}m. Therefore, a preliminary measured phase transition relaxation time {tau} = transition length/u{sub s} = 265 {mu}m/5.251 km/s = 50 ns. Both Boettger and Jensen conclude that the transition rate and likely the transition mechanisms depend on the impact stress and the sample thickness. Since Proton Radiography can measure directly the transition length as well as the shock velocity, a transition time can be directly calculated. With higher higher energy protons we have better resolution of the measured width and edge locations. This will allow a more precise measurement of phase transition relaxation time. We propose to perform a series of experiments to measure the phase transition relaxation time, {tau}, as a function of drive and sample size.

Schwartz, Cynthia Louise [Los Alamos National Laboratory

2010-01-01T23:59:59.000Z

359

Surface Treatment by Laser  

Science Journals Connector (OSTI)

By this treatment, new hardenings of the surface can occur; the surface is higher alloyed by remelting, or layers...

2014-01-01T23:59:59.000Z

360

NETL: News Release - Clean Coal Technology Report Showcases Advanced Iron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

April 6, 2000 April 6, 2000 Clean Coal Technology Report Showcases Advanced Iron Making Process, Benefits for the Environment Topical Report Profiles Blast Furnace Granular Coal Injection System; Now Available on DOE's Fossil Energy Web Site An advanced iron making technology demonstrated in the U.S. Department of Energy's Clean Coal Technology Program stands out for its potential to provide major environmental and financial benefits to the United States steel industry. Bethlehem Steel Topical Report The Energy Department has profiled the project in a topical report entitled Blast Furnace Granular Coal Injection System Demonstration Project. The report describes the federal government's partnership demonstration project with Bethlehem Steel Corporation, which tested a new method for reducing

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Arsenic Removal by Photochemical Methods: Nanoparticulate Zerovalent Iron  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Arsenic Removal by Photochemical Methods: Nanoparticulate Zerovalent Iron Arsenic Removal by Photochemical Methods: Nanoparticulate Zerovalent Iron and Heterogeneous Photocatalysis with TiO2 Speaker(s): Marta Litter Date: November 19, 2010 - 11:00am Location: 90-3122 Seminar Host/Point of Contact: Hugo Destaillats Arsenic in groundwater is a dramatic global problem due to the high incidence of arsenicosis or HACRE (Chronic Endemic Regional Hydro-arsenicism, Hidroarsenicismo Crónico Regional Endémico in Spanish), a severe illness causing skin lesions and cancer in extended regions of the world. For this reason, research on low-cost technologies for As removal to be applied in isolated, poor, rural locations is mandatory. This seminar will present a brief overview of arsenic pollution issues and mitigation needs in Latin America. It will also present results on As(V) removal using

362

Parkers-Iron Springs, Arkansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Parkers-Iron Springs, Arkansas: Energy Resources Parkers-Iron Springs, Arkansas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 34.6081427°, -92.3320235° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.6081427,"lon":-92.3320235,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

363

What's in the Cage Matters in Iron Antimonide Thermoelectric Materials |  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Novel Experiments on Cement Yield Concrete Results Novel Experiments on Cement Yield Concrete Results Watching a Glycine Riboswitch "Switch" Polyamorphism in a Metallic Glass Under Pressure, Vanadium Won't Turn Down the Volume New Nanoscale Engineering Breakthrough Points to Hydrogen-Powered Vehicles Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed What's in the Cage Matters in Iron Antimonide Thermoelectric Materials MARCH 29, 2007 Bookmark and Share Crystal structure of EuFe4Sb12 showing the cage confined Eu atoms (red) and Fe atoms (brown) surrounded by Sb tilted octahedral (Sb atoms are not shown). Thermoelectric materials such as iron antimonide have drawn intense interest because they offer a pollution-free source of electricity and a

364

IRON-PHOSPHATE GLASS FOR IMMOBILIZATION OF RADIOACTIVE TECHNETIUM  

SciTech Connect (OSTI)

Technetium-99 (Tc-99) can bring a serious environmental threat because of its high fission yield, long half-life, and high solubility and mobility in the ground water. The present work investigated the immobilization of Tc-99 (surrogated by Re) by heat-treating mixtures of an iron-phosphate glass with 1.5 to 6 wt.% KReO{sub 4} at {approx}1000 C. The Re retention in the glass was as high as {approx}1.2 wt. % while the loss of Re by evaporation during melting was {approx}50%. Re was uniformly distributed within the glass. The normalized Re release by the 7-day Product Consistency Test was {approx}0.39 g/m{sup 2}, comparable with that in phosphate-bonded ceramics and borosilicate glasses. These results suggest that iron-phosphate glass can provide a good matrix for immobilizing Tc-99.

KRUGER AA; HRMA PR; XU K; CHOI J; UM W; HEO J

2012-03-19T23:59:59.000Z

365

Iron beam acceleration using direct plasma injection scheme  

SciTech Connect (OSTI)

A new set of vanes of radio frequency quadrupole (RFQ) accelerator was commissioned using highly charged iron beam. To supply high intensity heavy ion beams to the RFQ, direct plasma injection scheme (DPIS) with a confinement solenoid was adopted. One of the difficulties to utilize the combination of DPIS and a solenoid field is a complexity of electro magnetic field at the beam extraction region, since biasing high static electric field for ion extraction, RFQ focusing field, and the solenoid magnetic field fill the same space simultaneously. To mitigate the complexity, a newly designed magnetic field clamps were used. The intense iron beam was observed with bunched structure and the total accelerated current reached 2.5 nC.

Okamura, M., E-mail: okamura@bnl.gov [Brookhaven National Laboratory, Upton, New York 11973 (United States); RIKEN-BNL Research Center, Upton, New York 11973 (United States); Kanesue, T. [Brookhaven National Laboratory, Upton, New York 11973 (United States)] [Brookhaven National Laboratory, Upton, New York 11973 (United States); Yamamoto, T. [Waseda University, Shinjuku, Tokyo 169-8555 (Japan)] [Waseda University, Shinjuku, Tokyo 169-8555 (Japan); Fuwa, Y. [Kyoto University, Uji, Kyoto 611-0011 (Japan) [Kyoto University, Uji, Kyoto 611-0011 (Japan); RIKEN, Wako, Saitama 351-0198 (Japan)

2014-02-15T23:59:59.000Z

366

Iron aluminide useful as electrical resistance heating elements  

DOE Patents [OSTI]

The invention relates generally to aluminum containing iron-base alloys useful as electrical resistance heating elements. The aluminum containing iron-base alloys have improved room temperature ductility, electrical resistivity, cyclic fatigue resistance, high temperature oxidation resistance, low and high temperature strength, and/or resistance to high temperature sagging. The alloy has an entirely ferritic microstructure which is free of austenite and includes, in weight %, over 4% Al, .ltoreq.1% Cr and either .gtoreq.0.05% Zr or ZrO.sub.2 stringers extending perpendicular to an exposed surface of the heating element or .gtoreq.0.1% oxide dispersoid particles. The alloy can contain 14-32% Al, .ltoreq.2% Ti, .ltoreq.2% Mo, .ltoreq.1% Zr, .ltoreq.1% C, .ltoreq.0.1% B, .ltoreq.30% oxide dispersoid and/or electrically insulating or electrically conductive covalent ceramic particles, .ltoreq.1% rare earth metal, .ltoreq.1% oxygen, .ltoreq.3% Cu, balance Fe.

Sikka, Vinod K. (Oak Ridge, TN); Deevi, Seetharama C. (Oak Ridge, TN); Fleischhauer, Grier S. (Midlothian, VA); Hajaligol, Mohammad R. (Richmond, VA); Lilly, Jr., A. Clifton (Chesterfield, VA)

1999-01-01T23:59:59.000Z

367

Iron aluminide useful as electrical resistance heating elements  

DOE Patents [OSTI]

The invention relates generally to aluminum containing iron-base alloys useful as electrical resistance heating elements. The aluminum containing iron-base alloys have improved room temperature ductility, electrical resistivity, cyclic fatigue resistance, high temperature oxidation resistance, low and high temperature strength, and/or resistance to high temperature sagging. The alloy has an entirely ferritic microstructure which is free of austenite and includes, in weight %, over 4% Al, .ltoreq.1% Cr and either .gtoreq.0.05% Zr or ZrO.sub.2 stringers extending perpendicular to an exposed surface of the heating element or .gtoreq.0.1% oxide dispersoid particles. The alloy can contain 14-32% Al, .ltoreq.2% Ti, .ltoreq.2% Mo, .ltoreq.1% Zr, .ltoreq.1% C, .ltoreq.0.1% B, .ltoreq.30% oxide dispersoid and/or electrically insulating or electrically conductive covalent ceramic particles, .ltoreq.1% rare earth metal, .ltoreq.1% oxygen, .ltoreq.3% Cu, balance Fe.

Sikka, Vinod K. (Oak Ridge, TN); Deevi, Seetharama C. (Oak Ridge, TN); Fleischhauer, Grier S. (Midlothian, VA); Hajaligol, Mohammad R. (Richmond, VA); Lilly, Jr., A. Clifton (Chesterfield, VA)

1997-01-01T23:59:59.000Z

368

Inhibiting Individual Notch Receptors Improves Treatment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Inhibiting Individual Notch Inhibiting Individual Notch Receptors Improves Treatment Inhibiting Individual Notch Receptors Improves Treatment Print Wednesday, 27 July 2011 00:00 Notch receptors constitute a family of evolutionarily conserved transmembrane proteins that function as conduits for cell communication, regulating cell fate and growth. Aberrant activation of any of the four human Notch receptors has been linked to diseases, particularly cancer, making the Notch pathway a compelling target for new drug studies. A research team from Bay Area companies Genentech and Exelixis has synthesized highly specialized antibody inhibitors that specifically inhibit only Notch1 or Notch2, acting through a potent and novel mechanism of Notch inhibition. These antibodies, characterized at ALS Beamline 5.0.2, could provide the tools to therapeutically target individual Notch receptors, avoiding the intestinal toxicity ascribed to treatment with more than one, or a pan-Notch, inhibitor.

369

Inhibiting Individual Notch Receptors Improves Treatment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Inhibiting Individual Notch Receptors Improves Treatment Print Inhibiting Individual Notch Receptors Improves Treatment Print Notch receptors constitute a family of evolutionarily conserved transmembrane proteins that function as conduits for cell communication, regulating cell fate and growth. Aberrant activation of any of the four human Notch receptors has been linked to diseases, particularly cancer, making the Notch pathway a compelling target for new drug studies. A research team from Bay Area companies Genentech and Exelixis has synthesized highly specialized antibody inhibitors that specifically inhibit only Notch1 or Notch2, acting through a potent and novel mechanism of Notch inhibition. These antibodies, characterized at ALS Beamline 5.0.2, could provide the tools to therapeutically target individual Notch receptors, avoiding the intestinal toxicity ascribed to treatment with more than one, or a pan-Notch, inhibitor.

370

Inhibiting Individual Notch Receptors Improves Treatment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Inhibiting Individual Notch Receptors Improves Treatment Print Inhibiting Individual Notch Receptors Improves Treatment Print Notch receptors constitute a family of evolutionarily conserved transmembrane proteins that function as conduits for cell communication, regulating cell fate and growth. Aberrant activation of any of the four human Notch receptors has been linked to diseases, particularly cancer, making the Notch pathway a compelling target for new drug studies. A research team from Bay Area companies Genentech and Exelixis has synthesized highly specialized antibody inhibitors that specifically inhibit only Notch1 or Notch2, acting through a potent and novel mechanism of Notch inhibition. These antibodies, characterized at ALS Beamline 5.0.2, could provide the tools to therapeutically target individual Notch receptors, avoiding the intestinal toxicity ascribed to treatment with more than one, or a pan-Notch, inhibitor.

371

Inhibiting Individual Notch Receptors Improves Treatment  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Inhibiting Individual Notch Receptors Improves Treatment Print Inhibiting Individual Notch Receptors Improves Treatment Print Notch receptors constitute a family of evolutionarily conserved transmembrane proteins that function as conduits for cell communication, regulating cell fate and growth. Aberrant activation of any of the four human Notch receptors has been linked to diseases, particularly cancer, making the Notch pathway a compelling target for new drug studies. A research team from Bay Area companies Genentech and Exelixis has synthesized highly specialized antibody inhibitors that specifically inhibit only Notch1 or Notch2, acting through a potent and novel mechanism of Notch inhibition. These antibodies, characterized at ALS Beamline 5.0.2, could provide the tools to therapeutically target individual Notch receptors, avoiding the intestinal toxicity ascribed to treatment with more than one, or a pan-Notch, inhibitor.

372

Coal Fly Ash as a Source of Iron in Atmospheric Dust  

SciTech Connect (OSTI)

Anthropogenic coal fly ash aerosols may represent a significant source of bioavailable iron in the open ocean. Few measurements have been made to compare the solubility of atmospheric iron from anthropogenic aerosols and other sources. We report an investigation of the iron dissolution of three fly ash samples in acidic aqueous solutions and compare the solubilities with that of Arizona test dust, a reference material of mineral dust. The effects of pH, cloud processing, and solar irradiation on Fe solubility were explored. Similar to previously reported results on mineral dust, iron in aluminosilicate phases provide predominant dissolved iron compared with iron in oxides. Iron solubility of fly ash is higher than Arizona test dust, especially at the higher pH conditions investigated. Simulated atmospheric processing elevates iron solubility due to significant changes in the morphology aluminosilicate glass, a dominantly material in fly ash particle. Iron continuously releases into the aqueous solution as fly ash particles break up into smaller fragments. The assessment of dissolved atmospheric iron deposition fluxes, and their effect on the biogeochemistry at ocean surface should be constrained by taking into account the source, environment pH, Fe speciation, and solar radiation.

