National Library of Energy BETA

Sample records for ip service providers

  1. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  2. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  3. Ancillary Services Provided from DER

    SciTech Connect (OSTI)

    Campbell, J.B.

    2005-12-21

    Distributed energy resources (DER) are quickly making their way to industry primarily as backup generation. They are effective at starting and then producing full-load power within a few seconds. The distribution system is aging and transmission system development has not kept up with the growth in load and generation. The nation's transmission system is stressed with heavy power flows over long distances, and many areas are experiencing problems in providing the power quality needed to satisfy customers. Thus, a new market for DER is beginning to emerge. DER can alleviate the burden on the distribution system by providing ancillary services while providing a cost adjustment for the DER owner. This report describes 10 types of ancillary services that distributed generation (DG) can provide to the distribution system. Of these 10 services the feasibility, control strategy, effectiveness, and cost benefits are all analyzed as in the context of a future utility-power market. In this market, services will be provided at a local level that will benefit the customer, the distribution utility, and the transmission company.

  4. Demand Response Providing Ancillary Services

    E-Print Network [OSTI]

    1 Demand Response Providing Ancillary Services: A Comparison of Opportunities and Challenges in US to operate (likely price takers) ­ Statistical reliability (property of large aggregations of small resources size based on Mid-Atlantic Reserve Zone #12;Market Rules: Resource Size Min. Size (MW) Aggregation

  5. Intellectual Property (IP) Service Providers for Acquisition and Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department of Energy

  6. Intellectual Property (IP) Service Providers for Acquisition and Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department of

  7. Industrial Plant Services Australia Pty Ltd IPS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. WaterInformationPlant Services Australia Pty

  8. Static Pricing for a Network Service Provider

    E-Print Network [OSTI]

    Caro, Felipe

    This article studies the static pricing problem of a network service provider who has a fixed capacity and faces different types of customers (classes). Each type of customers can have its own capacity constraint but it ...

  9. Commercial Building Loads Providing Ancillary Services in PJM

    E-Print Network [OSTI]

    MacDonald, Jason

    2014-01-01

    P. Barooah, and S. Meyn. "Ancillary service for the grid viaet al. "Demand Response for Ancillary Services." (2013): 1-8Demand Response Providing Ancillary Services: A Comparison

  10. Texas - PUC Substantive Rule 25.198 - Electric Service Providers...

    Open Energy Info (EERE)

    Texas - PUC Substantive Rule 25.198 - Electric Service Providers-Open Access Comparable Transmission Service for Electric Utilities in the Electric Reliability Council of Texas...

  11. Service Levels and Associated Cleaning Areas Service Level 0 -No Service will be provided.

    E-Print Network [OSTI]

    Escher, Christine

    Level 0 ­ Includes all rooms/areas categorized as: Hazardous Material, mechanical, storage, issue, stockService Levels and Associated Cleaning Areas Service Level 0 - No Service will be provided. Service Level 1- Includes all rooms/areas categorized as: offices, copy, file, mail, hallways, vestibules

  12. State Roles in Providing Affordable Mass Transport Services for...

    Open Energy Info (EERE)

    State Roles in Providing Affordable Mass Transport Services for Low-Income Residents Jump to: navigation, search Tool Summary LAUNCH TOOL Name: State Roles in Providing Affordable...

  13. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  14. IN-HOUSE COURSE Application Service Providers

    E-Print Network [OSTI]

    Furht, Borko

    Trends Description and Objective The objective of this course is to provide an in-depth survey software applications to businesses and consumers via the Internet. In this course we introduce components that enabled the ASP model, including advances in networking technologies, Internet deliverable software

  15. Using Partnerships to Drive Demand and Provide Services in Communities...

    Broader source: Energy.gov (indexed) [DOE]

    Program Multifamily and Low-Income Peer Exchange Call: Using Partnerships to Drive Demand and Provide Services in Communities, February 2, 2012. Call Slides and Discussion...

  16. Opportunities for Mass Market Demand Response to Provide Ancillary Services

    SciTech Connect (OSTI)

    Pratt, Rob; Najewicz, Dave

    2011-10-01

    Discusses what is meant by mass market demand response to provide ancillary services and outlines opportunities for adoption, and barriers to adoption.

  17. Commercial Building Loads Providing Ancillary Services in PJM

    E-Print Network [OSTI]

    MacDonald, Jason

    2014-01-01

    and Communications for Demand Response and Energy EfficiencyM. Hummon et al. "Demand Response for Ancillary Services." (and S. Kiliccote. 2012. “Demand Response Providing Ancillary

  18. Occupational therapy is a healthcare profession that provides services to

    E-Print Network [OSTI]

    Sibille, Etienne

    Occupational therapy is a healthcare profession that provides services to individuals of all ages of occupational therapy services, and contributor to the profession. The occupational therapist practitioner and healthcare, participates in clinical research, and advocates appropriately for clients and the profession

  19. Form 1410 FR.13 Instructions Internal Service Providers: Registration

    E-Print Network [OSTI]

    new customers, anticipated large reduction in customers, new products/services, and/or reduced Service Providers (ISPs) are required to complete an ISP Registration form when initially registering $100,000 annually), GC-Recharge Center > $100k (sponsored activity to $100,000 annually), or Cost

  20. Developing a global strategy for a Brazilian engineering services provider

    E-Print Network [OSTI]

    Oliveira, Abner Lima de

    2008-01-01

    The Delta Model framework is used in this work to assess a engineering services provider's current and desired level of customer bonding and define a Strategic Plan towards a global operation. Several other frameworks serve ...

  1. Texas - PUC Substantive Rule 25.174 - Electric Service Providers...

    Open Energy Info (EERE)

    Rule 25.174 - Electric Service Providers-Renewable Energy Resources and Use of Natural Gas Jump to: navigation, search OpenEI Reference LibraryAdd to library Legal...

  2. Texas - PUC Substantive Rule 25.5 - Electric Service Providers...

    Open Energy Info (EERE)

    search OpenEI Reference LibraryAdd to library Legal Document- RegulationRegulation: Texas - PUC Substantive Rule 25.5 - Electric Service Providers-General ProvisionsLegal...

  3. Texas - PUC Substantive Rule 25.83 - Electric Service Providers...

    Open Energy Info (EERE)

    search OpenEI Reference LibraryAdd to library Legal Document- RegulationRegulation: Texas - PUC Substantive Rule 25.83 - Electric Service Providers-Records, Reports, and other...

  4. Providing Multi-Page Data Extraction Services with XWRAPComposer

    SciTech Connect (OSTI)

    Liu, Ling; Zhang, Jianjun; Han, Wei; Pu, Calton; Caverlee, James; Park, Sungkeun; Critchlow, Terence J.; Buttler, David; Coleman, Matthew A.

    2008-04-30

    Dynamic Web data sources – sometimes known collectively as the Deep Web – increase the utility of the Web by providing intuitive access to data repositories anywhere that Web access is available. Deep Web services provide access to real-time information, like entertainment event listings, or present a Web interface to large databases or other data repositories. Recent studies suggest that the size and growth rate of the dynamic Web greatly exceed that of the static Web, yet dynamic content is often ignored by existing search engine indexers owing to the technical challenges that arise when attempting to search the Deep Web. To address these challenges, we present DYNABOT, a service-centric crawler for discovering and clustering Deep Web sources offering dynamic content. DYNABOT has three unique characteristics. First, DYNABOT utilizes a service class model of the Web implemented through the construction of service class descriptions (SCDs). Second, DYNABOT employs a modular, self-tuning system architecture for focused crawling of the Deep Web using service class descriptions. Third, DYNABOT incorporates methods and algorithms for efficient probing of the Deep Web and for discovering and clustering Deep Web sources and services through SCD-based service matching analysis. Our experimental results demonstrate the effectiveness of the service class discovery, probing, and matching algorithms and suggest techniques for efficiently managing service discovery in the face of the immense scale of the Deep Web.

  5. Market and Policy Barriers for Demand Response Providing Ancillary Services

    Office of Energy Efficiency and Renewable Energy (EERE)

    In this study, we attempt to provide a comprehensive examination of various market and policy barriers to demand response providing ancillary services in both ISO/RTO and non-ISO/RTO regions, especially at the program provider level. It is useful to classify barriers in order to create a holistic understanding and identify parties that could be responsible for their removal. This study develops a typology of barriers focusing on smaller customers that must rely on a program provider (i.e., electric investor owned utility or IOU, ARC) to create an aggregated DR resource in order to bring ancillary services to the balancing authority. The barriers were identified through examinations of regulatory structures, market environments, and product offerings; and discussions with industry stakeholders and regulators.

  6. Supplanting ecosystem services provided by scavengers raises greenhouse gas

    E-Print Network [OSTI]

    Richner, Heinz

    Supplanting ecosystem services provided by scavengers raises greenhouse gas emissions Zebensui to human-induced increments in atmospheric concentrations of greenhouse gases (GHG) is one of the most concentrations of some gases such as carbon dioxide, methane or nitrous oxide (globally called greenhouse gases

  7. CLIMATE STUDY Phase II: MU Student Services Providers Survey

    E-Print Network [OSTI]

    Taylor, Jerry

    MU CAMPUS CLIMATE STUDY VOLUME 2 Phase II: MU Student Services Providers Survey Phase III: MU CAMPUS CLIMATE STUDY: PHASES II ­ IV Over the past three years, members of the University of Missouri-Columbia (MU) have participated in the MU Campus Climate Study for Underrepresented Groups conducted by a team

  8. Commercial Building Loads Providing Ancillary Services in PJM

    SciTech Connect (OSTI)

    MacDonald, Jason; Kiliccote, Sila; Boch, Jim; Chen, Jonathan; Nawy, Robert

    2014-06-27

    The adoption of low carbon energy technologies such as variable renewable energy and electric vehicles, coupled with the efficacy of energy efficiency to reduce traditional base load has increased the uncertainty inherent in the net load shape. Handling this variability with slower, traditional resources leads to inefficient system dispatch, and in some cases may compromise reliability. Grid operators are looking to future energy technologies, such as automated demand response (DR), to provide capacity-based reliability services as the need for these services increase. While DR resources are expected to have the flexibility characteristics operators are looking for, demonstrations are necessary to build confidence in their capabilities. Additionally, building owners are uncertain of the monetary value and operational burden of providing these services. To address this, the present study demonstrates the ability of demand response resources providing two ancillary services in the PJM territory, synchronous reserve and regulation, using an OpenADR 2.0b signaling architecture. The loads under control include HVAC and lighting at a big box retail store and variable frequency fan loads. The study examines performance characteristics of the resource: the speed of response, communications latencies in the architecture, and accuracy of response. It also examines the frequency and duration of events and the value in the marketplace which can be used to examine if the opportunity is sufficient to entice building owners to participate.

  9. Loads Providing Ancillary Services: Review of International Experience

    SciTech Connect (OSTI)

    Heffner, Grayson; Goldman, Charles; Kintner-Meyer, Michael

    2007-05-01

    In this study, we examine the arrangements for and experiences of end-use loads providing ancillary services (AS) in five electricity markets: Australia, the United Kingdom (UK), the Nordic market, and the ERCOT and PJM markets in the United States. Our objective in undertaking this review of international experience was to identify specific approaches or market designs that have enabled customer loads to effectively deliver various ancillary services (AS) products. We hope that this report will contribute to the ongoing discussion in the U.S. and elsewhere regarding what institutional and technical developments are needed to ensure that customer loads can meaningfully participate in all wholesale electricity markets.

  10. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  11. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    for Future Procurement of Ancillary Services. Prepared byThe Performance of the Ancillary Services Markets, NationalProcedure: Frequency Control Ancillary Services. Document

  12. Market and Policy Barriers for Demand Response Providing Ancillary Services in U.S. Markets

    E-Print Network [OSTI]

    Cappers, Peter

    2014-01-01

    Response for Wholesale Ancillary Services. November 2009.Demand Response Providing Ancillary Services. Presented atManual 11: Energy & Ancillary Services Market Operations.

  13. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    2005. Eltra’s Need for Ancillary Services and RegulatingRegulating Reserves and Ancillary Services. Technical Part.Warwick, UK. Loads Providing Ancillary Services: Review of

  14. Techno-Economic Analysis of BEV Service Providers Offering Battery Swapping Services (Presentation)

    SciTech Connect (OSTI)

    Neubauer, J.; Pesaran, A.

    2013-05-01

    Battery electric vehicles (BEVs) could significantly reduce the nation's gasoline consumption and greenhouse gas emissions rates. However, both the upfront cost and the limited range of the vehicle are perceived to be deterrents to the widespread adoption of BEVs. A service provider approach to marketing BEVs, coupled with a battery swapping infrastructure deployment could address both issues and accelerate BEV adoption. This presentation examines customer selection, service usage statistics, service plan fees and driver economics. Our results show it is unlikely that a battery swapping service plan will be more cost-effective than ownership of a conventional vehicle. A battery swapping service plan may be a more cost-effective solution than a directly owned BEV for some single-vehicle, high-mileage consumers. However, other factors not considered in this analysis could decrease the viability of such a service.

  15. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    end-use customer’s Energy Services Provider can monitor thisarrangements with the Energy Services Provider who, as theaggregator, the Energy Services Provider, and the end-user.

  16. ECONOMIC EFFICIENCY OF AIR NAVIGATION SERVICE PROVIDERS: AN ASSESSMENT IN EUROPE

    E-Print Network [OSTI]

    ECONOMIC EFFICIENCY OF AIR NAVIGATION SERVICE PROVIDERS: AN ASSESSMENT IN EUROPE by Rui Neiva Service Providers: An Assessment in Europe A Dissertation submitted in partial fulfillment

  17. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    to support the transmission of electric power from seller toStandardized Transmission Service and Wholesale Electricmiles of transmission lines in order to keep electric power

  18. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    Control Automated Power Exchange Ancillary Services BritishAustralia) U.K. Power Exchange viii Executive Summary Ins first multinational power exchange. Nord Pool operates

  19. Techno-Economic Analysis of BEV Service Providers Offering Battery Swapping Services: Preprint

    SciTech Connect (OSTI)

    Neubauer, J.; Pesaran, A.

    2013-03-01

    Battery electric vehicles (BEVs) offer the potential to reduce both oil imports and greenhouse gas emissions, but high upfront costs, battery-limited vehicle range, and concern over high battery replacement costs may discourage potential buyers. A subscription model in which a service provider owns the battery and supplies access to battery swapping infrastructure could reduce upfront and replacement costs for batteries with a predictable monthly fee, while expanding BEV range. Assessing the costs and benefits of such a proposal are complicated by many factors, including customer drive patterns, the amount of required infrastructure, battery life, etc. The National Renewable Energy Laboratory has applied its Battery Ownership Model to compare the economics and utility of BEV battery swapping service plan options to more traditional direct ownership options. Our evaluation process followed four steps: (1) identifying drive patterns best suited to battery swapping service plans, (2) modeling service usage statistics for the selected drive patterns, (3) calculating the cost-of-service plan options, and (4) evaluating the economics of individual drivers under realistically priced service plans. A service plan option can be more cost-effective than direct ownership for drivers who wish to operate a BEV as their primary vehicle where alternative options for travel beyond the single-charge range are expensive, and a full-coverage-yet-cost-effective regional infrastructure network can be deployed. However, when assumed cost of gasoline, tax structure, and absence of purchase incentives are factored in, our calculations show the service plan BEV is rarely more cost-effective than direct ownership of a conventional vehicle.

  20. Techno-Economic Analysis of BEV Service Providers Offering Battery Swapping Services

    SciTech Connect (OSTI)

    Neubauer, J. S.; Pesaran, A.

    2013-01-01

    Battery electric vehicles (BEVs) offer the potential to reduce both oil imports and greenhouse gas emissions, but high upfront costs, battery-limited vehicle range, and concern over high battery replacement costs may discourage potential buyers. A subscription model in which a service provider owns the battery and supplies access to battery swapping infrastructure could reduce upfront and replacement costs for batteries with a predictable monthly fee, while expanding BEV range. Assessing the costs and benefits of such a proposal are complicated by many factors, including customer drive patterns, the amount of required infrastructure, battery life, etc. The National Renewable Energy Laboratory has applied its Battery Ownership Model to compare the economics and utility of BEV battery swapping service plan options to more traditional direct ownership options. Our evaluation process followed four steps: (1) identifying drive patterns best suited to battery swapping service plans, (2) modeling service usage statistics for the selected drive patterns, (3) calculating the cost-of-service plan options, and (4) evaluating the economics of individual drivers under realistically priced service plans. A service plan option can be more cost-effective than direct ownership for drivers who wish to operate a BEV as their primary vehicle where alternative options for travel beyond the single-charge range are expensive, and a full-coverage-yet-cost-effective regional infrastructure network can be deployed. However, when assumed cost of gasoline, tax structure, and absence of purchase incentives are factored in, our calculations show the service plan BEV is rarely more cost-effective than direct ownership of a conventional vehicle.

  1. The Biosta s cs Consul ng Service provides comprehensive sta s cal consul ng and

    E-Print Network [OSTI]

    ABOUT US The Biosta s cs Consul ng Service provides comprehensive sta s cal consul ng and data. DropIn is free, try it today. ByAppointment Service: These consul ng services include: Sample size for any of the above services, please fill out a consul ng applica on here: www

  2. NOAA Satellite and Information Service The National Environmental Satellite, Data, and Information Service (NESDIS) is dedicated to providing

    E-Print Network [OSTI]

    , and Information Service (NESDIS) is dedicated to providing timely access to global environmental data from sector. · Develop a skilled, energetic, and dedicated workforce through training, motivation

  3. Managing Routing Disruptions in Internet Service Provider Networks

    E-Print Network [OSTI]

    Rexford, Jennifer

    games, and commercial transactions. This new range of applications cannot tolerate poor network the impact of routing changes in their network. I. INTRODUCTION As the Internet becomes an ever more critical increasing pressure to provide good, predictable performance to a wide range of applications. Unfortunately

  4. PROVIDING COMMUNITY AND COLLABORATION SERVICES TO MMOG PLAYERS*

    E-Print Network [OSTI]

    and improve the community activities among their members. The Community Network Game (CNG) project has focused adapted to the needs of MMOG players. They are provided by the so-called CNG Server and have been The Community Network Game (CNG) [5] is a research and innovation project funded by the European Commission

  5. Ecosystem services provided by palms in SE Asia

    E-Print Network [OSTI]

    Schierup, Mikkel Heide

    important in forest ecosystems and include some 600 species in SEA. Rural communities depend on palms provided by ecosystems and research into the value of these resources should: - Include rural communities of rural communities' harvest of palm products - Evaluate the potential of developing new palm products

  6. Providing vital services for our nation's ocean resources

    E-Print Network [OSTI]

    of the greatest threats to marine life. Habitat such as wetlands and coral reefs provide important feeding shellfish culture, alternative feeds, and equipment. #12;Protecting Marine Mammals and Endangered Species Protected marine life such as whales, sea turtles, corals, and salmon serve as sentinels of the sea

  7. A survey of reading services provided to students with reading disabilities 

    E-Print Network [OSTI]

    Christen, Margaret Harding

    2009-05-15

    of special education services provided. Results showed that there was minimal provision of special education services for reading disabled students. When the results were analyzed by degree of disability the correlation was weak while the analysis...

  8. Gas engines provide cogeneration service for Fantoni MDF plant

    SciTech Connect (OSTI)

    Chellini, R.

