National Library of Energy BETA

Sample records for ip office manager

  1. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.


    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  3. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel


    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  4. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  5. Office of Information Management

    Broader source: [DOE]

    The Office of Information Management provides a broad range of information technology services in support of the Associate Under Secretary for the Office of Environment, Health, Safety and Security (AU).

  6. Site Office Manager, Princeton

    Broader source: [DOE]

    A successful candidate in this position will serve as the Princeton Site Office (PSO) Manager by providing overall executive leadership to the PSO.

  7. Workforce Management Office (WFMO) Functional Statements WORKFORCE MANAGEMENT OFFICE

    E-Print Network [OSTI]

    May 2014 Workforce Management Office (WFMO) ­ Functional Statements WORKFORCE MANAGEMENT OFFICE The Workforce Management Office (WFMO) is the servicing Human Resource Organization for NOAA and is the principal contact point with the Department of Commerce (DOC) Office of Human Resources Management. WFMO

  8. Office of Quality Management

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Quality Management develops and interprets Government-wide policies and procedures and conducts training to ensure the accurate identification of information and documents that must be classified or controlled under statute or Executive order to protect the national security and controlled unclassified Official Use Only information for the effective operation of the Government.


    Office of Legacy Management (LM)

    OFFICE FOR EMERGENCY MANAGEMENT 155OP STREETNW. WiSHINGTON. D.C. ' , iQns 25,19&L At-t :. I' .' at l530 P Btmat, IO&, XtwMn&m, 0. 6., at 9130 A.Jb Sa 1 llmbemupoftbaaomlttaal8f...

  10. Office of Personnel Management (OPM) Billing System PIA, Office...

    Energy Savers [EERE]

    Personnel Management (OPM) Billing System PIA, Office of Health, Safety and Security Office of Personnel Management (OPM) Billing System PIA, Office of Health, Safety and Security...

  11. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  12. DOE Jobs Online (Hiring Manager), Office of Human Capitol Management...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Jobs Online (Hiring Manager), Office of Human Capitol Management Innovation and Solutions DOE Jobs Online (Hiring Manager), Office of Human Capitol Management Innovation and...

  13. Information Security Office Risk Management

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Information Security Office Risk Management Exception Template #12;Risk Management Exception or Approved) 6/01/2013 CISO Jason Pufahl, CISO Approved 6/01/2013 RMAC Risk Management Advisory Council Reviewed #12;Risk Management Exception Template 2 | P a g e Please check one of the following: Requester

  14. Project Management Coordination Office Organization Chart

    Office of Energy Efficiency and Renewable Energy (EERE)

    Project Management Coordination Office Organization Chart, U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy.

  15. Office of Classroom Management 2011 Annual Report

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Office of Classroom Management 2011 Annual Report Office of Classroom Management · Academic Support Director, Office of Classroom Management Charts/graphs Table of Contents 1 2 3 4 5 6 7 8 9 10 11 12 13 14 Office of Classroom Management 2011 Annual Report #12;1 2011 OCM Annual Report OCM's functions Scheduling

  16. Manager, Golden Field Office

    Broader source: [DOE]

    This position is located in the Office of Energy Efficiency and Renewable Energy (EERE). The mission of EERE is to create and sustain American leadership in the global transition to a clean energy...

  17. Office of Personnel Management

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0

  18. Project Management Coordination Office Organization Chart | Department...

    Office of Environmental Management (EM)

    Office Organization Chart, U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy. pmeorgchart101013.pdf More Documents & Publications Management Reform...

  19. Partnering Policy for the Office of Environmental Management...

    Office of Environmental Management (EM)

    Policy for the Office of Environmental Management Partnering Policy for the Office of Environmental Management Partnering Policy for the Office of Environmental Management More...

  20. Occupational Health Manager PIA, Carlsbad Field Office | Department...

    Energy Savers [EERE]

    Occupational Health Manager PIA, Carlsbad Field Office Occupational Health Manager PIA, Carlsbad Field Office Occupational Health Manager PIA, Carlsbad Field Office PDF icon...

  1. University of Minnesota Office of Classroom Management

    E-Print Network [OSTI]

    Thomas, David D.

    University of Minnesota Office of Classroom Management "Low End" Asynchronous Videostreaming Pilot Office of Classroom Management "Low End" Asynchronous Videostreaming Pilot Project Evaluation Contents and testing of "low end" asynchronous video streaming as a Phase III in The Office of Classroom Management

  2. Line Management Perspective: Office of Environmental Management (EM)

    Broader source: [DOE]

    Slide Presentation by Matthew Moury, Deputy Assistant Secretary for Safety, Security and Quality Programs, Office of Environmental Management. EFCOG Integrated Safety Management Work Planning and Control.


    E-Print Network [OSTI]

    US Army Corps of Engineers

    and quality. VE contributes to the overall management objectives of streamlining operations, improving qualityEXECUTIVE OFFICE OF THE PRESIDENT OFFICE OF MANAGEMENT AND BUDGET WASHINGTON, D.C. 20503 December, improve performance, enhance quality, and foster the use of innovation. Agencies should maintain policies

  4. Office of Legacy Management ? Post Competition Accountability...

    Office of Environmental Management (EM)

    Organization Proposal 2012 This report serves as an official record of the quarterly cost, personnel, and performance information for the Office of Legacy Management to satisfy...

  5. Bioenergy Technologies Office Program Management Review

    Broader source: [DOE]

    The Bioenergy Technologies Office will be hosting its biennial Program Management Peer Review on June 25, 2015 at the Walter E. Washington Convention Center.

  6. Office of Classroom Management A quick reference

    E-Print Network [OSTI]

    Thomas, David D.

    Office of Classroom Management A quick reference for how to navigate your classroom's technology of the camera. #12;Office of Classroom Management 1. Press any button other than the "system off" button 2. When and resources Classroom Support Hotline: 612-625-1086 ·Controlsforthe

  7. Office of Legacy Management's Strategic Plan 2016-2025 | Department...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Office of Legacy Management's Strategic Plan 2016-2025 Office of Legacy Management's Strategic Plan 2016-2025 Office of Legacy Management's Strategic Plan 2016-2025 More Documents...

  8. CRAD, Emergency Management - Office of River Protection K Basin...

    Energy Savers [EERE]

    CRAD, Emergency Management - Office of River Protection K Basin Sludge Waste System CRAD, Emergency Management - Office of River Protection K Basin Sludge Waste System May 2004 A...

  9. Final Report Implementing Office of Management and Budget Information...

    Energy Savers [EERE]

    Final Report Implementing Office of Management and Budget Information Dissemination Quality Guidelines (67 Fed Reg 62446) Final Report Implementing Office of Management and Budget...

  10. Letter to Congress RE: Office of Civilian Radioactive Waste Management...

    Office of Environmental Management (EM)

    to Congress RE: Office of Civilian Radioactive Waste Management's Annual Financial Report Letter to Congress RE: Office of Civilian Radioactive Waste Management's Annual Financial...

  11. Acquisition and Project Management Office volunteers get up-close...

    National Nuclear Security Administration (NNSA)

    Our Jobs Our Jobs Working at NNSA Blog Home NNSA Blog Acquisition and Project Management Office volunteers get ... Acquisition and Project Management Office volunteers get...

  12. EERE Project Management Center Database PIA, The Office of Energy...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Project Management Center Database PIA, The Office of Energy Efficiency and Renewable Energy (EERE) EERE Project Management Center Database PIA, The Office of Energy Efficiency...

  13. Director, Office of Resource Management

    Broader source: [DOE]

    The Office of the Associate Under Secretary for Environment, Health, Safety, and Security (AU) provides corporate leadership and strategic approaches for protecting DOEs workers, the public, the...

  14. Workforce Management Office WORKFORCE AND SUCCESSION PLANNING

    E-Print Network [OSTI]

    2012 Workforce Management Office NOAA 1/1/2012 WORKFORCE AND SUCCESSION PLANNING Toolkit to Identify and Address Strategic Talent Gaps #12;Workforce & Succession Planning Toolkit NOAA Workforce .......................................................................................................3 Workforce Planning

  15. Line Management Perspective: Office of Science (SC)

    Broader source: [DOE]

    Remarks by Joseph A. McBrearty concerning the importance of integrated safety management for the protection of workers, the public, and the environment and successfully implementing the Department of Energy, Office of Science's missions.

  16. EM Field Office Manager Receives Military Honor

    Broader source: [DOE]

    EM Carlsbad Field Office (CBFO) Manager Joe Franco receives the Employer Support of the Guard and Reserve (ESGR) Seven Seals Award in June at a ESGR recognition event in Carlsbad, N.M.

  17. DOE Office of Science Programs and NERSC Allocation Managers

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    DOE Allocation Managers Department of Energy Science Offices, Programs and Allocation Managers NERSC is overseen by the DOE NERSC Program Manager, Dave Goodwin...

  18. Site Manager Pantex Site Office

    National Nuclear Security Administration (NNSA)

    workforce. These re- ports serve the purpose of assisting management in workforce planning aligned to our strategic goals. Additionally, the reports help us analyze our...

  19. Standards Panel: 1. Stephen Diamond, General Manager, Industry Standards Office and Global Standards Officer, EMC

    E-Print Network [OSTI]

    Standards Panel: 1. Stephen Diamond, General Manager, Industry Standards Office and Global was President of the IEEE Computer Society. Steve is General Manager of the Industry Standards Office at EMC Standards Officer, EMC Corporation, Office of the CTO Steve Diamond has 30 years of management, marketing

  20. Environmental Management Los Alamos Field Office Corrective Action...

    Energy Savers [EERE]

    Field Office Corrective Action Plan - Radiological Release Phase II Environmental Management Los Alamos Field Office Corrective Action Plan - Radiological Release Phase II On...

  1. Office of Environmental Management Perspective

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996How to ApplytheExecutive71.1 OMB Field Element Line ManagementEFCOG

  2. Acting Assistant Secretary for DOE Office of Environmental Management...

    Office of Environmental Management (EM)

    no shorts or skirts). Who: DOE Acting Assistant Secretary for Environmental Management David Huizenga, DOE Richland Operations Office Manager Matt McCormick What: Tour of major...

  3. 2011 Annual Planning Summary for Office of Legacy Management...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Legacy Management (LM), Grand Junction (See LM APS) 2011 Annual Planning Summary for Office of Legacy Management (LM), Grand Junction (See LM APS) The ongoing and projected...

  4. Daniel Hoag Named Y-12 Site Office Deputy Manager | National...

    National Nuclear Security Administration (NNSA)

    Y-12 Site Office Deputy Manager | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation...

  5. OSU Office of Risk Management Foreign Citizens Working Abroad

    E-Print Network [OSTI]

    Tullos, Desiree

    OSU Office of Risk Management Foreign Citizens Working Abroad Student/Employee Name: Phone: E the Office of Risk Management (ORM) for additional information. Student/Employee Status: (full warning or sanction, contact the Office of Risk Management at OSU. Special conditions may apply


    E-Print Network [OSTI]

    Arnold, Elizabeth A.

    OFFICE OF RISK MANAGEMENT STUDENT ACCIDENT INVESTIGATION REPORT James Madison University, Office of Risk Management, 131 West Grace Street, MSC 6703 Harrisonburg, VA 22807, Phone: 540-568-7812, Fax: 540/Injury: Student's Signature: Date: Return Original Form to: #12;OFFICE OF RISK MANAGEMENT STUDENT ACCIDENT

  7. The UNIVERSITY OF TENNESSEE Office of Risk Management

    E-Print Network [OSTI]

    Cui, Yan

    The UNIVERSITY OF TENNESSEE Office of Risk Management 112 Conference Center Building Knoxville, TN to the Office of Risk Management. NOTE: Please share this information within your department/unit with those with University and State requirements. It is imperative that the Office of Risk Management be notified

  8. Office of Legacy Management. Information and Records Management. Transition Guidance

    SciTech Connect (OSTI)



    The Office of Legacy Management (LM) is an integral part of the U.S. Department of Energy’s (DOE’s) strategy to ensure that legacy liabilities of former nuclear weapons production sites are properly managed following the completion of environmental cleanup activities. LM will work with each site using an integrated team approach to ensure a successful transition. Part of this process will include transition of Government records and information. The Office of Legacy Management Information and Records Management Transition Guidance focuses on LM’s goal to preserve and protect legacy records and information. This guidance document establishes a framework for the transfer of records management responsibilities for sites transferring to LM. It describes the requirements, responsibilities, and procedures for the efficient and cost-effective transfer of custody, ownership, and management of records and other information products from the transfer site to LM. Records management practices are critical to the functions of Federal agencies because records provide information about, or evidence of, the organization, functions, policies, decisions, procedures, operations, or other activities. Therefore, the information generated by an agency is created, maintained, and dispositioned through records management processes that ensure the appropriate preservation and retrieval of essential information. Because of their intrinsic value, best practices to preserve information and records should be utilized when records are transferred from one organization to another. As the transfer program completes cleanup activities at closure sites, a transitional process will facilitate the transparent shift in the management of site records activities to LM. The roles and responsibilities of the transfer site and/or program and LM described in this document are a necessary foundation for cooperation and coordination and are essential to the successful transition of records and information responsibilities. The DOE Office of the Chief Information Officer (OCIO) has a central role in DOE records management by providing guidance, expertise, and coordination to all DOE offices and organizations and coordination with the National Archives and Records Administration (NARA). LM and the transfer site will complete an integrated transition plan which will integrate all transition elements including information and records. As part of the overall transition plan, an Information and Records Transition Plan will be developed consistent with the integrated transition plan for the site transfer and included as an attachment. The Information and Records Management Transition Plan will be developed to assist both organizations in organizing the tasks; establishing a timetable and milestones for their completion; and identifying manpower, funding and other resources that will be needed to complete the ownership transfer. In addition, the plan will provide a valuable exchange of institutional knowledge that will assist LM in meeting the obligations of responsibly managing legacy records. Guidance for the development of the plan is included in this document. Records management concerns that may arise during site closure, such as management support, contract language and agreements, interactions with the OCIO and NARA, resource and budget considerations, and procedures to safeguard records are addressed. Guidelines and criteria for records management transition activities are also provided. These include LM expectations for the inventory, scheduling, and disposition of records; the management and transfer of electronic files, including databases and software; records finding aids, indices, and recordkeeping systems; and the process for the transfer of hard copy and electronic records to LM.

  9. Office of Emergency Management UCF Facilities and Safety

    E-Print Network [OSTI]

    Wu, Shin-Tson

    is lost. Bring extra batteries Fully charge cell phones and lap tops and keep chargers with you #12;Office, and charger Fire extinguisher Important documents #12;Office of Emergency Management UCF Facilities and Safety

  10. Office of Personnel Management (OPM) Guidance on Diversity and...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Report 2010.pdf More Documents & Publications Government-Wide Diversity and Inclusion Strategic Plan (2011), Office of Personnel Management Diversity and Inclusion Strategic...

  11. EM Richland Operations Office Manager Reflects on River Corridor...

    Energy Savers [EERE]

    DOE 300 Million Washington Closure Hanford, the contractor managing the River Corridor Closure Project for the Richland Operations Office, leveraged subcontractor expertise and...

  12. Office of Legacy Management FY 2013 Consolidated Energy Data...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    3 Consolidated Energy Data Report (CEDR) Office of Legacy Management FY 2013 Consolidated Energy Data Report (CEDR) The Consolidated Energy Data Report (CEDR) consists of 27...

  13. The Office of Legacy Management | Department of Energy

    Broader source: (indexed) [DOE]

    (LM) manages the Department's legacy responsibilities resulting from the nuclear weapons program. The mission of the Office is to protect human health and the environment...

  14. Office of Civilian Radioactive Waste Management-Quality Assurance...

    Broader source: (indexed) [DOE]

    and description of the Quality Assurance program. Office of Civilian Radioactive Waste Management-Quality Assurance Requirements and Description More Documents &...

  15. Position Description Project Manager, Office of Community and Economic Development

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    Position Description Project Manager, Office of Community and Economic Development Full will support all aspects of the success of CSU's Office of Community and Economic Development projects from conceptual development and scoping, through tracking and management of projects, including tracking details

  16. CAMPUS Updated 2/9/2012 OFFICE Safety & Risk Management

    E-Print Network [OSTI]

    de Lijser, Peter

    Page 1 CAMPUS Updated 2/9/2012 OFFICE Safety & Risk Management MAILING ADDRESS 9001 Stockdale Hwy, CIH Director of Safety & Risk Management (661) 6542066 Risk Management) 6546320 Safety, I.H., and Environmental Programs Director of Safety and Risk Management

  17. Annex 2 Risk Guidance Science Programme Office Project Management

    E-Print Network [OSTI]

    1 Annex 2 ­ Risk Guidance Science Programme Office Project Management Guidance on Risk Management and technical performance. However, with appropriate procedures, risks can be managed and in so doing, present as bad things happening. The objective of risk management is to identify, assess, reduce, accept


    E-Print Network [OSTI]

    Oliver, Douglas L.

    OFFICE of MATERIALS & LOGISTICS MANAGEMENT CAPITAL ASSET INVENTORY CERTIFICATE -- IC-10 DATE: From: Jack Ferraro University Director Office of Materials & Logistics Management (MLM) LB058, MC 2012

  19. The Office of Environmental Management technical reports: a bibliography

    SciTech Connect (OSTI)


    The Office of Environmental Management`s (EM) technical reports bibliography is an annual publication that contains information on scientific and technical reports sponsored by the Office of Environmental Management added to the Energy Science and Technology Database from July 1, 1995 through Sept. 30, 1996. This information is divided into the following categories: Focus Areas and Crosscutting Programs. Support Programs, Technology Integration and International Technology Exchange are now included in the General category. EM`s Office of Science and Technology sponsors this bibliography.

  20. CAMPUS Updated 2/9/2012 OFFICE Safety & Risk Management

    E-Print Network [OSTI]

    de Lijser, Peter

    Page 1 CAMPUS Updated 2/9/2012 OFFICE Safety & Risk Management MAILING ADDRESS 9001 Stockdale Hwy Juli A. Smith, CIH Director of Safety & Risk Management (661) 654-2066 Risk and Risk Management SAFETY RELATED FUNCTIONS SPECIFIC SAFETY FUNCTIONS RESPONSIBLE PERSON POSITION

  1. Project Management: Key to the future success of your office

    E-Print Network [OSTI]

    a case for project management in our offices Provide an easy entry point into project management Focus, Cost, Quality, HR, Communication, Risk, Procurement, and Stakeholder Management #12;Educational Opportunities HR classes 3rd party education companies New Horizons PMI Extensive professional development

  2. WORKERS' COMPENSATION CLAIMS PROGRAM Managed by the Office of Risk Management/Claims Services

    E-Print Network [OSTI]

    WORKERS' COMPENSATION CLAIMS PROGRAM Managed by the Office of Risk Management and needs medical a en on, the University (through his/her supervisor, the Office of Risk Management, and the Department of Labor & Industries un l the Industrial Injury claim is closed. No one knows their own job

  3. Office of Environmental Management MAJOR CONTRACTS SUMMARY

    Office of Environmental Management (EM)

    Contract Period Total Value Contract Description Contract Type Carlsbad Field Office Nuclear Waste Partnership, LLC DE-EM0001971 Base Period 10112 - 93017 1.4B Waste...

