National Library of Energy BETA

Sample records for ips industrial power

  1. IPS- Industrial Power Systems | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavy ElectricalsFTLTechnology SrlWindHydrodynamic

  2. The Industrialization of Thermoelectric Power Generation Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Industrialization of Thermoelectric Power Generation Technology The Industrialization of Thermoelectric Power Generation Technology Presents module and system requirements for...

  3. Industrial Distributed Energy: Combined Heat & Power

    Office of Energy Efficiency and Renewable Energy (EERE)

    Information about the Department of Energy’s Industrial Technologies Program and its Combined Heat and Power program.

  4. Automating An Industrial Power Plant 

    E-Print Network [OSTI]

    Williams, D. R.; McCowen, R. R.

    1987-01-01

    ,OOO/year. The upgrading process began with a search for a design/ build contractor that could provide complete turn key capability, beginning with a site survey and ending with operator acceptanoe. The contractor was selected through. a group...ATING AN INDUSTRIAL POWER PLANT DAVID R. WILLIAMS, P.E. Energy Coordi?nator John Deere Component Works Waterloo, Iowa ABSTRACT The need for an upgrade of boiler and turbine controls in the 15 MW coal-fired cogeneration plant at the John Deere Component Works...

  5. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  6. Cogeneration: An Industrial Steam and Power Option 

    E-Print Network [OSTI]

    Orlando, J. A.; Stewart, M. M.; Roberts, J. R.

    1993-01-01

    , these internal use systems use the cogenerated power on-site to reduce power purchases. Ranging from a few hundred kilowatts to tens of megawatts, they are somewhat smaller than the Wholesale Power systems; system size is determined by the industrial plant...

  7. Otter Tail Power Company - Commercial & Industrial Energy Efficiency...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Rebate Program Otter Tail Power Company - Commercial & Industrial Energy Efficiency Rebate Program < Back Eligibility Commercial Industrial Agricultural Savings Category Geothermal...

  8. Cooling, Heating, and Power for Industry: A Market Assessment...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Industry: A Market Assessment, August 2003 Cooling, Heating, and Power for Industry: A Market Assessment, August 2003 Industrial applications of CHP have been around for decades,...

  9. ITP Industrial Distributed Energy: Combined Heat and Power: Effective...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ITP Industrial Distributed Energy: Combined Heat and Power: Effective Energy Solutions for a Sustainable Future ITP Industrial Distributed Energy: Combined Heat and Power:...

  10. ITP Industrial Distributed Energy: Combined Heat and Power -...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    ITP Industrial Distributed Energy: Combined Heat and Power - A Decade of Progress, A Vision for the Future ITP Industrial Distributed Energy: Combined Heat and Power - A Decade of...

  11. Electric Power Industry Needs for Grid-Scale Storage Applications...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Electric Power Industry Needs for Grid-Scale Storage Applications Electric Power Industry Needs for Grid-Scale Storage Applications Stationary energy storage technologies will...

  12. Guangdong Nuclear Power and New Energy Industrial Investment...

    Open Energy Info (EERE)

    Nuclear Power and New Energy Industrial Investment Fund Management Company Jump to: navigation, search Name: Guangdong Nuclear Power and New Energy Industrial Investment Fund...

  13. Carbon Constraints and the Electric Power Industry

    SciTech Connect (OSTI)

    2007-11-15

    The report is designed to provide a thorough understanding of the type of carbon constraints that are likely to be imposed, when they are likely to take effect, and how they will impact the electric power industry. The main objective of the report is to provide industry participants with the knowledge they need to plan for and react to a future in which carbon emissions are restricted. The main goal of the report is to ensure an understanding of the likely restrictions that will be placed on carbon emissions, the methods available for reducing their carbon emissions, and the impact that carbon reductions will have on the electric power industry. A secondary goal of the report is to provide information on key carbon programs and market participants to enable companies to begin participating in the international carbon marketplace. Topics covered in the report include: overview of what climate change and the Kyoto Protocol are; analysis of the impacts of climate change on the U.S. and domestic efforts to mandate carbon reductions; description of carbon reduction mechanisms and the types of carbon credits that can be created; evaluation of the benefits of carbon trading and the rules for participation under Kyoto; Description of the methods for reducing carbon emissions available to the U.S. electric power industry; analysis of the impact of carbon restrictions on the U.S. electric power industry in terms of both prices and revenues; evaluation of the impact of carbon restrictions on renewable energy; overview of the current state of the global carbon market including descriptions of the three major marketplaces; descriptions of the industry and government programs already underway to reduce carbon emissions in the U.S. electric power industry; and, profiles of the major international carbon exchanges and brokers.

  14. Power Plant and Industrial Fuel Use Act | Department of Energy

    Office of Environmental Management (EM)

    Power Plant and Industrial Fuel Use Act Power Plant and Industrial Fuel Use Act Self Certifications Title II of the Powerplant and Industrial Fuel Use Act of 1978 (FUA), as amended...

  15. Interruptible Power: An Economic Advantage to Industrial Users 

    E-Print Network [OSTI]

    Reynolds, S. D.; Gardner, J. R.

    1981-01-01

    successful method by leveling demands and lowering costly and difficult-to-supply system peaks. Such power, offered to industrial customers in the TVA area in conjunction with firm power, benefits industry through lower power costs and provides TVA greater...

  16. Challenges of Electric Power Industry Restructuring for Fuel Suppliers

    Reports and Publications (EIA)

    1998-01-01

    Provides an assessment of the changes in other energy industries that could occur as the result of restructuring in the electric power industry.

  17. Quality of Power in the Industrial Sector 

    E-Print Network [OSTI]

    Marchbanks, G. J.

    1987-01-01

    tortions, overvoltage, undervoltage, momentary interruptions and transients that are inherent in the utility distribution system. The industrial customer turns to the power supplier to provide technical support, monitoring and assistance to upgrade.... * There was a lack of acceptance of responsi bility between customer, equipment supplier and the electrical contractor. The custo mer was unable to find anyone willing to accept responsibility for the problem. The utility can act as a coordinator between...

  18. High Power UV LED Industrial Curing Systems

    SciTech Connect (OSTI)

    Karlicek, Robert, F., Jr; Sargent, Robert

    2012-05-14

    UV curing is a green technology that is largely underutilized because UV radiation sources like Hg Lamps are unreliable and difficult to use. High Power UV LEDs are now efficient enough to replace Hg Lamps, and offer significantly improved performance relative to Hg Lamps. In this study, a modular, scalable high power UV LED curing system was designed and tested, performing well in industrial coating evaluations. In order to achieve mechanical form factors similar to commercial Hg Lamp systems, a new patent pending design was employed enabling high irradiance at long working distances. While high power UV LEDs are currently only available at longer UVA wavelengths, rapid progress on UVC LEDs and the development of new formulations designed specifically for use with UV LED sources will converge to drive more rapid adoption of UV curing technology. An assessment of the environmental impact of replacing Hg Lamp systems with UV LED systems was performed. Since UV curing is used in only a small portion of the industrial printing, painting and coating markets, the ease of use of UV LED systems should increase the use of UV curing technology. Even a small penetration of the significant number of industrial applications still using oven curing and drying will lead to significant reductions in energy consumption and reductions in the emission of green house gases and solvent emissions.

  19. Multi-Project Baselines for Evaluation of Industrial Energy-Efficiency and Electric Power Projects

    E-Print Network [OSTI]

    2001-01-01

    industrial energy- efficiency and electric power projects.of Industrial Energy-Efficiency and Electric Power Projectsof Industrial Energy-Efficiency and Electric Power Projects

  20. Challenges of electric power industry restructuring for fuel suppliers

    SciTech Connect (OSTI)

    1998-09-01

    The purpose of this report is to provide an assessment of the changes in other energy industries that could occur as the result of restructuring in the electric power industry. This report is prepared for a wide audience, including Congress, Federal and State agencies, the electric power industry, and the general public. 28 figs., 25 tabs.

  1. Industrial Utility Webinar: Public Power Open Session

    SciTech Connect (OSTI)

    2010-02-10

    The Industrial Utility Webinars focus on providing utilities with information on how to develop sucessful energy efficeincy programs for industrial energy consumers.

  2. Industrial Utility Webinar: Combined Heat and Power

    SciTech Connect (OSTI)

    2010-06-09

    The Industrial Utility Webinars focus on providing utilities with information on how to develop sucessful energy efficeincy programs for industrial energy consumers.

  3. The electric power industry : deregulation and market structure

    E-Print Network [OSTI]

    Thomson, Robert George

    1995-01-01

    The US electricity industry currently consists of vertically integrated regional utilities welding monopolistic power over their own geographic markets under the supervision of state and federally appointed regulators. ...

  4. Industrial Energy Efficiency and Combined Heat and Power Fact Sheet

    SciTech Connect (OSTI)

    Industrial Energy Efficiency and Combined Heat and Power Working Group

    2012-07-16

    Provides an overview of the State and Local Energy Efficiency Action Network's (SEE Action) Industrial Energy Efficiency and Combined Heat and Power Working Group.

  5. Oklahoma Municipal Power Authority- Commercial and Industrial Energy Efficiency Program

    Broader source: Energy.gov [DOE]

    The Oklahoma Municipal Power Authority (OMPA) offers the Demand and Energy Efficiency Program (DEEP) to eligible commercial, industrial, and municipal government customers served by OMPA. This...

  6. Industrial Power Factor Analysis Guidebook. Electrotek Concepts...

    Office of Scientific and Technical Information (OSTI)

    low power factors, increased conductor and transformer losses, and lower voltages. Utilities must supply both active and reactive power and compensate for these losses. Power...

  7. Benchmarking Variable Cost Performance in an Industrial Power Plant 

    E-Print Network [OSTI]

    Kane, J. F.; Bailey, W. F.

    1998-01-01

    One of the most perplexing problems for industrial power plants committed to improving competitiveness is measuring variable cost performance over time. Because variable costs like fuel and electricity represent the overwhelming majority of power...

  8. Industrial Power Factor Analysis Guidebook. (Technical Report...

    Office of Scientific and Technical Information (OSTI)

    of reactive power in an electrical system. Reactive power represents wasted energy--electricity that does no useful work because the electrical current is out of phase with...

  9. POWER CHARACTERISTICS OF INDUSTRIAL AIR COMPRESSORS Chris Schmidt

    E-Print Network [OSTI]

    Kissock, Kelly

    POWER CHARACTERISTICS OF INDUSTRIAL AIR COMPRESSORS Chris Schmidt Graduate Assistant / Project of Mechanical and Aerospace Engineering University of Dayton Dayton, Ohio ABSTRACT The power draw to energy input, which we call the average operating efficiency, based on input power to the compressor

  10. The changing structure of the electric power industry: An update

    SciTech Connect (OSTI)

    1996-12-01

    The U. S. electric power industry today is on the road to restructuring a road heretofore uncharted. While parallels can be drawn from similar journeys taken by the airline industry, the telecommunications industry, and, most recently, the natural gas industry, the electric power industry has its own unique set of critical issues that must be resolved along the way. The transition will be from a structure based on a vertically integrated and regulated monopoly to one equipped to function successfully in a competitive market. The long-standing traditional structure of the electric power industry is the result of a complex web of events that have been unfolding for over 100 years. Some of these events had far-reaching and widely publicized effects. Other major events took the form of legislation. Still other events had effects that are less obvious in comparison (e.g., the appearance of technologies such as transformers and steam and gas turbines, the invention of home appliances, the man-made fission of uranium), and it is likely that their significance in the history of the industry has been obscured by the passage of time. Nevertheless, they, too, hold a place in the underpinnings of today`s electric industry structure. The purpose of this report, which is intended for both lay and technical readers, is twofold. First, it is a basic reference document that provides a comprehensive delineation of the electric power industry and its traditional structure, which has been based upon its monopoly status. Second, it describes the industry`s transition to a competitive environment by providing a descriptive analysis of the factors that have contributed to the interest in a competitive market, proposed legislative and regulatory actions, and the steps being taken by the various components of the industry to meet the challenges of adapting to and prevailing in a competitive environment.

  11. The Homopolar Generator as a Pulsed Industrial Power Supply 

    E-Print Network [OSTI]

    Weldon, J. M.; Weldon, W. F.

    1979-01-01

    power supply for numerous industrial applications such as large metal cross section pulsed resistance welding, pulsed billet heating for subsequent hot working processes, pulsed heating for localized forging processes, and magnetic metal forming. Each...

  12. Changing Structure of the Electric Power Industry: Selected Issues, 1998

    Reports and Publications (EIA)

    1998-01-01

    Provides an analytical assessment of the changes taking place in the electric power industry, including market structure, consumer choice, and ratesetting and transition costs. Also presents federal and state initiatives in promoting competition.

  13. The Industrial Power Plant Management System - An Engineering Approach 

    E-Print Network [OSTI]

    Aarnio, S. E.; Tarvainen, H. J.; Tinnis, V.

    1979-01-01

    Based on energy studies in over 70 plants in the forest products industry, experience has shown that, in addition to process improvements, the most important energy conservation measures in mill power departments are: - Load shedding and fuel...

  14. Could energy intensive industries be powered by carbonfree electricity?

    E-Print Network [OSTI]

    MacKay, David J.C.

    requirements. Keywords: power per unit area; wind; nuclear; bioenergy 1. Overview Industry accounts for roughly of countries in 2005, and on the horizontal axis their population densities.) So, I will focus on per

  15. ITP Industrial Distributed Energy: Powering Microturbines With...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    releasing heat that causes the combustion gas to expand. * The expanding gas powers the gas turbine that in turn operates the gen- erator; the generator then produces...

  16. Towards and industrial ecosystem for power MEMS

    E-Print Network [OSTI]

    Havel, Timothy Franklin

    2007-01-01

    This thesis is concerned with the commercial applications of MEMS (Micro-Electro-Mechanical Systems) manufacturing processes to advanced energy technologies. This field of engineering has come to be known as Power MEMS. ...

  17. Industrial Interruptible Power: An Economical Alternative 

    E-Print Network [OSTI]

    Reynolds, S. D.; Gardner, J. R.

    1984-01-01

    Prevailing utility cost forecasts project that long-term energy costs will rise in real terms. With the addition of capacity construction costs into electric utility rate bases, electric power costs for some utilities will rise sharply...

  18. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    options for combined heat and power in Canada. Office ofpolicies to promote combined heat and power in US industry.conversions, such as combined heat and power and coke ovens,

  19. 2014 Retail Power Marketers Sales- Industrial

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers THURSDAY, APRILCustomers (DataIndustrial

  20. The Solarex Solar Power Industrial Facility 

    E-Print Network [OSTI]

    Macomber, H. L.; Bumb, D. R.

    1984-01-01

    apply. In addition to appl ing tax ben fits to reduce system co ts, any excess nergy g n rat d by the sys em may be sold to u iIities if the system qual ifies as a nall production facility (1 ss than 80 MW) d it is suitably interCOtmected to the 10..., the PV g nerator produces an excess of power. Since this is a stand-alone systE!T1 without utility interface, such excess power must be dissipated in the PV array. This is ac~ plished by the array OC to OC converter detracking the array to a higher...

  1. Update on Energy Saving Opportunities in Industrial Electrical Power Systems 

    E-Print Network [OSTI]

    Frasure, J. W.; Fredericks, C. J.

    1986-01-01

    application of capacitors to improve plant power factors will raise voltage levels and reduce'line currents, yielding a reduction in system losses. Also, by reducing var demand, capacitors can reduce or eliminate utility power-factor or demand charges..., force the industrial power user to continuously update and evaluate available means of saving electrical energy. This paper provides a survey of one company's experience with several methods of energy conservation in electrical distribution systems...

  2. Power Generation and Power Use Decisions in an Industrial Process 

    E-Print Network [OSTI]

    Gilbert, J. S.; Niess, R. C.

    1987-01-01

    on how much power must be made, and has little effect on the fuel-charged-to-power cost. I.n fact, the heat rate on a high-efficiency turbine may be slightly higher than for a low-efficiency turbine, due to greater gear-box losses. The argument may... COMPOSITE E w c: ::::> to < c: w a. ::E w to- ENERGY (0) Figure 3 Hot and Cold Compostte Curves 399 T, T~ ENERGY (0) Figure 2 [Qu1valent Coo1\

  3. Power Quality/Harmonic Detection: Harmonic Control in Electric Power Systems for the Telecommunications Industry 

    E-Print Network [OSTI]

    Felkner, L. J.; Waggoner, R. M.

    1993-01-01

    The control of harmonics in power systems continues to be a major concern in the telecommunications industry. AC/DC telecommunication conversion equipment has rarely been thought of as playing a major role in the harmonic interaction problem. Yet...

  4. Tests of cosmic ray radiography for power industry applications

    E-Print Network [OSTI]

    Durham, J M; Morris, C L; Bacon, J; Fabritius, J; Fellows, S; Plaud-Ramos, K; Poulson, D; Renshaw, J

    2015-01-01

    In this report, we assess muon multiple scattering tomography as a non-destructive inspection technique in several typical areas of interest to the nuclear power industry, including monitoring concrete degradation, gate valve conditions, and pipe wall thickness. This work is motivated by the need for radiographic methods that do not require the licensing, training, and safety controls of x-rays, and by the need to be able to penetrate considerable overburden to examine internal details of components that are otherwise inaccessible, with minimum impact on industrial operations. In some scenarios, we find that muon tomography may be an attractive alternative to more typical measurements.

  5. Selling green power in California: Product, industry, and market trends

    SciTech Connect (OSTI)

    Wiser, R.H.; Pickle, S.J.

    1998-05-01

    As one of the first US stages to open its doors to retail electric competition, California offers an important opportunity to assess the effectiveness of green power marketing as a mechanism for supporting renewable energy. This report is an interim assessment of key green power product, industry, and market trends in California. The report identifies and analyzes: the potential size of the green power market in California; the companies participating in the green power market; the green power products being offered and their prices; the impact of the green market on renewable generators and the environment; and the influence of several public policies and non-governmental programs on the market for green power. Data used in this paper have been collected, in large part, from surveys and interviews with green power marketers that took place between December 1997 and April 1998. There remain legitimate concerns over the viability of green power marketing to support significant quantities of renewable energy and provide large environmental gains, and it is far too early to assess the overall strength of customer demand for renewable energy. A critical finding of this report is that, because of the high cost of acquiring and servicing residential customers and the low utility default service price, green power marketing affords new energy service providers one of the only viable entrees to California`s residential marketplace.

  6. The CAIR vacatur raises uncertainty in the power generation industry

    SciTech Connect (OSTI)

    Dan Weiss; John Kinsman

    2008-12-15

    On 11 July 2008, the U.S. Court of Appeals for the District of Columbia issued a unanimous decision vacating the entire Clean Air Interstate Rule (CAIR) and the associated federal implementation plan. The upset of this program to reduce power plant sulfur dioxide (SO{sub 2}) and nitrogen oxides (NOx) emissions in the eastern United States was a great surprise, creating operational and planning turmoil in the industry. 4 refs.

  7. Waste Heat-to-Power in Small Scale Industry Using Scroll Expander...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Waste Heat-to-Power in Small Scale Industry Using Scroll Expander for Organic Rankine Bottoming Cycle Waste Heat-to-Power in Small Scale Industry Using Scroll Expander for Organic...

  8. Global nuclear power supply chains and the rise of China's nuclear industry

    E-Print Network [OSTI]

    Metzler, Florian

    2012-01-01

    China has embarked on a massive expansion of nuclear power that may fundamentally change the global nuclear industry, for better or for worse. Some industry observers argue that the incumbent nuclear power companies are ...

  9. Waste Heat-to-Power in Small Scale Industry Using Scroll Expander...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Heat-to-Power in Small Scale Industry Using Scroll Expander for Organic Rankine Bottoming Cycle Waste Heat-to-Power in Small Scale Industry Using Scroll Expander for Organic...

  10. The Market and Technical Potential for Combined Heat and Power in the Industrial Sector, January 2000

    Office of Energy Efficiency and Renewable Energy (EERE)

    Report of an analysis of the market and technical potential for combined heat and power in the industrial sector

  11. Hollow-waveguide delivery systems for high-power, industrial CO2 lasers

    E-Print Network [OSTI]

    Hollow-waveguide delivery systems for high-power, industrial CO2 lasers Ricky K. Nubling and James to deliver CO2 laser power for industrial laser applications. The transmission, bending loss, and output, beam delivery, industrial lasers, power delivery, CO2 lasers. r 1996 Optical Society of America 1

  12. Diagnosing and Mitigating Market Power in Chile's Electricity Industry

    E-Print Network [OSTI]

    Arellano, M. Soledad

    2004-06-16

    , Santiago Chile. Email: sarellano@dii.uchile.cl 1 1 Introduction Chile reformed and restructured its power industry in the early 1980's. Competition among generators was promoted and a 'simulated' spot market was created. Prices in this market were not truly... to 29.577 GWh, 37% of which was hydro-reservoir generation, 38% thermal generation and 26% hydro- Run-of-River (ROR) generation. Maximum demand in the year 2000 amounted to 4576 MW (April). The generating sector is highly concentrated: 93% of total...

  13. Nongqishi Electric Power Industrial Corporation | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg, Oregon: EnergyNongqishi Electric Power Industrial Corporation

  14. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  15. Industrial Utility Webinar: Public Power Financial Incentive Programs

    SciTech Connect (OSTI)

    2010-05-14

    The Industrial Utility Webinars focus on providing utilities with information on how to develop sucessful energy efficeincy programs for industrial energy consumers.

  16. Modeling the determinants of industry political power: industry winners in the Economic Recovery Tax Act of 1981 

    E-Print Network [OSTI]

    Kardell, Amy Louise

    2004-09-30

    This study uses qualitative comparative analysis (QCA) to examine the basis of industry political power by assessing conditions of economic interdependence and political action associated with the passage of the Economic ...

  17. Cheyenne Light, Fuel and Power (Electric)- Commercial and Industrial Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Cheyenne Light, Fuel and Power offers incentives to commercial and industrial electric customers who wish to install energy efficient equipment and measures in eligible facilities. Incentives are...

  18. A test for market power exertion in the credit card industry with the dual solow residual 

    E-Print Network [OSTI]

    Meurisse, Mark P

    2003-01-01

    This thesis investigates the possibility of market power exertion in the credit card industry, an issue recently raised in the United States Department of Justice's investigation of Visa and MasterCard. Market power is examined using Roeger's (1995...