    1996-12-01

    A large MDF (medium density fiberboard) plant recently started industrial production at the headquarters of Fantoni, in Osoppo (UDINE) Italy. Providing electric power and thermal energy to the process is a cogeneration plant based on four large spark-ignited gas engines. The new Osoppo MDF plant processes 800 m{sup 3} of finished boards per day in a manufacturing line that combines the most advanced technologies available from several European equipment manufacturers. The cogeneration plant features four type 12VA32G spark-ignited gas engines from Fincantieri`s Diesel Engine Division, driving 50Hz, 6.3 kV, 5400 kVA Ansaldo generators at 750 r/min. The turbocharged and intercooled engines are a spark-ignited version of the company`s A32 diesel. They feature 12 Vee-arranged cylinders with 320 mm bore and 390 mm stroke. 5 figs.

  9. Economic Incentives of Providing Network Security Services Journal of Information Technology Management 1

    E-Print Network [OSTI]

    Chen, Li-Chiou

    Economic Incentives of Providing Network Security Services Journal of Information Technology Management 1 THE ECONOMIC INCENTIVES OF PROVIDING NETWORK SECURITY SERVICES ON THE INTERNET INFRASTRUCTURE Li in the economic incentives inherent in providing the defenses as well as uncertainty in current defenses. We

  10. Texas - PUC Substantive Rule 25.101 - Electric ServiceProviders...

    Open Energy Info (EERE)

    search OpenEI Reference LibraryAdd to library Legal Document- RegulationRegulation: Texas - PUC Substantive Rule 25.101 - Electric Service Providers-Certification, Licensing...

  11. RIMapperWMS: a Web Map Service providing SVG maps with a built-in client

    E-Print Network [OSTI]

    Köbben, Barend

    RIMapperWMS: a Web Map Service providing SVG maps with a built-in client Barend K Consortium's Web Map Service spec- ification. It serves interactive web maps from a spatial database back application that conforms to the Open Geospatial Con- sortium's (OGC) Web Map Service (WMS) specification. We

  12. Zurich University of Teacher Education (PH Zurich) A leading national university providing services to education

    E-Print Network [OSTI]

    Steiner, Daniel

    Zurich University of Teacher Education (PH Zurich) A leading national university providing services include education, training, research and additional services such as consulting and international develop- ment projects. Our services ­ hands-on, innovative, excellent Initial teacher education The PH Zurich

  13. Design of Robust Distribution Networks Run by fourth Party Logistics Service Providers

    E-Print Network [OSTI]

    Armbruster, Dieter

    Design of Robust Distribution Networks Run by fourth Party Logistics Service Providers M logistics service provider (LSP), who faces the problem of distributing different products from suppliers distributions. 1 Introduction The logistics networks considered in this paper consist of production facilities

  14. Policy and Procedure for Providing Suppliers with Remote Access to IT Systems and Services

    E-Print Network [OSTI]

    Judd, Martin

    Policy and Procedure for Providing Suppliers with Remote Access to IT Systems and Services Purpose time to time be necessary to allow that supplier to have remote access to that service for support or development. Suppliers will often make it a requirement of the support contract that such access is provided

  15. Nutrient Management TrainingNutrient Management Training for Technical Service Providersfor Technical Service Providers

    E-Print Network [OSTI]

    Nutrient Management TrainingNutrient Management Training for Technical Service Providersfor Management Planning Technical Guidance.Management Planning Technical Guidance. Manure and Wastewater Handling Nutrient ManagementNutrient Management ­­ Record KeepingRecord Keeping ­­ Feed ManagementFeed Management

  16. Perspectives of Foster-Care Providers, Service Provicers, and Judges Regarding Privtized Foster-Care Services

    E-Print Network [OSTI]

    Humphrey, Kristen R.; Turnbull, Ann P.; Turnbull, H. Rutherford

    2006-01-01

    designed to control utilization or costs of services (Scallet, Brach, & Steel, 1997). Generally, pro- viders in a managed care contract accept a fixed compensation rate for a range of services for a particular group of clients (Wul- czyn, 2000). Controlling... in place for the youth (e.g., visi- tation, therapy, psychological evaluation); court orders in place for the parents (e.g., visitation, therapy, drug/alcohol evaluation, parenting classes); whether siblings were also in out-of-home placement; the past...

  17. Professional Services Provided By Texas Education Service Centers To Promote Improvement In Texas Public Schools-A Descriptive Study 

    E-Print Network [OSTI]

    Ausburn, Jerry Paul

    2011-10-21

    , respect, and trust others, then they are 10 more likely to be successful in that environment. Kaplan (1997) provides additional support for school reform and the improvement of climate and culture on campus by stating that school...-1 PROFESSIONAL SERVICES PROVIDED BY TEXAS EDUCATION SERVICE CENTERS TO PROMOTE IMPROVEMENT IN TEXAS PUBLIC SCHOOLS --A DESCRIPTIVE STUDY A Record of Study by JERRY PAUL AUSBURN Submitted to the Office of Graduate Studies of Texas A&M University...

  18. A Generalized Battery Model of a Collection of Thermostatically Controlled Loads for Providing Ancillary Service

    E-Print Network [OSTI]

    Sanandaji, Borhan M.

    Ancillary Service He Hao, Borhan M. Sanandaji, Kameshwar Poolla, and Tyrone L. Vincent Abstract for providing various ancillary services to the grid. In this work, we study aggregate modeling, and uncontrollability of renewable resources. To ensure the func- tionality and reliability of the grid, more ancillary

  19. 12/13Aviation Services provided by: Air Methods Corporation and Aero Air. Willapa Harbor

    E-Print Network [OSTI]

    Borenstein, Elhanan

    12/13Aviation Services provided by: Air Methods Corporation and Aero Air. Forks Aberdeen Willapa patients of all types. For short distance flights, or to smaller airports the Aero Commander 690 is our

  20. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  1. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  2. Opportunities and Challenges for Water and Wastewater Industries to Provide Exchangeable Services

    SciTech Connect (OSTI)

    Sparn, Bethany; Hunsberger, Randolph

    2015-11-13

    Water and wastewater treatment plants and distribution systems use significant amounts of energy, around 2 - 4% of the total electricity used in the US, and their energy use is projected to increase as populations increase and regulations become more stringent. Water and wastewater systems have largely been disconnected from the electric utilities' efforts to improve energy efficiency and provide energy efficiency and provide grid services, likely because their core mission is to provide clean water and treated wastewater. Energy efficiency has slowly crept into the water and wastewater industry as the economic benefit has become more apparent, but there is still potential for significant improvement. Some of the larger, more progressive water utilities are starting to consider providing grid services; however, it remains a foreign concept to many. This report explores intrinsic mechanisms by which the water and wastewater industries can provide exchangeable services, the benefit to the parties involved, and the barriers to implementation. It also highlights relevant case studies and next steps. Although opportunities for increasing process efficiencies are certainly available, this report focuses on the exchangeable services that water and wastewater loads can provide to help maintain grid reliability, keep overall costs down, and increase the penetration of distributed renewables on the electric grid. These services have potential to provide water utilities additional value streams, using existing equipment with modest or negligible upgrade cost.

  3. Lesson Title: CDC Recommendations for Lead Poisoning Prevention in Newly Arrived Refugee Children: Medical Service Providers

    E-Print Network [OSTI]

    Lesson Title: CDC Recommendations for Lead Poisoning Prevention in Newly Arrived Refugee Children arrived refugee children (e.g., physicians, nurses). Lesson Goal: To encourage direct medical service providers to conduct blood lead testing on all newly arrived refugee children and provide nutritional

  4. Fogler Library Fogler Library provides access to information essential to teaching, research, and service

    E-Print Network [OSTI]

    Thomas, Andrew

    Fogler Library Mission Fogler Library provides access to information essential to teaching of Fogler Library is to identify and provide the information and library resources needed by members; to instruct and assist in the use of library resources and services; to share in the development

  5. Market and policy barriers for demand response providing ancillary services in U.S. markets

    SciTech Connect (OSTI)

    Cappers, Peter; MacDonald, Jason; Goldman, Charles

    2013-03-01

    This study provides an examination of various market and policy barriers to demand response providing ancillary services in both ISO/RTO and non-ISO/RTO regions, especially at the program provider level. It is useful to classify barriers in order to create a holistic understanding and identify parties that could be responsible for their removal. This study develops a typology of barriers focusing on smaller customers that must rely on a program provider (i.e., electric investor owned utility or IOU, ARC) to create an aggregated DR resource in order to bring ancillary services to the balancing authority. The barriers were identified through examinations of regulatory structures, market environments, and product offerings; and discussions with industry stakeholders and regulators. In order to help illustrate the differences in barriers among various wholesale market designs and their constituent retail environments, four regions were chosen to use as case studies: Colorado, Texas, Wisconsin, and New Jersey.

  6. Secure Spatial Top-k Query Processing via Untrusted Location-Based Service Providers

    E-Print Network [OSTI]

    Zhang, Rui

    , Member, IEEE, Jingchao Sun, Student Member, IEEE, Yanchao Zhang, Senior Member, IEEE, and Chi Zhang-capable and location-aware mobile devices. The system consists of a data collector, data contributors, location-based service providers (LBSPs), and system users. The data collector gathers reviews about points

  7. A Reliable and Secure Cloud Storage Schema Using Multiple Service Providers

    E-Print Network [OSTI]

    Xu, Haiping

    A Reliable and Secure Cloud Storage Schema Using Multiple Service Providers Haiping Xu and Deepti stored in the cloud. In this paper, we propose a reliable and secure cloud storage schema using multiple at the server side, we propose a reliable and secure cloud storage schema that can be implemented at the client

  8. Real-Time Power Control of Data Centers for Providing Regulation Service

    E-Print Network [OSTI]

    Caramanis, Michael

    optimal policy performance statistics can enable data centers to bid for energy and to offer RS reservesReal-Time Power Control of Data Centers for Providing Regulation Service Hao Chen1 , Ayse K. Coskun-- Data centers account for 3% of the national elec- tricity consumption today. Recent advances in power

  9. Loads Providing Ancillary Services: Review of InternationalExperience-- Technical Appendix: Market Descriptions

    SciTech Connect (OSTI)

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-05-01

    In this study, we examine the arrangements for andexperiences of end-use loads providing ancillary services (AS) in fiveelectricity markets: Australia, the United Kingdom (UK), the Nordicmarket, and the ERCOT and PJM markets in the United States. Our objectivein undertaking this review of international experience was to identifyspecific approaches or market designs that have enabled customer loads toeffectively deliver various ancillary services (AS) products. We hopethat this report will contribute to the ongoing discussion in the U.S.and elsewhere regarding what institutional and technical developments areneeded to ensure that customer loads can meaningfully participate in allwholesale electricity markets.

  10. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  11. Abstract--The nonactive-power-related ancillary services provided by distributed energy (DE) resources are categorized by

    E-Print Network [OSTI]

    Tolbert, Leon M.

    Abstract-- The nonactive-power-related ancillary services provided by distributed energy (DE power theory is adopted to control the DE system to provide these ancillary services. Three control, are developed which can perform one or more of the ancillary services. The control schemes are implemented

  12. Implementation of a Cloud Data Server (CDS) for Providing Secure Service in E-Business

    E-Print Network [OSTI]

    Kesavaraja, D; Sasireka, D; 10.5121/ijdms.2010.2203

    2010-01-01

    Cloud Data Servers is the novel approach for providing secure service to e-business .Millions of users are surfing the Cloud for various purposes, therefore they need highly safe and persistent services. Usually hackers target particular Operating Systems or a Particular Controller. Inspiteof several ongoing researches Conventional Web Servers and its Intrusion Detection System might not be able to detect such attacks. So we implement a Cloud Data Server with Session Controller Architecture using Redundancy and Disconnected Data Access Mechanism. In this paper, we generate the hash code using MD5 algorithm. With the help of which we can circumvent even the attacks, which are undefined by traditional Systems .we implement Cloud Data Sever using Java and Hash Code backup Management using My SQL. Here we Implement AES Algorithm for providing more Security for the hash Code. The CDS using the Virtual Controller controls and monitors the Connections and modifications of the page so as to prevent malicious users fr...

  13. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  14. Analysis of the implications of the USSR providing reprocessing and MOX fabrication services to other countries

    SciTech Connect (OSTI)

    NONE

    1994-12-31

    This brief analysis, which is based on unclassified sources, seeks to identify what some of the implications would be if the Soviets started to move actively to try to provide reprocessing and MOX fabrication services to the US and other countries. While information on Soviet intentions is limited, it postulates that the Soviets would offer to reprocess spent LWR at competitive prices, fabricate the plutonium and reenrich the uranium, and sell these products back to the customer. Since it is not known whether they would insist on returning the waste from reprocessing or would be prepared to keep it, we comment briefly on what the implications of either of these actions might be.

  15. Rensselaer helps educate "leaders of tomorrow" by providing a robust set of student life programs and services designed to

    E-Print Network [OSTI]

    Varela, Carlos

    and services designed to: n facilitate academic success n offer education and practice in leadership for Students and Scholars International Services for Students and Scholars (ISSS) provides educational programsRensselaer helps educate "leaders of tomorrow" by providing a robust set of student life programs

  16. A Market-Based Mechanism for Providing Demand-Side Regulation Service Ioannis Ch. Paschalidis, Binbin Li, Michael C. Caramanis

    E-Print Network [OSTI]

    Caramanis, Michael

    A Market-Based Mechanism for Providing Demand-Side Regulation Service Reserves Ioannis Ch a building Smart Microgrid Operator (SMO) to offer regulation service reserves and meet the associated utility. We study an asymptotic regime in which this upper bound is tight and the static policy provides

  17. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  18. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    cost of service differentials, maintenance of the extensive and lightly-loaded network, and overloaded substations

  19. Abstract--As IT service providers are adoptingmore compre-hensive approachestowardsIT Service Management (ITSM), they

    E-Print Network [OSTI]

    TOM), no equivalent for the more general process frameworks of ITIL and ISO/IEC 20000 is in sight. This paper compliant to ISO/IEC 20000 requirements and ITIL recommendations. Index Terms--IT Service Management, Information Model, SID, ITIL, ISO/IEC 20000 I. INTRODUCTION HEefficient delivery of high quality IT services

  20. Market and Policy Barriers for Demand Response Providing Ancillary Services in U.S. Markets

    E-Print Network [OSTI]

    Cappers, Peter

    2014-01-01

    Wholesale Electricity Demand Response Program Comparison,J. (2009) Open Automated Demand Response Communicationsin Demand Response for Wholesale Ancillary Services.

  1. Services for Users with Disabilities Welcome to the University of Bath Library. We are committed to providing equality

    E-Print Network [OSTI]

    Burton, Geoffrey R.

    , including all national holidays. During semester, the Library is staffed from 9am to 7pm weekdays and 10amServices for Users with Disabilities Welcome to the University of Bath Library. We are committed the Library and accessing its resources. This guide provides an overview of the services the Library offers

  2. Rensselaer helps educate "leaders of tomorrow" by providing a robust set of student life programs and services designed to

    E-Print Network [OSTI]

    Varela, Carlos

    programs and services designed to: I facilitate academic success I offer education and practice/or enrolled through the Higher Education Opportunity Program (HEOP). Support services focus on recruitment26 Rensselaer helps educate "leaders of tomorrow" by providing a robust set of student life

  3. Abstract--Load serving entities (LSE) and holders of default service obligations, in restructured electricity markets, provide

    E-Print Network [OSTI]

    Oren, Shmuel S.

    the varying demand of their customers at fixed regulated prices. Electricity consumption volume directly, in restructured electricity markets, provide electricity service at regulated or contracted fixed prices while standard forward contracts and commodity derivatives. Keywords: Electricity Markets, Risk Management

  4. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  5. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  6. Dual Use of Veterans Health Administration and Indian Health Service: Healthcare Provider and Patient Perspectives

    E-Print Network [OSTI]

    Kramer, B. Josea; Vivrette, Rebecca L.; Satter, Delight E.; Jouldjian, Stella; McDonald, Leander Russell

    2009-01-01

    the Veterans Health Administration. Available at: http://of the veterans health administration and the Indian Healthof Veterans Health Administration and Indian Health Service:

  7. Selection of Web Services for Composition Using Location of Provider Hosts Criterion

    E-Print Network [OSTI]

    Sheng, Michael

    , Dubai, U.A.E zakaria.maamar@zu.ac.ae 2 School of Computer Science & Engineering The University of New, users from over the world can satisfy their needs by browsing and triggering the services

  8. Princeton University Parking Rules & Regulations Transportation & Parking Services at Princeton University is committed to providing

    E-Print Network [OSTI]

    Torquato, Salvatore

    for a vehicle to be legally parked on campus. The hangtag indicates parking zone and lot assignments and must will be issued. II. Parking Zone and lot assignments FacUlty/StaFF PaRkIng Each UniversiPrinceton University Parking Rules & Regulations Transportation & Parking Services at Princeton

  9. Online Strategies for Intra and Inter Provider Service Migration in Virtual Networks

    E-Print Network [OSTI]

    Schmid, Stefan

    : although the Internet developed tremendously in size and speed, innovation is constrained to lower layers to the current client loca- tions while taking into account migration cost. This paper identifies the major cost improved QoS and migration cost in the worst-case, both for service migration within an infrastruc- ture

  10. This report is a part of the College's efforts to provide you with information on security procedures, services, and resources available on

    E-Print Network [OSTI]

    's efforts to provide you with information on security procedures, services, and resources available on our ............................................................................................................................... 6 CLERY GEOGRAPHY

  11. DOE Selects 8(a) Small Business to Provide Waste Tracking Services |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels DataEnergy Webinar:IAbout Us »BuildingsInfrastructure Support Services

  12. Optimal Remote Homing for Providing Service Differentiation in Information-Aware Multi-Layered Wireless Sensor Networks

    E-Print Network [OSTI]

    Vokkarane, Vinod M.

    -Layered Wireless Sensor Networks Jianping Wang Department of Computer Sciences Georgia Southern University@umassd.edu Abstract-- Sensor networks are fundamentally deployed to handle extreme behaviors across sensing sites. Service differen- tiation in information-aware wireless sensor network refers to the ability to provide

  13. Subscriber access provided by Caltech Library Services Journal of Chemical Theory and Computation is published by the American

    E-Print Network [OSTI]

    Goddard III, William A.

    and rotamer libraries, scoring functions have not been studied as extensively.22-24 The focus of this paperSubscriber access provided by Caltech Library Services Journal of Chemical Theory and Computation III J. Chem. Theory Comput., 2008, 4 (12), 2160-2169 · DOI: 10.1021/ct800196k · Publication Date (Web

  14. Fixed-Price Contracts Payment for a fixed-price contract is based on successfully providing the goods or services

    E-Print Network [OSTI]

    Tam, Tin-Yau

    costs more or costs less to complete the project than the price initially agreed upon. OneFixed-Price Contracts Payment for a fixed-price contract is based on successfully providing the goods or services agreed to in the contract. A fixed-price contract is not adjusted when it actually

  15. eScholarship provides open access, scholarly publishing services to the University of California and delivers a dynamic

    E-Print Network [OSTI]

    Bigelow, Stephen

    eScholarship provides open access, scholarly publishing services to the University of California Santa Barbara Title: Erosion and Optimal Transport Author: Birnir, Bjorn, Department of Mathematics, University of California, Santa Barbara, CA 93106, USA Rowlett, Julie, Hausdorff Center for Mathematics

  16. eScholarship provides open access, scholarly publishing services to the University of California and delivers a dynamic

    E-Print Network [OSTI]

    Kammen, Daniel M.

    eScholarship provides open access, scholarly publishing services to the University of California and delivers a dynamic research platform to scholars worldwide. UC Berkeley Transportation Sustainability environmental performance Author: Turner, Brian T., Energy and Resources Group, Richard and Rhoda Goldman School

  17. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    the forestry, pulp and paper industry. However, the programindustry alone (See Figure B-6) could provide 1210 MW (Pulp and paper –

  18. This chapter is a guide to the web services available for institutions to submit data to the RAE 2008. The web services provide a programmable interface to the main RAE 2008 data collection system.

