National Library of Energy BETA

Sample records for ip number study

  1. WP-07 IP Studies & Documentation (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCaseStudies

  2. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  3. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  4. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Ĺ in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  5. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ˇ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  6. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  7. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  8. Brandeis University Environmental Studies current number of majors

    E-Print Network [OSTI]

    Hickey, Timothy J.

    and government agencies to tackle environmental health problems facing primarily low-income residents in areasBrandeis University Environmental Studies fast facts current number of majors and minors: 61 Number- engaged learning Popular second majors: American studies, biology, international and global studies

  9. Prediction of Thermoacoustic Instabilities: Numerical Study of Mach number Effects.

    E-Print Network [OSTI]

    Nicoud, Franck

    Prediction of Thermoacoustic Instabilities: Numerical Study of Mach number Effects. K. Wieczorek equations. I. Introduction In the calculation of thermoacoustic instabilities, an assumption lead to significant changes in the evaluation of the thermo-acoustic modes present in the combustion

  10. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  11. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  12. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  13. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  14. Impact Angle Control of Interplanetary Shock Geoeffectiveness: A Statistical Study

    E-Print Network [OSTI]

    Oliveira, D M

    2015-01-01

    We present a survey of interplanetary (IP) shocks using WIND and ACE satellite data from January 1995 to December 2013 to study how IP shock geoeffectiveness is controlled by IP shock impact angles. A shock list covering one and a half solar cycle is compiled. The yearly number of IP shocks is found to correlate well with the monthly sunspot number. We use data from SuperMAG, a large chain with more than 300 geomagnetic stations, to study geoeffectiveness triggered by IP shocks. The SuperMAG SML index, an enhanced version of the familiar AL index, is used in our statistical analysis. The jumps of the SML index triggered by IP shock impacts on the Earth's magnetosphere is investigated in terms of IP shock orientation and speed. We find that, in general, strong (high speed) and almost frontal (small impact angle) shocks are more geoeffective than inclined shocks with low speed. The strongest correlation (correlation coefficient R = 0.70) occurs for fixed IP shock speed and varying the IP shock impact angle. We ...

  15. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  16. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  17. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  18. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  19. http://journals.cambridge.org Downloaded: 29 Jan 2014 IP address: 128.174.229.211 In situ transmission electron microscopy studies enabled

    E-Print Network [OSTI]

    Allen, Leslie H.

    holder that allows the operation of a microelectromechanical system (MEMS) device inside a transmission approaches. Recent ad- vances in microelectromechanical system (MEMS) fab- rication allow for high transmission electron microscopy studies enabled by microelectromechanical system technology M. Zhang,a) E

  20. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  1. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  2. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  3. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  4. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  5. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  6. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  7. The Quarterly Publication of NCEER Volume 9, Number 3, July 1995 Crude Oil Transmission Study

    E-Print Network [OSTI]

    Nagarajaiah, Satish

    The Quarterly Publication of NCEER Volume 9, Number 3, July 1995 Crude Oil Transmission Study. The production and delivery of crude oil is critical to every major in- dustry and business sector in the United States. This nation's most crucial crude oil system traverses the midwest and is subject to seismic

  8. A Study of Entropy Sources in Cloud Random Number Generation on Cloud Hosts

    E-Print Network [OSTI]

    Chen, Yu

    A Study of Entropy Sources in Cloud Computers: Random Number Generation on Cloud Hosts Brendan Kerrigan and Yu Chen Dept. of Electrical and Computer Engineering, SUNY - Binghamton Abstract. Cloud security practices are based on assumptions that hold true for physical machines, but don't translate

  9. Particle-Number Projected Hartree-Fock-Bogoliubov Study with Effective Shell Model Interactions

    E-Print Network [OSTI]

    I. Maqbool; J. A. Sheikh; P. A. Ganai; P. Ring

    2010-11-22

    We perform particle-number projected mean-field study using the recently developed symmetry-projected Hartree-Fock-Bogoliubov (HFB) equations. Realistic calculations have been performed in sd- and fp-shell nuclei using the shell model empirical intearctions, USD and GXPFIA. It is demonstrated that the mean-field results for energy surfaces, obtained with these shell model interactions, are quite similar to those obtained using the density functional approaches. Further, it is shown that particle-number projected results, for neutron rich isotopes, can lead to different ground-state shapes in comparison to the bare HFB calculations.

  10. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  11. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ˇ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  12. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  13. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  14. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  15. Neutrino properties deduced from the study of lepton number violating processes at low and high energies

    SciTech Connect (OSTI)

    Stoica, Sabin [Horia Hulubei Foundation, P.O. Box MG-12, 077125 Magurele-Bucharest (Romania) and Horia Hulubei National Institute for Physics and Nuclear Engineering, P.O. Box MG-6, Magurele-Bucharest 077125 (Romania)

    2012-11-20

    There is nowadays a significant progress in understanding the neutrino properties. The results of the neutrino oscillation experiments have convincingly showed that neutrinos have mass and oscillate, in contradiction with the Standard Model (SM) assumptions, and these are the first evidences of beyond SM physics. However, fundamental properties of the neutrinos like their absolute mass, their character (are they Dirac or Majorana particles?), their mass hierarchy, the number of neutrino flavors, etc., still remain unknown. In this context there is an increased interest in the study of the lepton number violating (LNV) processes, since they could complete our understanding on the neutrino properties. Since recently, the neutrinoless double beta decay was considered the only process able to distinguish between Dirac or Majorana neutrinos and to give a hint on the absolute mass of the electron neutrino. At present, the increased luminosity of the LHC experiments makes feasible the search of LNV processes at high energy as well. In this lecture I will make a brief review on our present knowledge of the neutrino properties, on the present status of the double-beta decay studies and on the first attempts to search LNV processes at LHC.

  16. A Journal of Newar Studies - Number 4, NS 1121 / 2000-2001

    E-Print Network [OSTI]

    Shakya, Daya R; Manandhar, Gaurishankar

    2001-01-01

    , OR 97212, USA Ph. (503) 282-0447 Fax (503) 774-7554 E-mail: drasha@aol.com From South Asian Countries Siddhi R. Shakya P. a Box 571 Kathmandu, Nepal Ph: 977-1- 265348 AD 2000/01 ~@~~g~ (Newal) Vijiiana) The Journal Of Newar Studies ISSN 1536-866 1 Number -4... ' 59 Newah Organization of America (NOA) 60 News Report on Nepal Sambat 62 NepaIi flP1Ic:q))"l 65 'li'i'tlS«il ~~ ~ !f1qj

  17. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  18. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  19. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  20. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  1. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  2. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  3. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  4. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  5. Experimental study of Markstein number effects on laminar flamelet velocity in turbulent premixed flames

    SciTech Connect (OSTI)

    Weiss, M.; Zarzalis, N. [Division of Combustion Technology, Engler-Bunte-Institute, University of Karlsruhe (TH), Karlsruhe (Germany); Suntz, R. [Institute for Chemical Technology, University of Karlsruhe (TH), Karlsruhe (Germany)

    2008-09-15

    Effects of turbulent flame stretch on mean local laminar burning velocity of flamelets, u{sub n}, were investigated experimentally in an explosion vessel at normal temperature and pressure. In this context, the wrinkling, A{sub t}/A{sub l}, and the burning velocity, u{sub t}, of turbulent flames were measured simultaneously. With the flamelet assumption the mean local laminar burning velocity of flamelets, u{sub n}=u{sub t} x (A{sub t}/A{sub l}){sup -1}, was calculated for different turbulence intensities. The results were compared to the influence of stretch on spherically expanding laminar flames. For spherically expanding laminar flames the stretched laminar burning velocity, u{sub n}, varied linearly with the Karlovitz stretch factor, yielding Markstein numbers that depend on the mixture composition. Six different mixtures with positive and negative Markstein numbers were investigated. The measurements of the mean local laminar burning velocity of turbulent flamelets were used to derive an efficiency parameter, I, which reflects the impact of the Markstein number and turbulent flame stretch - expressed by the turbulent Karlovitz stretch factor - on the local laminar burning velocity of flamelets. The results showed that the efficiency is reduced with increasing turbulence intensity and the reduction can be correlated to unsteady effects. (author)

  6. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  7. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  8. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  9. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  10. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  11. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  12. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  13. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  14. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  15. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  16. Research Study - Global Enterprise VoIP Equipment Market Forecasts...

    Open Energy Info (EERE)

    we deeply analyzed the world's main region market conditions that including the product price, profit, capacity, production, capacity utilization, supply, demand and industry...

  17. Study of Genomic Copy Number Variation in Equine Health and Disease 

    E-Print Network [OSTI]

    Ghosh, Sharmila

    2014-07-30

    % involved 750 annotated genes with molecular functions predominantly in sensory perception, immunity, and reproduction. The findings were integrated with previous CNV studies in the horse to generate a composite genome-wide dataset of 1476 CNVRs. Of these...

  18. Scheme of the longline used in this study. Numbers show hook position. Ramon Munoz-Chapuli

    E-Print Network [OSTI]

    per basket) were 15m long. This stan- dard gear design is modified by ences by each species. Suzuki et Methods The longline gear employed in this study consisted of "baskets" be- tween floats (Fig. 1). Float al. (1977) state that the same fishing methods and longline gear are fre- quently used regardless

  19. MEngCEM Proposed Program of Study Form Name: Student Number

    E-Print Network [OSTI]

    Toronto, University of

    Buildings · CIV1164H - Bridge Engineering · CIV1167H - Advanced Structural Dynamics · CIV1169H - Advanced Topics in Building Design · APS1024H - Infrastructure Resilience Planning · APS1025H - Infrastructure · MIE1715H - Life Cycle Engineering · ECE1092H - Smart Grid Case Studies Operations Research · MIE1603H

  20. Accident/Incident Statistics 2010 Number of Work/Study-Related Injuries

    E-Print Network [OSTI]

    by Department LWD = Lost Workday(s) Cause of Work/Study-Related Injuries Figure 1 summarizes the causes for all injury cases, 4 of them were due to inadequate protection of eyes. Department No. of Accidents Total LWD=0 0LWD3 LWD>3 ACPF 1 1 BCB 3 3 CBME 1 1 CHEM 2 2 CLS 1 1 CSO 1 1 DMSF 1 1 FMO 11 1 2 8 LANG 1 1 LIB

  1. A Journal of Newar Studies - Number 2, NS 1119 / 1998-1999

    E-Print Network [OSTI]

    Shakya, Daya R; Manandhar, Gaurishankar

    1999-01-01

    to Newarliterature (Malla 1978:17-18). b) Literary Publications and Organizations The Newar people living in India for study or business purposes were also active in the sewice of their mother tongue. They staned establishing organizations and publications... was introduced which pushed Newar language further hack by forcing children to make a choice between language groups (icludig NL) or science and vocational subjects. Nevertheless, Newar intellectuals were trying to encoumge loyalty to their mother tongue...

  2. Evolutionary Genetic Studies of Mating Type and Silencing in Saccharomyces

    E-Print Network [OSTI]

    Zill, Oliver

    2010-01-01

    High-resolution studies on the architecture of silent chromatin in Saccharomyces using ChIP-Seq technology

  3. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  4. Laminar round jet diffusion flame buoyant instabilities: Study on the disappearance of varicose structures at ultra-low Froude number

    SciTech Connect (OSTI)

    Boulanger, Joan [Gas Turbine Laboratory, Institute for Aerospace Research, Ottawa, Ontario (Canada)

    2010-04-15

    At very low Froude number, buoyancy instabilities of round laminar jet diffusion flames disappear (except for small tip oscillations referred to as flickering) and those flames look stable and smooth. This study examines the contributions of the different phenomena in the flow dynamics that may explain this effect. It is observed that, at ultra-low Froude/Reynolds numbers, the material influenced by buoyancy is the plume of the flame and not the flame itself (reaction zone) that is short. Therefore, the vorticity creation zone does not profit from the reaction neighbourhood promoting a sharp gradient of density. Expansion and stretch are also important as they push vorticity creation terms more inside the flame and closer to the burner rim compared to moderate Froude flames. In these latter, the vorticity is continuously created around the flame reaction zone, along its developed height and closer to the vertical direction (in average). (author)

  5. A study of cytogenetic relationships between Paspalum species with base chromosome numbers of x=6 and 10 

    E-Print Network [OSTI]

    Wagner, Marcia Lynn

    1981-01-01

    study of the cytological relation- ship of a twelve chromosome sexual diploid and species with a base number of 10, which is typical of the genus. The objectives of this investigation were; (1) to P d t dP '1' tyt 'd tt 1 td~yl species; (2... in phylogenetic investi- gations because of the chromosomes that the biotypes have in common (18) . Burson and Bennett (18) began a phylogenetic investi- gation of selected species with the objectives to deter- 1t' PllP 'tll' th P~kg dt*dt mine...

  6. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  7. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  8. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  9. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  10. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  11. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  12. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  13. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  14. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  15. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  16. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  17. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  18. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  19. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  20. A study of the spray injection Reynolds number effects on gasoline yields of an FCC riser reactor

    SciTech Connect (OSTI)

    Bowman, B. J.; Zhou, C. Q.; Chang, S. L.; Lottes, S. A.

    2000-04-03

    A computational analysis of the combined effects of feed oil injection parameters in a commercial-scale fluidized catalytic cracking riser reactor was performed using a three-phase, multiple species kinetic cracking computer code. The analysis showed that the injection operating parameters (droplet diameter and injection velocity) had strong impacts on the gasoline yields of the FCC unit. A spray injection Reynolds number combining the two parameters was defined. A correlation between the spray injection Reynolds number and the gasoline product yields for various feed injection conditions was developed. A range of spray injection Reynolds number for the maximum gasoline yield was identified.

  1. Marine microbial intact polar diacylglycerolipids and their application in the study of nutrient stress and bacterial production

    E-Print Network [OSTI]

    Popendorf, Kimberly J. (Kimberly Julia)

    2013-01-01

    Intact polar diacylglycerolipids (IP-DAGs) were used to study microbial dynamics in the surface ocean. IP-DAGs from surface ocean seawater were quantified using high performance liquid chromatography-mass spectrometry ...

  2. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  3. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  4. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  5. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  6. Significant Nusselt number increase in microchannels with a segmented flow of two immiscible liquids: An experimental study

    E-Print Network [OSTI]

    Daraio, Chiara

    . For the segmented flow, up to four-fold increase of the Nusselt number was observed compared to pure water flow. Ó] achieved heat fluxes in excess of 10 kW/cm2 with flow boiling in small diameter tubes. However in microchannels as po- tential chemical reactors. Gunther et al. [6] reported the visualiza- tion

  7. Bayesian Inference of the Number of Factors in Gene-Expression Analysis: Application to Human Virus Challenge Studies

    E-Print Network [OSTI]

    Carin, Lawrence

    Bayesian Inference of the Number of Factors in Gene-Expression Analysis: Application to Human Virus. Ginsburg2 , Alfred Hero III3 , Joseph Lucas2 , David Dunson4 and Lawrence Carin1§ 1 Electrical and Computer University 3 Electrical & Computer Engineering Department, University of Michigan 4 Statistics Department

  8. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  9. For IPS Office Use Only A / R: Eng Prof

    E-Print Network [OSTI]

    supporting documents have been received (for instance, transcripts and official test scores) 2. You have / Country: ______________________________ Postal Code: ____________________________________ Postal Code country code and city code in telephone) Fax number if dialed from the US

  10. Change Number

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D BGene Network ShapingDate: M-16-04-04 Federal FacilityChange Number

  11. THE JOURNAL OF CHEMICAL PHYSICS VOLUME 59, NUMBER 8 15 OCTOBER 1973 Optical pumping of molecules II. Relaxation studies *

    E-Print Network [OSTI]

    Zare, Richard N.

    -up of excess population in the weakly absorbing sublevels. Be- cause of the multiplicity of radiative decay. These experiments may be roughly divided into two classes: (1) structural studies, in which radiofrequency

  12. Phospholipase C activity increases in cerebrospinal fluid from migraineurs in proportion to the number of comorbid conditions: a case--control study

    E-Print Network [OSTI]

    Fonteh, Alfred N; Pogoda, Janice M; Chung, Rainbow; Cowan, Robert P; Harrington, Michael G

    2013-01-01

    from migraineurs in proportion to the number of comorbidcontrols, increases in proportion to the number of migrainefrom migraineurs in proportion to the number of comorbid

  13. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  14. Weatherization Beyond the Numbers: Case Studies of Fifteen High-performing Weatherization Agencies - Conducted May 2011 through July 2012

    SciTech Connect (OSTI)

    Tonn, Bruce Edward; Rose, Erin M.; Hawkins, Beth A.

    2014-09-01

    The report presents fifteen individual case studies of high-performing and unique local weatherization agencies. This research was one component of the retrospective evaluation of the U.S. Department of Energy s Weatherization Assistance Program. The agencies were chosen to represent a range of contexts and approaches to weatherization. For example, the set of agencies includes a mix of urban and rural agencies, those that mainly use in-house crews to weatherize homes versus those that use contractor crews, and a mix of locations, from very cold climates to moderate to hot humid and dry climates. The case studies were mainly based on site visits to the agencies that encompassed interviews with program directors, weatherization crews, and recipients of weatherization. This information was supplemented by secondary materials. The cases document the diversity of contexts and challenges faced by the agencies and how they operate on a day-by-day basis. The cases also high common themes found throughout the agencies, such as their focus on mission and respect for their clients.

  15. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  16. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  17. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  18. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  19. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  20. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  1. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  2. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  3. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  4. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  5. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  6. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  7. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  8. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  9. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  10. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  11. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ˘ˇ¤Ł¦Ą¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  12. Universit degli Studi di Pisa Dipartimento di Informatica

    E-Print Network [OSTI]

    Ricci, Laura

    U Universitŕ degli Studi di Pisa Dipartimento di Informatica Gestione Indirizzi IP 1Laura Ricci Lezione n.2 LPR-Informatica Applicata Gestione indirizzi IP 20/2/2006 Laura Ricci Universitŕ degli Studi di Pisa Dipartimento di Informatica #12;U Universitŕ degli Studi di Pisa Dipartimento di Informatica

  13. Number of Work/Study-Related Injuries A total of 31 work/study related injury cases were recorded in 2008. Among the cases

    E-Print Network [OSTI]

    Accidents in 2008 by Department LWD = Lost Workday(s) Causes of Work/Study-Related Injuries Figure 1.1 16.2 2.5 7.5 16.6 4.1 7.9 17.2 4.8 6.4 Department No. of Accidents Total LWD=0 0LWDŁ3 LWD>3 BIOL 2 1

  14. Number of Work/Study-Related Injuries A total of 38 work/study-related injury cases were recorded in 2009. Among the cases

    E-Print Network [OSTI]

    by Department LWD = Lost Workday(s) Cause of Work/Study-Related Injuries Figure 1 summarizes the causes for all Per Accident 16.2 2.5 7.5 16.6 4.1 7.9 17.2 4.8 6.4 17.5 Department No. of Accidents Total LWD=0 0LWDŁ3 LWD>3 ACCT 1 1 BIOL 3 2 1 CSO 1 1 DBM 1 1 FMO 16 1 8 7 LANG 1 1 SAO 4 4 Total 27 4 9 14 #12

  15. Spectroscopic Studies of Photosynthetic Systems and Their Application in Photovoltaic Devices - Equipment Only: Cooperative Research and Development Final Report, CRADA Number CRD-06-175

    SciTech Connect (OSTI)

    Seibert, M.

    2014-09-01

    Spectral hole-burning (SHB) and single photosynthetic complex spectroscopy (SPCS) will be used to study the excitonic structure and excitation energy transfer (EET) processes of several photosynthetic protein complexes at low temperatures. The combination of SHB on bulk samples and SPCS is a powerful frequency domain approach for obtaining data that will address a number of issues that are key to understanding excitonic structure and energy transfer dynamics. The long-term goal is to reach a better understanding of the ultrafast solar energy driven primary events of photosynthesis as they occur in higher plants, cyanobacteria, purple bacteria, and green algae. A better understanding of the EET and charge separation (CS) processes taking place in photosynthetic complexes is of great interest, since photosynthetic complexes might offer attractive architectures for a future generation of circuitry in which proteins are crystallized.

  16. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  17. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  18. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  19. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  20. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  1. On Ramsey Numbers

    E-Print Network [OSTI]

    Dhananjay P. Mehendale

    2006-05-24

    In this paper we define new numbers called the Neo-Ramsay numbers. We show that these numbers are in fact equal to the Ramsay numbers. Neo-Ramsey numbers are easy to compute and for finding them it is not necessary to check all possible graphs but enough to check only special kind of graphs having a well-defined adjacency pattern.

  2. 1 -Routing Number 2 -Account Number

    E-Print Network [OSTI]

    Chen, Yiling

    you will need: · Your Harvard University Id Number (HUID) · Your HUID pin number · Your Checking/Savings on the right side of the screen under Payroll and Compensation. #12;*Please, in an effort to save paper and if you do not wish to receive a paper copy of the check. Click the small box above the SAVE button. CLICK

  3. Surveillance study of health effects associated with cleanup of a hazardous waste site, Ralph Gray Trucking Company (a/k/a Westminster Tract Number 2633), Westminster, Orange County, California, Region 9: CERCLIS number CAD981995947

    SciTech Connect (OSTI)

    Hoshiko, S.; Underwood, M.C.; Smith, D.; DeLorenze, G.; Neuhaus, J.

    1999-04-01

    Excavation of a Superfund site, the Ralph Gray Truncking Company located in Westminster Orange County, California was anticipated to release sulfur dioxide and other chemicals. The California Department of Health Services, under cooperative agreement with the Agency for Toxic Substances and Disease Registry, conducted a surveillance study to assess whether illnesses were associated with cleanup activities. A panel primarily composed of more sensitive persons (n = 36) was selected to report daily respiratory symptoms and odors. Exposures included sulfur dioxide (SO{sub 2}) measurements and daily tonnage of waste removed. Analysis used Conditional Likelihood Regression and Generalized Estimating Equations (GEE) methods. Levels of SO{sub 2} were generally higher than usual ambient air, at times exceeding levels which can cause health effects among asthmatics in laboratory settings. Wheeze and cough were significantly associated with tonnage of waste removed, especially on days when the highest amounts of waste were removed. Upper respiratory symptoms were found to be associated with SO{sub 2}, and weak relationships were found with nausea and burning nose and SO{sub 2}.

  4. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  5. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  6. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  7. PhD Awards for Improvement Science The Health Foundation has funded a number of PhD studentships through the PhD

    E-Print Network [OSTI]

    Haase, Markus

    1/1 PhD Awards for Improvement Science IPS 2013 The Health Foundation has funded a number of PhD studentships through the PhD Awards for Improvement Science. We will appoint two PhD students to undertake to building a scientific evidence base to facilitate improvements across healthcare. The PhD Awards

  8. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  9. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  10. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  11. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  12. Shannon Capacity Ramsey Numbers

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Shannon Capacity Ramsey Numbers Old links between Shannon and Ramsey New links between Shannon and Ramsey Bounds on Shannon Capacity and Ramsey Numbers from Product of Graphs Xiaodong Xu1 Stanislaw Institute of Technology, NY, USA March 2014 1/24 #12;Shannon Capacity Ramsey Numbers Old links between

  13. Faculty of Intercultural Studies Number of students who has finished (with a degree) and early leavers by AY (As of May 1, 2012)

    E-Print Network [OSTI]

    Banbara, Mutsunori

    % 7% 98% 0 0 0 0% 2 1 Intercultural Studies 140 152 152 80 59 10 149 53% 39% 7% 98% 2 0 0 1% 1 0 Total 140 152 152 80 59 10 149 53% 39% 7% 98% 2 0 0 1% 1 0 Intercultural Studies 140 145 145 82 52 134 57

  14. Number Theory Seminar

    E-Print Network [OSTI]

    $author.value

    2014-12-03

    Dec 3, 2014 ... TBA, Rachel Davis ... September 26, Rachel Davis .... Dessins d'Enfants · Indiana Pi Bill · Notes and Publications · Number Theory Seminar ...

  15. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  16. VOLUME 83, NUMBER 23 P H Y S I C A L R E V I E W L E T T E R S 6 DECEMBER 1999 Infrared Studies of the Onset of Conductivity in Ultrathin Pb Films

    E-Print Network [OSTI]

    Johnson, Peter D.