  19. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    Planta- tion Products and Paper Industry Council, Paper Industry, Confederationof European Paper Industries, Brussels, March 2001. CESP,

  20. INTRODUCTION The power industry is at the dawn of a new era

    E-Print Network [OSTI]

    Shihada, Basem

    clean and flexible power grid. NEW NETWORK REQUIREMENTS Integration of renewable energy sources, transmission, and distribution of power are reliably and securely provided, while the installed infrastructureINTRODUCTION The power industry is at the dawn of a new era of transformation, triggered

  1. HE ELECTRIC POWER INDUSTRY in the United States is facing a disquieting shortage

    E-Print Network [OSTI]

    , wholesale and retail electricity marketing, reactive power management, and other ancillary support systemsT HE ELECTRIC POWER INDUSTRY in the United States is facing a disquieting shortage of trained engineering personnel. For decades, things have gone downhill. The salaries paid to power engineers have been

  2. Industry

    SciTech Connect (OSTI)

    Bernstein, Lenny; Roy, Joyashree; Delhotal, K. Casey; Harnisch, Jochen; Matsuhashi, Ryuji; Price, Lynn; Tanaka, Kanako; Worrell, Ernst; Yamba, Francis; Fengqi, Zhou; de la Rue du Can, Stephane; Gielen, Dolf; Joosen, Suzanne; Konar, Manaswita; Matysek, Anna; Miner, Reid; Okazaki, Teruo; Sanders, Johan; Sheinbaum Parado, Claudia

    2007-12-01

    This chapter addresses past, ongoing, and short (to 2010) and medium-term (to 2030) future actions that can be taken to mitigate GHG emissions from the manufacturing and process industries. Globally, and in most countries, CO{sub 2} accounts for more than 90% of CO{sub 2}-eq GHG emissions from the industrial sector (Price et al., 2006; US EPA, 2006b). These CO{sub 2} emissions arise from three sources: (1) the use of fossil fuels for energy, either directly by industry for heat and power generation or indirectly in the generation of purchased electricity and steam; (2) non-energy uses of fossil fuels in chemical processing and metal smelting; and (3) non-fossil fuel sources, for example cement and lime manufacture. Industrial processes also emit other GHGs, e.g.: (1) Nitrous oxide (N{sub 2}O) is emitted as a byproduct of adipic acid, nitric acid and caprolactam production; (2) HFC-23 is emitted as a byproduct of HCFC-22 production, a refrigerant, and also used in fluoroplastics manufacture; (3) Perfluorocarbons (PFCs) are emitted as byproducts of aluminium smelting and in semiconductor manufacture; (4) Sulphur hexafluoride (SF{sub 6}) is emitted in the manufacture, use and, decommissioning of gas insulated electrical switchgear, during the production of flat screen panels and semiconductors, from magnesium die casting and other industrial applications; (5) Methane (CH{sub 4}) is emitted as a byproduct of some chemical processes; and (6) CH{sub 4} and N{sub 2}O can be emitted by food industry waste streams. Many GHG emission mitigation options have been developed for the industrial sector. They fall into three categories: operating procedures, sector-wide technologies and process-specific technologies. A sampling of these options is discussed in Sections 7.2-7.4. The short- and medium-term potential for and cost of all classes of options are discussed in Section 7.5, barriers to the application of these options are addressed in Section 7.6 and the implication of industrial mitigation for sustainable development is discussed in Section 7.7. Section 7.8 discusses the sector's vulnerability to climate change and options for adaptation. A number of policies have been designed either to encourage voluntary GHG emission reductions from the industrial sector or to mandate such reductions. Section 7.9 describes these policies and the experience gained to date. Co-benefits of reducing GHG emissions from the industrial sector are discussed in Section 7.10. Development of new technology is key to the cost-effective control of industrial GHG emissions. Section 7.11 discusses research, development, deployment and diffusion in the industrial sector and Section 7.12, the long-term (post-2030) technologies for GHG emissions reduction from the industrial sector. Section 7.13 summarizes gaps in knowledge.

  3. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    for the European Pulp and Paper Industry, Confederation ofin food and pulp and paper industry wastes, turbines tocement, and pulp and paper industries and in the control of

  4. The risk of reform : privatisation and liberalisation in the Brazilian electric power industry

    E-Print Network [OSTI]

    Tankha, Sunil, Ph. D. Massachusetts Institute of Technology

    2006-01-01

    In 1996, when Brazil was well-underway to privatising and liberalising its electric power industry, few would have predicted that within five years the reforms would be a shambles. Like its neighbors Argentina and Chile, ...

  5. Cheyenne Light, Fuel and Power (Gas)- Commercial and Industrial Efficiency Rebate Program

    Broader source: Energy.gov [DOE]

    Cheyenne Light, Fuel and Power (CLFP) offers incentives to commercial and industrial gas customers who install energy efficient equipment in existing buildings. Incentives are available for boilers...

  6. Changing Structure of the Electric Power Industry 2000: An Update, The

    Reports and Publications (EIA)

    2000-01-01

    Provides a comprehensive overview of the structure of the U.S. electric power industry over the past 10 years, with emphasis on the major changes that have occurred, their causes, and their effects.

  7. Changing Structure of Electric Power Industry 1999: Mergers and Other Corporate Combinations, The

    Reports and Publications (EIA)

    1999-01-01

    Presents data about corporate combinations involving investor-owned utilities in the United States, discusses corporate objectives for entering into such combinations, and assesses their cumulative effects on the structure of the electric power industry.

  8. Could energy intensive industries be powered by carbon-free electricity?

    E-Print Network [OSTI]

    MacKay, David J.C.

    requirements. Keywords: power per unit area; wind; nuclear; bioenergy 1. Overview Industry accounts for roughly of countries in 2005, and on the horizontal axis their population densities.) So, I will focus on per

  9. ITP Industrial Distributed Energy: Combined Heat and Power -...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Combined Heat and Power - A Decade of Progress, A Vision for the Future Overview of CHP, DOE's CHP program, accomplishments, progress, technology R&D, marketplace...

  10. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  11. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  12. Combined Heat & Power (CHP) -A Clean Energy Solution for Industry 

    E-Print Network [OSTI]

    Parks, H.; Hoffman, P.; Kurtovich, M.

    1999-01-01

    (CHP) - A Clean Energy Solution for Industry William Parks, Patricia Hoffman, and Martin Kurtovich U.S. Department of Energy System Laboratory From the late 1970's to the early 1990's cogeneration or CHP saw enormous growth, especially in the process...

  13. System Dynamics and the Electric Power Industry Andrew Forda

    E-Print Network [OSTI]

    Ford, Andrew

    by John Wiley & Sons, Ltd. Syst. Dyn. Rev. 13, 57­85, 1997 (No. of Figures: 9 No. of Tables: 4 No. of Refs historical developments that gave rise to a capital intensive, price regulated power sector in the United. System dynamics applications to electric power Table 1 lists 33 publications on the applications

  14. Diagnosing and mitigating market power in Chile's electricity industry

    E-Print Network [OSTI]

    Arellano, María Soledad

    2003-01-01

    This paper examines the incentives to exercise market power that generators would face and the different strategies that they would follow if all electricity supplies in Chile were traded in an hourly-unregulated spot ...

  15. Designing Optimal Heat and Power Systems for Industrial Processes 

    E-Print Network [OSTI]

    Rutkowski, M. A.; Witherell, W. D.

    1988-01-01

    . It must facilitate understanding the tradeoffs among the components of the heat and power system including steam generation, furnaces used for process heating, steam and gas turbines, heat exchange networks, heat pumps, refrigeration systems, and purchased...

  16. Optimum Heat Power Cycles for Process Industrial Plants 

    E-Print Network [OSTI]

    Waterland, A. F.

    1982-01-01

    Electric power cogeneration is compared with direct mechanical drives emphasizing the technical aspects having the greatest impact on energy economics. Both steam and gas turbine applications are discussed and practical methods of developing...

  17. Three essays on market power in Chile's electricity industry

    E-Print Network [OSTI]

    Arellano, María Soledad, 1971-

    2003-01-01

    This thesis examines the incentives to exercise market power that generators would face and the different strategies that they would follow if all electricity supplies in Chile were traded in an hourly-unregulated spot ...

  18. Regulatory risks paralyzing power industry while demand grows

    SciTech Connect (OSTI)

    Maize, K.; Peltier, R.

    2008-01-15

    2008 will be the year the US generation industry grapples with CO{sub 2} emission. Project developers are suddenly coal-shy, mostly flirting with new nuclear plants waiting impatiently in line for equipment manufacturers to catch up with the demand for wind turbines, and finding gas more attractive again. With no proven greenhouse gas sequestration technology on the horizon, utilities will be playing it safe with energy-efficiency ploys rather than rushing to contract for much-needed new generation.

  19. Understanding the Challenges in the Transition from Film Radiography in the Nuclear Power Industry

    SciTech Connect (OSTI)

    Meyer, Ryan M.; Ramuhalli, Pradeep; Moran, Traci L.; Nove, Carol A.; Pardini, Allan F.

    2012-09-01

    Nondestructive examination (NDE) applications in the nuclear power industry using film radiography are shrinking due to the advent of modern digital imaging technologies and advances in alternative inspection methods that do not present an ionizing radiation hazard. Technologies that are used routinely in the medical industry for patient diagnosis are being adapted to industrial NDE applications including the detection and characterization of defects in welds. From the user perspective, non-film inspection techniques provide several advantages over film techniques. It is anticipated that the shift away from the application of film radiography in the nuclear power industry represents an irreversible trend. The U.S. Nuclear Regulatory Commission (NRC) has noted this trend in the U.S. nuclear power industry and will be working to ensure that the effectiveness and reliability of component inspections is not compromised by this transition. Currently, specific concerns are associated with 1) obtaining a fundamental understanding of how inspection effectiveness and reliability may be impacted by this transition and 2) ensuring training standards and qualifications remain compatible with modern industrial radiographic practice. This paper discusses recent trends in industrial radiography and assesses their advantages and disadvantages from the perspective of nuclear power plant component inspections.

  20. The changing structure of the electric power industry: Selected issues, 1998

    SciTech Connect (OSTI)

    NONE

    1998-07-01

    More than 3,000 electric utilities in the United States provide electricity to sustain the Nation`s economic growth and promote the well-being of its inhabitants. At the end of 1996, the net generating capability of the electric power industry stood at more than 776,000 megawatts. Sales to ultimate consumers in 1996 exceeded 3.1 trillion kilowatthours at a total cost of more than $210 billion. In addition, the industry added over 9 million new customers during the period from 1990 through 1996. The above statistics provide an indication of the size of the electric power industry. Propelled by events of the recent past, the industry is currently in the midst of changing from a vertically integrated and regulated monopoly to a functionally unbundled industry with a competitive market for power generation. Advances in power generation technology, perceived inefficiencies in the industry, large variations in regional electricity prices, and the trend to competitive markets in other regulated industries have all contributed to the transition. Industry changes brought on by this movement are ongoing, and the industry will remain in a transitional state for the next few years or more. During the transition, many issues are being examined, evaluated, and debated. This report focuses on three of them: how wholesale and retail prices have changed since 1990; the power and ability of independent system operators (ISOs) to provide transmission services on a nondiscriminatory basis; and how issues that affect consumer choice, including stranded costs and the determination of retail prices, may be handled either by the US Congress or by State legislatures.

  1. A Multi-agent Approach to the Deregulation and Restructuring of Power Industry

    E-Print Network [OSTI]

    Poon, Ada

    the deregulation and privatization of their electric power industry [16, 29, 33]. Generation, transmission limitations of the transmission lines, and demand on days-ahead scheduling, the current trading mechanism and distribution of electricity had been considered as natural monopoly due to the economic scale [33]. New power

  2. Analysis of Industrial Microgrid Power Curves Based on the Theory of Stochastic Variables for

    E-Print Network [OSTI]

    Noé, Reinhold

    Analysis of Industrial Microgrid Power Curves Based on the Theory of Stochastic Variables--Design and control of microgrids require a wide range of considerations and information. A main issue is the sizing, which help to assess power curves and to dimension components of microgrids. I. INTRODUCTION The energy

  3. Open-Source Software for Power Industry Research, Teaching, and Training

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    .S. wholesale power markets. About 50% of U.S. electric power generating capacity is now operating under some version of the WPMP market design. #12;5 Regions Adopting Versions of WPMP Design to Date http://www.ferc.gov/industries/electricSource Software (OSS) Website OSS for Electricity Market Research,OSS for Electricity Market Research, Teaching

  4. Performance Issues for a Changing Electric Power Industry

    Reports and Publications (EIA)

    1995-01-01

    Provides an overview of some of the factors affecting reliability within the electric bulk power system. Historical and projected data related to reliability issues are discussed on a national and regional basis. Current research on economic considerations associated with reliability levels is also reviewed.

  5. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    pp. IEA, 2006b: Industrial motor systems energy efficiency:industrial energy efficiency. Presented at Energy Efficiency in Motorenergy-efficient electric motors and motor-systems. These include: (1) industrial

  6. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    and waste management that take place within industrialpolicies Waste management policies can reduce industrialWaste management policies.56 7.10 Co-benefits of industrial

  7. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    R.R. ,et al. , 2004: Eco-industrial park initiatives in theCHP plant) form an eco-industrial park that serves as an ex-

  8. Customizable Fuel Processor Technology Benefits Fuel Cell Power Industry

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalent Bonding inCustomer-Comments Sign In About |

  9. Chongqing Lanxi Power Industry Co Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLCLtd Jump to:ChangingCNE JumpChippewa ValleyEnergyLanxi Power

  10. EDF Industrial Power Services (TX), LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower VenturesInformation9)askDouble Oak,DurraNRELECOsponsible Jump to:EDF

  11. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    cement and pulp and paper industries in China, and in thePulp and Paper Industry, Confederation of European Paper Industries, Brussels, March 2001. CESP, 2004: China’pulp and paper industries (GOI, 2005). There are 39.8 million SMEs in China,

  12. Ensure Continuous Power to Critical Industrial Processes with the New Superconducting Storage Device (SSD™) 

    E-Print Network [OSTI]

    Dewinkel, C. C.; Koeppe, P. F.

    1992-01-01

    is especially vulnerable to these momentary voltage disturbances. These short-term disturbances are costing U.S. industry millions of dollars a year in downtime, product loss and equipment damage. The Superconducting Storage Device (SSOTM) has been... of Electric Marketing at Wisconsin Power & Light Company. and Dr. Richard Lundy. Sl's ChicfTeehnical Officer who was fomlerly Associate Director of Femli National Laboratory. Dr. Lundy is 64 ESL-IE-92-04-11 Proceedings from the 14th National Industrial...

  13. Carbon Dioxide Capture Technology for the Coal-Powered Electricity Industry: A Systematic Prioritization of Research Needs

    E-Print Network [OSTI]

    Carbon Dioxide Capture Technology for the Coal-Powered Electricity Industry: A Systematic and Policy Program #12;- 2 - #12;Carbon Dioxide Capture Technology for the Coal-Powered Electricity Industry in Technology and Policy Abstract Coal is widely relied upon as a fuel for electric power generation

  14. Fitness for duty in the nuclear power industry

    SciTech Connect (OSTI)

    Durbin, N.; Moore, C.; Grant, T.; Fleming, T.; Hunt, P.; Martin, R.; Murphy, S.; Hauth, J.; Wilson, R.; Bittner, A.; Bramwell, A.; Macaulay, J.; Olson, J.; Terrill, E.; Toquam, J. )

    1991-09-01

    This report presents an overview of the NRC licensees' implementation of the FFD program during the first full year of the program's operation and provides new information on a variety of FFD technical issues. The purpose of this document is to contribute to appropriate changes to the rule, to the inspection process, and to other NRC activities. It describes the characteristics of licensee programs, discusses the results of NRC inspections, updates technical information covered in previous reports, and identifies lessons learned during the first year. Overall, the experience of the first full year of licensees' FFD program operations indicates that licensees have functioning fitness for duty programs devoted to the NRC rule's performance objectives of achieving drug-free workplaces in which nuclear power plant personnel are not impaired as they perform their duties. 96 refs., 14 tabs.

  15. The Use of Thorium within the Nuclear Power Industry - 13472

    SciTech Connect (OSTI)

    Miller, Keith [The UK's National Nuclear Laboratory, Chadwick House, Birchwood Park, Warrington WA3 6AE (United Kingdom)] [The UK's National Nuclear Laboratory, Chadwick House, Birchwood Park, Warrington WA3 6AE (United Kingdom)

    2013-07-01

    Thorium is 3 to 4 times more abundant than uranium and is widely distributed in nature as an easily exploitable resource in many countries. Unlike natural uranium, which contains ?0.7% fissile {sup 235}U isotope, natural thorium does not contain any fissile material and is made up of the fertile {sup 232}Th isotope only. Therefore thorium and thorium-based fuel as metal, oxide or carbide, has been utilized in combination with fissile {sup 235}U or {sup 239}Pu in nuclear research and power reactors for conversion to fissile {sup 233}U, thereby enlarging fissile material resources. During the pioneering years of nuclear energy, from the mid 1950's to mid 1970's, there was considerable interest worldwide to develop thorium fuels and fuel cycles in order to supplement uranium reserves. Thorium fuels and fuel cycles are particularly relevant to countries having large thorium deposits but very limited uranium reserves for their long term nuclear power programme. The feasibility of thorium utilization in high temperature gas cooled reactors (HTGR), light water reactors (LWR), pressurized heavy water reactors (PHWRs), liquid metal cooled fast breeder reactors (LMFBR) and molten salt breeder reactors (MSBR) were demonstrated. The initial enthusiasm for thorium fuels and fuel cycles was not sustained among the developing countries later, due to new discovery of uranium deposits and their improved availability. However, in recent times, the need for proliferation-resistance, longer fuel cycles, higher burnup, and improved waste form characteristics, reduction of plutonium inventories and in situ use of bred-in fissile material has led to renewed interest in thorium-based fuels and fuel cycles. (authors)

  16. Thermal Efficiency Optimization for Industrial Power Plants Under Load Fluctuations Using Fuzzy Logic 

    E-Print Network [OSTI]

    Steffenhagan, W.; de Sam Lazaro, A.

    1995-01-01

    to carry out the optimization. The results of this work will be published separately. 8. REFERENCES [1] Naccarino JR., Cheung RT., Briggs W., and Mayur N., Real-time monitoring, optimization and control of a hydroelectric generation complex. IEEE... OPTIMIZATION FOR INDUSTRIAL POWER PLANTS UNDER LOAD FLUCTUATIONS USING FUZZY LOGIC A. de Sam Lazaro and W. Steffenhagan, Department of Mechanical Engineering St Martin's College, Lacey WA 98503 1. INTRODUCTION The automation of the control to a power...

  17. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    specified in the ‘Energy Technology List’ during the yearenergy consumers in the chemical industry, and list examples of technology

  18. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    disposal routes, several countries have set incen- tives to promote the use of various wastes in industrial processes in direct

  19. An Empirical Analysis of the Potential for Market Power in California's Electricity Industry

    E-Print Network [OSTI]

    California at Berkeley. University of

    PWP-044r An Empirical Analysis of the Potential for Market Power in California's Electricity's Electricity Industry Severin Borenstein and James Bushnell University of California Energy Institute 2539 the California electricity market after deregulation as a static Cournot market with a competitive fringe. Our

  20. Artificial Neural Networks In Electric Power Industry Technical Report of the ISIS Group

    E-Print Network [OSTI]

    Antsaklis, Panos

    Artificial Neural Networks In Electric Power Industry Technical Report of the ISIS Group at the University of Notre Dame ISIS-94-007 April, 1994 Rafael E. Bourguet and Panos J. Antsaklis Department," Technical Report of the ISIS (Interdisciplinary Studies of Intelligent Systems) Group, No. ISIS-94-007, Univ

  1. Submitted to IEEE Transactions on Power Systems, Nov. 2007 1 Abstract--A key need facing the electric power industry is the

    E-Print Network [OSTI]

    the electric power industry is the ongoing requirement to develop its future workforce. While university of possible careers in the power industry. Many also lose interest in math and science during their high school and even middle school years. This paper presents lesson plans and associated applets designed

  2. Efficiency, equity and the environment: Institutional challenges in the restructuring of the electric power industry

    SciTech Connect (OSTI)

    Haeri, M.H.

    1998-07-01

    In the electric power industry, fundamental changes are underway in Europe, America, Australia, New Zealand and, more recently, in Asia. Rooted in increased deregulation and competition, these changes are likely to radically alter the structure of the industry. Liberalization of electric power markets in the United Kingdom is, for the most part, complete. The generation market in the United States began opening to competition following the 1987 Public Utility Regulatory Policies Act (PURPA). The Energy Policy Act of 1992 set the stage for a much more dramatic change in the industry. The most far-reaching provision of the Act was its electricity title, which opened access to the electric transmission grid. With legal barriers now removed, the traditionally sheltered US electric utility market is becoming increasingly open to entry and competition. A number of important legislative, regulatory and governmental policy initiatives are underway in the Philippines that will have a profound effect on the electric power industry. In Thailand, the National Energy Planning Organization (NEPO) has undertaken a thorough investigation of industry restructuring. This paper summarizes recent international developments in the deregulation and liberalization of electricity markets in the U.K., U.S., Australia, and New Zealand. It focuses on the relevance of these experiences to development underway in the Philippines and Thailand, and presents alternative possible structures likely to emerge in these countries, drawing heavily on the authors' recent experiences in Thailand and the Philippines. The impact of these changes on the business environment for power generation and marketing will be discussed in detail, as will the opportunities these changes create for investment among private power producers.

  3. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    of its electricity requirements in the USA (US DOE, 2002)USA, where motor-driven systems account for 63% of industrial electricity

  4. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    increased use of biomass and energy efficiency improvements,Moreira, J. , 2006: Global biomass energy potential. Journal1971–2004 Notes 1) Biomass energy included 2) Industrial

  5. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    of Industrial Electrical Switchgear and Control Gear in the6 from use in electrical switchgear and magnesium processinggas insulated electrical switchgear, during the production

  6. Coal fly ash: the most powerful tool for sustainability of the concrete industry

    SciTech Connect (OSTI)

    Mehta, P.K.

    2008-07-01

    In the last 15 years the global cement industry has almost doubled its annual rate of direct emissions of carbon dioxide. These can be cut back by reducing global concrete consumption, reducing the volume of cement paste in mixtures and reducing the proportion of portland clinker in cement. It has recently been proved that use of high volumes of coal fly ash can produce low cost, durable, sustainable cement and concrete mixtures that would reduce the carbon footprint of both the cement and the power generation industries. 2 photos.

  7. Transmission Matters Now: How Will Power Market Regulations Impact the Industrial's Power Supply Costs and Reliability? 

    E-Print Network [OSTI]

    James, F.; Beidas, H.; Fox, R.