    E-Print Network [OSTI]

    Abrahams, I. David

    This chapter is a guide to the web services available for institutions to submit data to the RAE 2008. The web services provide a programmable interface to the main RAE 2008 data collection system. Using web services Using the web services with Visual Studio 2002, 2003 and 2005 To use the web services

  19. Potential for Distributed and Central Electrolysis to Provide Grid Support Services (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-07-01

    This NREL Hydrogen and Fuel Cell Technical Highlight describes how NREL operated both commercially available low-temperature electrolyzer technologies (PEM and alkaline) to evaluate their response to commands to increase and decrease stack power that shorten frequency disturbances on an alternating current (AC) mini-grid. Results show that both the PEM and alkaline electrolyzers are capable of adding or removing stack power to provide sub-second response that reduced the duration of frequency disturbances.

  20. Providing Reliability Services through Demand Response: A Prelimnary Evaluation of the Demand Response Capabilities of Alcoa Inc.

    SciTech Connect (OSTI)

    Starke, Michael R; Kirby, Brendan J; Kueck, John D; Todd, Duane; Caulfield, Michael; Helms, Brian

    2009-02-01

    Demand response is the largest underutilized reliability resource in North America. Historic demand response programs have focused on reducing overall electricity consumption (increasing efficiency) and shaving peaks but have not typically been used for immediate reliability response. Many of these programs have been successful but demand response remains a limited resource. The Federal Energy Regulatory Commission (FERC) report, 'Assessment of Demand Response and Advanced Metering' (FERC 2006) found that only five percent of customers are on some form of demand response program. Collectively they represent an estimated 37,000 MW of response potential. These programs reduce overall energy consumption, lower green house gas emissions by allowing fossil fuel generators to operate at increased efficiency and reduce stress on the power system during periods of peak loading. As the country continues to restructure energy markets with sophisticated marginal cost models that attempt to minimize total energy costs, the ability of demand response to create meaningful shifts in the supply and demand equations is critical to creating a sustainable and balanced economic response to energy issues. Restructured energy market prices are set by the cost of the next incremental unit of energy, so that as additional generation is brought into the market, the cost for the entire market increases. The benefit of demand response is that it reduces overall demand and shifts the entire market to a lower pricing level. This can be very effective in mitigating price volatility or scarcity pricing as the power system responds to changing demand schedules, loss of large generators, or loss of transmission. As a global producer of alumina, primary aluminum, and fabricated aluminum products, Alcoa Inc., has the capability to provide demand response services through its manufacturing facilities and uniquely through its aluminum smelting facilities. For a typical aluminum smelter, electric power accounts for 30% to 40% of the factory cost of producing primary aluminum. In the continental United States, Alcoa Inc. currently owns and/or operates ten aluminum smelters and many associated fabricating facilities with a combined average load of over 2,600 MW. This presents Alcoa Inc. with a significant opportunity to respond in areas where economic opportunities exist to help mitigate rising energy costs by supplying demand response services into the energy system. This report is organized into seven chapters. The first chapter is the introduction and discusses the intention of this report. The second chapter contains the background. In this chapter, topics include: the motivation for Alcoa to provide demand response; ancillary service definitions; the basics behind aluminum smelting; and a discussion of suggested ancillary services that would be particularly useful for Alcoa to supply. Chapter 3 is concerned with the independent system operator, the Midwest ISO. Here the discussion examines the evolving Midwest ISO market structure including specific definitions, requirements, and necessary components to provide ancillary services. This section is followed by information concerning the Midwest ISO's classifications of demand response parties. Chapter 4 investigates the available opportunities at Alcoa's Warrick facility. Chapter 5 involves an in-depth discussion of the regulation service that Alcoa's Warrick facility can provide and the current interactions with Midwest ISO. Chapter 6 reviews future plans and expectations for Alcoa providing ancillary services into the market. Last, chapter 7, details the conclusion and recommendations of this paper.

  1. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  2. servicelearning.msu.edu The Center for Service-Learning and Civic Engagement at Michigan State University provides beyond-the-classroom

    E-Print Network [OSTI]

    University provides beyond-the-classroom learning opportunities that are active, service-focused, community-based, mutually beneficial, and integrated with students' academic programs. Students who participate in service-learning of partnership roles and expectations for the CSLCE, the agency, and the student. Center for Service-Learning

  3. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  4. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  5. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  6. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  7. The Test Proctoring Center provides proctoring services to faculty members for individual students who require special testing considerations or who are taking classes off-campus or at

    E-Print Network [OSTI]

    Stuart, Steven J.

    The Test Proctoring Center provides proctoring services to faculty members for individual students who require special testing considerations or who are taking classes off-campus or at another://secure.touchnet.net/C20569_ustores/web/index.jsp (See Student Disability Services and Test Proctoring) · Check

  8. Nuclear Research & Consultancy Group (NRG) develops and provides sustainable nuclear technology for energy, environment, and health. NRG offers a wide range of services to energy

    E-Print Network [OSTI]

    Vuik, Kees

    for energy, environment, and health. NRG offers a wide range of services to energy utilities, governmentNuclear Research & Consultancy Group (NRG) develops and provides sustainable nuclear technology organizations and various branches of industry - including the nuclear, financial services and medical sectors

  9. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  10. eScholarship provides open access, scholarly publishing services to the University of California and delivers a dynamic

    E-Print Network [OSTI]

    van Kessel, Chris

    Agriculture, Division of Agriculture and Natural Resources Communication Services, UC Office of the President Moeching, Michael Mutters, Randall van Kessel, Chris Publication Date: 2008 Publication Info: California

  11. Company Overview: Founded in 2000, Visible World is the leading provider of targeted television advertising services. The

    E-Print Network [OSTI]

    advertising services. The company's suite of suite of applications and services enables advertisers, agencies, and media companies to deliver more targeted, measurable ads. Visible World empowers advertisers to deliver, advertising analytics, and algorithm development. This role will work very closely with engineering, database

  12. FINANCING A PENN DENTAL MEDICINE EDUCATION | Student Registration & Financial Services | www.sfs.upenn.edu Student Registration & Financial Services is pleased to partner with Penn Dental Medicine to provide you

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    #12;FINANCING A PENN DENTAL MEDICINE EDUCATION | Student Registration & Financial Services | www.sfs.upenn.edu Student Registration & Financial Services is pleased to partner with Penn Dental Medicine to provide you with the following educational financing information. Obtaining your education at an Ivy League university

  13. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  14. The Energy Services Provider as Corporate Engineer: A Partnership in Developing a Productive, Sustainable Energy Management Program 

    E-Print Network [OSTI]

    Imel, M.; Gromacki, M.

    2007-01-01

    . Burns & McDonnell (BMcD) is a large, multi-disciplined engineering firm with design-build and energy services capabilities. The firms have worked in the past on process design, environmental, and construction projects....

  15. Siena College E-Communications Policy E-Communications services are provided to the Siena community in support of

    E-Print Network [OSTI]

    -Communications includes all technology enhanced communications services, including but not limited to e-mail, voicemail, blogs, wikis, etc. III Policy Statement: A. Description E-Communications is an official means

  16. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  17. GE Healthcare Life Sciences provides products and services used as tools for biopharmaceutical manufacturing, drug discovery and the latest in cellular technologies, thereby enabling our customers

    E-Print Network [OSTI]

    Uppsala Universitet

    GE Healthcare Life Sciences provides products and services used as tools for biopharmaceutical protein purification at Protein Tools, GE Healthcare, Uppsala Background Immobilized metal affinity independently and in collaborations. The master thesis will be carried out at GE Healthcare in Uppsala and last

  18. Nuclear Research & Consultancy Group (NRG) develops and provides sustainable nuclear technology for energy, environment, and health. NRG offers a wide range of services to energy

    E-Print Network [OSTI]

    Lindken, Ralph

    Nuclear Research & Consultancy Group (NRG) develops and provides sustainable nuclear technology organizations and various branches of industry - including the nuclear, financial services and medical sectors: Better prediction of the flow and heat transfer in liquid metal cooled nuclear reactors will contribute

  19. 03.110 Electronic Funds Transfer (EFT) of Salary. 1. Purpose. To provide a service to University of North Texas System

    E-Print Network [OSTI]

    03.110 Electronic Funds Transfer (EFT) of Salary. 1. Purpose. To provide a service to University to participate must complete and sign an Authorization Agreement for Electronic Funds Transfer of Salary Form Controller to electronically deposit an employee's salary directly to their account and to initiate

  20. Reducing Extreme Weather Impacts: Building a Weather-Ready Nation For more than 140 years, the National Weather Service (NWS) has provided weather, water, and climate

    E-Print Network [OSTI]

    Reducing Extreme Weather Impacts: Building a Weather-Ready Nation For more than 140 years, the National Weather Service (NWS) has provided weather, water, and climate information to protect lives also been a year of extreme weather events. The impact of these events, both on lives and the economy

  1. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  2. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  3. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  4. Integrated assessment and ValuatIon of ecosystem goods and serVIces proVIded by coastal systems

    E-Print Network [OSTI]

    Vermont, University of

    stocks that produce them are critical to the functioning of the earth's life support systems. They also between land and sea, the coastal regions of the earth serve as unique geological, ecological for human activity. Early on, estuaries and inlets served as places of relative shelter that also provided

  5. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  6. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  7. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  8. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  9. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  10. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  11. Operations Management oversees all activities directly related to making a product or providing a service. This functional area is responsible for

    E-Print Network [OSTI]

    Calgary, University of

    are produced forecast future demand for goods and services manage logistics and supply chains (the movement of materials, equipment, energy, information, and human skills into goods and services that satisfy customer dynamic sectors such as energy, transportation, financial services, and manufacturing. This is an area

  12. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  13. The OHSU Library provides public access to medical information and resources. Please ask at the Library Service Desk if you need help with finding information or with any questions

    E-Print Network [OSTI]

    Chapman, Michael S.

    The OHSU Library provides public access to medical information and resources of access to the general public computers and/or access to the OHSU Library. Please ask at the Library Service Desk if you need help with finding

  14. Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopment Top Scientific Impact SinceService and Repair

  15. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  16. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  17. Hydranet: network support for scaling of large scale servic es 

    E-Print Network [OSTI]

    Chawla, Hamesh

    1998-01-01

    is based on replicating transport level service access points (TSAPS) for transparent distribution or replication of IP services. Measurements on a local testbed show that the overhead of our scheme is small. TSAP replication is widely applicable. We use...

  18. PRAXIS II Family and Consumer Sciences (FCS) Exam The Praxis SeriesTM assessments provide educational tests and other services that states use as part

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    educational tests and other services that states use as part of their teacher licensure and certification education, 10 questions regarding housing, 11 questions regarding clothing and textiles, 18 questions and lifestyles, the development and education of family members, consumer education, physical and psychological

  19. Area Community Services Employment and Training Council Â… Weatherization Assistance Program Funds Provided by the American Recovery and Reinvestment Act of 2009, OAS-RA-13-23

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram:Y-12Power, Inc | Department ofMarketing, LLCorArea Community Services

  20. Campus Shared Services (CSS) provides administrative support to campus, and Fiscal Close for FY2014-2015 represents the first time CSS will be processing work on behalf of nearly all UC Berkeley campus

    E-Print Network [OSTI]

    Jacobs, Lucia

    by the Controller's office. Please refer to the CSS Fiscal Close FY2014-2015 information found below and on the CSSCampus Shared Services (CSS) provides administrative support to campus, and Fiscal Close for FY2014 to complete processing of your requests/transactions for the fiscal close. Every effort will be made

  1. Providing quality water, power and service at a competitive price that our customers value 2320 California Street Everett, WA 98201 / Mailing Address: P.O. Box 1107 Everett, WA 98206-1107

    E-Print Network [OSTI]

    levels with our retailers if we withdraw from the lighting market. 2. Residential behavior: We haveProviding quality water, power and service at a competitive price that our customers value 2320-783-1000 · Toll-free in Western Washington at 1-877-783-1000 · www.snopud.com October 30, 2014 Northwest Power

  2. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  3. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  4. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  5. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  6. Perceptions of livestock producers, forage producers, wildlife managers, and forage-based service providers concerning extension and technology-transfer activities in south Texas and northeast Mexico 

    E-Print Network [OSTI]

    Folsom, Wendy Ann

    2001-01-01

    The purpose of this bi-national study was to determine the type, nature, and extent of existing extension and technology-transfer activities provided to livestock producers, forage producers, and wildlife managers in south ...

  7. Sandy beaches and dunes provide a natural buffer to coastal hazards, habitat for many estuarine species, and water quality services. While

    E-Print Network [OSTI]

    Sandy beaches and dunes provide a natural buffer to coastal hazards, habitat for many estuarine recreation. The importance of sandy shores was recognized with the passage of the Coastal Primary Sand Dune also defined a beach and coastal primary sand dune and included a list of those plants which grow upon

  8. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  9. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  10. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  11. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  12. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  13. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  14. Scotts Valley Energy Office and Human Capacity Building that will provide energy-efficiency services and develop sustainable renewable energy projects.

    SciTech Connect (OSTI)

    Anderson, Temashio

    2013-06-28

    The primary goal of this project is to develop a Scotts Valley Energy Development Office (SVEDO). This office will further support the mission of the Tribe's existing leadership position as the DOE Tribal Multi-County Weatherization Energy Program (TMCWEP) in creating jobs and providing tribal homes and buildings with weatherization assistance to increase energy efficiency, occupant comfort and improved indoor air quality. This office will also spearhead efforts to move the Tribe towards its further strategic energy goals of implementing renewable energy systems through specific training, resource evaluation, feasibility planning, and implementation. Human capacity building and continuing operations are two key elements of the SVEDO objectives. Therefore, the project will 1) train and employ additional Tribal members in energy efficiency, conservation and renewable resource analyses and implementation; 2) purchase materials and equipment required to implement the strategic priorities as developed by the Scotts Valley Tribe which specifically include implementing energy conservation measures and alternative energy strategies to reduce energy costs for the Tribe and its members; and 3) obtain a dedicated office and storage space for ongoing SVEDO operations.

  15. Technical support services to assist the Office of Environmental Audit in conducting the DOE Environmental Survey and to provide technical assistance on Environmental Compliance issues. Technical progress report, February 16, 1990--August 13, 1990

    SciTech Connect (OSTI)

    NONE

    1995-07-01

    NUS received authorization from DOE on August 14, 1987 to provide technical support services to assist the Office of Environmental Audit (OEV) in conducting the DOE Environmental Survey and to provide technical assistance on environmental compliance issues. The overall contract is to accomplish a one-time, no-fault baseline Survey of all DOE operating facilities, and to provide technical assistance and support for the resolution of environmental compliance issues. NUS has completed the Preliminary Reports and continues to support DOE on the Prioritization and Tiger Team Assessment efforts. The project requires a broad range of environmental protection expertise, necessitating senior-level personnel as the primary project staff. Many of the tasks assigned by DOE require quick startup and performance, and several tasks may be active at any one time.

  16. An Information Services Algorithm to Heuristically Summarize IP Addresses for a Distributed, Hierarchical Directory Service

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News Publications TraditionalWith PropaneNaturalTestAn Evolutionary Arms Race for

  17. QoS-Assured Service Composition in Managed Service Overlay Networks Xiaohui Gu, Klara Nahrstedt Rong N. Chang, Christopher Ward

    E-Print Network [OSTI]

    Nahrstedt, Klara

    Network (SON) SON Access Domain Service Provider: XXX.com service instance X service instance Y service

  18. Required Coordination with ITER Logistical Services Provider

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Project Office (USIPO) will issue Task Orders directly to the LSP for transportation, logistics, and customs clearance associated with items delivered under this Agreement. Seller...

  19. Static Pricing for a Network Service Provider

    E-Print Network [OSTI]

    Caro, F.; Simchi-Levi, D.

    2006-01-01

    in Multiservice Loss Networks: Static Pricing, Aysmptoticoptimal versus optimal (static prices). N N 1 N 2 J a J ? JJ ? ?J a J ? Table 2: Static pricing and threshold policies

  20. Providence Financial Services Ltd | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource HistoryPotentialRuralUtilityScalePVGeneration Jump to:SpatialResolutionWidth (m)Power Pty

  1. 2014 Revenue for Delivery Service Providers

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: AlternativeMonthly","10/2015"Monthly","10/2015" ,"Release7 Relative Standard Errors for RelativeIndustrial (DataRevenue for

  2. Aligning Building Owners and Service Providers

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based Fuels Research at NRELDepartmentJune 2, 2015Aligned Partnerships

  3. Providence Newberg Medical Center

    High Performance Buildings Database

    Newberg, Oregon In 2002, Providence Health & Services began planning a new 188,000 square foot medical center in Newberg, Oregon to respond to the growing community's need for accessible health care. Since this was Providence's first new hospital in almost thirty years, its leaders decided to approach the project through innovative planning, design, and construction, including the achievement of lifecycle energy savings and a potential LEED certification. The hospital is comprised of 40 inpatient beds with views out to the surrounding rural landscape or into lushly planted internal courtyards.

  4. Use of Service Curve for Resource Reservation in Wired-cum-Wireless Scenario

    E-Print Network [OSTI]

    Misra, Nitul Dutta; Iti Saha

    2010-01-01

    In a network, arrival process is converted into departure process through network elements. The departure process suffer propagation delay in the link, processing delay at the network elements like router and data loss due to buffer overflow or congestion. For providing guaranteed service resources need to be reserved before conversation takes place. To reserve such resources estimation of them are indispensable. The idea of service curve gives beforehand deterministic value of these parameters. In this paper, we aim to minimum and maximum buffer space required in the router, minimum link capacity required to guarantee a pre-specified end-to-end delay for an ongoing session in a wired-cum-wireless scenario by analyzing minimum and maximum service curve. We assume that the network we are analyzing is an IP based mobile network. The findings of the work are presented in the form of tables which can be used for resource reservation to offer quality service to end-users.

  5. IT Services' Service Level Agreement TECHNICAL SUPPORT

    E-Print Network [OSTI]

    Hamburger, Peter

    IT Services' Service Level Agreement TECHNICAL SUPPORT and HARDWARE/SOFTWARE/NETWORK MAINTENANCE This service level agreement (SLA) describes the computer services provided by Walb Union Operations into the university services card system's database by Union Operations. Walb Union Operations creates university

  6. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  7. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  8. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  9. Technical support services to assist the Office of Environmental Audit in conducting the DOE Environmental Survey and to provide technical assistance on Environmental Compliance issues. Technical progress report, August 14, 1990--February 15, 1991

    SciTech Connect (OSTI)

    NONE

    1995-07-01

    NUS received authorization from DOE on August 14, 1987 to provide technical support services to assist the Office of Environmental Audit (OEV) in conducting the DOE Environmental Survey and to provide technical assistance on environmental compliance issues. The overall contract is to accomplish a one-time, no-fault baseline Survey of all DOE operating facilities, and to provide technical assistance and support for the resolution of environmental compliance issues. NUS has completed the Preliminary Reports and continues to support DOE on the Prioritization and Tiger Team Assessment efforts. The project requires a broad range of environmental protection expertise, necessitating senior-level personnel as the primary project staff. Many of the tasks assigned by DOE require quick startup and performance, and several tasks may be active at any one time. The objective of the DOE Environmental Survey Program is to identify and prioritize areas of existing environmental risk at 36 DOE facilities. NUS`role is to technically assist the Office of Environmental Audit in the implementation of the Surveys.

  10. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  11. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  12. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  13. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  14. Creation of safety-net-based provider networks under the California Health Care Coverage Initiative: interim findings.