    VOLUME 83, NUMBER 23 P H Y S I C A L R E V I E W L E T T E R S 6 DECEMBER 1999 Infrared Studies of the Onset of Conductivity in Ultrathin Pb Films P. F. Henning,1,2 C. C. Homes,1 S. Maslov,1 G. L. Carr,1 D 1999) In this paper we report the first experimental measurement of the low-temperature, normal

  17. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  18. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  19. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  20. Big Numbers | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    with a length of 35 cm, which certainly helps . With Avogadro's number and the density of liquid hydrogen, we have about 1024 protons per cm2. We then take the beam of 160...

  1. KPA Activity Number

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    September 2002 Page 1 KPA Activity Number KPA Activity SEM Section SME Work Product SQSE Web Site http:cio.doe.govsqse REQUIREMENTS MANAGEMENT RM-1 The software engineering...

  2. Experimental determination of Ramsey numbers

    E-Print Network [OSTI]

    Zhengbing Bian; Fabian Chudak; William G. Macready; Lane Clark; Frank Gaitan

    2013-08-14

    Ramsey theory is a highly active research area in mathematics that studies the emergence of order in large disordered structures. Ramsey numbers mark the threshold at which order first appears and are extremely difficult to calculate due to their explosive rate of growth. Recently, an algorithm that can be implemented using adiabatic quantum evolution has been proposed that calculates the two-color Ramsey numbers $R(m,n)$. Here we present results of an experimental implementation of this algorithm and show that it correctly determines the Ramsey numbers R(3,3) and $R(m,2)$ for $4\\leq m\\leq 8$. The R(8,2) computation used 84 qubits of which 28 were computational qubits. This computation is the largest experimental implementation of a scientifically meaningful adiabatic evolution algorithm that has been done to date.

  3. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  4. Report number codes

    SciTech Connect (OSTI)

    Nelson, R.N.

    1985-05-01

    This publication lists all report number codes processed by the Office of Scientific and Technical Information. The report codes are substantially based on the American National Standards Institute, Standard Technical Report Number (STRN)-Format and Creation Z39.23-1983. The Standard Technical Report Number (STRN) provides one of the primary methods of identifying a specific technical report. The STRN consists of two parts: The report code and the sequential number. The report code identifies the issuing organization, a specific program, or a type of document. The sequential number, which is assigned in sequence by each report issuing entity, is not included in this publication. Part I of this compilation is alphabetized by report codes followed by issuing installations. Part II lists the issuing organization followed by the assigned report code(s). In both Parts I and II, the names of issuing organizations appear for the most part in the form used at the time the reports were issued. However, for some of the more prolific installations which have had name changes, all entries have been merged under the current name.

  5. UCGE Reports Number 20284

    E-Print Network [OSTI]

    Calgary, University of

    ABSTRACT Oil and gas are global fuels obtained primarily from drilling wells in underground terrestrial reservoirs. Vertical drilling is preferred because of its simplicity and therefore low cost, but subsurfaceUCGE Reports Number 20284 Department of Geomatics Engineering Continuous Measurement-While-Drilling

  6. Student Code Number: Thermodynamics

    E-Print Network [OSTI]

    Feeny, Brian

    Student Code Number: Thermodynamics Ph.D. Qualifying Exam Department of Mechanical Engineering;Thermodynamics Qualifier January 2013 Problem 1 Air is compressed in an axial-flow compressor operating at steady of exergy destruction within the compressor, in kJ per kg of air flowing. #12;Thermodynamics Qualifier

  7. UCGE Reports Number 20146

    E-Print Network [OSTI]

    Calgary, University of

    in considerable operational cost savings for many exploration and open-pit mining companies in the energy sectorUCGE Reports Number 20146 Department of Geomatics Engineering Development of a Mobile Equipment Equipment Management System solution. In the open-pit mining industries there is a need for these companies

  8. Australia NO REGISTRATION NUMBER

    E-Print Network [OSTI]

    Portugal Romania Slovenia Spain Turkey UK USA Australia Austria Belgium Cyprus France Germany Greece#12;#12;Australia Austria Belgium Cyprus France Germany Greece Ireland Italy Japan Macedonia Ireland Italy Japan Macedonia Portugal Romania Slovenia Spain Turkey UK USA #12;NO REGISTRATION NUMBER 1

  9. Results of Chemical Analyses for Alcove 8/Niche 3 Tracer Studies

    SciTech Connect (OSTI)

    Daniels, Jeanette

    2006-02-23

    This is the final report detailing the analyses performed under ORD-FY04-011 "Chemical Analyses for Alcove 8/Niche 3 Tracer Studies." The work was performed under the University and Community College System of Nevada (UCCSN) and the Department of Energy (DOE) Cooperative Agreement Number DE-FC28-04RW12232. This task provided method development and analytical support for the Alcove 8/Niche 3 Tracer Studies in the Exploratory Studies Facility (ESF). Concentrations of tracers, as well as major anions and cations, were reported for samples provided by Lawrence Berkeley National Laboratory (LBNL) and the US Geological Survey (USGS). Samples were analyzed using High Performance Liquid Chromatography (HPLC) and Ion Chromatography (IC). Samples were analyzed and controlled according to Implementing Procedures (IP's) written and approved in accordance with the Office of Civilian Radioactive Waste Management (OCRWM) approved Nevada System of Higher Education (NSHE) Quality Assurance Program.

  10. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  11. Quantum random number generator

    E-Print Network [OSTI]

    M. Stipcevic; B. Medved Rogina

    2007-01-01

    We report upon a novel principle for realization of a fast nondeterministic random number generator whose randomness relies on intrinsic randomness of the quantum physical processes of photonic emission in semiconductors and subsequent detection by the photoelectric effect. Timing information of detected photons is used to generate binary random digits-bits. The bit extraction method based on restartable clock theoretically eliminates both bias and autocorrelation while reaching efficiency of almost 0.5 bits per random event. A prototype has been built and statistically tested.

  12. Neither Name, Nor Number

    E-Print Network [OSTI]

    Federico Holik

    2011-12-20

    Since its origins, Quantum mechanics has presented problems with the concept of individuality. It is argued that quantum particles do not have individuality, and so, one can speak about "entities without identity". On the contrary, we claim that the problem of quantum non individuality goes deeper, and that one of its most important features is the fact that there are quantum systems for which particle number is not well defined. In this work, we continue this discussion in relation to the problem about the one and the many.

  13. UCGE Reports Number 20312

    E-Print Network [OSTI]

    Calgary, University of

    ), and the Churchill Northern Studies Centre. #12;v Dedication This thesis is dedicated to Dr. Reza Sedaghat............................................................................................................ iv Dedication

  14. Position Number: (Assigned when added to Library)

    E-Print Network [OSTI]

    California at Davis, University of

    Position Number: (Assigned when added to Library) 02016240 Dept: INST OF TRANSPORTATION STUDIES distributions to social media and trade media. 20% WEBSITE, SOCIAL MEDIA AND MEDIA MONITORING Monitor trends

  15. On Some Zarankiewicz Numbers and Bipartite Ramsey Numbers for

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    On Some Zarankiewicz Numbers and Bipartite Ramsey Numbers for Quadrilateral Janusz Dybizba Ramsey number b(n1, · · · , nk) is the least positive integer b such that any coloring of the edges of Kb Ramsey numbers avoiding quadrilateral. In particular, we prove that b4(2) = 19, and establish new general

  16. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  17. UCGE Reports Number 20290

    E-Print Network [OSTI]

    Calgary, University of

    twin-satellite mission to the study of Glacial Isostatic Adjustment (GIA) in North America. The GRACE, it is better to delay the onset of melting than to increase ice thickness when modifying global ice models

  18. Soils as a factor in Pinyon Pine mortality due to Ips Beetle infestation in Garden Park, Colorado: a case study.

    E-Print Network [OSTI]

    Krecic, Jeffrey

    2008-02-25

    Abstract: Observations by European settlers indicate that the distribution of pinyon - juniper woodlands has been expanding in the southwestern United States over the last two centuries. Beginning in the late 1990s, drought ...

  19. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  20. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  1. UCGE Reports Number 20205

    E-Print Network [OSTI]

    Calgary, University of

    Development of Mobile Asset Management Systems (URL: http of Mobile Asset Management Systems by Suen Man Lee A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES). A particular subset of LBS, Mobile Asset Management Systems (MAMS) has attracted the attention of industry

  2. UCGE Reports Number 20240

    E-Print Network [OSTI]

    Calgary, University of

    . Three localization approaches are implemented and compared using qualitative and quantitative methods Resolution Multi-Spectral Imagery by Qiaoping Zhang A THESIS SUBMITTED TO THE FACULTY OF GRADUATE STUDIES research and thesis preparation. I would like to thank my co-supervisor, Dr. Ayman Habib, for his valuable

  3. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  4. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  5. Dynamical real numbers and living systems

    E-Print Network [OSTI]

    Dhurjati Prasad Datta

    2010-01-11

    Recently uncovered second derivative discontinuous solutions of the simplest linear ordinary differential equation define not only an nonstandard extension of the framework of the ordinary calculus, but also provide a dynamical representation of the ordinary real number system. Every real number can be visualized as a living cell -like structure, endowed with a definite evolutionary arrow. We discuss the relevance of this extended calculus in the study of living systems. We also present an intelligent version of the Newton's first law of motion.

  6. The Distribution of Ramsey Numbers

    E-Print Network [OSTI]

    Lane Clark; Frank Gaitan

    2014-11-10

    We prove that the number of integers in the interval [0,x] that are non-trivial Ramsey numbers r(k,n) (3 <= k <= n) has order of magnitude (x ln x)**(1/2).

  7. Ordered Ramsey numbers David Conlon

    E-Print Network [OSTI]

    Fox, Jacob

    Ordered Ramsey numbers David Conlon Jacob Fox Choongbum Lee Benny Sudakov§ Abstract Given a labeled graph H with vertex set {1, 2, . . . , n}, the ordered Ramsey number r with vertices appearing in the same order as in H. The ordered Ramsey number of a labeled graph H is at least

  8. Hypergraph Ramsey numbers David Conlon

    E-Print Network [OSTI]

    Fox, Jacob

    Hypergraph Ramsey numbers David Conlon Jacob Fox Benny Sudakov Abstract The Ramsey number rk(s, n). In this paper we obtain new estimates for several basic hypergraph Ramsey problems. We give a new upper bound-color Ramsey number r3(n, n, n), which is the minimum N such that every 3-coloring of the triples

  9. Data Compression with Prime Numbers

    E-Print Network [OSTI]

    Gordon Chalmers

    2005-11-16

    A compression algorithm is presented that uses the set of prime numbers. Sequences of numbers are correlated with the prime numbers, and labeled with the integers. The algorithm can be iterated on data sets, generating factors of doubles on the compression.

  10. Compendium of Experimental Cetane Numbers

    SciTech Connect (OSTI)

    Yanowitz, J.; Ratcliff, M. A.; McCormick, R. L.; Taylor, J. D.; Murphy, M. J.

    2014-08-01

    This report is an updated version of the 2004 Compendium of Experimental Cetane Number Data and presents a compilation of measured cetane numbers for pure chemical compounds. It includes all available single compound cetane number data found in the scientific literature up until March 2014 as well as a number of unpublished values, most measured over the past decade at the National Renewable Energy Laboratory. This Compendium contains cetane values for 389 pure compounds, including 189 hydrocarbons and 201 oxygenates. More than 250 individual measurements are new to this version of the Compendium. For many compounds, numerous measurements are included, often collected by different researchers using different methods. Cetane number is a relative ranking of a fuel's autoignition characteristics for use in compression ignition engines; it is based on the amount of time between fuel injection and ignition, also known as ignition delay. The cetane number is typically measured either in a single-cylinder engine or a constant volume combustion chamber. Values in the previous Compendium derived from octane numbers have been removed, and replaced with a brief analysis of the correlation between cetane numbers and octane numbers. The discussion on the accuracy and precision of the most commonly used methods for measuring cetane has been expanded and the data has been annotated extensively to provide additional information that will help the reader judge the relative reliability of individual results.

  11. Number

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport for the Weldon Spring,7=cr5rnP 7694 i+lJNew York,' , /v-i 2

  12. Pipeline MT Instructions Identification Number

    E-Print Network [OSTI]

    Hong, Don

    Pipeline MT Instructions Identification Number For identification purposes, you will be assigned a special identification number. M# You can activate your MT email, login to PipelineMT to register for classes or pay tuition and fees. Activating the MTSU Email and PipelineMT accounts: Visit the website

  13. Constructive Lower Bounds on Classical Multicolor Ramsey Numbers

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Constructive Lower Bounds on Classical Multicolor Ramsey Numbers Xu Xiaodong and Xie Zheng studies lower bounds for classical multicolor Ramsey numbers, #12;rst by giving a short overview of past diagonal and o#11;-diagonal multicolor Ramsey numbers. In particular, we improve several lower bounds for R

  14. Shannon Capacity and Ramsey Numbers from Product of Graphs

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Bounds on Shannon Capacity and Ramsey Numbers from Product of Graphs Xiaodong Xu Guangxi Academy Abstract In this paper we study Shannon capacity of channels in the context of classical Ramsey numbers. We by Abbott and Song and thus establish new lower bounds for a special type of multicolor Ramsey numbers. We

  15. SPICE Simulation of a "Provably Secure" True Random Number Generator

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    SPICE Simulation of a "Provably Secure" True Random Number Generator Markus Dichtl, Bernd Meyer True Random Number Generator with Built-in Tolerance to Active Attacks", B. Sunar, W. Mar- tin, and D. Stinson propose a design for a true random number generator. Using SPICE simulation we study the behaviour

  16. Department.: Psychology Course Number: PSYC 296W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 296W Course Title: Senior Thesis in Psychology Credits: 3 Contact Person: John Rickards Catalog Copy: Senior Thesis in Psychology. Either semester. ThreeW is an Honors course taken by Psychology majors in their last semester of study; the purpose

  17. TEXAS MEMORIAL MUSEUM Speleological Monographs, Number 7

    E-Print Network [OSTI]

    Suarez, Andrew V.

    TEXAS MEMORIAL MUSEUM Speleological Monographs, Number 7 Studies on the CAVE AND ENDOGEAN FAUNA Science Research Laboratory Museum of Texas Tech University, 3301 4th Street Lubbock, Texas 79409 U.S.A. Email: james.cokendolpher@ttu.edu and James R. Reddell Texas Natural Science Center The University

  18. MARINE RESEARCH Volume 66, Number 1

    E-Print Network [OSTI]

    Journal of MARINE RESEARCH Volume 66, Number 1 Mean energy balance in the tropical Pacific Ocean requires energy input from the wind. Previous studies estimate that the mean rate of wind work (or wind global energy input into the ocean circulation, it is also critical in maintaining the east-west tilt

  19. Types of random numbers and Monte Carlo Methods Pseudorandom number generation

    E-Print Network [OSTI]

    Mascagni, Michael

    Types of random numbers and Monte Carlo Methods Pseudorandom number generation Quasirandom number generation Conclusions WE246: Random Number Generation A Practitioner's Overview Prof. Michael Mascagni #12;Types of random numbers and Monte Carlo Methods Pseudorandom number generation Quasirandom number

  20. Automatic Sets of Rational Numbers Eric Rowland

    E-Print Network [OSTI]

    Rowland, Eric

    Automatic Sets of Rational Numbers Eric Rowland Universit´e de Li`ege D´epartement de Math Abstract The notion of a k-automatic set of integers is well-studied. We develop a new notion -- the k-automatic recall a well-studied concept, that of k-automatic set (see, e.g., [8, 9, 2]): Definition 1. We say

  1. Automatic Sets of Rational Numbers Eric Rowland

    E-Print Network [OSTI]

    Rowland, Eric

    Automatic Sets of Rational Numbers Eric Rowland Universitâ??e de Liâ??ege Dâ??epartement de Math Abstract The notion of a k­automatic set of integers is well­studied. We develop a new notion --- the k­automatic, as follows: [L] k = {[w] k : w # L}. (2) We now recall a well­studied concept, that of k­automatic set (see

  2. ChIP-seq Accurately Predicts Tissue-Specific Activity of Enhancers

    SciTech Connect (OSTI)

    Visel, Axel; Blow, Matthew J.; Li, Zirong; Zhang, Tao; Akiyama, Jennifer A.; Holt, Amy; Plajzer-Frick, Ingrid; Shoukry, Malak; Wright, Crystal; Chen, Feng; Afzal, Veena; Ren, Bing; Rubin, Edward M.; Pennacchio, Len A.

    2009-02-01

    A major yet unresolved quest in decoding the human genome is the identification of the regulatory sequences that control the spatial and temporal expression of genes. Distant-acting transcriptional enhancers are particularly challenging to uncover since they are scattered amongst the vast non-coding portion of the genome. Evolutionary sequence constraint can facilitate the discovery of enhancers, but fails to predict when and where they are active in vivo. Here, we performed chromatin immunoprecipitation with the enhancer-associated protein p300, followed by massively-parallel sequencing, to map several thousand in vivo binding sites of p300 in mouse embryonic forebrain, midbrain, and limb tissue. We tested 86 of these sequences in a transgenic mouse assay, which in nearly all cases revealed reproducible enhancer activity in those tissues predicted by p300 binding. Our results indicate that in vivo mapping of p300 binding is a highly accurate means for identifying enhancers and their associated activities and suggest that such datasets will be useful to study the role of tissue-specific enhancers in human biology and disease on a genome-wide scale.

  3. Low-Resolution STELab IPS 3D Reconstructions of the Whole Heliosphere Interval and Comparison with in-Ecliptic Solar Wind Measurements from STEREO and Wind Instrumentation

    E-Print Network [OSTI]

    Bisi, M. M.; Jackson, B. V.; Buffington, A.; Clover, J. M.; Hick, P. P.; Tokumaru, M.

    2009-01-01

    structure of the fast solar wind. J. Geophys. Res. 112,observations of the solar wind. Proc. SPIE 6689, 668911-1.W.A. , Maagoe, S. : 1972, Solar wind velocity from ips

  4. Reprogramming peripheral blood mononuclear cells using an efficient feeder-free, non-integration method to generate iPS cells and the effect of immunophenotype and epigenetic state on HSPC fate 

    E-Print Network [OSTI]

    Liu, Jing

    2014-11-28

    Background and objectives In 2006 Shinya Yamanaka successfully reprogrammed mouse fibroblasts back to an embryonic stem cell-like state (called induced pluripotent cells, iPS cells) using retrovirus to introduce four ...

  5. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  6. Motion at low Reynolds number

    E-Print Network [OSTI]

    Tam, Daniel See Wai, 1980-

    2008-01-01

    The work described in this thesis centers on inertialess motion at low Reynolds numbers at the crossroad between biofluids and microfluids. Here we address questions regarding locomotion of micro-swimmers, transport of ...

  7. Departmental Business Instrument Numbering System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-01-27

    The Order prescribes the procedures for assigning identifying numbers to all Department of Energy (DOE) and National Nuclear Security Administration (NNSA) business instruments. Cancels DOE O 540.1. Canceled by DOE O 540.1B.

  8. Departmental Business Instrument Numbering System

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2000-12-05

    To prescribe procedures for assigning identifying numbers to all Department of Energy (DOE), including the National Nuclear Security Administration, business instruments. Cancels DOE 1331.2B. Canceled by DOE O 540.1A.

  9. MOTOR POOL RESERVATIONS Reservation Number:_______________

    E-Print Network [OSTI]

    Ottino, Julio M.

    of Department Chair or Organization Advisor: ________________________________________ Chart String Number: Fund: ______________________________________________________________________ Name of Department or Organization: _____________________________________________________ Name reservations require the "Organization Authorization for University Vehicles" form to be faxed to Motor Pool

  10. Kentucky Natural Gas Number of Residential Consumers (Number of Elements)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of Elements) Kentucky Natural Gas Number

  11. TRANSPORT NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION

    E-Print Network [OSTI]

    De Jonghe, Lutgard C.

    2014-01-01

    NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION Lutgard

  12. TRANSPORT NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION

    E-Print Network [OSTI]

    De Jonghe, Lutgard C.

    2012-01-01

    NUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION LutgardNUMBER GRADIENTS AND SOLID ELECTROLYTE DEGRADATION Lutgard

  13. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  14. Sensitivity in risk analyses with uncertain numbers.

    SciTech Connect (OSTI)

    Tucker, W. Troy; Ferson, Scott

    2006-06-01

    Sensitivity analysis is a study of how changes in the inputs to a model influence the results of the model. Many techniques have recently been proposed for use when the model is probabilistic. This report considers the related problem of sensitivity analysis when the model includes uncertain numbers that can involve both aleatory and epistemic uncertainty and the method of calculation is Dempster-Shafer evidence theory or probability bounds analysis. Some traditional methods for sensitivity analysis generalize directly for use with uncertain numbers, but, in some respects, sensitivity analysis for these analyses differs from traditional deterministic or probabilistic sensitivity analyses. A case study of a dike reliability assessment illustrates several methods of sensitivity analysis, including traditional probabilistic assessment, local derivatives, and a ''pinching'' strategy that hypothetically reduces the epistemic uncertainty or aleatory uncertainty, or both, in an input variable to estimate the reduction of uncertainty in the outputs. The prospects for applying the methods to black box models are also considered.

  15. Constrained Ramsey Numbers of Graphs

    E-Print Network [OSTI]

    Jiang, Tao

    Constrained Ramsey Numbers of Graphs Robert E. Jamison,1 Tao Jiang,2* and Alan C. H. Ling3 1-like trees. � 2002 Wiley Periodicals, Inc. J Graph Theory 42: 1­16, 2003 Keywords: Ramsey; monochromatic edges have the same color and rainbow iff all of its edges have different colors. In classical Ramsey

  16. Swimming by numbers QUANTUM CONTROL

    E-Print Network [OSTI]

    Mahadevan, L.

    flow, providing key qualitative insight in fluid mechanics. For example, the so-called Reynolds number be described by a universal mechanical principle seems optimistic -- if not entirely unrealistic. Now, however and pressure forces relevant for net propulsion. A measure of the thrust force is given by the mass

  17. The 17 GHz active region number

    SciTech Connect (OSTI)

    Selhorst, C. L.; Pacini, A. A.; Costa, J. E. R.; Giménez de Castro, C. G.; Valio, A.; Shibasaki, K.

    2014-08-01

    We report the statistics of the number of active regions (NAR) observed at 17 GHz with the Nobeyama Radioheliograph between 1992, near the maximum of cycle 22, and 2013, which also includes the maximum of cycle 24, and we compare with other activity indexes. We find that NAR minima are shorter than those of the sunspot number (SSN) and radio flux at 10.7 cm (F10.7). This shorter NAR minima could reflect the presence of active regions generated by faint magnetic fields or spotless regions, which were a considerable fraction of the counted active regions. The ratio between the solar radio indexes F10.7/NAR shows a similar reduction during the two minima analyzed, which contrasts with the increase of the ratio of both radio indexes in relation to the SSN during the minimum of cycle 23-24. These results indicate that the radio indexes are more sensitive to weaker magnetic fields than those necessary to form sunspots, of the order of 1500 G. The analysis of the monthly averages of the active region brightness temperatures shows that its long-term variation mimics the solar cycle; however, due to the gyro-resonance emission, a great number of intense spikes are observed in the maximum temperature study. The decrease in the number of these spikes is also evident during the current cycle 24, a consequence of the sunspot magnetic field weakening in the last few years.

  18. Development of an integrated in-situ remediation technology. Topical report for Task {number_sign}3.2 entitled, ``Modeling and iron dechlorination studies`` (September 26, 1994--August 31, 1997)

    SciTech Connect (OSTI)

    Shapiro, A.P.; Sivavec, T.M.; Principe, J.M. [General Electric Research and Development, Schenectady, NY (United States)

    1997-11-01

    Contamination in low-permeability soils poses a significant technical challenge to in-situ remediation efforts. Poor accessibility to the contaminants and difficulty in delivery of treatment reagents have rendered existing in-situ treatments such as bioremediation, vapor extraction, and pump and treat rather ineffective when applied to low-permeability soils present at many contaminated sites. The technology is an integrated in-situ treatment in which established geotechnical methods are used to install degradation zones directly in the contaminated soil, and electro-osmosis is utilized to move the contaminants back and forth through those zones until the treatment is complete. The present Topical Report for Task {number_sign}3.2 summarizes the modeling and dechlorination research conducted by General Electric Research and Development.