    2003-01-01

    The standardization of the power market structure and transmission access rules will result in new rules for dealing with the transmission systems. Furthermore, transmission system limitations and market inadequacies will have a significant impact...

  8. Japanese power electronics inverter technology and its impact on the American air conditioning industry

    SciTech Connect (OSTI)

    Ushimaru, Kenji.

    1990-08-01

    Since 1983, technological advances and market growth of inverter- driven variable-speed heat pumps in Japan have been dramatic. The high level of market penetration was promoted by a combination of political, economic, and trade policies in Japan. A unique environment was created in which the leading domestic industries-- microprocessor manufacturing, compressors for air conditioning and refrigerators, and power electronic devices--were able to direct the development and market success of inverter-driven heat pumps. As a result, leading US variable-speed heat pump manufacturers should expect a challenge from the Japanese producers of power devices and microprocessors. Because of the vertically-integrated production structure in Japan, in contrast to the out-sourcing culture of the United States, price competition at the component level (such as inverters, sensors, and controls) may impact the structure of the industry more severely than final product sales. 54 refs., 47 figs., 1 tab.

  9. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  10. Engineering Predictions in Industrial and Power Flows Using the Retrograde Condensation Curve. Part I-Methodology

    E-Print Network [OSTI]

    Labinov, Mark S

    2014-01-01

    Industrial and power systems rely on engineering predictions of the flow properties of working fluids. The paper proposes a way of the utilization of the vapor quality values along the new retrograde condensation curve in the generation of the void fraction design guidelines and reliable prediction of the saturated liquid specific volumes/densities. The new procedure eliminates the involvement of semi-empirical relationships like rectilinear diameter and other similar models.

  11. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    iron and steel production. IEA Greenhouse Gas R&D Programme,tempera- ture range. IEA/Caddet, Sittard, The Netherlands.industry. Cheltenham, UK, IEA Greenhouse Gas R&D Programme,

  12. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    developing countries, like India, adoption of efficient electricitydeveloping countries the sugar in- dustry uses bagasse and the edible oils industry uses byproduct wastes to generate steam and/or electricity (

  13. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    of pulverized coal, increased heat and energy recovery andFuel Switching Coal to natural gas and oil Power Recovery

  14. Prospects of development of the power industry in the zone of influence of the transcontinental railroad

    SciTech Connect (OSTI)

    Fel`dman, B.N.; Luk`yanov, V.A.

    1994-02-01

    The authors examine the possibilities of developing a power industry in the zone of influence of the transcontinental railroad (TCR). Two aspects of development are studied in particular: (1) the electric power supply for construction and subsequently for the operating railroad in coordination with simultaneous provision for the needs of adjacent regions; (2) the construction of a transcontinental transmission line with the use of a tunnel and railroad for its construction and with the creation of a unified transport--power corridor. Of great interest are the possibilities of constructing hydrostations in regions of the Sakha Republic (Yakutia), Chukchi Peninsula, and in the southern part of the Magadan region. The route of the proposed main line is located in the zone of influence of a number of prospective hydropower installations. 2 tabs.

  15. Industry

    E-Print Network [OSTI]

    Bernstein, Lenny

    2008-01-01

    Eidt, B. , 2004: Cogeneration opportunities - Global EnergyP.R.K. , 2003: Sugar cogeneration for power challenges andnewsletter in sugar and cogeneration. STAPPA/ALAPCO, 1999:

  16. Abstract--Since the renewable energy is popularly applied in power industry, especially the smart grid is fast developing all

    E-Print Network [OSTI]

    Chen, Zhe

    , the wind farm electrical systems present some unique challenges for protection, monitoring and control energy management, smart metering and distribution automation [1]. This paper reviews the significance1 Abstract-- Since the renewable energy is popularly applied in power industry, especially

  17. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  18. Fuelwood procurement for an industrial power plant: a case study of Dow Corning's program

    SciTech Connect (OSTI)

    Folger, A.G.; Sworden, P.G.; Bond, C.T.

    1984-08-01

    Dow Corning Corporation has developed effective procedures for meeting the fuelwood requirements of a 22.4 megawatt steam and electricity cogenerating power plant. The fuelwood procurement program of Dow Corning's Natural Resources Department involves special arrangements with private landowners, logging and hauling producers, and waste wood suppliers. The program's success is attributable to a favorable location, adequate allowance for advance planning, effective public relations, and flexible management. The program is significant because it demonstrates that industrial fuelwood requirements can be met and that improved production from nonindustrial private forests can be relied upon as a major source of fuelwood. 7 references, 7 figures.

  19. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  20. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  1. The structural design of air and gas ducts for power stations and industrial boiler applications

    SciTech Connect (OSTI)

    Schneider, R.L.

    1996-10-01

    The purpose of this paper is to discuss the new American Society of Civil Engineers (ASCE) book entitled, The Structural Design of Air and Gas Ducts for Power Stations and Industrial Boiler Applications. This 312 page book was published by the ASCE in August of 1995. This ASCE publication was created to assist structural engineers in performing the structural analysis and design of air and flue-gas ducts. The structural behavior of steel ductwork can be difficult to understand for structural engineers inexperienced in ductwork analysis and design. Because of this needed expertise, the ASCE committee that created this document highly recommends that the structural analysis and design of ducts be performed by qualified structural engineers, not be technicians, designers or drafters. There is a history within the power industry of failures and major degradation of flue-gas ductwork. There are many reasons for these failures or degradation, but in many cases, the problems may have been voided by a better initial design. This book attempts to help the structural engineer with this task. This book is not intended to be used to size or configure ductwork for flow and pressure drop considerations. But it does recommend that the ductwork system arrangement consider the structural supports and the structural behavior of the duct system.

  2. Towards more power efficient IP lookup engines 

    E-Print Network [OSTI]

    Ahmad, Seraj

    2007-04-25

    on the routing table compaction using logic minimization techniques. The second stream focuses on routing table partitioning. This work proposes to bridge the gap by employing strategies to combine these two leading state of the art schemes. The existing...

  3. Abstract--Market based contracting introduces increased competition in the power industry, and creates a need for

    E-Print Network [OSTI]

    Berleant, Daniel

    Abstract--Market based contracting introduces increased competition in the power industry) of a bid, generation companies (GENCOs) must strive to use models better than their competitors. Such models should account for factors such as buyers' market power, market mechanisms, other competitors

  4. 352 IEEE TRANSACTIONS ON INDUSTRIAL INFORMATICS, VOL. 6, NO. 3, AUGUST 2010 An Efficient Threshold-Based Power Management

    E-Print Network [OSTI]

    Lu, Ying

    352 IEEE TRANSACTIONS ON INDUSTRIAL INFORMATICS, VOL. 6, NO. 3, AUGUST 2010 An Efficient Threshold-Based Power Management Mechanism for Heterogeneous Soft Real-Time Clusters Leping Wang and Ying Lu Abstract--With growing cost of electricity, the power manage- ment (PM) of server clusters has become an important

  5. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  6. Industrial

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THE SITE-218inper Thousand CubicCampaignPages

  7. Industrial

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THE SITE-218inper Thousand

  8. The NUCLARR databank: Human reliability and hardware failure data for the nuclear power industry

    SciTech Connect (OSTI)

    Reece, W.J.

    1993-05-01

    Under the sponsorship of the US Nuclear Regulatory Commission (NRC), the Nuclear Computerized Library for Assessing Reactor Reliability (NUCLARR) was developed to provide human reliability and hardware failure data to analysts in the nuclear power industry. This IBM-compatible databank is contained on a set of floppy diskettes which include data files and a menu-driven system for locating, reviewing, sorting, and retrieving the data. NUCLARR contains over 2500 individual data records, drawn from more, than 60 sources. The system is upgraded annually, to include additional human error and hardware component failure data and programming enhancements (i.e., increased user-friendliness). NUCLARR is available from the NRC through project staff at the INEL.

  9. Evolution of Westinghouse heavy-duty power generation and industrial combustion turbines

    SciTech Connect (OSTI)

    Scalzo, A.J.; Bannister, R.L.; DeCorso, M.; Howard, G.S.

    1996-04-01

    This paper reviews the evolution of heavy-duty power generation and industrial combustion turbines in the United States from a Westinghouse Electric Corporation perspective. Westinghouse combustion turbine genealogy began in March of 1943 when the first wholly American designed and manufactured jet engine went on test in Philadelphia, and continues today in Orlando, Florida, with the 230 MW, 501G combustion turbine. In this paper, advances in thermodynamics, materials, cooling, and unit size will be described. Many basic design features such as two-bearing rotor, cold-end drive, can-annular internal combustors, CURVIC{sup 2} clutched turbine disks, and tangential exhaust struts have endured successfully for over 40 years. Progress in turbine technology includes the clean coal technology and advanced turbine systems initiatives of the US Department of Energy.

  10. Waste Heat-to-Power in Small Scale Industry Using Scroll Expander...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    to recover waste heat that is exhausted in various manufacturing industries, including food processing. A large portion of unrecovered industrial waste heat is considered to be...

  11. Impacts from Deployment Barriers on the United States Wind Power Industry: Overview & Preliminary Findings (Presentation)

    SciTech Connect (OSTI)

    Lantz, E.; Tegen, S.; Hand, M.; Heimiller, D.

    2012-09-01

    Regardless of cost and performance some wind projects are unable to proceed to commissioning as a result of deployment barriers. Principal deployment barriers in the industry today include: wildlife, public acceptance, access to transmission, and radar. To date, methods for understanding these non-technical barriers have failed to accurately characterize the costs imposed by deployment barriers and the degree of impact to the industry. Analytical challenges include limited data and modeling capabilities. Changes in policy and regulation, among other factors, also add complexity to analysis of impacts from deployment barriers. This presentation details preliminary results from new NREL analysis focused on quantifying the impact of deployment barriers on the wind resource of the United States, the installed cost of wind projects, and the total electric power system cost of a 20% wind energy future. In terms of impacts to wind project costs and developable land, preliminary findings suggest that deployment barriers are secondary to market drivers such as demand. Nevertheless, impacts to wind project costs are on the order of $100/kW and a substantial share of the potentially developable windy land in the United States is indeed affected by deployment barriers.

  12. Electric power industry restructuring in Australia: Lessons from down-under. Occasional paper No. 20

    SciTech Connect (OSTI)

    Ray, D.

    1997-01-01

    Australia`s electric power industry (EPI) is undergoing major restructuring. This restructuring includes commercialization of state-owned electric organization through privatization and through corporatization into separate governmental business units; structural unbundling of generation, transmission, retailing, and distribution; and creation of a National Electricity Market (NEM) organized as a centralized, market-based trading pool for buying and selling electricity. The principal rationales for change in the EPI were the related needs of enhancing international competitiveness, improving productivity, and lowering electric rates. Reducing public debt through privatization also played an important role. Reforms in the EPI are part of the overall economic reform package that is being implemented in Australia. Enhancing efficiency in the economy through competition is a key objective of the reforms. As the need for reform was being discussed in the early 1990s, Australia`s previous prime minister, Paul Keating, observed that {open_quotes}the engine which drives efficiency is free and open competition.{close_quotes} The optimism about the economic benefits of the full package of reforms across the different sectors of the economy, including the electricity industry, is reflected in estimated benefits of a 5.5 percent annual increase in real gross domestic product and the creation of 30,000 more jobs. The largest source of the benefits (estimated at 25 percent of total benefits) was projected to come from reform of the electricity and gas sectors.

  13. Abstract--Wind energy is the fastest growing source of renewable energy in the power industry and it will continue to

    E-Print Network [OSTI]

    Tolbert, Leon M.

    1 Abstract--Wind energy is the fastest growing source of renewable energy in the power industry fault conditions. Index Terms--induction generators, wind power generation, fault tolerance. I of energy. Wind energy is the fastest growing source of renewable energy in the power industry

  14. Ultra-Efficient and Power Dense Electric Motors for U. S. Industry

    SciTech Connect (OSTI)

    Melfi, Michael J.; Schiferl, Richard F.; Umans, Stephen D.

    2013-03-12

    The primary purpose of this project was to combine the ease-of-installation and ease-of-use attributes of industrial induction motors with the low-loss and small size and weight advantages of PM motors to create an ultra-efficient, high power density industrial motor that can be started across-the-line or operated from a standard, Volts/Hertz drive without the need for a rotor position feedback device. PM motor products that are currently available are largely variable speed motors that require a special adjustable speed drive with rotor position feedback. The reduced size and weight helps to offset the magnet cost in order make these motors commercially viable. The scope of this project covers horsepower ratings from 20 ? 500. Prototypes were built and tested at ratings ranging from 30 to 250 HP. Since fans, pumps and compressors make up a large portion of industrial motor applications, the motor characteristics are tailored to those applications. Also, since there is extensive use of adjustable frequency inverters in these applications, there is the opportunity to design for an optimal pole number and operate at other than 60 Hz frequency when inverters are utilized. Designs with four and eight pole configurations were prototyped as part of this work. Four pole motors are the most commonly used configuration in induction motors today. The results of the prototype design, fabrication, and testing were quite successful. The 50 HP rating met all of the design goals including efficiency and power density. Tested values of motor losses at 50 HP were 30% lower than energy efficient induction motors and the motor weight is 35% lower than the energy efficient induction motor of the same rating. Further, when tested at the 30 HP rating that is normally built in this 286T frame size, the efficiency far exceeds the project design goals with 30 HP efficiency levels indicating a 55% reduction in loss compared to energy efficient motors with a motor weight that is a few percentage points lower than the energy efficient motor. This 30 HP rating full load efficiency corresponds to a 46% reduction in loss compared to a 30 HP NEMA Premium? efficient motor. The cost goals were to provide a two year or shorter efficiency-based payback of a price premium associated with the magnet cost in these motors. That goal is based on 24/7 operation with a cost of electricity of 10 cents per kW-hr. Similarly, the 250 HP prototype efficiency testing was quite successful. In this case, the efficiency was maximized with a slightly less aggressive reduction in active material. The measured full load efficiency of 97.6% represents in excess of a 50% loss reduction compared to the equivalent NEMA Premium Efficiency induction motor. The active material weight reduction was a respectable 14.5% figure. This larger rating demonstrated both the scalability of this technology and also the ability to flexibly trade off power density and efficiency. In terms of starting performance, the 30 ? 50 HP prototypes were very extensively tested. The demonstrated capability included the ability to successfully start a load with an inertia of 25 times the motor?s own inertia while accelerating against a load torque following a fan profile at the motor?s full nameplate power rating. This capability will provide very wide applicability of this motor technology. The 250 HP prototype was also tested for starting characteristics, though without a coupled inertia and load torque. As a result it was not definitively proven that the same 25 times the motor?s own inertia could be started and synchronized successfully at 250 HP. Finite element modeling implies that this load could be successfully started, but it has not yet been confirmed by a test.

  15. For a Worldwide Leading Industrial Automation Company, we are looking for: Electronics and Power Electronics Development Engineer

    E-Print Network [OSTI]

    Segatti, Antonio

    For a Worldwide Leading Industrial Automation Company, we are looking for: Electronics and Power Electronics Development Engineer in Barcelona In this position the candidate will join the Global Development with Software and System Test Engineers, with colleagues from Marketing, Sales and Production

  16. Power management as a system-level inhibitor of modularity in the mobile computer industry

    E-Print Network [OSTI]

    Weinstein, Samuel K. (Samuel Keith), 1974-

    2004-01-01

    Since the mid-90s, the computer industry has been very modular with respect to both product architecture and industry structure. The growing market size of mobile computers means that the challenges facing this segment are ...

  17. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  18. Effects of post-LOCA conditions on a protective coating (paint) for the Nuclear Power Industry

    SciTech Connect (OSTI)

    Loyola, V.M.; Womelsduff, J.E.

    1985-03-01

    When corrosion protection of steel cannot be achieved by galvanizing due to size, use, or other restrictions, the steel is frequently protected by the application of a suitable corrosion-inhibiting paint. A widely accepted corrosion inhibiting coating is one in which finely powdered zinc metal is dispersed in an organic polymer matrix and applied to steel as a paint. This system is often used with a non-zinc bearing topcoat for enhanced protection. We have studied the oxidation of zinc in a zinc-rich coating used in the nuclear power industry and have measured the rates of hydrogen generation from these coatings due to zinc oxidation at temperatures of up to 175/sup 0/C. The results suggest that the real-time rates of hydrogen generation are considerably higher than previously believed. A second concern involves the generation of debris or solid reaction products which could cause plugging or fouling of the recirculation pumps, spray nozzles, and/or heat exchangers. Coatings are observed to fail at post-LOCA conditions which are well within the limits predicted by Design Basis Accident analysis. The failures involve cracking and/or delamination of the topcoat and production of solid corrosion products involving the zinc-rich primer. 22 refs., 10 figs., 6 tabs.

  19. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  20. 1/30/2014 Charge Your Smartphone and Power Your Home with Micro-Windmills -IndustryTap http://www.industrytap.com/charge-smartphone-power-home-micro-windmills/17780 1/5

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    1/30/2014 Charge Your Smartphone and Power Your Home with Micro-Windmills - IndustryTap http://www.industrytap.com/charge-smartphone-power-home-micro-windmills/17780 1/5 7Like Tweet 4 1 Charge Your Smartphone and Power Your Home with Micro-Windmills By: David with Micro-Windmills - IndustryTap http://www.industrytap.com/charge-smartphone-power-home-micro-windmills

  1. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  2. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  3. Potential impacts of Title I nonattainment on the electric power industry: A Chicago case study (Phase 2)

    SciTech Connect (OSTI)

    Fernau, M.E.; Makofske, W.J.; South, D.W.

    1993-06-01

    This study uses version IV of the Urban Airshed Model (UAM-IV) to examine the potential impacts of Title I (nonattainment) and Title IV (acid rain) of the Clean Air Act Amendments of 1990 (CAAA) on the utility industry. The UAM is run for a grid that covers the Commonwealth Edison Power Pool and encompasses the greater Chicago area and surrounding rural areas. Meteorological conditions are selected from an ozone (O{sub 3}) episode on July 5 and 6, 1988.

  4. First waste-to-energy power station put into operation in Vietnam has successfully produced electricity from household and industrial waste as a

    E-Print Network [OSTI]

    Columbia University

    First waste-to-energy power station put into operation in Vietnam Vietnam has successfully produced electricity from household and industrial waste as a newly-generated power supply has come online of the first turbine of the waste-powered electricity plant has been successful. The plant can produce 14,400KW

  5. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  6. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  7. A position paper for a central procurement organization for the nuclear power industry

    SciTech Connect (OSTI)

    Hendricks, J.R.

    1996-06-01

    This paper integrates the results of numerous nuclear utility industry meetings with commercial business practices. The Central Procurement Organization (CPO) is designed to achieve an immediate 30%--50% reduction in total procurement, engineering qualification, warehousing, and distribution cost. Three (3) areas define a CPO success criteria: (1) Lean, credible, and cost-effective issues discussed include facility cost, operational cost, staff expertise, product priorities, warehousing, and distribution, (2) Common technical, commercial, and quality requirement issues discussed include current industry practices and proposed future methodologies, and (3) Financial survivability issues which are the most critical since the CPO must exist during changing internal and external utility environments.

  8. Biomass power and state renewable energy policies under electric industry restructuring

    E-Print Network [OSTI]

    Porter, Kevin; Wiser, Ryan

    2000-01-01

    POWER AND STATE RENEWABLE ENERGY POLICIES UNDER ELECTRICPROVISIONS IN STATE RENEWABLE ENERGY POLICIES Of the 17that have adopted renewable energy policy measures as part

  9. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  10. Opportunities and Challenges for Development of a Mature Concentrating Photovoltaic Power Industry (Revision)

    SciTech Connect (OSTI)

    Kurtz, S.

    2012-11-01

    This report summarizes the current status of the CPV industry and is updated from previous versions to include information from the last year. New information presented at the CPV-8 conference is included along with the addition of new companies that have announced their interest in CPV, and estimates of production volumes for 2011 and 2012.

  11. Open-Source Software for Power Industry Research, Teaching, and Training: A DC-OPF Illustration

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    ], over 50% of the generation capacity in the U.S. is now operating under this market design, and other power markets essentially forces electricity researchers to resort to computa- tional methods wholesale power markets are extraor- dinarily complex. In the U.S. these markets typically involve spot

  12. Solar Energy Technologies Program - Growing Solar Power Industry Brightens Job Market (Green Jobs)

    SciTech Connect (OSTI)

    2010-04-01

    U.S. solar power capacity is expanding rapidly as part of the national initiative to double renewable energy resources in three years. This growth is helping to generate many new, well-paid jobs in solar power for American workers.

  13. Methodological and Practical Considerations for DevelopingMultiproject Baselines for Electric Power and Cement Industry Projects inCentral America

    SciTech Connect (OSTI)

    Murtishaw, Scott; Sathaye, Jayant; Galitsky, Christina; Dorion,Kristel

    2004-09-02

    The Lawrence Berkeley National Laboratory (Berkeley Lab) andthe Center for Sustainable Development in the Americas (CSDA) conductedtechnical studies and organized two training workshops to developcapacity in Central America for the evaluation of climate changeprojects. This paper describes the results of two baseline case studiesconducted for these workshops, one for the power sector and one for thecement industry, that were devised to illustrate certain approaches tobaseline setting. Multiproject baseline emission rates (BERs) for themain Guatemalan electricity grid were calculated from 2001 data. Inrecent years, the Guatemalan power sector has experienced rapid growth;thus, a sufficient number of new plants have been built to estimateviable BERs. We found that BERs for baseload plants offsetting additionalbaseload capacity ranged from 0.702 kgCO2/kWh (using a weighted averagestringency) to 0.507 kgCO2/kWh (using a 10th percentile stringency),while the baseline for plants offsetting load-followingcapacity is lowerat 0.567 kgCO2/kWh. For power displaced from existing load-followingplants, the rate is higher, 0.735 kgCO2/kWh, as a result of the age ofsome plants used for meeting peak loads and the infrequency of their use.The approved consolidated methodology for the Clean Development Mechanismyields a single rate of 0.753 kgCO2/kWh. Due to the relatively smallnumber of cement plants in the region and the regional nature of thecement market, all of Central America was chosen as the geographicboundary for setting cement industry BERs. Unfortunately, actualoperations and output data were unobtainable for most of the plants inthe region, and many data were estimated. Cement industry BERs rangedfrom 205 kgCO2 to 225 kgCO2 per metric ton of cement.