  4. The Office of Environmental Management technical reports: A bibliography

    SciTech Connect (OSTI)


    The Office of Environmental Management`s (EM) technical reports bibliography is an annual publication that contains information on scientific and technical reports sponsored by the Office of Environmental Management added to the Energy Science and Technology Database from July 1, 1995--that were published from October 1, 1996--September 30, 1997. This information is divided into the following categories: Miscellaneous, Focus Areas and Crosscutting Programs, Support Programs, Technology Integration and International Technology Exchange, are now included in the Miscellaneous category. The Office of Environmental Management within the Department of Energy (DOE) is responsible for environmental restoration, waste management, technology development and facility transition and management. Subjects include: subsurface contaminants; mixed waste characterization, treatment and disposal; radioactive tank waste remediation; plutonium; deactivation and decommissioning; robotics; characterization, monitoring, and sensor technology; and efficient separations. 880 refs.

  5. Technology Available for Licensing Office of Technology Management

    E-Print Network [OSTI]

    Maroncelli, Mark

    Technology Available for Licensing Office of Technology Management The Pennsylvania State University 113 Technology Center, University Park, PA 16802 814.865.6277 phone; 814.865.3591 fax Contact: Matthew D. Smith Sr. Technology Licensing Officer The Pennsylvania State University Phone: (814) 863

  6. Establishment of Management Decisions on Office of Inspector General Reports

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    To establish the responsibilities and requirements for Department of Energy (DOE) action required to make management decisions on Office of Inspector General (OIG) audit and public inspection reports. Cancels DOE 2320.2B

  7. Establishment of Management Decisions on Office of Inspector General Reports

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    The order establishes the responsibilities and requirements for Department of Energy elements to make management decisions on Office of Inspector General audits and public inspection reports. Supersedes DOE O 221.3.

  8. Office of Legacy Management (LM) Program Update, January???March...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    us at Welcome to the 2009 issue of the U.S. Department of Energy (DOE) Office of Legacy Management (LM) . This publication is designed to provide a status of...

  9. Research Development and Administration Office of Proposal & Award Management

    E-Print Network [OSTI]

    Chapman, Michael S.

    0690 SW Bancroft St Portland, Oregon 97239 503 494-0355 Fax 503 494-1191 OPAM Effort Office of Proposal & Award Management Mailcode: L106OPAM 0690 SW Bancroft St Portland, Oregon 97239 503

  10. New Carlsbad Field Office Manager Hits the Ground Running

    Broader source: [DOE]

    CARLSBAD, N.M. – If you want to catch up with Carlsbad Field Office (CBFO) Manager Joe Franco, you may have to run. In fact, his first weeks in his new job have looked like a sprint.

  11. Design and implementation of an integrated network management system for TCP/IP-based distributed networks 

    E-Print Network [OSTI]

    Patel, Samir K.


    in designing of tools for network management. Various workstation vendors have developed such tools for their window systems, but many of the tools are not compatible for other systems. The X Window System, however, provides hardware independent and network...

  12. Managing uncertainty : foresight and flexibility in cryptography and voice over IP policy

    E-Print Network [OSTI]

    Hung, Shirley Kon-Jean


    This main question in this dissertation is under what conditions government agencies show foresight in formulating strategies for managing emerging technologies. A secondary question is when they are capable of adaptation. ...

  13. The Office of Science Data-Management Challenge

    SciTech Connect (OSTI)

    Mount, Richard P.; /SLAC


    Science--like business, national security, and even everyday life--is becoming more and more data intensive. In some sciences the data-management challenge already exceeds the compute-power challenge in its needed resources. Leadership in applying computing to science will necessarily require both world-class computing and world-class data management. The Office of Science program needs a leadership-class capability in scientific data management. Currently two-thirds of Office of Science research and development in data management is left to the individual scientific programs. About $18M/year is spent by the programs on data-management research and development targeted at their most urgent needs. This is to be compared with the $9M/year spent on data management by DOE computer science. This highly mission-directed approach has been effective, but only in meeting just the highest-priority needs of individual programs. A coherent, leadership-class, program of data management is clearly warranted by the scale and nature of the Office of Science programs. More directly, much of the Office of Science portfolio is in desperate need of such a program; without it, data management could easily become the primary bottleneck to scientific progress within the next five years. When grouped into simulation-intensive science, experiment/observation-intensive science, and information-intensive science, the Office of Science programs show striking commonalities in their data-management needs. Not just research and development but also packaging and hardening as well as maintenance and support are required. Meeting these needs is a medium- to long-term effort requiring a well-planned program of evolving investment. We propose an Office of Science Data-Management Program at an initial scale of $32M/year of new funding. The program should be managed by a Director charged with creating and maintaining a forward-looking approach to multiscience data-management challenges. The program should favor collaborative proposals involving computer science and application science or, ideally, multiple application sciences. Proposals bringing substantial application science funding should be especially favored. The proposed program has many similarities to the DOE SciDAC program. SciDAC already has a modest data-management component. The SciDAC program partially addresses many issues relevant to data management, and has fostered close collaboration between computer science and application sciences. Serious consideration should be given to integrating the management of the new Office of Science Data-Management Program and that of SciDAC or the successor to SciDAC.

  14. Office of Management | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting inServices » NEPANews »AboutOfficeOffice


    Broader source: [DOE]

    Idaho Falls, ID – The Department of Energy Idaho Operations Office today announced that James Cooper has been named deputy manager of its highly-successful Idaho Cleanup Project, which oversees the environmental cleanup and waste management mission at DOE’s Idaho site.

  16. DOE - Office of Legacy Management -- Fernald Environmental Management...

    Office of Legacy Management (LM)

    Fernald Environmental Management Project - 027 FUSRAP Considered Sites Site: Fernald Environmental Management Project (027) Designated Name: Alternate Name: Location: Evaluation...

  17. Office of Legacy Management | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting inServices » NEPANews »AboutOfficeOffice of

  18. Site Manager Y-12 Site Office

    National Nuclear Security Administration (NNSA)

    workforce. These re- ports serve the purpose of assisting management in workforce planning aligned to our strategic goals. Additionally, the reports help us analyze our...

  19. DOE - Office of Legacy Management -- CERCLA Home

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *'AliquippaOffice of Site

  20. DOE - Office of Legacy Management -- Canon

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *'AliquippaOffice of

  1. DOE - Office of Legacy Management -- Central

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *'AliquippaOffice ofNevada

  2. DOE - Office of Legacy Management -- Chariot

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *'AliquippaOffice

  3. Business Opportunities Session Office of Environmental Management |

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l DeInsulation at theEnergy State Governmentstanding Office

  4. Boise State University Office of Risk Management & Insurance

    E-Print Network [OSTI]

    Barrash, Warren

    Boise State University Office of Risk Management & Insurance Motor Vehicle Record Guidelines INTRODUCTION These procedures are linked to University policy #7005. Vehicle operations create substantial risk. A best practice for reducing vehicle risk is to ensure only safe drivers are allowed to operate vehicles

  5. Office of Human Resources Management Liberal Leave During Snow Emergencies

    E-Print Network [OSTI]

    Alexandrova, Ivana

    Office of Human Resources Management Liberal Leave During Snow Emergencies In the event of a snow emergency, liberal leave policy is in effect. In such circumstances, we encourage supervisors of their work day should they chose not to leave early. The Snow Response Plan, which contains useful

  6. EPA ENERGY STAR Webcast- Portfolio Manager® Office Hours, Focus Topic: Portfolio Manager 2015 Priorities

    Broader source: [DOE]

    Portfolio Manager "Office Hours" is a live webinar that gives all users an opportunity to ask their questions directly to EPA in an open forum. We will plan to spend the first 20-30 minutes of each...

  7. Project Management Coordination Office | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeVehicle Replacement U.S.Job&EnergyProject Management

  8. Oak Ridge Office of Environmental Management

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADA ORMAT NEVADA ORMATcan decide

  9. Office of Administrative Management and Support

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergy InnovationOctober5,October,5items

  10. Office of Management | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory of rare Kaonforsupernovae model (JournalHearings andManagement Search Search

  11. Evolution and History of the Department of Energy and the Office of Environmental Management

    Broader source: [DOE]

    An overview of the Evolution and History of the Department of Energy and the Office of Environmental Management.

  12. NNSA Announces Kevin W. Smith as Los Alamos Site Office Manager...

    National Nuclear Security Administration (NNSA)

    Kevin W. Smith as Los Alamos Site Office Manager | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing...

  13. Various Project Management Reports | U.S. DOE Office of Science...

    Office of Science (SC) Website

    Various Project Management Reports Project Assessment (OPA) OPA Home About Project Management Processes and Procedures Department of Energy Office of Science Various Project...

  14. Increasing Federal Office Building Water Efficiency, Federal Energy Management Program (FEMP) (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available


    Quick guide to increasing Federal office building water efficiency, water management planning, performing a water audit, calculating a water balance, and best management practices.

  15. Office of Project Management Oversight & Assessments | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting inServices » NEPANewsOffice of Project Management

  16. EPA ENERGY STAR Webcast: Portfolio Manager Office Hours, Focus Topic: Sharing Forward and Transfer Ownership

    Broader source: [DOE]

    Portfolio Manager "Office Hours" is a live webinar that gives all users an opportunity to ask their questions directly to EPA in an open forum. In 2014, Office Hours will be held once a month. We...

  17. EPA ENERGY STAR Webcast- Portfolio Manager Office Hours, Focus Topic: Weather Data and Metrics

    Broader source: [DOE]

    Portfolio Manager "Office Hours" is a live webinar that gives all users an opportunity to ask their questions directly to EPA in an open forum. In 2014, Office Hours will be held once a month. We...

  18. Office of Civilian Radioactive Waste Management | Department of Energy

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergyA chart detailling the Office of

  19. Office of Civilian Radioactive Waste Management | Department of Energy

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergyA chart detailling the Office

  20. Contract Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4Contract Management Thomas Jefferson Site Office

  1. Lead Management Program for Building Maintenance and Construction Projects Office of Environmental Health and Safety

    E-Print Network [OSTI]

    Chan, Hue Sun

    )F & S 8 3.2.3 MANAGERS, MECHANICAL OPERATIONS AND MAINTENANCE 9 3.2.4 PROPERTY MANAGERS 10 3.2.5 MANAGERLead Management Program for Building Maintenance and Construction Projects Office of Environmental Maintenance and Construction Projects Page 2 of 22 UNIVERSITY OF TORONTO ­ Office of Environmental Health

  2. Effective Project Management Office Processes and Technology Transfer: Implementation of an Avaya Voice Over Internet Protocol Telephony System in Mexico

    E-Print Network [OSTI]

    Perez, Mary Louise


    Management Institute, Inc. (PMI) to implement Information Technology (IT) projects and to transfer technology know how knowledge to its subsidiary in Mexico. To answer this question, an assessment of Cisco and Avaya VoIP telephony systems was completed...

  3. Notice of Office of Management and Budget Action to Approve with...

    Office of Environmental Management (EM)

    Notice of Office of Management and Budget Action to Approve with Change the Information Collection Request (ICR) for a New Collection for OE Recovery Act Financial Assistance...

  4. Notice of Office of Management and Budget Action to Approve with...

    Broader source: (indexed) [DOE]

    Notice of Office of Management and Budget Action to Approve with Change the Information Collection Request (ICR) for an Extension without Change of a Currently Approved Collection...

  5. Notice of Office of Management and Budget Action to Approve with...

    Office of Environmental Management (EM)

    Notice of Office of Management and Budget Action to Approve with Change the Information Collection Request (ICR) for an Extension of the ICR for OE Recovery Act Financial...

  6. EM Richland Operations Office Manager Reflects on River Corridor's Safe, Successful Cleanup

    Broader source: [DOE]

    RICHLAND, Wash. – This month, Stacy L. Charboneau marks her first year as manager of EM’s Richland Operations Office (RL), responsible for management and oversight of cleanup of the 586-square-mile Hanford Site.

  7. Qualitative and Quantitative Management Tools Used by Financial Officers in Public Research Universities 

    E-Print Network [OSTI]

    Trexler, Grant 1961-


    This dissertation set out to identify effective qualitative and quantitative management tools used by financial officers (CFOs) in carrying out their management functions of planning, decision making, organizing, staffing, communicating, motivating...

  8. Office of Resource Management and Planning, February 2008 Page 1 1990's Budget Cut Overview

    E-Print Network [OSTI]

    Ishida, Yuko

    , library materials, utilities, etc.: #12;Office of Resource Management and Planning, February 2008 PageOffice of Resource Management and Planning, February 2008 Page 1 1990's Budget Cut Overview. This was 21% of the 1,635 ladder faculty FTE (199091). Staff also participated in VERIP. Planning

  9. The University of Texas at Austin Management of UTnet Wireless Access Policy Office of the Chief Information Officer Written By: Information Technology Services

    E-Print Network [OSTI]

    Patzek, Tadeusz W.

    The University of Texas at Austin Management of UTnet Wireless Access Policy Office of the Chief Information Officer Written By: Information Technology Services ­ Networking;Information Security Office Document Version: Approved Last Edited: 3/4/2011 1 Management of UTnet Wireless Access Policy 1

  10. NOAA Workforce Management Office, Strategic Human Capital Division June 17, 2015 Division Director

    E-Print Network [OSTI]

    NOAA Workforce Management Office, Strategic Human Capital Division ­ June 17, 2015 Division Silver Spring, MD (301) 713-6365 Program Manager for Distance Learning) 713-6379 Program Manager (Leadership Competency Development Program, Presidential Management Fellows

  11. University of Bristol Risk Management Policy (Updated September 2014) Strategic Planning and Governance Office, September 2014

    E-Print Network [OSTI]

    Bristol, University of

    University of Bristol Risk Management Policy (Updated September 2014) 1 Strategic Planning and Governance Office, September 2014 University of Bristol Risk Management Policy 1. Risk management Given the uncertainties faced by institutions, it is helpful explicitly to identify and address risks. Risk management

  12. Roles of Officers in Respect to Risk Management Policy and Procedures Commencement Date: 18 October, 2000

    E-Print Network [OSTI]

    Roles of Officers in Respect to Risk Management Policy and Procedures Commencement Date: 18 October Nil 5. POLICY STATEMENT 5.1 University-Wide Risk Management Plan There shall be a University wide Risk. The Risk Management Plan will examine the expected key outcomes for the University and assess, manage

  13. Ten Years of Legacy Management: U.S. DOE Office of Legacy Management Accomplishments - 13246

    SciTech Connect (OSTI)

    Carter, Tony [U.S. Department of Energy Office of Legacy Management, 1000 Independence Ave. SW, Washington, DC 20585 (United States)] [U.S. Department of Energy Office of Legacy Management, 1000 Independence Ave. SW, Washington, DC 20585 (United States); Miller, Judith [S.M. Stoller Corporation, 2597 Legacy Way, Grand Junction, CO 81503 (United States)] [S.M. Stoller Corporation, 2597 Legacy Way, Grand Junction, CO 81503 (United States)


    The U.S. Department of Energy (DOE) established the Office of Legacy Management (LM) to provide a long-term, sustainable solution to environmental impacts that remain from nuclear weapons production during World War II and the Cold War. The production activities created adverse environmental conditions at over 100 sites. When LM was established on December 15, 2003, it became responsible for 33 sites where active environmental remediation was complete. Currently, LM is responsible for long-term surveillance and maintenance of environmental remedies, promotion of beneficial reuse of land and buildings, and management of records and information at 89 sites in 29 states and Puerto Rico. LM is also responsible for meeting contractual obligations associated with former contractor workers' pensions and post-retirement benefits. Effectively addressing this environmental and human legacy will continue to require a focused and well-managed effort. (authors)

  14. Office of Nuclear Energy Knowledge Management Program Situational Analysis Report

    SciTech Connect (OSTI)

    Kimberlyn C. Mousseau


    Knowledge management (KM) has been a high priority for the Department of Energy (DOE) Office of Nuclear Energy (NE) for the past several years. NE Programs are moving toward well-established knowledge management practices and a formal knowledge management program has been established. Knowledge management is being practiced to some level within each of the NE programs. Although it continues to evolve as NE programs evolve, a formal strategic plan that guides the implementation of KM has been developed. Despite the acceptance of KM within DOE NE, more work is necessary before the NE KM program can be considered fully successful. Per Dr. David J. Skyrme[1], an organization typically moves through the following evolutionary phases: (1) Ad-hoc - KM is being practiced to some level in some parts of the organization; (2) Formal - KM is established as a formal project or program; (3) Expanding - the use of KM as a discipline grows in practice across different parts of the organization; (4) Cohesive - there is a degree of coordination of KM; (5) Integrated - there are formal standards and approaches that give every individual access to most organizational knowledge through common interfaces; and (6) Embedded - KM is part-and-parcel of everyday tasks; it blends seamlessly into the background. According to the evolutionary phases, the NE KM program is operating at the two lower levels, Ad-hoc and Formal. Although KM is being practiced to some level, it is not being practiced in a consistent manner across the NE programs. To be fully successful, more emphasis must be placed on establishing KM standards and processes for collecting, organizing, sharing and accessing NE knowledge. Existing knowledge needs to be prioritized and gathered on a routine basis, its existence formally recorded in a knowledge inventory. Governance to ensure the quality of the knowledge being used must also be considered. For easy retrieval, knowledge must be organized according to a taxonomy that mimics nuclear energy programs. Technologies need to be established to make accessing the knowledge easier for the user. Finally, knowledge needs to be used as part of a well defined work process.

  15. Office of Material Management and Minimization | National Nuclear...

    National Nuclear Security Administration (NNSA)

    Management and Minimization | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering...

  16. Office of Emergency Management Assessments | Department of Energy

    Office of Environmental Management (EM)

    requiring a quantitative Emergency Planning Hazards Assessment. Works closely with other IEA offices and DOE line organizations to schedule and undertake assessments. Evaluates the...

  17. DOE - Office of Legacy Management -- Inhalation Toxicology Research...

    Office of Legacy Management (LM)

    monitoring and surveillance which is expected to continue until 2006. The Office of Science is site landlord and will be responsible for Long Term Stewardship. Also see...

  18. Management support services to the Office of Utility Technologies. Final technical report

    SciTech Connect (OSTI)

    Not Available


    The Office of Utility Technologies works cooperatively with industry and the utility sector to realize the market potential for energy efficiency and renewable energy technologies. Under this contract, BNF has provided management support services for OUT R&D activities for the following Program offices: (1) Office of Energy Management; (2) Office of Solar Energy Conversion; (3) Office of Renewable Energy Conversion; and (4) Deputy Assistant Secretary. During the period between 4/17/91 and 9/17/93, BNF furnished the necessary personnel, equipment, materials, facilities and travel required to provide management support services for each of the above Program Offices. From 9/18/93 to 12/17/93, BNF has been involved in closeout activities, including final product deliverables. Research efforts that have been supported in these Program Offices are: (1) for Energy Management -- Advanced Utility Concepts Division; Utility Systems Division; Integrated Planning; (2) for Solar Energy Conversion -- Photovoltaics Division; Solar Thermal and Biomass Power Division; (3) for Renewable Energy Conversion -- Geothermal Division; Wind, Hydroelectric and Ocean Systems Division; (4) for the Deputy Assistant Secretary -- support as required by the Supporting Staff. This final report contains summaries of the work accomplished for each of the Program Offices listed above.

  19. 12 | BOISESTATE.EDU At Boise State, the Office of Technology Transfer manages intellectual property commercialization

    E-Print Network [OSTI]

    Barrash, Warren

    12 | BOISESTATE.EDU At Boise State, the Office of Technology Transfer manages intellectual property it to market," said Katy Ritter, director of the Office of Technology Transfer. "We hope that the result of our to Technology Transfer, as experienced by researchers in disciplines across campus. TECHNOLOGY TRANSFER TIMELINE

  20. Notice of Office of Management and Budget Action to Approve with...

    Broader source: (indexed) [DOE]

    Notice of Office of Management and Budget Action to Approve with Change as an emergency action for six months the Information Collection Request (ICR) for a new collection (Request...