  19. Marbled murrelet abundance and breeding activity at Naked Island, Prince William Sound, and Kachemak Bay, Alaska, before and after the Exxon Valdez oil spill. Bird study number 6. Exxon Valdez oil spill state/federal natural resource damage assessment final report

    SciTech Connect (OSTI)

    Kuletz, K.J.

    1994-08-01

    The author compared pre- and post-spill abundance and breeding activity of murrelets near the Naked Island group in central Prince William Sound, and in Kachemak Bay in lower Cook Inlet. Murrelet numbers at Naked Island were lower in 1989 than in 1978-1980 but not in 1990-1992. At Kachemak Bay, where oiling was minimal, murrelet densities did not change between 1988 and 1989. The results suggest that the murrelet population at Kachemak Bay, further removed temporally and spatially from the spill epicenter, was not affected as the Naked Island populations in 1989. Murrelet numbers were negatively correlated to numbers of boats at both study sites, and cleanup activities likely contributed to disruption in 1989.

  20. Louisiana Natural Gas Number of Residential Consumers (Number of Elements)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of33Cubic Foot)Year Jan

  1. California Natural Gas Number of Residential Consumers (Number of Elements)

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal4 ArizonaResidential Consumers (Number of Elements)

  2. Nebraska Natural Gas Number of Industrial Consumers (Number of Elements)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,Decade Year-03.823,172 3,009165,360Industrial Consumers (Number of

  3. Nebraska Natural Gas Number of Residential Consumers (Number of Elements)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,Decade Year-03.823,172 3,009165,360Industrial Consumers (Number

  4. North Dakota Natural Gas Number of Industrial Consumers (Number of

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements) Industrial Consumers (Number of

  5. North Dakota Natural Gas Number of Residential Consumers (Number of

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal, Nuclear,DecadeYear Jan FebElements) Industrial Consumers (Number

  6. GEOCENTRIFUGE STUDIES OF FLOW AND TRANSPORT IN POROUS MEDIA, FINAL REPORT FOR GRANT NUMBER DE-FG02-03ER63567 TO THE UNIVERSITY OF IDAHO (RW SMITH), ENVIRONMENTAL MANAGEMENT SCIENCE PROGRAM PROJECT NUMBER 86598, COUPLED FLOW AND REACTIVITY IN VARIABLY SATURATED POROUS MEDIA

    SciTech Connect (OSTI)

    Robert W. Smith; Carl D. Palmer; Earl D. Mattson

    2007-06-15

    Improved models of contaminant migration in heterogeneous, variably saturated porous media are required to better define the long-term stewardship requirements for U.S. Department of Energy (DOE) lands and to assist in the design of effective vadose-zone barriers to contaminant migrations. The development of these improved models requires field and laboratory results to evaluate their efficacy. However, controlled laboratory experiments simulating vadose conditions can require extensive period of time, and often are conducted at condition near saturation rather than the much drier conditions common in many contaminated arid vadose zone sites. Collaborative research undertaken by the Idaho National Laboratory (INL) and the University of Idaho as part of this Environmental Management Science Program project focused on the development and evaluation of geocentrifuge techniques and equipment that allows vadose zone experiments to be conducted for relevant conditions in time frames not possible in conventional bench top experiments. A key and novel aspect of the research was the use of the 2-meter radius geocentrifuge capabilities at the Idaho National Laboratory to conduct unsaturated transport experiments. Specifically, the following activities were conducted ** Reviewing of the theory of unsaturated flow in the geocentrifuge to establish the range of centrifuge accelerations/experimental conditions and the translation of centrifuge results to 1 gravity applications. ** Designing, constructing, and testing of in-flight experimental apparatus allowing the replication of traditional bench top unsaturated transport experiments on the geocentrifuge. ** Performing unsaturated 1-dimenstional column geocentrifuge experiments using conservative tracers to evaluate the effects of increased centrifugal acceleration on derived transport properties and assessing the scaling relationships for these properties. Because the application of geocentrifuge techniques to vadose transport is in its infancy experimental apparatus such as pumps, flow meters, columns, fraction collectors, etc. that would reliably function under the increased self weight experienced on the centrifuge had to be developed and tested as part of this project. Although, we initially planed to conduct experiments using reactive tracer and 2-dimensional heterogeneities, the cost and time associated with designing, building, and testing of experimental apparatus limited our experimental program to conservative tracer experiments using 1-dimensional columns. The results we obtained in this study indicate that the geocentrifuge technique is a viable experimental method for the study of subsurface processes where gravitational acceleration is important. The geocentrifuge allows experiments to be completed more quickly than tests conducted at 1-g, can be used to experimentally address important scaling issues, and permits experiments under a range of conditions that would be difficult or impossible using conventional approaches. The application of the geocentrifuge approaches and associated models developed in this project allows more meaningful investigation of DOE relevant vadose-zone issues under scalable conditions in time frames previously not obtainable.

  7. Reducing the Cost of Generating APH-distributed Random Numbers

    E-Print Network [OSTI]

    Telek, Miklós

    Reducing the Cost of Generating APH-distributed Random Numbers Philipp Reinecke1 , Mikl´os Telek2 from PH distributions and propose two algorithms for reducing the cost associated with generating representation that minimises the cost associated with generating random numbers. In this paper we study

  8. Combinatorial Number Theory in China Zhi-Wei Sun

    E-Print Network [OSTI]

    Sun, Zhi-Wei

    Combinatorial Number Theory in China Zhi-Wei Sun Nanjing University Nanjing 210093, P. R. China as number theorists. Zhi-Wei Sun's School: Study covers of the integers or groups, restricted sumsets via Combinatorial Nullstellensatz, and various combinatorial congruences. Remark. Sun and his students view

  9. VOLUME 78, NUMBER 12 P H Y S I C A L R E V I E W L E T T E R S 24 MARCH 1997 Catalytic Growth of Single-Wall Carbon Nanotubes: An Ab Initio Study

    E-Print Network [OSTI]

    Tománek, David

    on the nanotube wall and diffuse to the growing edge. We will show that atomic nickel that is strongly bound of Single-Wall Carbon Nanotubes: An Ab Initio Study Young Hee Lee,1,2 Seong Gon Kim,1, * and David Tománek1-wall carbon nanotubes based on density functional total energy calculations. Our results indicate nanotubes

  10. Abstract: Measurement of the number density evolution of galaxy clusters directly probes cosmological structure growth and has been identified as one of the most promising tools for Dark Energy studies. Achieving the sensitivity for distinguishing differe

    E-Print Network [OSTI]

    Boehringer, Hans

    Using Distant X-ray Luminous Galaxy Clusters as Dark Energy Probes The XMM-Newton Distant Cluster cosmological structure growth and has been identified as one of the most promising tools for Dark Energy studies. Achieving the sensitivity for distinguishing different Dark Energy scenarios rests largely

  11. VOLUME 80, NUMBER 4 P H Y S I C A L R E V I E W L E T T E R S 26 JANUARY 1998 Ideal Brittle Fracture of Silicon Studied with Molecular Dynamics

    E-Print Network [OSTI]

    Texas at Austin. University of

    Fracture of Silicon Studied with Molecular Dynamics Dominic Holland and M. Marder Center for Nonlinear September 1997) Dynamic fracture experiments measure crack velocity versus energy flux to the tip. We report, no determination whether ideal brittle fracture is a pathological feature of an artificial model, or whether

  12. The Fermat and Mersenne Numbers 

    E-Print Network [OSTI]

    Nowlin, W. D.

    1960-01-01

    . (Throughout this thesis, F will always denote a Feraat nmaber and M a Mersenne nuuber. ) The problea of deternining p which of the Fernat and Mersenne nmabers are prius has concerned uany matheuaticians during the last two centuries. This research has... or a Fermat, number. Next? Froth~a theorem, of which Pepin's test is a special case, is stated and proved. In the last section the theory of recurring series is used to establish primality tests of the Lucas type for both the Fermat and Mersenne...

  13. DRAFT CRUISE REPORT Cruise Number: DY0807

    E-Print Network [OSTI]

    Neuston (Neu) 68 Deployment of satellite buoy (SatBuoy) 3 Samples Collected Tows Number Number of larvae of buoy or mooring (Deploy) 3 3 Stimulated fluorescence collected during CTD casts (Fluor) 18 Number

  14. Feasibility Study of Supercritical Light Water Cooled Reactors for Electric Power Production, Nuclear Energy Research Initiative Project 2001-001, Westinghouse Electric Co. Grant Number: DE-FG07-02SF22533, Final Report

    SciTech Connect (OSTI)

    Philip E. MacDonald

    2005-01-01

    The supercritical water-cooled reactor (SCWR) is one of the six reactor technologies selected for research and development under the Generation IV program. SCWRs are promising advanced nuclear systems because of their high thermal efficiency (i.e., about 45% versus about 33% efficiency for current Light Water Reactors [LWRs]) and considerable plant simplification. SCWRs are basically LWRs operating at higher pressure and temperatures with a direct once-through cycle. Operation above the critical pressure eliminates coolant boiling, so the coolant remains single-phase throughout the system. Thus, the need for a pressurizer, steam generators, steam separators, and dryers is eliminated. The main mission of the SCWR is generation of low-cost electricity. It is built upon two proven technologies: LWRs, which are the most commonly deployed power generating reactors in the world, and supercritical fossil-fired boilers, a large number of which are also in use around the world. The reference SCWR design for the U.S. program is a direct cycle system operating at 25.0 MPa, with core inlet and outlet temperatures of 280 and 500 C, respectively. The coolant density decreases from about 760 kg/m3 at the core inlet to about 90 kg/m3 at the core outlet. The inlet flow splits with about 10% of the inlet flow going down the space between the core barrel and the reactor pressure vessel (the downcomer) and about 90% of the inlet flow going to the plenum at the top of the rector pressure vessel, to then flow down through the core in special water rods to the inlet plenum. Here it mixes with the feedwater from the downcomer and flows upward to remove the heat in the fuel channels. This strategy is employed to provide good moderation at the top of the core. The coolant is heated to about 500 C and delivered to the turbine. The purpose of this NERI project was to assess the reference U.S. Generation IV SCWR design and explore alternatives to determine feasibility. The project was organized into three tasks: Task 1. Fuel-cycle Neutronic Analysis and Reactor Core Design Task 2. Fuel Cladding and Structural Material Corrosion and Stress Corrosion Cracking Task 3. Plant Engineering and Reactor Safety Analysis. moderator rods. materials.

  15. Examining A Hypersonic Turbulent Boundary Layer at Low Reynolds Number 

    E-Print Network [OSTI]

    Semper, Michael Thomas

    2013-05-15

    The purpose of the current study was to answer several questions related to hypersonic, low Reynolds number, turbulent boundary layers, of which available data related to turbulence quantities is scarce. To that end, a ...

  16. Ramsey numbers of sparse hypergraphs David Conlon

    E-Print Network [OSTI]

    Fox, Jacob

    Ramsey numbers of sparse hypergraphs David Conlon Jacob Fox Benny Sudakov Abstract We give a short proof that any k-uniform hypergraph H on n vertices with bounded degree has Ramsey number at most c(, k on the Ramsey number of hypergraphs with at most m edges. 1 Introduction For a graph H, the Ramsey number r

  17. Department for Analysis and Computational Number Theory Additive functions and number systems

    E-Print Network [OSTI]

    Department for Analysis and Computational Number Theory Additive functions and number systems systems April 7, 2010 1 / 35 #12;Department for Analysis and Computational Number Theory Outline Number and Computational Number Theory Number systems Let R be an integral domain, b R, and N = {n1, . . . , nm} R

  18. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  19. Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too: Understanding action representation in left aIPS. Neuropsychologia (2010), doi:10.1016/j.neuropsychologia.2010.04.028

    E-Print Network [OSTI]

    Hamilton, Antonia

    2010-01-01

    Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too communication Triangles have goals too: Understanding action representation in left aIPS Richard Ramsey of animacy Corresponding author. E-mail address: richard.ramsey@nottingham.ac.uk (R. Ramsey). and brain

  20. Prime number generation and factor elimination

    E-Print Network [OSTI]

    Vineet Kumar

    2014-10-06

    We have presented a multivariate polynomial function termed as factor elimination function,by which, we can generate prime numbers. This function's mapping behavior can explain the irregularities in the occurrence of prime numbers on the number line. Generally the different categories of prime numbers found till date, satisfy the form of this function. We present some absolute and probabilistic conditions for the primality of the number generated by this method. This function is capable of leading to highly efficient algorithms for generating prime numbers.

  1. P-wave traveltime inversion in weakly anisotropic media: a preliminary study

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    (vertical seismic profiling) experiment, which provides a good angular illumination, and we study a general anisotropy in the inversion process. We use a vertical seismic profiling (VSP) configuration Republic. E-mail: b.ruzek@ig.cas.cz; ip@ig.cas.cz Abstract There is an increasing interest in seismic

  2. The distribution of prime numbers on the square root spiral

    E-Print Network [OSTI]

    Harry K. Hahn; Robert Sachs

    2008-01-09

    Prime Numbers clearly accumulate on defined spiral graphs,which run through the Square Root Spiral. These spiral graphs can be assigned to different spiral-systems, in which all spiral-graphs have the same direction of rotation and the same -second difference- between the numbers, which lie on these spiral-graphs. A mathematical analysis shows, that these spiral graphs are caused exclusively by quadratic polynomials. For example the well known Euler Polynomial x2+x+41 appears on the Square Root Spiral in the form of three spiral-graphs, which are defined by three different quadratic polynomials. All natural numbers,divisible by a certain prime factor, also lie on defined spiral graphs on the Square Root Spiral (or Spiral of Theodorus, or Wurzelspirale). And the Square Numbers 4, 9, 16, 25, 36 even form a highly three-symmetrical system of three spiral graphs, which divides the square root spiral into three equal areas. Fibonacci number sequences also play a part in the structure of the Square Root Spiral. With the help of the Number-Spiral, described by Mr. Robert Sachs, a comparison can be drawn between the Square Root Spiral and the Ulam Spiral. The shown sections of his study of the number spiral contain diagrams, which are related to my analysis results, especially in regards to the distribution of prime numbers.

  3. Department:Continuing Studies Course number: GS 295W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    , and biology, social sciences and the humanities as they related to the selected area of investigation. W literature on the topic, determine which materials are most pertinent to the subject, and incorporate of the class, in a class handout with the writing guidelines listed in the St. Martin's Handbook. 3

  4. UNIVERSITY STUDIES 2011-2012 Course Titles and Numbers

    E-Print Network [OSTI]

    Olszewski Jr., Edward A.

    Physical Activity and Wellness Mathematics and Statistics (3 hours) CSC 121 Introduction to Computer Science MAT 141 Concepts of Mathematics CSC 133 Discrete Mathematical Structures MAT 142 Concepts Art, Renaissance to Modern FRH 385 (FST 387) Introduction to French Cinema ARH 206 Artist in Film FST

  5. Winding number order in the Haldane model with interactions

    E-Print Network [OSTI]

    Emilio Alba; Jiannis Pachos; Juan Jose Garcia-Ripoll

    2015-05-02

    We study the Haldane model with nearest-neighbor interactions. This model is physically motivated by the associated ultracold atoms implementation. We show that the topological phase of the interacting model can be characterized by a physically observable winding number. The robustness of this number extends well beyond the topological insulator phase towards attractive and repulsive interactions that are comparable to the kinetic energy scale of the model. We identify and characterize the relevant phases of the model.

  6. Turing's normal numbers: towards randomness Veronica Becher

    E-Print Network [OSTI]

    presumably in 1938 Alan Turing gave an algorithm that produces real numbers normal to every integer base- putable normal numbers, and this result should be attributed to Alan Turing. His manuscript entitled "A

  7. Instability of High Mach Number Poiseuille (Channel) Flow: Linear Analysis and Direct Numerical Simulations 

    E-Print Network [OSTI]

    Xie, Zhimin

    2014-08-06

    is examined. Grid resolution and time-step convergence studies are performed over the range of Mach numbers of interest. The next study establishes the stability characteristics at very high and very low Mach number limits. While stability at low Mach number...

  8. Small Ramsey Numbers Stanislaw P. Radziszowski

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Small Ramsey Numbers Stanislaw P. Radziszowski Department of Computer Science Rochester Institute Ramsey numbers, where the avoided graphs are complete or complete without one edge. Many results per behavior of Ramsey numbers, but rather we concentrate on their specific values. Mathematical Reviews

  9. Ramsey Numbers Involving Cycles Stanislaw P. Radziszowski

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Ramsey Numbers Involving Cycles Stanislaw P. Radziszowski Department of Computer Science Rochester and data on Ramsey numbers involving cycles. This survey is based on the author's 2009 revi- sion #12 of the Dynamic Survey DS1, "Small Ramsey Numbers", at the Electronic Journal of Combinatorics. Table of Contents

  10. SHARP THRESHOLDS FOR HYPERGRAPH REGRESSIVE RAMSEY NUMBERS

    E-Print Network [OSTI]

    Lee, Gyesik

    SHARP THRESHOLDS FOR HYPERGRAPH REGRESSIVE RAMSEY NUMBERS LORENZO CARLUCCI, GYESIK LEE, AND ANDREAS WEIERMANN Abstract. The f-regressive Ramsey number Rreg f (d, n) is the minimum N such that every colouring regressive Ramsey numbers as defined by Kanamori and McAloon. In this paper we classifiy the growth

  11. Motivation Examples Star Avoiding Ramsey Numbers

    E-Print Network [OSTI]

    Isaak, Garth

    Motivation Examples Star Avoiding Ramsey Numbers Jonelle Hook, Garth Isaak Department and Cryptography Jonelle Hook, Garth Isaak Star Avoiding Ramsey Numbers #12;Motivation Examples Graph Ramsey-coloring of K13 has a red C5 or a blue K4. Jonelle Hook, Garth Isaak Star Avoiding Ramsey Numbers #12

  12. Diagonal Ramsey Numbers in Multipartite Graphs

    E-Print Network [OSTI]

    van Vuuren, Jan H.

    Diagonal Ramsey Numbers in Multipartite Graphs AP Burger , PJP Grobler , EH Stipp & JH van Vuuren September 17, 2003 Abstract The notion of a graph theoretic Ramsey number is generalised by assuming definition. Some small multipartite Ramsey numbers are found, while upper and lower bounds are established

  13. Diagonal Ramsey Numbers in Multipartite Graphs

    E-Print Network [OSTI]

    van Vuuren, Jan H.

    Diagonal Ramsey Numbers in Multipartite Graphs AP Burger + , PJP Grobler # , EH Stipp # & JH van Vuuren # September 17, 2003 Abstract The notion of a graph theoretic Ramsey number is generalised as in the classical definition. Some small multipartite Ramsey numbers are found, while upper and lower bounds

  14. Number of peer-reviewed publications

    E-Print Network [OSTI]

    ·Number of peer- reviewed publications produced per year ·Data accurate as of 02 April 2012 · Number of publications produced per institution (top 10) ·Collaborations counted multiple times · Non-cumulative number of citations received by OER publications per year ·Data accurate as of 02 April 2012 · The work

  15. Company number 5857955 Wellcome Trust Finance plc

    E-Print Network [OSTI]

    Rambaut, Andrew

    Company number 5857955 Wellcome Trust Finance plc Annual Report and Financial Statements Year ended 30 September 2014 #12;Company number 5857955 Wellcome Trust Finance plc Contents Page Strategic number 58579551 Wellcome Trust Finance plc Strategic Report For the year ended 30 September 2014

  16. KIAS SEOUL, February 2004 Transcendental Number Theory

    E-Print Network [OSTI]

    Waldschmidt, Michel

    ) ­ Introductio in Analysin Infinitorum. Suggests the transcendence of log 1/ log 2 when this number is irrational in Analysin Infinitorum. Suggests the transcendence of log 1/ log 2 when this number is irrational (for this number is irrational (for algebraic 1 and 2). http://www.math.jussieu.fr/miw/ 14 #12;Euler (1748

  17. Number Theory I: Tools and Diophantine Equations

    E-Print Network [OSTI]

    Cohen, Henri

    covered by two other books of the author [Coh0] and [Coh1]. The central (although not unique) theme in integers, rational numbers, or more generally in algebraic numbers. This theme is in particular the central of the reader that he or she is familiar with the standard basic theory of number fields, up to and including

  18. Clar number of catacondensed benzenoid hydrocarbons

    E-Print Network [OSTI]

    Klavzar, Sandi

    Clar number of catacondensed benzenoid hydrocarbons Sandi KlavŸzar a,# , Petra Ÿ Zigert a , Ivan hydrocarbon: CL is equal to the minimum number of straight lines required to intersect all hexagons theory; Clar formula; Clar number; Resonance graph; Benzenoid hydrocarbons 1. Introduction Within

  19. SN 2005ip: A luminous type IIn supernova emerging from a dense circumstellar medium as revealed by X-ray observations

    SciTech Connect (OSTI)

    Katsuda, Satoru [RIKEN (The Institute of Physical and Chemical Research) Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Maeda, Keiichi [Department of Astronomy, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Nozawa, Takaya [Kavli Institute for the Physics and Mathematics of the Universe (WPI), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Pooley, David [Department of Physics, Sam Houston State University, Huntsville, TX 77341-2267 (United States); Immler, Stefan [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 2077 (United States)

    2014-01-10

    We report on the X-ray spectral evolution of the nearby Type IIn supernova (SN) 2005ip based on Chandra and Swift observations covering ?1-6 yr after explosion. X-ray spectra in all epochs are well fitted by a thermal emission model with kT ? 7 keV. The somewhat high temperature suggests that the X-ray emission mainly arises from the circumstellar medium (CSM) heated by the forward shock. We find that the spectra taken two to three years after the explosion are heavily absorbed (N {sub H} ? 5 × 10{sup 22} cm{sup –2}), but the absorption gradually decreases to the level of the Galactic absorption (N {sub H} ? 4 × 10{sup 20} cm{sup –2}) at the final epoch. This indicates that the SN went off in a dense CSM and that the forward shock has overtaken it. The intrinsic X-ray luminosity stays constant until the final epoch, when it drops by a factor of ?2. The intrinsic 0.2-10 keV luminosity during the plateau phase is measured to be ?1.5 × 10{sup 41} erg s{sup –1}, ranking SN 2005ip as one of the brightest X-ray SNe. Based on the column density, we derive a lower limit of a mass-loss rate to be M-dot ?1.5×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, which roughly agrees with that inferred from the X-ray luminosity, M-dot ?2×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, where V{sub w} is the circumstellar wind speed. Such a high mass-loss rate suggests that the progenitor star had eruptive mass ejections similar to a luminous blue variable star. The total mass ejected in the eruptive period is estimated to be ?15 M {sub ?}, indicating that the progenitor mass is ? 25 M {sub ?}.

  20. Tip sheet: Expanded Library of Congress Call Number Classification system Call Number Subject Matter

    E-Print Network [OSTI]

    Kambhampati, Patanjali

    Tip sheet: Expanded Library of Congress Call Number Classification system Call Number Subject R: Medicine T: Technology U: Military Science Z: Bibliography. Library Science. Information

  1. Bounds on Some Ramsey Numbers Involving Quadrilateral +

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Bounds on Some Ramsey Numbers Involving Quadrilateral + Xiaodong Xu Guangxi Academy of Sciences@cs.rit.edu Abstract. For graphs G 1 , G 2 , · · · , Gm , the Ramsey number R(G 1 , G 2 , · · · , Gm ) is defined Ramsey numbers involving quadrilateral C 4 , including R(C 4 , K 9 ) # 32, 19 # R(C 4 , C 4 , K 4 ) # 22

  2. Predicting landfalling hurricane numbers from basin hurricane numbers: basic statistical analysis

    E-Print Network [OSTI]

    Laepple, T; Penzer, J; Bellone, E; Nzerem, K; Laepple, Thomas; Jewson, Stephen; Penzer, Jeremy; Bellone, Enrica; Nzerem, Kechi

    2007-01-01

    One possible method for predicting landfalling hurricane numbers is to first predict the number of hurricanes in the basin and then convert that prediction to a prediction of landfalling hurricane numbers using an estimated proportion. Should this work better than just predicting landfalling hurricane numbers directly? We perform a basic statistical analysis of this question in the context of a simple abstract model.