Chen, Haihan; Laskin, Alexander; Baltrusaitis, Jonas; Gorski, Christopher A.; Scherer, Michelle; Grassian, Vicki H.

2012-01-18T23:59:59.000Z

373

Chapter 12 - Coal use in iron and steel metallurgy  

Science Journals Connector (OSTI)

Abstract: This chapter discusses the role of coal in iron and steel metallurgy. The chapter first gives information about routes for steel manufacture, current levels of steel production and forecasts for the future. It then discusses the use of coal in different metallurgical processes with emphasis on various ironmaking technologies as the most energy consuming step of the process chain. Alternatives to coal like biomass, hydrogen or waste plastics are discussed from the point of view of CO2 reduction.

A. Babich; D. Senk

2013-01-01T23:59:59.000Z

374

Zinc sorption by iron oxides and soil samples  

E-Print Network [OSTI]

(Head of Department) May 1989 ABSTRACT Zinc Sorption by Iron Oxides and Soil Samples. (May 1989) Markku Juhani Yli-Halla, M. S. University of Helsinki, Finland Chair of Advisory Committee: Dr. Richard H. Loeppert Zn sorption by synthetic Fe oxide... and soil samples was studied. The purpose was to examine the effect of crystallinity and adsorbed silica on Zn adsorption by synthetic Fe oxide using goethite and ferrihydrite as test materials. Zn sorption by acid soil samples from Finland and a...

Yli-Halla, Markku Juhani

1989-01-01T23:59:59.000Z

375

Low resistivity contact to iron-pnictide superconductors  

DOE Patents [OSTI]

Method of making a low resistivity electrical connection between an electrical conductor and an iron pnictide superconductor involves connecting the electrical conductor and superconductor using a tin or tin-based material therebetween, such as using a tin or tin-based solder. The superconductor can be based on doped AFe.sub.2As.sub.2, where A can be Ca, Sr, Ba, Eu or combinations thereof for purposes of illustration only.

Tanatar, Makariy; Prozorov, Ruslan; Ni, Ni; Bud'ko, Sergey; Canfield, Paul

2013-05-28T23:59:59.000Z

376

Fouling of carbon steel heat exchanger caused by iron bacteria  

SciTech Connect (OSTI)

A carbon steel heat exchanger installed in a reverse osmosis unit failed after 1 1/2 years from start-up as a result of tubes, lids, tube sheets, and connection pipes clogging from rust deposits. Chemical analysis of cooling water and scraped precipitates, as well laboratory screening of the deposits for bacteria, revealed that activity of iron-oxidizing bacteria present in cooling water could lead to heat exchanger blockage.

Starosvetsky, J.; Armon, R.; Starosvetsky, D. (Technion-Israel Inst. of Tech. (Israel)); Groysman, A.

1999-01-01T23:59:59.000Z

377

Technology development for iron F-T catalysts. Final report  

SciTech Connect (OSTI)

The objectives of this work were twofold. The first objective was to design and construct a pilot plant for preparing precipitated iron oxide F-T precursors and demonstrate that the rate of production from this plant is equivalent to 100 lbs/day of dried metal oxide. Secondly, these precipitates were to be used to prepare catalysts capable of achieving 88% CO + H{sub 2} conversion with {le} 5 mole percent selectivity to methane + ethane.

Frame, R.R.; Gala, H.B.

1994-08-01T23:59:59.000Z

378

An Atomistic study of Helium Resolution in bcc Iron  

SciTech Connect (OSTI)

The evolution of gas-stabilized bubbles in irradiated materials can be a significant factor in the microstructural processes that lead to mechanical property and dimensional changes in structural materials exposed to high-energy neutrons. Helium generation and accumulation is particularly important under DT fusion irradiation conditions. Although the process of ballistic resolutioning of gas from bubbles has been long-discussed in the literature, there have been few computational studies of this mechanism. Resolutioning could limit bubble growth by ejecting gas atoms back into the metal matrix. A detailed atomistic study of ballistic He resolutioning from bubbles in bcc iron has been carried out using molecular dynamics. A newly-developed Fe-He interatomic potential was employed, with the iron matrix described by the potential of Ackland and co-workers from 1997. The primary variables examined were: irradiation temperature (100 and 600K), iron knock-on atom energy (5 and 20 keV), bubble radius (~0.5 and 1.0 nm), and He-to-vacancy ratio in the bubble (0.25, 0.5 and 1.0) in order to obtain an assessment of this dynamic resolutioning mechanism. The results presented here focus on the 5 keV cascades which indicate a modest, but potentially significant level of He removal by this process.

Stoller, Roger E [ORNL; Stewart, David M [ORNL

2011-01-01T23:59:59.000Z

379

Corrosion of iron in acid solutions with hydrogen sulfide  

SciTech Connect (OSTI)

The influence of pH and the concentration of hydrogen sulfide (H{sub 2}S) on corrosion of iron in acid solutions was studied using a potentiostatic polarization method. The alternating current (AC) impedance technique also was used to characterize the active dissolution process of iron. Results showed the dissolution process was accelerated by H{sub 2}S. The anodic dissolution current (i{sub a}) increased with pH and H{sub 2}S concentration with reaction orders of about n{sub pH} = n{sub H{sub 2}s} = 0.25 when the ratio of H{sub 2}S concentration and hydrogen ion (H{sub 3}O{sup +}) concentration was <10{sup 1.5} i{sub a} reached a maximum and became independent of pH and [H{sub 2}S] when [H{sub 2}S]/H{sub 3}O{sup +} > 10{sup 1.5}. The Nyquist diagram corresponding to the active dissolution process in the Tafel range exhibited two capacitive loops in addition to the well-known, high-frequency capacitive loop. A mechanism was proposed to explain the results in which H{sub 2}S chemisorbed first on the electrode surface and then catalyzed the anodic dissolution of iron in two discharging steps.

Cheng, X.L.; Ma, H.Y.; Zhang, J.P.; Chen, X.; Chen, S.H. [Shandong Univ., Jinan (China). Dept. of Chemistry; Yang, H.Q. [Peking Univ. (China). Dept. of Chemistry

1998-05-01T23:59:59.000Z

380

Iron phosphate glass for immobilization of 99Tc  

SciTech Connect (OSTI)

Technetium-99 (99Tc) can bring serious environmental threats because of its long half-life (t1/2 = ~2.1 x 105 years), high fission yield (~6%), and high solubility and mobility in the ground water. The high volatility makes it difficult to immobilize 99Tc in continuous melters vitrifying 99Tc-containing nuclear wastes in borosilicate glasses. This work explores a possibility of incorporating a high concentration of 99Tc, surrogated by the non-radioactive Re, in an iron phosphate glass by melting mixtures of iron phosphate glass frits with 1.5-6 mass% KReO4 at ~1000 C. The retention of Re achieved was ~1.1 mass%. The normalized Re release by the 7-day Product Consistency Test was <10*2 g/m2. Surprisingly, the Re escaped from the melt within a short time of heating, especially when the temperature was increased. Therefore, 99Tc volatilization would still be a challenging task for its immobilization in iron phosphate glasses.

Xu, Kai; Hrma, Pavel R.; Um, Wooyong; Heo, Jong

2013-06-15T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Economic analysis of transportation directly reduced iron (DRI) through ship  

Science Journals Connector (OSTI)

Directly reduced iron (DRI) is a major source of iron units in cases of low scrap availability and/or hot metal. Its main advantage is it is low content of phosphorus and sulphur. Removal of phosphorus and sulphur demands high energy consumption in steel making process. With fast depleting sources of cooking coal, the availability of hot metal will decrease in the coming years. Also, scrap availability is already on the declining trend. Hence, DRI is going to be the main source of iron units in the future, especially in electric arc furnace (EAF steel making). The disadvantage of DRI usages lies in it is high reactivity. Freshly produced DRI possesses high susceptibility to oxidation whenever it comes in contact with air. The generated heat in the oxidation reaction increases the tendency to oxidation, thereby, starting a short of chain reaction and ultimately leading to the burning of DRI. This phenomenon makes storage and handling of DRI a concern. The problem caused loss of one cargo in Delta steel company, Nigeria. The authors of this dissertation were given the responsibility to work out the solution in the minimum possible time for implementing it to the next shipments. It is heartening that the problem could be successfully solved and implemented in the next shipments in November '06. Hence, after above work implementation of the recommendations for a $45 risk/ton of DRI, only $1 is to be spent for protection against the risk.

Manikant K. Paswan; Chinmoy Mukherjee

2012-01-01T23:59:59.000Z

382

Kinetics of chromium(VI) reduction by ferrous iron  

SciTech Connect (OSTI)

Chromium is a primary inorganic contaminant of concern at the Pantex Plant. Chromium concentrations have been found to be two orders of magnitude higher than the drinking water standards, particularly in certain wells in the perched aquifer below Zone 12. In situ reduction of a mobile form of chromium, Cr(VI) to an immobile form, Cr(III), was examined as a viable option to active soil restoration. Successfully immobilizing chromium in the vadose zone as Cr(III) will reduce the amount of chromium that reaches the groundwater table. The results from the solution experiments indicated that chromium was rapidly and stoichiometrically reduced by Fe(II) in solution. Also, the slurry experiments showed that the aquifer solids removed Fe(II) from solution, but a portion of the iron removed remained available for reaction with Cr(VI), but at a slower rate. A model to predict different amounts of iron pseudo-components was developed, which allowed prediction of iron amounts required to reduce chromium under in situ conditions.

Batchelor, B.; Schlautman, M.; Hwang, I.; Wang, R. [Texas A and M Univ., College Station, TX (United States). Dept. of Civil Engineering

1998-09-01T23:59:59.000Z

383

Multilayer route to iron nanoparticle formation in an insulating matrix  

Science Journals Connector (OSTI)

Well-protected isolated bcc-iron nanoparticles embedded in silicon dioxide were prepared by e-beam evaporation and postannealing of multilayers in an ultrahigh vacuum system. The spherical shape and isolation of the particles were confirmed by plan-view and cross-sectional transmission electron microscopy.Oxidation was evaluated from the electron energy-loss near edge structure. In this technique a postedge peak of 40 eV above the iron L 3 threshold originating from backscattering of oxygen atoms provides a clear indication of iron oxide. The white-line ratio (WLR) measuring the 3 d -orbital occupancy is used to estimate the oxidation-layer thickness. In the samples of large ironnanoparticles (with average diameter larger than 10 nm ) a very thin surface layer appears to be the oxide maghemite approximately one atomic layer according to the WLR evaluations. The evolution of the coercivity with particle size as measured by the magneto-optical Kerr effect shows that the reversal process is dominated by the surfaceanisotropy and is also affected by the dipole interaction particularly in samples with large volume-filling factor.

Feng Wang; Marek Malac; Ray F. Egerton; Alkiviathes Meldrum; Xiaobin Zhu; Zhigang Liu; Nicole Macdonald; Peng Li; Mark R. Freeman

2007-01-01T23:59:59.000Z

384

Evolution of a Groundwater Treatment System-Rocky Flats, Colorado...  

Energy Savers [EERE]

the treatment cells (which are made of plastic, so they're more fragile than concrete tanks) and hauled away for disposal. Due to the past nuclear weapons-related mission of...

385

Boron-Nitride Nanotubes Show Potential in Cancer Treatment |...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Boron-Nitride Nanotubes Show Potential in Cancer Treatment NEWPORT NEWS, VA, April 26 - A new study has shown that adding boron-nitride nanotubes to the surface of cancer cells can...

386

Independent Oversight Review, Waste Treatment and Immobilization Plant- January 2013  

Broader source: Energy.gov [DOE]

Review of the Hanford Waste Treatment and Immobilization Plant Black-Cell and Hard-To-Reach Pipe Spools Procurement Process and the Office of River Protection Audit of That Process

387

X-Ray Astronomy to Resonant Theranostics for Cancer Treatment  

E-Print Network [OSTI]

X-Ray Astronomy to Resonant Theranostics for Cancer Treatment Sultana N. Nahar Department-Plasma Theranostics or RNPT, which gives indication for one most efficient way for destruction of malignant cells. 1

Nahar, Sultana Nurun

388

Synthesis of hydrocarbons from CO and H/sub 2/ in the presence of catalysts based on mononuclear iron complexes  

SciTech Connect (OSTI)

Iron catalysts for Fischer-Tropsch synthesis, activated by alkaline additives are active in the synthesis of hydrocarbons from CO and H/sub 2/. It is well known that catalysts obtained by applying K/sub 2/(Fe/sub 3/(CO)/sub 11/) complexes on ..gamma..-Al/sub 2/O/sub 3/ have increased selectivity in the formation of lower olefins from CO and H/sub 2/. IR spectroscopy using catalysts based on K/sub 2/(Fe/sub 3/(CO)/sub 11/) showed that during heat treatment in vacuum, CO, H/sub 2/, CO + H/sub 2/ atmosphere a transition is observed of polynuclear complexes found on a carrier surface, to a (Fe(CO)/sub 5/, Fe(acac)/sub 3/ and Fe(C/sub 5/H/sub 5/)/sub 2/, in Fischer-Tropsch synthesis. A study was made in this paper of the effect of the type of initial Fe-complex: iron pentacarbonyl Fe(CO)/sub 5/-I, iron acetylacetonate Fe(acac)/sub 3/-II, ferrocene Fe(C/sub 5/H/sub 5/)/sub 2/-III, on the activity and selectivity of Fe-K catalysts in the synthesis of lower olefins from CO and H/sub 2/. In these complexes Fe is oxidized from Fe/sup 0/ to Fe/sup 3 +/ (3). In order to prepare catalysts by the same method, Fe(acac)/sub 3/ was selected as Fe/sup 3 +/ compound, which is soluble in alkaline methanol solution.