  1. EPA ENERGY STAR Webcast: Portfolio Manager Office Hours, Focus Topic: Responding to a Data Request

    Office of Energy Efficiency and Renewable Energy (EERE)

    Portfolio Manager "Office Hours" is a live webinar that gives all users an opportunity to ask their questions directly to EPA in an open forum. We will plan to spend the first 20-30 minutes of each...

  2. HEALTH, SAFETY AND ENVIRONMENTAL MANAGEMENT SYSTEM Safety Regulations and Policies for Offices

    E-Print Network [OSTI]

    Saskatchewan, University of

    HEALTH, SAFETY AND ENVIRONMENTAL MANAGEMENT SYSTEM Safety Regulations and Policies for Offices #12 Table of Contents University of Saskatchewan Policies Relating to Health, Safety and Environment) ............................................................ 15 The Saskatchewan Occupational Health and Safety Act and Regulations............................ 17

  3. EPA ENERGY STAR Webinar: Portfolio Manager Office Hours, Focus Topic: Understanding Energy Metrics

    Broader source: [DOE]

    Portfolio Manager "Office Hours" is a live webinar that gives all users an opportunity to ask their questions directly to EPA in an open forum. We will plan to spend the first 20-30 minutes of each...

  4. Campus Sustainability Office Campus Planning Office

    E-Print Network [OSTI]

    Elzanowski, Marek

    Campus Sustainability Office (CSO) Campus Planning Office (CPO) Campus Sustainability Manager (Molly Bressers) Campus Sustainability Office and Campus Planning Office May 2015 Student Employee (Thea

  5. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available


    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  6. Grants Management Office Guide: How do I transfer grants to UNSW? GMO Guide: How do I transfer grants to UNSW?

    E-Print Network [OSTI]

    New South Wales, University of

    Grants Management Office Guide: How do I transfer grants to UNSW? GMO Guide: How do I transfer as possible, as UNSW Grants Management Office (GMO) communications will assume they are aware of the change to, or the Grants Officer responsible for your Faculty, School or Centre. You can

  7. Data Management Plans for NEH Office of Digital Humanities Proposals and Awards1

    E-Print Network [OSTI]

    Bergman, Keren

    1 Data Management Plans for NEH Office of Digital Humanities Proposals and Awards1 Executive Summary The data management plan (DMP) should be short (no more than two pages) and will be submitted as a document supplementing a grant application. The plan will need to address two main topics: What data

  8. CRAD, Management- Office of River Protection K Basin Sludge Waste System

    Broader source: [DOE]

    A section of Appendix C to DOE G 226.1-2 "Federal Line Management Oversight of Department of Energy Nuclear Facilities." Consists of Criteria Review and Approach Documents (CRADs) used for a May 2004 assessment of the Management at the Office of River Protection K Basin Sludge Waste System.

  9. OFFICE OF THE VICE-PRESIDENT, LEGAL AFFAIRS Archives and Records Management Department

    E-Print Network [OSTI]

    Administrative Record A document that has been preserved because it facilitates the operations and management OFFICE OF THE VICE-PRESIDENT, LEGAL AFFAIRS Archives and Records Management Department personal knowledge of facts. Access control Restrictions on access to records which are exercised

  10. Oak Ridge Office Document Management Ststem(HummingbirdDM) PIA...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Safety Management Workshop Registration, PIA, Idaho National Laboratory Occupational Medicine - Assistant PIA, Idaho National Laboratory Manchester Software 1099 Reporting...

  11. Oak Ridge Office Document Management Ststem(HummingbirdDM) PIA...

    Energy Savers [EERE]

    Safety Management Workshop Registration, PIA, Idaho National Laboratory Occupational Medicine - Assistant PIA, Idaho National Laboratory Manchester Software 1099 Reporting PIA,...

  12. Commercialization and Project Management PIA, Golden Field Office...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Safety Management Workshop Registration, PIA, Idaho National Laboratory Occupational Medicine - Assistant PIA, Idaho National Laboratory Manchester Software 1099 Reporting...

  13. Commercialization and Project Management PIA, Golden Field Office...

    Energy Savers [EERE]

    Safety Management Workshop Registration, PIA, Idaho National Laboratory Occupational Medicine - Assistant PIA, Idaho National Laboratory Manchester Software 1099 Reporting PIA,...

  14. Office of Environmental Management FY 2011 Budget Request

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (BillionProvedTravelInformationCollection Request Title:of Energy Office ofOffice ofBuilding on

  15. Office of the Under Secretary for Management and Performance | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting inServices » NEPANewsOffice ofOffice ofOfficeof

  16. Establishing the Office of Environmental Management Quality Assurance...

    Office of Environmental Management (EM)

    Assurance, EM-64 Kriss Grisham, Standards and Quality Assurance, EM-64 Robert Goldsmith, Director, Operations Oversight, EM-62 Chuan-Fu Wu, Director, Safety Management, EM-61...


    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    .-In the attached memorandum, dated February 25, 20 II, I required Mr. Jonathan A. Dowell, the AE, to demonstrate the following within 120 days: * A project management...

  18. Los Alamos Site Office Nuclear Maintenance Management Program...

    Office of Environmental Management (EM)

    oversight program and activities. This self-assessment was led by the DOE LASO Facility OperationsSafety Engineering Team's (FOSET) Nuclear Facility Maintenance Manager and was...

  19. Office of Information and Business Management | Department of...

    Broader source: (indexed) [DOE]

    comprised of meaningful portfolio management support, enterprise compliance, and an agile information technology suite of tools. This includes the following: Conducting assessments...

  20. Office of Science's Management of Research Misconduct Allegations

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian EnergyOne-Year

  1. Manager's Signature Log Privacy Impact Assessment, Office of Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousandReport)Price (Dollars8-2011. Management's1-25-2013.Manager

  2. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe


    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  3. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  4. Twin Cities Campus Office of Classroom Management Academic Support Resources

    E-Print Network [OSTI]

    Ciocan-Fontanine, Ionut

    Technical Services Technology standards, planning, design, installation & maintenance Campus AV experts coordination, planning, and technology. Key areas include classroom space utilization, classroom standards physical standards, service levels, and room readiness FF&E standards and management Coordination

  5. Lawrence Livermore Site Office Manager Joins EM's Senior Leadership...

    Office of Environmental Management (EM)

    and business and contract management of a multi-program laboratory with an annual budget of approximately 1.6 billion. With 24 years of federal experience, Williams served...

  6. Bureau of Land Management - Washington Office Directories | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmentalBowerbank, Maine: EnergyEnergyOhio: EnergyNorthInformation Washington Office

  7. Data Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thIWalter H. Zinn, 1969CALCDOfficeU.S.DOE Office ofScienceData

  8. Office of Emergency Management Assessments | Department of Energy

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|in the subsurfaceSecurity Assessments is responsible

  9. Office of Personnel Management (OPM) Guidance on Diversity and Inclusion |

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|in the subsurfaceSecurity Assessments isTheOutreach

  10. Office of Project Management Oversight & Assessments | Department of Energy

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|in the subsurfaceSecurity Assessments

  11. 1989 OCRWM [Office of Civilian Radioactive Waste Management] Bulletin compilation and index

    SciTech Connect (OSTI)


    The OCRWM Bulletin is published by the Department of Energy, Office of Civilian Radioactive Waste Management to provide current information about the national program for managing spent fuel and high-level radioactive waste. This document is a compilation of issues from the 1989 calendar year. A table of contents and one index have been provided to assist in finding information contained in this year`s Bulletins. The pages have been numbered consecutively at the bottom for easy reference. 7 figs.

  12. Technology Available for Licensing Office of Technology Management-The Pennsylvania State Univ.

    E-Print Network [OSTI]

    Maroncelli, Mark

    Technology Available for Licensing Office of Technology Management-The Pennsylvania State Univ. 113 Technology Center, University Park, PA 16802 814.865.6277 phone; 814.865.3591 fax Contact: WilliamHGowen Sr.Technology-desulfurization technology is complicated and expensive to use and a variety of other desulfurization processes have been

  13. Automated External Defibrillator Program 10/04/13 Page 1 of 4 Office of Risk Management

    E-Print Network [OSTI]

    Moore, Paul A.

    Automated External Defibrillator Program 10/04/13 Page 1 of 4 Office of Risk Management Automated to the appropriate energy level and automatically deliver a shock or advise the operator to deliver the shock. AED storage cabinet for ease of access. It should be noted that some AED's may be moved temporarily to provide

  14. OFFICE,

    Office of Legacy Management (LM)

    OFFICE, . . . . . ..-... --.-... .-..I... ..-... bUmME. wArl&l ' rrsldu*. in the dw6lopmQt pmgrwh : Be ostiamts Uuat not man lf+ .b%'o,Qds. cik'e%ah of the...

  15. Chicago Office Manager's Signature Log Privacy Impact Assessment

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematics And StatisticsProgram ManagerCorridor6Yellowstone National Easier. | Department

  16. U.S. Department of Energy Office of Environmental Management

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsStateof Energy|Initiative (ARI) |Management Technology

  17. Office of Environmental Management: A Journey to Excellence

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996How to ApplytheExecutive71.1 OMB Field Element Line ManagementEFCOG1

  18. Office of Civilian Radioactive Waste Management-Quality Assurance

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergyA chart detailling the

  19. Office of Environmental Management (EM) Organization Chart | Department of

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergyA chart

  20. Office of Personnel Management The Guide to Processing Personnel Actions

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergyA chart BillingDepartment ofFORM

  1. Contract Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4 2budget/about/jobs/Contract Management Argonne

  2. Contract Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4 2budget/about/jobs/Contract Management

  3. Contract Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4 2budget/about/jobs/Contract ManagementContract

  4. Contract Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4 2budget/about/jobs/ContractContract Management

  5. Quality Management | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D-Nicholas Turro,ScienceProjects,Quality Management

  6. Office of Inspector General audit report on credit card usage at the Ohio Field Office and the Fernald and Miamisburg Environmental Management Projects

    SciTech Connect (OSTI)



    In 1994 the Department of Energy (Department) obtained the services of Rocky Mountain BankCard System, through the use of a General Services Administration contract, as a means for the Department and its contractors to make small purchases. The use of credit cards was expected to simplify small purchase procedures and improve cash management. The Ohio Field Office (Field Office) uses the credit card system and oversees usage by its area offices. Contractors under the Field Office also use the credit card system to make small purchases. The Office of Inspector General (OIG) has issued one audit report concerning the use of credit cards. In April 1996, the OIG issued Report WR-B-96-06, Audit of Bonneville Power Administration`s Management of Information Resources. The audit concluded that improvements could be made in implementing credit card and property procedures in Bonneville`s management of computer-related equipment. Specifically, many credit card purchases were made by employees whose authority to buy was not properly documented, and the purchasing files often lacked invoices that would show what was purchased. Additionally, some cardholders split purchases to avoid credit card limits. The objective of this audit was to determine whether the Field Office, Fernald and Miamisburg Environmental Management Projects, Fluor Daniel, and B and W were using credit cards for the appropriate purposes and within the limitations established by Federal and Departmental regulations.

  7. Office of River Protection Integrated Safety Management System Description

    SciTech Connect (OSTI)

    CLARK, D.L.


    Revision O was never issued. Finding safe and environmentally sound methods of storage and disposal of 54 million gallons of highly radioactive waste contained in 177 underground tanks is the largest challenge of Hanford cleanup. TWRS was established in 1991 and continues to integrate all aspects of the treatment and management of the high-level radioactive waste tanks. In fiscal Year 1997, program objectives were advanced in a number of areas. RL TWRS refocused the program toward retrieving, treating, and immobilizing the tank wastes, while maintaining safety as first priority. Moving from a mode of storing the wastes to getting the waste out of the tanks will provide the greatest cleanup return on the investment and eliminate costly mortgage continuance. There were a number of safety-related achievements in FY1997. The first high priority safety issue was resolved with the removal of 16 tanks from the ''Wyden Watch List''. The list, brought forward by Senator Ron Wyden of Oregon, identified various Hanford safety issues needing attention. One of these issues was ferrocyanide, a chemical present in 24 tanks. Although ferrocyanide can ignite at high temperature, analysis found that the chemical has decomposed into harmless compounds and is no longer a concern.


    SciTech Connect (OSTI)

    Bush, S.


    The Office of Waste Processing identifies and reduces engineering and technical risks and uncertainties of the waste processing programs and projects of the Department of Energy's Environmental Management (EM) mission through the timely development of solutions to technical issues. The risks, and actions taken to mitigate those risks, are determined through technology readiness assessments, program reviews, technology information exchanges, external technical reviews, technical assistance, and targeted technology development and deployment. The Office of Waste Processing works with other DOE Headquarters offices and project and field organizations to proactively evaluate technical needs, identify multi-site solutions, and improve the technology and engineering associated with project and contract management. Participants in this program are empowered with the authority, resources, and training to implement their defined priorities, roles, and responsibilities. The Office of Waste Processing Multi-Year Program Plan (MYPP) supports the goals and objectives of the U.S. Department of Energy (DOE) - Office of Environmental Management Engineering and Technology Roadmap by providing direction for technology enhancement, development, and demonstration that will lead to a reduction of technical risks and uncertainties in EM waste processing activities. The MYPP summarizes the program areas and the scope of activities within each program area proposed for the next five years to improve safety and reduce costs and environmental impacts associated with waste processing; authorized budget levels will impact how much of the scope of activities can be executed, on a year-to-year basis. Waste Processing Program activities within the Roadmap and the MYPP are described in these seven program areas: (1) Improved Waste Storage Technology; (2) Reliable and Efficient Waste Retrieval Technologies; (3) Enhanced Tank Closure Processes; (4) Next-Generation Pretreatment Solutions; (5) Enhanced Stabilization Technologies; (6) Spent Nuclear Fuel; and (7) Challenging Materials. This report provides updates on 35 technology development tasks conducted during calendar year 2008 in the Roadmap and MYPP program areas.

  9. Implementation Plan for the Office of Nuclear Energy Knowledge Management Program

    SciTech Connect (OSTI)

    Kimberlyn C. Mousseau


    The primary purpose of the Department of Energy (DOE), Office of Nuclear Energy (NE) Knowledge Management (KM) Program is to capture, share, disseminate, and ensure the ability to apply the knowledge created by the major nuclear energy Research and Development (R&D) programs. In support of the KM program, the Implementation Plan for the Office of NE KM Program outlines the knowledge management and distributed data environment that is required for its success. In addition to enumerating some strategic goals and objectives, this document characterizes the initial program and identifies computer-based areas of investment required for increased knowledge sharing and collaboration. It identifies and addresses investments already in existence and describes how these investments can be further enhanced and implemented to support a distributed KM program. The Idaho National Laboratory (INL) is leading the effort to identify and address these investments through the implementation of a distributed KM program that includes participants from ten of the major DOE national laboratories.

  10. OCRWM annual report to Congress FY 1999 [USDOE Office of Civilian Radioactive Waste Management

    SciTech Connect (OSTI)


    During Fiscal Year 1999, the Office of Civilian Radioactive Waste Management (OCRWM) continued to make significant progress in its characterization of the Yucca Mountain, Nevada, candidate geologic repository site. Although OCRWM's appropriation for Fiscal Year 1999 was lower than requested, the Program accomplished all three success measures in the Secretary's Fiscal Year 1999 Performance Agreement with the President and completed important work in many other areas. This Annual Report reviews this work and looks toward future activities.

  11. U.S. Department of Energy, Office of Legacy Management Program Update, April-June 2009

    SciTech Connect (OSTI)



    Welcome to the April-June 2009 issue of the U.S. Department of Energy (DOE) Office of Legacy Management (LM) Program Update. This publication is designed to provide a status of activities within LM. The Legacy Management goals are: (1) Protect human health and the environment through effective and efficient long-term surveillance and maintenance - This goal highlights DOE's responsibility to ensure long-term protection of people, the environment, and the integrity of engineered remedies and monitoring systems. (2) Preserve, protect, and make accessible legacy records and information - This goal recognizes LM's commitment to successfully manage records, information, and archives of legacy sites under its authority. (3) Support an effective and efficient work force structured to accomplish Departmental missions and assure continuity of contractor worker pension and medical benefits - This goal recognizes DOE's commitment to its contracted work force and the consistent management of pension and health benefits. As sites continue to close, DOE faces the challenges of managing pension plan and health benefits liability. (4) Manage legacy land and assets, emphasizing protective real and personal property reuse and disposition - This goal recognizes a DOE need for local collaborative management of legacy assets, including coordinating land use planning, personal property disposition to community reuse organizations, and protecting heritage resources (natural, cultural, and historical). (5) Improve program effectiveness through sound management - This goal recognizes that LM's goals cannot be attained efficiently unless the federal and contractor work force is motivated to meet requirements and work toward continuous performance improvement.

  12. Grants Management Office Guide: How Do I Find Grant Funding? GMO Guide: How Do I Find Grant Funding?

    E-Print Network [OSTI]

    New South Wales, University of

    Grants Management Office Guide: How Do I Find Grant Funding? 1 GMO Guide: How Do I Find Grant Office (GMO) updates the Current Funding Opportunities Page as soon as information on schemes opening) are a significant source of funding for Australian researchers. The GMO tracks key dates for ARC and NHMRC major

  13. Approved by Vice/Associate Deans for Academic Affairs, Vice Provost for Academic Affairs, and Risk Management Office, February 2014

    E-Print Network [OSTI]

    Soloveichik, David

    Approved by Vice/Associate Deans for Academic Affairs, Vice Provost for Academic Affairs, and Risk Management Office, February 2014 Liability insurance guidelines UCSF In general, all faculty who conduct

  14. Idaho National Laboratory Cultural Resource Management Office FY 2011 Activity Report

    SciTech Connect (OSTI)

    Julie Braun Williams; Brenda R. Pace; Hollie K. Gilbert; Christina L. Olson


    The Idaho National Laboratory (INL) Site is home to vast numbers and a wide variety of important cultural resources representing at least a 13,500 year span of human land use in the region. As a federal agency, the Department of Energy, Idaho Operations Office (DOE-ID) has legal responsibility for the management and protection of the resources and has contracted these responsibilities to Battelle Energy Alliance (BEA). The BEA professional staff is committed to maintaining a cultural resource management program that accepts the challenge of preserving INL cultural resources in a manner reflecting their importance in local, regional, and national history. This report is intended as a stand-alone document that summarizes activities performed by the INL Cultural Resource Management Office (CRMO) staff during fiscal year 2011. This work is diverse, far-reaching and though generally confined to INL cultural resource compliance, also includes a myriad of professional and voluntary community activities. This document is intended to be informative to both internal and external stakeholders, serve as a planning tool for future INL cultural resource management work, and meet an agreed upon legal requirement.

  15. Idaho National Laboratory Cultural Resource Management Office FY 2010 Activity Report

    SciTech Connect (OSTI)

    Hollie K. Gilbert; Clayton F. Marler; Christina L. Olson; Brenda R. Pace; Julie Braun Williams


    The Idaho National Laboratory (INL) Site is home to vast numbers and a wide variety of important cultural resources representing at least a 13,500 year span of human land use in the region. As a federal agency, the Department of Energy, Idaho Operations Office (DOE-ID) has legal responsibility for the management and protection of the resources and has contracted these responsibilities to Battelle Energy Alliance (BEA). The BEA professional staff is committed to maintaining a cultural resource management program that accepts the challenge of preserving INL cultural resources in a manner reflecting their importance in local, regional, and national history. This report summarizes activities performed by the INL Cultural Resource Management Office (CRMO) staff during fiscal year 2010. This work is diverse, far-reaching and though generally confined to INL cultural resource compliance, also includes a myriad of professional and voluntary community activities. This document is intended to be informative to both internal and external stakeholders and to serve as a planning tool for future INL cultural resource management work.