  14. Maintenance approaches and practices in selected foreign nuclear power programs and other US industries: Review and lessons learned

    SciTech Connect (OSTI)

    Not Available

    1990-04-01

    The Commission published a Notice of Proposed Rule-making on Maintenance of Nuclear Power Plants on November 28, 1988, spelling out NRC's expectations in maintenance. In preparing the proposed rule, the NRC reviewed maintenance practices in other countries and considered maintenance approaches in other industries in this country. As a result of the review of maintenance practices, it was concluded that certain practices in the following areas have been found to contribute significantly to effective maintenance: (1) systems approach; (2) effectiveness monitoring; (3) technician qualifications and motivation; and (4) maintenance organization. 87 refs., 26 figs., 2 tabs.

  15. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  16. Industrial Plant Services Australia Pty Ltd IPS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. WaterInformationPlant Services Australia Pty

  17. Electric Power Interruption Cost Estimates for Individual Industries, Sectors, and U.S. Economy

    SciTech Connect (OSTI)

    Balducci, Patrick J.; Roop, Joseph M.; Schienbein, Lawrence A.; DeSteese, John G.; Weimar, Mark R.

    2002-02-27

    During the last 20 years, utilities and researchers have begun to understand the value in the collection and analysis of interruption cost data. The continued investigation of the monetary impact of power outages will facilitate the advancement of the analytical methods used to measure the costs and benefits from the perspective of the energy consumer. More in-depth analysis may be warranted because of the privatization and deregulation of power utilities, price instability in certain regions of the U.S. and the continued evolution of alternative auxiliary power systems.

  18. Modularity of the MIT Pebble Bed Reactor for use by the commercial power industry

    E-Print Network [OSTI]

    Hanlon-Hyssong, Jaime E

    2008-01-01

    The Modular Pebble Bed Reactor is a small high temperature helium cooled reactor that is being considered for both electric power and hydrogen production. Pebble bed reactors are being developed in South Africa, China and ...

  19. Safety culture in the nuclear power industry : attributes for regulatory assessment

    E-Print Network [OSTI]

    Alexander, Erin L

    2004-01-01

    Safety culture refers to the attitudes, behaviors, and conditions that affect safety performance and often arises in discussions following incidents at nuclear power plants. As it involves both operational and management ...

  20. FirstEnergy (MetEdison, Penelec, Penn Power)- Commercial and Industrial Energy Efficiency Program

    Broader source: Energy.gov [DOE]

    In order to help meet the goals established in Pennsylvania's Act 129, FirstEnergy's Pennsylvania companies (MetEdison, Penelec, and Penn Power) are providing energy efficiency incentives for a...

  1. Strategies to Address the Problem of Exiting Expertise in the Electric Power Industry

    E-Print Network [OSTI]

    Sciences, Symposium on Electric Power Systems Reliability, January 4-8, 2005, Kauai, Hawaii. #12;faculty 2005 IEEE. To be Published in the Proceedings of the Hawai'i International Conference on System

  2. Microsoft PowerPoint - DOE Paducah Site Tour Industry Day - 2012...

    Office of Environmental Management (EM)

    weapons until the mid-1960s when the plant began enriching uranium for use as commercial nuclear power reactor fuel. * Today, the plant is the nation's only gaseous diffusion...

  3. Oil to Coal Conversion of Power and Industrial Facilities in the Dominican Republic 

    E-Print Network [OSTI]

    Causilla, H.; Acosta, J. R.

    1982-01-01

    and economic feasibility of converting power plants and cement plants from oil to coal. The summary results and conclusions are presented and include coal conversion capital costs, cost savings, and program overall schedule. The intent of the authors...

  4. CHP Modeling as a Tool for Electric Power Utilities to Understand Major Industrial Customers 

    E-Print Network [OSTI]

    Kumana, J. D.; Alanis, F. J.; Swad, T.; Shah, J. V.

    1997-01-01

    in understanding the available options and appropriate strategy is to properly understand the customers’ thermal and electric energy needs, and the existing Combined Heat and Power (CHP) system. This paper outlines an approach for developing such models at low cost...

  5. The Web of science : power structure research of the American stem cell industry

    E-Print Network [OSTI]

    Wang, Lisheng, 1977-

    2004-01-01

    This thesis reviews the developments in the research of business power and social structure, particularly focusing on the phenomena of "inner circle" and "structural hole" and their underlying theories. Through a close ...

  6. Engineering Industrial & Systems

    E-Print Network [OSTI]

    Berdichevsky, Victor

    Industrial Engineering Department of Industrial & Systems Engineering Leslie Monplaisir, Ph powerful tool sets used in industry today. -Brent Gillett, BSIE 2007 Advanced Planning Engineer at BMW I is available at: http://ise.wayne.edu/bs-industrial/index What is Industrial Engineering? The industrial

  7. Power Services, Direct Service Industries letter to the region, May 29, 2009

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeedingProgram Guidelines This document w w w.pv - te ch.orgPower PlantRates

  8. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  9. The Future of Combustion Turbine Technology for Industrial and Utility Power Generation 

    E-Print Network [OSTI]

    Karp, A. D.; Simbeck, D. R.

    1994-01-01

    Low capital cost and ample low-cost natural gas supplies will make natural gas-fired combustion turbine systems the power generation technology of choice over the next decade. Against the background of earlier use by electric utilities, this paper...

  10. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch88 Sign In About | Careers |

  11. Energy Department Turns Up the Heat and Power on Industrial Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submitKansasCommunities Energy EfficiencyModular Nuclear Reactors |

  12. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  13. Human Reliability Analysis in the U.S. Nuclear Power Industry: A Comparison of Atomistic and Holistic Methods

    SciTech Connect (OSTI)

    Ronald L. Boring; David I. Gertman; Jeffrey C. Joe; Julie L. Marble

    2005-09-01

    A variety of methods have been developed to generate human error probabilities for use in the US nuclear power industry. When actual operations data are not available, it is necessary for an analyst to estimate these probabilities. Most approaches, including THERP, ASEP, SLIM-MAUD, and SPAR-H, feature an atomistic approach to characterizing and estimating error. The atomistic approach is based on the notion that events and their causes can be decomposed and individually quantified. In contrast, in the holistic approach, such as found in ATHEANA, the analysis centers on the entire event, which is typically quantified as an indivisible whole. The distinction between atomistic and holistic approaches is important in understanding the nature of human reliability analysis quantification and the utility and shortcomings associated with each approach.

  14. Prospects for the medium- and long-term development of China`s electric power industry and analysis of the potential market for superconductivity technology

    SciTech Connect (OSTI)

    Li, Z.

    1998-05-01

    First of all, overall economic growth objectives in China are concisely and succinctly specified in this report. Secondly, this report presents a forecast of energy supply and demand for China`s economic growth for 2000--2050. In comparison with the capability of energy construction in China in the future, a gap between supply and demand is one of the important factors hindering the sustainable development of Chain`s economy. The electric power industry is one of China`s most important industries. To adopt energy efficiency through high technology and utilizing energy adequately is an important technological policy for the development of China`s electric power industry in the future. After briefly describing the achievements of China`s electric power industry, this report defines the target areas and policies for the development of hydroelectricity and nuclear electricity in the 2000s in China, presents the strategic position of China`s electric power industry as well as objectives and relevant plans of development for 2000--2050. This report finds that with the discovery of superconducting electricity, the discovery of new high-temperature superconducting (HTS) materials, and progress in materials techniques, the 21st century will be an era of superconductivity. Applications of superconductivity in the energy field, such as superconducting storage, superconducting transmission, superconducting transformers, superconducting motors, its application in Magneto-Hydro-Dynamics (MHD), as well as in nuclear fusion, has unique advantages. Its market prospects are quite promising. 12 figs.

  15. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  16. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  17. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  18. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  19. Partial Oxidation Gas Turbine for Power and Hydrogen Co-Production from Coal-Derived Fuel in Industrial Applications

    SciTech Connect (OSTI)

    Joseph Rabovitser

    2009-06-30

    The report presents a feasibility study of a new type of gas turbine. A partial oxidation gas turbine (POGT) shows potential for really high efficiency power generation and ultra low emissions. There are two main features that distinguish a POGT from a conventional gas turbine. These are associated with the design arrangement and the thermodynamic processes used in operation. A primary design difference of the POGT is utilization of a non?catalytic partial oxidation reactor (POR) in place of a conventional combustor. Another important distinction is that a much smaller compressor is required, one that typically supplies less than half of the air flow required in a conventional gas turbine. From an operational and thermodynamic point of view a key distinguishing feature is that the working fluid, fuel gas provided by the OR, has a much higher specific heat than lean combustion products and more energy per unit mass of fluid can be extracted by the POGT expander than in the conventional systems. The POGT exhaust stream contains unreacted fuel that can be combusted in different bottoming ycle or used as syngas for hydrogen or other chemicals production. POGT studies include feasibility design for conversion a conventional turbine to POGT duty, and system analyses of POGT based units for production of power solely, and combined production of power and yngas/hydrogen for different applications. Retrofit design study was completed for three engines, SGT 800, SGT 400, and SGT 100, and includes: replacing the combustor with the POR, compressor downsizing for about 50% design flow rate, generator replacement with 60 90% ower output increase, and overall unit integration, and extensive testing. POGT performances for four turbines with power output up to 350 MW in POGT mode were calculated. With a POGT as the topping cycle for power generation systems, the power output from the POGT ould be increased up to 90% compared to conventional engine keeping hot section temperatures, pressures, and volumetric flows practically identical. In POGT mode, the turbine specific power (turbine net power per lb mass flow from expander exhaust) is twice the value of the onventional turbine. POGT based IGCC plant conceptual design was developed and major components have been identified. Fuel flexible fluid bed gasifier, and novel POGT unit are the key components of the 100 MW IGCC plant for co producing electricity, hydrogen and/or yngas. Plant performances were calculated for bituminous coal and oxygen blown versions. Various POGT based, natural gas fueled systems for production of electricity only, coproduction of electricity and hydrogen, and co production of electricity and syngas for gas to liquid and hemical processes were developed and evaluated. Performance calculations for several versions of these systems were conducted. 64.6 % LHV efficiency for fuel to electricity in combined cycle was achieved. Such a high efficiency arise from using of syngas from POGT exhaust s a fuel that can provide required temperature level for superheated steam generation in HRSG, as well as combustion air preheating. Studies of POGT materials and combustion instabilities in POR were conducted and results reported. Preliminary market assessment was performed, and recommendations for POGT systems applications in oil industry were defined. POGT technology is ready to proceed to the engineering prototype stage, which is recommended.

  20. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  1. Methodological and Practical Considerations for Developing Multiproject Baselines for Electric Power and Cement Industry Projects in Central America

    E-Print Network [OSTI]

    Murtishaw, Scott; Sathaye, Jayant; Galitsky, Christina; Dorion, Kristel

    2008-01-01

    generators entered into power purchase agreements (PPAs)take-orpay clause in its power purchase agreement. While thereceived generous power purchase agreements, but information

  2. Clean Power & Industrial Efficiency | (919) 515-0354 | www.ncsc.ncsu.edu North Carolina State University, Campus Box 7401, Raleigh, NC 27695 | 1 919-515-3480 | www.ncsc.ncsu.edu 01/2013

    E-Print Network [OSTI]

    water, air conditioning, humidity control, process steam for industrial steam loads, product fryingClean Power & Industrial Efficiency | (919) 515-0354 | www.ncsc.ncsu.edu North Carolina State demand. CHP has been employed for years, mainly in large commercial, industrial, and institutional

  3. Methodological and Practical Considerations for Developing Multiproject Baselines for Electric Power and Cement Industry Projects in Central America

    E-Print Network [OSTI]

    Murtishaw, Scott; Sathaye, Jayant; Galitsky, Christina; Dorion, Kristel

    2008-01-01

    in: Innovations in Portland Cement Manufacturing, Skokie,IL, Portland Cement Association. Worrell, E. , Price, L. ,emissions from the global cement industry’, Ann. Rev. Energy

  4. Bonneville Power Administration and the Industrial Technologies Program Leverage Support to Overcome Energy Efficiency Barriers in the Northwest

    Broader source: Energy.gov [DOE]

    This case study explores how Bonneville Power Administration, a Northwest regional wholesale power provider, rethought how to encourage and promote energy efficiency projects through its utilities.

  5. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  6. Bonneville Power Administration and the Industrial Technologies Program Leverage Support to Overcome Energy Efficiency Barriers in the Northwest

    SciTech Connect (OSTI)

    2010-06-18

    Through its Energy Smart Industrial program, BPA is informing and assisting utilities and industries to have a better understanding of the benefits that come from participating in energy-savings programs. Read about how BPA is encouraging energy efficiency projects through its utilities.

  7. 194 IEEE TRANSACTIONS ON INDUSTRIAL ELECTRONICS, VOL. 56, NO. 1, JANUARY 2009 PWM Method to Eliminate Power Sources in a

    E-Print Network [OSTI]

    Catholic University of Chile (Universidad Católica de Chile)

    unidirectional if the machine is not using regenerative braking. In this paper, these nine power supplies

  8. The Industrial Electrification Program 

    E-Print Network [OSTI]

    Harry, I. L.

    1982-01-01

    EPRI's role as the research organization of the electric power industry, in coordination with potential user industries, is to 1) define the viability of candidate electrification technologies by monitoring the state-of-the-art and continuously...

  9. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  10. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  11. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  12. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  13. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  14. Industrial innovations for tomorrow: Advances in industrial energy-efficiency technologies. Commercial power plant tests blend of refuse-derived fuel and coal to generate electricity

    SciTech Connect (OSTI)

    Not Available

    1993-11-01

    MSW can be converted to energy in two ways. One involves the direct burning of MSW to produce steam and electricity. The second converts MSW into refuse-derived fuel (RDF) by reducing the size of the MSW and separating metals, glass, and other inorganic materials. RDF can be densified or mixed with binders to form fuel pellets. As part of a program sponsored by DOE`s Office of Industrial Technologies, the National Renewable Energy Laboratory participated in a cooperative research and development agreement to examine combustion of binder-enhanced, densified refuse-derived fuel (b-d RDF) pellets with coal. Pelletized b-d RDF has been burned in coal combustors, but only in quantities of less than 3% in large utility systems. The DOE project involved the use of b-d RDF in quantities up to 20%. A major goal was to quantify the pollutants released during combustion and measure combustion performance.

  15. Abstract The process control industry has shown great interest in implementation of low cost, low power wireless sensor

    E-Print Network [OSTI]

    power transmission through metal walls using piezoelectric transducers [1], electromechanical network, low power wireless sensor networks. Such networks are much easier to deploy and reconfigure compared Wireless sensing and control networks have given machinery designers the flexibility to place network

  16. ITP Industrial Distributed Energy: Combined Heat & Power Multifamily Performance Program-- Sea Park East 150 kW CHP System

    Broader source: Energy.gov [DOE]

    Overview of Sea Park East 150 kilowatt (kW) Combined Heat and Power (CHP) System in Brooklyn, New York

  17. Power-law correlations in finance-related Google searches, and their cross-correlations with volatility and traded volume: Evidence from the Dow Jones Industrial components

    E-Print Network [OSTI]

    Kristoufek, Ladislav

    2015-01-01

    We study power-law correlations properties of the Google search queries for Dow Jones Industrial Average (DJIA) component stocks. Examining the daily data of the searched terms with a combination of the rescaled range and rescaled variance tests together with the detrended fluctuation analysis, we show that the searches are in fact power-law correlated with Hurst exponents between 0.8 and 1.1. The general interest in the DJIA stocks is thus strongly persistent. We further reinvestigate the cross-correlation structure between the searches, traded volume and volatility of the component stocks using the detrended cross-correlation and detrending moving-average cross-correlation coefficients. Contrary to the universal power-law correlations structure of the related Google searches, the results suggest that there is no universal relationship between the online search queries and the analyzed financial measures. Even though we confirm positive correlation for a majority of pairs, there are several pairs with insign...

  18. About Industrial Distributed Energy

    Broader source: Energy.gov [DOE]

    The Advanced Manufacturing Office's (AMO's) Industrial Distributed Energy activities build on the success of predecessor DOE programs on distributed energy and combined heat and power (CHP) while...

  19. IEEE TRANSACTIONS ON INDUSTRIAL ELECTRONICS, VOL. 56, NO. 8, AUGUST 2009 3079 Hybrid Electric Vehicle Power Management

    E-Print Network [OSTI]

    Tolbert, Leon M.

    IEEE TRANSACTIONS ON INDUSTRIAL ELECTRONICS, VOL. 56, NO. 8, AUGUST 2009 3079 Hybrid Electric transformer. This modified version can produce a high conversion ratio from a limited number of components and shows how the transformer-free version can be modified to create limited isolation from the circuit

  20. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  1. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  2. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  3. Carbon dioxide capture technology for the coal-powered electricity industry : a systematic prioritization of research needs

    E-Print Network [OSTI]

    Esber, George Salem, III

    2006-01-01

    Coal is widely relied upon as a fuel for electric power generation, and pressure is increasing to limit emissions of the CO2 produced during its combustion because of concerns over climate change. In order to continue the ...

  4. Methodological and Practical Considerations for Developing Multiproject Baselines for Electric Power and Cement Industry Projects in Central America

    E-Print Network [OSTI]

    Murtishaw, Scott; Sathaye, Jayant; Galitsky, Christina; Dorion, Kristel

    2008-01-01

    de?ne as all heavy and distillate fuel oil plants. Theirengines burning heavy fuel oil, whereas prior to that, theit is available and heavy fuel oil for supplying power to

  5. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  6. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  7. Assessing the impact of space weather on the electric power grid based on insurance claims for industrial electrical equipment

    E-Print Network [OSTI]

    Schrijver, Carolus J; Murtagh, William; Petrinec, Stephen M

    2014-01-01

    Geomagnetically induced currents are known to induce disturbances in the electric power grid. Here, we perform a statistical analysis of 11,242 insurance claims from 2000 through 2010 for equipment losses and related business interruptions in North-American commercial organizations that are associated with damage to, or malfunction of, electrical and electronic equipment. We find that claims rates are elevated on days with elevated geomagnetic activity by approximately 20% for the top 5%, and by about 10% for the top third of most active days ranked by daily maximum variability of the geomagnetic field. When focusing on the claims explicitly attributed to electrical surges (amounting to more than half the total sample), we find that the dependence of claims rates on geomagnetic activity mirrors that of major disturbances in the U.S. high-voltage electric power grid. The claims statistics thus reveal that large-scale geomagnetic variability couples into the low-voltage power distribution network and that relat...

  8. Assessment of Replicable Innovative Industrial Cogeneration Applicatio...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and Power for Industry: A Market Assessment, August 2003 Steam System Opportunity Assessment for the Pulp and Paper, Chemical Manufacturing, and Petroleum Refining Industries...

  9. DOE Hydrogen and Fuel Cells Program Record, Record # 13008: Industry...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Record, Record 13008: Industry Deployed Fuel Cell Powered Lift Trucks DOE Hydrogen and Fuel Cells Program Record, Record 13008: Industry Deployed Fuel Cell Powered Lift Trucks...

  10. Industrial Permit

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Industrial Permit Industrial Permit The Industrial Permit authorizes the Laboratory to discharge point-source effluents under the National Pollutant Discharge Elimination System....

  11. Impact on the steam electric power industry of deleting Section 316(a) of the Clean Water Act: Energy and environmental impacts

    SciTech Connect (OSTI)

    Veil, J.A.; VanKuiken, J.C.; Folga, S.; Gillette, J.L.

    1993-01-01

    Many power plants discharge large volumes of cooling water. In some cases, the temperature of the discharge exceeds state thermal requirements. Section 316(a) of the Clean Water Act (CWA) allows a thermal discharger to demonstrate that less stringent thermal effluent limitations would still protect aquatic life. About 32% of the total steam electric generating capacity in the United States operates under Section 316(a) variances. In 1991, the US Senate proposed legislation that would delete Section 316(a) from the CWA. This study, presented in two companion reports, examines how this legislation would affect the steam electric power industry. This report quantitatively and qualitatively evaluates the energy and environmental impacts of deleting the variance. No evidence exists that Section 316(a) variances have caused any widespread environmental problems. Conversion from once-through cooling to cooling towers would result in a loss of plant output of 14.7-23.7 billion kilowatt-hours. The cost to make up the lost energy is estimated at $12.8-$23.7 billion (in 1992 dollars). Conversion to cooling towers would increase emission of pollutants to the atmosphere and water loss through evaporation. The second report describes alternatives available to plants that currently operate under the variance and estimates the national cost of implementing such alternatives. Little justification has been found for removing the 316(a) variance from the CWA.

  12. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  13. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  14. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  15. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  16. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  17. Load Management for Industry 

    E-Print Network [OSTI]

    Konsevick, W. J., Jr.

    1982-01-01

    categories: Thermal Energy Storage, Communication and Load Control, Interconnection and Operation of Power Systems, and Selective Load Promotions. The endeavors of the utility industry and Ohio Edison Company in three of the four categories are described...

  18. NGV industry infrastructure

    SciTech Connect (OSTI)

    Not Available

    1984-12-01

    Current natural gas vehicle (NGV) technology faces a number of problems that must be overcome before vehicles powered by compressed natural gas become accepted in the US. Among these impediments are regulatory uncertainties, codes, standards and the NGV industry infrastructure itself. The marketing/supply infrastructure necessary to support the NGV industry is described.

  19. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  20. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  1. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  2. Green Industrial Policy: Trade and Theory

    E-Print Network [OSTI]

    Karp, Larry; Stevenson, Megan

    2012-01-01

    costs of de- veloping an industry that produces components for solar and wind powered energy. The US and

  3. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  4. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  5. Topics in nuclear power (Journal Article) | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    NUCLEAR POWER STATION; GAIN; JAPAN; NATURAL DISASTERS; NUCLEAR INDUSTRY; NUCLEAR POWER; NUCLEAR POWER PLANTS; PROBABILISTIC ESTIMATION; REACTOR ACCIDENTS; REACTOR MAINTENANCE;...

  6. Industrial Relations

    E-Print Network [OSTI]

    Ulman, Lloyd

    1987-01-01

    S. Tannenbaum. Madison: Industrial 1955. The Rise of the N ai a Working Paper 8733 INDUSTRIAL RELATIONS L l o y d UlmanEconomic Theory and Doctrine INDUSTRIAL RELATIONS Two great

  7. Analysis of system wide distortion in an integrated power system utilizing a high voltage DC bus and silicon carbide power devices

    E-Print Network [OSTI]

    Fallier, William F. (William Frederick)

    2007-01-01

    This research investigates the distortion on the electrical distribution system for a high voltage DC Integrated Power System (IPS). The analysis was concentrated on the power supplied to a propulsion motor driven by an ...