    E-Print Network [OSTI]

    2009-01-01

    physicians, hospitals, and ancillary service providers suchdiem (PD), Other (O) Ancillary Services and Reimbursementto county facilities. Ancillary Services and Reimbursement

  15. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  16. Rapid Detection of Maintenance Induced Changes in Service Performance

    E-Print Network [OSTI]

    Greenberg, Albert

    - plicated interactions across devices or software. During a maintenance activity, the Operations team is reRapid Detection of Maintenance Induced Changes in Service Performance Ajay Mahimkar , Zihui Ge ­ Research AT&T, Inc. The University of Texas at Austin § ABSTRACT Service quality in operational IP

  17. A PLATFORM FOR THE IMPLEMENTATION OF THE SERVICES OF AN EDUCATIONAL NETWORK

    E-Print Network [OSTI]

    A PLATFORM FOR THE IMPLEMENTATION OF THE SERVICES OF AN EDUCATIONAL NETWORK Ch. Bouras1,2 A. Gkamas for the implementation of the services of an educational network over TCP/IP networks such as the Internet. Our proposal aiming at the upgrade of the offered educational services. In such a network, information is located

  18. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  19. INFORMATIONQUALITYEVALUATIONFORGRID INFORMATION SERVICES

    E-Print Network [OSTI]

    Pallis, George

    INFORMATIONQUALITYEVALUATIONFORGRID INFORMATION SERVICES Wei Xing, Oscar Corcho, Carole Goble@cs.ucy.ac.cy Abstract The quality of the information provided by information services deployed in the EGEE production query by different information services can be different. Developers of these services and of other

  20. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  1. University of New Orleans Financial Conflict of Interest (FCOI) Information Digest The purpose of this Document is to provide to UNO researchers an overview of the 2011 revised U.S. Public Health Service (PHS) FCOI regulation

    E-Print Network [OSTI]

    Li, X. Rong

    ), Office of the Inspector General (OIG); Substance Abuse and Mental Health Services Administration (SAMHSA or disclosure of the monetary value. Subrecipient Institutions/Investigators and Reporting of identified FCOIs on their COI policy must report identified FCOIs to UNO in sufficient time to allow UNO to file reports

  2. Technical Assistance to ISO's and Grid Operators For Loads Providing...

    Office of Environmental Management (EM)

    & Publications Loads Providing Ancillary Services: Review of International Experience Demand Response and Energy Storage Integration Study - Past Workshops Load Participation...

  3. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  4. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  5. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  6. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  7. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  8. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  9. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  10. 1A. Project title Enabling quality of service in IP-based communication networks

    E-Print Network [OSTI]

    Boucherie, Richard J.

    , resource management mechanisms are proposed. These range from packet scheduling and priority mechanisms of Mathematical Sciences University of Twente Expert in: stochastic processes, queueing theory, logistics. 2 hrs research institute of the Uni- versity of Twente UT, operating in the area of telematics and information

  11. (4) HARDWARE-SOFTWARE COMPLEX FOR MULTIMEDIA CONTENT SERVICES IN IP

    E-Print Network [OSTI]

    California at Los Angeles, University of

    -10 /) - ­ , , 2.1. 2.1 DVB-S , $ Techno Trend TT-Pcline Budget (SkyStar3) PCI, PID 100 Techno Trend TT-Pcline Premium (SkyStar1) PCI, PID, MPEG2 200 TechniSat SkyStar3 PCI, PID 100 AverMedia AverTV DVB-S PCI, PID 109 Vision Plus VisionDTV SAT-CI PCI, PID, Common Interface ­ 140 #12

  12. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users Deny Service

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996HowFOAShowing YouNeed forUnruhDepartment ofM I C HCommands on| Department

  13. Mail Services User's Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-07-12

    This Manual provides detailed information on using the Department of Energy (DOE) mail services. Canceled by DOE G 573.1-1.

  14. Print news -IPS Inter Press Service Inter Press Service News Agency Tuesday, November 11, 2008 18:31 GMT

    E-Print Network [OSTI]

    in the midwestern U.S. state of Nebraska. The plant is designed to produce 50 million litres of bioethanol (fuel

  15. Print news -IPS Inter Press Service Inter Press Service News Agency Tuesday, November 11, 2008 18:17 GMT

    E-Print Network [OSTI]

    , the European Biodiesel Board and carmakers Volvo and Volkswagen. Environmental campaigners are perturbed to make way for biofuel plantations. In a recent report, it cited UN estimates that 60 million indigenous

  16. U-029: TCP/IP Services for OpenVMS POP/IMAP Service Bug Lets Remote Users

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsStateof Energy TwoEvent at the Pu2: AppleGain Unauthorized

  17. Library Services Strategic Plan

    E-Print Network [OSTI]

    Applebaum, David

    1 Library Services Strategic Plan 2013 - 2016 Contents 1. Overview 2. Mission Statements 3. Vision provided by Library Services will be integral to the College's success; therefore this strategic plan defines a vision of how the service will contribute to the achievement of the King's strategic plan over

  18. Mail Services User's Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-10-03

    This Guide provides information on using Department of Energy (DOE) mail services in accordance with U.S. Postal Service, General Services Administration (GSA), and DOE regulations. Cancels DOE M 573.1-1. Canceled by DOE N 251.89.

  19. Recent legislative changes affect the way we teach and provide service at Western. The Accessibility for Ontarians with Disabilities Act (AODA) has new requirements that came into effect as of January 1, 2014,

    E-Print Network [OSTI]

    Lennard, William N.

    . Accessible Educational and Training Resources Under the Information and Communication Standard, we are required to provide educational or training resources in an accessible format that takes into account records. Purchase educational materials that include an accessible or conversion-ready electronic format

  20. AdministrAtion And FinAnce mission stAtement Administration and Finance exists to support the strategic mission of Northern Kentucky University by providing quality service through sound

    E-Print Network [OSTI]

    Boyce, Richard L.

    20132013 AdministrAtion And FinAnce mission stAtement Administration and Finance exists to support within Administration and Finance are committed to the development, implementation, and continuous of Northern Kentucky University. Administration and Finance strives to provide a climate conducive

  1. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  2. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  3. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  4. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  5. Technical support services to assist the Office of Environmental Audit in conducting the DOE Environmental Survey and to provide technical assistance on Environmental Compliance issues. Technical progress report, February 16, 1991--August 16, 1991

    SciTech Connect (OSTI)

    NONE

    1995-07-01

    HALLIBURTON NUS received authorization from DOE on August 14, 1987 to provide technical support to assist the Office of Environmental Audit (OEV) in conducting the DOE Environmental Survey and to provide technical assistance on environmental compliance issues. The overall contract is to accomplish a one-time, no-fault baseline Survey of all DOE operating facilities, and to provide technical assistance and support for the resolution of environmental compliance issues. NUS has completed the Preliminary Reports and continues to support DOE on the Prioritization and Tiger Team Assessment efforts. The project requires a broad range of environmental protection expertise, necessitating senior-level personnel as the primary project staff. Many of the tasks assigned by DOE require quick startup and performance, and several tasks may be active at any one time. The objective of the DOE Environmental Survey Program is to identify and prioritize areas of existing environmental risk at 36 DOE facilities. NUS`role is to technically assist the Office of Environmental Audit in the implementation of the Surveys.

  6. and Providers With our vast network,

    E-Print Network [OSTI]

    Mease, Kenneth D.

    . In addition, we offer a number of quick and easy ways to locate participating providers. You can search for a provider by visiting our website, anthem.com/ca, or you can call Customer Service at the toll-free number health care. SC9722 Rev. 2/11 Anthem Blue Cross is the trade name of Blue Cross of California

  7. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  8. University Services Management Services

    E-Print Network [OSTI]

    into a consolidated data-center and server support team that lowered support costs and reduced or eliminated is that the University be known as much for its service and business innovation as for its high quality research innovative services to assist the units we serve to achieve their goals in a manner consistent with the world

  9. UNIVERSITY HEALTH SERVICES ANNUAL REPORT

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    UNIVERSITY HEALTH SERVICES ANNUAL REPORT 2009-2010 UHS Mission: To enhance learning and student to student-focused services. o A commitment to providing culturally competent and respectful services to all Services meets the changing needs of all university students in a culturally competent and respectful

  10. Student Services Student Services

    E-Print Network [OSTI]

    /Pacific American awareness and education. Resources include: · Academic support programs · Connections with community · Educational and cultural programs/resources · Student organization support · Student leadership in collaboration that maximizes the use of resources and services across the Division, across campus

  11. IEEE Wireless Communications August 200940 1536-1284/09/$25.00 2009 IEEE SERVICE-ORIENTED BROADBAND

    E-Print Network [OSTI]

    Zhang, Xi

    IEEE Wireless Communications · August 200940 1536-1284/09/$25.00 © 2009 IEEE Internet SERVICE-ORIENTED BROADBAND WIRELESS NETWORK ARCHITECTURE INTRODUCTION Recent years have witnessed the emergence of a variety of wireless services, such as videoconfer- encing, Internet Protocol (IP) TV, music down- loading, and online

  12. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  13. Next generation solutions for the energy services industry

    E-Print Network [OSTI]

    Kumar, Satish; Kromer, Steve

    2006-01-01

    in energy prices. The energy service providers will need toUncertainties Energy Service Providers Figure 2. Theenergy projects are evaluated both on the client side as well as on the service provider

  14. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  15. Providing Regulation Services and Managing Data Center Peak Power Budgets

    E-Print Network [OSTI]

    Simunic, Tajana

    -based peak shaving. However, none of these publications consider the feasibility of using the energy storage AND RELATED WORK Substantial integration of electric vehicles and renewable energy sources into the electric utility companies use to ensure stability. It includes multiple mechanisms, such as demand-response (DR

  16. Guidelines for Selecting a Compressed Air System Service Provider

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    facilities in achieving greater reliability, improved quality control, and lower operating costs for their compressed air systems. The CAC encourages facilities to take a...

  17. VISION STATEMENT We provide expert guidance and timely service

    E-Print Network [OSTI]

    Jia, Songtao

    & 14 C, then use separate col- umns on the waste label. Decay In Storage Guidelines: Radioactive wastes.ehs.columbia.edu RADIOACTIVE WASTE MANAGEMENT Environmental Health & Safety Radioactive Clearance Procedures: Lead from the equipment by the lab and managed as radioactive waste. All surfaces must be decontaminated

  18. Distributed Smart Grid Asset Control Strategies for Providing Ancillary Services

    SciTech Connect (OSTI)

    Kalsi, Karanjit; Zhang, Wei; Lian, Jianming; Marinovici, Laurentiu D.; Moya, Christian; Dagle, Jeffery E.

    2013-10-30

    With large-scale plans to integrate renewable generation driven mainly by state-level renewable portfolio requirements, more resources will be needed to compensate for the uncertainty and variability associated with intermittent generation resources. Distributed assets can be used to mitigate the concerns associated with renewable energy resources and to keep costs down. Under such conditions, performing primary frequency control using only supply-side resources becomes not only prohibitively expensive but also technically difficult. It is therefore important to explore how a sufficient proportion of the loads could assume a routine role in primary frequency control to maintain the stability of the system at an acceptable cost. The main objective of this project is to develop a novel hierarchical distributed framework for frequency based load control. The framework involves two decision layers. The top decision layer determines the optimal gain for aggregated loads for each load bus. The gains are computed using decentralized robust control methods, and will be broadcast to the corresponding participating loads every control period. The second layer consists of a large number of heterogeneous devices, which switch probabilistically during contingencies so that aggregated power change matches the desired amount according to the most recently received gains. The simulation results show great potential to enable systematic design of demand-side primary frequency control with stability guarantees on the overall power system. The proposed design systematically accounts for the interactions between the total load response and bulk power system frequency dynamics. It also guarantees frequency stability under a wide range of time varying operating conditions. The local device-level load response rules fully respect the device constraints (such as temperature setpoint, compressor time delays of HVACs, or arrival and departure of the deferrable loads), which are crucial for implementing real load control programs. The promise of autonomous, Grid Friendly™ response by smart appliances in the form of under-frequency load shedding was demonstrated in the GridWise Olympic Peninsula Demonstration in 2006. Each controller monitored the power grid voltage signal and requested that electrical load be shed by its appliance whenever electric power-grid frequency fell below 59.95 Hz. The controllers and their appliances responded reliably to each shallow under-frequency event, which was an average of one event per day and shed their loads for the durations of these events. Another objective of this project was to perform extensive simulation studies to investigate the impact of a population of Grid Friendly™ Appliances (GFAs) on the bulk power system frequency stability. The GFAs considered in this report are represented as demonstration units with water heaters individually modeled.

  19. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    settle with ERCOT for energy and capacity. Retail Electricfor participation in energy and capacity markets. Technicalloads participating in energy and capacity markets, it does

  20. US - Voice Over Internet Protocol Phone Service Providers Market Analysis

    E-Print Network [OSTI]

    Srinivasan, Vijaybabu

    2006-05-19

    .263 Bit stream in the Real-time Transport Protocol Vijaybabu Srinivasan Spring 2006 17 EMGT835 RTCP RTP Control protocol RTP Real-Time Transport H.323 Protocols... Total 100 Reputation/ Image: Evaluation Criteria: Reputation is the current sum total of the specific traits attributed to a company by people. A company?s reputation is produced by the memory impressions of its perceived actions over time. 13...

  1. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    2006a). Advanced telemetry or SCADA was required for mostrequirements (e.g. , SCADA or similar arrangement),rather than the stringent SCADA requirement. 24 Table 8:

  2. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    AEMC 2005. Australia Electricity Market Commission, 2005.Annual Electricity Market Performance Review - Reliability &3 Selecting Electricity Markets for

  3. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    with overall market design, procurement arrangements andand Wholesale Electric Market Design, FERC Working PaperElements of a Successful Market Design”, X. Ma and D. Sun.

  4. Loads Providing Ancillary Services: Review of International Experience...

    Energy Savers [EERE]

    have been relaxed as third party load aggregators have developed and installed lower-cost communications equipment. These load aggregators targeted customers with small...

  5. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    kW) back-up generators and dual-fuel boilers as sources ofelectric water heaters, dual-fuel boilers, and buildingselectric water heaters, dual-fuel boilers, and any building

  6. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    unexpected generator outages and transmission line failures.equipment failure. The output from wind generators or other

  7. ORNL/TM-2008/233 Providing Reliability Services through

    E-Print Network [OSTI]

    Pennycook, Steve

    ://www.ntis.gov/support/ordernowabout.htm Reports are available to DOE employees, DOE contractors, Energy Technology Data Exchange (ETDE

  8. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    Down (DRS) Frequency Controlled Disturbance Reserve (FCDR)its assigned Frequency Controlled Disturbance Reserves and120 MW of frequency-controlled disturbance reserve and 400

  9. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    to meet forecast demand for both energy and ancillarydemand forecast determines the market price. 2006a). As an energy-

  10. Loads Providing Ancillary Services: Review of International Experience

    E-Print Network [OSTI]

    Heffner, Grayson

    2008-01-01

    12”. National Grid Electricity Transmission, plc. January 9,British Electricity Trading and Transmission ArrangementBritish Electricity Trading and Transmission Arrangement (

  11. ALTERNATIVE FINANCIAL SERVICE PROVIDERS THE SPATIAL VOID HYPOTHESIS

    E-Print Network [OSTI]

    Smith, Tony E.

    )--check cashing outlets, payday lenders, pawnshops, rent-to-own stores, auto title lenders, and money transmitters

  12. Using Partnerships to Drive Demand and Provide Services in Communities |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-Sessions | Department ofVP ofof EnergyFactConditions

  13. CBEI: Aligning Owners and Service Providers - 2015 Peer Review | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram:Y-12Power,5 BUDGET AT-A-GLANCE BuildingsC.D.CALiPER TestingReview |of

  14. Loads Providing Ancillary Services: Review of International Experience |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbineProcesses to Their Environmental

  15. London Climate Change Service Providers Group LCCSPG | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EAInvervarLeeds, UnitedLibertyLite OnCounty Coop Power

  16. Guidelines for Selecting a Compressed Air System Service Provider |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nA Guide to Tapping STD-1128-2013levelGUIDE TO| Departmentcovers how

  17. Energy Services Providers, Inc. (New York) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdisto Electric Coop, Incsource History View NewRecommerce IncTrust

  18. For Service Providers and Software Developers | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015ExecutiveFluorescent Lamp BallastsActivities, OAS-M-06-09 |

  19. Loads Providing Ancillary Services: Review of International Experience

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPA PublicLED ADOPTIONtoLightingEnergyEnergyLiveEnergy

  20. IPv6 Implementation at a Network Service Provider

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D.FoodHydropower, WaveID-11383 Revision 2TOIORIPMIPv6

  1. Congressional Research Service, Research

    E-Print Network [OSTI]

    Fernández-Juricic, Esteban

    , confidential memos, expert testimony at Congressional hearings, and responses to inquiries about major policyCongressional Research Service, Research Associate Graduate Intern Behind the Capitol Building, the face of the Legislative Branch, lies the Congressional Research Service (CRS) which provides support

  2. An Energy Services Initiative 

    E-Print Network [OSTI]

    Beasley, R. C.; Tipton, J. K.; Ehmer, R. C.

    1996-01-01

    The parent company of a large electric utility has launched a new unregulated subsidiary that provides a portfolio of value-added, beyond-the-meter energy services. These services are designed to meet the specific needs of customers and to better...

  3. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  4. Delivered by Ingenta to: IP : 131.84.11.215

    E-Print Network [OSTI]

    Mukhopadhyay, Sharmila M.

    and Nanotechnology Letters Vol. 3, 110­113, 2011 Cell Growth in a Porous Microcellular Structure: Influence to have more cell growth along pore walls but do not have any significant influence on overall nuclear for specific biological environments. Such an investigation will provide effective assessment and development

  5. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  6. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  7. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  8. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  9. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  10. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  11. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  12. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  13. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  14. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  15. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  16. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  17. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  18. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  19. INFORMATION TECHNOLOGY SERVICES CRM Agent Training

    E-Print Network [OSTI]

    McQuade, D. Tyler

    INFORMATION TECHNOLOGY SERVICES CRM Agent Training Assigning an agent to a case Service Management case, select the case number. INFORMATION TECHNOLOGY SERVICES #12;3 5. When the case page has opened TECHNOLOGY SERVICES #12;4 7. Select the appropriate provider group. INFORMATION TECHNOLOGY SERVICES #12;5 8

  20. Utility Service Renovations

    Broader source: Energy.gov [DOE]

    Any upgrade to utility service provides an opportunity to revisit a Federal building's electrical loads and costs, but it also may provide an economic way to bundle the upgrade with an onsite renewable electricity project during renovation. Upgrading utility service to the site may involve improving or adding a transformer, upgrading utility meters, or otherwise modifying the interconnection equipment or services with the utility. In some cases, the upgrade may change the tariff structure for the facility and may qualify the property for a different structure with lower overall costs. In all cases, the implementation of renewable energy technologies should be identified during the design phase.

  1. Research Data Management: Tools & Services

    E-Print Network [OSTI]

    Tsang, Daniel C

    2013-01-01

    Research Data Management Tools & Services Daniel C.Data Librarian, UCI Libraries Research Data Management Manyand provide stewardship for research data generated by

  2. Beryllium - HPMC Occupational Health Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hanford in accordance with 10 CFR 850. This program is designed to provide professional services in support of Hanford workers. HPMC OMS is committed to the health, preventive...

  3. Ergonomics - HPMC Occupational Health Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Font Size Decrease Font Size AMHErgonomicsImages HPMC OMS provides ergonomic support services which include consultation, office and field ergonomic evaluation and education....

  4. Director, Information Technology Services Office

    Broader source: Energy.gov [DOE]

    The mission of the information Technologies Services Office is to provide effective corporate management leadership to proactively identify and manage business system efficiency improvements and to...

  5. Indigenous Services Services for Students

    E-Print Network [OSTI]

    Sinnamon, Gordon J.