  16. Management & Officers 

    E-Print Network [OSTI]



    the information collected in the counts, all three of the detectors were calibrated according to the guidelines established in ANSI N 13.30 and NCRP Report 57, using guidance from NUREG 8.9. The primary results of this project were: 1) a knowledge of how...

  17. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  18. Project Execution Plan, Waste Management Division, Nevada Operations Office, U.S. Department of Energy, April 2000

    SciTech Connect (OSTI)

    DOE /NV


    This plan addresses project activities encompassed by the U.S. Department of Energy/Nevada Operations Office Waste Management Division and conforms to the requirements contained in the ''Life Cycle Asset Management,'' U.S. Department of Energy Order O430.1A; the Joint Program Office Policy on Project Management in Support of DOE Order O430.1, and the Project Execution and Engineering Management Planning Guide. The plan also reflects the milestone philosophies of the Federal Facility Agreement and Consent Order, as agreed to by the state of Nevada; and traditional project management philosophies such as the development of life cycle costs, schedules, and work scope; identification of roles and responsibilities; and baseline management and controls.

  19. President Office Vice President Office

    E-Print Network [OSTI]

    Wu, Yih-Min

    Affairs Division Computer Information Management Division Media Instruction and Production Center Division Campus Security Supplies Office Office of Research and Development Planning Section and Waste Control Division Radiation Protection Division Biological Pollution Control Division #12

  20. Audit Report on "The Office of Science's Management of Information Technology Resources"

    SciTech Connect (OSTI)



    The Department of Energy's Office of Science (Science) and its facility contractors are aggressive users of information technology (IT) to support fundamental research in areas such as energy, environmental remediation and computational sciences. Of its $4 billion Fiscal Year 2008 budget, Science spent about $287 million to manage its IT program. This included cyber security activities, acquisition of hardware and software, and support service costs used to maintain the operating environments necessary to support the missions of the program. Prior Office of Inspector General reports have identified various issues with Science's management of its IT programs and resources. For instance, our report on Facility Contractor Acquisition and Management of Information Technology Hardware (DOE/IG-0768, June 2007) noted that the Science sites reviewed spent more than necessary when acquiring IT hardware. In another example, our review of The Department's Efforts to Implement Common Information Technology Services at Headquarters (DOE/IG-0763, March 2007) disclosed that Science's reluctance to adopt the Department of Energy Common Operating Environment (DOE-COE) at Headquarters contributed to the Department's inability to fully realize potential cost savings through consolidation and economies of scale. In light of the magnitude of the Office of Science IT program and previously identified program weaknesses, we initiated this audit to determine whether Science adequately managed its IT resources. Science had taken a number of actions to improve its cyber security posture and align its program to Federal requirements. Yet, our review disclosed that it had not taken some basic steps to enhance security and reduce costs. In particular, we found that: (1) For their non-scientific computing environments, all seven of the field sites reviewed (two Federal, five contractor) had implemented security configurations that were less stringent than those included in the Federal Desktop Core Configuration. This configuration was designed by the National Institute of Standards and Technology and its use was mandated by the Office of Management and Budget; (2) Although we previously highlighted weaknesses and recommended corrective actions, Science still had not fully established or enforced IT hardware standards for acquiring hardware such as desktop and laptop computers or related peripherals, contributing to significant unnecessary expenditures; and (3) While we have noted in a series of past reports that significant savings could be realized from aggregating demand for IT services and products across the enterprise, Science had not implemented a common infrastructure for users at its Federal sites and continued to maintain an IT environment independent of the Department's Common IT Operating Environment. The weaknesses identified were attributable, at least in part, to a lack of adequate policies and procedures for ensuring effective cyber security and hardware acquisition practices. In addition, Science had not effectively monitored the performance of its field sites to ensure that previously reported internal control weaknesses were addressed and had not implemented an appropriate mechanism to track its IT-related costs. Without improvements, Science may be unable to realize the benefits of improved security over its information systems, reduce costs associated with hardware acquisition, and lower IT support costs through consolidation of services. In particular, we determined that Science could potentially realize savings of more than $3.3 million over the next three years by better controlling hardware costs and implementing standards for certain equipment. Furthermore, Science could continue to pay for duplicative IT support services and fail to take advantage of opportunities to lower costs and apply potential savings to mission-related work. During the course of our audit work, we learned from Science officials that they had initiated the process of revising the Program Cyber Security Plan to better clarify its policy for implementing

  1. US Office of Coastal Zone Management (OCZM) has approved an amendment to the Washington State Coastal Zone Management program

    SciTech Connect (OSTI)

    Not Available


    The US Office of Coastal Zone Management (OCZM) has approved an amendment to the Washington State Coastal Zone Management Program, which deletes the ''Evans Policy Statement'', on the grounds that it has no legally enforceable status under state or federal law on selection of an oil port site or the advisability of a pipeline hook-up. Existing state and federal regulations adequately protect the Puget Sound environment and delection of the statement from the program would have no significant impact on the environment. The deleted statement had held that Washington State supports the policy of a single, major oil transshipment port at, or west of, Port Angeles and that the subject port will provide a hook-up to supply existing refineries in Whatcom and Skagit Counties, Wash., with oil, thus precluding expansion of existing Puget Sound oil off-loading facilities. OCZM's action on this matter will have no effect on future government decisions on the proposed Northern Tier Pipeline Co. project or selection of an oil port. This rule is effective as of 12/31/79.

  2. Office of the Chief Information Officer Office...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of the Chief Information Officer Office of IT Planning, Architecture and E-government Records Management Division (IM-23) Employee Separation:...

  3. An Inventor's Guide:Technology Transfer at LSU Health Sciences Center -New Orleans Office of Technology Management

    E-Print Network [OSTI]

    1 An Inventor's Guide:Technology Transfer at LSU Health Sciences Center - New Orleans Office of Technology Management 433 Bolivar St., Suite 827 New Orleans, LA 70112 504-568-8303 #12;2 A MESSAGE FROM THE DIRECTOR The `An Inventor's Guide: Technology Transfer at LSU Health Sciences

  4. Redesignation Order No. 00-09.01-01 to the Manager of Department of Energy Idaho Operations Office

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    Redesignation of the Manager of the Idaho Operations Office as the representative to perform as the "authorized representative," as that term is used in the NRC regulations at 10 CFR 72.16(b), and as name holder of the NRC license under 10 CFR 72 for the Idaho Spent Fuel Facility Independent Spent Fuel Storage Installation.

  5. Ann Williamson, Deputy Director, Office of Environmental Assessment Mike Cox, Manager, Risk Assessment Unit, Office of Environmental Assessment

    E-Print Network [OSTI]

    Assessment Unit, Office of Environmental Assessment U.S. Environmental Protection Agency ­ Region 10 Greg to the Northwest Power and Conservation Council on June 11, 2008, to provide an update on EPA's national commitment Report for review. This letter will provide some compelling information from that working draft which we

  6. Responsible University Officer Chief Information Officer

    E-Print Network [OSTI]

    Whitton, Mary C.

    Responsible University Officer Chief Information Officer Responsible Office Information Technology at Chapel Hill that manages its own or subcontracts its information technology must: Establish and maintain Management Plan, contact the Information Security Office (ISO) at 919-445-9393 or Designate

  7. Proceedings of the US Department of Energy Office of Environmental Restoration and Waste Management

    SciTech Connect (OSTI)

    Not Available


    The fifth of a series of waste minimization (WMIN)/reduction workshops (Waste Reduction Workshop V) was held at the Little Tree Inn in Idaho Falls, Idaho, on July 24--26, 1990. The workshops are held under the auspices of the US Department of Energy's (DOE's) Office of Environmental Restoration and Waste Management (EM). The purpose of this workshop was to provide a forum for sharing site activities in WMIN/reduction planning. Topics covered were management commitment, organizational structure, goal setting, reporting requirements, data bases and tracking systems, pollution prevention, awareness and incentives, information exchange, process waste assessment (PWA) implementation, and recycling internal and external. The workshops assist DOE waste-generating sites in implementing WMIN/reduction programs, plans, and activities, thus providing for optimal waste reduction within the DOE complex. All wastes are considered within this discipline: liquid, solid, and airborne, within the categories of high-level waste (HLW), transuranic waste (TRU), low-level waste (LLW), hazardous waste, and mixed waste.

  8. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  9. The DOE Office of Environmental Management International Cooperative Program: Overview of Technical Tasks and Results

    SciTech Connect (OSTI)

    Marra, James C.; Fox, Kevin M.; Jannik, Gerald T.; Farfan, Eduardo B.; Kim, Dong-Sang; Vienna, John D.; Roach, Jay; Aloy, A. S.; Stefanovsky, S. V.; Lopukh, D. B.; Bondarkov, M. D.; Gerdes, Kurt D.; Han, Ana M.


    The DOE Office of Environmental Management (DOE-EM) Office of Engineering and Technology is responsible for implementing EM’s International Cooperative Program. Over the past 15 years, collaborative work has been conducted through this program with researchers in Russia, Ukraine, France, United Kingdom and Republic of Korea. Currently, work is being conducted with researchers in Russia and Ukraine. Efforts aimed at evaluating and advancing technologies to support U.S. high-level waste (HLW) vitrification initiatives are being conducted in collaboration with Russian researchers. Work at Khlopin Radium Institute (KRI) is targeted at improving the throughput of current vitrification processes by increasing melting rate. These efforts are specifically targeted at challenging waste types identified at the Savannah River Site (SRS) and Hanford Site. The objectives of current efforts at SIA Radon are to gain insight into vitrification process limits for the cold crucible induction melter (CCIM) technology. Previous demonstration testing has shown that the CCIM offers the potential for dramatic increases in waste loading and waste throughput. However, little information is known regarding operational limits that could affect long-term, efficient CCIM operations. Collaborative work with the Russian Electrotechnical University (ETU) “LETI” is aimed at advancing CCIM process monitoring, process control and design. The goal is to further mature the CCIM technology and to establish it as a viable HLW vitrification technology. The greater than two year effort conducted with the International Radioecology Laboratory in the Ukraine recently completed. The objectives of this study were: to assess the long-term impacts to the environment from radiation exposure in the Chernobyl Exclusion Zone (ChEZ); and to provide information on remediation guidelines and ecological risk assessment within radioactively contaminated territories around the Chernobyl Nuclear Power Plant (ChNPP) based on the results of long-term field monitoring, analytical measurements, and numerical modeling of soils and groundwater radioactive contamination.


    SciTech Connect (OSTI)

    Marra, J.; Fox, K.; Farfan, E.; Jannik, T.


    The DOE Office of Environmental Management (DOE-EM) Office of Engineering and Technology is responsible for implementing EM's International Cooperative Program. Over the past 15 years, collaborative work has been conducted through this program with researchers in Russia, Ukraine, France, United Kingdom and Republic of Korea. Currently, work is being conducted with researchers in Russia and Ukraine. Efforts aimed at evaluating and advancing technologies to support U.S. high-level waste (HLW) vitrification initiatives are being conducted in collaboration with Russian researchers. Work at Khlopin Radium Institute (KRI) is targeted at improving the throughput of current vitrification processes by increasing melting rate. These efforts are specifically targeted at challenging waste types identified at the Savannah River Site (SRS) and Hanford Site. The objectives of current efforts at SIA Radon are to gain insight into vitrification process limits for the cold crucible induction melter (CCIM) technology. Previous demonstration testing has shown that the CCIM offers the potential for dramatic increases in waste loading and waste throughput. However, little information is known regarding operational limits that could affect long-term, efficient CCIM operations. Collaborative work with the Russian Electrotechnical University (ETU) 'LETI' is aimed at advancing CCIM process monitoring, process control and design. The goal is to further mature the CCIM technology and to establish it as a viable HLW vitrification technology. The greater than two year effort conducted with the International Radioecology Laboratory in the Ukraine recently completed. The objectives of this study were: to assess the long-term impacts to the environment from radiation exposure in the Chernobyl Exclusion Zone (ChEZ); and to provide information on remediation guidelines and ecological risk assessment within radioactively contaminated territories around the Chernobyl Nuclear Power Plant (ChNPP) based on the results of long-term field monitoring, analytical measurements, and numerical modeling of soils and groundwater radioactive contamination.

  11. Assessment of thermal analysis software for the DOE Office of Civilian Radioactive Waste Management

    SciTech Connect (OSTI)

    Williams, P.T.; Graham, R.F.; Lagerberg, G.N.; Chung, T.C.


    This assessment uses several recent assessments and the more general code compilations that have been completed to produce a list of 116 codes that can be used for thermal analysis. This list is then compared with criteria prepared especially for the Department of Energy Office of Civilian Radioactive Waste Management (DOE/OCRWM). Based on these criteria, fifteen codes are narrowed to three primary codes and four secondary codes for use by the OCRWM thermal analyst. The analyst is cautioned that since no single code is sufficient for all applications, a code must be selected based upon the predominate heat transfer mode of the problem to be solved, but the codes suggested in this report have been used successfully for a range of OCRWM applications. The report concludes with a series of recommendations for additional work of which the major points include the following: The codes suggested by this report must be benchmarked with the existing US and international problems and validated when possible; An interactive code selection tool could be developed or, perhaps even more useful, a users group could be supported to ensure the proper selection of thermal codes and dissemination of information on the latest version; The status of the 116 codes identified by this report should be verified, and methods for maintaining the still active codes must be established; and special capabilities of each code in phase change, convection and radiation should be improved to better enable the thermal analyst to model OCRWM applications. 37 refs., 3 figs., 12 tabs.


    SciTech Connect (OSTI)

    Bush, S.


    The mission of the Department of Energy's (DOE's) Office of Environmental Management (EM) is to clean up the environmental legacy of nuclear weapons research and production during the Cold War. That mission includes cleaning up nuclear waste, contaminated groundwater and soil, nuclear materials, and contaminated facilities covering two million acres of land in thirty-five states. EM's principal program goals include timely completion of tank waste treatment facilities, reduction of the life-cycle costs and acceleration of the cleanup of the Cold War legacy, and reduction of the EM footprint. The mission of the EM Technology Innovation and Development program is to transform science and innovation into practical solutions to achieve the EM mission. During fiscal year 2010 (October 2009-September 2010), EM focused upon accelerating environmental cleanup by expeditiously filling identified gaps in available knowledge and technology in the EM program areas. This report describes some of the approaches and transformational technologies in tank waste processing, groundwater and soil remediation, nuclear materials disposition, and facility deactivation and decommissioning developed during fiscal year 2010 that will enable EM to meet its most pressing program goals.

  13. POLICY FOR THE MANAGEMENT OF HAZARDOUS MATERIALS Effective Date: February 15, 2010 Originating Office: Office of the

    E-Print Network [OSTI]

    Doedel, Eusebius

    POLICY FOR THE MANAGEMENT OF HAZARDOUS MATERIALS Effective Date: February 15, 2010 Originating, storage, removal or disposal of chemicals or other hazardous chemical products on University premises. For the purposes of this Policy, hazardous materials includes chemicals, biological, and radioactive materials

  14. POLICY FOR THE MANAGEMENT OF HAZARDOUS MATERIALS Effective Date: February 15, 2010 Originating Office: Office of the

    E-Print Network [OSTI]

    Doedel, Eusebius

    is responsible for the safe handling and disposal of hazardous waste (including transport as per TDG regulations. For the purposes of this Policy, hazardous materials includes chemicals, biological, and radioactive materials. Radiation Safety Policy (VPS-46) outlines the management of radioactive materials as required

  15. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  16. Program Management at the National Nuclear Security Administration Office of Defense Nuclear Security: A Review of Program Management Documents and Underlying Processes

    SciTech Connect (OSTI)

    Madden, Michael S.


    The scope of this paper is to review the National Nuclear Security Administration Office of Defense Nuclear Security (DNS) program management documents and to examine the underlying processes. The purpose is to identify recommendations for improvement and to influence the rewrite of the DNS Program Management Plan (PMP) and the documentation supporting it. As a part of this process, over 40 documents required by DNS or its stakeholders were reviewed. In addition, approximately 12 other documents produced outside of DNS and its stakeholders were reviewed in an effort to identify best practices. The complete list of documents reviewed is provided as an attachment to this paper.

  17. Dynaically Responsive IP Window Coatings

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pacific Northwest National Laboratory Dynamically Responsive IR Window Coatings 2014 Building Technologies Office Peer Review 2 Project Summary Timeline: Start date:...

  18. Vehicle Technologies Office Merit Review 2015: Power Electronics Thermal Management R&D

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation given by National Renewable Energy Laboratory at 2015 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about power...

  19. Vehicle Technologies Office Merit Review 2015: Unitary Thermal Energy Management for Propulsion Range Augmentation (UTEMPRA)

    Broader source: [DOE]

    Presentation given by Delphi Automotive Systems, LLC at 2015 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about Unitary...

  20. Vehicle Technologies Office Merit Review 2015: Electric Motor Thermal Management R&D

    Broader source: [DOE]

    Presentation given by National Renewable Energy Laboratory at 2015 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about electric...

  1. Vehicle Technologies Office Merit Review 2014: Trip Prediction and Route-Based Vehicle Energy Management

    Broader source: [DOE]

    Presentation given by Argonne National Laboratory at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about trip prediction...

  2. Office of Legacy Management Decision Tree for Solar Photovoltaic Projects - 13317

    SciTech Connect (OSTI)

    Elmer, John; Butherus, Michael; Barr, Deborah L.


    To support consideration of renewable energy power development as a land reuse option, the DOE Office of Legacy Management (LM) and the National Renewable Energy Laboratory (NREL) established a partnership to conduct an assessment of wind and solar renewable energy resources on LM lands. From a solar capacity perspective, the larger sites in the western United States present opportunities for constructing solar photovoltaic (PV) projects. A detailed analysis and preliminary plan was developed for three large sites in New Mexico, assessing the costs, the conceptual layout of a PV system, and the electric utility interconnection process. As a result of the study, a 1,214-hectare (3,000-acre) site near Grants, New Mexico, was chosen for further study. The state incentives, utility connection process, and transmission line capacity were key factors in assessing the feasibility of the project. LM's Durango, Colorado, Disposal Site was also chosen for consideration because the uranium mill tailings disposal cell is on a hillside facing south, transmission lines cross the property, and the community was very supportive of the project. LM worked with the regulators to demonstrate that the disposal cell's long-term performance would not be impacted by the installation of a PV solar system. A number of LM-unique issues were resolved in making the site available for a private party to lease a portion of the site for a solar PV project. A lease was awarded in September 2012. Using a solar decision tree that was developed and launched by the EPA and NREL, LM has modified and expanded the decision tree structure to address the unique aspects and challenges faced by LM on its multiple sites. The LM solar decision tree covers factors such as land ownership, usable acreage, financial viability of the project, stakeholder involvement, and transmission line capacity. As additional sites are transferred to LM in the future, the decision tree will assist in determining whether a solar PV project is feasible on the new sites. (authors)

  3. Sampling and Analysis Plan for U.S. Department of Energy Office of Legacy Management Sites

    SciTech Connect (OSTI)


    This plan incorporates U.S. Department of Energy (DOE) Office of Legacy Management (LM) standard operating procedures (SOPs) into environmental monitoring activities and will be implemented at all sites managed by LM. This document provides detailed procedures for the field sampling teams so that samples are collected in a consistent and technically defensible manner. Site-specific plans (e.g., long-term surveillance and maintenance plans, environmental monitoring plans) document background information and establish the basis for sampling and monitoring activities. Information will be included in site-specific tabbed sections to this plan, which identify sample locations, sample frequencies, types of samples, field measurements, and associated analytes for each site. Additionally, within each tabbed section, program directives will be included, when developed, to establish additional site-specific requirements to modify or clarify requirements in this plan as they apply to the corresponding site. A flowchart detailing project tasks required to accomplish routine sampling is displayed in Figure 1. LM environmental procedures are contained in the Environmental Procedures Catalog (LMS/PRO/S04325), which incorporates American Society for Testing and Materials (ASTM), DOE, and U.S. Environmental Protection Agency (EPA) guidance. Specific procedures used for groundwater and surface water monitoring are included in Appendix A. If other environmental media are monitored, SOPs used for air, soil/sediment, and biota monitoring can be found in the site-specific tabbed sections in Appendix D or in site-specific documents. The procedures in the Environmental Procedures Catalog are intended as general guidance and require additional detail from planning documents in order to be complete; the following sections fulfill that function and specify additional procedural requirements to form SOPs. Routine revision of this Sampling and Analysis Plan will be conducted annually at the beginning of each fiscal year when attachments in Appendix D, including program directives and sampling location/analytical tables, will be reviewed by project personnel and updated. The sampling location/analytical tables in Appendix D, however, may have interim updates according to project direction that are not reflected in this plan. Deviations from location/analytical tables in Appendix D prior to sampling will be documented in project correspondence (e.g., startup letters). If significant changes to other aspects of this plan are required before the annual update, then the plan will be revised as needed.