  8. Industrial Engineering Industrial Advisory Board

    E-Print Network [OSTI]

    Gelfond, Michael

    Industrial Engineering Industrial Advisory Board (IAB) #12;PURPOSE: The Texas Tech University - Industrial Engineering Industrial Ad- visory Board (IAB) is an association of professionals with a com- mon goal - promoting and developing the Texas Tech Department of Industrial Engineering and its students

  9. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  10. Analyzing the effects of component reliability on naval Integrated Power System quality of service

    E-Print Network [OSTI]

    Hawbaker, Benjamin F. (Benjamin Forrest)

    2008-01-01

    The Integrated Power System (IPS) is a key enabling technology for future naval vessels and their advanced weapon systems. While conventional warship designs utilize separate power systems for propulsion and shipboard ...

  11. Feasibility Study of Economics and Performance of Biomass Power Generation at the Former Farmland Industries Site in Lawrence, Kansas. A Study Prepared in Partnership with the Environmental Protection Agency for the RE-Powering America's Land Initiative: Siting Renewable Energy on Potentially Contaminated Land and Mine Sites

    SciTech Connect (OSTI)

    Tomberlin, G.; Mosey, G.

    2013-03-01

    Under the RE-Powering America's Land initiative, the U.S. Environmental Protection Agency (EPA) provided funding to the National Renewable Energy Laboratory (NREL) to support a feasibility study of biomass renewable energy generation at the former Farmland Industries site in Lawrence, Kansas. Feasibility assessment team members conducted a site assessment to gather information integral to this feasibility study. Information such as biomass resources, transmission availability, on-site uses for heat and power, community acceptance, and ground conditions were considered.

  12. Asymmetry in In-Degree and Out-Degree Distributions of Large-Scale Industrial Networks

    E-Print Network [OSTI]

    Luo, Jianxi; Whitney, Daniel E.

    2015-01-01

    Network structures in industrial pricing: the effect ofrecession? ranking U.S. industrial sectors by the Power-of-distributions of large-scale industrial networks Jianxi Luo

  13. Research and development in the textile industry

    SciTech Connect (OSTI)

    1987-06-01

    Included in the portfolio of IP's projects are the R and D activities for several advanced technologies targeted at the textile industry, one of the top ten energy intensive industries in the country. These R and D projects have primarily been aimed at improving the energy efficiency and productivity of textile production processes. Many projects in this area have been successfully completed, and some have resulted in the development and implementation of new technologies (e.g., foam processing) for various process steps. Other projects have produced technical results that have later been utilized by the industry in other capacities (e.g., hyperfiltration). Several projects at various stages of development are currently underway. This brochure describes the Office of Industrial Programs' R and D activities relevant to the textile industry. The brochure is comprised of the following: Industry Update, Energy Consumption in the Textile Industry, Energy Consumption in the Textile Industry, Potential Energy Savings in the Textile Industry, Office of Industrial Programs, R and D Efforts, and R and D Data Base.

  14. Commercial and Industrial DSM Program Overview | Department of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Commercial and Industrial DSM Program Overview Commercial and Industrial DSM Program Overview Presentation provides an overview of PEPCO and Delmarva Power's demand side management...

  15. Advanced, Energy-Efficient Hybrid Membrane System for Industrial...

    Broader source: Energy.gov (indexed) [DOE]

    Advanced, Energy- Efficient Hybrid Membrane System for Industrial Water Reuse New Hybrid Membrane System Utilizes Industrial Waste Heat to Power Water Purification Process As...

  16. Sandia Energy - Brayton Cycle Workshop and Industry Day

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Brayton Cycle Workshop and Industry Day Home Stationary Power Nuclear Fuel Cycle Nuclear Energy Workshops Brayton Cycle Workshop and Industry Day Brayton Cycle Workshop and...

  17. Outsourcing Ownership, Operation and Management of Industrial Facility Power Plants for the Purpose of Reducing Future Risk and Capital Requirements of the Corporation 

    E-Print Network [OSTI]

    Sebesta, J. J.; Schubbe, T.

    1999-01-01

    For many industrial corporations, the availability of funds for maintaining and modernizing Central Utility systems is becoming more and more difficult to obtain. Total return on investments in facility infrastructure generally does not tend to meet...

  18. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  19. Industrial Marketing Management Special Issue

    E-Print Network [OSTI]

    MacDonald, Mark

    Industrial Marketing Management Special Issue Power in Business, Customer and Market Relationships number of highly powerful grocery retailers (Lindgreen, Hingley & Trienekens, 2008; Hingley, 2005a, 2005b Revised April 2014, September 2014 Accepted April 1, 2015 Exercising power in asymmetric relationships

  20. Keyed Side-Channel Based Hashing for IP Protection using Wavelets

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    signal feature extraction method, the wavelet transform, to form a keyed side-channel hash function industry, however, has virtually no opportunity to confirm a suspected plagiarism. Products on the market devices emit physically observ- able quantities, for instance the power consumption, electromagnetic

  1. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  2. Research Study - Global Enterprise VoIP Equipment Market Forecasts...

    Open Energy Info (EERE)

    we deeply analyzed the world's main region market conditions that including the product price, profit, capacity, production, capacity utilization, supply, demand and industry...

  3. Energy Department Actions to Deploy Combined Heat and Power,...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Actions to Deploy Combined Heat and Power, Boost Industrial Efficiency Energy Department Actions to Deploy Combined Heat and Power, Boost Industrial Efficiency October 21, 2013 -...

  4. Industry Partners Panel

    Broader source: Energy.gov [DOE]

    Industry Panel presenters include: Michael G. Andrew, Director - Academic and Technical Programs, Advanced Products and Materials, Johnson Controls Power Solutions Michael A. Fetcenko, Vice President and Managing Director, BASF Battery Materials – Ovonic, BASF Corporation Adam Kahn, Founder and CEO, AKHAN Technologies, Inc. Stephen E. Zimmer, Executive Director, United States Council for Automotive Research (USCAR)

  5. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  6. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  7. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  8. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  9. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  10. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  11. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  12. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  13. Quick Start Guide Cisco Small Business Pro IP Phone

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    are using an external power source, insert one end of the power cord into an outlet and insert the other end of the power cord into the power port on the phone body. STEP 7 Connect your phone to the network: · Using to the network and receives a basic configuration, your phone line keys should glow green (on models with phone

  14. China's Nuclear Industry After Fukushima

    E-Print Network [OSTI]

    YUAN, Jingdong

    2013-01-01

    2013-9 January 2013 China’s Nuclear Industry After FukushimaMarch 2011 Fukushima nuclear accident has had a significanton the future of China’s nuclear power. First, it highlights

  15. Energy Efficiency Improvement and Cost Saving Opportunities for the Pharmaceutical Industry. An ENERGY STAR Guide for Energy and Plant Managers

    E-Print Network [OSTI]

    Galitsky, Christina

    2008-01-01

    and Trends in the Pulp and Paper Industry. Proceedings ofand in the pulp & paper, food, and lumber industries. Power

  16. Industrial Wastes as a Fuel 

    E-Print Network [OSTI]

    Richardson, G.; Hendrix, W.

    1980-01-01

    available for coal since it was at one time a major industrial fuel and is still used extensively for electric power generation. However, combustion data for other fuels such as wood and solid materials typically generated as industrial wastes can only...

  17. OTHER INDUSTRIES

    Office of Energy Efficiency and Renewable Energy (EERE)

    AMO funded research results in novel technologies in diverse industries beyond the most energy intensive ones within the U.S. Manufacturing sector. These technologies offer quantifiable energy...

  18. DOE Hydrogen and Fuel Cells Program Record #13007: Industry Deployed...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    13007: Industry Deployed Fuel Cell Backup Power (BuP) DOE Hydrogen and Fuel Cells Program Record 13007: Industry Deployed Fuel Cell Backup Power (BuP) This record from the DOE...

  19. Electric power 2007

    SciTech Connect (OSTI)

    2007-07-01

    Subjects covered include: power industry trends - near term fuel strategies - price/quality/delivery/opportunity; generating fleet optimization and plant optimization; power plant safety and security; coal power plants - upgrades and new capacity; IGCC, advanced combustion and CO{sub 2} capture technologies; gas turbine and combined cycle power plants; nuclear power; renewable power; plant operations and maintenance; power plant components - design and operation; environmental; regulatory issues, strategies and technologies; and advanced energy strategies and technologies. The presentations are in pdf format.

  20. Natural Gas Delivered to Industrial Consumers

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    to Commercial Consumers Volumes Delivered to Industrial Consumers Volumes Delivered to Vehicle Fuel Consumers Volumes Delivered to Electric Power Consumers Period: Monthly...

  1. ENERGY USE AND CONSERVATION IN INDUSTRIALIZED COUNTRIES

    E-Print Network [OSTI]

    Schipper, L.

    2012-01-01

    Cogeneration of electricity and heat in industrial plants iscogeneration, especially just now when long term electricity contracts hide the marginal cost of new power from existing plants.

  2. A study of power electronic building block (PEBB)-based integrated shipboard power systems during reconfiguration 

    E-Print Network [OSTI]

    Adediran, Adeoti Taiwo

    2004-09-30

    conversion is to be utilized to convert alternating current (AC) generation to direct current (DC) distribution. As state-of-the-art power electronics, the Navy plans to use power electronic building blocks (PEBB) technology in its IPS. A U.S. naval shipboard...

  3. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  4. A modeling and control framework for operating large-scale electric power systems under present and newly evolving competitive industry structures

    E-Print Network [OSTI]

    Ilic, Marija

    1995-01-01

    This paper introduces a systematic, structure-based modeling framework for analysis and control of electric power systems for processes evolving over the mid-term and long-term time horizons. Much simpler models than the ...

  5. Economic Evaluation of By-Product Power/Co-Generation Systems for Industrial Plants with Fluidized-Bed Coal Burning Facilities 

    E-Print Network [OSTI]

    Mesko, J. E.

    1980-01-01

    . The plants analyzed employ fluidized bed boilers for generation of steam for process and building/heating/cooling demands, in conjunction with electric power co-generation. Results of the analysis are presented, using life cycle costs and investment payback...

  6. Elevated Temperature Materials for Power Generation and Propulsion The energy industry is designing higher-efficiency land-based turbines for natural gas-fired

    E-Print Network [OSTI]

    Nair, Sankar

    higher-efficiency land-based turbines for natural gas-fired power generation systems. The high inlet is significant for modeling cyclic deformation in directionally solidified and single crystal turbine blades

  7. Energy Department Announces New Concentrating Solar Power Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Department Announces New Concentrating Solar Power Technology Investments to American Industry, Universities Energy Department Announces New Concentrating Solar Power...

  8. PowerPoint Presentation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Associate General Counsel Steve Ventura Associate General Counsel Doug Rose IP Attorney Marc Filigenzi Administrative Assistant Gwen Scudder Managing IP Attorney Jud Hightower...

  9. Industrial energy management and utilization

    SciTech Connect (OSTI)

    Witte, L.C.; Schmidt, P.S.; Brown, D.

    1986-01-01

    This text covers the principles of industrial energy conservation and energy conservation applications, with emphasis on the energy-intensive industries. Topics covered include energy consumption, alternative energy sources, elements of energy audits, economic investment analysis, management of energy conservation programs, boilers and fired heaters, steam and condensate systems, classification and fouling of heat exchangers, heat transfer augmentation, waste heat sources, heat recovery equipment, properties and characteristics of insulation, energy conservation in industrial buildings, cogeneration, power circuit components and energy conversion devices, electrical energy conservation. A review of the fundamentals of fluid mechanics, heat transfer, and thermodynamics, as well as examples, problems, and case studies from specific industries are included.

  10. Industry Economist

    Broader source: Energy.gov [DOE]

    A successful candidate in this position will report to the Manager of Load Forecasting and Analysis of the Customer Services Organization. He/she serves as an industry economist engaged in load...

  11. The Great American Education-Industrial Complex

    E-Print Network [OSTI]

    Johnson Jr.,, Ray

    The Great American Education-Industrial Complex Ideology, Technology, and Profit Anthony G. Picciano & Joel Spring The Great American Education-Industrial Complex examines the structure and nature in a powerful common entity, and detail how the educational-industrial complex has grown and strengthened its

  12. Pulp & Paper Industry- A Strategic Energy Review 

    E-Print Network [OSTI]

    Stapley, C. E.

    1997-01-01

    The pulp and paper industry with yearly energy purchases of $5 billion per year including 50 billion kWh of power is one of the largest industrial energy producers in the U.S. However, structural changes in the global pulp and paper industry could...

  13. Type B Accident Investigation Board Report of the July 7, 1997, Industrial Accident at the Knolls Atomic Power Laboratory Windsor Site, Windsor, Connecticut

    Broader source: Energy.gov [DOE]

    On Monday, July 7, 1997, at approximately 10:47 a. m., an asbestos abatement subcontractor laborer working at the Knolls Atomic Power Laboratory-Windsor Site stepped on and fell backward through an unprotected rooftop skylight in the northwest quadrant of Building 5 (see Figure #1).

  14. Modeling Generator Power Plant Portfolios and Pollution Taxes in

    E-Print Network [OSTI]

    Nagurney, Anna

    Modeling Generator Power Plant Portfolios and Pollution Taxes in Electric Power Supply Chain-term solution (e.g.,are long-term solution (e.g., solar power and wind power (solar power and wind power Heavy user of fossil fuels:Heavy user of fossil fuels: Electric power industryElectric power industry

  15. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  16. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  17. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  18. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  19. Coal Industry Annual 1995

    SciTech Connect (OSTI)

    1996-10-01

    This report presents data on coal consumption, coal distribution, coal stocks, coal prices, coal quality, and emissions for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States. This report does not include coal consumption data for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. Consumption for nonutility power producers not included in this report is estimated to be 21 million short tons for 1995.

  20. Coal industry annual 1996

    SciTech Connect (OSTI)

    1997-11-01

    This report presents data on coal consumption, coal distribution, coal stocks, coal prices, and coal quality, and emissions for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States.This report does not include coal consumption data for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. Consumption for nonutility power producers not included in this report is estimated to be 24 million short tons for 1996. 14 figs., 145 tabs.

  1. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  2. Opportunities in African power generation: A business briefing for industry and investment executives. Held in Baltimore, Maryland, June 21-22, 1995. Export trade information

    SciTech Connect (OSTI)

    1995-06-21

    The report, prepared by the Institute of International Education, was funded by the U.S. Trade and Development Agency. The information contained in the report was compiled in part for a power generation conference held in Baltimore, Maryland. The focus of the report is the market created by electric power projects financed by multilateral development banks. The study contains country information and project profiles related to the energy sector for eleven countries: Benin, Botswana, Cote D`Ivoire, Ethiopia, Ghana, Malawi, Morocoo, Senegal, Tanzania, Zambia, and Zimbabwe. The report also outlines the range of service opportunities in the region such as consulting, engineering, construction and project management, and equipment procurement. It is divided into the following sections: (1) Agenda/Program; (2) African Energy Sector Overview; (3) Project Profiles; (4) Country Information; and (5) Attendees.

  3. Research and development separation technology: The DOE Industrial Energy Conservation Program

    SciTech Connect (OSTI)

    Not Available

    1987-07-01

    This brochure summarizes the Office of Industrial Programs' RandD efforts in the advancement of separation technology. The purpose of this brochure is to provide interested parties with information on federal industrial energy conservation activities in separation technology. The brochure is comprised of the following sections: Separation Technology, summarizes the current state of separation technology and its uses. Potential Energy Savings, discusses the potential for industrial energy conservation through the implementation of advanced separation processes. Office of Industrial Programs' RandD Efforts in Separation Technology Development, describes the separation RandD projects conducted by IP. RandD Data Base, lists contractor, principal investigator, and location of each separation-related RandD effort sponsored by IP.

  4. Analysis and Design of Power Acceptability Curves

    E-Print Network [OSTI]

    Analysis and Design of Power Acceptability Curves for Industrial Loads Masters Thesis and Final Analysis and Design of Power Acceptability Curves for Industrial Loads Thesis and Final Report John Kyei

  5. DC Power Distribution Systems 

    E-Print Network [OSTI]

    Savage, P.

    2012-01-01

    - A FLEXIBLE ALTERNATIVE ..OR ELECTRICAL POWER SUPPLY S. D. REYNOLDS Manager of Industrial Marketing & Services Tennessee Valley Authority Chattanooga, Tennessee ABSTRACT In an increasingly competitive operating environment, utilities must... place greater emphasis on developing programs that benefit the customer while at the same time benefiting the utility. Economy Surplus Power (ESP) is such a program. ESP offers industrial customers attractively priced power supply arrangements based...

  6. Electric power annual 1993

    SciTech Connect (OSTI)

    Not Available

    1994-12-08

    This report presents a summary of electric power industry statistics at national, regional, and state levels: generating capability and additions, net generation, fossil-fuel statistics, retail sales and revenue, finanical statistics, environmental statistics, power transactions, demand side management, nonutility power producers. Purpose is to provide industry decisionmakers, government policymakers, analysts, and the public with historical data that may be used in understanding US electricity markets.

  7. The Power 25 Charles Otto -POLICY MAKER

    E-Print Network [OSTI]

    The Power 25 Charles Otto - POLICY MAKER When Charles Otto was awarded swimming and lifesaving 2008 Power 25 By Aquatics International Staff Some of the most powerful people in the industry://www.aquaticsintl.com #12;The Power 25 Some of the most powerful people in the industry are not necessarily aquatics

  8. Fossil Power Plant Applications of Expert Systems: An EPRI Perspective 

    E-Print Network [OSTI]

    Divakaruni, S. M.

    1989-01-01

    the role of expert systems in the electric power industry, with particular emphasis on six fossil power plant applications currently under development by the Electric Power Research Institute....

  9. Maintaining a competitive geothermal industry

    SciTech Connect (OSTI)

    Zodiaco, V.P.

    1996-04-10

    I come to this geothermal business with over 30 years of experience in the power generation industry. I have earned my spurs (so to speak) in the electric utility, nuclear power, coal and the gas-fired cogeneration power businesses. I have been employed by Oxbow Power for the past seven years and for the past 18 months I have been based in Reno and responsible for the operation, maintenance and management of Oxbow`s domestic power projects which include three geothermal and two gas-fired facilities. The Oxbow Power Group (consisting principally of Oxbow Power Corporation, Oxbow Geothermal Corporation, Oxbow Power of Beowawe, Oxbow Power International and Oxbow Power Services, Inc.) is based in West Palm Beach, Florida, and has regional offices in Reno, Hong Kong and Manila to support on-line geothermal projects in Nevada, other domestic power projects and a geothermal plant under construction in the Philippines. Oxbow Power employs approximately 30 professionals in the development and management of power projects and over 100 supervisors and technicians in the operation and maintenance of power facilities. Current ownership in independent power projects total 340 MW in the United States and 47 MW under construction in the Philippines. Oxbow is currently negotiating additional projects in several Asian and Central American countries.

  10. EPRI's Industrial Energy Management Program 

    E-Print Network [OSTI]

    Mergens, E.; Niday, L.

    1992-01-01

    supporting national objectives for a clean environment and a strong economic future. The Electric Power Research Institute (EPRI) recognizes that the management of energy use and the environmental impacts of industrial activity are of national importance... in municipal water and sewage treatment plants, field evaluation of advanced reverse osmosis to recycle electroplating waste water, and cross divisional analysis and assessment of EPRI-developed technology for industrial customer applications. SUMMARY...

  11. Hybrid Power Test Bed

    SciTech Connect (OSTI)

    NONE

    1996-06-01

    This document describes efforts by the National Renewable Energy Laboratory to simulate hybrid power systems. Hybrid power systems combine multiple power sources such as wind turbines, photovoltaic (PV) arrays, diesel generators, and battery storage systems. They typically are used in remote areas, away from major electric grids. The Hybrid Power Test Bed is designed to assist the U.S. wind industry in developing and testing hybrid power generation systems. Test bed capabilities, features, and equipment are described.

  12. MIT and the Supply Chain Logistics/Transportation Industries MIT Industry Brief

    E-Print Network [OSTI]

    Herr, Hugh

    MIT and the Supply Chain Logistics/Transportation Industries MIT Industry Brief MIT's Industrial Liaison Program (ILP) can bring the intellectual power of MIT to your organization by providing a direct of Technology (MIT) is a leading center of research and education on topics important to companies

  13. 896 IEEE TRANSACTIONS ON INDUSTRY APPLICATIONS, VOL. 35, NO. 4, JULY/AUGUST 1999 Dynamic Overmodulation Characteristics

    E-Print Network [OSTI]

    Hava, Ahmet

    , utility interface, and uninterruptible power supply (UPS) applications as a means for dc ac electric TRANSACTIONS ON INDUSTRY APPLICATIONS by the Industrial Power Converter Committee of the IEEE Industry

  14. "A High Speed Laser Profiling Device for Refractory Lininig Thickness Measurements In a Gasifier with Cross-Cut to the Metals, Forest Products, Chemical and Power Generation Industries"

    SciTech Connect (OSTI)

    Michel Bonin; Tom Harvill; Jared Hoog; Don Holve; Alan Alsing; Bob Clark; Steve Hrivnak

    2007-11-01

    Process Metrix began this project with the intent of modifying an existing ranging system and combining the same with a specially designed optical scanner to yield three dimensional range images that could be used to determine the refractory lining thickness in a gasifier. The goal was to make these measurements during short outages while the gasifier was at or near operating temperature. Our initial estimates of the photon counts needed for the modulation-based range finder were optimistic, and we were forced to undertake a redesign of the range finder portion of the project. This ultimately created significant and unanticipated time delays that were exacerbated when Acuity Technologies, the subcontractor responsible for delivering the redesigned range finder, failed to deliver electrical components capable of meeting the specific range error requirements needed for accurate lining thickness measurement. An extensive search for an alternate, off-the-shelf solution was unsuccessful, and Process Metrix was forced to undertake the electronics development internally without project funds. The positive outcome of this effort is a documented set of range finder electronics that have exceptional accuracy, simplicity, temperature stability and detection limit; in sum a package perfectly suited to the measurement requirements and within our control. It is unfortunate yet understandable, given the time delays involved in reaching this milestone, that the Department of Energy decided not to continue the project to completion. The integration of this electronics set into the optomechanical hardware also developed within the scope of the project remains as follow-on project that Process Metrix will finish within the calendar year 2008. Testing in the gasifier is, at this point, not certain pending the award of additional funding needed for field trials. Eastman, our industrial partner in this project, remains interested in evaluating a finished system, and working together we will attempt to secure funding from alternate sources that have been referenced by our contract monitor. It remains our hope and goal to follow this project through to completion, thereby achieving the objectives outlined at the start of our effort.