  3. Harmonic resolution as a holographic quantum number

    E-Print Network [OSTI]

    Bousso, Raphael

    2009-01-01

    LBNL- 57239 Harmonic resolution as a holographic quantumhep-th/0310223 UCB-PTH-03/26 Harmonic resolution as aquantum number, the harmonic resolution K. The Bekenstein

  4. REFINED BOUNDS ON THE NUMBER OF CONNECTED ...

    E-Print Network [OSTI]

    2011-04-06

    Apr 6, 2011 ... Smith inequality (see Theorem 2.5) a bound on the number of semi- ... then using Smith inequality, have been used before in several different ...

  5. Call Numbers** A, B, C 3rd

    E-Print Network [OSTI]

    Saldin, Dilano

    Call Numbers** A, B, C 3rd Floor Southeast . D, E, F, G, H, J, K, L 3rd Floor West . . . . . P 3rd Floor West . Q, R

  6. Numbers, proof and 'all that jazz'.

    E-Print Network [OSTI]

    2007-01-08

    CHAPTER 1. Numbers, proof and 'all that jazz'. There is a fundamental difference between mathematics and other sciences. In most sciences, one does ...

  7. RNA Extraction and Labeling 1. To IP pellet (~ 25 l vol), add 175 l of: 10 mM HEPES-NaOH, pH 7.5

    E-Print Network [OSTI]

    Aris, John P.

    85 RNA Extraction and Labeling 1. To IP pellet (~ 25 µl vol), add 175 µl of: 10 mM HEPES-NaOH, pH 7 Speed-Vac. 7. Labeling 3' ends. To each pellet, add 10 µl containing: 1 X NEB RNA Ligase buffer 10% DMSO precipitate. Use DEPC-treated 3M NaOAc, pH 5. Wash with 75% EtOH and dry. 12. Resuspend pellet completely in 5

  8. A Thermodynamic Classification of Real Numbers

    E-Print Network [OSTI]

    Thomas Garrity

    2009-03-15

    A new classification scheme for real numbers is given, motivated by ideas from statistical mechanics in general and work of Knauf and of Fiala and Kleban in particular. Critical for this classification of a real number will be the Diophantine properties of its continued fraction expansion.

  9. Circular Chromatic Ramsey Number Kyle F. Jao

    E-Print Network [OSTI]

    West, Douglas B.

    Circular Chromatic Ramsey Number Kyle F. Jao , Claude Tardif , Douglas B. West , Xuding Zhu, the circular chromatic Ramsey number Rc (F, G) is the infimum of c(H) over graphs H such that every red of a Ramsey problem for the families of homomorphic images of F and G. Letting zk = 3 - 2-k, we prove that zk

  10. 2001 TRAFFIC ZONE BOUNDARIES Zone Numbers

    E-Print Network [OSTI]

    Toronto, University of

    2001 TRAFFIC ZONE BOUNDARIES Zone Numbers & Detailed Definitions #12;2001 TRAFFIC ZONE BOUNDARIES of Toronto Joint Program in Transportation January 2003 #12;PREFACE This report presents the 2001 traffic zone numbers by local municipalities in the 2001 TTS survey area. The second part presents detailed

  11. Real numbers and other completions Fred Richman

    E-Print Network [OSTI]

    Richman, Fred

    Real numbers and other completions Fred Richman Florida Atlantic University Boca Raton, FL 33431 11 March 2007 Abstract A notion of completeness and completion suitable for use in the absence of countable choice is developed. This encompasses the con- struction of the real numbers as well as the completion

  12. Company number 5857955 Wellcome Trust Finance plc

    E-Print Network [OSTI]

    Rambaut, Andrew

    Company number 5857955 Wellcome Trust Finance plc Annual Report and Financial Statements Year ended 30 September 2012 #12;Company number 5857955 Wellcome Trust Finance plc Contents Page Directors Trust Finance plc Directors' Report for the year ended 30 September 2012 Report of the Directors

  13. Company number 5857955 Wellcome Trust Finance plc

    E-Print Network [OSTI]

    Rambaut, Andrew

    Company number 5857955 Wellcome Trust Finance plc Annual Report and Financial Statements Year ended 30 September 2013 #12;Company number 5857955 Wellcome Trust Finance plc Contents Page Directors Trust Finance plc Directors' Report For the year ended 30 September 2013 Report of the Directors

  14. RNG: A Practitioner's Overview Random Number Generation

    E-Print Network [OSTI]

    Mascagni, Michael

    -Kac/path integral methods to solve partial differential equations with random walks Defense: neutronics, nuclear random numbers 1. Each calculation is a numerical experiment Subject to known and unknown sources a calculation with the same numbers Across different machines (modulo arithmetic issues) Parallel

  15. Resolution-Stationary Random Number Generators

    E-Print Network [OSTI]

    L'Ecuyer, Pierre

    of successive output values over their entire period length. For F2-linear generators, the commonly adopted efficient ways of implementing high-quality and long-period Tausworthe generators. Key words: random number un [0, 1) is the output of the generator at step n and the number of bits in this output, L

  16. enter part number BNC / RP-BNC

    E-Print Network [OSTI]

    Berns, Hans-Gerd

    enter part number Products 7/16 1.0/2.3 1.6/5.6 AFI AMC BNC / RP-BNC C FAKRA SMB FME HN MCX Mini ------- Product Search ------- Inventory Search Search Results for: 31-10152-RFX Results: 1 - 1 of 1 Part Number. All rights reserved. Copyright | Terms & Conditions | RF E-Mail Client | Contact Us | Amphenol

  17. Flow Past a Sphere and a Prolate Spheroid at Low Reynolds Numbers 

    E-Print Network [OSTI]

    Zhang, Youfeng

    2013-12-04

    on studying variations of the drag coefficient with the Reynolds number and aspect ratio. The simulation shows that a spheroid has larger drag coefficient than a sphere at lower Reynolds numbers and then tends to be the smaller one for higher Reynolds numbers....

  18. The Size-Ramsey Number of Trees P.E. Haxell1* and Y. Kohayakawa2

    E-Print Network [OSTI]

    Kohayakawa, Yoshiharu

    The Size-Ramsey Number of Trees P.E. Haxell1* and Y. Kohayakawa2 1Department of Pure- matic copy of H in any 2-colouring of the edges of G. The size-Ramsey number re* *(H) of a graph H are concerned with a numerical problem in Ramsey theory: we shall study the size-Ramsey number of trees. Before

  19. Wiener Numbers of Pericondensed Benzenoid Hydrocarbons Sandi Klav zar

    E-Print Network [OSTI]

    Klavzar, Sandi

    Wiener Numbers of Pericondensed Benzenoid Hydrocarbons Sandi Klav#20;zar Department of Mathematics expressions for W for several homologous series of pericondensed benzenoid hydrocarbons. An elementary proof polycyclic systems studied were catacondensed benzenoid hydrocarbons. 11{14 Few years ago the situation

  20. Ramsey numbers and adiabatic quantum computing

    E-Print Network [OSTI]

    Frank Gaitan; Lane Clark

    2012-01-08

    The graph-theoretic Ramsey numbers are notoriously difficult to calculate. In fact, for the two-color Ramsey numbers $R(m,n)$ with $m,n\\geq 3$, only nine are currently known. We present a quantum algorithm for the computation of the Ramsey numbers $R(m,n)$. We show how the computation of $R(m,n)$ can be mapped to a combinatorial optimization problem whose solution can be found using adiabatic quantum evolution. We numerically simulate this adiabatic quantum algorithm and show that it correctly determines the Ramsey numbers R(3,3) and R(2,s) for $5\\leq s\\leq 7$. We then discuss the algorithm's experimental implementation, and close by showing that Ramsey number computation belongs to the quantum complexity class QMA.

  1. IMPACT OF CAPILLARY AND BOND NUMBERS ON RELATIVE PERMEABILITY

    SciTech Connect (OSTI)

    Kishore K. Mohanty

    2002-09-30

    Recovery and recovery rate of oil, gas and condensates depend crucially on their relative permeability. Relative permeability in turn depends on the pore structure, wettability and flooding conditions, which can be represented by a set of dimensionless groups including capillary and bond numbers. The effect of flooding conditions on drainage relative permeabilities is not well understood and is the overall goal of this project. This project has three specific objectives: to improve the centrifuge relative permeability method, to measure capillary and bond number effects experimentally, and to develop a pore network model for multiphase flows. A centrifuge has been built that can accommodate high pressure core holders and x-ray saturation monitoring. The centrifuge core holders can operate at a pore pressure of 6.9 MPa (1000 psi) and an overburden pressure of 17 MPa (2500 psi). The effect of capillary number on residual saturation and relative permeability in drainage flow has been measured. A pore network model has been developed to study the effect of capillary numbers and viscosity ratio on drainage relative permeability. Capillary and Reynolds number dependence of gas-condensate flow has been studied during well testing. A method has been developed to estimate relative permeability parameters from gas-condensate well test data.

  2. Numerical distance effect in the N240 component in a number-matching task

    E-Print Network [OSTI]

    2006-01-01

    stimulus probability on ERP components elicited by numericalprocessing of numbers. Previous ERP studies have examined3], we expected to find ERP differences associated with

  3. The Size-Ramsey Number of Trees P.E. Haxell1

    E-Print Network [OSTI]

    Kohayakawa, Yoshiharu

    The Size-Ramsey Number of Trees P.E. Haxell1 and Y. Kohayakawa2 1Department of Pure Mathematics-colouring of the edges of G. The size-Ramsey number re(H) of a graph H is the smallest possible number in Ramsey theory: we shall study the size-Ramsey number of trees. Before we proceed, let us introduce some

  4. 4. Wrzburger Workshop ,,IP Netzmanagement, IP Netzplanung und Optimierung"

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    Protocol (ICMP, ,,ping" and ,,traceroute" Funktionen) - Simple Network Management Protocol (SNMP) - DNSRessourcenmanagement Architektur R R R R R R S R R R S S QoS Architektur Harte und weiche QoS Garantien DiffServ Netz mit

  5. Polygonal Numbers, Primes and Ternary Quadratic Forms

    E-Print Network [OSTI]

    Sun, Zhi-Wei

    Polygonal Numbers, Primes and Ternary Quadratic Forms Zhi-Wei Sun Nanjing University Nanjing 210093 three papers: Z. W. Sun [Acta Arith. 2007], S. Guo, H. Pan & Z. W. Sun [Integers, 2007], and B. K. Oh

  6. High speed optical quantum random number generation

    E-Print Network [OSTI]

    Weinfurter, Harald

    High speed optical quantum random number generation Martin F¨urst1,2,, Henning Weier1,2, Sebastian/publicationFile/30276/ais20 pdf.pdf (1999). 2. "Fips 140-2, security requirements for cryptographic modules

  7. Unpredictability and the transmission of numbers

    E-Print Network [OSTI]

    Myers, John M

    2015-01-01

    Curiously overlooked in physics is its dependence on the transmission of numbers. For example the transmission of numerical clock readings is implicit in the concept of a coordinate system. The transmission of numbers and other logical distinctions is often achieved over a computer-mediated communications network in the face of an unpredictable environment. By unpredictable we mean something stronger than the spread of probabilities over given possible outcomes, namely an opening to unforeseeable possibilities. Unpredictability, until now overlooked in theoretical physics, makes the transmission of numbers interesting. Based on recent proofs within quantum theory that provide a theoretical foundation to unpredictability, here we show how regularities in physics rest on a background of channels over which numbers are transmitted. As is known to engineers of digital communications, numerical transmissions depend on coordination reminiscent of the cycle of throwing and catching by players tossing a ball back and...

  8. Department.: Music Department Course number: 210W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Music Department Course number: 210W Course title: Music, History, and Ideas Credits: 3 Contact Person: Alain Frogley Catalog Copy: MUSI 210W. Music, History, and Ideas Either semester

  9. Department.: Psychology Course Number: PSYC 210W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 210W Course Title: Lab in Cognition Credits: 3 Contact in these experiments, the writing assignments provide a richer and fuller of the nature of psychological inquiry

  10. Department.: Psychology Course Number: PSYC 244W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 244W Course Title: Laboratory in Personality Credits: 3 Psychological Association. The total report is at least 15 pages in length. The final report is the primary

  11. Department.: Psychology Course Number: PSYC 263W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 263W Course Title: Laboratory in Animal Learning or 253 , and consent of instructor; ENGL 105 or 110 or 111 or 250 . W Criteria: Psychology 263W is a lab

  12. Student ID (R) Number ________________________ Semester/Year______ ________________________

    E-Print Network [OSTI]

    Rock, Chris

    Student ID (R) Number ________________________ Semester/Year______ ________________________ THIRD: ______________________________________________________ CHECK ALL THAT APPLY: _____First-time Third Party Student _____TTU Campus Student _____Non sponsor and the Third Party Sponsor Agreement prior to the due date to ensure timely posting of third

  13. Computing the Betti Numbers of Arrangements

    E-Print Network [OSTI]

    2015-08-29

    To our knowledge ... on ?. Categories and Subject Descriptors ... sets defined in terms of such hypersurfaces can be topolog- ... The first bounds on the individual Betti numbers of semi- .... The idea of using filtrations for computing Betti num-.

  14. Small Winding-Number Expansion: Vortex Solutions at Critical Coupling

    E-Print Network [OSTI]

    Keisuke Ohashi

    2015-07-22

    We study an axially symmetric solution of a vortex in the Abelian-Higgs model at critical coupling in detail. Here we propose a new idea for a perturbative expansion of a solution, where the winding number of a vortex is naturally extended to be a real number and the solution is expanded with respect to it around its origin. We test this idea on three typical constants contained in the solution and confirm that this expansion works well with the help of the Pad\\'e approximation. For instance, we analytically reproduce the value of the scalar charge of the vortex with an error of $O(10^{-6})$. This expansion is also powerful even for large winding numbers.

  15. Small Winding-Number Expansion: Vortex Solutions at Critical Coupling

    E-Print Network [OSTI]

    Keisuke Ohashi

    2015-09-01

    We study an axially symmetric solution of a vortex in the Abelian-Higgs model at critical coupling in detail. Here we propose a new idea for a perturbative expansion of a solution, where the winding number of a vortex is naturally extended to be a real number and the solution is expanded with respect to it around its origin. We test this idea on three typical constants contained in the solution and confirm that this expansion works well with the help of the Pad\\'e approximation. For instance, we analytically reproduce the value of the scalar charge of the vortex with an error of $O(10^{-6})$. This expansion is also powerful even for large winding numbers.

  16. Small Winding-Number Expansion: Vortex Solutions at Critical Coupling

    E-Print Network [OSTI]

    Ohashi, Keisuke

    2015-01-01

    We study an axially symmetric solution of a vortex in the Abelian-Higgs model at critical coupling in detail. Here we propose a new idea for a perturbative expansion of a solution, where the winding number of a vortex is naturally extended to be a real number and the solution is expanded with respect to it around its origin. We test this idea on three typical constants contained in the solution and confirm that this expansion works well with the help of the Pad\\'e approximation. For instance, we analytically reproduce the value of the scalar charge of the vortex with an error of $O(10^{-6})$. This expansion is also powerful even for large winding numbers.

  17. Bulletin of Tibetology: Volume 3 Number 3 : Full issue

    E-Print Network [OSTI]

    Namgyal Institute of Tibetology

    ourselves before the gates of the Tholing shrine on the evening of 14 August 1922. The intrepid mountaineer Professor Shiv Ram KashYIiIP of the Indian Educational Service had led a party of four lecturers (including myself) of the Khalsa College, Amritsar... of Damphu (tambourine) are composed either in Tamang dialect or in Nepali language. In my primary school days I often heard my Tamang class friends singing: 'Bara Tamang Athara Jet Goru ko Tauko Dhana ko Bhat: In simple language the song explains...

  18. Dynaically Responsive IP Window Coatings

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pacific Northwest National Laboratory Dynamically Responsive IR Window Coatings 2014 Building Technologies Office Peer Review 2 Project Summary Timeline: Start date:...

  19. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of a publication or guarantee its technical correctness. Title: Northern New Mexico Climate, Water Year 2012 at Los Alamos National Laboratory, Poster, Individual Permit for...

  20. IP Awareness Seminar Presented by

    E-Print Network [OSTI]

    Yang, Eui-Hyeok

    /Patent Process at Stevens Inventor Idea Issued Patent 2 ­ 4 Years US PTO Inventor Incentives Inventor OIE: Details, Details, 1. "First-Inventor-to-File" system ­ Effective Date: March 16, 2013. 3. Post requirement that an individual inventor be listed as the applicant. Effective Date: Applies to applications

  1. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch88 Sign In About | Careers |

  2. True random numbers from amplified quantum vacuum

    E-Print Network [OSTI]

    M. Jofre; M. Curty; F. Steinlechner; G. Anzolin; J. P. Torres; M. W. Mitchell; V. Pruneri

    2011-10-17

    Random numbers are essential for applications ranging from secure communications to numerical simulation and quantitative finance. Algorithms can rapidly produce pseudo-random outcomes, series of numbers that mimic most properties of true random numbers while quantum random number generators (QRNGs) exploit intrinsic quantum randomness to produce true random numbers. Single-photon QRNGs are conceptually simple but produce few random bits per detection. In contrast, vacuum fluctuations are a vast resource for QRNGs: they are broad-band and thus can encode many random bits per second. Direct recording of vacuum fluctuations is possible, but requires shot-noise-limited detectors, at the cost of bandwidth. We demonstrate efficient conversion of vacuum fluctuations to true random bits using optical amplification of vacuum and interferometry. Using commercially-available optical components we demonstrate a QRNG at a bit rate of 1.11 Gbps. The proposed scheme has the potential to be extended to 10 Gbps and even up to 100 Gbps by taking advantage of high speed modulation sources and detectors for optical fiber telecommunication devices.

  3. Unpredictability and the transmission of numbers

    E-Print Network [OSTI]

    John M. Myers; F. Hadi Madjid

    2015-08-05

    Curiously overlooked in physics is its dependence on the transmission of numbers. For example the transmission of numerical clock readings is implicit in the concept of a coordinate system. The transmission of numbers and other logical distinctions is often achieved over a computer-mediated communications network in the face of an unpredictable environment. By unpredictable we mean something stronger than the spread of probabilities over given possible outcomes, namely an opening to unforeseeable possibilities. Unpredictability, until now overlooked in theoretical physics, makes the transmission of numbers interesting. Based on recent proofs within quantum theory that provide a theoretical foundation to unpredictability, here we show how regularities in physics rest on a background of channels over which numbers are transmitted. As is known to engineers of digital communications, numerical transmissions depend on coordination reminiscent of the cycle of throwing and catching by players tossing a ball back and forth. In digital communications, the players are computers, and the required coordination involves unpredictably adjusting "live clocks" that step these computers through phases of a cycle. We show how this phasing, which we call `logical synchronization,' constrains number-carrying networks, and, if a spacetime manifold in invoked, put "stripes" on spacetime. Via its logically synchronized channels, a network of live clocks serves as a reference against which to locate events. Such a network in any case underpins a coordinate frame, and in some cases the direct use of a network can be tailored to investigate an unpredictable environment. Examples include explorations of gravitational variations near Earth.

  4. THE NATIVE AND NONNATIVE PROCESSING OF NUMBER AND GENDER AGREEMENT IN SPANISH: AN ERP INVESTIGATION

    E-Print Network [OSTI]

    Aleman Banon, Jose

    2012-08-31

    The present study utilizes EEG to examine the processing of number and gender agreement in Spanish by native speakers and adult English-speaking learners. With respect to native processing, the study focuses on how different ...

  5. Can Problem Solving Affect the Understanding of Rational Numbers in the Middle School Setting? 

    E-Print Network [OSTI]

    Meredith, Krystal B.

    2010-07-14

    In this study, problem solving provided deeper meaning and understanding through the implementation of a structured problem solving strategy with the teaching of rational numbers. This action-research study was designed as a quasi-experimental model...

  6. Using the QBO to predict the number of hurricanes hitting the U.S

    E-Print Network [OSTI]

    Coughlin, Katie

    2007-01-01

    A simple study of the relationship between the QBO and the number of hurricanes in the Atlantic, both in the Basin and hitting the U.S. coastline, demonstrates that the QBO is not a particularly useful index to help predict hurricane numbers on five-year time scales. It is shown that there is very little difference between the number of hurricanes following easterly winds in the equatorial stratosphere and the number that follow westerly winds. Given this it is reasonable one would make better predictions just using the mean number of hurricanes in lieu of using the QBO and this is also simply demonstrated here.

  7. Baryon Number as the Fourth Color

    E-Print Network [OSTI]

    Fornal, Bartosz; Tait, Tim M P

    2015-01-01

    We propose an extension of the Standard Model in which baryon number is promoted to be part of a non-Abelian gauge symmetry at high energies. Specifically, we consider the gauge group SU(4) x SU(2)_L x U(1)_X, where the SU(4) unifies baryon number and color. This symmetry is spontaneously broken down to the Standard Model gauge group at a scale which can be as low as a few TeV. The SU(4) structure implies that each SM quark comes along with an uncolored quark partner, the lightest of which is stabilized by the generalized baryon number symmetry and can play the role of dark matter. We explore circumstances under which one can realize a model of asymmetric dark matter whose relic abundance is connected to the observed baryon asymmetry, and discuss unique signatures that can be searched for at the LHC.

  8. Hypergraph Ramsey Numbers and Adiabatic Quantum Algorithm

    E-Print Network [OSTI]

    Ri Qu; Yan-ru Bao

    2012-07-18

    Gaitan and Clark [Phys. Rev. Lett. 108, 010501 (2012)] have recently presented a quantum algorithm for the computation of the Ramsey numbers R(m, n) using adiabatic quantum evolution. We consider that the two-color Ramsey numbers R(m, n; r) for r-uniform hypergraphs can be computed by using the similar ways in [Phys. Rev. Lett. 108, 010501 (2012)]. In this comment, we show how the computation of R(m, n; r) can be mapped to a combinatorial optimization problem whose solution be found using adiabatic quantum evolution.

  9. Probing lepton number violation on three frontiers

    SciTech Connect (OSTI)

    Deppisch, Frank F. [Department of Physics and Astronomy, University College London (United Kingdom)

    2013-12-30

    Neutrinoless double beta decay constitutes the main probe for lepton number violation at low energies, motivated by the expected Majorana nature of the light but massive neutrinos. On the other hand, the theoretical interpretation of the (non-)observation of this process is not straightforward as the Majorana neutrinos can destructively interfere in their contribution and many other New Physics mechanisms can additionally mediate the process. We here highlight the potential of combining neutrinoless double beta decay with searches for Tritium decay, cosmological observations and LHC physics to improve the quantitative insight into the neutrino properties and to unravel potential sources of lepton number violation.

  10. Determine Ramsey numbers on a quantum computer

    E-Print Network [OSTI]

    Hefeng Wang

    2015-10-07

    We present a quantum algorithm for computing the Ramsey numbers whose computational complexity grows super-exponentially with the number of vertices of a graph on a classical computer. The problem is mapped to a decision problem on a quantum computer, a probe qubit is coupled to a register that represents the problem and detects the energy levels of the problem Hamiltonian. The decision problem is solved by determining whether the probe qubit exhibits resonance dynamics. The algorithm shows a quadratic speedup over its classical counterparts, and the degenerate ground state problem in the adiabatic quantum evolution algorithm for this problem is avoided.

  11. Compare Activities by Number of Employees

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr May Jun Jul Aug Sep3,118,592Number of ComputersNumber

  12. The New Element Curium (Atomic Number 96)

    DOE R&D Accomplishments [OSTI]

    Seaborg, G. T.; James, R. A.; Ghiorso, A.

    1948-00-00

    Two isotopes of the element with atomic number 96 have been produced by the helium-ion bombardment of plutonium. The name curium, symbol Cm, is proposed for element 96. The chemical experiments indicate that the most stable oxidation state of curium is the III state.