Lapidus, A.L.; Savel'ev, M.M.; Tsapkina, M.V.; Solodov, S.N.; Sominskii, S.D.

1985-01-01T23:59:59.000Z

389

Advances in Glass Formulations for Hanford High-Aluminum, High-Iron and Enhanced Sulphate Management in HLW Streams - 13000  

SciTech Connect (OSTI)

The current estimates and glass formulation efforts have been conservative in terms of achievable waste loadings. These formulations have been specified to ensure that the glasses are homogenous, contain essentially no crystalline phases, are processable in joule-heated, ceramic-lined melters and meet Hanford Tank Waste Treatment and Immobilization Plant (WTP) Contract terms. The WTP's overall mission will require the immobilization of tank waste compositions that are dominated by mixtures of aluminum (Al), chromium (Cr), bismuth (Bi), iron (Fe), phosphorous (P), zirconium (Zr), and sulphur (S) compounds as waste-limiting components. Glass compositions for these waste mixtures have been developed based upon previous experience and current glass property models. Recently, DOE has initiated a testing program to develop and characterize HLW glasses with higher waste loadings and higher throughput efficiencies. Results of this work have demonstrated the feasibility of increases in waste loading from about 25 wt% to 33-50 wt% (based on oxide loading) in the glass depending on the waste stream. In view of the importance of aluminum limited waste streams at Hanford (and also Savannah River), the ability to achieve high waste loadings without adversely impacting melt rates has the potential for enormous cost savings from reductions in canister count and the potential for schedule acceleration. Consequently, the potential return on the investment made in the development of these enhancements is extremely favorable. Glass composition development for one of the latest Hanford HLW projected compositions with sulphate concentrations high enough to limit waste loading have been successfully tested and show tolerance for previously unreported tolerance for sulphate. Though a significant increase in waste loading for high-iron wastes has been achieved, the magnitude of the increase is not as substantial as those achieved for high-aluminum, high-chromium, high-bismuth or sulphur. Waste processing rate increases for high-iron streams as a combined effect of higher waste loadings and higher melt rates resulting from new formulations have been achieved. (author)

Kruger, Albert A. [WTP Engineering Division, United States Department of Energy, Office of River Protection, Post Office Box 450, Richland, Washington 99352 (United States)] [WTP Engineering Division, United States Department of Energy, Office of River Protection, Post Office Box 450, Richland, Washington 99352 (United States)

2013-07-01T23:59:59.000Z

390

Advances in Glass Formulations for Hanford High-Alumimum, High-Iron and Enhanced Sulphate Management in HLW Streams - 13000  

SciTech Connect (OSTI)

The current estimates and glass formulation efforts have been conservative in terms of achievable waste loadings. These formulations have been specified to ensure that the glasses are homogenous, contain essentially no crystalline phases, are processable in joule-heated, ceramic-lined melters and meet Hanford Tank Waste Treatment and Immobilization Plant (WTP) Contract terms. The WTP?s overall mission will require the immobilization of tank waste compositions that are dominated by mixtures of aluminum (Al), chromium (Cr), bismuth (Bi), iron (Fe), phosphorous (P), zirconium (Zr), and sulphur (S) compounds as waste-limiting components. Glass compositions for these waste mixtures have been developed based upon previous experience and current glass property models. Recently, DOE has initiated a testing program to develop and characterize HLW glasses with higher waste loadings and higher throughput efficiencies. Results of this work have demonstrated the feasibility of increases in waste loading from about 25 wt% to 33-50 wt% (based on oxide loading) in the glass depending on the waste stream. In view of the importance of aluminum limited waste streams at Hanford (and also Savannah River), the ability to achieve high waste loadings without adversely impacting melt rates has the potential for enormous cost savings from reductions in canister count and the potential for schedule acceleration. Consequently, the potential return on the investment made in the development of these enhancements is extremely favorable. Glass composition development for one of the latest Hanford HLW projected compositions with sulphate concentrations high enough to limit waste loading have been successfully tested and show tolerance for previously unreported tolerance for sulphate. Though a significant increase in waste loading for high-iron wastes has been achieved, the magnitude of the increase is not as substantial as those achieved for high-aluminum, high-chromium, high-bismuth or sulphur. Waste processing rate increases for high-iron streams as a combined effect of higher waste loadings and higher melt rates resulting from new formulations have been achieved.

Kruger, Albert A.

2013-01-16T23:59:59.000Z

391

The effects of physiological age on bone marrow-derived mesenchymal stem cells  

E-Print Network [OSTI]

Jaenisch. Treatment of sickle cell anemia mouse model withcan be used to treat sickle cell anemia in a mouse model 5 ,

Buckspan, Caitlin

2010-01-01T23:59:59.000Z

392

Solvent Tuning of Properties of Iron-Sulfur Clusters in Proteins  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Solvent Tuning of Properties of Solvent Tuning of Properties of Iron-Sulfur Clusters in Proteins Figure 1. Schematic repre-sentation of the common active-site iron-sulfur cluster structural motif. Proteins containing Fe4S4 iron-sulfur clusters are ubiquitous in nature and catalyze one-electron transfer processes. These proteins have evolved into two classes that have large differences in their electrochemical potentials: high potential iron-sulfur proteins (HiPIPs) and bacterial ferredoxins (Fds). The role of the surrounding protein environment in tuning the redox potential of these iron sulfur clusters has been a persistent puzzle in biological electron transfer [1]. Although HiPIPs and Fds have the same iron sulfur structural motif - a cubane-type structure - (Figure 1), there are large differences in their electrochemical

393

Method for the production of hydrocarbons using iron-carbon-based catalysts  

SciTech Connect (OSTI)

This patent describes a process for producing C/sub 2/+ aliphatic hydrocarbons from a CO and H/sub 2/ mixture comprising the step of contacting the mixture with a catalyst comprising finely divided nonpyrophoric iron-carbon catalyst particles comprising iron and carbon, in the substantial absence of silicon, a substantial portion of which is dementite, which was produced in a reaction zone in the presence of laser radiation under such conditions of laser flux density, power adsorption, concentration of iron compound reactants selected from the group consisting of iron carbonyls, iron acetylacetonate, and ferrocene, and pressure sufficient to produce non-pyrophoric iron-carbon particles having average diameters between 1 and 100 nm.

Rice, G.W.; Fiato, R.A.; Soled, S.L.

1988-11-29T23:59:59.000Z

394

E-Print Network 3.0 - acid treatment inhibits Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ation by inhibiting the action of the enzyme that links... oxygen with red blood cells. POISON SYMPTOMS AND TREATMENT Prussic acid poisoning can occur within a few... , prompt...

395

Production of Electricity during Wastewater Treatment Using a  

E-Print Network [OSTI]

Production of Electricity during Wastewater Treatment Using a Single Chamber Microbial Fuel Cell H wastewater, while at the same time accomplishing biological wastewater treatment (removal of chemical oxygen of the wastewater. Power output was proportional to the hydraulic retention time over a range of 3-33 h

396

Evaluation of hybrid polymer containing iron oxides as As(III) and As(V) sorbent for drinking water purification  

Science Journals Connector (OSTI)

Abstract The objective of this paper was to evaluate the possibility of utilization of a novel hybrid polymer containing iron oxides as an arsenate and arsenite sorbent in water treatment. This material was primarily obtained as a by-product in the water de-ironing process by means of N-chlorosulfonamide polymers. The sorption properties of the hybrid polymer, including pH and coexisting ions’ influence on arsenic removal efficiency, were examined using kinetic and equilibrium experiments in a batch regime. In the column process, conducted with As-spiked natural water containing both As(III) and As(V), the breakthrough of the sorbent bed occurred after the solution amounting to about 4800 bed volumes passed through the column. The regeneration and re-use of the sorbent with NaOH and NaCl solution was also studied, indicating the possibility of repeated use of the sorbent with only a slight decrease in its sorptive properties for four cycles.

Daniel Oci?ski; Irena Jacukowicz-Sobala; Jerzy Raczyk; El?bieta Kocio?ek-Balawejder

2014-01-01T23:59:59.000Z

397

Facile additive-free synthesis of iron oxide nanoparticles for efficient adsorptive removal of Congo red and Cr(VI)  

Science Journals Connector (OSTI)

Abstract The iron oxide nanoparticles had been successfully synthesized via an additive-free hydrolysis process at 75 °C for 12 h. The product was characterized by X-ray diffraction (XRD), transmission electron microscopy (TEM), and N2 adsorption–desorption. The results of XRD and N2 adsorption–desorption demonstrated that the as-prepared product was mainly ?-Fe2O3 with a large surface area of 164.1 m2 g?1. The TEM images illustrated that the as-prepared product was found to consist of a mixture of irregular spherical nanoparticles (a diameter of ?50 nm) and nanowhiskers (a diameter of ?50 nm and uneven length). The as-prepared product was used to investigate its promising applications in water treatment. Due to its small size and large surface area, the maximum adsorption capacities of Congo red and Cr(VI) have been determined using the Langmuir equation and found to reach up to 253.8 and 17.0 mg g?1, respectively. The facile synthesis method and the superior adsorption performance derived from the iron oxide nanoparticles display the potential applications for the removal of Congo red and Cr(VI) from aqueous solution.

Tao Hao; Chao Yang; Xuehui Rao; Jide Wang; Chunge Niu; Xintai Su

2014-01-01T23:59:59.000Z

398

E-Print Network 3.0 - arsenic rich iron Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 Processes conducive to the release and transport of arsenic into aquifers of Bangladesh Summary: then by reductive dissolution of iron and arsenic during the ensuing...

399

Arsenic Removal from Groundwater Using Iron Electrocoagulation: Effect of Charge Dosage Rate  

E-Print Network [OSTI]

iron-­? containing   adsorbents   for   arsenic   removal.  arsenate-selective adsorbent. [29] Electrochemical Reactorsof pre-synthesized HFO adsorbent (ps-HFO; i.e. HFO that was

Amrose, Susan E.

2014-01-01T23:59:59.000Z

400

E-Print Network 3.0 - advanced iron aluminide-clad Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Molecular to Field Scale Uranium... , Arsenic, and Iron Biogeochemistry at Abandoned Mining Sites Abandoned Uranium Mine Tailings in Harding Source: Borch, Thomas - Department...

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

E-Print Network 3.0 - anaerobically corroding iron Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

This publication provides a general overview of anaero- Summary: . Scrubbing the biogas with iron-impregnated wood chips has been used in anaerobic digesters in municipal......

402

Layer-By-Layer Assembled Hybrid Film of Carbon Nanotubes/Iron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

By-Layer Assembled Hybrid Film of Carbon NanotubesIron Oxide Nanocrystals for Reagentless Electrochemical Detection of Layer-By-Layer Assembled Hybrid Film of Carbon Nanotubes...

403

Synthesis of the H-Cluster Framework of Iron-Only Hydrogenase...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for hydrogen production or uptake, pertinent to energy transduction technology and a hydrogen economy. Herein we report the assembly of the first materials with di-iron...

404

Promotion of atherogenesis by copper or iron-Which is more likely?  

SciTech Connect (OSTI)

Iron levels increase in atherosclerotic lesions in cholesterol fed-rabbits and play a role in atherosclerosis. We investigated whether copper also rises. Male New Zealand White rabbits were fed high-cholesterol diets for 8 weeks. After sacrifice, lesion sizes were determined, and elemental analyses of the lesion and unaffected artery wall performed using nuclear microscopy. Unlike iron, lesion copper is decreased by about half compared with the unaffected artery wall, and much less copper than iron is present. Our data suggest that iron may be more likely to play a role in the promotion of atherosclerosis than copper.

Rajendran, Reshmi [Centre for Ion Beam Applications, Department of Physics, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Department of Biochemistry, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Ren, Minqin [Centre for Ion Beam Applications, Department of Physics, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Ning, Pan [Department of Biochemistry, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Tan Kwong Huat, Benny [Department of Pharmacology, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore); Halliwell, Barry [Department of Biochemistry, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore)]. E-mail: bchbh@nus.edu.sg; Watt, Frank [Centre for Ion Beam Applications, Department of Physics, National University of Singapore, MD7, 8 Medical Drive, Singapore 117597 (Singapore)

2007-02-02T23:59:59.000Z

405

Contribution of Iron-Reducing Bacteria to Mercury Methylation in Marine Sediments  

E-Print Network [OSTI]

in continental margin sediments off central Chile. Limnologyof microbial iron reduction in sediments of the Baltic-Northreducing bacteria from sediments of an acid stressed lake.