  4. IU China Office Manager IU International Consulting and ResearchChina, LLC

    E-Print Network [OSTI]

    Robeson, Scott M.

    o Ordering and maintaining office inventory of supplies. Write formal and informal correspondence but are not intended to be a total listing of responsibilities. Qualifications: 1. Baccalaureate degree required, and presentation (for example, Microsoft Office Word, Excel, Outlook, and PowerPoint applications) 4. A minimum

  5. DIVERSITY PROJECTS DEVELOPMENT FUND Sponsored by the Office of the Vice Chancellor for Human Resources Management

    E-Print Network [OSTI]

    Johnson Jr.,, Ray

    DIVERSITY PROJECTS DEVELOPMENT FUND Sponsored by the Office of the Vice Chancellor for Human The Diversity Projects Development Fund (DPDF) was established by the Office of the Vice Chancellor for Human provides administrative oversight to the Diversity Projects Development Fund. Vice Chancellor Gloriana

  6. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)


    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  7. Office of Legacy Management (LM) Program Update, April¬タモJune 2009

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice ofOfficeA

  8. Science Highlights | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    Agency - Energy (ARPA-E) Office of Environmental Management (EM) Office of Energy Efficiency and Renewable Energy (EERE) Office of Fossil Energy (FE) Office of Nuclear Energy...

  9. Nevada Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Nevada Field Office Nevada Field Office FY15 Semi Annual Report FY14 Year End...

  10. Sandia Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Sandia Field Office Sandia Field Office FY15 Semi Annual Report FY14 Year End...

  11. Livermore Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Livermore Field Office Livermore Field Office FY15 Semi Annual Report FY14 Year...

  12. Pantex Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Pantex Field Office Pantex Field Office FY12 Semi Annual Report FY11 Year End...

  13. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  14. Vehicle Technologies Office Merit Review 2014: Look-Ahead Driver Feedback and Powertrain Management

    Broader source: [DOE]

    Presentation given by Eaton at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about look-ahead driver feedback and...

  15. Vehicle Technologies Office Merit Review 2015: Stand-Alone Battery Thermal Management System

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation given by DENSO International America at 2015 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about stand-alone...

  16. Vehicle Technologies Office Merit Review 2014: Stand-Alone Battery Thermal Management System

    Broader source: [DOE]

    Presentation given by DENSO International America, Inc. at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about stand-alone...

  17. Office of Legacy Management (LM) Program Update, April¬タモJune 2011

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice

  18. Office of Legacy Management (LM) Program Update, January¬タモMarch 2010

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0 - Visit

  19. Office of Legacy Management (LM) Program Update, July¬タモSeptember 2009

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0 -

  20. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  1. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  2. Office of Inspector General audit report on vehicle fleet management at the Idaho National Engineering and Environmental Laboratory

    SciTech Connect (OSTI)



    In a prior report, Audit of Light Vehicle Fleet Management at the Idaho National Engineering Laboratory, WR-B-93-7, September 29, 1993, the Office of Inspector General (OIG) concluded that vehicle fleet operations might be done more cost effectively by the General Services Administration (GSA) than by Idaho Operations Office (Idaho) and its contractor. The report also concluded that a significant number of vehicles were underused and the fleet was too large. Accordingly, the report contained recommendations that a cost comparison study be conducted to ascertain the most economical and efficient method of managing fleet operations and that vehicle usage data be reviewed periodically by the contractor, with prompt reassignment or disposal of significantly underused vehicles. Thus, the purpose of this audit was to determine if action has been taken to implement recommendations in the prior report. Specifically, the objectives of the current audit were to determine whether a cost comparison had been performed and whether the fleet was still too large. In this report, the authors recommend that Idaho annually review individual vehicle use against mileage standards and promptly dispose of or reassign vehicles not meeting the standards. The authors also recommend that the Idaho Deputy Manager be provided a vehicle assignment report for review and approval.

  3. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  4. Office of Inspector General audit report on aircraft and air service management programs

    SciTech Connect (OSTI)



    The Department of Energy`s (DOE) Albuquerque Operations Office (Albuquerque) owns seven aircraft that support defense programs, research and development efforts, emergency response programs, and official travel of Government and contractor employees. An Office of Inspector General (OIG) report, issued in 1994, identified concerns with Albuquerque`s cost for air service. Since that report, there have been reductions in cost and personnel indicating changes in air service requirements. This audit was conducted to determine (1) whether costs to operate Albuquerque`s aircraft were excessive and (2) if individual aircraft in the fleet were justified.

  5. Office of Legacy Management (LM) Program Update, January¬タモMarch 2011

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0 - Visit1

  6. Office of Legacy Management (LM) Program Update, July¬タモSeptember 2011

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0 -S e p t

  7. Office of Legacy Management FY 2014 Consolidated Energy Data Report (CEDR)

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0 -S e p

  8. Office of Legacy Management FY 2015 Consolidated Energy Data Report (CEDR)

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailableHighOffice of Indian Energy PolicyOffice0 -S e p|

  9. Engineering, analytical, and program management assistance to the US Department of Energy Boston Support Office. Final report

    SciTech Connect (OSTI)

    Jones, W.; Azad, B.; Poston, P.


    The scope of the monitoring effort included a total of 132 grants awarded to schools, hospitals, and other eligible institutions throughout the six New England States. The monitoring was conducted during a six-month period at the rate of approximately 22 grantees per month. Table 1 presents a summary of grantees assigned for monitoring for the period December 1981 - May 1982. The nature of the monitoring involved a significant level of communication and coordination with State Program Coordinators at the Boston Support Office and Program Managers at the State Energy Offices. The monitoring required the cooperation and active participation of the grantees' energy conservation grant project managers and building operators. The effort also required a high level of internal coordination due to the geographic dispersion of the grantees being monitored and the need to maintain regular communication with federal- and state-level officials during the course of the project. To address the requirements of all parties involved in the monitoring, it was necessary to organize and conduct the work in a systematic fashion. As a result, the approach to the monitoring program consisted of five distinct steps which were replicated on a monthly basis for each group of grants assigned for monitoring. These steps included: scheduling of site visits; review of working files prior to each visit; site visitation and meeting with grantee officials; notification of BSO regarding critical problems; and preparation of site visit and monthly reports.

  10. Office for Student Financial Affairs S107 Criser Hall Division Enrollment Management PO Box 114025

    E-Print Network [OSTI]

    Sin, Peter

    S107 Criser Hall Division Enrollment Management. · Student is now employed and has to reduce course load to accommodate employment

  11. Management and Operating (M&O) Contracts | U.S. DOE Office of...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Management and Operating (M&O) Contracts Integrated Support Center (ISC) ISC Home About Services Freedom of Information Act (FOIA) Privacy Act NEPA Documents Contact Information...

  12. Suggested Elements for a Data Management Plan | U.S. DOE Office...

    Office of Science (SC) Website

    Suggested Elements for a Data Management Plan Funding Opportunities Funding Opportunities Home Grants & Contracts Support Award Search Public Abstracts Find Funding Early Career...

  13. For IPS Office Use Only A / R: Eng Prof

    E-Print Network [OSTI]

    supporting documents have been received (for instance, transcripts and official test scores) 2. You have / Country: ______________________________ Postal Code: ____________________________________ Postal Code country code and city code in telephone) Fax number if dialed from the US

  14. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu


    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  15. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.


    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  16. Audit Report on Management Controls over the Use of Service Contracts at the Office of River Protection

    SciTech Connect (OSTI)



    The Department of Energy's (Department) Office of River Protection (ORP) is responsible for the storage, treatment, and disposal of over 53 million gallons of highly radioactive waste from over 40 years of plutonium production at the Hanford Site. Because of the diversity, complexity, and large scope of its mission, coupled with its small staff, ORP told us that it has found it necessary to engage in service contracts to obtain consulting services, technical expertise, and support staff. Federal policy generally permits contractors to perform a wide range of support service activities, including, in most situations, the drafting of Government documents subject to the review and approval of Federal employees. Federal policy issued by the Office of Management and Budget, however, prohibits contractors from drafting agency responses to Congressional inquiries and reports issued by the Office of Inspector General and Government Accountability Office (GAO) because they are so closely related to the public interest and provide the appearance of private influence. To provide a majority of its needed services, ORP issued a Blanket Purchase Agreement to Project Assistance Corporation (PAC) in 2003. Through the Blanket Purchase Agreement, ORP acquired services in the areas of project management, risk assessment, program assessment, quality assurance, safety, cost and schedule estimating, budgeting and finance, and engineering. PAC has, in turn, subcontracted with various other firms to obtain some of the services needed by ORP. From 2005 to 2008, the total annual cost for the contract with PAC had grown from $4.7 million to $9.2 million. Because of the extent of the services provided and growing costs of the contract, we conducted this review to determine whether ORP appropriately administered its contract with the Project Assistance Corporation. Our review disclosed that, in some instances, ORP had not appropriately administered all work performed under the PAC contract. Specifically, ORP allowed PAC employees to perform work that was inherently governmental and created situations where a potential conflict of interest occurred. Specifically: (1) ORP assigned PAC employees responsibility for providing information and responses to Congressional inquiries and reports issued by the GAO and the Department of Energy's Office of Inspector General (OIG); and (2) PAC employees were also allowed to perform functions that created potential conflicts of interest. ORP permitted PAC employees, for example, to develop statements of work and approve funding of work to be performed under PAC's own contract. We concluded that these problems occurred, at least in part, because ORP had not established controls necessary to effectively administer the PAC contract. Federal procurement regulations recommended that agencies provide additional management controls over contractors whose work has the potential to influence the action of government officials. ORP, however, had not implemented the controls specifically recommended in Federal policy guidance for administering contracts, including: (1) Performing conflict of interest reviews; and (2) Separating contractor and Department employees either physically or organizationally. By not effectively administering its contract with PAC, ORP increased the risk that decisions based on work performed by the contractor may not have been made in the best interests of the Department. For example, ORP increased the risk that approved work would be unnecessary or too costly. As we also recently noted in our report on 'Management Challenges at the Department of Energy' (DOE/IG-0808, December 2008), contract administration issues such as those discussed in this report remain a significant vulnerability. Continued efforts to improve this area are vitally important since the risk that contractors receive payments for unallowable costs could also increase as the Department expands its contracting activities under the American Recovery and Reinvestment Act. To its credit, however, ORP has recognized that there are weakn

  17. Office of Legacy Management (LM) Program Update, April¬タモJune 2012

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice of02 -

  18. Office of Legacy Management (LM) Program Update, January¬タモMarch 2012

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice of0212

  19. Office of Legacy Management (LM) Program Update, October¬タモDecember 2011

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice1 -0

  20. Office of Legacy Management (LM) Program Update: July¬タモSeptember 2012

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice1 -02

  1. Assistant Director (Commissioned Officer)

    E-Print Network [OSTI]

    Matrajt, Graciela

    Manager Maintenance Sup. II Bldg & Grounds Sup. B Program Ops Specialist Maintenance & Construction Coord. Coordinator Parking Enforcement Officer 2 - FTE Budget Analyst Cashier .5 FTE Parking Operations Officer 8

  2. ITDS tech contacts

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  3. 2014 Annual Workforce Analysis and Staffing Plan Report- Office of Environmental Management

    Broader source: [DOE]

    Managers perform an annual workforce analysis of their organization and develop staffing plans that identify technical capabilities and positions they need to ensure safe operation of defense nuclear facilities.

  4. 4. Wrzburger Workshop ,,IP Netzmanagement, IP Netzplanung und Optimierung"

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    Protocol (ICMP, ,,ping" and ,,traceroute" Funktionen) - Simple Network Management Protocol (SNMP) - DNSRessourcenmanagement Architektur R R R R R R S R R R S S QoS Architektur Harte und weiche QoS Garantien DiffServ Netz mit

  5. DOE - Office of Legacy Management -- Chicago North IL Site - IL 05

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *'AliquippaOfficeNorth IL

  6. DOE - Office of Legacy Management -- Chicago South IL Site - IL 06

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *'AliquippaOfficeNorth

  7. Office of Legacy Management (LM) Program Update, April¬タモJune 2010

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice of0 90

  8. Office of Legacy Management (LM) Program Update, October¬タモDecember 2009

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice1 -0 9

  9. Office of Legacy Management (LM) Program Update, October¬タモDecember 2010

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovemberDOE's PrioritiesOctoberResearch ProgramOffice1 -0 90

  10. Various Project Management Reports | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thIWalter H.4Office of

  11. The Office of Environmental Management Celebrates 20 years (1989-2009)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S.Week Day Year(activeInforumMILC TheThe New FaceOakThe Office


    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  13. Director, Information Technology Services Office

    Broader source: [DOE]

    The mission of the information Technologies Services Office is to provide effective corporate management leadership to proactively identify and manage business system efficiency improvements and to...

  14. Cybersecurity Management in the States: The Emerging Role of Chief Information Security Officers

    E-Print Network [OSTI]

    Goodyear, Marilu; Goerdel, Holly T.; Portillo, Shannon; Williams, Linda M.


    -Government and Cyber Security: The Role of Cyber Security Exercises. Proceedings of the 39th Hawaii International Conference on System Sciences. Kauai, Hawaii. January 4–7, 2006. IBM Center for The Business of Government8 CYBERSECURITY MANAGEMENT IN THE STATES...

  15. Chief Marketing Officer Health Promotion Specialist

    E-Print Network [OSTI]

    Dennett, Daniel

    · Chief Marketing Officer · Health Promotion Specialist · Director of Communications · Account/Manager · Communication Specialist · Marketing Director · Senior Account Manager · Project Manager · Research Assistant of Public Relations · International Marketing Manager · Product Manager · Clinical Trial Manager Genentech

  16. Office of Civilian Radioactive Waste Management fiscal year 1996 annual report to Congress

    SciTech Connect (OSTI)



    In Fiscal Year 1996 a revised program strategy was developed that reflects Administration policy and responds to sharply reduced funding and congressional guidance while maintaining progress toward long-term objectives. The program is on track, working toward an early, comprehensive assessment of the viability of the Yucca Mountain site; more closely determining what will be required to incorporate defense waste into the waste management system; pursuing a market-driven strategy for waste acceptance, storage, and transportation; and preserving the core capability to respond to an interim storage contingency. Overall, the elements of an integrated system for managing the Nation`s spent fuel and high-level radioactive waste are emerging, more soundly conceived, and more modestly designed, as the OCRWM works toward the physical reality of waste shipments to Federal facilities.

  17. USDOE Office of Civilian Radioactive Waste Management quarterly report on program cost and schedule

    SciTech Connect (OSTI)

    Not Available


    This report is intended to provide a summary of the cost and schedule performance for the Civilian Radioactive Waste Management Program. Historical and current cost profiles (extracted from final Financial Information System (FIS) reports) are presented for each of the major program elements. Also included in this report is the status of the Nuclear Waste Fund revenues and disbursements. This report includes data through September 1990.

  18. Management and Operating (M&O) Contracts | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousandReport)Price (Dollars perManagement Council

  19. Office of Chief Financial Officer

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    Page Change 1 to DOE O 520.1 modifies the responsibility statement to include NNSA Field CFO positions, modifies Heads of Field Elements responsibilities for consistency with the CFO responsibilities, and makes a minor change to reflect the establishment of the Office of Management, Budget and Evaluation. Cancels SEN 34-9.

  20. NA GC - Office of General Counsel | National Nuclear Security...

    National Nuclear Security Administration (NNSA)

    Blog Home About Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA GC - Office of General Counsel NA GC - Office of General Counsel...

  1. Savannah River Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Savannah River Field Office Savannah River Field Office FY15 Semi Annual Report...

  2. NA 1 - Immediate Office of the Administrator | National Nuclear...

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics NA 1 - Immediate Office of the Administrator NA 1 - Immediate Office of the...

  3. Kansas City Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Kansas City Field Office Kansas City Field Office FY15 Semi Annual Report FY14...

  4. Los Alamos Field Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Los Alamos Field Office Los Alamos Field Office FY15 Semi Annual Report FY14 Year...

  5. Independent Oversight Review of the NNSA Production Office Readiness...

    Energy Savers [EERE]

    Independent Oversight Review of the NNSA Production Office Readiness Review Program February 2014 Office of Safety and Emergency Management Evaluations Office of Enforcement and...

  6. Notice of Office of Management and Budget Action to Approve with Change the

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 News en INFOGRAPHIC:Pictured:Collection Request Title:

  7. Acquisition and Project Management Office volunteers get up-close look at

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the t-) S/,,5 'a C O09OurManagement | National

  8. Data Management Resources at the Office of Science User Facilities | U.S.

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4Contract Management Thomas JeffersonDOE

  9. Data Management Resources | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4Contract Management Thomas JeffersonDOEData

  10. Deputy Director for Resource Management Homepage | U.S. DOE Office of

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D- 6 0 4Contract Management ThomasDeputy(SC)

  11. Management & Operating (M&O) Contracts | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion toMSDS on theMaitrayeeEnergyMakingManagement


    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site


  13. Office of Enterprise Assessments Review of the Sandia National...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Sandia National LaboratoriesNew Mexico 2014 Site-Level Emergency Management Exercise April 2015 Office of Emergency Management Assessments Office of Environment, Safety and Health...

  14. Documenting cost and performance for environmental remediation projects: Department of Energy Office of Environmental Management

    SciTech Connect (OSTI)



    The purpose of this DOE guide is to facilitate the use of consistent procedures to document cost and performance information for projects involving the remediation of media contaminated with hazardous and radioactive wastes. It provides remedial action project managers with a standardized set of data to document completed remediation projects. Standardized reporting of data will broaden the utility of the information, increase confidence in the effectiveness of future remedial technologies, and enhance the organization, storage and retrieval of relevant information for future cleanup projects. The foundation for this guide was laid down by the Federal Remediation Technologies Roundtable (FRTR) in their publication, Guide to Documenting Cost and Performance for Remediation Projects, EPA-542-B- 95-002. Member agencies of the FRTR include the US EPA, the US DOD, the US DOE, and the US DOI. All the member agencies are involved in site remediation projects and anticipate following the guidance provided in the above reference. Therefore, there is much to be gained for DOE to be consistent with the other member agencies as it will be easier to compare projects across different agencies and also to learn from the experiences of a wider spectrum of prior completed projects.