  13. Department .: Sociology Course number : Soci 290W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department .: Sociology Course number : Soci 290W Title : Social Movements and Social Change Credits : 3 Contact Person : Brad Wright Catalog Copy : Soci 290. Social Movements and Social Change, and escapist movements. Soci 290W. Social Movements and Social Change. Prerequisite: Engl 110 or 111 or 250. W

  14. Department .: Sociology Course number : Soci 227W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department .: Sociology Course number : Soci 227W Title : Revolutionary Social Movements Around the World Credits : 3 Contact Person : Brad Wright Catalog Copy : Soci 227. Revolutionary Social Movements, and Nicaraguan revolutions and movements in South Africa and the Middle East. Soci 227W. Revolutionary Social

  15. Entropy Numbers, Operators and Support Vector Kernels

    E-Print Network [OSTI]

    Botea, Adi

    feature of the present paper is the manner in which we directly bound the covering numbers of interest Supported by the Australian Research Council and the DFG (# Ja 379/71). P. Fischer and H.U. Simon (Eds.): EuroCOLT'99, LNAI 1572, pp. 285­298, 1999. c Springer-Verlag Berlin Heidelberg 1999 #12;286 Robert C

  16. Code Number: Department of Mechanical Engineering

    E-Print Network [OSTI]

    Feeny, Brian

    that the drag force on a plate of length L is given by = L wallD wdxxF 0 )( , calculate the overall drag if the Reynolds number ReL is large making the drag coefficient small, the drag force FD becomes large. Use of a falling sphere depends on the sphere diameter, sphere density, fluid density, fluid viscosity

  17. Department: HISTORY Course number: 3551 W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department: HISTORY Course number: 3551 W Course title: Topics in U.S. Legal History Credits: 3 Contact Person: Sherri Olson Q/W: W Catalog Copy:HIST 3551W [248W]. Topics in U.S.Legal History. 3 credits

  18. Department: HISTORY Course number: 3412 W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department: HISTORY Course number: 3412 W Course title: Intellectual and Social History of Europe]. Intellectual and Social History of Europe in the Nineteenth Century LANSING, DINTENFASS Prerequisite: ENGL 105 or 110 or 111 or 250. Course Information: The course explores the history of European thought in its

  19. QUARTERLY OF APPLIED MATHEMATICS VOLUME , NUMBER 0

    E-Print Network [OSTI]

    Zhu, Song Chun

    reweighting the energy function. We construct ELMs in the model space for two classic statistical learning, two-step EM and Swendsen-Wang cuts, in the energy landscapes. 1. Introduction. In many statisticalQUARTERLY OF APPLIED MATHEMATICS VOLUME , NUMBER 0 XXXX XXXX, PAGES 000­000 MAPPING ENERGY

  20. Maine Number of Natural Gas Consumers

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    20,806 21,142 22,461 23,555 24,765 27,047 1987-2014 Sales 21,141 22,461 23,555 24,765 27,047 1997-2014 Transported 1 0 0 0 0 2010-2014 Commercial Number of Consumers 8,815 9,084...

  1. Department.: Marketing Course number: MKTG 4997W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Marketing Course number: MKTG 4997W Course title: Senior Thesis in Marketing Credits that it become a 'W' course: 4997. Senior Thesis in Marketing (296) Either semester. Three credits. Hours by arrangement. Prerequisite: Open only to Marketing Department Honor Students with consent of instructor

  2. Materials Science Volume 7, Number 4

    E-Print Network [OSTI]

    Poeppelmeier, Kenneth R.

    Materials Science TM Volume 7, Number 4 Technologies for a changing world Nanomaterials for Energy Conversion and Storage Electrode Materials for Lithium Ion Batteries Surface-enhanced Solar Energy Convesion Changing the Landscape of Environmental and Energy Research Through Novel Nanoscale Materials #12

  3. Department: Art History Course number: 3050W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department: Art History Course number: 3050W Course title: African American Art Credits: 3 Contact Person:Jean Givens Content Area: Q/W: W only Catalog Copy:ARTH 3050W African American Art, Either semester. 3 credits The artistic and social legacy of African American art from the eighteenth century

  4. Department: Art & Art History Course number: 3375

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department: Art & Art History Course number: 3375 Course title: Indian Art and Popular Culture Copy: ART 244/3375: Indian Art and Popular Culture: Independence to the Present, 3 credits. Either semester. Instructor: Myers. An interdisciplinary studio art course introducing modern, contemporary, folk

  5. Department: Journalism Course number: 3045W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department: Journalism Course number: 3045W Course title: Specialized Reporting Credits: 3 Contact Person: Wayne Worcester Q/W: W Catalog Copy: JOUR 245W. Specialized Journalism Either semester. Three and feature stories and journalism that demands unswerving accuracy, uncommon grace and thoughtful context

  6. Ramsey numbers of cubes versus cliques

    E-Print Network [OSTI]

    Conlon, David

    The cube graph Q[subscript n] is the skeleton of the n-dimensional cube. It is an n-regular graph on 2[superscript n] vertices. The Ramsey number r(Q[subscript n] ;K[subscript s]) is the minimum N such that every graph of ...

  7. Department: Statistics Course number: STAT 202W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department: Statistics Course number: STAT 202W Title: Undergraduate Seminar II Credits: 1 Contact, and choose one statistical topic to investigate in detail. The student will write a well revised will attend 6-8 seminars per semester, and choose one statistical topic to investigate in detail. The student

  8. Family Name: . . . . . . . . . . . . . . . . . . . . . . . . . . Other Names: . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ID Number: . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

    E-Print Network [OSTI]

    ; } double price = 54.70 + numberComponents 18.36; return price; } (a) [1 mark] What is the name using BlueJ and enter "Yes" in the dialog box asking for the value of ans). What will it print out? HintStuffOut(String ans){ System.out.println("printStuffOut(" + ans + "):"); String first = "Maybe"; String third = ans

  9. Washington Number of Natural Gas Consumers

    Gasoline and Diesel Fuel Update (EIA)

    059,239 1,067,979 1,079,277 1,088,762 1,102,318 1,118,193 1987-2014 Sales 1,067,979 1,079,277 1,088,762 1,102,318 1,118,193 1997-2014 Commercial Number of Consumers 98,965 99,231...

  10. Building Grassmann Numbers from PI-Algebras

    E-Print Network [OSTI]

    Ricardo M. Bentin; Sergio Mota

    2012-04-06

    This works deals with the formal mathematical structure of so called Grassmann Numbers applied to Theoretical Physics, which is a basic concept on Berezin integration. To achieve this purpose we make use of some constructions from relative modern Polynomial Identity Algebras (PI-Algebras) applied to the special case of the Grassmann algebra.

  11. Department.: Psychology Course Number: PSYC 239W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 239W Course Title: Current Topics in Developmental Psychology Credits: 3 Contact Person: John Rickards Catalog Copy: Current Topics in Developmental Psychology Division of the Department of Psychology, the faculty have used this "Current Topics" course to fulfill

  12. Department.: Psychology Course Number: PSYC 242W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 242W Course Title: Laboratory in Social Psychology ; PSYC 240 , and consent of instructor. Methods and techniques of research in social psychology psychology in order to be the best resources to the students, given the subject matter. #12;

  13. Department :PSYCHOLOGY Course number: 3370 W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department :PSYCHOLOGY Course number: 3370 W Course title: Current Topics in Clinical Psychology Psychology. Three credits. Either semester. Prerequisite: PSYC 243 or PSYC 245 or PSYC 245W or consent of instructor. May be repeated for credit with a change in topic. Justification: Clinical psychology is an area

  14. Department.: Psychology Course Number: PSYC 245W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 245W Course Title: Abnormal Psychology Credits: 3 Criteria: 1. This course covers topics in abnormal psychology, including specific syndromes in several ways. First, the students must read relevant chapters of the Psychology Student Writer's Manual

  15. Department.: Psychology Course Number: PSYC 282W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 282W Course Title: Social-Organizational Psychology Credits: 3 Contact Person: John Rickards Catalog Copy: PSYC 282W. Social-Organizational Psychology. Either semester. Three credits. Prerequisite: PSYC 268 or PSYC 240. Barnes-Farell, Magley. Social psychological

  16. Department.: Psychology Course Number: PSYC 202QW

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 202QW Course Title: Principles of Research in Psychology Credits: 4 Contact Person: Charles A. Lowe, Department Head Catalog Copy : PSYC 202QW. Principles of Research in Psychology Either semester. Four credits. Three 1-hour lecture periods and one 2-hour

  17. Department.: Psychology Course Number: PSYC 232W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 232W Course Title: Laboratory in Developmental Credits psychological research on young children; advanced topics. W Criteria: - The students will perform both as laboratory reports after each is completed. The reports will follow American Psychological Association

  18. Department.: Psychology Course Number: PSYC 280W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 280W Course Title: Current Topics in Industrial/Organizational Psychology Credits: 3 Contact Person: John Rickards Competency Group: W only Catalog Copy: PSYC 280W. Current Topics in Industrial/Organizational Psychology. Three credits. Either semester. Prerequisites: PSYC 135

  19. Department.: Psychology Course Number: PSYC 241W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 241W Course Title: Current Topics in Social Psychology Credits: 3 Contact Person: John Rickards Catalog Copy: 241W. Current Topics in Social Psychology. Semester of bias, communication of prejudice, self-in social psychology, psychosocial aspects of the HIV epidemic

  20. Department.: Psychology Course Number: PSYC 291W

    E-Print Network [OSTI]

    Alpay, S. Pamir

    Department.: Psychology Course Number: PSYC 291W Course Title: The History and Systems of Psychology Credits: 3 Contact Person: John Rickards Catalog Copy: PSYC 291W. The History and Systems of Psychology. Prerequisite: PSYC 135 or 133; ENGL 105 or 110 or 111 or 250. W Criteria: 1. The History

  1. Data Conversion in Residue Number System

    E-Print Network [OSTI]

    Zilic, Zeljko

    ;2 Abstract This thesis tackles the problem of data conversion in the Residue Number System (RNS). The RNS has the use of RNS at the applications. In this thesis, we aim at developing efficient schemes for the conversion from the conventional representation to the RNS representation and vice versa. The conventional

  2. Customer Service Specialist Job Number: 54844874

    E-Print Network [OSTI]

    Heller, Barbara

    Customer Service Specialist Job Number: 54844874 Company Name: Baxter International, Inc Job to the customer and/or the sales team including any corrective actions needed to prevent the failure in the future: Medical Information, Distribution Centers, Planning and Deployment, Credit and Collections, Customer

  3. Integrality of L2 -Betti numbers

    E-Print Network [OSTI]

    Schick, Thomas

    Integrality of L2 -Betti numbers Thomas Schick FB Mathematik -- Universit¨at M¨unster Germany Last algebraic question: e-mail: thomas.schick@math.uni-muenster.de www: http://www.math.uni-muenster.de/u/schickt/ Fax: ++49 -251/83 38370 1 #12;2 Thomas Schick 1.2 Definition. Let Z Q be an additive subgroup

  4. Code Number :.............. HEAT TRANSFER QUALIFYING EXAM

    E-Print Network [OSTI]

    Feeny, Brian

    is at 40 °C, estimate the heat transfer per unit length by radiation and convection between the twoCode Number :.............. HEAT TRANSFER QUALIFYING EXAM January 2010 OPEN BOOK (only one book) The heat transfer coefficient c) The length of pipe needed for a 35 °C increase in mean temperature d

  5. Policy Title: Policy Number: Federal Student Aid

    E-Print Network [OSTI]

    Franco, John

    . All such officials shall further distribute the Code to their direct and indirect reports who havePolicy Title: Policy Number: Federal Student Aid Code of Conduct 1.3.3 Category: Administrative Office of the Bursar University of Cincinnati Federal Student Aid Code of Conduct, page 1 of 5 Background

  6. NUMBER: 1530 TITLE: Code of Student Conduct

    E-Print Network [OSTI]

    . For the purposes of this Code, the term "University Official" is inclusive of "Faculty Member" as defined in IV 1530 1 NUMBER: 1530 TITLE: Code of Student Conduct APPROVED: August 27, 1970; Revised June 14, 2012 I. BASIS AND RATIONALE FOR A CODE OF STUDENT CONDUCT Old Dominion University

  7. Random Numbers Certified by Bell's Theorem

    E-Print Network [OSTI]

    S. Pironio; A. Acin; S. Massar; A. Boyer de la Giroday; D. N. Matsukevich; P. Maunz; S. Olmschenk; D. Hayes; L. Luo; T. A. Manning; C. Monroe

    2010-10-19

    Randomness is a fundamental feature in nature and a valuable resource for applications ranging from cryptography and gambling to numerical simulation of physical and biological systems. Random numbers, however, are difficult to characterize mathematically, and their generation must rely on an unpredictable physical process. Inaccuracies in the theoretical modelling of such processes or failures of the devices, possibly due to adversarial attacks, limit the reliability of random number generators in ways that are difficult to control and detect. Here, inspired by earlier work on nonlocality based and device independent quantum information processing, we show that the nonlocal correlations of entangled quantum particles can be used to certify the presence of genuine randomness. It is thereby possible to design of a new type of cryptographically secure random number generator which does not require any assumption on the internal working of the devices. This strong form of randomness generation is impossible classically and possible in quantum systems only if certified by a Bell inequality violation. We carry out a proof-of-concept demonstration of this proposal in a system of two entangled atoms separated by approximately 1 meter. The observed Bell inequality violation, featuring near-perfect detection efficiency, guarantees that 42 new random numbers are generated with 99% confidence. Our results lay the groundwork for future device-independent quantum information experiments and for addressing fundamental issues raised by the intrinsic randomness of quantum theory.

  8. MARINE RESEARCH Volume 56, Number 1

    E-Print Network [OSTI]

    Balmforth, Neil

    Journal of MARINE RESEARCH Volume 56, Number 1 Enhanced dispersion of near-inertial waves at San Diego, La Jolla, California, 92093- 0230, U.S.A. Journal of Marine Research, 56, 1­40, 1998 1 #12 the near-inertial energy in the mixed layer returns to backgroundlevels on a time scale of ten to twenty

  9. NUMBER: 1626 TITLE: Information Technology Management

    E-Print Network [OSTI]

    cost of more than $100,000 but less than $1 million. E. University Advisory Council on Technology (UACT technology project estimated to cost $1 million or more or deemed to be mission-critical. VI. Designated1626 - 1 NUMBER: 1626 TITLE: Information Technology Management APPROVED: September 9, 2005 I

  10. Clar number of catacondensed benzenoid hydrocarbons

    E-Print Network [OSTI]

    Klavzar, Sandi

    Clar number of catacondensed benzenoid hydrocarbons Sandi Klavzara, , Petra Zigerta , Ivan Gutmanb sextets in any of the Clar formulae) of a catacondensed benzenoid hydrocarbon: CL is equal to the minimum; Resonance graph; Benzenoid hydrocarbons 1. Introduction Within the theory that was formulated [1, 2

  11. PROCESSING STUDENT RECORDS Generating Permission Numbers

    E-Print Network [OSTI]

    Ottino, Julio M.

    Numbers Find an Existing Value page appears. Enter the desired Term and Subject Area codes in the fields provided or click on the magnifying glass icon to lookup a term or subject (to narrow your search, type to Records and Enrollment, Term Processing, Class Permissions, Class Permissions. The Class Permission

  12. Particle Number Fluctuations for van der Waals Equation of State

    E-Print Network [OSTI]

    V. Vovchenko; D. V. Anchishkin; M. I. Gorenstein

    2015-02-04

    The van der Waals (VDW) equation of state describes a thermal equilibrium in system of particles, where both repulsive and attractive interactions between them are included. This equation predicts an existence of the 1st order liquid-gas phase transition and the critical point. The standard form of the VDW equation is given by the pressure function in the canonical ensemble (CE) with a fixed number of particles. In the present paper the VDW equation is transformed to the grand canonical ensemble (GCE). We argue that this procedure can be useful for new physical applications. Particularly, the fluctuations of number of particles, which are absent in the CE, can be studied in the GCE. For the VDW equation of state in the GCE the particle number fluctuations are calculated for the whole phase diagram, both outside and inside the liquid-gas mixed phase region. It is shown that the scaled variance of these fluctuations remains finite within the mixed phase and goes to infinity at the critical point. The GCE formulation of the VDW equation of state can be also an important step for its application to a statistical description of hadronic systems, where numbers of different particle species are usually not conserved.

  13. Page 1 of 33 3 STYLE HEADING NUMBER FOR CHP. (USED FOR FIG. NUMBERING)

    E-Print Network [OSTI]

    Baker, Jack W.

    Page 1 of 33 3 STYLE HEADING NUMBER FOR CHP. (USED FOR FIG. NUMBERING) ACCOUNTING FOR GROUND MOTION intensities considered in the original building design. For modern buildings in the western United States for this spectral shape effect is through selection of a set of ground motions that is specific to the building

  14. Call Numbers Explained 1 8/23/2012 Call Numbers Explained

    E-Print Network [OSTI]

    Su, Xiao

    . In the library, books are organized by call number. 3. A call number classifies a book by its subject and tells in the library. 6. The King Library is unusual because it is both a public library and a university library. Because of this, it uses two different classification systems. That is, two different types of call

  15. Diophantine Equations and Congruent Number Equation Solutions

    E-Print Network [OSTI]

    Mamuka Meskhishvili

    2015-04-16

    By using pairs of nontrivial rational solutions of congruent number equation $$ C_N:\\;\\;y^2=x^3-N^2x, $$ constructed are pairs of rational right (Pythagorean) triangles with one common side and the other sides equal to the sum and difference of the squares of the same rational numbers. The parametrizations are found for following Diophantine systems: \\begin{align*} (p^2\\pm q^2)^2-a^2 & =\\square_{1,2}\\,, \\\\[0.2cm] c^2-(p^2\\pm q^2)^2 & =\\square_{1,2}\\,, \\\\[0.2cm] a^2+(p^2\\pm q^2)^2 & =\\square_{1,2}\\,, \\\\[0.2cm] (p^2\\pm q^2)^2-a^2 & =(r^2\\pm s^2)^2. \\end{align*}

  16. Cost Center: 9417 Job Number: 5501

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    Cost Center: 9417 Job Number: 5501 Job Title: Coil Bus Runs Job Manager: Mark Smith Estimate (user input) SCHEDULE FY09$K HOURS (priced at FY09 rates) ` % USER INPUT TASKS AND DESCRIPTIONS USER INPU $1**EM(analysisengr) EA**(Designer) EC**EM(computingEng EC**SB(ComputingTec EC**TB(ComputingTec EE**EM(ElctrEngr) EE**SM(SeniorElectr

  17. Multicolor Ramsey Numbers Involving K3 + e and K4 -e

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    On Some Multicolor Ramsey Numbers Involving K3 + e and K4 - e Daniel S. Shetler Department: The Ramsey number R(G1, G2, G3) is the smallest positive in- teger n such that for all 3-colorings color. We study the bounds on various 3-color Ramsey numbers R(G1, G2, G3), where Gi {K3, K3 + e, K4

  18. Fractal sets of dual topological quantum numbers

    E-Print Network [OSTI]

    Wellington da Cruz

    2004-06-18

    The universality classes of the quantum Hall transitions are considered in terms of fractal sets of dual topological quantum numbers filling factors, labelled by a fractal or Hausdorff dimension defined into the interval $1 < h < 2$ and associated with fractal curves. We show that our approach to the fractional quantum Hall effect-FQHE is free of any empirical formula and this characteristic appears as a crucial insight for our understanding of the FQHE. According to our formulation, the FQHE gets a fractal structure from the connection between the filling factors and the Hausdoff dimension of the quantum paths of particles termed fractons which obey a fractal distribution function associated with a fractal von Neumann entropy. This way, the quantum Hall transitions satisfy some properties related to the Farey sequences of rational numbers and so our theoretical description of the FQHE establishes a connection between physics, fractal geometry and number theory. The FQHE as a convenient physical system for a possible prove of the Riemann hypothesis is suggested.

  19. About the logic of the prime number distribution

    E-Print Network [OSTI]

    Harry K. Hahn

    2008-01-28

    There are two basic number sequences which play a major role in the prime number distribution. The first Number Sequence SQ1 contains all prime numbers of the form 6n+5 and the second Number Sequence SQ2 contains all prime numbers of the form 6n+1. All existing prime numbers seem to be contained in these two number sequences, except of the prime numbers 2 and 3. Riemanns Zeta Function also seems to indicate, that there is a logical connection between the mentioned number sequences and the distribution of prime numbers. This connection is indicated by lines in the diagram of the Zeta Function, which are formed by the points s where the Zeta Function is real. Another key role in the distribution of the prime numbers plays the number 5 and its periodic occurrence in the two number sequences SQ1 and SQ2. All non-prime numbers in SQ1 and SQ2 are caused by recurrences of these two number sequences with increasing wave-lengths in themselves, in a similar fashion as Overtones (harmonics) or Undertones derive from a fundamental frequency. On the contrary prime numbers represent spots in these two basic Number Sequences SQ1 and SQ2 where there is no interference caused by these recurring number sequences. The distribution of the non-prime numbers and prime numbers can be described in a graphical way with a -Wave Model- (or Interference Model) -- see Table 2.

  20. Analysis, Design, and Testing of Airfoils for Use at Ultra-Low Reynolds Numbers

    E-Print Network [OSTI]

    Stanford University

    Analysis, Design, and Testing of Airfoils for Use at Ultra- Low Reynolds Numbers Peter J. Kunz Ilan M. Kroo Abstract: Advances in technology have begun to make ultra-low Reynolds number flight a real of the relevant aerodynamics. A reasonable starting point is the study of airfoil section aerodynamics at ultra-low

  1. Willingness to Pay for Strawberries: Effect of Number of Choices Using Nonhypothetical Valuation Procedures 

    E-Print Network [OSTI]

    Chavez, Daniel

    2015-07-15

    TO PAY FOR STRAWBERRIES: EFFECT OF NUMBER OF CHOICES USING NONHYPOTHETICAL VALUATION PROCEDURES A Thesis by DANIEL EDUARDO CHAVEZ Submitted to the Office of Graduate and Professional Studies of Texas A&M University in partial fulfillment.... ......................................................................................... 39 Table 4: Kruskal-Wallis results for WTP for strawberries variety with number of alternatives. ............................................................................................................ 40 Table 5. Wilcoxon rank-sum test z...

  2. HIGH LEWIS NUMBER COMBUSTION WAVEFRONTS JOHN HORNIBROOK, SANJEEVA BALASURIYA, AND STEPHANE LAFORTUNE

    E-Print Network [OSTI]

    Sydney, University of

    HIGH LEWIS NUMBER COMBUSTION WAVEFRONTS JOHN HORNIBROOK, SANJEEVA BALASURIYA, AND ST are inherently unstable. Key words. Combustion waves, high Lewis number, wavespeed, stability, Evans function. In this article, we study the wavespeed and stability of a combustion wavefront along a one-dimensional medium

  3. On the Distribution of the Subset Sum Pseudorandom Number Generator on Elliptic

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    On the Distribution of the Subset Sum Pseudorandom Number Generator on Elliptic Curves Simon R a previous result in this direction due to E. El Mahassni. 1 Introduction The knapsack generator or subset sum generator is a pseudorandom number generator introduced by Rueppel and Massey [14] and studied

  4. Halo occupation numbers and galaxy bias

    E-Print Network [OSTI]

    J. A. Peacock; R. E. Smith

    2000-06-30

    We propose a heuristic model that displays the main features of realistic theories for galaxy bias. We show that the low-order clustering statistics of the dark-matter distribution depend almost entirely on the locations and density profiles of dark-matter haloes. A hypothetical galaxy catalogue depends on (i) the efficiency of galaxy formation, as manifested by the halo occupation number -- the number of galaxies brighter than some sample limit contained in a halo of a given mass; (ii) the location of these galaxies within their halo. The first factor is constrained by the empirical luminosity function of groups. For the second factor, we assume that one galaxy marks the halo centre, with any remaining galaxies acting as satellites that trace the halo mass. These simple assumptions amount to a recipe for non-local bias, in which the probability of finding a galaxy is not a simple function of its local mass density. We have applied this prescription to some CDM models of current interest, and find that the predictions are close to the observed galaxy correlations for a flat $\\Omega=0.3$ model ($\\Lambda$CDM), but not for an $\\Omega=1$ model with the same power spectrum ($\\tau$CDM). This is an inevitable consequence of cluster normalization for the power spectra: cluster-scale haloes of given mass have smaller core radii for high $\\Omega$, and hence display enhanced small-scale clustering. Finally, the pairwise velocity dispersion of galaxies in the $\\Lambda$CDM model is lower than that of the mass, allowing cluster-normalized models to yield a realistic Mach number for the peculiar velocity field. This is largely due to the strong variation of galaxy-formation efficiency with halo mass that is required in this model.

  5. Texas Rice, Volume II, Number

    E-Print Network [OSTI]

    2002-01-01

    Texas A&M University System Agricultural Research and Extension Center Beaumont, Texas June 2002 Volume II Number 4 Texas Rice A Tribute to David Wintermann 28th Annual Field Day at Eagle Lake David Wintermann’s active in- volvement... Sugar Refinery near Eagle Lake and in 1909 he, along with other investors, in- corporated Lakeside Irrigation Co. (previously Eagle Lake Ir- rigation Co.) When R.J. died in 1910, he left all his prop- erty to his wife Louise, and $25,000 to each of his...