Fleming, Emily J.; Nelson, D C

2006-01-01T23:59:59.000Z

406

E-Print Network 3.0 - approved iron nanoparticles Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of Standards and Technology (NIST), Materials Reliability Division Collection: Materials Science 2 Synthesis of Monodisperse Biotinylated p(NIPAAm)-Coated Iron Oxide Magnetic...

407

ORNL scientists uncover clues to role of magnetism in iron-based...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Media Relations (865) 574-7308 ORNL scientists uncover clues to role of magnetism in iron-based superconductors Oak Ridge National Laboratory scientists used scanning...

408

Quantification of liver iron content with CT—added value of dual-energy  

Science Journals Connector (OSTI)

To evaluate the value of dual-energy CT (DECT) with use of an ... decomposition algorithm for the quantification of liver iron content (LIC).

Michael A. Fischer; Caecilia S. Reiner; Dimitri Raptis; Olivio Donati…

2011-08-01T23:59:59.000Z

409

FACTORS CONTROLLING SYNTHESIS OF IRON OXIDE NANOPARTICLES AND THE EFFECT OF SURFACE CHARGE ON MAGNETIC HYPERTHERMIA.  

E-Print Network [OSTI]

??ABSTRACT Iron oxide nanoparticles (IONPs) have been widely studied in the theranostics application due to their promising magnetic properties, low cytotoxicity and attractive biocompatibility. Despite… (more)

Qi, Bin

2013-01-01T23:59:59.000Z

410

Preservation of iron(II) by carbon-rich matrices in a hydrothermal plume  

SciTech Connect (OSTI)

Hydrothermal venting associated with mid-ocean ridge volcanism is globally widespread. This venting is responsible for a dissolved iron flux to the ocean that is approximately equal to that associated with continental riverine runoff. For hydrothermal fluxes, it has long been assumed that most of the iron entering the oceans is precipitated in inorganic forms. However, the possibility of globally significant fluxes of iron escaping these mass precipitation events and entering open-ocean cycles is now being debated, and two recent studies suggest that dissolved organic ligands might influence the fate of hydrothermally vented metals. Here we present spectromicroscopic measurements of iron and carbon in hydrothermal plume particles at the East Pacific Rise mid-ocean ridge. We show that organic carbon-rich matrices, containing evenly dispersed iron(II)-rich materials, are pervasive in hydrothermal plume particles. The absence of discrete iron(II) particles suggests that the carbon and iron associate through sorption or complexation. We suggest that these carbon matrices stabilize iron(II) released from hydrothermal vents in the region, preventing its oxidation and/or precipitation as insoluble minerals. Our findings have implications for deep-sea biogeochemical cycling of iron, a widely recognized limiting nutrient in the oceans.

Toner, Brandy M.; Fakra, Sirine C.; Manganini, Steven J.; Santelli, Cara M.; Marcus, Matthew A.; Moffett, James W.; Rouxel, Olivier; German, Christopher R.; Edwards, Katrina J.

2008-09-20T23:59:59.000Z

411

Effect of PCI blending on combustion characteristics for iron-making.  

E-Print Network [OSTI]

??The PCI technology is well established for reducing the consumption of economic and environmentally expensive coke in blast furnace iron-making. Often, coal blends show unexpected… (more)

Gill, Trilochan Singh

2009-01-01T23:59:59.000Z

412

Effect of copper and iron on the oxidative flavor deterioration of ice cream  

E-Print Network [OSTI]

for the degree of "ASTER CP SCIENCE Jhnuary I~ Nc )or Sub)catt Dairy &~actures EFFECT GF COFFER ARD IRON CR Tlm OXIDATIVE FLAVOR DETKRI/Z'TJ ' CF ICE CRE//P A Thesis Pi? Pbdul Hasid 'Pish Approved as to style and content by: I /'i'I /' ' / , r... Archihald (2? 3) reported results cf cariiar studies on the effect oi' feed and added coppex' or iron or. the coppex' and iron content of milk. Cn tne lamia of these earlier ?tudiss the effect of feeding supplemental copper and iron on the copper...

Miah, Md. Abdul Hamid

1961-01-01T23:59:59.000Z

413

Chemical classification of iron meteorites—IX. A new group (IIF), revision of IAB and IIICD, and data on 57 additional irons  

Science Journals Connector (OSTI)

Structural observations and concentrations of Ni, Ga, Ge and Ir allow the classification of 57 iron meteorites in addition to those described in the previous papers in this series; the number of classified independent iron meteorites is now 535. INAA for an additional six elements indicates that five previously studied irons having very high GeGa ratios are compositionally closely related and can be gathered together as group IIF. A previously unstudied iron, Dehesa, has the highest GeGa ratio known in an iron meteorite, a ratio 18 × higher than that in CI chondrites. Although such high GeGa ratios are found in the metal grains of oxidized unequilibrated chondrites, their preservation during core formation requires disequilibrium melting or significant compositional and temperature effects on metal/silicate distribution constants and/or activity coefficients. In terms of GeGa ratios and various other properties group IIF shows genetic links to the Eagle Station pallasites and COCV chondrites. Klamath Falls is a new high-Ni, low-Ir member of group IIIF that extends the concentration ranges in this group and makes these comparable to the ranges in large igneous groups such as IIIAB. Groups IAB and IIICD have been revised to extend the lower Ni boundary of group IIICD down to 62 mg/g. The iron having by far the highest known Ni concentration (585 mg/g), Oktibbeha County, is a member of group IAB and extends the concentration ranges of all elements in this nonmagmatic group. Morasko, a IAB iron associated with a crater field in Poland, is paired with the Seeläsgen iron discovered 100 km away. All explosion craters from which meteorites have been recovered were produced by IAB and IIIAB irons.

Alfred Kracher; John Willis; John T Wasson

1980-01-01T23:59:59.000Z

414

Phosphate influences cycling of iron and carbon in the environment |  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Science Science Computing, Environment & Life Sciences Energy Engineering & Systems Analysis Photon Sciences Physical Sciences & Engineering Energy Frontier Research Centers Science Highlights Postdoctoral Researchers Phosphate influences cycling of iron and carbon in the environment August 30, 2013 Tweet EmailPrint Aquatic and terrestrial environments are dynamic systems where coupled microbiological, geochemical, and hydrological processes define the complex interactions that drive the biogeochemical cycling of water and the major and minor elements. Therefore, a thorough understanding of these complex interactions is critical for predicting the biogeochemical cycling of carbon, nutrients, heavy metals, radionuclides, and other contaminants; managing water quality; and understanding the interactions between

415

Iron catalyst for preparation of polymethylene from synthesis gas  

DOE Patents [OSTI]

This invention relates to a process for synthesizing hydrocarbons; more particularly, the invention relates to a process for synthesizing long-chain hydrocarbons known as polymethylene from carbon monoxide and hydrogen or from carbon monoxide and water or mixtures thereof in the presence of a catalyst comprising iron and platinum or palladium or mixtures thereof which may be supported on a solid material, preferably an inorganic refractory oxide. This process may be used to convert a cabon monoxide containing gas to a product which could substitute for high density polyethylene.

Sapienza, Richard S. (Shoreham, NY); Slegeir, William A. (Hampton Bays, NY)

1990-01-01T23:59:59.000Z

416

Corrosion of Iron Stainless Steels in Molten Nitrate Salt  

Science Journals Connector (OSTI)

Abstract Energy storage for concentrating solar power (CSP) is a major area of research that seeks to lower the levelized cost of electricity within the aggressive SunShot goals of 6¢/kW-hrth[1–3]. One viable approach is sensible thermal energy storage (TES), which currently utilizes molten nitrate binary salt, stored at 575 °C in the hot tank of a two tank system [4,5]. Increasing the temperature limit within the hot tank requires a detailed understanding of materials corrosion behavior, in addition to salt thermal stability properties. High temperature nickel based alloys are the logical choice for strength and corrosion resistance as elevated temperatures will increase corrosion kinetics, however, the cost of nickel based alloys are nearly four times more expensive than iron based steels [6]. For this reason iron based stainless steels, specifically 321SS and 347SS (nominally Fe-17Cr-9Ni), were chosen for investigation at several temperatures in nitrate salt. 316SS, an elementally similar alloy, was susceptible to stress corrosion cracking while tested at Solar Two [4]. It was suggested that alloys with stabilizing additions of niobium (347SS) or titanium (321SS) would mitigate this deleterious behavior. Flat coupon samples were immersed in binary nitrate salts at temperatures of 400, 500, 600, and 680 °C, with air sparging on all tests. Samples were nominally removed at intervals of 500, 1000, 2000, and 3000 hours to acquire data on time varying weight gain information while simultaneously employing metallography to identify corrosion mechanisms occurring within the melt. Corrosion rates varied dramatically with temperature according to an Arrhenius-type behavior. 347SS and 321SS had very little oxidation for 400 and 500 °C, indicative of a protective corrosion scale and low corrosion kinetics. Data at 600 °C showed that 321SS tended toward linear oxidation behavior based on oxide spallation which was observed on the samples upon removal. Corrosion products at 500 °C had phases of iron oxide, with obvious chromium depletion as observed in energy dispersive spectroscopy (EDS) scans. 600 °C corrosion layers were primarily iron oxide with obvious phases of sodium ferrite on the outer surface. 680 °C marked an excessive rate of corrosion with metal loss in both alloys.

Alan Kruizenga; David Gill

2014-01-01T23:59:59.000Z

417

New iron catalyst for preparation of polymethylene from synthesis gas  

DOE Patents [OSTI]

This invention relates to a process for synthesizing hydrocarbons; more particularly, the invention relates to a process for synthesizing long-chain hydrocarbons known as polymethylene from carbon monoxide and hydrogen or from carbon monoxide and water or mixtures thereof in the presence of a catalyst comprising iron and platinum or palladium or mixtures thereof which may be supported on a solid material, preferably an inorganic refractory oxide. This process may be used to convert a carbon monoxide containing gas to a product which could substitute for high density polyethylene.

Sapienza, R.S.; Slegeir, W.A.

1988-03-31T23:59:59.000Z

418

Chemistry and Electronic Structure of Iron-Based Superconductors  

SciTech Connect (OSTI)

The solid state provides a richly varied fabric for intertwining chemical bonding, electronic structure, and magnetism. The discovery of superconductivity in iron pnictides and chalcogenides has revealed new aspects of this interplay, especially involving magnetism and superconductivity. Moreover, it has challenged prior thinking about high-temperature superconductivity by providing a set of materials that differ in many crucial aspects from the previously known cuprate superconductors. Here we review some of what is known about the superconductivity and its interplay with magnetism, chemistry, and electronic structure in Fe-based superconductors.

Safa-Sefat, Athena [ORNL; Singh, David J [ORNL

2011-01-01T23:59:59.000Z

419

The iron reduction ability of various rose rootstocks  

E-Print Network [OSTI]

's (Hoagland and Amon 1950) solution, without iron and with NO3 as the nitrogen source (see Appendix 2 for recipe). Solution pH was adjusted with 1N NaOH to 6. 3. All solutions were well aerated with a powerhead air/circulation pump (venturi type Rolf C... with six different Fe +EDTA solutions at the following concentrations: 0, 0. 05, 1, 4, 8, and 48 pM Fe +EDTA (0 to 2. 78 mg liter ). Plants were aerated with a powerhead venturi type air/circulation pump (Rolf C. Hagen Corp, Mansfield MA) to insure...

McDonald, Garry Vernon

2012-06-07T23:59:59.000Z

420

A New Sendai Virus Vector Deficient in the Matrix Gene Does Not Form Virus Particles and Shows Extensive Cell-to-Cell Spreading  

Science Journals Connector (OSTI)

...CV-1 cells, various lines of cancer cells, and normal human cells...cells, from which they are not depleted since there is almost no virion...treatment of diseases such as cancers. In these cases, a cytolytic...SeV/M for the treatment of cancers are now in progress. Thus...

Makoto Inoue; Yumiko Tokusumi; Hiroshi Ban; Takumi Kanaya; Masayuki Shirakura; Tsuyoshi Tokusumi; Takahiro Hirata; Yoshiyuki Nagai; Akihiro Iida; Mamoru Hasegawa

2003-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Strategy I responses to Fe-deficiency of two Citrus rootstocks differing in their tolerance to iron chlorosis  

Science Journals Connector (OSTI)

The expression of iron (Fe) acquisition-related genes in roots was studied in roots of two different citrus seedlings, namely, Carrizo citrange (CC, Fe chlorosis-sensitive) and Cleopatra mandarin (CM, Fe chlorosis-tolerant), growing either with (control) or without (?Fe) Fe in the nutrient solution. Fe-deficiency increased expression of the gene HA1 coding for proton-ATPase (H+-ATPase) enzyme in both genotypes, although no differences were observed between treatments among rootstocks. Furthermore, while the gene expression levels of FRO2 – which encodes the Ferric Chelate Reductase (FC-R) enzyme–, increased under ?Fe condition in both genotypes, CM always recorded the highest activity. CC showed the greatest induction of genes IRT1 and IRT2 encoding two iron transporters, however only IRT1 was significantly induced by Fe starvation. Analysis of the enzymatic activities (H+-ATPase and FC-R) regulated by the aforementioned genes confirmed these results. Thus, in agreement with the acidification pattern registered, H+-ATPase activities were higher in ?Fe plants than in controls, although no significant differences were detected between each treatment among rootstocks. Fe starvation also induced FC-R activity; however, this was greater in CM than in CC roots. Interestingly, root 57Fe uptake rates from 57Fe-EDDHA solutions were increased by Fe-deficiency, especially in the CM genotype, and CM accumulated a much larger Fe pool in the root apoplast than CC. Taken together, the main trait determining Fe-chlorosis tolerance among these genotypes is the ability to boost Fe3+ reduction in response to Fe-deficiency through enhanced FRO2 gene expression. Moreover, Fe chlorosis resistance in these plants could be related to the amount of Fe stored in the root apoplast.