  15. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  16. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  17. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao


    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  18. Emergency Management Concepts, Existing Guidance, and Changes

    Broader source: [DOE]

    Presenter: David Freshwater, Emergency Management Specialist, Office of Emergency Management, National Nuclear Security Administration

  19. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society


    E-Print Network [OSTI]

    Matrajt, Graciela

    security and privacy. Services are designed to help UW units understand risks by analyzing and forecasting Chief Information Security Officer In reflecting back on all our hard work during 2012, I would like of Contents Asset-Based Risk Management

  1. Vehicle Technologies Office Merit Review 2014: Integrated Vehicle Thermal Management – Combining Fluid Loops in Electric Drive Vehicles

    Office of Energy Efficiency and Renewable Energy (EERE)

    Presentation given by National Renewable Energy Laboratory at 2014 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Office Annual Merit Review and Peer Evaluation Meeting about...

  2. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh


    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.


    SciTech Connect (OSTI)

    Looney, B.; Denham, M.; Eddy-Dilek, C.


    The U.S. Department of Energy Office of Legacy Management (DOE-LM) manages the legacy contamination at the Riverton, WY, Processing Site – a former uranium milling site that operated from 1958 to 1963. The tailings and associated materials were removed in 1988-1989 and contaminants are currently flushing from the groundwater. DOE-LM commissioned an independent technical team to assess the status of the contaminant flushing, identify any issues or opportunities for DOE-LM, and provide key recommendations. The team applied a range of technical frameworks – spatial, temporal, hydrological and geochemical – in performing the evaluation. In each topic area, an in depth evaluation was performed using DOE-LM site data (e.g., chemical measurements in groundwater, surface water and soil, water levels, and historical records) along with information collected during the December 2013 site visit (e.g., plant type survey, geomorphology, and minerals that were observed, collected and evaluated). A few of the key findings include: ? Physical removal of the tailings and associated materials reduced contaminant discharges to groundwater and reduced contaminant concentrations in the near-field plume. ? In the mid-field and far-field areas, residual contaminants are present in the vadose zone as a result of a variety of factors (e.g., evaporation/evapotranspiration from the capillary fringe and water table, higher water levels during tailings disposal, and geochemical processes). ? Vadose zone contaminants are widely distributed above the plume and are expected to be present as solid phase minerals that can serve as “secondary sources” to the underlying groundwater. The mineral sample collected at the site is consistent with thermodynamic predictions. ? Water table fluctuations, irrigation, infiltration and flooding will episodically solubilize some of the vadose zone secondary source materials and release contaminants to the groundwater for continued down gradient migration – extending the overall timeframe for flushing. ? Vertical contaminant stratification in the vadose zone and surficial aquifer will vary from location to location. Soil and water sampling strategies and monitoring well construction details will influence characterization and monitoring data. ? Water flows from the Wind River, beneath the Riverton Processing Site and through the plume toward the Little Wind River. This base flow pattern is influenced by seasonal irrigation and other anthropogenic activities, and by natural perturbations (e.g., flooding). ? Erosion and reworking of the sediments adjacent to the Little Wind River results in high heterogeneity and complex flow and geochemistry. Water flowing into oxbow lakes (or through areas where oxbow lakes were present in the past) will be exposed to localized geochemical conditions that favor chemical reduction (i.e., “naturally reduced zones”) and other attenuation processes. This attenuation is not sufficient to fully stabilize the plume or to reduce contaminant concentrations in the groundwater to target levels. Consistent with these observations, the team recommended increased emphasis on collecting data in the zones where secondary source minerals are projected to accumulate (e.g., just above the water table) using low cost methods such as x-ray fluorescence. The team also suggested several low cost nontraditional sources of data that have the potential to provide supplemental data (e.g., multispectral satellite imagery) to inform and improve legacy management decisions. There are a range of strategies for management of the legacy contamination in the groundwater and vadose zone near the Riverton Processing Site. These range from the current strategy, natural flushing, to intrusive remedies such as plume scale excavation of the vadose zone and pump & treat. Each option relates to the site specific conditions, issues and opportunities in a unique way. Further, each option has advantages and disadvantages that need to be weighed. Scoping evaluation was performed for three major classes

  4. Manager, Oak Ridge Office

    Broader source: [DOE]

    A successful candidate in this position will provide overall executive leadership to and integration of the Oak Ridge Integrated Support Center, which houses mission critical activities and support...


    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700 GJO-2003-411-TAC GJO-PIN~$ ., .

  6. Office of Legacy Management

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the t-) S/,,5 'a C O M1 the RFSOGor _^29.1ed

  7. Finance and Enterprises Office February 2014

    E-Print Network [OSTI]

    Tam, Vincent W. L.

    Finance and Enterprises Office February 2014 Office Management Student matters Insurance HKU SPACE Planning & Management Associate Director of Finance ----------------------------------- Antony Hui Associate Director of Finance ----------------------------------- Edmund Li Assistant Director of Finance

  8. Office of Inspector General audit report on the U.S. Department of Energy`s management of Associated Western Universities grant programs

    SciTech Connect (OSTI)


    The Department of Energy (DOE), recognizing the need to maintain a strong science and engineering base at a time when enrollments in these disciplines were declining, implemented several educational programs. Among these were educational programs to provide faculty and students of US colleges and universities with energy-related training and research experience. Associated Western Universities (AWU), a nonprofit organization, administered post-secondary educational programs for DOE through grants and, occasionally, subcontracts. The objectives of the audit were to determine whether: (1) DOE was achieving its goal of enhancing US science and engineering education and (2) AWU was appropriately accumulating and classifying its costs. It was found that DOE was not fully achieving its objective of enhancing science and engineering education for students of US colleges and universities. In addition, it was found that AWU had not complied with cost principles for nonprofit organizations as required under the terms of the grants. Specifically, AWU misclassified a $13,000 overrun of direct program cost as indirect cost, incurred $40,000 of idle facility costs that were unallowable under the terms of the grant, misclassified indirect costs as direct costs, and claimed reimbursement for consultant costs that were inappropriate under the terms of the consulting contract. These discrepancies resulted in $53,000 of questionable costs, as well as costs having been charged to the Office of Energy Research (ER) grant that should have been charged to the Richland and Idaho grants. The authors recommended that the Managers of the Richland and Idaho Operations offices take actions to ensure that the objectives of DOE`s educational programs are met. In addition, they recommended that the Manager, Idaho Operations Office, direct the Contracting Officer to have AWU comply with the appropriate cost principles for nonprofit organizations.

  9. Grants Management Specialist

    Broader source: [DOE]

    The Office of Science manages fundamental research programs in basic energy sciences, biological and environmental sciences, and computational science. In addition, the Office of Science is the...

  10. Inspection of Environment, Safety, and Health Management at the Oak Ridge Operations Office and East Tennessee Technology Park- Volume I, May 2003

    Broader source: [DOE]

    The Secretary of Energy’s Office of Independent Oversight and Performance Assurance (OA) conducted an inspection of environment, safety, and health (ES&H) and emergency management programs at the U.S. Department of Energy (DOE) East Tennessee Technology Park (ETTP) site in April-May 2003. The inspection was performed as a joint effort by the OA Office of Environment, Safety and Health Evaluations and the Office of Emergency Management Oversight. This volume discusses the results of the review of the ETTP ES&H programs. The results of this OA inspection indicate that work remains to address a number of deficiencies in ISM processes and implementation of those processes. However, the results of this inspection also indicate that ETTP has made significant progress in the past three years in addressing systemic deficiencies. Section 2 of this volume provides an overall discussion of the results of the review of the ETTP ES&H programs, including positive aspects and weaknesses. Section 3 provides OA’s conclusions regarding the overall effectiveness of OR and ETTP management of the ES&H programs. Section 4 presents the ratings assigned during this review. Appendix A provides supplemental information, including team composition. Appendix B identifies the specific findings that require corrective action and follow-up. Appendix C presents the results of the review of selected guiding principles of ISM. Appendix D presents the results of the review of the OR and contractor feedback and continuous improvement processes. Appendices E and F provide the results of the review of the application of the core functions of ISM for the selected BJC and BNFL activities, respectively.

  11. Deployment summary: Fiscal years 1995-2000 [USDOE Office of International Programs

    SciTech Connect (OSTI)


    This publication summarizes the progress made by the Office of International Programs (IP) in deploying innovative technologies for the environmental remediation of the DOE complex and for sites of its international collaborators for fiscal years 1995 through 2000.

  12. Portsmouth Paducah Project Office

    Broader source: [DOE]

    The U.S. Department of Energy (DOE) established the Portsmouth/Paducah Project Office (PPPO) on October 1, 2003, to provide focused leadership to the Environmental Management missions at the...

  13. Using CORE Model-Based Systems Engineering Software to Support Program Management in the U.S. Department of Energy Office of the Biomass Project: Preprint

    SciTech Connect (OSTI)

    Riley, C.; Sandor, D.; Simpkins, P.


    This paper describes how a model-based systems engineering software, CORE, is helping the U. S. Department of Energy's Office of Biomass Program assist with bringing biomass-derived biofuels to the market. This software tool provides information to guide informed decision-making as biomass-to-biofuels systems are advanced from concept to commercial adoption. It facilitates management and communication of program status by automatically generating custom reports, Gantt charts, and tables using the widely available programs of Microsoft Word, Project and Excel.

  14. Badge Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Badge Office Badge Office The central point where badges are issued to employees and official visitors. Contact Badge Office (505) 667-6901 Email Badge Office location As the...

  15. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill


    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  16. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  17. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  18. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  19. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  20. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar} Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet


    E-Print Network [OSTI]

    Wirosoetisno, Djoko

    UNIVERSITY OF YORK COMMUNICATIONS OFFICE WEB OFFICE Web Strategy Date 4 February, 2003 Version 4, Press and PR Officer William Mackintosh, Web Manager #12;Web Strategy 4.4 ©University of York Page 2............................................................................................... 6 3.2 Objectives of the Web Strategy

  2. Richland Operations Office technology summary

    SciTech Connect (OSTI)

    Not Available


    This document has been prepared by the Department of Energy`s Environmental Management Office of Technology Development to highlight its research, development, demonstration, testing, and evaluation activities funded through the Richland Operations Office. Technologies and processes described have the potential to enhance cleanup and waste management efforts.

  3. Chief Financial Officer Responsibilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    The Order sets forth requirements for operating the Department of Energy in full compliance with the Chief Financial Officers Act of 1990 and sets standards for sound financial management policies and practices, effective internal controls, accurate and timely financial information, and well-qualified financial managers. Supersedes DOE O 520.1.

  4. Independent Activity Report, Office of River Protection Waste...

    Broader source: (indexed) [DOE]

    and Introduction of New Office of Safety and Emergency Management Evaluations Site Lead for the Office of River Protection Waste Treatment Plant and Tank Farms...

  5. Environmental restoration and waste management site specific plan for Oak Ridge Operation Office Paducah Gaseous Diffusion Plant

    SciTech Connect (OSTI)

    Not Available


    The Paducah Gaseous Diffusion Plant (PGDP) occupies 748 security-fenced acres located on a 3,400-acre tract in McCracken County, Kentucky, which was previously part of the Kentucky Ordnance Works. The principle objective on-site process at PGDP is the separation of uranium isotopes through gaseous diffusion. The process produces enriched uranium, which is used for nuclear fuel in commercial power plants and for military purposes. This document provides an overview of the major environmental and waste management concerns at PGDP, requirements for implementation, organization/management, corrective activities, environmental restoration, waste management options, compliance with National Environmental Policy Act (NEPA), reporting and data management, quality assurance and federal, state and local interactions. 12 refs., 6 figs., 5 tabs.

  6. Attitudes and Perceptions of Texas Public Safety Training Officers Regarding the Effectiveness of the National Incident Management System (NIMS). 

    E-Print Network [OSTI]

    Wilson, Jason


    training (interoperability), simplification of the management structure, and a mentoring program. This study should be explored further in an urban setting, based on this model. This study showed that respondents agreed that rural emergency responders tend...


    E-Print Network [OSTI]

    Walker, Lawrence R.



    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIALU.S.LeadershipLumileds R&D ImpactsMARVINServices6, 2010 MEMO

  9. Supply Management Specialist

    Broader source: [DOE]

    This position is located in the Logistics Management organization (NSL), Supply Chain Services (NS), Chief Administrative Office (N). NSL manages the warehousing of materials; the investment...

  10. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi


    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  11. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  12. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif


    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  13. Research and development of methods/utilities and rules for managing cooperation for performance improvement in government offices

    SciTech Connect (OSTI)

    Kurstedt, H.A.


    Purpose is to help managers approach their responsibilities proactively, so that they can anticipate problems and take actions to alleviate or eliminate those problems. Continuous performance improvement, the philosophy behind total quality management, requires working cooperatively to do a little better each day. The most effective tools are working through a closed set of 9 methods: setting expectations, charting, defining indicators and standards, collecting and logging data, converting data to information, organizing and presenting information, reviewing status and progress, self-management, and appraising. In addition, there are 8 rules: focus on what you can do, supply physical evidence of progress, pay attention to detail, inspect (don't expect), review progress routinely and frequently, face ''success/fail'' squarely, communicate crisply, and conduct honest, open appraisals. Scope and plans of the draft research plan (study areas) are described.

  14. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.


    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  15. QUARTERLY REPORT FORM Report Date: 24 May 2004 U. S. DOE Project Manager's Progress Report Office of Science

    E-Print Network [OSTI]

    Large Hadron Collider Program

    .00 Open Commitments 0 1 Percentage calculation: Remaining Contingency divided by Remaining Costs where of Science Project Number: n/a Title: U.S. LHC Accelerator Construction Project Program: High Energy Physics SUMMARY ASSESSMENT PROJECT MANAGEMENT Current Quarter Previous Quarter Cost: Minor Concern Minor Concern

  16. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  17. PERFORMANCE MANAGEMENT TIP SHEET Performance Management for New Employees

    E-Print Network [OSTI]

    PERFORMANCE MANAGEMENT TIP SHEET Performance Management for New Employees NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION UNITED STATES DEPARTMENT OF COMMERCE Workforce Management Office Ready to Perform Management at NOAA Performance Management is the process used to communicate expectations, evaluate employee

  18. The Department of Energy's Office of Environmental Management's Budget Allocation Plan, OAS-L-12-03

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsState of Pennsylvania OAS-RA-L-11-11 SeptemberManagementTheThe

  19. New Mexico State University Controller's Office

    E-Print Network [OSTI]

    Johnson, Eric E.

    New Mexico State University Controller's Office MOU Remote Document Submission - Version A CO according to New Mexico Administrative Codes (NMAC) and NMSU Records Management and Retention (NMSU RMR

  20. Alternate Watch Office | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    Alternate Watch Office | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the Stockpile Preventing Proliferation Powering the...

  1. Office of Nuclear Facility Safety Programs

    Broader source: [DOE]

    The Office of Nuclear Facility Safety Programs establishes nuclear safety requirements related to safety management programs that are essential to the safety of DOE nuclear facilities.

  2. CMTA Office

    High Performance Buildings Database

    Prospect, KY When CMTA outgrew their old office space, the consultant engineering company decided to construct a new building. Not only does the structure provide offices for the firm, it also showcases progressive design elements and allows the firm to test new technologies and demonstrate their effectiveness to clients. The new CMTA office building is located in a live-work development on the outskirts of Louisville, KY. The location was selected to place the office close to where the employees live.

  3. management

    National Nuclear Security Administration (NNSA)

    5%2A en Management and Budget

  4. Office of Headquarters Personnel Security Operations

    Broader source: [DOE]

    The Office of Headquarters Personnel Security manages and implements safeguards and security access authorization functions for DOE Headquarters and manages the Personal Identity Verification (PIV) process for Headquarters as mandated by Homeland Security Presidential Directive Number 12 (HSPD-12).

  5. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  6. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead


    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  8. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  9. Process for Transition of Uranium Mill Tailings Radiation Control Act Title II Disposal Sites to the U.S. Department of Energy Office of Legacy Management for Long-Term Surveillance and Maintenance

    SciTech Connect (OSTI)


    This document presents guidance for implementing the process that the U.S. Department of Energy (DOE) Office of Legacy Management (LM) will use for assuming perpetual responsibility for a closed uranium mill tailings site. The transition process specifically addresses sites regulated under Title II of the Uranium Mill Tailings Radiation Control Act (UMTRCA) but is applicable in principle to the transition of sites under other regulatory structures, such as the Formerly Utilized Sites Remedial Action Program.

  10. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  11. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  12. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia


    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  13. NOAA Office of Program Planning and Integration

    E-Print Network [OSTI]

    : · continuing to foster strategic management process among NOAA Line and Staff Offices, Goal Teams, Programs's Strategic Vision by Developing and evolving of NOAA's Strategic Plan Managing designated programs accordingNOAA Office of Program Planning and Integration STRATEGIC PLAN FY 2005 ­ FY 2010 U.S. Department

  14. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  15. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  16. Building Technologies Office Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Roland Risser Director, Building Technologies Office Building Technologies Office Energy Efficiency Starts Here. 2 Building Technologies Office Integrated Approach: Improving...

  17. Summary - Environmental Management Waste Management Facility...

    Office of Environmental Management (EM)

    Oak Ridge, TN EM Project: EM Waste Management Facility ETR Report Date: February 2008 ETR-11 United States Department of Energy Office of Environmental Management (DOE-EM) External...


    E-Print Network [OSTI]

    or even a change of ownership need not alter the course of management. Response to natural `events' can be accommodated, as can changes in resources available. What is a Management Plan? Essentially, a management planFORESTRY COMMISSION NATIONAL OFFICE FOR SCOTLAND GUIDANCE NOTE NO 12 MANAGEMENT PLANS FOR SEMI


    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996 EM Health and IntercomJanuary 30, 2004 EMEMSENMAX Energy Marketing Inc.

  20. Carlsbad Field Office Manager Selected

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B LReports from thecarbon captureCarbonCareersO ffice P.10,Field

  1. DOE - Office of Legacy Management

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and Myers Co -VANaval ,, *' ;x-L*QwnerWeldon Spring

  2. DOE - Office of Legacy Management --

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont, South Dakota,You are here Home » Sites

  3. DOE - Office of Legacy Management

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and700, 1. .&.ChupaderaDraft


    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolarNewsusceptometer under pressureNavyNumericalO K H AAnnual Report Form -


    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolarNewsusceptometer under pressureNavyNumericalO K H AAnnual Report Form


    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolarNewsusceptometer under pressureNavyNumericalO K H AAnnual Report


    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shinesSolarNewsusceptometer under pressureNavyNumericalO K H AAnnual ReportSF-428S

  8. Logistics Management Specialist

    Broader source: [DOE]

    The Deputy Assistant Secretary for the Office of Petroleum Reserves (OPR) manages the Strategic Petroleum Reserve (SPR) and is responsible for establishing policies, goals, and priorities for the...

  9. International Commitments Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    This Order establishes a process to manage the Department's International Commitments under the administrative direction of the Office of Policy and International Affairs. No cancellation.

  10. Sustainability Performance Office | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sustainability Performance Office Sustainability Performance Office Sustainability Performance Office Sustainability Performance Office Sustainability Performance Office...

  11. Continuous Energy Management of the HVAC&R System in an Office Building System Operation and Energy Consumption for the Eight Years after Building Completion 

    E-Print Network [OSTI]

    Akashi, Y.; Shinozaki, M.; Kusuda, R.; Ito, S.


    The authors continuously studied the energy consumption of a heating, ventilating, air- conditioning and refrigerating (HVAC&R) system in an office for the operation of the system in terms of its expected performance. A fault in the system control...