  6. Texas Rice, Volume VII, Number

    E-Print Network [OSTI]

    2007-01-01

    Texas A&M University System Agricultural Research and Extension Center Beaumont, Texas September 2007 Volume VII Number 7 Texas Rice Nobel Peace Prize Recipient Dr. Norman Borlaug continued on page 4 September of 2003 was a time etched... Tabien, and Dr. Lee Tarpley. Four years ago this month, the Texas A&M Research and Exten- sion Center at Beaumont was hon- ored to welcome one of the most influential people in agriculture. Nobel Peace Prize recipient, Dr. Norman Borlaug, has a long...

  7. Health Code Number (HCN) Development Procedure

    SciTech Connect (OSTI)

    Petrocchi, Rocky; Craig, Douglas K.; Bond, Jayne-Anne; Trott, Donna M.; Yu, Xiao-Ying

    2013-09-01

    This report provides the detailed description of health code numbers (HCNs) and the procedure of how each HCN is assigned. It contains many guidelines and rationales of HCNs. HCNs are used in the chemical mixture methodology (CMM), a method recommended by the department of energy (DOE) for assessing health effects as a result of exposures to airborne aerosols in an emergency. The procedure is a useful tool for proficient HCN code developers. Intense training and quality assurance with qualified HCN developers are required before an individual comprehends the procedure to develop HCNs for DOE.

  8. Compare Activities by Number of Computers

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)DecadeYear Jan Feb Mar Apr May Jun Jul Aug Sep3,118,592Number of Computers

  9. Property:PhoneNumber | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLCALLETE Inc dEA EIS ReportNumberOfUnitsOwners

  10. Climate Zone Number 4 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company) Jump to:NewMinnesota:Protection Action2BZone Number 4 Jump

  11. Climate Zone Number 6 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company) Jump to:NewMinnesota:Protection Action2BZone Number 4

  12. Climate Zone Number 7 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company) Jump to:NewMinnesota:Protection Action2BZone Number 4Climate

  13. Climate Zone Number 8 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (Utility Company) Jump to:NewMinnesota:Protection Action2BZone Number

  14. Climate Zone Number 2 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures Jump to: navigation, search Name:Climate Zone Number 2 Jump to:

  15. Climate Zone Number 3 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures Jump to: navigation, search Name:Climate Zone Number 2 Jump

  16. Climate Zone Number 5 | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures Jump to: navigation, search Name:Climate Zone Number 2

  17. Grammatical morphology as a source of early number word meanings

    E-Print Network [OSTI]

    2013-01-01

    to counting is important to learning number word meanings,hearing number words used outside of these routines—in thewere given two tests of number word knowledge. The Give-a-

  18. Why is number word learning hard? Evidence from bilingual learners

    E-Print Network [OSTI]

    Wagner, Katie; Kimura, Katherine; Cheung, Pierina; Barner, David

    2015-01-01

    s acquisition of the number words and the counting system.as a source of early number word meanings. PNAS, 110(46),the acquisition of number words. Journal of Child Language,

  19. Pure and Applied Mathematics Quarterly Volume 2, Number 2

    E-Print Network [OSTI]

    Waldschmidt, Michel

    Keywords: Periods, transcendental numbers, irrationality, integrals, series, Diophantine approximation, irrationality measures, transcendence measures, measures of algebraic independence, Gamma function, Beta: to decide whether a period is a rational number, an irrational algebraic number or else a tran- scendental

  20. The New Element Californium (Atomic Number 98)

    DOE R&D Accomplishments [OSTI]

    Seaborg, G. T.; Thompson, S. G.; Street, K. Jr.; Ghiroso, A.

    1950-06-19

    Definite identification has been made of an isotope of the element with atomic number 98 through the irradiation of Cm{sup 242} with about 35-Mev helium ions in the Berkeley Crocker Laboratory 60-inch cyclotron. The isotope which has been identified has an observed half-life of about 45 minutes and is thought to have the mass number 244. The observed mode of decay of 98{sup 244} is through the emission of alpha-particles, with energy of about 7.1 Mev, which agrees with predictions. Other considerations involving the systematics of radioactivity in this region indicate that it should also be unstable toward decay by electron capture. The chemical separation and identification of the new element was accomplished through the use of ion exchange adsorption methods employing the resin Dowex-50. The element 98 isotope appears in the eka-dysprosium position on elution curves containing berkelium and curium as reference points--that is, it precedes berkelium and curium off the column in like manner that dysprosium precedes terbium and gadolinium. The experiments so far have revealed only the tripositive oxidation state of eka-dysprosium character and suggest either that higher oxidation states are not stable in aqueous solutions or that the rates of oxidation are slow. The successful identification of so small an amount of an isotope of element 98 was possible only through having made accurate predictions of the chemical and radioactive properties.

  1. Rainbow Connection Number of Graph Power and Graph Products

    E-Print Network [OSTI]

    Basavaraju, Manu; Rajendraprasad, Deepak; Ramaswamy, Arunselvan

    2011-01-01

    Rainbow connection number, $rc(G)$, of a connected graph G is the minimum number of colors needed to color its edges, so that every pair of vertices is connected by at least one path in which no two edges are colored the same. In this paper we study the rainbow connection number with respect to three important graph product operations (cartesian product, lexicographic product and strong product) and the operation of graph powering. More specifically we show the following: (Here, $r(G)$ denotes the radius of $G$, an obvious lower bound for $rc(G)$) (1.) For a connected graph $G$, let $G^{k}$ be the k-th power of $G$. We show that for $k \\ge 2$, $r(G^{k}) \\le rc(G^{k}) \\le 2r(G^{k}) + 1$. The upper bound is tight up to an additive constant of 1. (2.) For two-connected, non-trivial graphs $G$ and $H$, let $G \\Box H$ be the Cartesian Product of $G$ and $H$. We show that $r(G \\Box H) \\le rc(G \\Box H)$ $\\le$ $2r(G \\Box H)$. The bound is tight. (3.) For two graphs $G$ and $H$ such that $G$ is a connected, non-trivia...

  2. On the Euclidean Version of the Photon Number Integral

    E-Print Network [OSTI]

    S. Ruijsenaars; L. Stodolsky

    2007-10-23

    We reconsider the Euclidean version of the photon number integral introduced in ref 1. This integral is well defined for any smooth non-self-intersecting curve in $\\R^N$. Besides studying general features of this integral (including it s conformal invariance), we evaluate it explicitly for the ellipse. The result is $n_{ellipse}=(\\xi^{-1}+\\xi)\\pi^2$, where $\\xi$ is the ratio of the minor and major axes. This is in agreement with the previous result $n_{circle}=2\\pi^2$ and also with the conjecture that the minimum value of $n$ for any plane curve occurs for the circle.

  3. L^2-Betti numbers of coamenable quantum groups

    E-Print Network [OSTI]

    Kyed, David

    2007-01-01

    We study the relationship between the notion of coamenability of a compact quantum group and the notion of amenability of its fusion algebra. We furthermore propose a Foelner condition for compact quantum groups. Using this we prove that for a coamenable compact matrix quantum group with tracial Haar state, the enveloping von Neumann algebra is dimension flat over the Hopf *-algebra of matrix coefficients. This generalizes a theorem of Lueck from the group case to the quantum group case, and provides examples of compact quantum groups with vanishing L^2-Betti numbers.

  4. Modeling the Number of Ignitions Following an Earthquake: Developing...

    Office of Environmental Management (EM)

    Modeling the Number of Ignitions Following an Earthquake: Developing Prediction Limits for Overdispersed Count Data Modeling the Number of Ignitions Following an Earthquake:...

  5. Navigating the Numbers: Greenhouse Gas Data and International...

    Open Energy Info (EERE)

    Navigating the Numbers: Greenhouse Gas Data and International Climate Policy Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Navigating the Numbers: Greenhouse Gas Data...

  6. Some Applicatio Number theory (New York, 19911995),Springer, New York, 1996

    E-Print Network [OSTI]

    Kolountzakis, Mihalis

    Some Applicatio Number theory (New York, 1991­­1995),Springer, New York, 1996 ns of Probability for Advanced Study, Olden Lane, Princeton, New Jersey 08540. E­mail: kolount@math.ias.edu. Supported by NSF

  7. Human MutationRESEARCH ARTICLE Recurrent Copy Number Alterations in BRCA1-Mutated

    E-Print Network [OSTI]

    their oncogenesis. Many previous studies investigated copy number alterations (CNA) in sporadic and BRCA between these patients and allows us to learn more about their oncogenesis. Recently, Walsh et al. [2008

  8. From rational numbers to algebra: Separable contributions of decimal magnitude and relational understanding of fractions

    E-Print Network [OSTI]

    DeWolf, M; Bassok, M; Holyoak, KJ

    2015-01-01

    From rational numbers to algebra: Separable contributions ofof rei?cation: The case of algebra. Educational Studies inM. L. Blanton (Eds. ), Algebra in the early grades (pp. 95–

  9. California's Efforts for Advancing Ultrafine Particle Number...

    Energy Savers [EERE]

    Sacramento, California 1 ACKNOWLEDGEMENTS TSI Inc. Kindly provided the EEPS 3090, 3010D, and 3786 for the study. CARB Emissions Laboratory Staff Mr. Keshav Sahay, Mr. John...

  10. The Number of Planets Around Stars

    E-Print Network [OSTI]

    Noam Soker

    1997-06-24

    Based on the large number of elliptical planetary nebulae I argue that about 55 per cent of all progenitors of planetary nebulae have planets around them. The planets spin up the stars when the later evolve along the red giant branch or along the asymptotic giant branch. The arguments, which were presented in several of my earlier works, and are summarized in the paper, suggest that the presence of four gas-giant planets in the solar system is the generality rather than the exception. I here continue and: (1) examine the possibility of detecting signatures of surviving Saturn-like planets inside planetary nebulae, and, (2) propose a model by which the second parameter of the horizontal branch, which determines the distribution of horizontal branch stars in the HR diagram, is the presence of planets. A red giant branch star that interacts with a planet will lose a large fraction of its envelope and will become a blue horizontal branch star.

  11. Study of Engine Operating Parameter Effects on GDI Engine Particle...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Study of Engine Operating Parameter Effects on GDI Engine Particle-Number Emissions Study of Engine Operating Parameter Effects on GDI Engine Particle-Number Emissions Results show...

  12. Bipartite Ramsey Numbers and Zarankiewicz Wayne Goddard 1

    E-Print Network [OSTI]

    Goddard, Wayne

    Bipartite Ramsey Numbers and Zarankiewicz Numbers Wayne Goddard 1 School of Geological and Computer Ramsey number b(m, n) is the least positive integer b such that if the edges of K(b, b) are coloured are used to bound b(m, n) for m, n 6. Key words: Graphs, bipartite Ramsey numbers, Zarankiewicz, bicliques

  13. Degree Ramsey and On-Line Degree Ramsey Numbers

    E-Print Network [OSTI]

    West, Douglas B.

    Degree Ramsey and On-Line Degree Ramsey Numbers Douglas B. West Department of Mathematics;Parameter Ramsey Numbers Def. H G means every 2-coloring of E(H) gives a monochromatic G. Ramsey's Theorem H exists. Ramsey number R(G) = min{n: Kn G}. #12;Parameter Ramsey Numbers Def. H G means every 2

  14. Classifying the phase transition threshold for unordered regressive Ramsey numbers

    E-Print Network [OSTI]

    Weiermann, Andreas

    Classifying the phase transition threshold for unordered regressive Ramsey numbers Florian the notion of unordered regressive Ramsey numbers or unordered Kanamori-McAloon numbers. We show that these are of Ackermannian growth rate. For a given number- theoretic function f we consider unordered f-regressive Ramsey

  15. Degree Ramsey and On-Line Degree Ramsey Numbers

    E-Print Network [OSTI]

    West, Douglas B.

    Degree Ramsey and On-Line Degree Ramsey Numbers Douglas B. West Department of Mathematics Stocker #12;Parameter Ramsey Numbers Def. H G means every 2-coloring of E(H) gives a monochromatic G. Ramsey's Theorem H exists. Ramsey number R(G) = min{n: Kn G}. #12;Parameter Ramsey Numbers Def. H G

  16. AERODYNAMICS AND DESIGN FOR ULTRA-LOW REYNOLDS NUMBER FLIGHT

    E-Print Network [OSTI]

    Stanford University

    AERODYNAMICS AND DESIGN FOR ULTRA-LOW REYNOLDS NUMBER FLIGHT A DISSERTATION SUBMITTED at Reynolds numbers below 10,000, here termed ultra-low Reynolds numbers. The effects of airfoil geometry at ultra-low Reynolds numbers. To further explore this design space, the flow solver has been coupled

  17. Report Number R99/0497 Report Title

    E-Print Network [OSTI]

    Marsh, Helene

    Report Number R99/0497 Report Title IMPROVING THE ACCURACY OF AERIAL SURVEYS FOR DUGONGS. Report Date December 2004 #12;AFMA Report Number R99/0497 2 IMPROVING THE ACCURACY OF AERIAL SURVEYS, Raleigh, NC 27695-8203, USA AFMA Project Number R 99/0497 December 2004 #12;AFMA Report Number R99/0497 3

  18. Scaling an RNS number using the core function Neil Burgess,

    E-Print Network [OSTI]

    Oklobdzija, Vojin G.

    Scaling an RNS number using the core function Neil Burgess, Cardiff School of Engineering, Cardiff for extracting the core of a Residue Number System (RNS) number within the RNS, this affording a new method for scaling RNS numbers. Suppose an RNS comprises a set of co-prime moduli, mi, with mi = M. This paper

  19. Volume 65, Numbers 1&2 (Complete) 

    E-Print Network [OSTI]

    Dickson, Donald

    2007-01-01

    This qualitative study sought to understand better the experiences of women leaders in México, a predominantly male-dominated culture. Seven women leaders were interviewed. They shared personal experiences, reflections, ...

  20. Number of faculty: 18 can you minor

    E-Print Network [OSTI]

    Hickey, Timothy J.

    papers significantly less daunting and actually exciting to write. I will definitely save the pieces I struggling with poverty. study abroad The program has a partnership with boston university for brandeis

  1. Brandeis University Economics current number of majors

    E-Print Network [OSTI]

    Hickey, Timothy J.

    in international develop- ment and global poverty to raise funds for microfinance institutions across the world, helping to alleviate global poverty. study abroad Economics majors and minors are encouraged to further

  2. Volume 62, Numbers 3&4 (Complete) 

    E-Print Network [OSTI]

    Dickson, Donald

    2004-01-01

    This study documents and accounts for maintenance and change in dialectal features of Salvadoran Spanish in the United States, especially voseo, as opposed to tuteo, terms signifying the use of the second person singular ...

  3. Revised 04/20/2015 Contact Numbers

    E-Print Network [OSTI]

    Noble, James S.

    Farms/Centers Unit Forestry International Ag MoRAP Fish and Wildlife Soil, Env, and Atmos Dalton Economics English German and Russian Studies History Law Mathematics Missouri Review MOREnet MU Libraries

  4. Texas Rice, Volume IV, Number

    E-Print Network [OSTI]

    2004-01-01

    research in Vietnam, Myanmar, Bangladesh, Philippines, Indo- nesia, Egypt and India. Vietnam and Japan both initiated hybrid rice re- search in 1983, although Japanese scientists had been studying hybrid rice production since the 1950s. Ja- pan released...

  5. 90 Los Alamos Science Number 23 1995 Number 23 1995 Los Alamos Science 91

    E-Print Network [OSTI]

    Massey, Thomas N.

    in the photo at left graphically portray the rate of can- cer mortality in the United States. On average, one. The purple cir- cles represent excess cancer deaths above the normal rate. The job of the radiation epidemiologist is to determine the number of ex- cess cancer deaths among a group that has been exposed

  6. MIXMAX random number generator. Generalised parameters

    E-Print Network [OSTI]

    Savvidy, Konstantin

    2015-01-01

    We are exploring the parameter space of the MIXMAX random number generator, which is based on Kolmogorov-Anosov C-system defined on a torus. For a two-parameter family of C-system operators A(N,s), parametrised by the integers N and s, we found new larger values of N. One can deduce from this data that the entropy and the period are sharply increasing with N. For all of these parameters, the sequence passes all tests in the BigCrush suite. For the largest of them, N=44851, the period approaches million digits. The generator with N=256 and s=487013230256099064 has the best combination of speed, reasonable size of the state and availability for implementing the parallelisation and is currently the default generator in the ROOT software package at CERN. A three-parameter generator A(N,s,m) of the MIXMX family of generators is also presented, and it provides high quality statistical properties for small values of N.

  7. ISSN 0362 1197, Human Physiology, 2012, Vol. 38, No. 2, pp. 121128. Pleiades Publishing, Inc., 2012. Original Russian Text I.P. Ganin, S.L. Shishkin, A. G. Kochetova, A.Ya. Kaplan, 2012, published in Fiziologiya Cheloveka, 2012, Vol. 38, No. 2, pp. 513.

    E-Print Network [OSTI]

    Kaplan, Alexander

    ., 2012. Original Russian Text © I.P. Ganin, S.L. Shishkin, A. G. Kochetova, A.Ya. Kaplan, 2012, published of the Stimulus Position in a Stimulus Train I. P. Ganin, S. L. Shishkin, A. G. Kochetova, and A. Ya. Kaplan

  8. Matrix Online Characteristic Number and Its applications in Goldbach Conjecture,Polignac Conjecture,the Twin Prime Conjecture

    E-Print Network [OSTI]

    Baoshan Zhang

    2013-06-11

    This article consists of three chapters.In Chapter 1, it is determined by the consecutive odd numbers, and study to the intrinsic properties of a class of matrix sequence. Through the establishment of matrix online number concept, characteristics and the online number column use mathematical induction to prove the some properties of this kind of matrix on the number of online features (Theorem 1). Finally, it is given a trial to prove the Goldbach conjecture (Theorem 6). This is the author in the years to explore prime properties in the process of research and discovery, and believe that this finding is of great significance.In Chapter 2, it is defined the concepts of matrix master characteristic number and the Matrix Master Characteristic Sequence (Definition 1). Firstly, we prove that any even number can be expressed as for the difference of two odd prime numbers at least two groups (Theorem 4). Secondly, we prove that there are infinitely many odd prime numbers separated by four (Theorem 9). Finally, we prove that if there is greater than 1 in the intersection by S(3) and s(2m+3) for any natural number m, so that there are infinitely many odd prime numbers separated by 2m(Theorem11). The results will undoubtedly promote the research for Polignac conjecture.In Chapter 3, mainly as a result of any odd natural number a, the intersection by S(a) and s(a+2) is not empty number set, and there are far more than 1 number in the set, where S(a)={k,If 2k+a be prime as k be natural number},and P is a prime number set, N is natural number set. we prove that there are an infinite number of twin prime, and then solve the problem of the twin primes in number theory.

  9. ASTROBIOLOGY Volume 1, Number 4, 2001

    E-Print Network [OSTI]

    Gerakines, Perry

    Research Council Space Studies Board's (1999) document A Science Strategy for the Exploration of Europa spacecraft will serve as platforms for in situ investigations directed to- ward issues relevant to both will be a unique experience, even when compared with the Huy- gens probe now directed to Titan. While labora- tory

  10. Brandeis University Politics current number of majors

    E-Print Network [OSTI]

    Hickey, Timothy J.

    , economic development, environmental policy, social rights and responsive governance. Public sector regimes Popular second majors: history, international and global studies Website: brandeis of policing a diverse society; the global political economy of trade in cultural production; and U.S. foreign

  11. Volume 22, Number 2, 2014 ENGINEERING

    E-Print Network [OSTI]

    Jacobson, Arne

    for Illumination of Households in Russia and in the USA 38 Manuel Jesús Hermoso Orzáez and José Ramón de Andrés Tabak Erginoz and Cenk Yavuz Energy Quality Analysis and Improvement for Fluorescent and LED Light Different Light Sources, a Study on Facade Colour 90 Content #3 99 #12;23 and emerging set of handmade solar

  12. Volume 29, Number 8 "April 13, 1983

    E-Print Network [OSTI]

    Farrell, Anthony P.

    . Peters received the award for his work in the area If hydrometallurgical leaching systems. I ":m projects. Prof. Peters will be studying the ! xucture of mineralsto determine what * chemical never get 100 tr cent extraction, as there are always ; .le components that remain nleachable'. sap Prof

  13. LLW Notes, Volume 12, Number 1

    SciTech Connect (OSTI)

    Norris, C.; Brown, H.; Colsant, J.; Lovinger, T.; Scheele, L.; Shaker, M.A.

    1997-01-01

    Contents include articles entitled: Suit against Envirocare sparks investigations: Formal petition filed with NRC; Group alleges misconduct by USGS re Beatty study; EPA rescinds NESHAPs subpart 1; Northwest Compact executive director changes jobs; New forum participant for the state of New Jersey; and Director of North Carolina division of radiation control retires.

  14. Texas Rice, Volume 1, Number

    E-Print Network [OSTI]

    2001-01-01

    .) These local initiatives were the fore- runner of the statewide check-off program that Texas Rice Research Foundation began in 1982. Cur- rently, funding for the western op- erations farm services is provided through the TAES system. Expand- ing the Texas... conduct studies each year at the western lo- cations in various projects includ- ing Varietal Improvement, Soil and Plant Nutrition, Pathology, Plant Physiology, Water Management and Entomology. In addition, Dr. Garry McCauly’s water manage- ment program...

  15. Volume 71, Numbers 3 & 4 (complete) 

    E-Print Network [OSTI]

    Dickson, Donald

    2013-01-01

    Stage. Review by ???? ????? ................. ??? Philip Major, ed., Literatures of Exile in the English Revolution and its Aftermath, 1640-1690. Review by ??????? ? ??? ???? ?.....................................??? David Randall, English... of the responses Miltonists have to their subject. ?e editors aptly place Susanne Woods? essay on rival hermeneutics at the beginning of this collection, for she makes clear what the term hermeneutics means as regards Milton studies. Woods?s theme, liberty...

  16. Heaviest Nuclei: New Element with Atomic Number 117

    ScienceCinema (OSTI)

    Oganessian, Yuri [Flerov Laboratory of Nuclear Reactions, Russia and Joint Institute for Nuclear Research

    2010-09-01

    One of the fundamental outcomes of the nuclear shell model is the prediction of the 'stability islands' in the domain of the hypothetical super heavy elements. The talk is devoted to the experimental verification of these predictions - the synthesis and study of both the decay and chemical properties of the super heavy elements. The discovery of a new chemical element with atomic number Z=117 is reported. The isotopes 293117 and 294117 were produced in fusion reactions between 48Ca and 249Bk. Decay chains involving 11 new nuclei were identified by means of the Dubna gas-filled recoil separator. The measured decay properties show a strong rise of stability for heavier isotopes with Z =111, validating the concept of the long sought island of enhanced stability for heaviest nuclei.

  17. Projection techniques as methods of particle-number symmetry restoration

    SciTech Connect (OSTI)

    Oudih, M. R.; Fellah, M.; Allal, N. H.; Benhamouda, N. [Laboratoire de Physique Theorique, Faculte de Physique, Universite des Sciences et de la Technologie Houari Boumediene, BP 32, El Alia, 16111 Bab Ezzouar, Algiers, Algeria, and Centre de Recherche Nucleaire d'Alger - COMENA, BP 399, Alger-Gare, Algiers (Algeria)

    2007-10-15

    The accuracy of the variation before (VBP) and after (VAP) particle-number projection methods, the Lipkin-Nogami (LN) prescription, and the projected Lipkin-Nogami (PLN) method have been studied using two exactly solvable models. It is shown that the VBP and the LN methods are rather dubious not only in a weak pairing regime, but also in strong pairing for the evaluation of quantities other than the ground state energy. The PLN method provides good results for the ground and the excited state energies, but it must be used with caution for the occupation probabilities and the observables that strongly depend on it. It seems that the VAP is the only suitable method for a global description of the nuclear properties.