Mary-Rus Martínez-Cuenca; M. Ángeles Forner-Giner; Domingo J. Iglesias; Eduardo Primo-Millo; Francisco Legaz

2013-01-01T23:59:59.000Z

422

THE ROLE OF FERRIC IRON UPTAKE REGULATOR (FUR) PROTEIN ON IRON REGULATION IN COXIELLA BURNETII  

E-Print Network [OSTI]

;TCGTTTCCCTTCAGTCGCTG#7;#7;CBU2012 forward#7;CGAAGAACTGGATAGCGAAAG#7;#7; Beta-Galactosidase Assay C loned plasmids were electroporated into either BN4020 pMH15 or BN4020 pNP104 electrocompetent cells to form two plasmid heterolo ssay was performed...;#7;pMH15#7;pACYC184 with E. coli fur#7;#7;#7;pBlue TOPO#7;TA cloning vector, promoter trap#7;Invitrogen#7;#7;pNP104#7;pACYC184 with complete C. burnetii fur#7;This work#7;#7;BN4020#7;E. coli fur deletion strain#7;This work#7;#7; Table 2. List of all...

Wilson, Mary J

2006-08-16T23:59:59.000Z

423

Synthesis and properties of Fe3O4 nanoparticles by sol-vothermal method using iron(III) acetylacetonate  

Science Journals Connector (OSTI)

Well dispersed Fe3O4...nanoparticles were synthesized at 180°C by sol-vothermal method, using iron (III) acetylacetonate as iron source and poly-vinilpyrrolidone (PVP) as ... reaction temperature and time, the am...

Xiaojuan Liang; Guoyuan Ji; Liping Zhang; Yuxiang Yang…

2011-08-01T23:59:59.000Z

424

Effect of iron acetylacetonate on physico-chemical properties of waterglass based aerogels by ambient pressure drying  

Science Journals Connector (OSTI)

The effect of iron acetylacetonate on the physico-chemical properties of waterglass ... has been investigated. Doping the gels with iron acetylacetonat (FeAA) facilitates in the diminution...2SiO3 molar ratio fro...

A. Venkateswara Rao; Uzma K. H. Bangi…

2011-01-01T23:59:59.000Z

425

Water Gas Shift Catalysis Using Iron Aerogels Doped with Palladium by the Gas-Phase Incorporation Method  

Science Journals Connector (OSTI)

The WGS activity of 2% Pd iron aerogel was higher by 50% than that of 1% Pd incorporated iron aerogel. ... (30) The reactors were charged with 100 mg of fresh catalysts held in place with Whatman QMA quartz fiber filters. ...

Sumit Bali; Gregory C. Turpin; Richard D. Ernst; Ronald J. Pugmire; Vivek Singh; Mohindar S. Seehra; Edward M. Eyring

2008-03-28T23:59:59.000Z

426

Technology and form : iron construction and transformation of architectural ideals in nineteenth century France, 1830-1889.  

E-Print Network [OSTI]

This dissertation investigates the transformation of architectural ideals brought about by the development of iron construction during the nineteenth century in France. The emergence of iron construction paralleled the ...

Lee, Sanghun

1996-01-01T23:59:59.000Z

427

Emerging Energy-efficiency and Carbon Dioxide Emissions-reduction Technologies for the Iron and Steel Industry  

E-Print Network [OSTI]

effective use of non-coking coal and iron-bearing dust andfrom iron ore and non-coking coal. The process was developedBF production in using non-coking coal as reducing agent and

Hasanbeigi, Ali

2014-01-01T23:59:59.000Z

428

Raman studies of corrosion layers formed on archaeological irons in various media  

E-Print Network [OSTI]

147 Raman studies of corrosion layers formed on archaeological irons in various media Ludovic mandana.saheb@cea.fr, f philippe.dillmann@cea.fr Keywords: Raman spectroscopy, iron corrosion, ancient artefact, imaging. Abstract. The description and identification of corrosion products formed

429

Synthetic Analogues of Cysteinate-Ligated Non-Heme Iron and Non-Corrinoid Cobalt Enzymes  

E-Print Network [OSTI]

Synthetic Analogues of Cysteinate-Ligated Non-Heme Iron and Non-Corrinoid Cobalt Enzymes Julie A June 24, 2003 Contents 1. Introduction to Non-Heme Iron Enzymes 825 2. Nitrile Hydratase (NHase) 826 2.1. Enzyme Function 826 2.2. Enzyme Active Site Structure 826 2.3. Spectroscopic Properties 827 2

Kovacs, Julie

430

Graphene–Nanotube–Iron Hierarchical Nanostructure as Lithium Ion Battery Anode  

Science Journals Connector (OSTI)

Graphene–Nanotube–Iron Hierarchical Nanostructure as Lithium Ion Battery Anode ... In this study, we report a novel route via microwave irradiation to synthesize a bio-inspired hierarchical graphene–nanotube–iron three-dimensional nanostructure as an anode material in lithium-ion batteries. ...

Si-Hwa Lee; Vadahanambi Sridhar; Jung-Hwan Jung; Kaliyappan Karthikeyan; Yun-Sung Lee; Rahul Mukherjee; Nikhil Koratkar; Il-Kwon Oh

2013-04-03T23:59:59.000Z

431

Structural and magnetic characterization of norbornenedeuterated norbornene dicarboxylic acid diblock copolymers doped with iron oxide  

E-Print Network [OSTI]

, Ag, Pd, Pt, Cu) [5­9] and semiconductor nanoclusters (PbS, CdS, ZnS) [10­12] were synthesized within diblock copolymers doped with iron oxide nanoparticles Pinar Akcoraa , Xin Zhangb , Bindhu Varughesec 2005 Available online 29 April 2005 Abstract A series of iron oxide doped norbornene (NOR

Rubloff, Gary W.

432

Photo-Fenton oxidation of phenol with magnetite as iron source Marco Minella,1  

E-Print Network [OSTI]

Photo-Fenton oxidation of phenol with magnetite as iron source Marco Minella,1 Giulia Marchetti,1 irradiation. Very interestingly, the photo-Fenton degradation of phenol was also observed under neutral to promote photo-Fenton reactions even under circumneutral pH conditions, the limited iron leaching and its

433

Transcriptional Response of Leptospira interrogans to Iron Limitation and Characterization of a PerR Homolog  

Science Journals Connector (OSTI)

...upregulated in response to low iron...genome-wide frequency (18.6 and...upregulated in response to an increase...require an energy transduction...need for iron storage proteins and...or stress responses. FIG. 1...information storage and processing...includes C, energy production...

Miranda Lo; Gerald L. Murray; Chen Ai Khoo; David A. Haake; Richard L. Zuerner; Ben Adler

2010-08-30T23:59:59.000Z

434

Melting of Iron under Earth's Core Conditions from Diffusion Monte Carlo Free Energy Calculations  

E-Print Network [OSTI]

Melting of Iron under Earth's Core Conditions from Diffusion Monte Carlo Free Energy Calculations Ester Sola1 and Dario Alfe`1,2 1 Thomas Young Centre@UCL, and Department of Earth Sciences, UCL, Gower. Here we used quantum Monte Carlo techniques to compute the free energies of solid and liquid iron

Alfè, Dario

435

Competitive adsorption effects in the electrodeposition of iron-nickel alloys  

SciTech Connect (OSTI)

Two-step reaction mechanisms involving adsorbed monovalent intermediate ions for the electrodeposition of iron and nickel as single metals can be combined to form a predictive model for the codeposition of iron-nickel alloys. Inhibition of the more noble nickel in the presence of iron is caused by preferential surface coverage of the adsorbed iron intermediate resulting from a difference between the two elements in Tafel constant for the electrosorption step. The role of hydrolyzed cations and surface pH is investigated and methods for evaluating the influence of pH are explored. The analysis shows that changes in surface pH with potential are not necessary for iron-rich (anomalous) deposits, but that variations in pH from one electrolyte to another may influence deposit composition. The tendency toward iron-rich deposits with increasing overpotential exists in all systems, however, and can be prevented only by decreasing the iron concentration of the bath. An extension of the analysis to account for transport limitations in baths with low iron concentration is developed and calculations with the model are presented to illustrate the effects of current density and electrolyte convection under conditions similar to those investigated experimentally in the literature.

Matlosz, M. (Ecole Polytechnique Federale de Lausanne, (Switzerland). Dept. des materiaux)

1993-08-01T23:59:59.000Z

436

1. Introduction Copper, along with iron active sites dominate the field of  

E-Print Network [OSTI]

#12;1. Introduction Copper, along with iron active sites dominate the field of biological oxygen chemistry[1] and play important roles in homogeneous[2] and heterogeneous catalysis.[3, 4] Copper pro- teins heme ± iron centers).[8] The known copper proteins which are involved in dioxygen binding, activation

Chen, Peng

437

Towards improved iron-based catalysts for direct coal liquefaction  

SciTech Connect (OSTI)

Iron-based catalysts for direct coal liquefaction (DCL) have several advantages: they are cheap and environmentally benign, and have a reasonable activity in the sulfide form. Work in this area has recently been collected and published. work in our laboratory has focussed on catalysts made with ferric sulfide as a precursor. This material is unstable even at room temperature, and disproportionates to form pyrite (FeS{sub x}; PY) , non-stoichiometric pyrrhotite (FeS{sub x}, x {approx} 1; PH) , and elemental S. The value of x and the relative amounts of PY and PH depend upon the time and temperature of disproportionation. Materials from hydrothermal disproportionation at 200{degrees}C for 1 h have roughly equal amounts of PH and PY (on an iron basis), and these materials appear to make the most active and selective catalysts for DCL. These catalyst precursors and catalyst materials have been characterized by atomic adsorption spectroscopy (AA), Auger electron spectroscopy (AES) and x-ray diffraction (XRD). The characterizations have been correlated to the reactions of Fe during disproportionation and to the performance of the catalysts. Improvements in these catalysts can be made in two ways: by altering the active sites, and by decreasing the particle sizes. In the present work, we present examples of both types. The active sites are altered by using small amounts of a second metal. The particle sizes are reduced by using an aerosol technique for preparation.

Dadyburjor, D.B.; Stiller, A.H.; Stinespring, C.D. [West Virginia Univ., Morgantown, WV (United States)] [and others

1994-12-31T23:59:59.000Z

438

Plasma Treatments and Biomass Gasification  

Science Journals Connector (OSTI)

Exploitation of forest resources for energy production includes various methods of biomass processing. Gasification is one of the ways to recover energy from biomass. Syngas produced from biomass can be used to power internal combustion engines or, after purification, to supply fuel cells. Recent studies have shown the potential to improve conventional biomass processing by coupling a plasma reactor to a pyrolysis cyclone reactor. The role of the plasma is twofold: it acts as a purification stage by reducing production of tars and aerosols, and simultaneously produces a rich hydrogen syngas. In a first part of the paper we present results obtained from plasma treatment of pyrolysis oils. The outlet gas composition is given for various types of oils obtained at different experimental conditions with a pyrolysis reactor. Given the complexity of the mixtures from processing of biomass, we present a study with methanol considered as a model molecule. This experimental method allows a first modeling approach based on a combustion kinetic model suitable to validate the coupling of plasma with conventional biomass process. The second part of the paper is summarizing results obtained through a plasma-pyrolysis reactor arrangement. The goal is to show the feasibility of this plasma-pyrolysis coupling and emphasize more fundamental studies to understand the role of the plasma in the biomass treatment processes.

J Luche; Q Falcoz; T Bastien; J P Leninger; K Arabi; O Aubry; A Khacef; J M Cormier; J Lédé

2012-01-01T23:59:59.000Z

439

Iron-based Material Paves Way for New Superconductors | Department of  

Broader source: Energy.gov (indexed) [DOE]

Iron-based Material Paves Way for New Superconductors Iron-based Material Paves Way for New Superconductors Iron-based Material Paves Way for New Superconductors February 12, 2013 - 6:26pm Addthis Brookhaven physicists Weidong Si (left) and Qiang Li look into the vacuum chamber where the new high-field iron-based superconductors are made through a process called pulsed-laser deposition. Brookhaven physicists Weidong Si (left) and Qiang Li look into the vacuum chamber where the new high-field iron-based superconductors are made through a process called pulsed-laser deposition. Michael Hess Michael Hess Former Digital Communications Specialist, Office of Public Affairs How much better is this film? Under an intense 30-tesla magnetic field, the film carried a record-high 200,000 amperes per square centimeter.