    STUDENT SERVICES Indigenous Services Services for Students with Disabilities Learning Skills Distance Studies Continuing Studies Student Success CentreLEARNING SERVICES TEACH ING& DEVELOPM E NTCENTRE collaborative and student- focused efforts make a difference. John Doerksen Vice-Provost (Academic Programs

  6. Transmission Services Commercial Systems Support and Development

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Call Agenda This customer conference call will provide updates concerning BPA Transmission Services' commercial systems support and development efforts. It will also provide...

  7. Project Final Report UBC LBS Project Services1 Project Final Report UBC LBS Project Services2

    E-Print Network [OSTI]

    is used as a foundation for all development, land use, and transportation activities at UBC. LBS Project Services is a fee-for-service provider of development, design, and project management servicesProject Final Report UBC LBS Project Services1 #12;Project Final Report UBC LBS Project Services2

  8. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  9. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  10. Notes2Providers.doc -1-Notes to Retail Providers

    E-Print Network [OSTI]

    providers that purchase electricity from a power pool that submits an Annual Report to the Energy CommissionNotes2Providers.doc -1- Notes to Retail Providers February 2003 Power Source Disclosure an energy mix or fuel mix different than the California Mix, (Net System Power)i . As a retail provider you

  11. Update on Service Management project

    ScienceCinema (OSTI)

    None

    2011-04-25

    GS and IT Service Management project status meeting -------------------------------------------------------------------------- Distribution: Sigurd Lettow, Frederic Hemmer, Thomas Pettersson, David Foster, Matti Tiirakari, GS⁢ Service Providers When and where: Thursday 2nd September at 10:00-11:30 in IFiltration Plant (222-R-001) Dear All, We would like to inform you about progress made on different topics like the Service Catalogue, the new Service Management Tool and the Service Desk. We would also like to present the plan for when we hope to "go live" and what this will mean for all of you running and providing services today. We will need your active support and help in the coming months to make this happen. GS⁢ Service Management Teams Reinoud Martens, Mats Moller

  12. INFORMATION TECHNOLOGY SERVICES CRM Agent Training

    E-Print Network [OSTI]

    McQuade, D. Tyler

    INFORMATION TECHNOLOGY SERVICES CRM Agent Training Creating a Case Service Management Deployment Request. An agent can change the INFORMATION TECHNOLOGY SERVICES #12;3 type to reflect the type of case of the provider group field. INFORMATION TECHNOLOGY SERVICES #12;4 Selecting the magnifying glass will open

  13. Academic Data Research Services Alliance: Bridging the Gap Between Data and Discovery

    E-Print Network [OSTI]

    Warner, Beth Forrest; Stephens, Denise; Spurling, Loretta

    2002-10-03

    . The University of Kansas Academic Data Research Services Alliance provides a cross-unit model for improving data services....

  14. Satellites provide the big picture

    E-Print Network [OSTI]

    Famiglietti, JS; Cazenave, A; Eicker, A; Reager, JT; Rodell, M; Velicogna, I

    2015-01-01

    provide the necessary “big-picture” spatial coverage, asprovide the big picture gether, these measurements will

  15. UNIT TYPE MILITARY PROVIDES IIT PROVIDES (Navy/Marines)

    E-Print Network [OSTI]

    Heller, Barbara

    UNIT TYPE MILITARY PROVIDES IIT PROVIDES Naval (Navy/Marines) 4 year­Type 1 Full tuition and fees. Room and board* for all 4 years. Navy (Must be currently enlisted personnel) STA-21 Seaman to Admiral

  16. Managing Faults in the Service Delivery Process of Service Provider Coalitions Patricia Marcu

    E-Print Network [OSTI]

    processes of ITSM are critical for successful delivery as stressed by the IT Infrastructure Library (ITIL

  17. Digital help service opportunities for communication service providers in the convergent digital home

    E-Print Network [OSTI]

    Spiniak, Juan (Spiniak Irarrazaval)

    2011-01-01

    Homes are becoming increasingly connected as new technologies allow users to access media and information from any-device at anytime. Notebooks, HDTVs, smartphones, media servers, photo cameras, and video cameras, all form ...

  18. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  19. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  20. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  1. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  2. Utility Energy Services Contracts: Enabling Documents

    SciTech Connect (OSTI)

    2009-05-01

    Utility Energy Services Contracts: Enabling Documents provides materials that clarify the authority for Federal agencies to enter into utility energy services contracts (UESCs), as well as sample documents and resources to ease utility partnership contracting.

  3. USAA: Organizing for Innovation and Superior Customer Service

    E-Print Network [OSTI]

    Ross, Jeanne W.

    2010-12-01

    USAA, a diversified financial services firm serving the U.S. military, had long been recognized for outstanding customer service. The company had never operated branches, instead providing services through remote channels, ...

  4. System Assessment Standards: Defining the Market for Assessment Services 

    E-Print Network [OSTI]

    McKane, A. T.; Sheaffer, P. E.

    2008-01-01

    potential. A significant barrier to realizing this potential is the lack of market definition for system energy efficiency assessment services. This creates problems for service providers in establishing market value for their services and problems...

  5. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  6. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  7. License-aware Service Selection G.R. Gangadharan

    E-Print Network [OSTI]

    Dustdar, Schahram

    License-aware Service Selection G.R. Gangadharan , Marco Comerio , Hong-Linh Truong§ , Vincenzo D consumers and service providers, licenses are critical to be considered in services. A service license de to be enhanced together with consid- eration of licenses. In this paper, we analyze current service licensing

  8. ORIGINAL ARTICLE Ecosystem services and hydroelectricity in Central America

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ORIGINAL ARTICLE Ecosystem services and hydroelectricity in Central America: modelling service services provided to the Costa Rican and Nicaraguan hydroelectric sectors, which are crucial sectors for the conservation and restoration of forests for the services they provide to the hydroelectric sector. As such

  9. TEXAS&STATEWIDE&ASSESSMENT&& OF&FOREST&ECOSYSTEM&SERVICES&

    E-Print Network [OSTI]

    TEXAS&STATEWIDE&ASSESSMENT&& OF&FOREST&ECOSYSTEM&SERVICES& A&comprehensive&analysis&of®ulating& and&cultural&services&provided&by&Texas'&forests& & & & & & October&2013 June 2009 #12;#12;Texas&Statewide&Assessment&of&& Forest&Ecosystem&Services& A&comprehensive&analysis&of&the®ulating&and&& cultural&services&provided&by&Texas

  10. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  11. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  12. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  13. Using Dimmable Lighting for Regulation Capacity and Non-Spinning Reserves in the Ancillary Services Market. A Feasibility Study.

    E-Print Network [OSTI]

    Rubinstein, Francis

    2011-01-01

    EIA LBNL NRC Analog to Digital Ancillary Services Californiafor Non-AGC Units Providing Ancillary Services, http://Response for Wholesale Ancillary Services”. LBNL-2945E

  14. Field Testing of Automated Demand Response for Integration of Renewable Resources in California's Ancillary Services Market for Regulation Products

    E-Print Network [OSTI]

    Kiliccote, Sila

    2013-01-01

    the Market Report for PJM: Ancillary Service Markets. 2010Response for Wholesale Ancillary Services", Grid—Kintner—Meyer, Loads Providing Ancillary Services: Review of

  15. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  16. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  17. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  18. Service bulletin inventory management and modeling for aerospace parts in customer service organization

    E-Print Network [OSTI]

    Pardede, Erna K. (Erna Kertasasmita)

    2013-01-01

    The Customer Service department of United Technology Corporation (UTC) Aerospace System is primarily responsible for providing spare parts, repair services, training, and technical support for products that UTC Aerospace ...

  19. VT Electric Services VTES 601 Energy Dr.

    E-Print Network [OSTI]

    VT Electric Services Location VTES 601 Energy Dr. Blacskburg, VA 24061 (540) 231-6437 Office Hours Electric Services is to provide adequate, reliable and economical electric service to the buildings and sidewalk lighting. Functional Areas Customer Support; Powerline Repair & Maintenance; Power Transmission

  20. Web Services Need Consistency Giacomo Piccinelli

    E-Print Network [OSTI]

    Finkelstein, Anthony

    Web Services Need Consistency Giacomo Piccinelli Hewlett-Packard Laboratories Stoke Gifford Park.finkelstein|c.nentwich}@cs.ucl.ac.uk Abstract Web Services provide a powerful access channel to business capabilities. Inside the company can be streamlined and business opportunities extended. A major issue with the current Web Service

  1. Security Services Discovery by ATM Endsystems

    SciTech Connect (OSTI)

    Sholander, Peter; Tarman, Thomas

    1999-07-15

    This contribution proposes strawman techniques for Security Service Discovery by ATM endsystems in ATM networks. Candidate techniques include ILMI extensions, ANS extensions and new ATM anycast addresses. Another option is a new protocol based on an IETF service discovery protocol, such as Service Location Protocol (SLP). Finally, this contribution provides strawman requirements for Security-Based Routing in ATM networks.

  2. Transmission Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Transmission Services BPA Clarifications on the DSO216 1 Document updated on 2242015 at 3:29:25 PM B O N N E V I L L E P O W E R A D M I N I S T R A T I O N BPA Clarifications on...

  3. Service Proveider's Optimal Pricing for PVC and SVC Service

    E-Print Network [OSTI]

    Kansas, University of

    at which the provider's net income is maximized is strongly influenced by the relationship between the service provider's net income, taking into account both revenue derived from customers and the costs with an example based on a web browsing application, using realistic cost and pricing information. 1.Introduction

  4. Issues in Security Service Discovery and Routing

    SciTech Connect (OSTI)

    Sholander, P.; Tarman, T.

    1999-04-07

    The Security Specification, Version 1.0 allows security services to be provided by many devices in a network. It correctly presumes that if a virtual circuit needs these security services, then network topology and device policy will act to ensure that the appropriate security services are applied to the virtual circuit. This contribution moves that the Security Service Discovery and Routing function be included in the Security Version 2.0 work scope.

  5. The state of the energy service company today

    SciTech Connect (OSTI)

    Mozzo, M.A. Jr.

    1998-10-01

    Energy service companies have been around for several years. Every year, experts predict their demise. The traditional energy service company (ESCo), whose work utilizes utility rebates, will probably be long gone as rebates disappear. The new energy service company will arise in this industry. This new company will be one that can provide a vast menu of services to their customers. These services can include, but are not necessarily limited to, the following: (1) corporate energy management services, (2) natural gas transportation services, (3) electrical deregulation services, (4) energy engineering services, (5) economics and forecasting, and (6) project financing. The new energy service company must have the engineering, financial, and managerial resources and skills to provide these services. It must also have the ability to recognize the needs of a changing industry and adapt to these changes in order to survive and ultimately provide a benefit to society.

  6. INFORMATION TECHNOLOGY SERVICES CRM Self Service Training

    E-Print Network [OSTI]

    INFORMATION TECHNOLOGY SERVICES CRM Self Service Training Adding a Case Service Management Technology Services | its.fsu.edu | 2 #12;4. Select a Case Type 5. Select a Category that describes | Information Technology Services | its.fsu.edu | 3 #12;

  7. August 1998Published for the Members of the IP Multicast Initiative. BROADCAST on page 6

    E-Print Network [OSTI]

    Touch, Joe

    and financial services, media and manufacturing, retail, energy, telecommunications, and more. Our services in the international business community, with offices in eight countries in North America, Asia, and Europe. Our-known aggregator of Internet audio sites, became America's best-ever initial publicoffering when its shares opened

  8. Submitted to manuscript (Please, provide the manuscript number!)

    E-Print Network [OSTI]

    Ziya, Serhan

    with Unknown Types Zhankun Sun, Nilay Tanik Argon, Serhan Ziya Department of Statistics and Operations Research of a job may not be available immediately, but can be revealed through some preliminary investigation. While investigation provides useful information, it also delays the provision of services. Therefore

  9. Demand Response Providing Ancillary A Comparison of Opportunities and

    E-Print Network [OSTI]

    LBNL-5958E Demand Response Providing Ancillary Services A Comparison of Opportunities Government or any agency thereof or The Regents of the University of California. #12;Demand Response System Reliability, Demand Response (DR), Electricity Markets, Smart Grid Abstract Interest in using

  10. Bear Valley Electric Service- Solar Initiative Program

    Office of Energy Efficiency and Renewable Energy (EERE)

    Bear Valley Electric Service is providing an incentive for their residential customers to install photovoltaic (PV) systems. Systems must be sized to provide no more than 90% of the calculated or...

  11. Demand Response for Ancillary Services

    SciTech Connect (OSTI)

    Alkadi, Nasr E; Starke, Michael R

    2013-01-01

    Many demand response resources are technically capable of providing ancillary services. In some cases, they can provide superior response to generators, as the curtailment of load is typically much faster than ramping thermal and hydropower plants. Analysis and quantification of demand response resources providing ancillary services is necessary to understand the resources economic value and impact on the power system. Methodologies used to study grid integration of variable generation can be adapted to the study of demand response. In the present work, we describe and illustrate a methodology to construct detailed temporal and spatial representations of the demand response resource and to examine how to incorporate those resources into power system models. In addition, the paper outlines ways to evaluate barriers to implementation. We demonstrate how the combination of these three analyses can be used to translate the technical potential for demand response providing ancillary services into a realizable potential.

  12. Recent Developments in the Management of Cameco Corporation's Fuel Services Division Waste - 13144

    SciTech Connect (OSTI)

    Smith, Thomas P.

    2013-07-01

    Cameco Corporation is a world leader in uranium production. Headquartered in Saskatoon, Saskatchewan our operations provide 16% of the world uranium mine production and we have approximately 435 million pounds of proven and probable uranium reserves. Cameco mining operations are located in Saskatchewan, Wyoming, Nebraska and Kazakhstan. Cameco is also a major supplier of uranium processing services required to produce fuel for the generation of clean energy. These operations are based in Blind River, Cobourg and Port Hope, Ontario and are collectively referred to as the Fuel Services Division. The Fuel Services Division produces uranium trioxide from uranium ore concentrate at the Blind River Refinery. Cameco produces uranium hexafluoride and uranium dioxide at the Port Hope Conversion Facility. Cameco operates a fuel manufacturing facility in Port Hope, Ontario and a metal fabrication facility located in Cobourg, Ontario. The company manufactures fuel bundles utilized in the Candu reactors. Cameco's Fuel Services Division produces several types of low-level radioactively contaminated wastes. Internal processing capabilities at both the Blind River Refinery and Port Hope Conversion Facility are extensive and allow for the recycling of several types of waste. Notwithstanding these capabilities there are certain wastes that are not amenable to the internal processing capabilities and must be disposed of appropriately. Disposal options for low-level radioactively contaminated wastes in Canada are limited primarily due to cost considerations. In recent years, Cameco has started to ship marginally contaminated wastes (<500 ppm uranium) to the United States for disposal in an appropriate landfill. The landfill is owned by US Ecology Incorporated and is located near Grand View, Idaho 70 miles southeast of Boise in the Owyhee Desert. The facility treats and disposes hazardous waste, non-hazardous industrial waste and low-activity radioactive material. The site's arid climate, deep groundwater and favourable geology help ensure permanent waste isolation. Combined with a state of the art multi-layer landfill liner system, the Grand View facility represents an ideal choice to minimize environmental liability. Marginally contaminated wastes from operations within the Fuel Services Division are typically loaded into PacTec IP-2 rated Intermediary Bulk Containers and then transported by road to a nearby rail siding. The Intermediary Bulk Containers are then loaded in US Ecology owned gondola rail-cars. The gondolas are then transported via Canadian Pacific and Union Pacific railroads to the US Ecology Rail Transfer facility located in Mayfield, Idaho. The Intermediary Bulk Containers are unloaded into trucks for transport to the disposal facility located approximately 32 miles away. (authors)

  13. Coiled tubing; Operations and services

    SciTech Connect (OSTI)

    Sas-Jaworsky, A. II )

    1991-12-01

    This article outlines the minimum safety requirements that should be considered for onshore and offshore oil well service operations with coiled tubing equipment. These guidelines comply with Minerals Management Service (MMS) regulations issued on May 31, 1988, for offshore work. Where specific MMS regulations are sited, the regulation reference, Incident of Non-Compliance (INC), number is provided. These guidelines can be used by operators and contractors, and although U.S. offshore operations are emphasized, they are applicable wherever coiled tubing services are used.

  14. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 - 19PortalStatusUserUserHome Contact User Services

  15. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 - 19PortalStatusUserUserHome Contact UserServices

  16. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 - 19PortalStatusUserUserHome ContactUser Services

  17. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With WIPPfinalUnexpectedofWykoW03: DatatheServices Print The User

  18. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With WIPPfinalUnexpectedofWykoW03: DatatheServices Print The UserUser

  19. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With WIPPfinalUnexpectedofWykoW03: DatatheServices Print The

  20. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With WIPPfinalUnexpectedofWykoW03: DatatheServices Print TheUser

  1. User Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With WIPPfinalUnexpectedofWykoW03: DatatheServices Print TheUserUser

  2. Service Buildings

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYearby the(Dollars1.840YearDecade Year-0Feet)Service

  3. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  4. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  5. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  6. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  7. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  8. Environmental standards provide competitive advantage

    SciTech Connect (OSTI)

    Chynoweth, E.; Kirshner, E.

    1993-04-28

    Quality organizations are breaking new ground with the development of international standards for environmental management. These promise to provide the platform for chemical companies wanting to establish their environmental credibility with a global audience. [open quotes]It will be similar to auditing our customers to ISO 9000[close quote], says the environmental manager for a European chemical firm. [open quote]We will only want to deal with people who have got their environmental act together. And we'll be in a better competitive positions[close quote]. The International Organization for Standardization (ISO;Geneva) has set up a taskforce to develop an environmental management standard, which is expected to be completed by the mid-1990s. Observers think the ISO standard will draw heavily on the British Standard Institute's (BSI;London) environmental management standard, BS7750, which will likely be the first system adopted in the world. Published last year, BS7750 has been extensively piloted in the UK (CW, Sept. 30, 1992, p. 62) and is now set to be revised before being offically adopted by BSI. The UK's Chemical Industries Association (CIA;London) is anxious to prevent a proliferation of standards, and its report on BS7750 pilot projects calls for an approach integrating quality, environment, and health and safety. But standard setters, including ISO, appear to be moving in the opposite direction. In the US, the American national Standards Institute (ANSI;Washington) has started work on an environmental management standard.

  9. SEMF -Service Evolution Management Framework Martin Treiber, Hong-Linh Truong, Schahram Dustdar

    E-Print Network [OSTI]

    Dustdar, Schahram

    ,truong,dustdar}@infosys.tuwien.ac.at Abstract With the growing popularity of Web services, an increas- ing number of Web services have been integrated into and used by complex service oriented systems. As a result, the management of Web services has gained more importance as Web services management systems can provide useful service information

  10. Requirements for Web Service Composition Babak Esfandiari, Vladimir Tosic

    E-Print Network [OSTI]

    Requirements for Web Service Composition Management Babak Esfandiari, Vladimir Tosic { babak Language) Web services [Cer02] can be used for providing services to end users, the true power of Web Service technologies is leveraged through compositions (orchestrations and choreographies [Pel03]) of Web

  11. INFORMATION TECHNOLOGY SERVICES CRM Self Service Training

    E-Print Network [OSTI]

    INFORMATION TECHNOLOGY SERVICES CRM Self Service Training Editing a Case Service Management showing the case details Florida State University | Information Technology Services | its.fsu.edu | 2 #12 the Notes and Attachments tab. A new window will open Florida State University | Information Technology

  12. WEB servicesWEB services Samuel Tardieu

    E-Print Network [OSTI]

    Tardieu, Samuel

    WEB servicesWEB services Samuel Tardieu École Nationale Supérieure des Télécommunications sam@enst.fr #12;ConceptsConcepts Web services are a new breed of Web application. They are self-contained, self-describing, modular applications that can be published, located, and invoked across the Web. Web services perform

  13. Transmission Services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    methods will be used by BPA to provide information to the various wind plants: 1. SCADA ICCP. 2. GenICCP. 3. SCADA RTUs (GE D20), either as original installation or an...