  18. Texas Rice, Volume III, Number

    E-Print Network [OSTI]

    2003-01-01

    on page 6 Christine enjoying the Beaumont Field Day with her friend and USDA co-worker Jodie Cammack. 5 Spotlight on Support in the Quality Lab Fernando Goffman - Research Chemist Fernando was born in Buenos Aires, Argentina, the middle child of three. His... Roebbelen from the Institute of Agronomy and Plant Breeding, Georg-August University of Goettingen in Germany, a world-renowned institution for the study of plant breed- ing and Chemistry. In the end, Fernando was one of only 20 students from Argentina...

  19. LLW Notes, Volume 12, Number 3

    SciTech Connect (OSTI)

    Norris, C.; Brown, H. [eds.; Colsant, J.; Lovinger, T.; Scheele, L.; Shaker, M.A.

    1997-03-01

    Contents include articles entitled: California DHS sues US Interior Department to compel land transfer; LLW Forum holds winter meeting; LLW Forum waste information working group meets; LLW Forum regulatory issues discussion group meets; Envirocare investigation transferred to feds; Host state TCC meets in Laughlin, Nevada; BLM to require new permit for California site testing; Federal agencies and committees; Pena sworn in as Energy Secretary, Grumbly departs DOE; U.S. Supreme Court tackles property rights issues; GAO to study DOI`s actions; Congress scrutinizes FY `98 budget requests; and Senate committee passes high-level waste bill: Clinton threatens to veto.

  20. k-AUTOMATIC SETS OF RATIONAL NUMBERS ERIC ROWLAND AND JEFFREY SHALLIT

    E-Print Network [OSTI]

    Rowland, Eric

    k-AUTOMATIC SETS OF RATIONAL NUMBERS ERIC ROWLAND AND JEFFREY SHALLIT Abstract. The notion of a k-automatic set of integers is well-studied. We develop a new notion -- the k-automatic set of rational numbers S N is k-automatic if there exists a regular language L k such that S = [L]k. The class of k-automatic

  1. The Differential Approach to Superlative Index Number Theory

    E-Print Network [OSTI]

    Barnett, William A.; Choi, Ki-Hong; Sinclair, Tara M.

    2003-09-01

    Diewert’s “superlative” index numbers, defined to be exact for second-order aggregator functions, unify index number theory with aggregation theory but have been difficult to identify. We present a new approach to finding ...

  2. ADDITIVITY PROPERTIES OF GENERALIZED BRIDGE NUMBERS OF KNOTS

    E-Print Network [OSTI]

    . Later, Helmut Doll generalized the the notion of bridge number of a knot. Schubert's notion of bridge splitting of S 3 , whereas Doll's more general notion of bridge number can be formulated in terms of a nice

  3. Grammatical morphology as a source of early number word meanings

    E-Print Network [OSTI]

    Almoammer, Alhanouf

    How does cross-linguistic variation in linguistic structure affect children’s acquisition of early number word meanings? We tested this question by investigating number word learning in two unrelated languages that feature ...

  4. Numbers and Arithmetic: Neither Hardwired Nor Out There

    E-Print Network [OSTI]

    Nuńez, Rafael

    Numbers and Arithmetic: Neither Hardwired Nor Out There Rafael N ´u ~nez Department of Cognitive that number concepts and arithmetic are neither hard- wired in the brain, nor do they exist out

  5. Stern-Gerlach Experiments and Complex Numbers in Quantum Physics

    E-Print Network [OSTI]

    S. Sivakumar

    2012-07-09

    It is often stated that complex numbers are essential in quantum theory. In this article, the need for complex numbers in quantum theory is motivated using the results of tandem Stern-Gerlach experiments

  6. Certification of Taxpayer Identification Number for Individuals Please check one

    E-Print Network [OSTI]

    Zallen, Richard

    Substitute Form W-9 Certification of Taxpayer Identification Number for Individuals Please check: ________________________ Middle: _____________________ Last: _______________________________ 2. U.S. taxpayer identification statements are true, correct, and complete and that: 1. The number shown on this form is my correct taxpayer

  7. ORISE: Report shows number of health physics degrees for 2010

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    report shows number of health physics degrees increased for graduates, decreased for undergraduates in 2010 Decreased number of B.S. degrees remains higher than levels in the early...

  8. NATURE GENETICS | VOLUME 37 | NUMBER 12 | DECEMBER 2005 1299 Power tools for human genetics

    E-Print Network [OSTI]

    Kruglyak, Leonid

    NATURE GENETICS | VOLUME 37 | NUMBER 12 | DECEMBER 2005 1299 Power tools for human genetics Leonid of common genetic variants to human disease, but the tools to carry out such studies have been incomplete for study design, analysis and interpretation. Humans show a great deal of heritable inter- individual

  9. On the size-Ramsey number of hypergraphs Andrzej Dudek

    E-Print Network [OSTI]

    Mubayi, Dhruv

    On the size-Ramsey number of hypergraphs Andrzej Dudek Steven La Fleur Dhruv Mubayi Vojtech R¨odl§ March 20, 2015 Abstract The size-Ramsey number of a graph G is the minimum number of edges in a graph H such that every 2-edge-coloring of H yields a monochromatic copy of G. Size-Ramsey numbers of graphs have been

  10. MULTI-DEGREE BOUNDS ON THE BETTI NUMBERS OF REAL ...

    E-Print Network [OSTI]

    2015-07-28

    Jul 28, 2015 ... Multidegree bounds, Betti numbers, Smith inequalities, semi-algebraic sets, polynomial partitioning, incidence problems. Basu was partially ...

  11. Experiment Number 19 The Transmission of -Radiation Through Matter

    E-Print Network [OSTI]

    is the Avogadro's number is the density so that the probability of a certain electron being scattered is very

  12. Radio Number for Trees Daphne Der-Fen Liu

    E-Print Network [OSTI]

    Liu, Daphne Der-Fen

    Radio Number for Trees Daphne Der-Fen Liu Department of Mathematics California State University be a connected graph with diameter diam(G). The radio number for G, denoted by rn(G), is the smallest integer k bound for the radio number of trees, and characterize the trees achiev- ing this bound. Moreover, we

  13. Small Ramsey Numbers Stanisl/aw P. Radziszowski

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Small Ramsey Numbers Stanisl/aw P. Radziszowski Department of Computer Science Rochester Institute Ramsey numbers, where the avoided graphs are complete or complete without one edge. Many results per behavior of Ramsey numbers, but rather we concentrate on their specific values. Mathematical Reviews

  14. Constructive Lower Bounds on Classical Multicolor Ramsey Numbers

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Constructive Lower Bounds on Classical Multicolor Ramsey Numbers Xu Xiaodong and Xie Zheng bounds for classical multicolor Ramsey numbers, first by giving a short overview of past results-diagonal multicolor Ramsey numbers. In particular, we improve several lower bounds for Rk(4) and Rk(5) for some small

  15. Ramsey Numbers for Triangles Almost-Complete Graphs

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    Ramsey Numbers for Triangles versus Almost-Complete Graphs To the fond memory of Paul Erd on the corresponding Ramsey number, R(K 3 ; K 10 e) #20; 38. The new lower bound of 37 for this number is established by one the best previously known lower and upper bounds. We also give the bounds for the next Ramsey

  16. Bounds for Ramsey numbers in multipartite Eugene Heinz Stipp

    E-Print Network [OSTI]

    van Vuuren, Jan H.

    Bounds for Ramsey numbers in multipartite graphs Eugene Heinz Stipp Submitted in partial fulfilment-Committee B. #12;iv ­ ABSTRACT ­ The notion of a classical graph theoretic Ramsey number is generalized as in the standard definition. Some small multipartite Ramsey numbers are found, while upper- and lower bounds

  17. New Computational Upper Bounds for Ramsey Numbers R(3, k)

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    New Computational Upper Bounds for Ramsey Numbers R(3, k) Jan Goedgebeur Department of Applied computational techniques we derive six new upper bounds on the classical two- color Ramsey numbers: R(3, 10) 42) 42. Keywords: Ramsey number; upper bound; computation the electronic journal of combinatorics XX

  18. Bounds for Ramsey numbers in multipartite Eugene Heinz Stipp

    E-Print Network [OSTI]

    van Vuuren, Jan H.

    Bounds for Ramsey numbers in multipartite graphs Eugene Heinz Stipp Submitted in partial ful#12 theoretic Ramsey number is generalized by assuming that both the original graph whose edges are arbitrarily of complete graphs as in the standard de#12;nition. Some small multipartite Ramsey numbers are found, while

  19. Degree Ramsey Number of Cycles Douglas B. West

    E-Print Network [OSTI]

    West, Douglas B.

    Degree Ramsey Number of Cycles Douglas B. West Department of Mathematics University of Illinois Jiang, Bill Kinnersley, and Kevin Milans #12;Parameter Ramsey Numbers Def. H G means every 2-coloring of E(H) gives a monochromatic G. Ramsey's Theorem H exists. Ramsey number R(G) = min{n: Kn G}. #12

  20. Comparative estimation of the reproduction number for pandemic

    E-Print Network [OSTI]

    Chowell, Gerardo

    -8523, Japan The reproduction number, R, defined as the average number of secondary cases generated notifications during the autumn wave of the influenza pandemic (Spanish flu) in the city of San Francisco.07, 2.65) for the entire autumn wave. We conclude that the reproduction number for pandemic influenza

  1. Compact floating-gate true random number generator

    E-Print Network [OSTI]

    Maryland at College Park, University of

    Compact floating-gate true random number generator P. Xu, Y.L. Wong, T.K. Horiuchi and P.A. Abshire A compact true random number generator (RNG) integrated circuit with adjustable probability is presented. Introduction: Random number generation is indispensable in crypto- graphy, scientific computing and stochastic

  2. Number of Jacobi quartic curves over finite Rongquan Feng1

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Number of Jacobi quartic curves over finite fields Rongquan Feng1 , Hongfeng Wu2 1 LMAM, School@gmail.com Abstract In this paper the number of Fq-isomorphism classes of Jacobi quar- tic curves, i.e., the number of Jacobi quartic curves with distinct j- invariants, over finite field Fq is enumerated. Keywords: Elliptic

  3. TRANSCENDENCE OF THE GAUSSIAN LIOUVILLE NUMBER AND RELATIVES

    E-Print Network [OSTI]

    Borwein, Peter

    TRANSCENDENCE OF THE GAUSSIAN LIOUVILLE NUMBER AND RELATIVES PETER BORWEIN AND MICHAEL COONS to that of Dekking's proof of the transcendence of the Thue­Morse number [7] as well as a theorem of Mahler's [16 is that l is irrational. Theorem 1. If l is the Liouville number, then l / Q. Proof. See proof

  4. MU student numberVISITING STUDENT APPLICATION UNIVERSITY OF MISSOURI

    E-Print Network [OSTI]

    Taylor, Jerry

    (area code) Telephone number (area code) Cellphone number (area code) Fax number (if available) Student officials, and the completed application is to be sent to the Director of Admissions, University of Missouri, 230 Jesse Hall, Columbia, MO 65211-1300. Because this certification is in lieu of an official

  5. Design studies for the next generation electron ion colliders

    SciTech Connect (OSTI)

    Sayed, Hisham Kamal; Bogacz, Slawomir A.; Krafft, Geoffrey A.

    2014-04-01

    The next generation Electron Ion Collider (EIC) at Thomas Jefferson National Accelerator Facility (JLAB) utilizes a figure-8 shaped ion and electron rings. EIC has the ability to preserve the ion polarization during acceleration, where the electron ring matches in footprint with a figure-8 ion ring. The electron ring is designed to deliver a highly polarized high luminous electron beam at interaction point (IP). The main challenges of the electron ring design are the chromaticity compensation and maintaining high beam polarization of 70% at all energies 3–11 GeV without introducing transverse orbital coupling before the IP. The very demanding detector design limits the minimum distance between the final focus quadrupole and the interaction point to 3.5 m which results in a large ? function inside the final focus quadrupoles leading to increased beam chromaticity. In this paper, we present a novel chromaticity compensation scheme that mitigates IP chromaticity by a compact chromaticity compensation section with multipole magnet components. In addition, a set of spin rotators are utilized to manipulate the polarization vector of the electron beam in order to preserve the beam polarization. The spin rotator solenoids introduce undesired coupling between the horizontal and vertical betatron motion of the beam. We introduce a compact and modular orbit decoupling insert that can fit in the limited space of the straight section in the figure-8 ring. We show a numerical study of the figure-8 ring design with the compact straight section, which includes the interaction region, chromaticity compensation section, and the spin rotators, the figure-8 design performance is evaluated with particle tracking.

  6. Louisiana Natural Gas Number of Gas and Gas Condensate Wells (Number of

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963Residential Consumers (Number of33Cubic Foot)Year Jan FebYear

  7. U.S. Natural Gas Number of Commercial Consumers - Sales (Number of

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0Proved ReservesData2009 2010Year Jan Feb Mar Apr May Jun (Number

  8. U.S. Natural Gas Number of Industrial Consumers - Sales (Number of

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0Proved ReservesData2009 2010Year Jan Feb Mar Apr May (Number

  9. U.S. Natural Gas Number of Residential Consumers - Sales (Number of

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet)Decade Year-0Proved ReservesData2009 2010Year Jan Feb Mar Apr May (Number

  10. U.S. Natural Gas Number of Industrial Consumers (Number of Elements)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of the NationalSalesof(MillionIndustrial Consumers (Number of

  11. U.S. Natural Gas Number of Residential Consumers (Number of Elements)

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of the NationalSalesof(MillionIndustrial Consumers (Number

  12. Grant Title: INITIATIVE FOR MAXIMIZING STUDENT DEVELOPMENT (IMSD) (R25) Funding Opportunity Number: PAR-13-082. CFDA Number(s): 93.859.

    E-Print Network [OSTI]

    Farritor, Shane

    : PAR-13-082. CFDA Number(s): 93.859. Agency/Department: National Institutes of Health (NIH), National skills, communication skills, time-management, group learning opportunities, independent library or bench career choices with appropriate role models. The proposed research education prog

  13. Prandtl Number Dependent Natural Convection with Internal Heat Sources

    SciTech Connect (OSTI)

    Kang Hee Lee; Seung Dong Lee; Kune Y. Suh; Joy L. Rempe; Fan-Bill Cheung; Sang B. Kim

    2004-06-01

    Natural convection plays an important role in determining the thermal load from debris accumulated in the reactor vessel lower head during a severe accident. Recently, attention is being paid to the feasibility of external vessel flooding as a severe accident management strategy and to the phenomena affecting the success path for retaining the molten core material inside the vessel. The heat transfer inside the molten core material can be characterized by the strong buoyancy-induced flows resulting from internal heating due to decay of fission products. The thermo-fluid dynamic characteristics of such flow depend strongly on the thermal boundary conditions. The spatial and temporal variation of heat flux on the pool wall boundaries and the pool superheat are mainly characterized by the natural convection flow inside the molten pool. In general, the natural convection heat transfer phenomena involving the internal heat generation are represented by the modified Rayleigh number (Ra’), which quantifies the internal heat source and hence the strength of the buoyancy force. In this study, tests were conducted in a rectangular section 250 mm high, 500 mm long and 160 mm wide. Twenty-four T-type thermocouples were installed in the test section to measure temperatures. Four T-type thermocouples were used to measure the boundary temperatures. The thermocouples were placed in designated locations after calibration. A direct heating method was adopted in this test to simulate the uniform heat generation. The experiments covered a range of Ra' between 1.5x106 and 7.42x1015 and the Prandtl number (Pr) between 0.7 and 6.5. Tests were conducted with water and air as simulant. The upper and lower boundary conditions were maintained uniform. The results demonstrated feasibility of the direct heating method to simulate uniform volumetric heat generation. Particular attentions were paid to the effect of Pr on natural convection heat transfer within the rectangular pool.

  14. Low Mach Number Modeling of Type Ia Supernovae. II. Energy Evolution

    E-Print Network [OSTI]

    A. S. Almgren; J. B. Bell; C. A. Rendleman; M. Zingale

    2006-06-21

    The convective period leading up to a Type Ia supernova (SN Ia) explosion is characterized by very low Mach number flows, requiring hydrodynamical methods well-suited to long-time integration. We continue the development of the low Mach number equation set for stellar scale flows by incorporating the effects of heat release due to external sources. Low Mach number hydrodynamics equations with a time-dependent background state are derived, and a numerical method based on the approximate projection formalism is presented. We demonstrate through validation with a fully compressible hydrodynamics code that this low Mach number model accurately captures the expansion of the stellar atmosphere as well as the local dynamics due to external heat sources. This algorithm provides the basis for an efficient simulation tool for studying the ignition of SNe Ia.

  15. Turbulent mixing of a slightly supercritical Van der Waals fluid at Low-Mach number

    E-Print Network [OSTI]

    Battista, Francesco; Casciola, Carlo Massimo

    2014-01-01

    Supercritical fluids near the critical point are characterized by liquid-like densities and gas-like transport properties. These features are purposely exploited in different contexts ranging from natural products extraction/fractionation to aerospace propulsion. Large part of studies concerns this last context, focusing on the dynamics of supercritical fluids at high Mach number where compressibility and thermodynamics strictly interact. Despite the widespread use also at low Mach number, the turbulent mixing properties of slightly supercritical fluids have still not investigated in detail in this regime. This topic is addressed here by dealing with Direct Numerical Simulations (DNS) of a coaxial jet of a slightly supercritical Van der Waals fluid. Since acoustic effects are irrelevant in the Low Mach number conditions found in many industrial applications, the numerical model is based on a suitable low-Mach number expansion of the governing equation. According to experimental observations, the weakly superc...

  16. Fluid dynamic propagation of initial baryon number perturbations on a Bjorken flow background

    E-Print Network [OSTI]

    Floerchinger, Stefan

    2015-01-01

    Baryon number density perturbations offer a possible route to experimentally measure baryon number susceptibilities and heat conductivity of the quark gluon plasma. We study the fluid dynamical evolution of local and event-by-event fluctuations of baryon number density, flow velocity and energy density on top of a (generalised) Bjorken expansion. To that end we use a background-fluctuation splitting and a Bessel-Fourier decomposition for the fluctuating part of the fluid dynamical fields with respect to the azimuthal angle, the radius in the transverse plane and rapidity. We examine how the time evolution of linear perturbations depends on the equation of state as well as on shear viscosity, bulk viscosity and heat conductivity for modes with different azimuthal, radial and rapidity wave numbers. Finally we discuss how this information is accessible to experiments in terms of the transverse and rapidity dependence of correlation functions for baryonic particles in high energy nuclear collisions.

  17. Export support of renewable energy industries, grant number 1, deliverable number 3. Final report

    SciTech Connect (OSTI)

    1998-01-14

    The United States Export Council for Renewable Energy (US/ECRE), a consortium of six industry associations, promotes the interests of the renewable energy and energy efficiency member companies which provide goods and services in biomass, geothermal, hydropower, passive solar, photovoltaics, solar thermal, wind, wood energy, and energy efficiency technologies. US/ECRE`s mission is to catalyze export markets for renewable energy and energy efficiency technologies worldwide. Under this grant, US/ECRE has conducted a number of in-house activities, as well as to manage activities by member trade associations, affiliate organizations and non-member contractors and consultants. The purpose of this document is to report on grant coordination and effectiveness.

  18. Export support of renewable energy industries. Task number 1, deliverable number 3. Final report

    SciTech Connect (OSTI)

    1998-01-14

    The United States Export Council for Renewable Energy (US/ECRE), a consortium of six industry associations, promotes the interests of the renewable energy and energy efficiency member companies which provide goods and services in biomass, geothermal, hydropower, passive solar, photovoltaics, solar thermal, wind, wood energy, and energy efficiency technologies. US/ECRE`s mission is to catalyze export markets for renewable energy and energy efficiency technologies worldwide. Under this grant, US/ECRE has conducted a number of in-house activities, as well as to manage activities by member trade associations, affiliate organizations and non-member contractors and consultants. The purpose of this document is to report on task coordination and effectiveness.

  19. Study Abroad Programs and Requirements Study abroad programs

    E-Print Network [OSTI]

    Study Abroad ­ Programs and Requirements Study abroad programs A number of study abroad opportunities exist: group study programs, exchange, and visiting students. Group Study Programs are University of Engineering takes an annual study abroad trip to Greece (ENGG 407 and ENGG 393, a complementary studies option

  20. The distribution of natural numbers divisible by 2,3,5,11,13 and 17 on the Square Root Spiral

    E-Print Network [OSTI]

    Harry K. Hahn

    2008-01-29

    The natural numbers divisible by the Prime Factors 2, 3, 5, 11, 13 and 17 lie on defined spiral graphs, which run through the Square Root Spiral. A mathematical analysis shows, that these spiral graphs are defined by specific quadratic polynomials. Basically all natural number which are divisible by the same prime factor lie on such spiral graphs. And these spiral graphs can be assigned to a certain number of Spiral Graph Systems, which have a defined spatial orientation to each other. This document represents a supplementation to my detailed introduction study to the Square Root Spiral, and it contains the missing diagrams and analyses, showing the distribution of the natural numbers divisible by 2, 3, 5, 11, 13 and 17 on the Square Root Spiral. My introduction study to the Square Root Spiral can be found in the arxiv-archive. The title of this study : The ordered distribution of the natural numbers on the Square Root Spiral.

  1. Spatial and temporal patterns of colonization and brood development of IPS avulsus (Eichh.) and I. Calligraphus (Germ.) (Coleoptera:scolytidae) in loblolly pine 

    E-Print Network [OSTI]

    Flamm, Richard Owen

    1984-01-01

    height . 2 Expected times of arrival (Days) of attacking I. au isus, I. ~cai1i a h s. a d D. f ontaiis Tn incnlvlZuaT trees Page 17 3 Expected times (days) of gallery construction by I. a i sue. i. ~col ii a h s, a d D. fro taiis in individual trees.... ) and mixed hardwood species. Four adjacent plots of 3 pine trees each were designated for this study. Average tree height of the sample trees was 21. 4 m (S. D. = Z. 3 m) and average tree diameter at 2 m was Z5. 9 m (S. O. = 2. 8 m). Bark beetle attack...

  2. Ramsey number of a connected triangle matching Andras Gyarfas

    E-Print Network [OSTI]

    Sarkozy, Gabor

    Ramsey number of a connected triangle matching Andr´as Gy´arf´as Alfr´ed R´enyi Institute Ramsey number of a connected triangle match- ing c(nK3) which is a graph with n vertex disjoint triangles matching, R(nK3, nK3) = 5n. The motivation is to determine the Ramsey number R(C2 n, C2 n) of the square

  3. Proc. of ASME Design Automation Conference, Albuquerque, NM, September 1922, 1993, vol. 2, pp. 7380. COMPUTATIONS OF DUAL NUMBERS

    E-Print Network [OSTI]

    Cheng, Harry H.

    ) pioneered kinematic anal­ ysis of spatial mechanisms via dual numbers. Using dual numbers, Yang and Freudenstein (1963, 1964) studied kine­ matic analysis of spatial mechanisms; and Ravani and Roth (1984 in kinematics and dynamics of spatial mechanisms. Succinct formulas and equations can be derived by using dual

  4. MULTI-DEGREE BOUNDS ON THE BETTI NUMBERS OF REAL ...

    E-Print Network [OSTI]

    2015-07-28

    Jul 28, 2015 ... problem posed in their paper – on extending their bounds on the number of connected ... sets, polynomial partitioning, incidence problems.

  5. The Chern-Simons Number as a Dynamical Variable

    E-Print Network [OSTI]

    Tye, S -H Henry

    2016-01-01

    In the standard electroweak theory that describes nature, the Chern-Simons number associated with the vacua as well as the unstable sphaleron solutions play a crucial role in the baryon number violating processes. We recall why the Chern-Simons number should be generalized from a set of discrete values to a dynamical (quantum) variable. Via the construction of an appropriate Hopf invariant and the winding number, we discuss how the geometric information in the gauge fields is also captured in the Higgs field. We then discuss the choice of the Hopf variable in relation to the Chern-Simons variable.

  6. Request for Proposals Number RHB-5-52483

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    9 National Renewable Energy Laboratory Managed and Operated by the Alliance for Sustainable Energy, LLC Request for Proposals Number RHB-5-52483 "Subsurface Utility Engineering...

  7. Chicago Office NEPA Tracking Number U. S. DEPARTMENT OF ENERGY

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    CH F 560-ACQ (1105) Previous editions are obsolete. Chicago Office NEPA Tracking Number U. S. DEPARTMENT OF ENERGY OFFICE OF SCIENCE -- CHICAGO OFFICE NATIONAL ENVIRONMENTAL...