440

DOE - Office of Legacy Management -- Rogers Iron Works Co - MO 10  

Office of Legacy Management (LM)

Rogers Iron Works Co - MO 10 Rogers Iron Works Co - MO 10 FUSRAP Considered Sites Site: ROGERS IRON WORKS CO. (MO.10 ) Elimination from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Rogers Iron Co. MO.10-1 Location: Joplin , Missouri MO.10-1 Evaluation Year: 1990 MO.10-2 MO.10-3 Site Operations: Tested C-liner crushing methods. MO.10-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material handled MO.10-3 MO.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Trace Amounts) MO.10-2 Radiological Survey(s): None Indicated Site Status: Elimination from consideration under FUSRAP Also see Documents Related to ROGERS IRON WORKS CO. MO.10-1 - National Lead Company of Ohio Analytical Data Sheet 9908;

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Sorption of Ferric Iron from Siderophore Complexes by Layer Type Manganese  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sorption of Ferric Iron from Siderophore Complexes by Layer Type Sorption of Ferric Iron from Siderophore Complexes by Layer Type Manganese Oxides Owen W. Duckworth (North Carolina State University), John R. Bargar (Stanford Synchrotron Radiation Lightsource), and Garrison Sposito (University of California-Berkeley) figure 1 Figure 1. Top: Iron is thought to limit phytoplankton in much of the world's oceans. Bottom: Structure of the iron-siderophore complex ferrioxamine B [Fe(III)HDFOB+]. Image courtesy of Andrzej Jarzecki, Brooklyn College, the City University of New York. Iron is one of several essential nutrients thought to limit phytoplankton growth in large areas of the world's oceans. The growth of marine phytoplankton represents a important linkage in the carbon cycle, accounting for approximately 50% of the total biological uptake of carbon

442

X-ray absorption spectroscopic studies of mononuclear non-heme iron enzymes  

SciTech Connect (OSTI)

Fe-K-edge X-ray absorption spectroscopy (XAS) has been used to investigate the electronic and geometric structure of the iron active site in non-heme iron enzymes. A new theoretical extended X-ray absorption fine structure (EXAFS) analysis approach, called GNXAS, has been tested on data for iron model complexes to evaluate the utility and reliability of this new technique, especially with respect to the effects of multiple-scattering. In addition, a detailed analysis of the 1s{yields}3d pre-edge feature has been developed as a tool for investigating the oxidation state, spin state, and geometry of iron sites. Edge and EXAFS analyses have then been applied to the study of non-heme iron enzyme active sites.

Westre, T.E.

1996-01-01T23:59:59.000Z

443

Phase II Calderon Process to Produce Direct Reduced Iron Research and Development Project  

SciTech Connect (OSTI)

This project was initially targeted to the making of coke for blast furnaces by using proprietary technology of Calderon in a phased approach, and Phase 1 was successfully completed. The project was then re-directed to the making of iron units. In 2000, U.S. Steel teamed up with Calderon for a joint effort to produce directly reduced iron with the potential of converting it into molten iron or steel consistent with the Roadmap recommendations of 1998 prepared by the Steel Industry in cooperation with the Department of Energy by using iron ore concentrate and coal as raw materials, both materials being appreciably lower in cost than using iron pellets, briquettes, sinter and coke.

Albert Calderon

2007-03-31T23:59:59.000Z

444

Experimental design to optimise colour removal of diazo dye Congo Red using Zero-Valent Iron  

Science Journals Connector (OSTI)

Two types of zero-valent iron named Iron Powder (IP) and Iron Wool (IW) were used for colour removal of Congo Red (CR) dye from aqueous solution. Strong acidic condition (pH 2?3) favoured 99% colour removal with 2454-2485 mg/g of dye removal capacity by IP and IW. Decolourization of CR followed first order kinetics. At acidic pH, COD (Chemical Oxygen Demand) removal was 14-15% probably by adsorption by various oxidised iron species and at pH 7, it increased to 85%, due to co-precipitation by iron oxide products. IW was reused for three successive cycles without compromising colour removal efficiency of CR.

Animesh Debnath; Saswati Chakraborty

2013-01-01T23:59:59.000Z

445

PHASE II CALDERON PROCESS TO PRODUCE DIRECT REDUCED IRON RESEARCH AND DEVELOPMENT PROJECT  

SciTech Connect (OSTI)

This project was initially targeted to the making of coke for blast furnaces by using proprietary technology of Calderon in a phased approach, and Phase I was successfully completed. The project was then re-directed to the making of iron units. In 2000, U.S. Steel teamed up with Calderon for a joint effort which will last 42 months to produce directly reduced iron with the potential of converting it into molten iron or steel consistent with the Roadmap recommendations of 1998 prepared by the Steel Industry in cooperation with the Department of Energy by using iron ore concentrate and coal as raw materials, both materials being appreciably lower in cost than using iron pellets and coke.

Albert Calderon

2004-10-28T23:59:59.000Z

446

Real-time x-ray absorption spectroscopy of uranium, iron, and manganese in contaminated sediments during bioreduction  

E-Print Network [OSTI]

ferric iron in aquatic sediments. Applied and Environmentalin evaporation basin sediments. Geochimica Cosmochimica Actaof uranium-contaminated subsurface sediments. Environmental

Tokunaga, T.K.

2008-01-01T23:59:59.000Z

447

A Long, Contingent Path to Comparative Advantage: Industrial Policy and the Japanese Iron and Steel Industry, 1900-1973  

E-Print Network [OSTI]

Overseas Procurement of Coking Coal By the Japanese Steelendowed as Japan in coking coal and iron ore (Yonekura,

ELBAUM, BERNARD

2006-01-01T23:59:59.000Z

448

Electrochemical properties of iron dissolution in the presence of CO{sub 2} -- Basics revisited  

SciTech Connect (OSTI)

In order to shed more light on the anodic reaction mechanism in CO{sub 2} corrosion of mild steel, two different kinds of electrochemical measurements were used: potentiodynamic sweep and galvanostatic measurements. Experiments were conducted in a glass cell at room temperature (T = 22 {+-} 1 C), different CO{sub 2} partial pressures (0--1 bar), over a broad pH range (2--7) using a rotating cylinder at 4,000 rpm. Distinct and different anodic mechanisms were observed for pH < 4 and for pH > 5. In the intermediate area there seems to be a transition from one mechanism to another. New orders of reaction and Tafel slopes were extracted, very different from what was previously assumed. A coherent ensemble of mechanisms was proposed for the anodic reaction which is consistent with the experimental results. Consequences of the present findings for the CO{sub 2} corrosion area are discussed. For example, in the case of undissolved iron carbide layers, it is no longer possible to discriminate the roles of galvanic coupling and internal acidification.

Nesic, S.; Thevenot, N. [Inst. for Energiteknikk, Kjeller (Norway); Crolet, J.L. [Elf Aquitaine, Pau (France); Drazic, D.M. [Univ. of Belgrade (Yugoslavia). Faculty of Technology and Metallurgy

1996-08-01T23:59:59.000Z

449

Human Colon Adenocarcinomas Express a MUC1-associated Novel Carbohydrate Epitope on Core Mucin Glycans Defined by a Monoclonal Antibody (A10) Raised against Murine Ehrlich Tumor Cells  

Science Journals Connector (OSTI)

...enzymatic treatments) once bound...Mini-Protean Cell Electrophoresis; Bio-Rad...deionized water. Enzymatic Treatments. These treatments...4, and dialysis; (b) phenol...ether and dialysis against distilled water; (d) alkali treatment (b-elimination...

Maite Medina; Desireé Vélez; José A. Asenjo; Gustavo Egea; Francisco X. Real; Juana Gil; and José L. Subiza

1999-03-01T23:59:59.000Z

450

Medical Actinium Therapeutic Treatment  

ScienceCinema (OSTI)

Learn how INL researchers are increasing world supplies of Bismuth 213 to help with cancer treatments. For more information about INL research projects, visit http://www.facebook.com/idahonationallaboratory.

None

2013-05-28T23:59:59.000Z

451

Electrodialysis in Water Treatment  

Science Journals Connector (OSTI)

This chapter focuses on the uses of electrodialysis and specially electrodialysis reversal for the treatment of brackish and groundwater to produce drinking water. Over the last 10–15 years,...

Andréa Moura Bernardes; Marco A. S. Rodrigues

2014-01-01T23:59:59.000Z

452

6230 surface treatment [n  

Science Journals Connector (OSTI)

constr. (Surfacing of manufactured stone products, metals, wood,...Specific term for surface treatment of stones with hammer and chisel tooling); syn. surfacing [n] (2);s tratamiento [m] de superfici...

2010-01-01T23:59:59.000Z

453

Diverted Total Synthesis Leads to the Generation of Promising Cell-Migration Inhibitors for Treatment of Tumor Metastasis: In vivo and Mechanistic Studies on the Migrastatin Core Ether Analog  

Science Journals Connector (OSTI)

Cancer Biology and Genetics Program, Cell Biology Program, Laboratory for Bioorganic Chemistry, Organic Synthesis Core Facility, Howard Hughes Medical Institute, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, New York 10065, and Department of Chemistry, Columbia University, Havemeyer Hall, 3000 Broadway, New York, New York 10027 ... This work was supported by NIH grants CA103823 (S.J.D.), CA126518 (J.M.), and CA129243 (J.M.); by the Alan and Sandra Gerry Metastasis Research Initiative (J.M.); and by a Cancer Research Institute Gar Reichman Award (M.M.). ... Danishefsky, S. J., Yan, C. F., Singh, R. K., Gammill, R. B., McCurry, P. M., Jr., Fritsch, N. and Clardy, J. J. Am. ...

Thordur Oskarsson; Pavel Nagorny; Isaac J. Krauss; Lucy Perez; Mihirbaran Mandal; Guangli Yang; Ouathek Ouerfelli; Danhua Xiao; Malcolm A. S. Moore; Joan Massagué; Samuel J. Danishefsky

2010-02-15T23:59:59.000Z

454

Chem.Mater. 1996,7, 1419-1421 1419 Encapsulation of Iron Carbide in Carbon Nanocapsules  

E-Print Network [OSTI]

Chem.Mater. 1996,7, 1419-1421 1419 Encapsulation of Iron Carbide in Carbon Nanocapsules Nikolai S Manuscript Received April 24, 1995@ Whiskers of iron carbide encased in carbon shells have been prepared from microscopy. The iron carbide whiskers range in length from 300 to 500 nm, and their widths are approximately

Wang, Zhong L.

455

Extrinsic Allergic Alveolitis (Hypersensitivity Pneumonitis) Caused by Sphingobacterium spiritivorum from the Water Reservoir of a Steam Iron  

Science Journals Connector (OSTI)

...spiritivorum from the Water Reservoir of a Steam Iron Peter Kampfer 1 Corresponding author...symptoms were associated with the use of a steam iron. The water reservoir was heavily...episodes of discomfort. She had used a steam iron which is additionally equipped with...

Peter Kämpfer; S. Engelhart; M. Rolke; J. Sennekamp

2005-09-01T23:59:59.000Z

456

Revealing the Dual Nature of Magnetism in Iron Pnictides and Iron Chalcogenides Using X-ray Emission Spectroscopy  

SciTech Connect (OSTI)

We report a Fe K{beta} x-ray emission spectroscopy study of local magnetic moments in various iron-based superconductors in their paramagnetic phases. Local magnetic moments are found in all samples studied: PrFeAsO, Ba(Fe,Co){sub 2}As{sub 2}, LiFeAs, Fe{sub 1+x}(Te,Se), and A{sub 2}Fe{sub 4}Se{sub 5} (where A = K, Rb, and Cs). The moment size is independent of temperature or carrier concentration but varies significantly across different families. Specifically, all iron pnictide samples have local moments of about 1 {micro}B/Fe, while FeTe and K{sub 2}Fe{sub 4}Se{sub 5} families have much larger local moments of {approx}2 {micro}B/Fe and {approx}3.3 {micro}B/Fe, respectively. Our results illustrate the importance of multiorbital physics in describing magnetism of these compounds.

Gretarsson H.; Xu Z.; Lupascu, A.; Kim, J.; Casa, D.; Gog, T,; Wu, W.; Julian, S.R.; Wen, J.S.; Gu, G.D.; Yuan, R.H.; Chen, Z.G.; Wang, N.-L.; Khim, S.; Kim, K.H.; Ishikado, M.; Jarrige, I.; Shamoto, S.; Chu, J.-H.; Fisher, I.R.and Young-June Kim

2011-09-22T23:59:59.000Z

457

Fuel Cell Technologies Office Newsletter: February 2013 | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

is currently posted on the Energy Department's blog. The facility uses fuel cells and biogas from the Orange County Sanitation District's wastewater treatment plant to produce...

458

Energy Department Applauds World's First Fuel Cell and Hydrogen...  

Office of Environmental Management (EM)

The Fountain Valley tri-generation fuel cell and hydrogen energy station uses biogas from the municipal wastewater treatment plant as the fuel for a fuel cell. The system...