  12. Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physics Physical Society Prof. Cezar Bruma IPS_Join_to_2006


    E-Print Network [OSTI]

    de Lijser, Peter

    CALIFORNIA STATE UNIVERSITY, FULLERTON RISK MANAGEMENT ANNUAL REPORT November 2005 OFFICE OF UNIVERSITY RISK MANAGEMENT LH-806C 714-278-7346 #12;2004 ­ 2005 Risk Management Annual Report Page 2 I. Introduction The Office of University Risk Management provides resources, advice and training that allow

  14. Building Technologies Office Overview

    SciTech Connect (OSTI)


    Building Technologies Office Overview Presentation for the 2013 Building Technologies Office's Program Peer Review

  15. Risk Management, Mar 2012 Risk Management

    E-Print Network [OSTI]

    Risk Management, Mar 2012 Risk Management Conditions of Volunteer Service (Please send completed form to the Office of Risk Management) Fax: 541-346-7008 As a volunteer Tort Claims Act, ORS 30.260-300, and Oregon Department of Administrative Services Risk Management

  16. The Rockefeller University Office of Technology Transfer 502 Founders Hall

    E-Print Network [OSTI]

    The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New Sabharwal, Ph.D. Technology Manager Office of Technology Transfer (212) 327-7092 nsabharwal

  17. The Rockefeller University Office of Technology Transfer 502 Founders Hall

    E-Print Network [OSTI]

    The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New(19):4355-4364 Nidhi Sabharwal, Ph.D. Technology Manager Office of Technology Transfer (212) 327-7092 nsabharwal

  18. The Rockefeller University Office of Technology Transfer 502 Founders Hall

    E-Print Network [OSTI]

    The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New, Ph.D. Technology Manager Office of Technology Transfer (212) 327-7092 #12;

  19. High-Efficiency, Wideband Three-Phase Rectifiers and Adaptive Rectifier Management for Telecom Central Office and Large Data Center Applications

    SciTech Connect (OSTI)


    Fact sheet about high-efficiency, wideband, three-phase rectifiers and active rectifier management for ICT centers

  20. Office of Chief Financial Officer

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    This Order implements the provisions of the Chief Financial Officers Act of 1990 within the Department of Energy. Cancels SEN 34-91. Canceled by DOE O 520.1A.

  1. Federal Energy Management Trade Show | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Federal Energy Management Trade Show Federal Energy Management Trade Show Addthis 1 of 4 Timothy Unruh, Program Manager for the Office of Energy Efficiency and Renewable Energy...

  2. Fellows' Officers

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFES OctoberEvan Racah861May 2011AprilOfficers Fellows' Officers

  3. Jefferson Lab Project Management & Integrated Planning

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Project Manager (757) 269-7511, Program Development & Planning The Program Development function of Project Management Office serves three main purposes: 1. Monitor...

  4. EERE Program Management Quick Reference Guide

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Energy Efficiency and Renewable Energy (EERE) Program Management Reference Guide. It provides an overall description of the EERE program management structure, defines...

  5. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  6. DOE Recognizes EM Richland Operations Office Employees for Excellence...

    Office of Environmental Management (EM)

    and Mobile EM Office of River Protection (ORP) Manager Kevin Smith, right, discusses the Low-Activity Waste Facility design and construction with Waste Treatment and...


    E-Print Network [OSTI]

    AARH ARCH Facility Management FCMG COSC Global Art, Design, and Construction GADC ARCH Sustainable PETE PETE Radiological Health Engineering RHEN NUEN #12;DIVISION OF ACADEMIC AFFAIRS OFFICE

  8. Natjonal Nuclespr Security Adm/nistration PANTEX SITE OFFICE

    Broader source: (indexed) [DOE]

    Agreements and evaluates and verifies the effectiveness of the M&O Contractor's safety Software Quality Assurance (SQA). Pantex Site Office Contract Management Plan February 4,...

  9. National Nuclear Security Administration LOS ALAMOS SITE OFFICE

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Nuclear Security Administration LOS ALAMOS SITE OFFICE National Nuclear Security Administration CONTRACT MANAGEMENT PLAN For LOS ALAMOS NATIONAL LABORATORY CONTRACT NO....

  10. Office of River Protection's (ORP) Path to Reinvigorating Technology...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Development Presentation from the 2015 DOE National Cleanup Workshop by Kevin Smith, Manager, Office of River Protection. ORP's Path to Reinvigorating Technology...

  11. EERE Information Center Contact, PIA, The Office of Energy Efficiency...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Office of Energy Efficiency and Renewable Energy (EERE) Integrated Safety Management Workshop Registration, PIA, Idaho National Laboratory Occupational Medicine - Assistant...

  12. Letter: Transition of Closure Sites from the Office of Environmental...

    Office of Environmental Management (EM)

    Office of Environmental Management to other DOE Organizations From: Deputy Secretary of Energy, Kyle E. McSlarrow (DS-1) To: Todd Martin, Chair, Hanford Advisory Board This...

  13. Y-12 Site Office Recognized For Contributions To Combined Federal...

    National Nuclear Security Administration (NNSA)

    Site Office Recognized For Contributions To Combined Federal Campaign | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the...

  14. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC


    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  15. Responsible University Officer Chief Information Officer

    E-Print Network [OSTI]

    Whitton, Mary C.

    Responsible University Officer Chief Information Officer Responsible Office Information Technology Services Information Security Liaison Policy Policy Statement Given the risks associated with information and Department Heads be aware of information security issues and of their responsibilities for mitigating

  16. Deputy Assistant Secretary for Acquisition and Project Management

    Office of Environmental Management (EM)

    for the EM Complex. My office provides project management assistance, independent project oversight, and performance evaluation. My office is also responsible for effective...

  17. Business Manangement System(BMS), RL-2008/Project Hanford Management...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Business Manangement System(BMS), RL-2008Project Hanford Management Contract PHMC (Flour), Office of the Chief Information Officer Business Manangement System(BMS), RL-2008...

  18. NOAA Office of Education Promoting Environmental Literacy

    E-Print Network [OSTI]

    NOAA Office of Education Promoting Environmental Literacy Science On a Sphere, Orlando Science-cutting priority of promoting environmental literacy. The Office of Education directly implements and manages Center Photo: Orlando Science Center Education Strategic Plan, 2009-2029 Photo: NOAA EPP Ph.D graduate

  19. Back Cover Front Cover Office of Continuing

    E-Print Network [OSTI]

    Goodman, Robert M.

    Back Cover Front Cover Office of Continuing Professional Education 2012­2013 Professional Landscape of Golf Course Irrigation Systems (p. 13) · Basics of Turf Management (p. 21) · Turfgrass Establishment (p

  20. National Nuclear Secutffy Admlnlsbrrtlon NEVADA SITE OFFICE

    Energy Savers [EERE]

    Nuclear Secutffy Admlnlsbrrtlon NEVADA SITE OFFICE CONTRACT MANAGEMENT PLAN for CONTRACT NO. DE-AC52-06NA25946 with NATIONAL SECURITY TECHNOLOGIES, LLC Jose Stephen A. e l l ; l...

  1. Catalog of publications, Office of Science and Technology (Office of Water, Environmental Protection Agency), 1999 edition

    SciTech Connect (OSTI)


    This catalog focuses on the following: Introduction to the Office of Science and Technology (OST); Industrial Effluent Limitations and Guidelines (Listed alphabetically by Point Source); Water Quality Standards; Ambient Water Quality Criteria; Biological Quality Criteria; Nutrient Criteria; Equilibrium Partitioning Sediment Guidelines (Sediment Quality Criteria); Drinking Water Criteria; Drinking Water Health Advisories; Water Quality Modeling and Total Maximum Daily Loads Guidance; Analytical Laboratory Methods; Contaminated Sediments; Fish Tissue Quality; Municipal Sewage Sludge; Great Lakes Guidance; Beach Water Quality; Pollution Prevention-IP3 Reports; Videotapes; and Datafiles and Software.


    E-Print Network [OSTI]

    Pittendrigh, Barry

    OFFICE OF SUPPLIER DIVERSITY DEVELOPMENT STRATEGIC PLAN JESSE MOORE, MANAGER August, 2005 Mission Statement Provide leadership and develop relationships that will result in Purdue's campus' supplier base is a recognized national leader in developing a diverse supplier base. All staff involved with purchasing

  3. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman


    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  4. PPPL Project Management System Page 1 of 111 PPPL Project Management System Description Rev-01

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    : ___________________________________ Date: ________________ Tim Stevenson Head, Project Management Office Approved by................................................................................................. 18 2.2 STATUS AND EARNED VALUE CALCULATION............................................... 20 2

  5. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  6. Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  7. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  8. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  9. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  10. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso} Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  11. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}, Abstract--Failure recovery in IP networks is critical to high- quality service

  12. Inspection of Environment, Safety, and Health and Emergency Management at the Oak Ridge Operations Office and East Tennessee Technology Park, Summary Report, May 2003

    Office of Energy Efficiency and Renewable Energy (EERE)

    This report provides the results of an inspection of environment, safety, and health and emergency management programs at the U.S. Department of Energy's (DOE) East Tennessee Technology Park (ETTP).

  13. High Performance TCP/IP Concepts, Issues, and Solutions

    E-Print Network [OSTI]

    Jain, Raj

    President and Editorial Director, ECS: Marcia J. Horton Publisher: Alan R. Apt Associate Editor: Toni Dianne Manufacturing Manager: Trudy Pisciotti Manufacturing Buyer: Lynda Castillo Marketing Manager: Pamela Shaffer c

  14. Office of NEPA Policy and Compliance, Staff Directory

    Broader source: [DOE]

    Office of NEPA Policy and Compliance, Staff Directory including phone number and areas of responsibility for the  Energy and Waste Management Unit, Western Energy and Waste Management Unit, and the...

  15. The Rockefeller University Office of Technology Transfer 502 Founders Hall

    E-Print Network [OSTI]

    The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New Sabharwal, Ph.D. Technology Manager Office of Technology Transfer (212) 327-7092 #12;The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New


    E-Print Network [OSTI]

    Matrajt, Graciela

    OFFICE of the CHIEF INFORMATION SECURITY OFFICER 2013 Information Security and Privacy Annual conversation,The Office of the Chief Information Security Officer (CISO) invites readers to email by May 1st, 2014 with privacy-themed cap- tions for the cartoon on the right.Winning captions


    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  18. Page 1 of 2 Risk Management March 2012 Risk Management

    E-Print Network [OSTI]

    Page 1 of 2 Risk Management March 2012 Risk Management Supervisor's Vehicle Incident Report (Complete all sections of this form and return within 24 hours of incident to the Office of Risk Management Risk Management March 2012 Risk Management Unsafe Conditions or Actions (describe all contributing

  19. Research and development of methods/utilities and rules for managing cooperation for performance improvement in government offices. Second Technical progress report, September 1, 1992--January 31, 1993

    SciTech Connect (OSTI)

    Kurstedt, H.A.


    Purpose is to help managers approach their responsibilities proactively, so that they can anticipate problems and take actions to alleviate or eliminate those problems. Continuous performance improvement, the philosophy behind total quality management, requires working cooperatively to do a little better each day. The most effective tools are working through a closed set of 9 methods: setting expectations, charting, defining indicators and standards, collecting and logging data, converting data to information, organizing and presenting information, reviewing status and progress, self-management, and appraising. In addition, there are 8 rules: focus on what you can do, supply physical evidence of progress, pay attention to detail, inspect (don`t expect), review progress routinely and frequently, face ``success/fail`` squarely, communicate crisply, and conduct honest, open appraisals. Scope and plans of the draft research plan (study areas) are described.

  20. Director's Office

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB PacketDiesel pricesCenter at CornellDirector's Office Print

  1. Office Buildings

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements)Feet) Decade8 45YearYear

  2. Before the Senate Homeland Security and Governmental Affairs Subcommittee on Oversight of Government Management, the Workforce, and the District of Columbia

    Broader source: [DOE]

    Subject: Strengthening the Federal Acquisition Workforce: Government-wide Leadership and Initiatives By: John Bashista, Deputy Director, Office of Procurement and Assistance Management, Office of Management

  3. Fermi National Accelerator Laboratory / Kirk and Pine Street / P.O. Box 500 / Batavia, IL 60510 / 630.840.3000 / / Managed by Fermi Research Alliance, LLC for the U.S. Department of Energy Office of Science

    E-Print Network [OSTI]

    Quigg, Chris

    Fermi National Accelerator Laboratory / Kirk and Pine Street / P.O. Box 500 / Batavia, IL 60510 / 630.840.3000 / / Managed by Fermi Research Alliance, LLC for the U.S. Department of Energy Office of Science AFFIDAVIT I (employee), _________________________, certify that my

  4. Director of IT Services Project Office

    E-Print Network [OSTI]

    Birmingham, University of

    Who we are Quality Yvonne O'Byrne Facilities Management John Owen Networks John Turnbull Customer IT Support Nick Foley Heather Behan Network operations Cabling and wireless network Directory and authentication Voice & mobile services Project management services Project office Process analysis IT Service

  5. Thomas J. Schlagel Chief Information Officer, BNL

    E-Print Network [OSTI]

    Homes, Christopher C.

    of information technology and management activities · Held IT roles at Jupiter Media Metrix and NSLIJ from 2000 role of Chief Information Officer ­ senior manager accountable for cyber protections · Resident · Research Library · Business systems to support HR, Finance, Procurement, Facilities, ES&H · Centralized

  6. Office Of Worker Safety And Health Assistance

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Worker Safety and Health Assistance supports program and line organizations in the identification and resolution of worker safety and health issues and management concerns utilizing a corporate issues management process for crosscutting issues providing technical support for organizational specific issues and concerns.

  7. Final environmental assessment for off-site transportation of low-level waste from four California sites under the management of the U.S. Department of Energy Oakland Operations Office

    SciTech Connect (OSTI)



    The Department of Energy Oakland Operations Office (DOE/OAK) manages sites within California that generate Low Level Waste (LLW) in the course or routine site operations. It is the preference of the DOE to dispose of LLW at federally owned and DOE-operated disposal facilities; however, in some circumstances DOE Headquarters has determined that disposal at commercial facilities is appropriate, as long as the facility meets all regulatory requirements for the acceptance and disposal of LLW, including the passage of a DOE audit to determine the adequacy of the disposal site. The DOE would like to ship LLW from four DOE/OAK sites in California which generate LLW, to NRC-licensed commercial nuclear waste disposal facilities such as Envirocare in Clive, Utah and Chem Nuclear in Barnwell, South Carolina. Transportation impacts for shipment of LLW and MLLW from DOE Oakland sites to other DOE sites was included in the impacts identified in the Department`s Waste Management Programmatic Environmental Impact Statement (WM-PEIS), published in May, 1997, and determined to be low. The low impacts for shipment to commercial sites identified herein is consistent with the WM-PEIS results.

  8. Office of Communication - Speakers' Bureau

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Office of Communication Office of Communication home | Office of Communication staff | speakers' bureau | available materials | links | talk to Fermilab Speakers' Bureau The Office...

  9. United States General Accounting Office GAO High-Risk Series

    E-Print Network [OSTI]

    Ladkin, Peter B.

    Financial Management 62 GAO/HR-97-2 Quick Reference GuidePage 4 #12;Contents Asset Forfeiture Programs 67 of the Office of Management and Budget, and the heads of major departments and agencies. James F. Hinchman-2 Quick Reference GuidePage 3 #12;Contents Defense Financial Management 8 Defense Contract Management 12


    E-Print Network [OSTI]

    Winfree, Erik

    HAZARDOUS WASTE MANAGEMENT REFERENCE GUIDE Prepared by Environment, Health and Safety #12;Hazardous Waste Management Reference Guide Page 2 of 36 TABLE OF CONTENTS Satellite Accumulation Area 9 Waste Accumulation Facility 10 HAZARDOUS WASTE CONTAINER MANAGEMENT Labeling

  11. Financial Policy Manual RISK MANAGEMENT POLICIES

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    Financial Policy Manual Page 1 RISK MANAGEMENT POLICIES 2601 Departmental Scope & Responsibility;Financial Policy Manual Page 1 2601 DEPARTMENTAL SCOPE & RESPONSIBILITY Subject: Risk Management & Insurance Effective: December 1986 Revised: May 2011 Last Reviewed: March 2014 Resp. Office: Risk Management

  12. Finance & Administration Controller's Office

    E-Print Network [OSTI]

    Weston, Ken

    Finance & Administration Controller's Office April 2014 Michael Williams Controller Controller ICOFA 61318 Revised: 4/4/2014 #12;Finance & Administration Controller's Office Accounting & Asset Coordinator Property Surplus Sales 81269 Revised: 4/4/2014 #12;Finance & Administration Controller's Office

  13. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  14. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  15. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  16. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso} Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  17. NA IM- Associate Administrator for Information Management & Chief...

    National Nuclear Security Administration (NNSA)

    IM- Associate Administrator for Information Management & Chief Information Officer | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission...

  18. Chief Information Officer

    Broader source: [DOE]

    The Federal Energy Regulatory Commission is looking for an experienced senior level executive to serve as the Chief Information Officer (CIO). The Chief Information Officer (CIO) reports directly...

  19. Building Technologies Office Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Roland Risser Director, Building Technologies Office Building Technologies Office Overview Our Homes and Buildings Use 40% of Our Nation's Energy and 75% of Electricity Energy Use...

  20. Building Technologies Office Overview

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Technologies Office Roland Risser Director, Building Technologies Office National Energy Consumption 40% 60% Reducing consumption or improving performance calls for cutting-edge...

  1. Chicago Operations Office: Technology summary

    SciTech Connect (OSTI)

    Not Available


    This document has been prepared by the Department of Energy`s (DOE) Environmental Management (EM) Office of Technology Development (OTD) to highlight its research, development, demonstration, testing, and evaluation (RDDT and E) activities funded through the Chicago Operations Office. Technologies and processes described have the potential to enhance DOE`s cleanup and waste management efforts, as well as improve US Industry`s competitiveness in global environmental markets. The information has been assembled from recently produced OTD documents which highlight technology development activities within each of the OTD program elements. OTD technologies addresses three specific problem areas: (1) groundwater and soils cleanup; (2) waste retrieval and processing; and (3) pollution prevention. These problems are not unique to DOE, but are associated with other Federal agency and industry sites as well. Thus, technical solutions developed within OTD programs will benefit DOE, and should have direct applications in outside markets.

  2. Moisture Management of High-R Walls (Fact Sheet), Building America Case Study: Technology Solutions for New and Existing Homes, Building Technologies Office (BTO)

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy6-09.docAERMOD-PRIME, Units 4,ModernizingManagement of

  3. 2014 Awards for Project Management | Department of Energy

    Energy Savers [EERE]

    4 Awards for Project Management 2014 Awards for Project Management Federal Project Director of the Year for 2014: Pepin Carolan (Office of Science) Secretary's Award of Excellence:...

  4. 2012 Awards for Project Management | Department of Energy

    Energy Savers [EERE]

    2 Awards for Project Management 2012 Awards for Project Management Federal Project Director of the Year for 2012 Mr. Hannibal Joma The 2012 Secretary Achievement Award The Office...

  5. Carbon Foam Thermal Management Materials for Electronic Packaging...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Foam Thermal Management Materials for Electronic Packaging Carbon Foam Thermal Management Materials for Electronic Packaging Presentation from the U.S. DOE Office of Vehicle...

  6. Department of Energy to Compete Management and Operating Contracts...

    Energy Savers [EERE]

    Department of Energy to Compete Management and Operating Contracts for Three Office of Science Laboratories Department of Energy to Compete Management and Operating Contracts for...