  8. Reducing the Particulate Emission Numbers in DI Gasoline Engines...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Emission Numbers in DI Gasoline Engines Formation of droplets was minimized through optimization of fuel vaporization and distribution avoiding airfuel zones richer than...

  9. bounding the number of stable homotopy types of a parametrized ...

    E-Print Network [OSTI]

    He obtained a full topological classification of such varieties making ... Wall obtains as a consequence of his classification theorem, that the number of different ...

  10. A multichain polymer slip-spring model with fluctuating number...

    Office of Scientific and Technical Information (OSTI)

    A multichain polymer slip-spring model with fluctuating number of entanglements for linear and nonlinear rheology Citation Details In-Document Search This content will become...

  11. Universal decay of high Reynolds number Taylor-Couette turbulence

    E-Print Network [OSTI]

    Verschoof, Ruben A; van der Veen, Roeland C A; Sun, Chao; Lohse, Detlef

    2015-01-01

    We study the decay of high-Reynolds number Taylor-Couette turbulence, i.e. the turbulent flow between two coaxial rotating cylinders. To do so, the rotation of the inner cylinder ($Re_i = 2 \\cdot 10^6$, the outer cylinder is at rest) was suddenly stopped. Using a combination of laser Doppler anemometry and particle image velocimetry measurements, six decay decades of the kinetic energy could be captured. First, in the absence of cylinder rotation, the flow-velocity during the decay does not develop any height dependence in contrast to the well-known Taylor vortex state. Next, the radial profile of the azimuthal velocity is found to be self-similar, i.e. when normalizing it with the mean velocity, it is universal. Nonetheless, the decay of this wall-bounded inhomogeneous turbulent flow does not follow a strict power law as for decaying turbulent homogeneous isotropic flows, but it is faster, due to the strong viscous drag applied by the bounding walls. We theoretically describe the decay in a quantitative way ...

  12. Fleet Management Procedure Policy number 001 -September 2013

    E-Print Network [OSTI]

    Thompson, Michael

    Fleet Management Procedure Policy number 001 - September 2013 Complete Policy Title: Facility Services Fleet and Non- Fleet Maintenance/Operations Policy Number: 001 Approved by: VP Administration Date program that will extend the safety, quality and longevity of all vehicles and equipment owned

  13. Heating Season Has Ended An Update On The Numbers

    E-Print Network [OSTI]

    . An Update On The Numbers The attached graphics illustrate electricity consumption over a number of years. As a reference point, electricity comprises 2/3rds of our total fuel costs. Consumption will vary from year)/May and September/October time-frames represent seasonal transition and an opportunity to save on fuel consumption

  14. Submitted to Operations Research manuscript (Please, provide the manuscript number!)

    E-Print Network [OSTI]

    Powell, Warren B.

    , geothermal and biomass, Renewable Portfolio Standards (RPSs) have been implemented in a number of states attributed to the artificial vertical demand curve imposed by regulations. A number of papers (such as Felder arising from a vertical demand curve (or a cliff policy) such as an uncompetitive market, volatile

  15. 142 Los Alamos Science Number 29 2005 Direct Numerical

    E-Print Network [OSTI]

    Kurien, Susan

    142 Los Alamos Science Number 29 2005 Direct Numerical Simulations of Turbulence Data Generation visualization tools. Los Alamos scientists have been able to simulate flows of Reynolds numbers up to 105 subdomain of the 20483 turbulence simulation performed on the ASC Q machine at Los Alamos. The ASC Q machine

  16. On Pattern Ramsey Numbers of Graphs Robert E. Jamison

    E-Print Network [OSTI]

    West, Douglas B.

    On Pattern Ramsey Numbers of Graphs Robert E. Jamison Mathematical Sciences Clemson University is a Ramsey family if there is some integer N such that every edge- coloring of KN has a copy of some pattern in F. The smallest such N is the (pattern) Ramsey number R(F) of F. The classical Canonical Ramsey

  17. Computing Hypergraph Ramsey Numbers by Using Quantum Circuit

    E-Print Network [OSTI]

    Ri Qu; Zong-shang Li; Juan Wang; Yan-ru Bao; Xiao-chun Cao

    2012-10-12

    Gaitan and Clark [Phys. Rev. Lett. 108, 010501 (2012)] have recently shown a quantum algorithm for the computation of the Ramsey numbers using adiabatic quantum evolution. We present a quantum algorithm to compute the two-color Ramsey numbers for r-uniform hypergraphs by using the quantum counting circuit.

  18. Planar Ramsey Numbers for Small Graphs Andrzej Dudek

    E-Print Network [OSTI]

    Ruciñski, Andrzej

    Planar Ramsey Numbers for Small Graphs Andrzej Dudek Department of Mathematics and Computer Science Adam Mickiewicz University Pozna´n, Poland Abstract Given two graphs G1 and G2, the planar Ramsey a copy of G1 or its complement contains a copy of G2. So far, the planar Ramsey numbers have been deter

  19. On Pattern Ramsey Numbers of Graphs Robert E. Jamison

    E-Print Network [OSTI]

    West, Douglas B.

    On Pattern Ramsey Numbers of Graphs Robert E. Jamison Mathematical Sciences Clemson University is a Ramsey family if there is some integer N such that every edge- coloring of KN has a copy of some pattern in F . The smallest such N is the (pattern) Ramsey number R(F ) of F . The classical Canonical Ramsey

  20. New Computational Upper Bounds for Ramsey Numbers R(3, k)

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    New Computational Upper Bounds for Ramsey Numbers R(3, k) Jan Goedgebeur Department of Applied@cs.rit.edu Kolloquium ĂĽber Kombinatorik Berlin, November 16, 2012 1/25 Avoiding Triangles in Ramsey Graphs or independence in triangle-free graphs 1 Ramsey Numbers R(3, k) Asymptotics Some background and history Lower

  1. More Constructive Lower Bounds on Classical Ramsey Numbers

    E-Print Network [OSTI]

    Radziszowski, Stanislaw P.

    More Constructive Lower Bounds on Classical Ramsey Numbers Xiaodong Xu Guangxi Academy of Sciences Abstract. We present several new constructive lower bounds for classical Ramsey numbers. In particular that for all integers k, l, with k 5 and l 3, the connectivity of any Ramsey-critical (k, l

  2. Unsteady Aerodynamic Models for Agile Flight at Low Reynolds Numbers

    E-Print Network [OSTI]

    Rowley, Clarence W.

    for Wagner's and Theodorsen's models, making them compatible with modern control-system analysis. A number thanks are to my advisor, Clancy Rowley, who has been both a role model and a source of encouragementUnsteady Aerodynamic Models for Agile Flight at Low Reynolds Numbers Steven L. Brunton

  3. Page 1 of 7 (page number not for citation purposes)

    E-Print Network [OSTI]

    Page 1 of 7 (page number not for citation purposes) Chemistry Central Journal Open Access operations during large-scale virtual screening jobs. We also implemented an algorithm to output docked in a number of therapeutic programs at the lead discovery stage [1]. Published: 8 September 2008 Chemistry

  4. COMPLETENESS NUMBER OF FAMILIES OF SUBSETS OF CONVERGENCE SPACES

    E-Print Network [OSTI]

    Dolecki, Szymon

    COMPLETENESS NUMBER OF FAMILIES OF SUBSETS OF CONVERGENCE SPACES SZYMON DOLECKI In honor, triquotient maps and extensions of the Choquet active boundary theorem. The completeness number of a family in a convergence space is the least cardinality of collections of covers for which the family becomes complete. 0

  5. Effective Reverse Conversion in Residue Number System Processors

    E-Print Network [OSTI]

    propose effective Residue Number System (RNS) to Weighted Number System conversion techniques with k being the num- ber of moduli. First, we introduce an RNS to MRC technique, which ad- dresses in an RNS to MRC with an asymptotic complexity, in terms of arithmetic operations, in the order of O

  6. Modular Arithmetic Implementation with the Residue Number System (RNS)

    E-Print Network [OSTI]

    Sousa, Leonel

    Modular Arithmetic Implementation with the Residue Number System (RNS) Samuel Antăo and Leonel are the addition/subtraction, multiplication and reduction as well as the conversion of Residue Number System (RNS discussed in the following. 1 RNS Forward/Reverse Conversions Forward conversion corresponds

  7. THEORETICAL CRYPTANALYSIS OF THE KLIMOVSHAMIR NUMBER GENERATOR TF1

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    THEORETICAL CRYPTANALYSIS OF THE KLIMOV­SHAMIR NUMBER GENERATOR TF­1 BOAZ TSABAN Abstract generator TF­1 was introduced in [2] and is based on the methods developed in [1] and references therein. This is an iterative pseudorandom number generator. Its internal state consists of 4 words a, b, c, d, of size w bits

  8. Analysis of the Linux Random Number Generator Zvi Gutterman

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Analysis of the Linux Random Number Generator Zvi Gutterman Safend and The Hebrew University Abstract Linux is the most popular open source project. The Linux random number generator is part of the kernel of all Linux distributions and is based on generating randomness from entropy of operating system

  9. Jacobi forms over totally real number elds Howard Skogman

    E-Print Network [OSTI]

    Skogman, Howard

    Jacobi forms over totally real number #12;elds Howard Skogman 0 2000 Mathematics Subject Classi#12;cation: 11F50 1 #12; Abstract We de#12;ne Jacobi forms over a totally real algebraic number #12;eld K upper half space respectively. Then symplectic modular forms are created and Jacobi forms arise

  10. SHIFTED JACOBI POLYNOMIALS AND DELANNOY NUMBERS GABOR HETYEI

    E-Print Network [OSTI]

    Jiang, Jiancheng

    SHIFTED JACOBI POLYNOMIALS AND DELANNOY NUMBERS G´ABOR HETYEI `A la m´emoire de Pierre Leroux Abstract. We express a weigthed generalization of the Delannoy numbers in terms of shifted Jacobi Jacobi polynomials. Another specializa- tion provides a weighted lattice path enumeration model

  11. Jacobi Forms over Imaginary Quadratic Number Fields Howard Skogman

    E-Print Network [OSTI]

    Skogman, Howard

    Jacobi Forms over Imaginary Quadratic Number Fields Howard Skogman University of California, San Diego La Jolla, CA 1 #12; Abstract We de#12;ne Jacobi Forms over an imaginary quadratic number #12;eld K half space respectively. We then create symplectic modular forms and create Jacobi forms by taking

  12. True Random Number Generators Secure in a Changing Environment

    E-Print Network [OSTI]

    Shaltiel, Ronen

    , which is applied to the high­entropy source in order to obtain an output string that is shorterTrue Random Number Generators Secure in a Changing Environment Boaz Barak, Ronen Shaltiel, and Eran, ISRAEL Email: {boaz,ronens,tromer}@wisdom.weizmann.ac.il Abstract. A true random number generator (TRNG

  13. Convexity in partial cubes: the hull number Marie Albenque1

    E-Print Network [OSTI]

    Felsner, Stefan

    that the combinatorial optimization problem of de- termining the hull number of a partial cube is NP-complete. This makesConvexity in partial cubes: the hull number Marie Albenque1 and Kolja Knauer2 1 LIX UMR 7161 partial cubes the minimal graph class for which NP-completeness of this problem is known and improves some

  14. A Nonempirical Test on the Weight of Pseudorandom Number Generators

    E-Print Network [OSTI]

    Matsumoto, Makoto

    . In middle 80's, physicists began to find the failure of these generators in simulations of physical modelsA Nonempirical Test on the Weight of Pseudorandom Number Generators Makoto Matsumoto1 and Takuji introduce a theoretical test, named weight discrepancy test, on pseu- dorandom number generators. This test

  15. REGULAR POLES AND -NUMBERS IN THE THEORY OF HOLOMORPHIC SEMIGROUPS

    E-Print Network [OSTI]

    Bracci, Filippo

    REGULAR POLES AND -NUMBERS IN THE THEORY OF HOLOMORPHIC SEMIGROUPS FILIPPO BRACCI, MANUEL D. CONTRERAS, AND SANTIAGO D´IAZ-MADRIGAL Abstract. We introduce the notion of regular (boundary) poles- ular poles in terms of -points (i.e. pre-images of values with positive Carleson-Makarov -numbers

  16. Course number and title: Physics 6314 EN-9098 -Field Oceanography A course proposed by

    E-Print Network [OSTI]

    deYoung, Brad

    Course number and title: Physics 6314 EN-9098 - Field Oceanography A course proposed by: Ralf Oceanography) Rationale: Oceanography is a multidisciplinary field of research that brings together applied studies in oceanography through many departments (e.g. Biology, Earth Sciences, Engineering and Applied

  17. A True Measure of Exposure 238 Los Alamos Science Number 23 1995

    E-Print Network [OSTI]

    Massey, Thomas N.

    A True Measure of Exposure 238 Los Alamos Science Number 23 1995 Authorization and Collection Alamos tissue analysis program obtained samples for study. During the first twelve years of the program at the Los Alamos Medical Center. As described in the main text, the first case was Cecil Kelley, who had

  18. Fall 2011 CIS 452 STRUCTURED QUERY LANGUAGE (SQL) Course Number: CIS 452

    E-Print Network [OSTI]

    Diestel, Geoff

    Fall 2011 CIS 452 STRUCTURED QUERY LANGUAGE (SQL) Course Number: CIS 452 Course Name: Structured Query Language (SQL) Catalog Description: (2010-2011) A study of SQL, including relational database schema in SQL, formulating SQL queries and sub queries of varying complexity, embedding SQL statements

  19. Collaborative Search and Sensemaking Despite the large number of patent searches conducted

    E-Print Network [OSTI]

    Bhavnani, Suresh K.

    Collaborative Search and Sensemaking of Patents Abstract Despite the large number of patent searches conducted by professional patent searchers and inventors, little is known about how such searches are actually performed. Here we describe a qualitative study of experienced patent searchers as they conducted

  20. Paper Number 15736-PA Title Reaction Kinetics of Fuel Formation for In-Situ Combustion

    E-Print Network [OSTI]

    Abu-Khamsin, Sidqi

    Paper Number 15736-PA Title Reaction Kinetics of Fuel Formation for In-Situ Combustion Authors Abu believed to cause fuel formation for in-situ combustion have been studied and modeled. A thin, packed bed the approach of a combustion front. Analysis of gases produced from the reaction cell revealed that pyrolysis

  1. Industry Dynamics: Foundations For Models with an Infinite Number of Firms

    E-Print Network [OSTI]

    Van Roy, Ben

    Industry Dynamics: Foundations For Models with an Infinite Number of Firms Gabriel Y. Weintraub August, 2010 Abstract This paper explores the connection between three important threads of economic research offering different approaches to studying the dynamics of an industry with heterogeneous firms

  2. AO18: Satellite tracking of volcanic eruption plumes using ash and Candidate number: 782932

    E-Print Network [OSTI]

    Oxford, University of

    AO18: Satellite tracking of volcanic eruption plumes using ash and SO2 Candidate number: 782932 was to study, using satel- lite images, both ash and SO2 emitted from vol- canoes during eruptions, particularly to investi- gate whether the ash and SO2 in volcanic plumes are always collocated. If not, the aim

  3. Issuing Department: Human Subjects Protection Office Policy Number: 2011-015.0

    E-Print Network [OSTI]

    2011-015.0 Issuing Department: Human Subjects Protection Office Policy Number: 2011-015.0 Policy Title: Recruitment of and Payment to Research Subjects Purpose The purpose of this policy is to set forth requirements regarding recruitment of subjects into research studies. Definitions See policy 2011

  4. 28 LINCOLN LABORATORY JOURNAL n VOLUME 18, NUMBER 2, 2010 All-Weather

    E-Print Network [OSTI]

    Reuter, Martin

    the relatively high cloud-penetrating capability at microwave wave- lengths and the relatively sharp weighting resolution throughout the atmosphere [6]. Global simulation studies over ocean and land in clear and cloudy cloud penetration and high vertical resolution. » #12;VOLUME 18, NUMBER 2, 2010 n LINCOLN LABORATORY

  5. Nov/Dec 2003 When Your Number Comes Up Selected CSBA Convention Highlights

    E-Print Network [OSTI]

    Ishida, Yuko

    , and truck towing. Eric Mussen reviewed the current literature on effects of miticides on queens and drones scientific studies on drones and queens concern fluvali- nate and coumaphos. Results suggest that queens detrimental to drones. Total numbers, lon- gevity, and sperm counts of drones were reduced. How- ever

  6. Impinging laminar jets at moderate Reynolds numbers and separation distances Jeffrey M. Bergthorson,

    E-Print Network [OSTI]

    Impinging laminar jets at moderate Reynolds numbers and separation distances Jeffrey M. Bergthorson an experimental and numerical study of impinging, incompressible, axisym- metric, laminar jets, where the jet axis velocities along the centerline of the flow field. The jet-nozzle pressure drop is measured simultaneously

  7. New Paradigm for Baryon and Lepton Number Violation

    E-Print Network [OSTI]

    Pavel Fileviez Perez

    2015-08-17

    The possible discovery of proton decay, neutron-antineutron oscillation, neutrinoless beta decay in low energy experiments, and exotic signals related to the violation of the baryon and lepton numbers at collider experiments will change our understanding of the conservation of fundamental symmetries in nature. In this review we discuss the rare processes due to the existence of baryon and lepton number violating interactions. The simplest grand unified theories and the neutrino mass generation mechanisms are discussed. The theories where the baryon and lepton numbers are defined as local gauge symmetries spontaneously broken at the low scale are discussed in detail. The simplest supersymmetric gauge theory which predicts the existence of lepton number violating processes at the low scale is investigated. The main goal of this review is to discuss the main implications of baryon and lepton number violation in physics beyond the Standard Model.

  8. A Proposed Exact Integer Value for Avogadro's Number

    E-Print Network [OSTI]

    Ronald F. Fox; Theodore P. Hill

    2007-04-28

    An exact value for Avodagro's number, namely NA* = (84446888)^3, is proposed. The number 84446888 represents the side length of a cube of atoms whose volume is closest, among all integral side lengths, to the current official NIST value of Avogadro's number. This value NA* is nearly dead center of the estimated range for the value of Avogadro's number, and is within the official standard level of uncertainty. Adoption of this value as the fixed value for NA would eliminate the current time-dependent definition of Avogadro's number, which depends on the definition of kilogram via an unstable physical artifact. It would also eliminate the need for the kilogram artifact altogether, since then, by definition, a kilogram would be exactly 1000/12 the mass of NA* atoms of carbon-12.

  9. Verification of Numerical Programs: From Real Numbers to Floating Point Numbers

    E-Print Network [OSTI]

    Muńoz, César A.

    as to whether the properties verified in the theoretical setting hold in practice. This short paper de- scribes of the case study in this paper is air traffic man- agement (ATM). Advances in surveillance and communication detection and resolution (CD&R) systems that assist pilots and air traffic controllers to maintain safety

  10. Mid-American Review of Sociology, Volume 2, Number 2 (WINTER, 1977): Book Review

    E-Print Network [OSTI]

    Keating, Barbara R.

    1977-01-01

    , Kirsten. A New Look at the Silenced Majority: Women and American Democracy. Prentice-Hall, Inc. 1977. 83 Barbara R. KeatingUniversity of Nebraska-Lincoln A New Look at the Silenced Majority: Women and American Democracy by Kirsten Amundsen won... be familiar with a number of the many studies cited to support this disappointed outlook. But newcomers to the movement, students perhaps, will be introduced to a fairly comprehensive review of both empirical studies and essays concerning the women's movement...

  11. Bulletin of Tibetology: Volume 28 Number 3 Number 3 : Full issue

    E-Print Network [OSTI]

    Namgyal Institute of Tibetology

    1992-11-16

    SERIES No.3 16 November 1992 SIKKIM RESEARCH INSTITUTE OF TIBETOLOGY GANGTOK, INDIA The Bulletin of Tibetology seeks to seNe the specialist as well as the general reader with an interest in this field of study. The motif portraying the Stupa... on the mountains sug­ gests the dimensions of the field. • EDITORS· JAMPAL K. RECHUNG KUNGA YONTEN HOCHOTSANG BHAJAGOVINDA GHOSH BULLETIN OF TIBETOLOGY 1992 NEW SERIES No.3 16 November 1992 SIKKIM RESEARCH INSTITUTE OF TIBETOLOGY GANGTO~ INDIA CHU- SPRAL...

  12. Entanglement spectrum and number fluctuations in the spin-partitioned BCS ground state

    E-Print Network [OSTI]

    Xavier M. Puspus; Kristian Hauser Villegas; Francis N. C. Paraan

    2014-10-14

    We study entanglement between the spin components of the Bardeen-Cooper-Schrieffer (BCS) ground state by calculating the full entanglement spectrum and the corresponding von Neumann entanglement entropy. The entanglement spectrum is effectively modeled by a generalized Gibbs ensemble (GGE) of non-interacting electrons, which may be approximated by a canonical ensemble at the BCS critical temperature. We further demonstrate that the entanglement entropy is jointly proportional to the pairing energy and to the number of electrons about the Fermi surface (an area law). Furthermore, the entanglement entropy is also proportional to the number fluctuations of either spin component in the BCS state.

  13. Baryon Number and Electric Charge Fluctuations in High Energy Nucleus-Nucleus Collisions

    E-Print Network [OSTI]

    Konchakovski, V P; Bratkovskaya, E L; Stöcker, H

    2006-01-01

    Event-by-event fluctuations of the net baryon number and electric charge in nucleus-nucleus collisions are studied in Pb+Pb at 158 AGeV within the HSD transport model. We reveal an important role of the fluctuations in the number of target nucleon participants. They strongly influence all measured fluctuations even in the samples of events with rather rigid centrality trigger. This fact can be used to check different scenarios of nucleus-nucleus collisions by measuring the multiplicity fluctuations as a function of collision centrality in fixed kinematical regions of the projectile and target hemispheres.

  14. Lepton Number Violation and the Baryon Asymmetry of the Universe

    E-Print Network [OSTI]

    Harz, Julia; Päs, Heinrich

    2015-01-01

    Neutrinoless double beta decay, lepton number violating collider processes and the Baryon Asymmetry of the Universe (BAU) are intimately related. In particular lepton number violating processes at low energies in combination with sphaleron transitions will typically erase any pre-existing baryon asymmetry of the Universe. In this contribution we briefly review the tight connection between neutrinoless double beta decay, lepton number violating processes at the LHC and constraints from successful baryogenesis. We argue that far-reaching conclusions can be drawn unless the baryon asymmetry is stabilized via some newly introduced mechanism.

  15. Regulation Indentifier Number Title/Subject/Purpose Rule Type

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    of a specific rule, please see the Federal Register at https:www.regulations.gov. Regulation Indentifier Number TitleSubjectPurpose Rule Type Status 1991-AB82 Acquisition...

  16. CRUISE REPORT Cruise Number: DY10-04

    E-Print Network [OSTI]

    of satellite buoy (SatBuoy) 1 Transect (Trans) 3 Samples Collected Tows Number misc species in EtOH (AMGEN) 17 of buoy or mooring (Deploy) 1 1 Stimulated fluorescence collected during CTD casts (Fluor) 12 Any other

  17. To ASME Journal of Mechanical Design Manuscript Number 20302

    E-Print Network [OSTI]

    Chen, Wei

    To ASME Journal of Mechanical Design Revision Manuscript Number 20302 Sequential Optimization and Reliability Assessment Method for Efficient Probabilistic Design Xiaoping Du, Assistant Professor Department of Mechanical and Aerospace Engineering and Engineering Mechanics University of Missouri ­ Rolla Rolla, Missouri

  18. Computing the stability number of a graph via semidefinite and ...

    E-Print Network [OSTI]

    2006-04-27

    then the vertices of G can be numbered so that E(G8) ? E(G ). Thus G8 is the smallest graph G such that ?(1)(G) > ?(G) = 3. We can extend the above reasoning ...

  19. Copositivity cuts for improving SDP bounds on the clique number ...

    E-Print Network [OSTI]

    2008-11-13

    ?(1)(G8) = 3.04328 while cutting with K4-free graphs trivially delivers the exact clique number since G8 itself is K4-free. See Subsection 6.1 below for.

  20. NUMBER: BUSF 1.08 SECTION: Business and Finance

    E-Print Network [OSTI]

    Almor, Amit

    NUMBER: BUSF 1.08 SECTION: Business and Finance SUBJECT: Relocation Expenses DATE: November 1, 2006 can claim reimbursement for your actual expenses such as gas and oil or the standard mileage rate (for