459

Lin28a is a putative factor in regulating cancer stem cell-like properties in side population cells of oral squamous cell carcinoma  

SciTech Connect (OSTI)

Cancer stem cells (CSCs) are among the target cells of cancer therapy because they are uniquely involved in both cancer progression and sensitivity to chemotherapeutic agents. We identified side population (SP) cells, which are known to be an enriched population of CSC, in five oral squamous cell carcinoma (OSCC) cells (SCC9, SCC25, TOSCC7, TOSCC17, and TOSCC23). The percentages of SP cells ranged from 0% to 3.3%, with TOSCC23 cells showing the highest percentages of SP cells (3.3% of the total cell population). The SP cells isolated from TOSCC23 cells also showed greater cell proliferation and invasion compared to non-SP (MP) cells. Therefore, our initial findings suggested that SP cells were enriched for CSC-like cells. Furthermore, DNA microarray analysis revealed that the expression of cell proliferation-related and anti-apoptotic genes was greater in SP cells compared to MP cells. We focused on Lin28a, which showed the highest expression (approximately 22-fold) among the upregulated genes. The overexpression of Lin28a in TOSCC23 cells increased their proliferation, colony formation, and invasion. These findings suggest that Lin28a is an appropriate CSC target molecule for OSCC treatment - Highlights: ? Lin28a is a SP cell-specific factor in oral squamous cell carcinoma (OSCC) cells. ? SP cells in OSCC cells show cancer stem cell-like properties. ? Lin28a regulates OSCC proliferative and invasive activities.

Hayashi, S.; Tanaka, J.; Okada, S.; Isobe, T.; Yamamoto, G.; Yasuhara, R.; Irie, T.; Akiyama, C.; Kohno, Y.; Tachikawa, T.; Mishima, K., E-mail: mishima-k@dent.showa-u.ac.jp

2013-05-01T23:59:59.000Z

460

Climate VISION: Private Sector Initiatives: Iron and Steel: GHG Information  

Office of Scientific and Technical Information (OSTI)

GHG Information GHG Information This section provides various sources describing the energy consumption of the industrial sector and the carbon emissions in particular. Below is an estimate of the million metric tons of carbon dioxide emissions (MMTCO2) based upon the Annual Energy Outlook 2007. According to EIA "Annual Energy Outlook 2007" data, energy-related CO2 emissions projected for the Iron and Steel industry were 133.5 MMTCO2 in 2006. The AEO Supplementary Tables were generated for the reference case of the Annual Energy Outlook 2007 using the National Energy Modeling System, a computer-based model which produces annual projections of energy markets for 2005-2030. The AEO2007 reflects data and information available as of September 15, 2006. Source: Annual Energy Outlook 2007 (PDF 38.44 KB) with

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Climate VISION: Private Sector Initiatives: Iron and Steel: Resources and  

Office of Scientific and Technical Information (OSTI)

Resources & Links Resources & Links Software Tools Steel Industry of the Future Tools & Publications The Industrial Technologies Program offers a wide array of publications, videos, software, and other information products for improving energy efficiency in the iron and steel industry. DOE BestPractices Software Tools DOE BestPractices offers a range of software tools and databases that help manufacturers assess their plant's steam, compressed air, motor, and process heating systems. DOE Plant Energy Profiler Industry experience has shown that many plant utility personnel do not have an adequate understanding of their energy cost structure and where the major focus should be for any energy savings program. This tool will address this need and enable an engineer assigned to a plant utility to

462

City of Mountain Iron, Minnesota (Utility Company) | Open Energy  

Open Energy Info (EERE)

Minnesota (Utility Company) Minnesota (Utility Company) Jump to: navigation, search Name City of Mountain Iron Place Minnesota Utility Id 13044 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Rate Commercial Municipal Service Rate: No Demand meter Commercial Municipal Service Rate: With Demand meter Industrial Off-Peak Water Heating Commercial Power Service Rate Industrial Residential Service Rate Residential Average Rates Residential: $0.0948/kWh Commercial: $0.1180/kWh Industrial: $0.1300/kWh

463

The Superpower behind Iron Oxyfluoride Battery Electrodes | Advanced Photon  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Watching a Protein as it Functions Watching a Protein as it Functions Shedding Light on Chemistry with a Biological Twist Teasing Out the Nature of Structural Instabilities in Ceramic Compounds Doubling Estimates of Light Elements in the Earth's Core A New Material for Warm-White LEDs Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed The Superpower behind Iron Oxyfluoride Battery Electrodes APRIL 2, 2013 Bookmark and Share Structural changes probed using operando PDF analysis indicates a partitioning of a FeOF-based electrode into fluorine- and oxygen-rich phases with different reactivity for each component. Innovative materials chemistries continue to drive advances in lithium-ion

464

Iron acetylacetonate complex anchored on silica xerogel polymer  

Science Journals Connector (OSTI)

Iron(III) acetylacetonate complex immobilized on silica surface was obtained by the following three steps synthesis: (i) synthesis of organic precursor (acacsil) containing the acetylacetonate (acac) group; (ii) simultaneous polycondensation of the acacsil with the tetraethylorthosilicate (TEOS) by the sol–gel method resulting in the acac/silica xerogel; and (iii) complexation of the Fe(III) on the acac sites of the xerogel surface forming a Fe-acac/silica xerogel. The xerogels, acac/silica and Fe-acac/silica, are hybrid polymers that present a covalent organic/inorganic interface between the acac groups and silica. Xerogels were characterized by using scanning electron microscopy, energy dispersive spectroscopy, infrared spectroscopy, N2 adsorption desorption isotherms (pore size distribution and surface area) and elemental analysis. The Fe-acac/silica xerogel was tested as heterogeneous catalyst for the cis-cyclooctene epoxidation, employing the same conditions of the homogeneous Mukaiyama system.

Marcia C. Brasil; Edilson V. Benvenutti; José R. Gregório; Annelise E. Gerbase

2005-01-01T23:59:59.000Z

465

Ferromagnetic resonance of sputtered yttrium iron garnet nanometer films  

SciTech Connect (OSTI)

Growth of nm-thick yttrium iron garnet (YIG) films by sputtering and ferromagnetic resonance (FMR) properties in the films were studied. The FMR linewidth of the YIG film decreased as the film thickness was increased from several nanometers to about 100?nm. For films with very smooth surfaces, the linewidth increased linearly with frequency. In contrast, for films with big grains on the surface, the linewidth-frequency response was strongly nonlinear. Films in the 7–26?nm thickness range showed a surface roughness between 0.1?nm and 0.4?nm, a 9.48-GHz FMR linewidth in the 6–10?Oe range, and a damping constant of about 0.001.

Liu, Tao [Department of Physics, Colorado State University, Fort Collins, Colorado 80523 (United States); State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Chang, Houchen; Sun, Yiyan; Kabatek, Michael; Wu, Mingzhong, E-mail: mwu@lamar.colostate.edu [Department of Physics, Colorado State University, Fort Collins, Colorado 80523 (United States); Vlaminck, Vincent; Hoffmann, Axel [Materials Science Division, Argonne National Laboratory, Argonne, Illinois 60439 (United States); Deng, Longjiang [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

2014-05-07T23:59:59.000Z

466

Energy and materials flows in the iron and steel industry  

SciTech Connect (OSTI)

Past energy-consumption trends and future energy-conservation opportunities are investigated for the nation's iron and steel industry. It is estimated that, in 1980, the industry directly consumed approximately 2.46 x 10/sup 15/ Btu of energy (roughly 3% of total US energy consumption) to produce 111 million tons of raw steel and to ship 84 million tons of steel products. Direct plus indirect consumption is estimated to be about 3.1 x 10/sup 15/ Btu. Of the set of conservation technologies identified, most are judged to be ready for commercialization if and when the industry's capital formation and profitability problems are solved and the gradual predicted increase in energy prices reduces the payback periods to acceptable levels.

Sparrow, F.T.

1983-06-01T23:59:59.000Z

467

Effect of benzotriazole on the hydrogen absorption by iron  

SciTech Connect (OSTI)

The results presented show that benzotriazole (BTA) inhibits the absorption of hydrogen into iron which is cathodically polarized in an acid (pH {approx_equal} 1.7) sulfate solution. Analysis of the results indicates that BTA inhibits also the hydrogen evolution reaction, although it does not change its mechanism, which is shown to be proton discharge-Tafel recombination. However, BTA shifts the position of the equilibrium, H{sub ads} {r_equilibrium} H{sub abs}, toward the left side and hence leads to a decrease in the concentration of H{sub abs} within the lattice. The extent of this decrease depends on the BTA concentration, e.g., about fivefold at 1 mM and tenfold at 10 mM BTA. This effect is opposite to that reported for inhibitors such as thiourea which inhibits the hydrogen evolution reaction and yet promotes hydrogen permeation.

Abd Elhamid, M.H.; Pickering, H.W. [Pennsylvania State Univ., University Park, PA (United States). Dept. of Materials Science and Engineering; Ateya, B.G. [Cairo Univ. (Egypt)

1997-04-01T23:59:59.000Z

468

Arsenic remediation of drinking water using iron-oxide coated coal bottom ash  

SciTech Connect (OSTI)

We describe laboratory and field results of a novel arsenic removal adsorbent called 'Arsenic Removal Using Bottom Ash' (ARUBA). ARUBA is prepared by coating particles of coal bottom ash, a waste material from coal fired power plants, with iron (hydr)oxide. The coating process is simple and conducted at room temperature and atmospheric pressure. Material costs for ARUBA are estimated to be low (~;;$0.08 per kg) and arsenic remediation with ARUBA has the potential to be affordable to resource-constrained communities. ARUBA is used for removing arsenic via a dispersal-and-removal process, and we envision that ARUBA would be used in community-scale water treatment centers. We show that ARUBA is able to reduce arsenic concentrations in contaminated Bangladesh groundwater to below the Bangladesh standard of 50 ppb. Using the Langmuir isotherm (R2 = 0.77) ARUBA's adsorption capacity in treating real groundwater is 2.6x10-6 mol/g (0.20 mg/g). Time-to-90percent (defined as the time interval for ARUBA to remove 90percent of the total amount of arsenic that is removed at equilibrium) is less than one hour. Reaction rates (pseudo-second-order kinetic model, R2>_ 0.99) increase from 2.4x105 to 7.2x105 g mol-1 min-1 as the groundwater arsenic concentration decreases from 560 to 170 ppb. We show that ARUBA's arsenic adsorption density (AAD), defined as the milligrams of arsenic removed at equilibrium per gram of ARUBA added, is linearly dependent on the initial arsenic concentration of the groundwater sample, for initial arsenic concentrations of up to 1600 ppb and an ARUBA dose of 4.0 g/L. This makes it easy to determine the amount of ARUBA required to treat a groundwater source when its arsenic concentration is known and less than 1600 ppb. Storing contaminated groundwater for two to three days before treatment is seen to significantly increase ARUBA's AAD. ARUBA can be separated from treated water by coagulation and clarification, which is expected to be less expensive than filtration of micron-scale particles, further contributing to the affordability of a community-scale water treatment center.

MATHIEU, JOHANNA L.; GADGIL, ASHOK J.; ADDY, SUSAN E.A.; KOWOLIK, KRISTIN

2010-06-01T23:59:59.000Z

469

A Comparison of Iron and Steel Production Energy Use and Energy Intensity  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A Comparison of Iron and Steel Production Energy Use and Energy Intensity A Comparison of Iron and Steel Production Energy Use and Energy Intensity in China and the U.S. Title A Comparison of Iron and Steel Production Energy Use and Energy Intensity in China and the U.S. Publication Type Report Year of Publication 2011 Authors Hasanbeigi, Ali, Lynn K. Price, Nathaniel T. Aden, Zhang Chunxia, Li Xiuping, and Shangguan Fangqin Date Published June/2011 Publisher Lawrence Berkeley National Laboratory; Iron & Steel Research Institute, Iron and Steel Industry Keywords energy intensity, energy use, Low Emission & Efficient Industry Abstract Production of iron and steel is an energy-intensive manufacturing process. In 2006, the iron and steel industry accounted for 13.6% and 1.4% of primary energy consumption in China and the U.S., respectively (U.S. DOE/EIA, 2010a; Zhang et al., 2010). The energy efficiency of steel production has a direct impact on overall energy consumption and related carbon dioxide (CO2) emissions. The goal of this study is to develop a methodology for making an accurate comparison of the energy intensity (energy use per unit of steelproduced) of steel production. The methodology is applied to the steel industry in China and the U.S. The methodology addresses issues related to boundary definitions, conversion factors, and indicators in order industry energy use to develop a common framework for comparing steel intensity energy use.

470

Machinability of clean thin-wall gray and ductile iron castings. Final report  

SciTech Connect (OSTI)

First phase was to develop a laboratory technique for evaluating the machinability of gray and ductile iron; longer term goal is to learn how to modify the foundry process to produce castings meeting all specified mechanical properties while providing improved machining behavior. Microcarbides present in the irons were found to dominate the machinability of iron. Pearlitic irons with acceptable machinability contain 8.9 to 10.5 wt% microcarbides. The weight fraction microcarbides in the iron is influenced by carbide forming element concentrations, presence of elements that retard carbon diffusion, and cooling rate from the eutectic through the eutectoid temperature range. Tool wear rate increased at higher surface machining speeds and fraction microcarbides; all irons containing above 11.5% microcarbides had poor machinability. Graphite size, shape, distribution, etc. had a lesser effect on machinability. Reducing the addition of a foundry grade Ca and Al bearing 75% FeSi inoculant from 0.5 to 0.2% increased the tool life 100%. Inoculation test castings were also poured in a class 40 gray iron; laboratory analysis is currently underway. Exploratory studies were conducted to determine if tool force could be used to predict tool life: torque and feed forces were found to correlate with machinability.