  7. Administrative Management Staff (HC-1.5) | Department of Energy

    Office of Environmental Management (EM)

    Chief Human Capital Officer (HC-1) Administrative Management Staff (HC-1.5) Administrative Management Staff (HC-1.5) Mission Statement This organization is responsible for the...

  8. CRAD, Emergency Management Program - February 13, 2014 (HSS CRAD...

    Broader source: (indexed) [DOE]

    - January 3, 2013 CRAD, Emergency Management - Idaho Accelerated Retrieval Project Phase II CRAD, Emergency Management - Office of River Protection K Basin Sludge Waste System...

  9. Federal Energy and Water Management Award Winner 22nd Operations...

    Energy Savers [EERE]

    Federal Energy and Water Management Award Winner 22nd Operations Group Fuel Efficiency Office Federal Energy and Water Management Award Winner 22nd Operations Group Fuel Efficiency...

  10. risk management annual report

    E-Print Network [OSTI]

    Frantz, Kyle J.

    ____________________________________________________________________ 2 The ERM Process______________________________________________________________________ 28 The ERM Process in 2014 and Beyond and mitigating the risks that threaten its mission, the Office of Enterprise Risk Management (ERM) was tasked

  11. U.S. Department of Energy Office of Inspector General report on inspection of Westinghouse Savannah River Company fees for managing and operating the Savannah River Site

    SciTech Connect (OSTI)



    During the first five years of its contract with the Department of Energy, Westinghouse Savannah River Company was paid over $130 million in fees to manage and operate the Savannah River Site. Fees paid to Westinghouse steadily increased over the five year period. For example, fees paid for the last six months of this five year period were over three times as large as fees paid for the first six months. The purpose of this inspection was to review the Department`s annual negotiation of total available fees with Westinghouse, and to examine the reasons for the growth in fees over this five year period. The review disclosed that, after Fiscal Year 1989, the Department used an increasing number of fee bases in calculating Westinghouse Savannah River Company`s fixed-fee-equivalents from the maximum fee schedules within the Department of Energy Acquisition Regulation. The authors found that the Department had significantly increased the percentage of the dollar value of subcontracts being placed in Westinghouse`s fee bases for fee calculation purposes. They found that the Department had effectively increased Westinghouse`s fixed-fee-equivalents by approximately $3 million in both Fiscal Year 1993 and 1994 to, in large part, fund an unallowable employee incentive compensation program. They found that Westinghouse`s total paid fees for the five year period increased significantly over what they would have been had the terms resulting from the original competitive negotiations been maintained. The authors recommended that the Deputy Assist Secretary for Procurement and Assistance Management require that changes in either the number or composition of fee bases used in calculating fees from the maximum fee schedules be submitted to the Department`s Procurement Executive for approval.


    E-Print Network [OSTI]

    de Lijser, Peter

    CALIFORNIA STATE UNIVERSITY, FULLERTON RISK MANAGEMENT ANNUAL REPORT January 2008 OFFICE OF UNIVERSITY RISK MANAGEMENT CP-320 714-278-7346 #12;2006 ­ 2007 Risk Management Annual Report Page 2 I. Executive Summary A. Program Cost One method to assess the effectiveness of the University's risk management


    E-Print Network [OSTI]

    de Lijser, Peter

    CALIFORNIA STATE UNIVERSITY, FULLERTON RISK MANAGEMENT ANNUAL REPORT November 2006 OFFICE OF UNIVERSITY RISK MANAGEMENT LH-806C 714-278-7346 #12;2005 ­ 2006 Risk Management Annual Report Page 2 I. Executive Summary A. Program Cost One method to assess the effectiveness of the University's risk management

  14. Interdisciplinary (Nuclear Safety Oversight Program Manager) (General/Nuclear Engineer/Physical Scientist)

    Broader source: [DOE]

    The Office of Science manages fundamental research programs in basic energy sciences, biological and environmental sciences, and computational science. In addition, the Office of Science is the...

  15. Advanced Manufacturing Office News

    SciTech Connect (OSTI)


    News stories about advanced manufacturing, events, and office accomplishments. Subscribe to receive updates.

  16. Mid Career Training of Indian Forest Service Officers: International Training Program

    E-Print Network [OSTI]

    Phase III Mid Career Training of Indian Forest Service Officers: International Training Program and Training #12;Acknowledgments The Indian Forest Service Officer Training program coordinators at Colorado University Center for Protected Area Management and Training · Colorado State University Warner College

  17. Office of Chief Financial Officer

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing853926 NewsORMAT NEVADAEnergy


    E-Print Network [OSTI]

    's implementation of ACI with its strong support for the National Science Foundation (NSF) and the standards of the bill. #12;2 American Competitiveness Initiative (ACI) The Administration commends the Committee and research activities of the National Institute of Standards and Technology (NIST). However


    E-Print Network [OSTI]

    's implementation of ACI with its strong support for the National Science Foundation (NSF) and the standards of the bill. #12;American Competitiveness Initiative (ACI) The Administration commends the Committee and research activities of the National Institute of Standards and Technology. However, the Administration


    E-Print Network [OSTI]

    that will improve energy security by expanding the use of clean coal technology. In addition for carbon sequestration technologies, which are part of the President's Coal Research Initiative

  1. DOE - Office of Legacy Management -- American Railway Express Office - NY

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont, South Dakota,You are hereNY

  2. Voice over IP: Risks, Threats and Vulnerabilities Angelos D. Keromytis

    E-Print Network [OSTI]

    Keromytis, Angelos D.

    , as well as the potential for lower cost through equipment consolidation and, for the con- sumer market reinforced this trend. In this envi- ronment of constant innovation, individuals, governments un- derstanding and managing their risks. In this struggle, cost reductions, convenience and new

  3. The Office of Independent Enterprise Assessments' Office of Enforcemen...

    Office of Environmental Management (EM)

    The Office of Independent Enterprise Assessments' Office of Enforcement convened the 2014 DOE Safety and Security Enforcement Workshop May 13 and 14, 2014 The Office of Independent...

  4. Directory of Small Business Program Managers (SBPMs)

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Office of Small and Disadvantaged Business Utilization 1000 Independence Ave., SW Washington, DC 20585 DIRECTORY OF SMALL BUSINESS PROGRAM MANAGERS (SBPMs) Section I 2 CONTENTS...

  5. Environmental Management Science Education and Internship Program

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Environmental worker near water Oak Ridge Office of Environmental Management offers students and recent college graduates opportunities to learn about the mission of the DOE-EM...

  6. Content Management System Webforms

    Office of Energy Efficiency and Renewable Energy (EERE)

    For Office of Energy Efficiency and Renewable Energy (EERE) websites,'s content management system (CMS) has the ability to create webforms.

  7. Environmental Management Advisory Board - November 17, 2010,...

    Office of Environmental Management (EM)

    present: * Dr. Franklin Coffman, AECOM Government Services * Dr. David Gallay, Logistics Management Institute * Mr. Stan Genega, Consultant EMAB Designated Federal Officer:...

  8. Earned Value Management | Department of Energy

    Energy Savers [EERE]

    sponsored by the Office of Project Management Oversight and Assessments (PM), provides training in EVMS tropics. EVM Tutorials Module 1 - Introduction to Earned Value (pdf...

  9. PIA - Environmental Management Consolidated Business Center ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Test Reactor National Scientific User Facility Users Week 2009 LM Records Handling System (LMRHS01) - Rocky Flats Environmental Records Database, Office of Legacy Management...

  10. Supervisory Logistics Management Specialist | Department of Energy

    Office of Environmental Management (EM)

    serve as the Director for the Office of Operations and Readiness with responsibility for logistics management operations that involve planning, directing, implementing and...

  11. Building America Teams Technical Quality Management

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Building America Teams Technical Quality Management 2015 Building Technologies Office Peer Review Stacey Rothgeb, National Renewable Energy Laboratory...

  12. Information Collection Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]


    This Order sets forth DOE requirements and responsibilities for implementing the information collection management provisions of the Paperwork Reduction Act of 1995 and the Office of Management and Budgets implementing regulation Controlling Paperwork Burdens on the Public, as contained in 5 CFR 1320. No cancellation.

  13. COURSE OUTLINE Management 3313

    E-Print Network [OSTI]

    COURSE OUTLINE Management 3313 Developing Leadership Skills Online Syllabus Faculty: Andrew L Classroom): Administrative contact: CEPD Distance Learning Office, 108 Gundersen, cepd, the focus will be on self- management and interpersonal concepts as opposed to organizational leadership

  14. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.


    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  15. RMI 357e spring 2013 Risk Management

    E-Print Network [OSTI]

    Ghosh, Joydeep

    RMI 357e ­ spring 2013 1 Risk Management R M 357e Professor: Christopher McClellan Office: CBA 3 Syllabus ­ spring 2013 Textbook Risk Management for Enterprises and Individuals, v.1:// Risk Management: 357E. Risk Management - Upper-Division Course Principles of risk management


    E-Print Network [OSTI]

    Weaver, Harold A. "Hal"

    OFFICE DIRECTORY John Kunz, SPHR, HCS, Director of Human Resources · Manager and staff HR consultation · Employee Relations · JHU Child Safety compliance

  17. Office Buildings: Consumption Tables

    U.S. Energy Information Administration (EIA) Indexed Site

    and Type of Office Building Total (trillion Btu) per Building (million Btu) per Square Foot (thousand Btu) Dollars per Million Btu All Office Buildings 1,089 1,475 90.5 16.32...

  18. Finance & Administration Controller's Office

    E-Print Network [OSTI]

    McQuade, D. Tyler

    Finance & Administration Controller's Office July 2014 Michael Williams Controller Controller Administrative Services 51111 Catherine Hebert Program Director ICOFA 61318 Revised: 7/28/2014 #12;Finance Surplus Property 81269 Revised: 7/28/2014 #12;Finance & Administration Controller's Office Disbursement

  19. Office Buildings - Full Report

    Gasoline and Diesel Fuel Update (EIA)

    PDF Office Buildings Although no one building type dominates the commercial buildings sector, office buildings are the most common and account for more than 800,000 buildings or 17...

  20. Student Services Conference Office

    E-Print Network [OSTI]

    Sussex, University of

    Student Services Conference Office Guidelines VAT Exemption for Eligible Bodies #12;Student ........................................................................................................2 Applying the rules to Conferences is intended for use by the University of Sussex Conference Office to determine if an Organisation using

  1. Finance & Administration Controller's Office

    E-Print Network [OSTI]

    Finance & Administration Controller's Office July 2015 Michael Williams Assistant VP & Controller Thornton Exec. Support Assistant Administrative Services 57950 Cherrylyn Mills-Brown Office Administrator Administrative Services 51112 Judd Enfinger Associate Controller Accounting Services 60998 Sandra Scanlan

  2. NASA Earth Science Technology Office (ESTO) Decadal Survey Technology Investments

    E-Print Network [OSTI]

    Christian, Eric

    investments · Risks are retired before major dollars are invested: a cost-effective approach to technologyNASA Earth Science Technology Office (ESTO) Decadal Survey Technology Investments January 7, 2009 #12;Overview: Earth Science Technology Office Science Driven, Competed, Actively Managed

  3. READ AND SIGN THE PARTIAL ASSUMPTION OF RISK ON REVERSE Risk Management 12/2012 Risk Management

    E-Print Network [OSTI]

    Cina, Jeff

    READ AND SIGN THE PARTIAL ASSUMPTION OF RISK ON REVERSE Risk Management 12/2012 Risk Management Conditions of Volunteer Service Please send completed form to the Office of Risk Management: riskmanagement ___________________________________________ (name/title of department supervisor) and the Office of Risk Management, (541) 346-8316, within 24 hours

  4. When Good Ideas Take Flight: Carlsbad Field Office Shows Support...

    Office of Environmental Management (EM)

    DOE Carlsbad Field Office (CBFO) Manager Joe Franco, right, took to the skies in a New Mexico National Guard UH-60 Blackhawk helicopter flight in southeast New Mexico recently. An...

  5. The Rockefeller University Office of Technology Transfer 502 Founders Hall

    E-Print Network [OSTI]

    The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New­11067 Cherise T. Bernard, Ph.D. Assistant Technology Manager Technology Transfer (212) 327-8263 cbernard

  6. The Rockefeller University Office of Technology Transfer 502 Founders Hall

    E-Print Network [OSTI]

    The Rockefeller University Office of Technology Transfer 502 Founders Hall 1230 York Avenue New,049,814 · US Patent 8,553,143 Nidhi Sabharwal, Ph.D. Technology Manager Technology Transfer (212) 327

  7. Energy use in office buildings

    SciTech Connect (OSTI)



    This is the report on Task IB, Familiarization with Additional Data Collection Plans of Annual Survey of BOMA Member and Non-Member Buildings in 20 Cities, of the Energy Use in Office Buildings project. The purpose of the work was to monitor and understand the efforts of the Building Owners and Managers Association International (BOMA) in gathering an energy-use-oriented data base. In order to obtain an improved data base encompassing a broad spectrum of office space and with information suitable for energy analysis in greater detail than is currently available, BOMA undertook a major data-collection effort. Based on a consideration of geographic area, climate, population, and availability of data, BOMA selected twenty cities for data collection. BOMA listed all of the major office space - buildings in excess of 40,000 square feet - in each of the cities. Tax-assessment records, local maps, Chamber of Commerce data, recent industrial-development programs, results of related studies, and local-realtor input were used in an effort to assemble a comprehensive office-building inventory. In order to verify the accuracy and completeness of the building lists, BOMA assembled an Ad-Hoc Review Committee in each city to review the assembled inventory of space. A questionnaire on office-building energy use and building characteristics was developed. In each city BOMA assembled a data collection team operating under the supervision of its regional affiliate to gather the data. For each city a random sample of buildings was selected, and data were gathered. Responses for over 1000 buildings were obtained.


    E-Print Network [OSTI]

    Wiegner, Tracy N.


  9. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  10. 2011-2015 Human Capital Management Plan

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Office of Legacy Management (LM) needs skilled and engaged staff to accomplish our mission and carry out our responsibilities to the American people. This Human Capital Management Plan (HCMP or...

  11. Programs of the Governor's Energy Management Center 

    E-Print Network [OSTI]

    Verdict, M.


    The 70th Texas Legislature transferred the Energy Efficiency Division of the Public Utility Commission to the Governor's Office in September 1987 and directed the Governor's Energy Management Center (GEMC) to perform energy management services...

  12. Content Management System

    Broader source: [DOE] Content Management SystemEERE's websites are hosted in's Drupal content management system (CMS), which is maintained by the U.S. Department of Energy's Public Affairs Office.

  13. Environmental Management Performance Report July 2000

    SciTech Connect (OSTI)

    EDER, D.M.


    The purpose of this report is to provide the Department of Energy Richland Operations Office (DOE-RL) a monthly summary of the Project Hanford Management Contractor's (PHMC) Environmental Management (EM) performance by Fluor Hanford (FH) and its subcont.

  14. Environmental Management Performance Report 11/1999

    SciTech Connect (OSTI)

    EDER, D.M.


    The purpose of the Environmental Management Performance Report (EMPR) is to provide the Department of Energy Richland Operations Office's (DOE-RL's) report of Hanford's Environmental Management performance by: US Department of Energy, Richland Operation

  15. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  16. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)


    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  17. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  18. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  19. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  20. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  1. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  2. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  3. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  4. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  5. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  6. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  7. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg} R. Santos School of Telematics UCOL, Colima, Mexico M. Lopez-Guerrero Department of Electrical Engineering UAM

  8. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  9. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key


    E-Print Network [OSTI]

    de Lijser, Peter

    CALIFORNIA STATE UNIVERSITY, FULLERTON RISK MANAGEMENT 2003-04 ANNUAL REPORT OFFICE OF UNIVERSITY RISK MANAGEMENT #12;2 I. Introduction "Of course you have to go out on a limb sometimes, that's where the best outcome in a changing environment, is the essence of risk management.3 This Report was developed

  11. Lesson Learned by Environmental Management Complex-wide Activity-level Work Planning and Control

    Broader source: [DOE]

    Slide Presentation by Roger Claycomb, Work Control Program Manager, DOE Idaho Operations Office. Office of Environmental Management Work Planning and Control Oversight. Contractor Good Practices and DOE EM Good Practices.

  12. FY 1994 program summary: Office of Technology Development, Office of Research and Development, Office of Demonstration, Testing, and Evaluation

    SciTech Connect (OSTI)

    Not Available


    The US Department of Energy (DOE) Office of Environmental Management, formerly the Office of Environmental Restoration and Waste Management (EM), was established in November 1989 as the first step toward correcting contamination problems resulting from nearly 50 years of nuclear weapons production and fuel processing activities. EM consolidates several DOE organizations previously responsible for the handling, treatment, and disposition of radioactive and hazardous waste. Within EM, the Office of Technology Development (OTD/EM-50) is responsible for developing technologies to meet DOE`s goal for environmental restoration. OTD manages an aggressive national program of applied research, development, demonstration, testing, and evaluation (RDDT and E) for environmental cleanup, waste management, and related technologies. The program is designed to resolve major technical issues, to rapidly advanced beyond current technologies for environmental restoration and waste management operations, and to expedite compliance with applicable environmental laws and regulations. This report summarizes Fiscal Year 1994 (FY94) programmatic information, accomplishments, and planned activities relevant to the individual activities within OTD`s RDDT and E.

  13. U.S. Office of Personnel Management

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    as noted in Question 23 and 27, when a record on its face, or in conjunction with other records, indicates a violation or potential violation of law, whether civil, criminal, or...

  14. Office of Acquisition and Project Management

    Office of Environmental Management (EM)

    production and energy research generated millions of gallons of liquid radioactive waste, millions of cubic meters of solid radioactive wastes, thousands of tons of spent...

  15. Office of Legacy Management | Department of Energy

    Energy Savers [EERE]

    Abandoned Uranium Mines Abandoned Uranium Mines Read more Ambrosia Lake, New Mexico, Disposal Site Ambrosia Lake, New Mexico, Disposal Site Read more Durango, Colorado,...

  16. Office of Resource Management | Department of Energy

    Office of Environmental Management (EM)

    internal policies and procedures related to administrative, budgetfinancial, information technology, personnel, procurement, environment, health, safety, and security programs....

  17. U.S. Office of Personnel Management, ...

    Broader source: (indexed) [DOE]

    "endeavor to achieve a work force from all segments of society," while avoiding discrimination for or against any employee or applicant on the basis of race, color, religion,...

  18. DOE - Office of Legacy Management -- Massachusetts Institute...

    Office of Legacy Management (LM)

    Massachusetts Institute of Technology Hood Building - MA 01 FUSRAP Considered Sites Site: MASSACHUSETTS INSTITUTE OF TECHNOLOGY, HOOD BUILDING (MA.01 ) Eliminated from further...

  19. Records Inventory Department: Library Records Management Office

    E-Print Network [OSTI]

    Nicholson, Bruce J.

    Keep 20 years after material no longer being used or new form received Rm 5.084.File A, drawer 4 (electronic) Library Materials Control Records. 454 US Keep each record in database until it is no longer Exhibit Materials Library Materials - N/A (not a state record) AV Keep as long as valuable Rm 2

  20. Office of Wastewater Management catalog of publications

    SciTech Connect (OSTI)


    The contents include: Introduction; Categories of Documents (Biosolids; Construction Grants; Environmental Impact Statements; Federal Registers; Finance; Needs and Assessments; Operation and Maintenance; Permitting Issues; Pollution Prevention and Control; Pretreatment; Small Communities; Storm Water/Combined Sewer Overflows; Treatment; Water Conservation and Efficiency; Water Quality and Standards; and Miscellaneous); and Document Title Index.