  14. Remote information service access system based on a client-server-service model

    DOE Patents [OSTI]

    Konrad, A.M.

    1996-08-06

    A local host computing system, a remote host computing system as connected by a network, and service functionalities: a human interface service functionality, a starter service functionality, and a desired utility service functionality, and a Client-Server-Service (CSS) model is imposed on each service functionality. In one embodiment, this results in nine logical components and three physical components (a local host, a remote host, and an intervening network), where two of the logical components are integrated into one Remote Object Client component, and that Remote Object Client component and the other seven logical components are deployed among the local host and remote host in a manner which eases compatibility and upgrade problems, and provides an illusion to a user that a desired utility service supported on a remote host resides locally on the user`s local host, thereby providing ease of use and minimal software maintenance for users of that remote service. 16 figs.

  15. Remote information service access system based on a client-server-service model

    DOE Patents [OSTI]

    Konrad, A.M.

    1997-12-09

    A local host computing system, a remote host computing system as connected by a network, and service functionalities: a human interface service functionality, a starter service functionality, and a desired utility service functionality, and a Client-Server-Service (CSS) model is imposed on each service functionality. In one embodiment, this results in nine logical components and three physical components (a local host, a remote host, and an intervening network), where two of the logical components are integrated into one Remote Object Client component, and that Remote Object Client component and the other seven logical components are deployed among the local host and remote host in a manner which eases compatibility and upgrade problems, and provides an illusion to a user that a desired utility service supported on a remote host resides locally on the user`s local host, thereby providing ease of use and minimal software maintenance for users of that remote service. 16 figs.

  16. Remote information service access system based on a client-server-service model

    DOE Patents [OSTI]

    Konrad, Allan M. (P.O. Box 4023, Berkeley, CA 94704)

    1999-01-01

    A local host computing system, a remote host computing system as connected by a network, and service functionalities: a human interface service functionality, a starter service functionality, and a desired utility service functionality, and a Client-Server-Service (CSS) model is imposed on each service functionality. In one embodiment, this results in nine logical components and three physical components (a local host, a remote host, and an intervening network), where two of the logical components are integrated into one Remote Object Client component, and that Remote Object Client component and the other seven logical components are deployed among the local host and remote host in a manner which eases compatibility and upgrade problems, and provides an illusion to a user that a desired utility service supported on a remote host resides locally on the user's local host, thereby providing ease of use and minimal software maintenance for users of that remote service.

  17. Remote information service access system based on a client-server-service model

    DOE Patents [OSTI]

    Konrad, Allan M. (P.O. Box 4023, Berkeley, CA 94704)

    1997-01-01

    A local host computing system, a remote host computing system as connected by a network, and service functionalities: a human interface service functionality, a starter service functionality, and a desired utility service functionality, and a Client-Server-Service (CSS) model is imposed on each service functionality. In one embodiment, this results in nine logical components and three physical components (a local host, a remote host, and an intervening network), where two of the logical components are integrated into one Remote Object Client component, and that Remote Object Client component and the other seven logical components are deployed among the local host and remote host in a manner which eases compatibility and upgrade problems, and provides an illusion to a user that a desired utility service supported on a remote host resides locally on the user's local host, thereby providing ease of use and minimal software maintenance for users of that remote service.

  18. Remote information service access system based on a client-server-service model

    DOE Patents [OSTI]

    Konrad, Allan M. (P.O. Box 4023, Berkeley, CA 94704)

    1996-01-01

    A local host computing system, a remote host computing system as connected by a network, and service functionalities: a human interface service functionality, a starter service functionality, and a desired utility service functionality, and a Client-Server-Service (CSS) model is imposed on each service functionality. In one embodiment, this results in nine logical components and three physical components (a local host, a remote host, and an intervening network), where two of the logical components are integrated into one Remote Object Client component, and that Remote Object Client component and the other seven logical components are deployed among the local host and remote host in a manner which eases compatibility and upgrade problems, and provides an illusion to a user that a desired utility service supported on a remote host resides locally on the user's local host, thereby providing ease of use and minimal software maintenance for users of that remote service.

  19. A SERVICE TO THE VICTORIAN COMMUNITY What is Flood Watch?

    E-Print Network [OSTI]

    Greenslade, Diana

    A SERVICE TO THE VICTORIAN COMMUNITY What is Flood Watch? Flood Watch is a service provided by the Bureau of Meteorology to notify the Victorian community of the potential flood threat from a developing weather situation. It is an enhancement and replacement to the Flood Advice service previously provided

  20. Network Characterization Service (NCS)

    SciTech Connect (OSTI)

    Jin, Guojun; Yang, George; Crowley, Brian; Agarwal, Deborah

    2001-06-06

    Distributed applications require information to effectively utilize the network. Some of the information they require is the current and maximum bandwidth, current and minimum latency, bottlenecks, burst frequency, and congestion extent. This type of information allows applications to determine parameters like optimal TCP buffer size. In this paper, we present a cooperative information-gathering tool called the network characterization service (NCS). NCS runs in user space and is used to acquire network information. Its protocol is designed for scalable and distributed deployment, similar to DNS. Its algorithms provide efficient, speedy and accurate detection of bottlenecks, especially dynamic bottlenecks. On current and future networks, dynamic bottlenecks do and will affect network performance dramatically.

  1. rizona's grassland ecosystems are an integral part of the regional ecology, and they provide important social and economic values

    E-Print Network [OSTI]

    losses from conservation may work against it. Ecosystem services valuation can provide information about page 3 for information. #12;Grassland Ecosystem Services Arizona's grassland ecosystems provide manyA rizona's grassland ecosystems are an integral part of the regional ecology, and they provide

  2. Providing protection: Agencies receive funding to repair, upgrade dams 

    E-Print Network [OSTI]

    Wythe, Kathy

    2009-01-01

    by Kathy Wythe tx H2O | pg. 26 Providing protection Agencies receive funding to repair, upgrade dams along with local partners, can apply for grant funds, he said. Construction of the dams began through four federal authorizations passed between... 1944 and 1981. Land rights were acquired from landowners, and local agencies constructed the dams with federal money from NRCS (formerly the Soil Conservation Service). Local sponsors?including cities, counties, local soil and water conservation...

  3. IP Fast Rerouting for Single-Link/Node Failure Kang Xi and H. Jonathan Chao

    E-Print Network [OSTI]

    Chao, Jonathan

    ranging from online shop- ping to worldwide business- and science-related activities. For such a critical is critical to high quality service provisioning. The main challenge is how to achieve fast recovery without is to calculated backup paths in advance. When a failure is detected, the affected packets are immediately

  4. Patent Pending Introducing SCSI-To-IP Cache for Storage Area

    E-Print Network [OSTI]

    Yang, Qing "Ken"

    an essential role in today's fast-growing data-intensive network services. New standards and products emerge, data unit sizes, and design considerations that prevent fast and efficient deployment of SAN (Storage results using popular PostMark benchmark program and EMC's trace have shown dramatic performance gain over

  5. Proportional Differentiated Services: Delay Differentiation and Packet Scheduling

    E-Print Network [OSTI]

    Dovrolis, Constantinos

    Proportional Differentiated Services: Delay Differentiation and Packet Scheduling Constantinos propose the proportional differ­ entiation model as a way to refine and quantify this basic premise of relative differentiated services. The proportional differentiation model aims to provide the network

  6. Thinking outside the TBox multiparty service matchmaking as information retrieval 

    E-Print Network [OSTI]

    Lambert, David James

    2010-01-01

    Service oriented computing is crucial to a large and growing number of computational undertakings. Central to its approach are the open and network-accessible services provided by many different organisations, and which ...

  7. Funding for this research has been provided by the Natural Science and Engineering Research Council and the O'Brien Foundation. The prototyping system was provided by CMC/SOCRN. We demonstrated that while using a programmable controller as an

    E-Print Network [OSTI]

    Chow, Paul

    , Arun Patel, Samir Parikh, Manuel Saldana, and Paul Chow Designing an FPGA SoC using a Standardized IP

  8. Management of Support Services Activities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1991-05-17

    To provide the policy, procedures, and responsibilities for the management of support services contracts with the Department of Energy (DOE). Cancels DOE O 4200.3B dated 10-3-85. Chg 1 dated 3-26-92. Canceled by DOE O 4200.3D dated 8-31-92.

  9. Western University Rehabilitation Services

    E-Print Network [OSTI]

    Lennard, William N.

    1 Western University Rehabilitation Services Transitional Accommodation Program Western by Rehabilitation Services and is updated at frequent intervals in order to: 1. confirm progression toward treatment information is held in the strictest confidence within Rehabilitation Services. Only capabilities

  10. Personal Services Agreements Waivers

    E-Print Network [OSTI]

    capital construction and controlled maintenance contracts. Type of Service 1. Construction Consultants limitations. 3. Building and Ground Services: Include floor finishing, roofing maintenance, welding operations. CSM does not have staff qualified to perform these specialized services, or does not have

  11. IBM Global Technology Services Server Services

    E-Print Network [OSTI]

    ServerTM, Power SystemsTM, pSeries®, #12;2 PowerVMTM, PowerHATM, System StorageTM disk systems, System p®, System x® and other IBM selected products with the option to purchase as a ServicePac® including: IBM Implementation Services for Power Systems-- AIX V6.1 remote implementation IBM Implementation Services for Power

  12. GENERAL SERVICES ADMINISTRATION PUBLIC BUILDINGS SERVICE

    E-Print Network [OSTI]

    (Wax, cleansers, cloths, etc.) 7. CONTRACT SERVICES (Window washing, waste and snow removal) B. HEATING a share of building support/common areas such as elevator lobbies, building corridors, and floor service areas. Floor service areas typically include restrooms, janitor rooms, telephone closets, electrical

  13. Beyond Hierarchy: Towards a Service Model supporting new Sourcing Strategies for IT

    E-Print Network [OSTI]

    -providers to realize these services. In their current releases, both the IT Infrastructure Library (ITIL modeling of services: According to ITIL, service models are blueprints for ser- vice management processes

  14. B. Our Education Mission 7. Undergraduate Student Experience: Service Learning Opportunities

    E-Print Network [OSTI]

    Zandstra, Peter W.

    B. Our Education Mission 7. Undergraduate Student Experience: Service Learning Opportunities University of Toronto Performance Indicators 2014 Service Learning Opportunities Performance Relevance: Service-learning provides students with practical, "experiential" learning opportunities with community

  15. B. Our Education Mission 7. Undergraduate Student Experience: Service Learning Opportunities

    E-Print Network [OSTI]

    Zandstra, Peter W.

    B. Our Education Mission 7. Undergraduate Student Experience: Service Learning Opportunities Figures a-b University of Toronto Performance Indicators 2012 Service Learning Opportunities Performance Relevance: Service-learning provides students with practical, "experiential" learning opportunities

  16. B. Our Education Mission 7. Undergraduate Student Experience: Service Learning Opportunities

    E-Print Network [OSTI]

    Zandstra, Peter W.

    B. Our Education Mission 7. Undergraduate Student Experience: Service Learning Opportunities University of Toronto Performance Indicators 2013 Service Learning Opportunities Performance Relevance: Service-learning provides students with practical, "experiential" learning opportunities with community

  17. August 2010 |Vol.7 No.4 Providing Insight, Understanding and Community

    E-Print Network [OSTI]

    Kim, Duck O.

    management who have been key in our efforts to engage staff. JHC: What is the most important quality you look for imaging services, cardiac services and supply chain operations Lifespan, Providence, R.I. Five hospitals management University of Connecticut Health Center, John Dempsey Hospital, Farmington, Conn. Thomas M

  18. UF IFAS EXTENSION ALACHUA COUNTY PROVIDING SOLUTIONS

    E-Print Network [OSTI]

    Hill, Jeffrey E.

    Services, Alachua County Board of County Commissioners and strives to impact the well-being of the citizens. Injecting soil-marking dyes into irrigation systems and digging the soil to show the water movement within

  19. Web Service Engineering with DIWE Engin Kirda

    E-Print Network [OSTI]

    Kruegel, Christopher

    Web Service Engineering with DIWE Engin Kirda£ , Clemens Kerer£ , Christopher Kruegel� and Roman 93106, USA chris@cs.ucsb.edu Abstract A Web service is frequently defined as browser-less ac- cess to content on a Web site. The industry's focus to date has been on providing easy-to-use low-level libraries

  20. Business Services | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    products and services that support the lab's overall mission. Managing the lab's vendor process is the Procurement & Services department. The department is dedicated to the...

  1. ORISE: Health physics services

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Health physics services Nuclear power plant The Oak Ridge Institute for Science and Education (ORISE) offers comprehensive health physics services in a number of technical areas...

  2. Waste generator services implementation plan

    SciTech Connect (OSTI)

    Mousseau, J.; Magleby, M.; Litus, M.

    1998-04-01

    Recurring waste management noncompliance problems have spurred a fundamental site-wide process revision to characterize and disposition wastes at the Idaho National Engineering and Environmental Laboratory. The reengineered method, termed Waste Generator Services, will streamline the waste acceptance process and provide waste generators comprehensive waste management services through a single, accountable organization to manage and disposition wastes in a timely, cost-effective, and compliant manner. This report outlines the strategy for implementing Waste Generator Services across the INEEL. It documents the culmination of efforts worked by the LMITCO Environmental Management Compliance Reengineering project team since October 1997. These efforts have included defining problems associated with the INEEL waste management process; identifying commercial best management practices; completing a review of DOE Complex-wide waste management training requirements; and involving others through an Integrated Process Team approach to provide recommendations on process flow, funding/charging mechanisms, and WGS organization. The report defines the work that will be performed by Waste Generator Services, the organization and resources, the waste acceptance process flow, the funding approach, methods for measuring performance, and the implementation schedule and approach. Field deployment will occur first at the Idaho Chemical Processing Plant in June 1998. Beginning in Fiscal Year 1999, Waste Generator Services will be deployed at the other major INEEL facilities in a phased approach, with implementation completed by March 1999.

  3. Wilders Grove Solid Waste Services Center

    Broader source: Energy.gov [DOE]

    Project objective: Provide demonstration of Geothermal Heat Pumps viability on energy usage for future Service Centers planned by the City of Raleigh and other similar facilities in the southeast.

  4. Complexity of service value networks: Conceptualization

    E-Print Network [OSTI]

    of the services ecosystem. The paper then discusses what transformative role information and communication for consumers by providing greater levels of value network integration, information visibility, and means, consulting, logistics, information technology (IT), telecommunications, software, and health care. 1

  5. Pricing of Departmental Materials and Services

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-12-18

    The order establishes DOE requirements for prices and charges for materials and services sold or provided to external organizations, other Federal agencies, or the private sector either directly or through a Departmental site/facility management contract.

  6. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  7. Coiled tubing; Operations and services

    SciTech Connect (OSTI)

    Sas-Jaworsky, A. II )

    1992-03-01

    Operations involving sand or solids washing are the most common of today's coiled tubing workover services. Wellbore cleanouts require pumping fluid that will entrain solids and return them to the surface. In most cases, wash fluids and solids are captured in surface tanks of sufficient volume to allow solids to settle out. Where practical, fluids are recirculated to reduce cost. An important concern when designing sand wash programs is correct fluid system selection. Wash fluids should closely balance BHP and provide piston like displacement for solids removal. This paper is an overview of compressible and incompressible fluids commonly used for coiled tubing services.

  8. An Approach for Mining Web Service Composition Patterns from Execution Logs

    E-Print Network [OSTI]

    Zou, Ying

    1 An Approach for Mining Web Service Composition Patterns from Execution Logs Ran Tang and Ying Zou.zou}@queensu.ca Abstract-- A service-oriented application is composed of multiple web services to fulfill complex functionality that cannot be provided by individual web service. The combination of services is not random

  9. New Advanced Refrigeration Technology Provides Clean Energy,...

    Office of Environmental Management (EM)

    Refrigeration Technology Provides Clean Energy, Low Utility Bills for Supermarkets New Advanced Refrigeration Technology Provides Clean Energy, Low Utility Bills for...

  10. 24th Annual BIA Tribal Providers Conference

    Broader source: Energy.gov [DOE]

    The BIA Tribal Providers Conference is the second largest conference in Alaska, providing opportunities for tribal leaders, native corporations and rural representatives to connect with federal...

  11. Redefining the Cloud based on Beneficial Service Characteristics A New Cloud Taxonomy Leads to Economically Reasonable Semi-cloudification

    E-Print Network [OSTI]

    Redefining the Cloud based on Beneficial Service Characteristics A New Cloud Taxonomy Leads, Germany kemmler@lrz.de Keywords: Cloud, Semi-cloud, Service, Cloud Service, Semi-cloud Service, Service Management. Abstract: Cloud services promise benefits for customers and providers such as scalability

  12. Web Services Distributed

    E-Print Network [OSTI]

    Cook, William R.

    1 Web Services versus Distributed Objects William R. Cook, Janel Barfield University of Texas at Austin 2 How many times have you heard... 3 "Web Services suck..." ? 4 "WS are a bad version Objects 10 to 100 times faster than Web Services 7 Test Case Call a remote service that returns an integer

  13. STUDENT HEALTH MEDICAL SERVICES

    E-Print Network [OSTI]

    Huang, Haiying

    Ver 2.0 09/2012 ANNEX H STUDENT HEALTH & MEDICAL SERVICES #12;Ver 2.0 09/2012 H-i APPROVAL & IMPLEMENTATION Annex H Student Health & Medical Services This emergency management plan is hereby approved. ______________________________ ________________________ Robert Blum Date Director of Health Services Marie Bannister Date Director of Mental Health Services

  14. University of Leicester -Estates (Operations) -Service Level Statement Estates and Facilities Management Division

    E-Print Network [OSTI]

    Banaji,. Murad

    and Facilities Management Division (Operations) Service Level Statement Postal Services a) Aim To provideUniversity of Leicester - Estates (Operations) - Service Level Statement Feb 2015 Estates and partner organisations by ensuring that the EFMD staff provide a customer focussed, quality service

  15. The Web Services Vision Definition of Web Services

    E-Print Network [OSTI]

    Cheverst, Keith

    1 The Web Services Vision Overview Definition of Web Services Key concepts Difference from traditional web model Context Service-oriented architecture Distributed computing Overview Microsoft .NET vision Web Services Difference from traditional web model Context Service-oriented architecture

  16. Microsoft Word - Enable New Products Services and Markets_Final...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    options Enable new products, services, and markets Provide power quality for the digital economy Optimize asset utilization and operate efficiently Anticipate &...

  17. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServices ServicesServices

  18. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServicesServices Services

  19. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServicesServicesServices

  20. Making a good match: How schools and external service providers negotiate needs and services in support of school improvement

    E-Print Network [OSTI]

    Vixie Sandy, Mary

    2013-01-01

    and learning that is focused on student performance. Thelearning and leadership systems, and participate in systematic, reflective dialogue focused on implementation progress and studentlearning climate. Specific expectations for student learning are combined with focused

  1. HealtH ServiceS We provide CoNFideNTiAL mediCAL CAre ANd

    E-Print Network [OSTI]

    of common health concerns. - Respiratory infections (e.g., cough, asthma attacks) - Injuries (e.g., sprains

  2. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  3. Curtin University is a trademark of Curtin University of Technology CRICOS Provider Code 00301J

    E-Print Network [OSTI]

    Mucina, Ladislav

    Workshop scenarios 23 Oct 2014IP & Commercialisation at Curtin #12;Curtin University is a trademark Across a range of fields: software, design, engineering, health sciences, basic sciences 23 Oct 2014IP to an existing company Spinout: form a new company which will develop the technology and enter the market. 23

  4. Ris Energy Report 4 Summary, conclusions and recommendations The world is facing major challenges in providing energy

    E-Print Network [OSTI]

    Risø Energy Report 4 Summary, conclusions and recommendations 2 Summary The world is facing major challenges in providing energy services to meet the future needs of the developed world and the growing needs of developing countries. These challenges are exacerbated by the need to provide energy services with due

  5. Design and implementation of an integrated network management system for TCP/IP-based distributed networks 

    E-Print Network [OSTI]

    Patel, Samir K.