Bates, C.E.; Littleton, H.E.; Eleftheriou, E.; Griffin, R.D.; Dwyer, Z.B.; DelSorbo, C.; Sprague, J.

1997-02-01T23:59:59.000Z

471

Cancer-fighting treatment gets boost from Isotope Production Facility  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Cancer-fighting treatment gets boost from Isotope Production Cancer-fighting treatment gets boost from Isotope Production Facility Cancer-fighting treatment gets boost from Isotope Production Facility New capability expands existing program, creates treatment product in quantity. April 13, 2012 Medical Isotope Work Moves Cancer Treatment Agent Forward Medical Isotope Work Moves Cancer Treatment Agent Forward - Los Alamos scientist Meiring Nortier holds a thorium foil test target for the proof-of-concept production experiments. Research indicates that it will be possible to match current annual, worldwide production of Ac-225 in just two to five days of operations using the accelerator at Los Alamos and analogous facilities at Brookhaven. Alpha particles are energetic enough to destroy cancer cells but are unlikely to move beyond a tightly controlled target region and destroy

472

Biophysical Investigation of the 'Ironome' of Jurkat Cells and Saccharomyces cerevisiae  

E-Print Network [OSTI]

The speciation of iron in intact Jurkat cells and their isolated mitochondria was assessed using biophysical methods. [Fe4S4]^(2+) clusters, low-spin (LS) Fe^(II) heme centers, non-heme high-spin (NHHS) FeII species, ferritin-like material and Fe...

Jhurry, Nema

2013-08-30T23:59:59.000Z

473

Characterization of iron oxide thin films for photoelectrochemical hydrogen production.  

E-Print Network [OSTI]

??Solar energy is the most sustainable source of energy available. However, solar applications such as photovoltaic cells represent only a partial solution to weaning our… (more)

George, Kyle Eustace Nelson

2009-01-01T23:59:59.000Z

474

Computational study: Reduction of iron corrosion in lead coolant of fast nuclear reactor  

SciTech Connect (OSTI)

In this paper we report molecular dynamics simulation results of iron (cladding) corrosion in interaction with lead coolant of fast nuclear reactor. The goal of this work is to study effect of oxygen injection to the coolant to reduce iron corrosion. By evaluating diffusion coefficients, radial distribution functions, mean-square displacement curves and observation of crystal structure of iron before and after oxygen injection, we concluded that a significant reduction of corrosion can be achieved by issuing about 2% of oxygen atoms into lead coolant.

Arkundato, Artoto; Su'ud, Zaki; Abdullah, Mikrajuddin; Widayani [Physics Department, ITB, Bandung (Indonesia) and Physics Department, University of Jember, Jl. Kalimantan III/25, Jember (Indonesia); Physics Department, ITB Jl. Ganesha 10, Bandung (Indonesia)

2012-06-20T23:59:59.000Z

475

Decaking of coal or oil shale during pyrolysis in the presence of iron oxides  

DOE Patents [OSTI]

A method for producing a fuel from the pyrolysis of coal or oil shale in the presence of iron oxide in an inert gas atmosphere is described. The method includes the steps of pulverizing feed coal or oil shale, pulverizing iron oxide, mixing the pulverized feed and iron oxide, and heating the mixture in a gas atmosphere which is substantially inert to the mixture so as to form a product fuel, which may be gaseous, liquid and/or solid. The method of the invention reduces the swelling of coals, such as bituminous coal and the like, which are otherwise known to swell during pyrolysis. 4 figs., 8 tabs.

Rashid Khan, M.

1988-05-05T23:59:59.000Z

476

Decaking of coal or oil shale during pyrolysis in the presence of iron oxides  

DOE Patents [OSTI]

A method for producing a fuel from the pyrolysis of coal or oil shale in the presence of iron oxide in an inert gas atmosphere. The method includes the steps of pulverizing feed coal or oil shale, pulverizing iron oxide, mixing the pulverized feed and iron oxide, and heating the mixture in a gas atmosphere which is substantially inert to the mixture so as to form a product fuel, which may be gaseous, liquid and/or solid. The method of the invention reduces the swelling of coals, such as bituminous coal and the like, which are otherwise known to swell during pyrolysis.

Khan, M. Rashid (Morgantown, WV)

1989-01-01T23:59:59.000Z

477

PHASE II CALDERON PROCESS TO PRODUCE DIRECT REDUCED IRON RESEARCH AND DEVELOPMENT PROJECT  

SciTech Connect (OSTI)

This project was initially targeted to the making of coke for blast furnaces by using proprietary technology of Calderon in a phased approach, and Phase I was successfully completed. The project was then re-directed to the making of iron units. U.S. Steel teamed up with Calderon for a joint effort which will last 30 months to produce directly reduced iron with the potential of converting it into molten iron or steel consistent with the Roadmap recommendations of 1998 prepared by the Steel Industry in cooperation with the Department of Energy.

Albert Calderon

2003-04-28T23:59:59.000Z

478

Watermelon-like iron nanoparticles: Cr doping effect on magnetism and magnetization interaction reversal  

SciTech Connect (OSTI)

Chromium (Cr) forms a solid solution with iron (Fe) lattice when doped in core-shell iron -iron oxide nanocluster (NC) and shows a mixed phase of sigma (?) FeCr and bcc Fe. The Cr dopant affects heavily the magnetization and magnetic reversal process, and causes the hysteresis loop to shrink near the zero field axis. Dramatic transformation happens from dipolar interaction (0 at. % Cr) to strong exchange interaction (8 at. % of Cr) is confirmed from the Henkel plot and delta M plot, and is explained by a water-melon model of core-shell NC system.

Kaur, Maninder; Dai, Qilin; Bowden, Mark E.; Engelhard, Mark H.; Wu, Yaqiao; Tang, Jinke; Qiang, You

2013-06-26T23:59:59.000Z

479

Biophysical and Bioanalytical Analysis of the Iron-ome in Mitochondria Isolated from Saccharomyces cerevisiae  

E-Print Network [OSTI]

dinucleotide ISC Iron sulfur cluster BPS Bathophenanthroline disulfonic acid EXAFS Extended X-ray absorption fine structure CIA Cytosolic iron sulfur cluster assembly machinery ISC Iron sulfur cluster ER Endoplasmic reticulum OD600 Optical density... assembly (CIA) 20 Figure 1-4. Mitochondrial Fe metabolism. Fe is imported and chelated by Yfh1p which delivers Fe to Isu1/2p for Fe/S cluster biosynthesis. It may also deliver Fe to either Hem15p for heme biosynthesis, but this is still...

Garber Morales, Jessica H.

2011-08-08T23:59:59.000Z

480

Nuclear inelastic scattering spectroscopy of tris(acetylacetonate)iron(III); A vibrational probe via the iron atom  

Science Journals Connector (OSTI)

We report application of nuclear inelastic scattering (NIS) spectroscopy to the compound tris(acetylacetonate)iron(III), [Fe(III)(acac)3] enriched in 57Fe. Experimental results are compared with the simulated spectrum based on the normal mode analysis of the isolated [57Fe(III)(acac)3] molecule using DFT calculations. Good agreement between the peak positions and intensities of the simulated and experimental spectra enables complete and reliable assignment of the Fe-selective vibrational modes. It is concluded that in the solid state E modes are enhanced by coupling with the lattice modes. Additionally, infrared and Raman spectra of [Fe(III)(acac)3] are calculated from DFT and compared with experiment thus demonstrating the complementarity of these three vibrational spectroscopic techniques.

Upali A. Jayasooriya; Jamie N.T. Peck; J. Elaine Barclay; Sinead M. Hardy; Aleksandr I. Chumakov; David J. Evans; Christopher J. Pickett; Vasily S. Oganesyan

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "iron treatment cells" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Summary of INEL research on the iron-enriched basalt waste form  

SciTech Connect (OSTI)

This report summarizes the knowledge base on the iron-enriched basalt (IEB) waste form developed at the Idaho National Engineering Laboratory (INEL) during 1979--1982. The results presented discuss the applicability of IEB in converting retrieved transuranic (TRU) waste from INEL`s Radioactive Waste Management Complex (RWMC) into a vitreous/ceramic (glassy/rock) stable waste form suitable for permanent disposal in an appropriate repository, such as the Waste Isolation Pilot Plant (WIPP) in New Mexico. Borosilicate glass (BSG), the approved high-level waste form, appears unsuited for this application. Melting the average waste-soil mix from the RWMC produces the IEB composition and attempting to convert IEB to the BSG composition would require additions of substantial B{sub 2}0{sub 3}, Na, and SiO{sub 2} (glass frit). IEB requires processing temperatures of 1400 to 1600{degrees}C, depending upon the waste composition. Production of the IEB waste form, using Joule heated melters, has proved difficult in the past because of electrode and refractory corrosion problems associated with the high temperature melts. Higher temperature electric melters (arc and plasma) are available to produce this final waste form. Past research focused on extensive slag property measurements, waste form leachability tests, mechanical, composition, and microstructure evaluations, as well as a host of experiments to improve production of the waste form. Past INEL studies indicated that the IEB glass-ceramic is a material that will accommodate and stabilize a wide range of heterogeneous waste materials, including long lived radionuclides and scrap metals, while maintaining a superior level of chemical and physical performance characteristics. Controlled cooling of the molten IEB and subsequent heat treatment will produce a glass-ceramic waste form with superior leach resistance.

Reimann, G.A.; Grandy, J.D.; Eddy, T.L.; Anderson, G.L.

1992-01-01T23:59:59.000Z

482

Summary of INEL research on the iron-enriched basalt waste form  

SciTech Connect (OSTI)

This report summarizes the knowledge base on the iron-enriched basalt (IEB) waste form developed at the Idaho National Engineering Laboratory (INEL) during 1979--1982. The results presented discuss the applicability of IEB in converting retrieved transuranic (TRU) waste from INEL's Radioactive Waste Management Complex (RWMC) into a vitreous/ceramic (glassy/rock) stable waste form suitable for permanent disposal in an appropriate repository, such as the Waste Isolation Pilot Plant (WIPP) in New Mexico. Borosilicate glass (BSG), the approved high-level waste form, appears unsuited for this application. Melting the average waste-soil mix from the RWMC produces the IEB composition and attempting to convert IEB to the BSG composition would require additions of substantial B{sub 2}0{sub 3}, Na, and SiO{sub 2} (glass frit). IEB requires processing temperatures of 1400 to 1600{degrees}C, depending upon the waste composition. Production of the IEB waste form, using Joule heated melters, has proved difficult in the past because of electrode and refractory corrosion problems associated with the high temperature melts. Higher temperature electric melters (arc and plasma) are available to produce this final waste form. Past research focused on extensive slag property measurements, waste form leachability tests, mechanical, composition, and microstructure evaluations, as well as a host of experiments to improve production of the waste form. Past INEL studies indicated that the IEB glass-ceramic is a material that will accommodate and stabilize a wide range of heterogeneous waste materials, including long lived radionuclides and scrap metals, while maintaining a superior level of chemical and physical performance characteristics. Controlled cooling of the molten IEB and subsequent heat treatment will produce a glass-ceramic waste form with superior leach resistance.

Reimann, G.A.; Grandy, J.D.; Eddy, T.L.; Anderson, G.L.

1992-01-01T23:59:59.000Z

483

WASTEWATER TREATMENT OVER SAND COLUMNS  

E-Print Network [OSTI]

93/0096 WASTEWATER TREATMENT OVER SAND COLUMNS TREATMENT YIELDS, LOCALISATION OF THE BIOMASS Domestic wastewater treatment by infiltration-percolation is a process that becomming common in France, a greater depth for desinfection purposes. KEYWORDS Wastewater treatment, Infiltration-percolation. Sand

Paris-Sud XI, Université de

484

U-102: Cisco IronPort Encryption Appliance Input Validation Flaw Permits  

Broader source: Energy.gov (indexed) [DOE]

2: Cisco IronPort Encryption Appliance Input Validation Flaw 2: Cisco IronPort Encryption Appliance Input Validation Flaw Permits Cross-Site Scripting Attacks U-102: Cisco IronPort Encryption Appliance Input Validation Flaw Permits Cross-Site Scripting Attacks February 14, 2012 - 8:00am Addthis PROBLEM: A vulnerability was reported in Cisco IronPort Encryption Appliance. PLATFORM: Version(s): prior to 6.5.3 ABSTRACT: A remote user can conduct cross-site scripting reference LINKS: Vendor URL CVE-2012-0340 Security Tracker ID:1026669 IMPACT ASSESSMENT: Medium Discussion: The interface does not properly filter HTML code from user-supplied input before displaying the input. A remote user can create a specially crafted URL that, when loaded by a target user, will cause arbitrary scripting code to be executed by the target user's browser. The code will originate from