  15. MIT and Automotive Industries MIT Industry Brief

    E-Print Network [OSTI]

    Herr, Hugh

    MIT and Automotive Industries MIT Industry Brief MIT's Industrial Liaison Program (ILP) can bring@ilp.mit.edu, or visit http://ilp.mit.edu. MIT and Automotive Industries The Massachusetts Institute of Technology (MIT) is a leading center of research and education on topics important to the automotive industry and its suppliers

  16. Coal industry annual 1997

    SciTech Connect (OSTI)

    1998-12-01

    Coal Industry Annual 1997 provides comprehensive information about US coal production, number of mines, prices, productivity, employment, productive capacity, and recoverable reserves. US Coal production for 1997 and previous years is based on the annual survey EIA-7A, Coal Production Report. This report presents data on coal consumption, coal distribution, coal stocks, coal prices, and coal quality for Congress, Federal and State agencies, the coal industry, and the general public. Appendix A contains a compilation of coal statistics for the major coal-producing States. This report includes a national total coal consumption for nonutility power producers that are not in the manufacturing, agriculture, mining, construction, or commercial sectors. 14 figs., 145 tabs.

  17. Deregulation-restructuring: Evidence for individual industries

    SciTech Connect (OSTI)

    Costello, K.W.; Graniere, R.J.

    1997-05-01

    Several studies have measured the effects of regulation on a particular industry. These studies range widely in sophistication, from simple observation (comparison) of pre-transformation and post-transformation actual industry performance to econometric analysis that attempt to separate the effects of deregulation from other factors in explaining changes in an industry`s performance. The major problem with observation studies is that they are unable to measure the effect of one particular event, such as deregulation, on an industry`s performance. For example, at the same time that the United Kingdom privatized its electric power industry, it also radically restructured the industry to encourage competition and instituted a price-cap mechanism to regulate the prices of transmission, distribution, and bundled retail services. Subsequent to these changes in 1991, real prices for most UK electricity customers have fallen. It is not certain however, which of these factors was most important or even contributed to the decline in price. In any event, one must be cautious in interpreting the results of studies that attempt to measure the effect of deregulation per se for a specific industry. This report highlights major outcomes for five industries undergoing deregulation or major regulatory and restructuring reforms. These include the natural gas, transportation, UK electric power, financial, and telecommunications industries. Particular attention was given to the historical development of events in the telecommunications industry.

  18. Energy Management Services for the Industrial Market Segment at TVA 

    E-Print Network [OSTI]

    Hamby, R. E.; Knight, V. R.

    1984-01-01

    The Tennessee Valley Authority has provided energy management surveys (EMSs) to commercial and industrial power consumers since 1979. A significant number of EMSs have been performed to a variety of industry types and sizes. As in all developmental...

  19. DOE Report Tracks Maturation of U.S. Wind Industry

    E-Print Network [OSTI]

    Bolinger, Mark; Wiser, Ryan

    2007-01-01

    the Growth of the U.S. Wind Industry The U.S. Department ofAnnual Report on U.S. Wind Power Installation, Cost, andkey trends in the U.S. wind industry, in many cases using

  20. The Market and Technical Potential for Combined Heat and Power...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Industrial Sector, January 2000 The Market and Technical Potential for Combined Heat and Power in the Industrial Sector, January 2000 This January 2000 ONSITE SYCOM Energy...

  1. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  2. Industry @ ALS

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat Pumps Heat Pumpsfacility doe logoInIndustry @ ALS

  3. Industrial Permit

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientific andIndividualEvent Sign InIndustrial

  4. Industrial Users

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientific andIndividualEvent SignIndustrial Users -

  5. Industry Economists

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry Natural GasNatural GasEIA lowerslong4,Guide toHighHowIndustry

  6. Systems and Industry Analyses

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With LivermoreSustainable Landmimic keySystemssystems and industry

  7. Industry Profile

    Broader source: Energy.gov [DOE]

    Combined heat and power (CHP)—sometimes referred to as cogeneration—involves the sequential process of producing and utilizing electricity and thermal energy from a single fuel. CHP is widely recognized to save energy and costs, while reducing carbon dioxide (CO2) and other pollutants. CHP is a realistic, near-term option for large energy efficiency improvements and significant CO2 reductions.

  8. Introduction Actual Industrial Problems

    E-Print Network [OSTI]

    Nigam, Nilima

    Introduction Actual Industrial Problems What's needed? Is there really interesting mathematics in Industry? Can mathematicians contribute to society, and do we want to...? Nilima Nigam Department Mathematics in Industry #12;Introduction Actual Industrial Problems What's needed? Some controversial

  9. Mechanical & Industrial Engineering

    E-Print Network [OSTI]

    Mountziaris, T. J.

    Mechanical & Industrial Engineering 1 Welcome MIE Industrial Advisory Board October 15, 2010 #12;Mechanical & Industrial Engineering 2 MIE Dorothy Adams Undergraduate/Graduate Secretary David Schmidt Associate Professor & Graduate Program Director #12;Mechanical & Industrial Engineering 3 MIE James Rinderle

  10. WP-07 IP Direct Testimony (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCase Initial

  11. WP-07 IP Rebuttal Testimony (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCase

  12. WP-07 IP Studies & Documentation (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCaseStudies

  13. Wind Power

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Wind Power Bioenergy Power Systems Wind Power Wind Power Main Page Outreach Programs Image Gallery FAQs Links Software Hydro Power INL Home Wind Power Introduction The Wind Power...

  14. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  15. Cascading Closed Loop Cycle Power Generation 

    E-Print Network [OSTI]

    Romero, M.

    2008-01-01

    the combustion of fossil fuels. The WOWGen® power plant inherently reduces emissions and Greenhouse Gases (GHG) by producing power from waste heat without consuming fuel, thus increasing the overall energy efficiency of any industrial plant or power generation...

  16. Patterns of innovation in service industries

    E-Print Network [OSTI]

    Wong, Regan (Regan A.)

    2007-01-01

    Over the years, scholars studying technology-based innovation have uncovered patterns of success and failure. Many of the lessons learned from these observations can serve as powerful guidelines for leaders of industry as ...

  17. Microsoft Word - letter announcing draft contract for Port townsend...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    is proposing to offer a Block Power Sales Agreement (Block Contract) to Port Townsend Paper Company at the Industrial Power (IP) rate. Port Townsend currently receives service...

  18. Microsoft Word - Public Letter regarding Port Townsend 6-22-09...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    is proposing to offer a Block Power Sales Agreement (Block Contract) to Port Townsend Paper Company at the Industrial Power (IP) rate. Port Townsend currently receives...

  19. INDUSTRIAL ENGINEERING Industrial engineering is concerned

    E-Print Network [OSTI]

    INDUSTRIAL ENGINEERING Industrial engineering is concerned with looking at the "big picture" of systems that allow organizations and individuals to perform at their best. Industrial engineers bridge should be used and how they should be used. Industrial engineers design and run the factories and systems

  20. INDUSTRIAL ENGINEERING Industrial engineering is concerned

    E-Print Network [OSTI]

    INDUSTRIAL ENGINEERING Industrial engineering is concerned with looking at the "big picture" of systems that allow organizations and individuals to perform at their best. Industrial engineers bridge should be used and how they should be used. The focus of industrial engineering is on process improvement

  1. Small Industrial

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541 *Impact NeutronSmall Business- News

  2. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  3. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  4. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  5. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  6. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  7. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  8. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  9. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  10. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  11. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  12. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  13. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  14. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  15. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  16. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  17. DOE Fuel Cell Technologies Office Record 14010: Industry Deployed...

    Broader source: Energy.gov (indexed) [DOE]

    DOE Hydrogen and Fuel Cells Program Record, Record 13008: Industry Deployed Fuel Cell Powered Lift Trucks Market Transformation Fact Sheet DOE Fuel Cell Technologies...

  18. DOE Fuel Cell Technologies Office Record 14009: Industry Deployed...

    Broader source: Energy.gov (indexed) [DOE]

    & Publications DOE Hydrogen and Fuel Cells Program Record 13007: Industry Deployed Fuel Cell Backup Power (BuP) DOE Hydrogen and Fuel Cells Program Record, Record 13008:...

  19. AEP (SWEPCO)- Commercial and Industrial Energy Efficiency Program

    Broader source: Energy.gov [DOE]

    South Western Electric Power Company (SWEPCO) as part of its C&I solutions program provides various incentives to its commercial and industrial customers to save energy. 

  20. Geothermal Industry Ends 2012 on a High Note | Department of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    additional highlights of geothermal industry development in 2012 were: The first hybrid solar-geothermal project was commissioned by Enel Green Power at its Stillwater Geothermal...

  1. Improve Overall Plant Efficiency and Fuel Use, Software Tools for Industry, Industrial Technologies Program (ITP) (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2008-12-01

    This fact sheet describes how the Industrial Technologies Program combined heat and power (CHP) tool can help identify energy savings in gas turbine-driven systems.

  2. Power Characteristics of Industrial Air Compressors 

    E-Print Network [OSTI]

    Schmidt, C.; Kissock, K.

    2003-01-01

    common types of compressor control for small reciprocating and rotary air compressors, and derive relations for estimating compressed air output as a function of the type of control and motor loading. Using these relations, we develop a method to estimate...

  3. Longmont Power & Communications - Commercial and Industrial Energy...

    Broader source: Energy.gov (indexed) [DOE]

    Motion Sensor Controls: 75 Building Envelope Window Replacement: 1.50sq. ft. Window Film: 0.73 - 1.00sq. ft. Roof Insulation: 0.16sq. ft. Wall Insulation: 0.03sq. ft....

  4. Beacon Power Corporation NREL Industry Growth Forum

    E-Print Network [OSTI]

    , the successful execution of the Company's plan of operation, changes in the Company's anticipated earnings;55 Safe Harbor Statement This presentation contains forward-looking statements, including the Company's beliefs about its business prospects and future results of operations. These statements involve risks

  5. Global Climate Change Electric Power Industry

    E-Print Network [OSTI]

    Ford, Andrew

    , and the European nations have launched the Emissions Trading Scheme (ETS), a three-year mandatory market

  6. SLS Power Industries Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,EnergyEastCarbon Development | OpenGmbHSEMOSEVILSITASJVNSKCSLS

  7. Solar Power Industries SPI | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc JumpHeter Battery TechnologySocovoltaicCorporation Ltd Jump to:SPI Jump to:

  8. Aditya Solar Power Industries | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAand DaltonSolar Energy LLCAdema Technologies Inc Jump to:

  9. The Industrialization of Thermoelectric Power Generation Technology |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsState of Pennsylvania U.S.The FirstEnergyDepartment of

  10. Electric Power Industry--Chap6

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry Natural GasNatural GasEIA lowers

  11. Power Plant Power Plant

    E-Print Network [OSTI]

    Stillwater Power Plant Wabuska Power Plant Casa Diablo Power Plant Glass Mountain Geothermal Area Lassen Geothermal Area Coso Hot Springs Power Plants Lake City Geothermal Area Thermo Geothermal Area Lakeview Geothermal Area Raft River Geothermal Area Cove Fort Power Plant Roosevelt Power Plant Borax Lake

  12. The Icelandic Power Situation

    E-Print Network [OSTI]

    Karlsson, Brynjar

    #12;The Icelandic Power Situation #12;Iceland generates the most electricity in Europe per capita plants and customers 52 MWh per capita #12;Electrical usage in Iceland Low cost reliable and renewable energy attracts power intensive industry to Iceland Households use only 5% 90% of district heating

  13. Power equipment applications

    SciTech Connect (OSTI)

    Seeley, R.S. (Consultant, Bridgewater, NJ (United States))

    1993-11-01

    Many considerations are taken into account in selecting equipment for power projects. The project often becomes a proving ground, benefiting equipment suppliers and developers. In designing and building power generation projects, developers and engineering and construction firms must go through the process of choosing the right equipment for the job. In doing so, a number of considerations regarding the benefits of selection and ease of installation must be taken into account. Understanding the selection process demonstrates how the independent power generation industry becomes a proving ground for different applications of power equipment. In turn, this adds more innovation and versatility to the entire power generation industry. It also provides lenders with examples of proven equipment that will more readily lead to successful financing in the future. Several developers and equipment vendors recently talked about how and why the choices were made for equipment like gas turbines, fluidized bed boilers, water treatment, power cooling equipment, and instruments and controls. 3 figs.

  14. Module-Integrated Power Converters Based on Universal Dock

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    power supply industry Power FETs, passives, microcontrollers, etc Much higher switching frequencies smaller passives ACPV Modules PV module with AC, rather than DC,...

  15. Mechanical, Industrial & Manufacturing

    E-Print Network [OSTI]

    Balasubramanian, Ravi

    Mechanical, Industrial & Manufacturing Engineering (MIME) COLLEGE OF ENGINEERING FY2013 Oregon graduate degrees (MS, MEng, PhD) in mechanical engineering, industrial engineering, and materials science. We offer bachelor's degrees in mechanical, industrial, manufacturing, and energy systems engineering

  16. Chemicals Industry Vision

    SciTech Connect (OSTI)

    none,

    1996-12-01

    Chemical industry leaders articulated a long-term vision for the industry, its markets, and its technology in the groundbreaking 1996 document Technology Vision 2020 - The U.S. Chemical Industry. (PDF 310 KB).

  17. Industrial and Systems engineering

    E-Print Network [OSTI]

    Berdichevsky, Victor

    Industrial and Systems engineering COLLEGE of ENGINEERING DepartmentofIndustrialandSystemsEngineering EDGE Engineering Entrepreneur Certificate Program is a great addition to an industrial and systems to expert clinical recommendations. engineering.wayne.edu/isefaculty Industrial and systems engineering

  18. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  19. Wireless Industrial Monitoring and Control using a Smart Sensor Platform

    E-Print Network [OSTI]

    California at Los Angeles, University of

    Wireless Industrial Monitoring and Control using a Smart Sensor Platform Harish Ramamurthy, B. S/RF link specific firmware modules `over-the-air'. Sample implementations for industrial applications attention of the industry on account of reduced costs, better power management, ease in maintenance

  20. ITP Mining: Water Use in Industries of the Future: Mining Industry

    Broader source: Energy.gov [DOE]

    Water and energy may be directly or indirectly related in the mining industry, and the connection is mainly through pumping power to transfer the water or aqueous slurries of mineral products to another location.

  1. Electric Utility Industry Update

    Broader source: Energy.gov [DOE]

    Presentation—given at the April 2012 Federal Utility Partnership Working Group (FUPWG) meeting—covers significant electric industry trends and industry priorities with federal customers.

  2. Uranium industry annual 1997

    SciTech Connect (OSTI)

    NONE

    1998-04-01

    This report provides statistical data on the U.S. uranium industry`s activities relating to uranium raw materials and uranium marketing.

  3. Industry Analysis February 2013

    E-Print Network [OSTI]

    Fletcher, Robin

    -Industries · Biodiesel ­ Biofuel ­ Alternate fuels ­ Green fuels ­ Renewable fuels/energy ­ Green energy ­ Green) · Business Source Complete - Company, market, industry news and articles · CBCA and Canadian Newsstand

  4. Chemical Industry Corrosion Management

    SciTech Connect (OSTI)

    2003-02-01

    Improved Corrosion Management Could Provide Significant Cost and Energy Savings for the Chemical Industry. In the chemical industry, corrosion is often responsible for significant shutdown and maintenance costs.

  5. Introduction The electric power grid and electric power

    E-Print Network [OSTI]

    Introduction The electric power grid and electric power industry are undergoing a dramatic transforma- tion. By linking information technologies with the electric power grid--to provide "electricity the standards process that will allow the many pieces of "the world's largest and most complex machine" to work

  6. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  7. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  8. Designing Industrial DSM Programs that Work 

    E-Print Network [OSTI]

    Nadel, S. M.; Jordan, J. A.

    1994-01-01

    successful program is discussed in the sections below. British Colwnbia Hydro Power Smart: Efficient Compressed Air Systems Program. BC Hydro has estimated that up to 50 % of the energy used in an industrial compressed air system can be lost through..., the utility will refund the customer's payment for the leak testing unit. The high participation rate has been attributed by the utility to extensive marketing efforts (Merrill 1992). BC Hydro Power Smart: Motor Rebate Program. BC Hydro's Power Smart...

  9. Nuclear power high technology colloquium: proceedings

    SciTech Connect (OSTI)

    Not Available

    1984-12-10

    Reports presenting information on technology advancements in the nuclear industry and nuclear power plant functions have been abstracted and are available on the energy data base.

  10. Hudson Light & Power- Photovoltaic Incentive Program

    Office of Energy Efficiency and Renewable Energy (EERE)

    Hudson Light & Power Department, the municipal utility for the Town of Hudson, offers a limited number of solar photovoltaic (PV) rebates for residential, commercial, industrial, and municipal...

  11. Barriers to Industrial Energy Efficiency - Report to Congress, June 2015

    SciTech Connect (OSTI)

    2015-06-01

    This report examines barriers that impede the adoption of energy efficient technologies and practices in the industrial sector, and identifies successful examples and opportunities to overcome these barriers. Three groups of energy efficiency technologies and measures were examined: industrial end-use energy efficiency, industrial demand response, and industrial combined heat and power. This report also includes the estimated economic benefits from hypothetical Federal energy efficiency matching grants, as directed by the Act.

  12. Barriers to Industrial Energy Efficiency - Study (Appendix A), June 2015

    SciTech Connect (OSTI)

    2015-06-01

    This study examines barriers that impede the adoption of energy efficient technologies and practices in the industrial sector, and identifies successful examples and opportunities to overcome these barriers. Three groups of energy efficiency technologies and measures were examined: industrial end-use energy efficiency, industrial demand response, and industrial combined heat and power. This study also includes the estimated economic benefits from hypothetical Federal energy efficiency matching grants, as directed by the Act.

  13. New players, opportunities and frustrations in the global marketplace -- Results of an industry-wide survey

    SciTech Connect (OSTI)

    Schwartz, R.

    1998-07-01

    Review of the annual industry-wide survey of the independent power industry, including top players, market shares, company growth rates, player activities by country and market expectations. The author offers fresh analysis on industry trends based on the survey, conducted through direct interviews with nearly 200 global power developers. Unlike other overviews offering demand projections of various power markets, this survey takes a look at the industry itself.

  14. Mechanical & Industrial Engineering

    E-Print Network [OSTI]

    Mountziaris, T. J.

    Mechanical & Industrial Engineering 1 Welcome MIE Industrial Advisory Board May 5th, 2011 #12;Mechanical & Industrial Engineering 2 IAB 2010-2011 · David K. Anderson ­ Alden Research Laboratory, Inc went on for three weeks Mechanical & Industrial Engineering 6 #12;Reza Shahbazian Yassar Mechanical

  15. INDUSTRIAL ENGINEERING GRADUATE PROGRAMS

    E-Print Network [OSTI]

    Gelfond, Michael

    INDUSTRIAL ENGINEERING GRADUATE PROGRAMS The Master of Science in Industrial Engineering (M Systems and Engineering (M.S.M.S.E.), the Doctor of Philosophy in Industrial Engineering, and the Doctor of Philosophy in Systems and Engineering Management programs prepare competent industrial engineers

  16. Industry Analysis October 2010

    E-Print Network [OSTI]

    Abolmaesumi, Purang

    Industry and Company research ­ they build on each other #12;Industry Studies Standard & Poor's Net of competitors Standard & Poor's NetAdvantage - See 'Industry Surveys' under the "Quick Links" #12;Where Common technologies are there industry standards, platforms manufacturing processes, outsourcing? #12

  17. Relationships between Western Area Power Administration`s power marketing program and hydropower operations at Salt Lake City area integrated projects

    SciTech Connect (OSTI)

    Veselka, T.D.; Folga, S.; Poch, L.A. [and others

    1995-03-01

    This technical memorandum provides background information on the Western Area Power Administration (Western) and the physical characteristics of the Salt Lake City Area Integrated Projects (SLCA/IP) hydropower plants, which include the Colorado River Storage Project, the Rio Grande Project, and the Collbran Project. In addition, the history, electrical capacity, storage capacity, and flow restrictions at each dam are presented. An overview of Western`s current programs and services, including a review of statutory authorities, agency discretion, and obligations, is also provided. The variability of SLCA/IP hourly generation under various alternative marketing strategies and purchasing programs is discussed. The effects of Western`s services, such as area load control, outage assistance, and transmission, on SLCA/IP power plant operations are analyzed.

  18. BONNEVILLE POWER ADMINISTRATION FOR IMMEDIATE RELEASE

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    publicly owned electric utilities have helped 473 industrial companies save enough energy to power nearly 60,000 homes for a year. PR 02 15 BONNEVILLE POWER ADMINISTRATION FOR...

  19. Electric Power annual 1996: Volume II

    SciTech Connect (OSTI)

    NONE

    1997-12-01

    This document presents a summary of electric power industry statistics. Data are included on electric utility retail sales of electricity, revenues, environmental information, power transactions, emissions, and demand-side management.

  20. Gasification world database 2007. Current industry status

    SciTech Connect (OSTI)

    NONE

    2007-10-15

    Information on trends and drivers affecting the growth of the gasification industry is provided based on information in the USDOE NETL world gasification database (available on the www.netl.doe.gov website). Sectors cover syngas production in 2007, growth planned through 2010, recent industry changes, and beyond 2010 - strong growth anticipated in the United States. A list of gasification-based power plant projects, coal-to-liquid projects and coal-to-SNG projects under consideration in the USA is given.

  1. Encouraging Industrial Demonstrations of Fuel Cell Applications 

    E-Print Network [OSTI]

    Anderson, J. M.

    1986-01-01

    INDUSTRIAL DEMONSTRATIONS OF FUEL CELL APPLICATIONS Joseph M~ Anderson, P.E. INDUSTRIAL FUEL CELL ASSOCIATION Lake Charles, Louisiana ABSTRACT Fuel Cell technology has advanced from a space-age curiosity to near commercial status within the last few... years. Both the electric and the gas utilities in the United States have conducted ambitious programs to oemonstrate the practicality of fuel cell power plants in a number of applications. The Japanese have been equally active in promoting a fuel...

  2. Electric power annual 1992

    SciTech Connect (OSTI)

    Not Available

    1994-01-06

    The Electric Power Annual presents a summary of electric utility statistics at national, regional and State levels. The objective of the publication is to provide industry decisionmakers, government policymakers, analysts and the general public with historical data that may be used in understanding US electricity markets. The Electric Power Annual is prepared by the Survey Management Division; Office of Coal, Nuclear, Electric and Alternate Fuels; Energy Information Administration (EIA); US Department of Energy. ``The US Electric Power Industry at a Glance`` section presents a profile of the electric power industry ownership and performance, and a review of key statistics for the year. Subsequent sections present data on generating capability, including proposed capability additions; net generation; fossil-fuel statistics; retail sales; revenue; financial statistics; environmental statistics; electric power transactions; demand-side management; and nonutility power producers. In addition, the appendices provide supplemental data on major disturbances and unusual occurrences in US electricity power systems. Each section contains related text and tables and refers the reader to the appropriate publication that contains more detailed data on the subject matter. Monetary values in this publication are expressed in nominal terms.