    1993-01-01

    in designing of tools for network management. Various workstation vendors have developed such tools for their window systems, but many of the tools are not compatible for other systems. The X Window System, however, provides hardware independent and network...

  6. A Snapshot of Public Web Services Jianchun Fan & Subbarao Kambhampati

    E-Print Network [OSTI]

    Kambhampati, Subbarao

    A Snapshot of Public Web Services Jianchun Fan & Subbarao Kambhampati Department of Computer}@asu.edu Abstract Web Service Technology has been developing rapidly as it provides a flexible application-to-application interaction mechanism. Several ongoing research efforts focus on various aspects of web service technology

  7. Food web complexity and higher-level ecosystem services

    E-Print Network [OSTI]

    Rodríguez, Miguel Ángel

    LETTER Food web complexity and higher-level ecosystem services Jose´ M. Montoya1,2 *, Miguel A of herbivores in 19 plant-herbivore-parasitoid food webs influence the service supplied by natural enemies producers have shown that species richness provides and promotes fundamental ecosystem services. However, we

  8. CMC Markets Stockbroking Limited Financial Services Guide (FSG)

    E-Print Network [OSTI]

    Peters, Richard

    and responsibility of CMC Markets Stockbroking when it provides retail clients with the financial services describedCMC Markets Stockbroking Limited Financial Services Guide (FSG) 1 October 2013 AFSL No. 246381 and ABN 69 081 002 851 #12;Table of Contents CMC Markets Stockbroking Limited | Financial Services Guide 2

  9. Web Service Access Management for Integration with Agent Systems

    E-Print Network [OSTI]

    Web Service Access Management for Integration with Agent Systems B.J. Overeinder, P.D. Verkaik, from the perspective of agent systems (and not as is gen- erally the case by web service providers). Mediating between web service requests from (virtual) organizations of agents, the web ser- vice gateway

  10. Service Oriented Middleware for the Internet of Things: A Perspective

    E-Print Network [OSTI]

    Teixeira, Thiago

    Service Oriented Middleware for the Internet of Things: A Perspective (Invited Paper) Thiago. The Internet of Things plays a central role in the foreseen shift of the Internet to the Future Internet that the Internet of Things will cooperate with the Internet of Services to provide users with services

  11. Analysis of Assembly 264 - Amended: Pediatric Asthma Self-Management Training and Education Services for Children at High Risk

    E-Print Network [OSTI]

    California Health Benefits Review Program (CHBRP)

    2006-01-01

    cover services. Seven trials assessed group classes providedcover services. Seven trials assessed group classes providedclasses provided to groups of five to seven children and

  12. EMPLOYEE BENEFIT SERVICE Signature Service Oil Change

    E-Print Network [OSTI]

    New Mexico, University of

    UNM Staff EMPLOYEE BENEFIT SERVICE Jiffy Lube Signature Service Oil Change Fast - No Appointment We change your oil with up to 5 quarts of major brand motor oil We install a new oil fi We visually inspect. ASE training programs · Jiffy Lube uses top quality products that meet or exceed vehicle warranty

  13. Finance & Administrative Services Office of Accounting Services

    E-Print Network [OSTI]

    Harms, Kyle E.

    Finance & Administrative Services Office of Accounting Services Payroll 204 Thomas Boyd Hall when there is any change to their bank and/or bank account(s) that affects their direct deposit to disbursing funds from their account. Employees with a qualifying hardship, or students whose salary is funded

  14. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  15. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  16. Residence Coordinator Agreement Concerning University Provided Housing

    E-Print Network [OSTI]

    Howitt, Ivan

    Residence Coordinator Agreement Concerning University Provided Housing I understand-campus apartments and provides such housing. My acceptance of employment also constitutes my agreement to the following terms related to housing provided to me by the University: 1. I agree to make no substantial

  17. Technology and Innovation in the Service Economyin the Service Economy

    E-Print Network [OSTI]

    Gabrieli, John

    ;Some emerging "smart" applications 1818 Smart traffic systems Smart water management Smart energy grids supply chains Smart cities Smart retail #12;Smart Cities as a System of Systems EDUCATION · TRANSPORTA, VoIP, Medical imaging, Laptops, smart meters, multi-player games, Satellite images, GPS, ATMs

  18. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  19. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  20. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  1. Web services @ MIT

    E-Print Network [OSTI]

    Tyagi, Sapna DevendraSingh, 1978-

    2004-01-01

    There are several useful web services developed at MIT by students, faculty and researchers. However, they are scattered all over MIT. Most people at MIT are unaware of the availability of these web services and hence they ...

  2. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    Requirements Energy Spot trading Size/ Requirements (MW)trading as VicPower Trading Energy Response Pty Ltd Thetrading: Spot trading of energy through a commodities-type

  3. The Field: The University of Rhode Island provides a broad range of courses and services

    E-Print Network [OSTI]

    Rhode Island, University of

    School Admission Test preparation. The University, in conjunction with state agencies and local lawyers, and analytical skills. Students are encouraged to seek out courses which place heavy emphasis on reading in the sciences, language, business, political science, history, engineering, pharmacy, English, art, economics

  4. Market and Policy Barriers for Demand Response Providing Ancillary Services in U.S. Markets

    E-Print Network [OSTI]

    Cappers, Peter

    2014-01-01

    4 Figure 2: Map of ISO/RTO balancing areas in theFERC (2012) Figure 2: Map of ISO/RTO balancing areas in the

  5. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    the IEA DDR TASK XIII Workshop, Melbourne. Energy Responseat the IEA DDR TASK XIII Workshop, Melbourne. Energy Users

  6. Role of the private sector in providing sanitation services to the poor in India

    E-Print Network [OSTI]

    Rana, Suneira

    2015-01-01

    "Sanitation is more important than independence." - Mahatma Gandhi. Lack of sanitation causes nearly three million deaths around the world annually. This issue compounded by the negative economic impact of poor sanitation, ...

  7. Abstract--Pervasive services provided to the enterprise require from increased speed, performance, degree of

    E-Print Network [OSTI]

    Atkinson, Robert C

    management functionality which grant access to strategic information assets, i.e. realizing the Mobile broadband communications at a lower cost, either in terms of battery power consumption or price. The common needs include: - Need to Accelerate Transmission at users indication. - Need to Autonomously

  8. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    John Wiley and Sons, New York. IEA DSM 2003. DSM Spotlight,2003. Prepared for the IEA Demand-Side Management Executivepresented by Lance Hoch at the IEA Task XIII Demand Response

  9. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    out requirements for telemetry (SCADA), metering (50 msecthan the stringent SCADA requirement. 40 Participating

  10. A comparison of two GIV mechanisms for providing ancillary services at the University of Delaware

    E-Print Network [OSTI]

    Firestone, Jeremy

    of charging are required. Even if EVs are not near a plug all 23 hours, this simple calculation shows that EVs will offer a lot of flexibility in timing and rate of their charging power. Typically, EV aggregators are seen as the actors using this charging flexibility [1]. For an EV aggregator, a wide range

  11. An application service provider infrastructure for shared workspaces in Internet-based collaborative design

    E-Print Network [OSTI]

    Solari, Jaime, 1973-

    2000-01-01

    For architectural, engineering and construction projects involving transient 'virtual organizations' composed of non-collocated team-members, the adoption of concurrent design principles is seen as vital. An important ...

  12. Providing quality of service over high speed electronic and optical switches

    E-Print Network [OSTI]

    Koksal, Can Emre, 1975-

    2003-01-01

    In a network, multiple links are interconnected by means of switches. A switch is a device with multiple input and output links, and its job is to move data from the input links to the output links. In this thesis, we focus ...

  13. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    available to reflect trading in the Power Exchanges. C.2.3most power transactions are based on bilateral trading ofPower Exchanges operate over similar timescales, although trading

  14. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    Market. Prepared by Power Exchange Operations. LoadsPrepared by: NEMMCO Power Exchange, 29May. (http://Power Exchanges)..

  15. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    of a Mature Isolated Market Design, presented by Charlie2 A.2 NEM Market Design and49 C.2 Market Design and

  16. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    electric boilers of district heating systems) must shedcapabilities 42 of the district heating systems not allgreater than 5 MW) district heating schemes can quickly

  17. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    Denmark. Elkraft 2005a. Demand Response in Practice, Elkraftand Developing Demand Response in the Energy Markets.Demand Management Delivery. Demand Response Workshop. Slide

  18. Using Provider Performance Incentives to Increase HIV Testing and Counseling Services in Rwanda.

    E-Print Network [OSTI]

    2013-01-01

    Statistique du Rwanda (INSR), ORC Macro. Rwanda Demographicand Health Survey. INSR and ORC Macro: Calverton, Maryland,du Rwanda (INSR) and ORC Macro, 2006). The Government of

  19. Cancer survivors and survivorship care: Provider expectations, post-treatment health services, and patient reported outcomes

    E-Print Network [OSTI]

    Hahn, Erin Elizabeth

    2013-01-01

    2011) Long Term Effects and Cancer Survivorship in the OlderGanz (Eds. ), Management of Cancer for the Older Patient (the Quality of Care for Cancer Survivors. Psycho-Oncology (

  20. Trust-Oriented Service Provider Selection in Complex Online Social Networks

    E-Print Network [OSTI]

    Wang, Yan

    with constraints, which is actually an NP-Complete problem. Experimental results illustrate that the proposed Networks (OSNs) (e.g. Facebook1 and MySpace2) have become in- creasingly popular recently and are being announced their strategic plan to deepen the relationship with Facebook1 for creating a new crop of e

  1. ORNL/TM-2005/263 ANCILLARY SERVICES PROVIDED FROM DER

    E-Print Network [OSTI]

    Tolbert, Leon M.

    ://www.ntis.gov/support/ordernowabout.htm Reports are available to DOE employees, DOE contractors, Energy Technology Data Exchange (ETDE

  2. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    and restore frequency-controlled operating and disturbancethe frequency responsive operating and disturbance reserves,120 MW of frequency-controlled disturbance reserve and 400

  3. Microsoft Word - RL14788-Section_J-03 Service Providers Mod 337...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Some of the programs conducted at PNNL are part of the DOE Office of Science laboratory system and require no integration with the Hanford DOE Office of Environmental Management...

  4. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    docs/Electricity_Transmission/Transmission_Planning/CRA%British Electricity Trading and Transmission Arrangements).Coordination of Transmission of Electricity) and Russia (see

  5. Cancer survivors and survivorship care: Provider expectations, post-treatment health services, and patient reported outcomes

    E-Print Network [OSTI]

    Hahn, Erin Elizabeth

    2013-01-01

    treatment and the impact of cancer-related infertility,treatment such as chronic fatigue, cardiomyopathy, second malignancies, chronic pain, menopausal symptoms, lymphedema, cognitive deficits, sexual dysfunction, and infertility.

  6. Texas - PUC Substantive Rule 25.174 - Electric Service Providers-Renewable

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Opensource HistoryTerraWattTesting user formTetraEnergy

  7. Texas - PUC Substantive Rule 25.198 - Electric Service Providers-Open

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Opensource HistoryTerraWattTesting user formTetraEnergyAccess

  8. Texas - PUC Substantive Rule 25.5 - Electric Service Providers-General

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Opensource HistoryTerraWattTesting user

  9. Texas - PUC Substantive Rule 25.83 - Electric Service Providers-Records,

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Opensource HistoryTerraWattTesting userReports, and other

  10. State Roles in Providing Affordable Mass Transport Services for Low-Income

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren) Jumpand Maintenance Geothermal Project |Residents | Open

  11. Microsoft Word - RL14788-Section_J-03 Service Providers Mod 337.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGE OFDetection of Hydrates onRHUBC Operations PlanD7

  12. LED Provides Effective and Efficient Parking Area Lighting at the NAVFAC Engineering Service Center

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPA PublicLED ADOPTION REPORT LED ADOPTION REPORTLED PerformanceLED

  13. Daren A. Reed and Kenneth J. Turner. Components for Quality of Service in Distributed Environments: Monitoring Service (extended version). In Andrew

    E-Print Network [OSTI]

    Turner, Ken

    . Support Components for Quality of Service in Distributed Environments: Monitoring Service D.A. Reed (dar of Service oriented distributed environment. One of these required services is monitoring. To provide, monitoring, distributed environments 1. Introduction There are many `middleware' distributed systems

  14. BMT provides in-house specialists in green building project management

    E-Print Network [OSTI]

    the LCA tools. Energy Simulation BMT can analyse the energy efficiency of buildings and provide advice on building envelop and services systems for more energy efficient development. Energy Use: Typical BuildingBMT provides in-house specialists in green building project management and co

  15. Prediction of Air Conditioning Load Response for Providing Spinning Reserve - ORNL Report

    SciTech Connect (OSTI)

    Kueck, John D; Kirby, Brendan J; Ally, Moonis Raza; Rice, C Keith

    2009-02-01

    This report assesses the use of air conditioning load for providing spinning reserve and discusses the barriers and opportunities. Air conditioning load is well suited for this service because it often increases during heavy load periods and can be curtailed for short periods with little impact to the customer. The report also provides an appendix describing the ambient temperature effect on air conditioning load.

  16. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services Services IntegratedServicesServices

  17. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServices Services The

  18. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServices Services

  19. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServicesServices

  20. FOOD SERVICE Professional Organizations

    E-Print Network [OSTI]

    Acton, Scott

    FOOD SERVICE Professional Organizations: National Association of College and University Food National Association of College and University Food Services (NACUFS) conference NACUFS Mid-Atlantic Region of Colleges and University Food Services e-newsletter Social Media: National Association of College

  1. Ancillary services market in California

    E-Print Network [OSTI]

    Gomez, Tomas; Marnay, Chris; Siddiqui, Afzal; Liew, Lucy; Khavkin, Mark

    1999-01-01

    on the Operation of the Ancillary Services Markets of theOperator (CAISO). 1999. Ancillary Service Market RedesignMethodology for AGC Ancillary Services Markets. Paper

  2. Modelling Large Pathways: A Hybrid Agent-Based Discrete Event Simulation Tool for Emergency Medical Services Improvement

    E-Print Network [OSTI]

    Oakley, Jeremy

    -Based Ambulance Service model on Geographical Information System. 3. To develop a Discrete Event Simulation model services. The incorporation of geographical information systems (GIS) can provide precise data Services Improvement Anastasia Anagnostou and Simon Taylor School of Information Systems, Computing

  3. Crystal Structures of Phosphite Dehydrogenase Provide Insights...

    Office of Scientific and Technical Information (OSTI)

    Structures of Phosphite Dehydrogenase Provide Insights into Nicotinamide Cofactor Regeneration Citation Details In-Document Search Title: Crystal Structures of Phosphite...

  4. Hydrogen Fuel Cells Providing Critical Backup Power

    Broader source: Energy.gov [DOE]

    ReliOn, Inc., specializes in hydrogen fuel-cell backups for businesses have to stay functional during power outages -- companies like your wireless provider.

  5. Product Service Codes Description: Product Service Codes used...

    Broader source: Energy.gov (indexed) [DOE]

    V301 RELOCATION SERVICES 273 5,828,484 R423 INTELLIGENCE SERVICES 7 5,744,939 R706 LOGISTICS SUPPORT SERVICES 11 5,536,000 S201 CUSTODIAL JANITORIAL SERVICES 5 4,401,160 D304...

  6. Generation of Web Service Descriptions and Web Service

    E-Print Network [OSTI]

    Generation of Web Service Descriptions and Web Service Module Implementation for Concept University of Science and Technology Software Systems Institute (STS) #12;Abstract Nowadays web services in order to initiate the communication. A web services endpoint communication interface utilizes

  7. ENROLLMENT SERVICES Exceptional Service and Solutions

    E-Print Network [OSTI]

    Media Improved service and interaction with students and parents via Facebook and Twitter. #12 individual's actual cost of varying credit loads and housing plans · No user logon required · Available

  8. Marketing Plan for Transmission Planning Services

    E-Print Network [OSTI]

    Tu, Linh

    2006-12-15

    in the non-consulting side of the firm, the following are services provided on the consulting side, still known as Consultation Company: ? Cogeneration services ? Energy facilities planning ? Energy supply management ? Transmission ? Utility formation... Consultation Company?s competitive advantage in the electrical industry is their experience and expertise in the energy market. The company has been working with companies and individuals to help plan, develop and build power plants for over twenty years...

  9. STRATEGIC PLAN Providing Australians with environmental

    E-Print Network [OSTI]

    Greenslade, Diana

    STRATEGIC PLAN 2010-2015 Providing Australians with environmental intelligence for safety to improve. The foundation of this Strategic Plan is maintaining our commitment to meeting our current, accounts, data-sets and standards. This Strategic Plan provides a long-term direction and action agenda

  10. August 13, 2001 To Retail Providers

    E-Print Network [OSTI]

    ://www.energy.ca.gov/regulations/retail_disclosure.html#retaildisclosure>. Sample power content labels for the "no specific purchase case" (default) and the "50% specific purchase Disclosure Regulations (SB 1305, Power Source Disclosure Program) In March of this year, the Energy Providers for providing customers with a quarterly power content label and additionally, in some cases

  11. February 10, 2003 Dear Retail Provider

    E-Print Network [OSTI]

    that purchase electricity from a power pool that submits an Annual Report to the Energy Commission may provideFebruary 10, 2003 Dear Retail Provider: Subject: Power Source Disclosure and Customer Credit on the mailing lists for the Power Source Disclosure Program and the Customer Credit Program. As someone involved

  12. BSL-3 Lab Provides New Opportunities

    E-Print Network [OSTI]

    Rock, Chris

    BSL-3 Lab Provides New Opportunities :: Texas Tech Today http://today.ttu.edu/2014/01/bsl-3-lab-provides-new-opportunities-for-texas-tech to biological pathogens and toxins. Written by Sally Logue Post 10Like Texas Tech University has dedicated a new contacted Texas Tech. "Texas Tech was able to utilize existing laboratory equipment and resources in the new

  13. A Mediation Framework for Mobile Web Service Provisioning

    E-Print Network [OSTI]

    Srirama, Satish Narayana; Prinz, Wolfgang; 10.1109/EDOCW.2006.9

    2010-01-01

    Web Services and mobile data services are the newest trends in information systems engineering in wired and wireless domains, respectively. Web Services have a broad range of service distributions while mobile phones have large and expanding user base. To address the confluence of Web Services and pervasive mobile devices and communication environments, a basic mobile Web Service provider was developed for smart phones. The performance of this Mobile Host was also analyzed in detail. Further analysis of the Mobile Host to provide proper QoS and to check Mobile Host's feasibility in the P2P networks, identified the necessity of a mediation framework. The paper describes the research conducted with the Mobile Host, identifies the tasks of the mediation framework and then discusses the feasible realization details of such a mobile Web Services mediation framework.

  14. An Ontology for the Quality Attributes of web services Web Services are an implementation of Service Oriented Architecture. Web Services

    E-Print Network [OSTI]

    An Ontology for the Quality Attributes of web services Abstract Web Services are an implementation of Service Oriented Architecture. Web Services applications are built by integration of many loosely coupled heterogeneous Services. Unfortunately Web Services still face many problems that are limiting their growth

  15. HEALTH SCIENCE CENTER HANDBOOK OF OPERATING PROCEDURES Chapter 5 Information Management & Services Effective: June 2000

    E-Print Network [OSTI]

    Nicholson, Bruce J.

    & Web Services Responsibility: Vice President and Chief Information Officer MULTIMEDIA & WEB SERVICES Responsibilities Multimedia & Web Services provides products, services and expertise in the following areas of Graphics, Photography, Web Design and programming in support of the missions of the Health Science Center

  16. Stateless Core: A Scalable Approach for Quality of Service in the Internet

    E-Print Network [OSTI]

    ., MCI, and Sun Microsystems. Views and conclusions contained in this document are those of the authors, NSF, Intel, MCI, Sun, or the U.S. government. #12; Keywords: Quality of Service, Internet, scalabile to provide more powerful services such as guaranteed services, differentiated services, and flow protection

  17. Stateless Core: A Scalable Approach for Quality of Service in the Internet

    E-Print Network [OSTI]

    ., MCI, and Sun Microsystems. Views and conclusions contained in this document are those of the authors, NSF, Intel, MCI, Sun, or the U.S. government. #12;Keywords: Quality of Service, Internet, scalabile to provide more powerful services such as guaranteed services, differentiated services, and flow protection

  18. Services | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideo »Services ServicesServices

  19. 2004 Notes2Providers.doc -1-Notes to Retail Providers

    E-Print Network [OSTI]

    with the meter data reported to the system operator (Retail providers that purchase electricity from a power pool2004 Notes2Providers.doc -1- Notes to Retail Providers February 2005 Power Source Disclosure than the California Mix, (Net System Power)i . As a retail provider you are probably aware that all

  20. General Service LED Lamps

    Broader source: Energy.gov [DOE]

    A U.S. DOE SSL technology fact sheet that compares general service LED light bulbs with incandescent and CFL bulbs.

  1. Internal Revenue Service

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ABCDEFGHI ABCDEFGHI ABCDEFGHI ABCDEFGHI ABCDEFGHI ABCDEFGHI ABCDEFGHI ABCDE 200254 X PREPAID LEGAL X SCHEDULE A (Form 5500) Department of the Treasury Internal Revenue Service...

  2. UGIES Midstream Services

    Broader source: Energy.gov (indexed) [DOE]

    to local markets; Wilkes Barre and Scranton markets no longer dependent upon Natural gas from the Gulf of Mexico Locational volatility and spreads UGI Energy Services, LLC 8...

  3. Web Service Interface (API)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    OSCARS and Future Tech OSCARS Standard and Open Grid Forum OSCARS Developers Community Web Browser Interface (WBUI) Web Service Interface (API) Read More... Fasterdata IPv6...

  4. SBIR/STTR ALERTING SERVICE --July 30, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    participation of the small business community. NASA does not plan to award more than 5 SBIR contracts and 2 STTR 2010.B Solicitations Pre-release and Modifications -- PHS 2011.1 SBIR Contract Presolicitation Notice for an additional temporary extension of programs under the Small Business Act and the Small Business Investment Act

  5. SBIR/STTR ALERTING SERVICE --March 25, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    -- U.S. House Small Business Committee SBIR Hearing Summary Available -- SBIR Grant Winner Profile treatment technologies." #12;EPA anticipates awarding approximately $2.8M in firm fixed price contracts the EPA SBIR website at http://epa.gov/ncer/sbir/. -- U.S. House Small Business Committee SBIR Hearing

  6. SBIR/STTR ALERTING SERVICE --October 8, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    Opens The Department of Energy (DOE) Fiscal Year 2011 Phase I Funding Opportunity opened on September 28.fedconnect.net. Then click on "Search Public Opportunities", and under "Search Criteria", select "Reference Number," enter That May Impede the Emerging Commercial Space Industry Federal Highway Administration (4 Awards) 111.1-FH1

  7. SBIR/STTR ALERTING SERVICE --May 20, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    for the Rapid Transition of DHS Center of Excellence Enabling Research to Both the Public and Private Sector to make approximately 150 fixed amount awards for SBIR Phase I proposals in amounts up to $150,000. Award that the 2012 USDA-SBIR Phase I Solicitation is tentatively scheduled to be released June 2011, with a expected

  8. SBIR/STTR ALERTING SERVICE --June 3, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    with the guidelines specified in the NSF Grant Proposal Guide (GPG). The complete text of the GPG is available electronically on the NSF website at: http://www.nsf.gov/publications/pub_summ.jsp?ods_key=gpg'. -- DoD SBIR 2011

  9. SBIR/STTR ALERTING SERVICE --June 17, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    topics in this solicitation: 11.1-001: Development of commercial hand-held and backpack neutron detectors 11.1-002: Flexible Form Factor Radiation Monitor 11.1-003: Growth & Characterization of New that a new Proposal Submission system has been implemented. As a result, the process to submit proposals

  10. SBIR/STTR ALERTING SERVICE --November 5, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    and Units Development of an SCAP Content Creation Tool Non-contact microwave measurement of electrical of Inhaler Dose Concentration mm-Wave Phase Noise Measurement System Using Photonic Delay-Line High

  11. SBIR/STTR ALERTING SERVICE --October 14, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    -- NIH New Start-Up Evaluation License and Start-Up Commercial License Agreements Announced -- SBIR II: $700K Federal Railroad Administration 12.1-FR3 Advanced Locomotive Energy Storage System

  12. SBIR/STTR ALERTING SERVICE --February 19, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    AND INFORMATION -- NSF SBIR/STTR and ERC Collaboration Opportunity (SECO) Dr. Kesh Narayanan, Division Director) Directors From: Dr. Kesh Narayanan, Division Director Division of Industrial Innovation and Partnerships

  13. SBIR/STTR ALERTING SERVICE --June 11, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    problem. Sincerely, Kesh Narayanan Division Director Division of Industrial Innovation and Partnerships

  14. SBIR/STTR ALERTING SERVICE --May 14, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    . NEWS IN THIS ISSUE -- NIH and NSF i6 Challenge Announcement -- 12th Annual NIH SBIR/STTR Conference AND INFORMATION -- NIH and NSF i6 Challenge Announcement The National Institutes of Health (NIH) recently posted a notice on their SBIR/STTR News Flash Page (http://grants.nih

  15. SBIR/STTR ALERTING SERVICE --September 30, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    Announced -- NIH SBIR Program Announcement and Requests for Applications -- SBIR Proposal Writing Tip AND INFORMATION -- SBIR Reauthorization Update The NIH posted a notice on their SBIR/STTR News Flash Page (http://grants.nih

  16. SBIR/STTR ALERTING SERVICE --December 2, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    Deadline Reminder -- DOT FY12.1 SBIR Solicitation Deadline Reminder -- NIH SBIR Program Announcement Efforts Continue On November 18, the NIH posted a notice on their SBIR/STTR News Flash Page (http://grants.nih

  17. SBIR/STTR ALERTING SERVICE --February 11, 2011 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    Gases E) Drinking Water Monitoring Treatment F) Wastewater and Sustainable Infrastructure G) Air Pollution Monitoring and Control H) Biofuels I) Waste Monitoring and Management J) Homeland Security A new

  18. SBIR/STTR ALERTING SERVICE --March 19, 2010 The SBIR/STTR Alerting Service is a free service that provides bi-weekly notification of SBIR and STTR

    E-Print Network [OSTI]

    ; C) Nanotechnology; D) Greenhouse Gases; E) Drinking Water Monitoring and Treatment; F) Wastewater and Sustainable Infrastructure; G) Air Pollution Monitoring and Control; H) Biofuels; I) Waste Monitoring

  19. Outboard motor provided with a four-stroke engine

    SciTech Connect (OSTI)

    Sumigawa, Y.

    1986-09-16

    This patent describes a lubricating system for an internal combustion engine having a lubricant reservoir adapted to contain a lubricant for the engine. The system includes an inlet line depending into the lubricant reservoir for supplying lubricant for an engine lubricating system, a strainer disposed at the inlet end of the inlet line for removing foreign particles from the lubricant entering the inlet line, a drain opening in the lubricant reservoir for draining lubricant therefrom, and a drain plug for closing the drain opening, the improvement is described comprising the drain opening and the strainer being sized and related for servicing of the strainer through the drain opening, and relief valve means for bypassing the strainer in providing unfiltered lubricant to the inlet line in the event the strainer becomes plugged.

  20. Ternary mixes provide excellent workability and finishing characteristics, especially in hot weather.

    E-Print Network [OSTI]

    weather. Type IS with 20% Class C fly ash replacement Type IP with 20% Class C fly ash replacement Ternary paving has been placed in Iowa utilizing the following ternary blends: Type IS with 20% Class C fly ash replacement ·8.5 million yd2 (7.1 million m2) Type IP with 20% Class C fly ash replacement ·2.7 million yd2 (2

  1. Services for Persons with Disabilities This information is available on the Web, at

    E-Print Network [OSTI]

    Gustafsson, Torgny

    Services for Persons with Disabilities This information is available on the Web, at: http://www.libraries.rutgers.edu/accessibility The staff of the Rutgers University Libraries provide services and/or accommodations aimed at equalizing-routine accommodations so that appropriate staff can be scheduled to provide timely assistance. Services Some examples

  2. Oregon State University Extension Service 4-H Volunteer Screening and Education Process

    E-Print Network [OSTI]

    Tullos, Desiree

    Oregon State University Extension Service 4-H Volunteer Screening and Education Process Screening Process Rationale: The Extension Service is committed to providing a safe environment for young people participating in its programs. With this in mind, the Extension Service will provide the needed screening

  3. Method for providing a compliant cantilevered micromold

    DOE Patents [OSTI]

    Morales, Alfredo M. (Livermore, CA); Domeier, Linda A. (Danville, CA); Gonzales, Marcela G. (Shoreline, WA); Keifer, Patrick N. (Livermore, CA); Garino, Terry J. (Albuquerque, NM)

    2008-12-16

    A compliant cantilevered three-dimensional micromold is provided. The compliant cantilevered micromold is suitable for use in the replication of cantilevered microparts and greatly simplifies the replication of such cantilevered parts. The compliant cantilevered micromold may be used to fabricate microparts using casting or electroforming techniques. When the compliant micromold is used to fabricate electroformed cantilevered parts, the micromold will also comprise an electrically conducting base formed by a porous metal substrate that is embedded within the compliant cantilevered micromold. Methods for fabricating the compliant cantilevered micromold as well as methods of replicating cantilevered microparts using the compliant cantilevered micromold are also provided.

  4. HANFORD SITE WELDING PROGRAM SUCCESSFULLY PROVIDING A SINGLE SITE FUNCTION FOR USE BY MULTIPLE CONTRACTORS

    SciTech Connect (OSTI)

    CANNELL GR

    2009-11-19

    The Department of Energy, Richland Operations (DOE-RL) recently restructured its Hanford work scope, awarding two new contracts over the past several months for a total of three contracts to manage the sites cleanup efforts. DOE-RL met with key contractor personnel prior to and during contract transition to ensure site welding activities had appropriate oversight and maintained code compliance. The transition also provided an opportunity to establish a single site-wide function that would provide welding and materials engineering services to the Hanford site contractors: CH2M HILL Plateau Remediation Company (CHPRC); Mission Support Alliance (MSA); Washington River Protection Solutions (WRPS); and Washington Closure Hanford (WCH). Over the years, multiple and separate welding programs (amongst the several contractors) existed at the Hanford site leading to inefficiencies resulting from duplication of administrative efforts, maintenance of welding procedures, welder performance certifications, etc. The new, single program eliminates these inefficiencies. The new program, co-managed by two of the sites' new contractors, the CHPRC ('owner' of the program and responsible for construction welding services) and the MSA (provides maintenance welding services), provides more than just the traditional construction and maintenance welding services. Also provided, are welding engineering, specialty welding development/qualification for the closure of radioactive materials containers and materials evaluation/failure analysis. The following describes the new Hanford site welding program.

  5. Introduction Seismic inversion techniques provide us with

    E-Print Network [OSTI]

    Taylor, Mark A J

    Introduction Seismic inversion techniques provide us with information about the wave velocity stratigraphy requires a knowledge of the physical properties, such as the bulk and shear moduli, and the microstructure of media through which the waves travel. Understanding how seismic velocities depend

  6. Providing medical care within underserved communities has

    E-Print Network [OSTI]

    Almor, Amit

    Providing medical care within underserved communities has always been my dream. The Florence campus the health of the citizens of South Carolina. The Community Florence, SC is conveniently located as a primary care physician with an emphasis on rural populations. Professional Leadership Tract Living

  7. Providing Security With Insecure Systems Andrew Odlyzko

    E-Print Network [OSTI]

    Odlyzko, Andrew M.

    not caused by cyber­in­security. Even taking the crash into account, the world economy has been doing veryProviding Security With Insecure Systems Andrew Odlyzko School of Mathematics, University: Security, Economics, Human Factors Extended Abstract A Martian who arrived on Earth today would surely con

  8. VISION STATEMENT We provide expert guidance

    E-Print Network [OSTI]

    Lance, Veronica P.

    splatter. An in-line HEPA filter (C) is used to protect the vacuum system (D) Please, No Food or Drink. In-line HEPA filters provide added protec- tion for the house vacuum system and must be used whenever in the Lab! Eating, drinking, smoking, handling con- tact lenses, applying cosmetics, and stor- ing food

  9. Ground water provides drinking water, irrigation for

    E-Print Network [OSTI]

    Saldin, Dilano

    they join tributaries to the Mississippi River. · The deep ground water divide is the underground boundary Deep ground water divide Racine Kenosha Walworth Waukesha Washington Ozaukee Milwaukee LAKE MICHIGANGround water provides drinking water, irrigation for crops and water for indus- tries. It is also

  10. MESSAGE EXCHANGES FOR WEB SERVICE-BASED MAPPING SERVICES

    E-Print Network [OSTI]

    MESSAGE EXCHANGES FOR WEB SERVICE-BASED MAPPING SERVICES Ahmet Sayar 1, *, Marlon Pierce 1 will be implemented more extensively by using Web Service approach. A spatial data infrastructure lets many GIS the integration of data and services from multiple sources from different vendors. The Web services architecture

  11. IAEA reorganizes nuclear information services

    SciTech Connect (OSTI)

    Levine, E.

    2012-08-15

    As part of an overall restructuring of the International Atomic Energy Agency's Department of Nuclear Energy, the agency has established the Nuclear Information Section (NIS). The restructuring, recently announced by IAEA Director General Yukiya Amano, also includes the creation of a separate Nuclear Knowledge Management (NKM) Section, as demand for assistance in this area is growing among member countries. According to the NIS Web site, 'This restructuring and the creation of the NIS provides an opportunity for further enhancing existing information products and services and introducing new ones-all with an eye towards advancing higher organizational efficiency and effectiveness.'

  12. SERVICE MANUAL AUTORANGING

    E-Print Network [OSTI]

    Kleinfeld, David

    SERVICE MANUAL AUTORANGING DC POWER SUPPLY AGILENT MODELS 6010A, 6011A, 6012B and 6015A Agilent pay for return of products to Customer. Warranty services outside the country of initial purchase, the Customer shall be entitled to a refund of the purchase price upon return of the product to Agilent

  13. Digital Product Services Abstract

    E-Print Network [OSTI]

    Daraio, Chiara

    link physical products with digital services. By using Internet of Things technologies we try to help and at the University of St. Gallen conducts research in the field of Internet of Things. Our research focus is on next Internet of Things technologies and mobile devices make it feasible to "attach" digital product services

  14. Service Assessment HURRICANE FRAN

    E-Print Network [OSTI]

    Service Assessment HURRICANE FRAN August 28 - September 8, 1996 U.S.Department of Commerce National-12 Visible, 753 a.m. EDT, September4, 1996. #12;Service Assessment HURRICANE FRAN August 28 Bureau Hurricane Series ERRATA NOTICE One or more conditions of the original document may affect

  15. Personal Services Agreements Waivers

    E-Print Network [OSTI]

    ­ that do not require design work: Advertising services are required for such things as faculty positions wide list of high school students that meet possible criteria for attending CSM. The School does not have adequate staff to perform these services. 9. Safety Inspection: The School does not have

  16. Fitness for service applications in LNG plants

    SciTech Connect (OSTI)

    Bagnoli, D.L.; Polk, C.J.; Yin, H.; Gordon, J.R.

    1995-12-31

    Fitness-for-service assessments can provide information regarding operational reliability of equipment. However, to be meaningful, such assessments require an analytical procedure to determine the ability of engineering structures to tolerate the presence of weld flaws. In recent years, there has been a significant interest in this technology by the refining and petrochemical industries for predicting and avoiding fracture in pressurized components. Most applications have covered pressure vessel and piping where carbon and low alloy steels are the traditional materials of construction. More recently, fitness for service questions have developed for equipment with highly ductile materials such as aluminum alloys. In order to handle these questions ductile tearing resistance must be considered and R curve methods are required. In this paper examples are cited where fitness for service assessments were required for an aluminum heat exchanger in LNG service. Suitable R curve data were developed in order to establish flaw tolerance following UT inspections of this equipment.

  17. Product and Service directory - 2007 issue

    SciTech Connect (OSTI)

    Agnihotri, Newal

    2006-11-15

    The focus of the November-December issue each year is to provide an up to date product and services directory. The Directory is a source of informaiton on resources for over 3,000 products and services related to the nuclear power industry. The information included was submitted by approximately 300 suppliers worldwide during October-November 2006. The section includes listings of available current products and services with the names of the related supliers. Items listed in the Directory are related to the nuclear power industry only. Therefore the words 'nuclear' or 'nuclear power' have been dropped from the indexing terms that aid in organizing the information presented. Each suppliers listing in the suppliers section includes complete contact information. The Corporate Capabiliites section lists products and services of organizations in one central location.

  18. Product and Service directory - 2005 issue

    SciTech Connect (OSTI)

    Agnihotri, Newal

    2004-11-15

    The focus of the November-December issue each year is to provide an up to date product and services directory. The Directory is a source of informaiton on resources for over 3,000 products and services related to the nuclear power industry. The information included was submitted by approximately 300 suppliers worldwide during October-November 2004. The section includes listings of available current products and services with the names of the related supliers. Items listed in the Directory are related to the nuclear power industry only. Therefore the words 'nuclear' or 'nuclear power' have been dropped from the indexing terms that aid in organizing the information presented. Each suppliers listing in the suppliers section includes complete contact information. The Corporate Capabiliites section lists products and services of organizations in one central location.

  19. Product and Service directory - 2008 issue

    SciTech Connect (OSTI)

    Agnihotri, Newal

    2007-11-15

    The focus of the November-December issue each year is to provide an up to date product and services directory. The Directory is a source of informaiton on resources for over 3,000 products and services related to the nuclear power industry. The information included was submitted by approximately 300 suppliers worldwide during October-November 2007. The section includes listings of available current products and services with the names of the related supliers. Items listed in the Directory are related to the nuclear power industry only. Therefore the words 'nuclear' or 'nuclear power' have been dropped from the indexing terms that aid in organizing the information presented. Each suppliers listing in the suppliers section includes complete contact information. The Corporate Capabiliites section lists products and services of organizations in one central location.

  20. Product and Service directory - 2009 issue

    SciTech Connect (OSTI)

    Agnihotri, Newal

    2008-11-15

    The focus of the November-December issue each year is to provide an up to date product and services directory. The Directory is a source of informaiton on resources for over 3,000 products and services related to the nuclear power industry. The information included was submitted by approximately 300 suppliers worldwide during October-November 2008. The section includes listings of available current products and services with the names of the related supliers. Items listed in the Directory are related to the nuclear power industry only. Therefore the words 'nuclear' or 'nuclear power' have been dropped from the indexing terms that aid in organizing the information presented. Each suppliers listing in the suppliers section includes complete contact information. The Corporate Capabiliites section lists products and services of organizations in one central location.