  3. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  4. Process modeling and industrial energy use

    SciTech Connect (OSTI)

    Howe, S O; Pilati, D A; Sparrow, F T

    1980-11-01

    How the process models developed at BNL are used to analyze industrial energy use is described and illustrated. Following a brief overview of the industry modeling program, the general methodology of process modeling is discussed. The discussion highlights the important concepts, contents, inputs, and outputs of a typical process model. A model of the US pulp and paper industry is then discussed as a specific application of process modeling methodology. Case study results from the pulp and paper model illustrate how process models can be used to analyze a variety of issues. Applications addressed with the case study results include projections of energy demand, conservation technology assessment, energy-related tax policies, and sensitivity analysis. A subsequent discussion of these results supports the conclusion that industry process models are versatile and powerful tools for energy end-use modeling and conservation analysis. Information on the current status of industry models at BNL is tabulated.

  5. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  6. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  7. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  8. Demand-Side Response from Industrial Loads

    SciTech Connect (OSTI)

    Starke, Michael R; Alkadi, Nasr E; Letto, Daryl; Johnson, Brandon; Dowling, Kevin; George, Raoule; Khan, Saqib

    2013-01-01

    Through a research study funded by the Department of Energy, Smart Grid solutions company ENBALA Power Networks along with the Oak Ridge National Laboratory (ORNL) have geospatially quantified the potential flexibility within industrial loads to leverage their inherent process storage to help support the management of the electricity grid. The study found that there is an excess of 12 GW of demand-side load flexibility available in a select list of top industrial facilities in the United States. Future studies will expand on this quantity of flexibility as more in-depth analysis of different industries is conducted and demonstrations are completed.

  9. Power marketing and renewable energy

    SciTech Connect (OSTI)

    Fang, J.M.

    1997-09-01

    Power marketing refers to wholesale and retail transactions of electric power made by companies other than public power entities and the regulated utilities that own the generation and distribution lines. The growth in power marketing has been a major development in the electric power industry during the last few years, and power marketers are expected to realize even more market opportunities as electric industry deregulation proceeds from wholesale competition to retail competition. This Topical Issues Brief examines the nature of the power marketing business and its relationship with renewable power. The information presented is based on interviews conducted with nine power marketing companies, which accounted for almost 54% of total power sales by power marketers in 1995. These interviews provided information on various viewpoints of power marketers, their experience with renewables, and their respective outlooks for including renewables in their resource portfolios. Some basic differences exist between wholesale and retail competition that should be recognized when discussing power marketing and renewable power. At the wholesale level, the majority of power marketers stress the commodity nature of electricity. The primary criteria for developing resource portfolios are the same as those of their wholesale customers: the cost and reliability of power supplies. At the retail level, electricity may be viewed as a product that includes value-added characteristics or services determined by customer preferences.

  10. Optimal Endogenous Carbon Taxes Electric Power Supply Chains with Power Plants

    E-Print Network [OSTI]

    Nagurney, Anna

    Optimal Endogenous Carbon Taxes for Electric Power Supply Chains with Power Plants Anna Nagurney for the determination of optimal carbon taxes applied to electric power plants in the con- text of electric power supply portion of such policy inter- ventions directed at the electric power industry. The general framework

  11. Educational/trainingEducational/training needs of Nuclear Powerneeds of Nuclear Power

    E-Print Network [OSTI]

    Educational/trainingEducational/training needs of Nuclear Powerneeds of Nuclear Power Industry [NPI.Activities of the NPI. ·· Activities important for a GreekActivities important for a Greek Nuclear Power Industry.Nuclear and models discussed are based on the USdiscussed are based on the US Nuclear Power Industry andNuclear Power

  12. INDUSTRIAL ENGINEER APPRENTICE OPPORTUNITY

    E-Print Network [OSTI]

    Pohl, Karsten

    INDUSTRIAL ENGINEER APPRENTICE OPPORTUNITY SUMMER 2013 Industrial Engineering COOP Student needed-Fri, for summer 2013. Student must be enrolled in BS Engineering program. (Preferably completed 2-3 yrs

  13. The Political Economy of Wind Power in China

    E-Print Network [OSTI]

    Swanson, Ryan Landon

    2011-01-01

    adds 18.9 GW of new wind power capacity in 2010. ? GlobalEnd Challenged Subsidies in Wind Power Case. ? Internationalemergence in the global wind power industry. ? Ph. D.

  14. Energy management system functions in deregulated power systems 

    E-Print Network [OSTI]

    Magnago, Fernando Hugo

    1997-01-01

    The market structures for electric energy and power are changing. In the past interconnected electric utility systems dealt only with each other to buy and sell power and energy. In recent times, the electric power industry is facing...

  15. The Political Economy of Wind Power in China

    E-Print Network [OSTI]

    Swanson, Ryan Landon

    2011-01-01

    Coco. ?China Rebuilds Its Power Grid as Part of Its CleanSchwartz, Louis. ?The Power Grid and Wind Industry in China:Measure on Supervision of Power-Grid Enterprise Purchases of

  16. PowerPoint Presentation

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    IP Imaging Products * Analytical Facilities (HRTEM, SIMS, XRD, UPSXPS) Vadient Optics (Corvallis, Oregon) 3D Freeform GRIN Optics * Spun out in 2013; Inkjet-printed...

  17. Geothermal Industry Partnership Opportunities

    Broader source: Energy.gov [DOE]

    Here you'll find links to information about partnership opportunities and programs for the geothermal industry.

  18. Vehicle-to-Grid Power: Battery, Hybrid, and Fuel Cell Vehicles as Resources for Distributed Electric Power in California

    E-Print Network [OSTI]

    Kempton, Willett; Tomic, Jasna; Letendre, Steven; Brooks, Alec; Lipman, Timothy

    2001-01-01

    and of the electric power grid, yet analysts, industries,be realized only if the power grid operator has control overplugged in when the power grid needs them. A. The California

  19. Industry Analysis January 2012

    E-Print Network [OSTI]

    Abolmaesumi, Purang

    ;8 Conference Board E-Library ­ Canadian industries, economic trends & forecasts ­ national, provincial1 CHEE 906 Industry Analysis January 2012 Constance Adamson, Stauffer Library adamsonc for both Industry and Company research ­ they build on each other #12;3 Where are they? · Library website

  20. Industrial Optimization Compact Course

    E-Print Network [OSTI]

    Kirches, Christian

    Industrial Optimization Compact Course and Challenge Workshop Optimization plays a crucial role in designing and conducting industrial processes. The potential gains range from saving valuable resources over makers from industry and academia to initiate new projects and to foster new structured collaborations

  1. Mechanical & Industrial Engineering

    E-Print Network [OSTI]

    Mountziaris, T. J.

    Mechanical & Industrial Engineering Mario A. Rotea Professor and Department Head #12;2Mechanical & Industrial Engineering Outline · Undergraduate Degree Programs · Graduate Degree Programs · The Faculty · The Research · Summary #12;3Mechanical & Industrial Engineering Undergraduate Programs ­ BSME & BSIE 0 20 40 60

  2. Photovoltaics industry profile

    SciTech Connect (OSTI)

    1980-10-01

    A description of the status of the US photovoltaics industry is given. Principal end-user industries are identified, domestic and foreign market trends are discussed, and industry-organized and US government-organized trade promotion events are listed. Trade associations and trade journals are listed, and a photovoltaic product manufacturers list is included. (WHK)

  3. Lessons learned from existing biomass power plants

    SciTech Connect (OSTI)

    Wiltsee, G.

    2000-02-24

    This report includes summary information on 20 biomass power plants, which represent some of the leaders in the industry. In each category an effort is made to identify plants that illustrate particular points. The project experiences described capture some important lessons learned that lead in the direction of an improved biomass power industry.

  4. Current and future industrial energy service characterizations

    SciTech Connect (OSTI)

    Krawiec, F.; Thomas, T.; Jackson, F.; Limaye, D.R.; Isser, S.; Karnofsky, K.; Davis, T.D.

    1980-10-01

    Current and future energy demands, end uses, and cost used to characterize typical applications and resultant services in the industrial sector of the United States and 15 selected states are examined. A review and evaluation of existing industrial energy data bases was undertaken to assess their potential for supporting SERI research on: (1) market suitability analysis, (2) market development, (3) end-use matching, (3) industrial applications case studies, and (4) identification of cost and performance goals for solar systems and typical information requirements for industrial energy end use. In reviewing existing industrial energy data bases, the level of detail, disaggregation, and primary sources of information were examined. The focus was on fuels and electric energy used for heat and power purchased by the manufacturing subsector and listed by 2-, 3-, and 4-digit SIC, primary fuel, and end use. Projections of state level energy prices to 1990 are developed using the energy intensity approach. The effects of federal and state industrial energy conservation programs on future industrial sector demands were assessed. Future end-use energy requirements were developed for each 4-digit SIC industry and were grouped as follows: (1) hot water, (2) steam (212 to 300/sup 0/F, each 100/sup 0/F interval from 300 to 1000/sup 0/F, and greater than 1000/sup 0/F), and (3) hot air (100/sup 0/F intervals). Volume I details the activities performed in this effort.

  5. Long-Term Nuclear Industry Outlook - 2004

    SciTech Connect (OSTI)

    Reichmuth, Barbara A.; Wood, Thomas W.; Johnson, Wayne L.

    2004-09-30

    The nuclear industry has become increasingly efficient and global in nature, but may now be poised at a crossroads between graceful decline and profound growth as a viable provider of electrical energy. Predicted population and energy-demand growth, an increased interest in global climate change, the desire to reduce the international dependence on oil as an energy source, the potential for hydrogen co-generation using nuclear power reactors, and the improved performance in the nuclear power industry have raised the prospect of a “nuclear renaissance” in which nuclear power would play an increasingly more important role in both domestic and international energy market. This report provides an assessment of the role nuclear-generated power will plan in the global energy future and explores the impact of that role on export controls.

  6. Industrial Dojo Program Fosters Industrial Internet Development | GE Global

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THE SITE-218inper ThousandIndustrialResearch

  7. Feasibility Study of Economics and Performance of Solar Photovoltaics at the Peru Mill Industrial Park in the City of Deming, New Mexico. A Study Prepared in Partnership with the Environmental Protection Agency for the RE-Powering America's Land Initiative: Siting Renewable Energy on Potentially Contaminated Land and Mine Sites

    SciTech Connect (OSTI)

    Kiatreungwattana, K.; Geiger, J.; Healey, V.; Mosey, G.

    2013-04-01

    The U.S. Environmental Protection Agency (EPA), in accordance with the RE-Powering America's Land initiative, selected the Peru Mill Industrial Park site in the City of Deming, New Mexico, for a feasibility study of renewable energy production. The National Renewable Energy Laboratory (NREL) provided technical assistance for this project. The purpose of this report is to assess the site for a possible photovoltaic (PV) system installation and estimate the cost, performance, and site impacts of different PV options. In addition, the report recommends financing options that could assist in the implementation of a PV system at the site.

  8. INDUSTRIAL RELATIONS 1. Agreements with Industry

    E-Print Network [OSTI]

    of the New Hampshire Industrial Research Center (NHIRC), a cooperative project of the New Hampshire Department of Resources and Economic Development (DRED), the University of New Hampshire (UNH), and Dartmouth

  9. Industrial policy and the Indian electronics industry

    E-Print Network [OSTI]

    Love, Robert (Robert Eric)

    2008-01-01

    Recently, production within India's Electronics sector amounted to a low $12 billion when compared to the global output of $1400 billion. The slow growth in the local industry is often judged to be the result of late ...

  10. Industrial Dojo Program Fosters Industrial Internet Development...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dojo,' Contributes to Open Source to Foster Continued Development of the Industrial Internet Click to email this to a friend (Opens in new window) Share on Facebook (Opens in new...

  11. Industry`s turnaround looks real

    SciTech Connect (OSTI)

    NONE

    1997-08-01

    The paper discusses the industry outlook for North American gas and oil industries. In a robust Canada, land sales are setting records, drilling is up, and output is rising beyond last year`s 21% growth. A perception among US operators that wellhead prices will remain stable is translating to increased spending. The USA, Canada, Mexico, Cuba are evaluated separately, with brief evaluations of Greenland, Guatemala, Belize, and Costa Rico. Data are presented on drilling activities.

  12. Defying value-shift : how incumbents regain values in the industry with new technologies

    E-Print Network [OSTI]

    Kuramoto, Yukari

    2010-01-01

    Historically, incumbent assembly firms with unquestionable strong positions in such industries as the automobile, consumer electronics, computer and mobile phone industries, have lost power when new technology is introduced; ...

  13. WEATHERIZATION INDUSTRIES SAVE ENERGY ST SE SALEM, OREGON 97301 (503) 5691381 WEATHERIZATIONALLIES@GMAIL.COM

    E-Print Network [OSTI]

    WEATHERIZATION INDUSTRIES SAVE ENERGY 565 21ST ST SE SALEM, OREGON 97301 · (503) 5691381 AND CONSERVATION COUNCIL'S CONSERVATION PLANNING ASSUMPTIONS Weatherization Industries Save Energy (WISE · WEATHERIZATIONALLIES@GMAIL.COM COMMENTS ON ACHIEVABLE SAVINGS: A RETROSPECTIVE LOOK AT THE NORTHWEST POWER

  14. Photovoltaic industry progress through 1984

    SciTech Connect (OSTI)

    Watts, R.L.; Smith, S.A.; Dirks, J.A.

    1985-04-01

    The growth of the US photovoltaics (PV) industry over the past decade has been impressive. First designed to provide power for satellites using high-cost production techniques, PV is now the economical choice in many remote terrestrial applications. The remarkable growth of PV in terms of quality of cells and modules, production techniques, and system design, was initiated by a cooperative effort of the US Government and the domestic PV manufacturers. European and Japanese firms entered the PV industry later, but are also growing rapidy. The Europeans continue to supply PV systems for village electrification and water pumping to many Third World countries. The Japanese have been developing the amorphous silicon (A-Si) technology by expanding its use in consumer goods. The world PV industry saw dramatic changes in industry ownership and in the emphasis on developing new and improved technology during 1984. The objective of this report is to present information on the developments of the world PV industry and focuses on developments occurring in 1984. Information is presented on a regional basis (US, Europe, Japan, other) to avoid disclosing company-confidential data. All information was gleaned from several sources, including a review of the technical literature and direct contacts with PV manufacturers. Prior to publishing the regional totals, all numbers were compared with those of other sources. The information contained in this report is prepared for use by the Department of Energy for their use in long-term R and D planning. However, this information should also be of interest by PV manufacturers and to those who may be contemplating entering the PV market. PV shipments for 1984, government supports for PV, and various PV market sectors are discussed.

  15. INDUSTRIAL&SYSTEMS Industrial and Systems engineers use engineering

    E-Print Network [OSTI]

    Rohs, Remo

    78 INDUSTRIAL&SYSTEMS Industrial and Systems engineers use engineering and business principles companies compete in today's global marketplace. The Industrial and Systems engineer's task is to take of industries including consulting, technology development, software, supply chain manufacturing, engineering

  16. Industry Cluster Development Grant winners

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THE SITE-218inperHygiene AmesSafety GeneralIndustry

  17. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  18. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  19. In addition, the court properly has jurisdiction over a counterclaim...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    power to the DSIs; (2) if Bonneville chooses to sell power to the DSIs, it must first offer industrial firm power at the IP rate before offering any other form of power at a...

  20. Midwest Industrial Energy Efficiency Handbook

    SciTech Connect (OSTI)

    2010-06-25

    This Industrial Technologies Program handbook connects industry with the various energy efficiency resources available in the midwest.

  1. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  2. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  3. Enhanced interleaved partitioning PTS for peak-to-average power ratio reduction in

    E-Print Network [OSTI]

    -PTS is proposed that can be used to produce fully independent candidates so that IP-PTS can achieve similar perforEnhanced interleaved partitioning PTS for peak-to-average power ratio reduction in OFDM systems G. Lu, P. Wu and C. Carlemalm-Logothetis The independence of the candidates generated in the existing

  4. Optimizing Process Loads in Industrial Cogeneration Energy Systems 

    E-Print Network [OSTI]

    Ahner, D. J.; Babson, P. E.

    1995-01-01

    W OPTIMIZING PROCESS LOADS IN INDUSTRIAL COGENERAnON ENERGY SYSTEMS DJ. Ahner Manager, Generation Technology Power Tecbnologies, Inc. Schenectady, New York ABSTRACT Optimum dispatcb of energy supply systems can result in large savings... and industrial cogeneration are extended to solving this trigeneration problem where the optimum dispatch of the final load devices (i.e. compressors, fans, pumps, etc.) are an integral part of the total energy system optimization. An example industrial...

  5. Secretary Chu Announces More than $155 Million for Industrial...

    Office of Environmental Management (EM)

    both the heat and power needed for industrial processes on-site, instead of using electricity from the grid, and can be nearly twice as efficient as conventional heat and...

  6. Large Industrial Renewable Energy Purchase Program (New Brunswick)

    Broader source: Energy.gov [DOE]

    Beginning January 1, 2012 the Large Industrial Renewable Energy Purchase Program allows NB Power to purchase renewable energy generated by its largest customers at a rate of $95/MWh. This...

  7. Achieving business and operational excellence in the pharmaceutical industry

    E-Print Network [OSTI]

    Coffey, Shonna (Shonna Marie)

    2008-01-01

    Historically the pharmaceutical industry has been highly profitable. However, the increasing regulatory requirements, bargaining power of buyers, and drug failures together with the threat of biosimilars and decreasing R&D ...

  8. BPA Letter announcing draft contract for Direct Service Industries...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    discussion with parties to help the agency decide the amount of power that it should offer to the direct-service industries (DSIs) and the terms of such offer. BPA published a...

  9. Case Studies of Industrial Cogeneration in the U. S. 

    E-Print Network [OSTI]

    Limaye, D. R.; Isser, S.; Hinkle, B.; Hough, T.

    1980-01-01

    This paper describes the results of a survey and evaluation of plant-specific information on industrial cogeneration. The study was performed as part of a project sponsored by the Electric Power Research Institute to evaluate Dual Energy Use Systems...

  10. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  11. Key Challenges in the North American Power Grid | GE Global Research

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    A Journey Inside the Complex and Powerful World of Industrial Circuit Breakers Bringing Technology to Life Photovoltaic Power Generation in Flagstaff Subscribe to Future Posts...

  12. CPES Power Management Consortium -with Extended Scope of Work

    E-Print Network [OSTI]

    Ha, Dong S.

    , networking products, telecom equipment, solid state lighting and other industrial and consumer electronic frequency modeling · Digital control · High efficiency power architectures for laptops, desktops and servers Manufacturing Innovation Institute (NGPEMII)". CPES is in partnership with this multi-industry, multi

  13. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  14. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  15. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  16. CASL - Industry Council

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Member round Robin Discussion and New Action items Organization Senior Leadership Technical Leadership Outreach Board of Directors Industry Council Science Council One-Roof Culture...

  17. CASL - Industry Council Resources

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2014 March 17, 2015 Upcoming Meeting Information Organization Senior Leadership Technical Leadership Outreach Board of Directors Industry Council Science Council One-Roof Culture...

  18. Presentations for Industry

    Broader source: Energy.gov [DOE]

    Learn energy-saving strategies from leading manufacturing companies and energy experts. The presentations are organized below by topic area. In addition, industrial energy managers, utilities, and...

  19. AMO Industrial Distributed Energy: Industrial Distributed Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    in owning and operating costs, thereby improving the economics of distributed power generation using reciprocating gas engines. Caterpillar's Phase I technologies have...

  20. Feasibility Study Of Advanced Technology Hov Systems: Volume 2b: Emissions Impact Of Roadway-powered Electric Buses, Light-duty Vehicles, And Automobiles

    E-Print Network [OSTI]

    Miller, Mark A.; Dato, Victor; Chira-chavala, Ted

    1992-01-01

    for: Types of power plants in California Uncontrolledboiler power plants in Southern California. The authorsCalifornia Air Resources Board, Uncontrolled and Controlled Power Industrial Plant

  1. Potential Energy Savings and CO2 Emissions Reduction of China's Cement Industry

    E-Print Network [OSTI]

    Ke, Jing

    2013-01-01

    Specific cement energy consumption: conversion of power into2006. Cement industry energy consumption status and energyZhou, H. , 2007a. Energy consumption and environment

  2. Smart Grid as a Driver for Energy-Intensive Industries: A Data Center Case Study

    E-Print Network [OSTI]

    Ganti, Venkata

    2014-01-01

    Actions for Industrial Demand Response in California. LBNL-and Techniques for Demand Response. California EnergyFlex your Power. 2008. Demand Response Programs. Available

  3. Production v. conservation in the utility industry. Hearing before the Subcommittee on Energy Conservation and Power of the Committee on Energy and Commerce, House of Representatives, Ninety-Seventh Congress, First Session, April 3, 1981

    SciTech Connect (OSTI)

    Not Available

    1981-01-01

    Amory Lovins of Friends of the Earth and three officers of the American Nuclear Energy Council debated the relative merits of energy efficiency and energy production for electric utilities. Congressional review of utility financial problems will include the arguments for and against new power plant construction. The testimony is followed by additional material submitted for the record by both organizations. (DCK)

  4. and Industrial Engineering

    E-Print Network [OSTI]

    Mountziaris, T. J.

    45 Mechanical and Industrial Engineering 220 Engineering Lab Degrees: Bachelor of Science in Mechanical Engineering Bachelor of Science in Industrial Engineering Contact: James R. Rinderle, Undergraduate Program Director Office: 207C Engineering Lab Building Phone: (413) 545-2505 Head of Department

  5. Uranium industry annual 1996

    SciTech Connect (OSTI)

    1997-04-01

    The Uranium Industry Annual 1996 (UIA 1996) provides current statistical data on the US uranium industry`s activities relating to uranium raw materials and uranium marketing. The UIA 1996 is prepared for use by the Congress, Federal and State agencies, the uranium and nuclear electric utility industries, and the public. Data on uranium raw materials activities for 1987 through 1996 including exploration activities and expenditures, EIA-estimated reserves, mine production of uranium, production of uranium concentrate, and industry employment are presented in Chapter 1. Data on uranium marketing activities for 1994 through 2006, including purchases of uranium and enrichment services, enrichment feed deliveries, uranium fuel assemblies, filled and unfilled market requirements, uranium imports and exports, and uranium inventories are shown in Chapter 2. A feature article, The Role of Thorium in Nuclear Energy, is included. 24 figs., 56 tabs.

  6. Posted 3/2/13 Medline Industries Industrial Engineer

    E-Print Network [OSTI]

    Heller, Barbara

    Posted 3/2/13 Medline Industries ­ Industrial Engineer Medline Industries, Inc. has an immediate opening for an Industrial Engineer for our SPT Division located in Waukegan, IL. We are seeking a hard-working, detail-oriented professional with experience in industrial engineering and lean manufacturing within

  7. INDUSTRIAL&SYSTEMS Industrial and Systems engineers use engineering

    E-Print Network [OSTI]

    Rohs, Remo

    78 INDUSTRIAL&SYSTEMS Industrial and Systems engineers use engineering and business principles companies compete in today's global marketplace. The Industrial and Systems engineer's task is to take · Industrial and Systems Engineering Bachelor of Science 128 units · Industrial and Systems Engineering

  8. INDUSTRIAL & SYSTEMS Industrial and Systems engineers use engineering

    E-Print Network [OSTI]

    Rohs, Remo

    78 INDUSTRIAL & SYSTEMS Industrial and Systems engineers use engineering and business principles companies compete in todays global marketplace. The Industrial and Systems engineers task is to take limited Industrial and Systems Engineering Bachelor of Science 128 units Industrial and Systems Engineering

  9. INDUSTRIAL&SYSTEMS Industrial and Systems engineers use

    E-Print Network [OSTI]

    Rohs, Remo

    78 INDUSTRIAL&SYSTEMS Industrial and Systems engineers use engineering and business principles companies compete in today's global marketplace. The Industrial and Systems engineer's task is to take · Industrial and Systems Engineering Bachelor of Science 128 units · Industrial and Systems Engineering

  10. Electric power annual 1995. Volume II

    SciTech Connect (OSTI)

    NONE

    1996-12-01

    This document summarizes pertinent statistics on various aspects of the U.S. electric power industry for the year and includes a graphic presentation. Data is included on electric utility retail sales and revenues, financial statistics, environmental statistics of electric utilities, demand-side management, electric power transactions, and non-utility power producers.

  11. Making Industry Part of the Climate Solution

    SciTech Connect (OSTI)

    Lapsa, Melissa Voss; Brown, Dr. Marilyn Ann; Jackson, Roderick K; Cox, Matthew; Cortes, Rodrigo; Deitchman, Benjamin H

    2011-06-01

    Improving the energy efficiency of industry is essential for maintaining the viability of domestic manufacturing, especially in a world economy where production is shifting to low-cost, less regulated developing countries. Numerous studies have shown the potential for significant cost-effective energy-savings in U.S. industries, but the realization of this potential is hindered by regulatory, information, workforce, and financial obstacles. This report evaluates seven federal policy options aimed at improving the energy efficiency of industry, grounded in an understanding of industrial decision-making and the barriers to efficiency improvements. Detailed analysis employs the Georgia Institute of Technology's version of the National Energy Modeling System and spreadsheet calculations, generating a series of benefit/cost metrics spanning private and public costs and energy bill savings, as well as air pollution benefits and the social cost of carbon. Two of the policies would address regulatory hurdles (Output-Based Emissions Standards and a federal Energy Portfolio Standard with Combined Heat and Power); three would help to fill information gaps and workforce training needs (the Superior Energy Performance program, Implementation Support Services, and a Small Firm Energy Management program); and two would tackle financial barriers (Tax Lien Financing and Energy-Efficient Industrial Motor Rebates). The social benefit-cost ratios of these policies appear to be highly favorable based on a range of plausible assumptions. Each of the seven policy options has an appropriate federal role, broad applicability across industries, utilizes readily available technologies, and all are administratively feasible.

  12. Handbook of industrial and hazardous wastes treatment. 2nd ed.

    SciTech Connect (OSTI)

    Lawrence Wang; Yung-Tse Hung; Howard Lo; Constantine Yapijakis

    2004-06-15

    This expanded Second Edition offers 32 chapters of industry- and waste-specific analyses and treatment methods for industrial and hazardous waste materials - from explosive wastes to landfill leachate to wastes produced by the pharmaceutical and food industries. Key additional chapters cover means of monitoring waste on site, pollution prevention, and site remediation. Including a timely evaluation of the role of biotechnology in contemporary industrial waste management, the Handbook reveals sound approaches and sophisticated technologies for treating: textile, rubber, and timber wastes; dairy, meat, and seafood industry wastes; bakery and soft drink wastes; palm and olive oil wastes; pesticide and livestock wastes; pulp and paper wastes; phosphate wastes; detergent wastes; photographic wastes; refinery and metal plating wastes; and power industry wastes. This final chapter, entitled 'Treatment of power industry wastes' by Lawrence K. Wang, analyses the stream electric power generation industry, where combustion of fossil fuels coal, oil, gas, supplies heat to produce stream, used then to generate mechanical energy in turbines, subsequently converted to electricity. Wastes include waste waters from cooling water systems, ash handling systems, wet-scrubber air pollution control systems, and boiler blowdown. Wastewaters are characterized and waste treatment by physical and chemical systems to remove pollutants is presented. Plant-specific examples are provided.

  13. Creating Value Wood Products Industry

    E-Print Network [OSTI]

    1 Creating Value for the Wood Products Industry Creating Value for the Wood Products Industry for the Wood Products Industry The forest industry contributes more than 50 percent of the total value of all assistance to the primary and value-added processing wood products industries in Louisiana. Since its

  14. Wind Vision: A New Era for Wind Power

    Broader source: Energy.gov (indexed) [DOE]

    results from a collaboration of the DOE with over 250 experts from industry, electric power system operators, environmental stewardship organizations, state and federal...

  15. Wind Power: How Much, How Soon, and At What Cost?

    E-Print Network [OSTI]

    Wiser, Ryan H

    2010-01-01

    on U.S. Wind Power Installation, Cost, and Performanceaccess the nation's lowest-cost wind resources can be builtpressure on installed wind project costs while the industry

  16. Marine & Hydrokinetic Technologies, Wind and Water Power Program...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and evaluate various technology types. Technology Development, Testing & Deployment Water Power Program projects support the marine and hydro- kinetic technology industry in its...

  17. Omaha Public Power District- Commercial Energy Efficiency Rebate Programs

    Office of Energy Efficiency and Renewable Energy (EERE)

    Omaha Public Power District (OPPD) offers incentives for commercial and industrial customers to install energy-efficient heat pumps and replace/retrofit existing lighting systems. The Commercial...

  18. Combined Heat and Power (CHP) Installation Market to be Driven...

    Open Energy Info (EERE)

    overall combined heat and power installation market owing to widespread application in residential, commercial, and industrial segments. The growth of the Europe market can also...

  19. Ultra-Efficient and Power-Dense Electric Motors

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Ultra-Efficient and Power-Dense Electric Motors Advanced Electric Motors Offer Large Energy Savings in Industrial Applications Pumps, fans, and compressors use more than 60% of...

  20. Power Politics: The Political Economy of Russia's Electricity Sector Liberalization

    E-Print Network [OSTI]

    Wengle, Susanne Alice

    2010-01-01

    Private Participation in the Electricity Sector World BankTelecommunications and Electricity Sectors." Governance 19,Power Struggle: Reforming the Electricity Industry." In The

  1. Hudson Light and Power- Photovoltaic Incentive Program (Massachusetts)

    Broader source: Energy.gov [DOE]

    Starting in 2011, Hudson Light and Power Department, the municipal utility for the Town of Hudson, started offering a limited number of photovoltaic rebates for residential, commercial, industrial,...

  2. Industrial process surveillance system

    DOE Patents [OSTI]

    Gross, K.C.; Wegerich, S.W.; Singer, R.M.; Mott, J.E.

    1998-06-09

    A system and method are disclosed for monitoring an industrial process and/or industrial data source. The system includes generating time varying data from industrial data sources, processing the data to obtain time correlation of the data, determining the range of data, determining learned states of normal operation and using these states to generate expected values, comparing the expected values to current actual values to identify a current state of the process closest to a learned, normal state; generating a set of modeled data, and processing the modeled data to identify a data pattern and generating an alarm upon detecting a deviation from normalcy. 96 figs.

  3. Industrial Process Surveillance System

    DOE Patents [OSTI]

    Gross, Kenneth C. (Bolingbrook, IL); Wegerich, Stephan W (Glendale Heights, IL); Singer, Ralph M. (Naperville, IL); Mott, Jack E. (Idaho Falls, ID)

    2001-01-30

    A system and method for monitoring an industrial process and/or industrial data source. The system includes generating time varying data from industrial data sources, processing the data to obtain time correlation of the data, determining the range of data, determining learned states of normal operation and using these states to generate expected values, comparing the expected values to current actual values to identify a current state of the process closest to a learned, normal state; generating a set of modeled data, and processing the modeled data to identify a data pattern and generating an alarm upon detecting a deviation from normalcy.

  4. Industrial process surveillance system

    DOE Patents [OSTI]

    Gross, Kenneth C. (Bolingbrook, IL); Wegerich, Stephan W. (Glendale Heights, IL); Singer, Ralph M. (Naperville, IL); Mott, Jack E. (Idaho Falls, ID)

    1998-01-01

    A system and method for monitoring an industrial process and/or industrial data source. The system includes generating time varying data from industrial data sources, processing the data to obtain time correlation of the data, determining the range of data, determining learned states of normal operation and using these states to generate expected values, comparing the expected values to current actual values to identify a current state of the process closest to a learned, normal state; generating a set of modeled data, and processing the modeled data to identify a data pattern and generating an alarm upon detecting a deviation from normalcy.

  5. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  6. Oklahoma Industrial Energy Management Program 

    E-Print Network [OSTI]

    Turner, W. C.; Webb, R. E.; Phillips, J. M.; Viljoen, T. A.

    1979-01-01

    series of tuition free Industrial Energy Management Conferences (over 20 given to date involving many Oklahoma industries). 2. A free energy newsletter entitled "Energy Channel" mailed to all participating Oklahoma industries. 3. A series of Energy...

  7. Innovative Energy Efficient Industrial Ventilation 

    E-Print Network [OSTI]

    Litomisky, A.

    2005-01-01

    This paper was written to describe an innovative “on-demand” industrial ventilation system for woodworking, metalworking, food processing, pharmaceutical, chemical, and other industries. Having analyzed existing industrial ventilation in 130...

  8. Caraustar Industries Energy Assessment

    SciTech Connect (OSTI)

    2010-06-25

    This plant-wide assessment case study is about commissioned energy assessments by the U.S. Department of Energy Industrial Technologies Program at two of Caraustar's recycled paperboard mills.

  9. Industrial Decision Making 

    E-Print Network [OSTI]

    Elliott, R. N.; McKinney, V.; Shipley, A.

    2008-01-01

    Domestic industrial investment has declined due to unfavorable energy prices, and external markets. Investment behavior has changed over the past few years, and will continue due to high labor costs, tight markets and an unstable U.S. economy...

  10. Industrial Assessment Center

    SciTech Connect (OSTI)

    J. Kelly Kissock; Becky Blust

    2007-04-17

    The University of Dayton (UD) performed energy assessments, trained students and supported USDOE objectives. In particular, the UD Industrial Assessment Center (IAC) performed 96 industrial energy assessment days for mid-sized manufacturers. The average identified and implemented savings on each assessment were $261,080 per year and $54,790 per year. The assessments served as direct training in industrial energy efficiency for 16 UD IAC students. The assessments also served as a mechanism for the UD IAC to understand manufacturing energy use and improve upon the science of manufacturing energy efficiency. Specific research results were published in 16 conference proceedings and journals, disseminated in 22 additional invited lectures, and shared with the industrial energy community through the UD IAC website.

  11. BTU Accounting for Industry 

    E-Print Network [OSTI]

    Redd, R. O.

    1979-01-01

    Today, as never before, American industry needs to identify and control their most critical resources. One of these is energy. In 1973 and again in 1976, the American public and business was confronted with critical energy supply problems. As a...

  12. AI Industrial Engineering 

    E-Print Network [OSTI]

    Unknown

    2011-08-17

    This paper describes the California Energy Commission’s (Commission) energy policies and programs that save energy and money for California’s manufacturing and food processing industries to help retain businesses in-state and reduce greenhouse gases...

  13. Uranium Industry Annual, 1992

    SciTech Connect (OSTI)

    Not Available

    1993-10-28

    The Uranium Industry Annual provides current statistical data on the US uranium industry for the Congress, Federal and State agencies, the uranium and electric utility industries, and the public. The feature article, ``Decommissioning of US Conventional Uranium Production Centers,`` is included. Data on uranium raw materials activities including exploration activities and expenditures, resources and reserves, mine production of uranium, production of uranium concentrate, and industry employment are presented in Chapter 1. Data on uranium marketing activities including domestic uranium purchases, commitments by utilities, procurement arrangements, uranium imports under purchase contracts and exports, deliveries to enrichment suppliers, inventories, secondary market activities, utility market requirements, and uranium for sale by domestic suppliers are presented in Chapter 2.

  14. Industrial energy use indices 

    E-Print Network [OSTI]

    Hanegan, Andrew Aaron

    2009-05-15

    Energy use index (EUI) is an important measure of energy use which normalizes energy use by dividing by building area. Energy use indices and associated coefficients of variation are computed for major industry categories ...

  15. Utility and Industrial Partnerships 

    E-Print Network [OSTI]

    Sashihara, T. F.

    1989-01-01

    In the past decade, many external forces have shocked both utilities and their large industrial customers into seeking more effective ways of coping and surviving. One such way is to develop mutually beneficial partnerships optimizing the use...

  16. Industrial energy use indices 

    E-Print Network [OSTI]

    Hanegan, Andrew Aaron

    2008-10-10

    Energy use index (EUI) is an important measure of energy use which normalizes energy use by dividing by building area. Energy use indices and associated coefficients of variation are computed for major industry categories ...

  17. Animal Industries Building 

    E-Print Network [OSTI]

    Unknown

    2011-08-17

    Plant managers around the world are interested in improving the energy efficiency of their facilities while both growing and modernizing their manufacturing capabilities. Emerging industrial technologies, both at the ...

  18. Animal Industries Building 

    E-Print Network [OSTI]

    Unknown

    2011-08-17

    Industrial steam users recognize the need to reduce system cost in order to remain internationally competitive. Steam systems are a key utility that influence cost significantly, and represent a high value opportunity ...

  19. Steel Industry Profile

    Broader source: Energy.gov [DOE]

    The steel industry is critical to the U.S. economy. Steel is the material of choice for many elements of manufacturing, construction, transportation, and various consumer products. Traditionally...

  20. Optimization of opportunistic replacement activities: A case study in the aircraft industry

    E-Print Network [OSTI]

    Patriksson, Michael

    examples are power plants (e.g., water and nuclear plants), processing industry (e.g., paper plantsOptimization of opportunistic replacement activities: A case study in the aircraft industry Torgny Svensson # Abstract In the aircraft industry maximizing availability is essential. Maintenance schedules

  1. Industrial Fuel Flexibility Workshop

    SciTech Connect (OSTI)

    none,

    2006-09-01

    On September 28, 2006, in Washington, DC, ITP and Booz Allen Hamilton conducted a fuel flexibility workshop with attendance from various stakeholder groups. Workshop participants included representatives from the petrochemical, refining, food and beverage, steel and metals, pulp and paper, cement and glass manufacturing industries; as well as representatives from industrial boiler manufacturers, technology providers, energy and waste service providers, the federal government and national laboratories, and developers and financiers.

  2. Industrial Compressed Air System Energy Efficiency Guidebook.

    SciTech Connect (OSTI)

    United States. Bonneville Power Administration.

    1993-12-01

    Energy efficient design, operation and maintenance of compressed air systems in industrial plants can provide substantial reductions in electric power and other operational costs. This guidebook will help identify cost effective, energy efficiency opportunities in compressed air system design, re-design, operation and maintenance. The guidebook provides: (1) a broad overview of industrial compressed air systems, (2) methods for estimating compressed air consumption and projected air savings, (3) a description of applicable, generic energy conservation measures, and, (4) a review of some compressed air system demonstration projects that have taken place over the last two years. The primary audience for this guidebook includes plant maintenance supervisors, plant engineers, plant managers and others interested in energy management of industrial compressed air systems.

  3. Superior Energy Performance Industrial Facility Best Practice...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Industrial Facility Best Practice Scorecard Superior Energy Performance Industrial Facility Best Practice Scorecard Superior Energy Performance logo Industrial facilities seeking...

  4. Effects of interplanetary shock inclinations on auroral power intensity

    E-Print Network [OSTI]

    Oliveira, D M; Tsurutani, B T; Gjerloev, J W

    2015-01-01

    We derive fast forward interplanetary (IP) shock speeds and impact angles to study the geoeffectivness of 461 IP shocks that occurred from January 1995 to December 2013 using ACE and WIND spacecraft data. The geomagnetic activity is inferred from the SuperMAG project data. SuperMAG is a large chain which employs more than 300 ground stations to compute enhanced versions of the traditional geomagnetic indices. The SuperMAG auroral electroject SME index, an enhanced version of the traditional AE index, is used as an auroral power (AP) indicator. AP intensity jumps triggered by shock impacts are correlated with both shock speed and impact angle. It is found that high AP intensity events typically occur when high speed IP shocks impact the Earths magnetosphere with the shock normal almost parallel to the Sun-Earth line. This result suggests that symmetric and strong magnetospheric compression leads to favorable conditions for intense auroral power release, as shown previously by simulations and observations. Some...

  5. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  6. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  7. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  8. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  9. Identifying industrial best practices for the waste minimization of low-level radioactive materials

    SciTech Connect (OSTI)

    Levin, V.

    1996-04-01

    In US DOE, changing circumstances are affecting the management and disposal of solid, low-level radioactive waste (LLW). From 1977 to 1991, the nuclear power industry achieved major reductions in solid waste disposal, and DOE is interested in applying those practices to reduce solid waste at DOE facilities. Project focus was to identify and document commercial nuclear industry best practices for radiological control programs supporting routine operations, outages, and decontamination and decommissioning activities. The project team (DOE facility and nuclear power industry representatives) defined a Work Control Process Model, collected nuclear power industry Best Practices, and made recommendations to minimize LLW at DOE facilities.

  10. Predictive models for power dissipation in optical transceivers

    E-Print Network [OSTI]

    Butler, Katherine, 1981-

    2004-01-01

    Power dissipation in optical networks is a significant problem for the telecommunications industry. The optical transceiver was selected as a representative device of the network, and a component based power model is ...

  11. EIS-0123: Direct Service Industry Options

    Broader source: Energy.gov [DOE]

    BPA proposes to implement one or more options to reduce load fluctuations and revenue uncertainty resulting from its electrical service to 10 aluminum smelters and its other direct service industrial customers. BPA believes these options will give BPA greater ability to plan for power needs and help to maintain its relatively strong financial position during the current period of power surplus. They also are expected to enhance BPA's ability to repay the U.S. Treasury. In turn, BPA rates to other customers would stabilize.

  12. Mechanical and Industrial Engineering Industry Advisory Board University of Massachusetts Amherst

    E-Print Network [OSTI]

    Mountziaris, T. J.

    9/13/2007 Mechanical and Industrial Engineering Industry Advisory Board University of Massachusetts Amherst Department of Mechanical and Industrial Engineering About the Mechanical and Industrial Engineering Industry Advisory Board The purpose of the Mechanical and Industrial Engineering Industry Advisory

  13. Industry/Utility Partnerships: Formula for Success 

    E-Print Network [OSTI]

    Smith, W. R.; Spriggs, H. D.

    1995-01-01

    /UTILITY PARTNERSHIPS: FORMULA FOR SUCCESS William R. Smith, PE, Business Development, Houston Lighting & Power Company, Houston, TX 77046 H. D. Spriggs, PhD, President, Matrix 2000, Leesburg, VA 22075 ABSTRACT Industry/utility partnerships are created when... be a strong partnership between HL&P and its customers. HL&P must help them to find real solutions to their most pressing problems and both parties must win. HL&P's customers must keep their costs low, maintain operating flexibility, meet...

  14. Perovskite Power

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Perovskite Power 1663 Los Alamos science and technology magazine Latest Issue:October 2015 past issues All Issues submit Perovskite Power A breakthrough in the production of...

  15. Real-Time Power Quality Waveform Recognition with a Programmable Digital

    E-Print Network [OSTI]

    Mamishev, Alexander

    quality (PQ) monitoring is an important issue to electric utilities and many industrial power customers) related disturbances in power systems by electric utilities and industrial power customers. SoftwareReal-Time Power Quality Waveform Recognition with a Programmable Digital Signal Processor M. Wang

  16. EIS-0183: Bonneville Power Administration Business Plan

    Broader source: Energy.gov [DOE]

    The Bonneville Power Administration is considering how to respond to the challenges of a dynamic electric utility industry, and prepared this environmental impact statement to analyze environmental and socioeconomic impacts associated with alternatives to address this challenge.

  17. 1 Industrial Electron Accelerators type ILU for Industrial Technologies

    E-Print Network [OSTI]

    1 Industrial Electron Accelerators type ILU for Industrial Technologies The present work describes industrial electron accelerators of the ILU family. Their main parameters, design, principle of action the pulse linear accelerators type ILU are developed and supplied to the industry. The ILU machines

  18. industrial & systems Industrial and Systems engineers use engineering

    E-Print Network [OSTI]

    Rohs, Remo

    78 industrial & systems Industrial and Systems engineers use engineering and business principles companies compete in today's global marketplace. The Industrial and Systems engineer's task is to take to introduce the philosophy, subject matter, aims, goals, and techniques of industrial and systems engineering

  19. industrial & systems Industrial and Systems engineers use engineering

    E-Print Network [OSTI]

    Rohs, Remo

    78 industrial & systems Industrial and Systems engineers use engineering and business principles companies compete in today's global marketplace. The Industrial and Systems engineer's task is to take s e n G i n e e r i n G ( i s e ) ISE 105 Introduction to Industrial and Systems Engineering (2, Fa

  20. MIT and Building/Construction & Related Industries MIT Industry Brief

    E-Print Network [OSTI]

    Kastner, Marc A.

    MIT and Building/Construction & Related Industries MIT Industry Brief MIT's Industrial Liaison-617-253-2691, e-mail us at liaison@ilp.mit.edu, or visit http://ilp.mit.edu. MIT and Building and education on topics important to build- ing, construction, and related areas and industries such as