Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

LANL: Ion Beam Materials Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Ion Beam Materials Laboratory (IBML) is a Los Ion Beam Materials Laboratory (IBML) is a Los Alamos National Laboratory resource devoted to materi- als research through the use of ion beams. Current major research areas include surface characterization through ion beam analysis techniques, surface modification and materials synthesis through ion implantation technology, and radiation damage stud- ies in gases, liquids, and solids. The laboratory's core is a 3.2 MV tandem ion accelerator and a 200 kV ion implanter together with several beam lines. Attached to each beam line is a series of experimental stations that support various research programs. The operation of IBML and its interactions with users are organized around core facilities and experimental stations. The IBML provides and operates the core facilities as well as supports

2

Sandia National Laboratories: ion beam assisted deposition  

NLE Websites -- All DOE Office Websites (Extended Search)

ion beam assisted deposition Sandia, Los Alamos, Superconducting Technologies Inc., & Superpower: Solution Deposition Planarization On March 20, 2013, in CINT, Facilities, Grid...

3

Simulation of ion beam transport through the 400 Kv ion implanter at Michigan Ion Beam Laboratory  

SciTech Connect

The Michigan Ion Beam Laboratory houses a 400 kV ion implanter. An application that simulates the ion beam trajectories through the implanter from the ion source to the target was developed using the SIMION Registered-Sign code. The goals were to have a tool to develop an intuitive understanding of abstract physics phenomena and diagnose ion trajectories. Using this application, new implanter users of different fields in science quickly understand how the machine works and quickly learn to operate it. In this article we describe the implanter simulation application and compare the parameters of the implanter components obtained from the simulations with the measured ones. The overall agreement between the simulated and measured values of magnetic fields and electric potentials is {approx}10%.

Naab, F. U.; Toader, O. F.; Was, G. S. [Department of Engineering and Radiological Sciences, University of Michigan, 2355 Bonisteel Boulevard, Ann Arbor, MI 48109-2104 (United States)

2013-04-19T23:59:59.000Z

4

Spontaneous ion beam formation in the laboratory, space, and simulation  

SciTech Connect

We present experimental evidence for the spontaneous formation of multiple double layers within a single divergent magnetic field structure. Downstream of the divergent magnetic field, multiple accelerated ion populations are observed. The similarity of the accelerated ion populations observed in these laboratory experiments to ion populations observed in the magnetosphere and in numerical simulations suggests that the observation of a complex ion velocity distribution alone is insufficient to distinguish between simple plasma expansion and magnetic reconnection. Further, the effective temperature of the aggregate ion population is significantly larger than the temperatures of the individual ion population components, suggesting that insufficiently resolved measurements could misidentify multiple beam creation as ion heating. Ions accelerated in randomly oriented electric fields that mimic heating would have an ion heating rate dependent on the ion charge and mass that is qualitatively consistent with recent experimental observations of ion heating during magnetic reconnection.

Carr, J. Jr.; Cassak, P. A.; Galante, M.; Keesee, A. M.; Lusk, G.; Magee, R. M.; McCarren, D.; Scime, E. E.; Sears, S.; Vandervort, R. [Department of Physics, West Virginia University, Morgantown, West Virginia 26506 (United States)] [Department of Physics, West Virginia University, Morgantown, West Virginia 26506 (United States); Gulbrandsen, N. [University of Tromsø, Tromsø (Norway)] [University of Tromsø, Tromsø (Norway); Goldman, Martin; Newman, David [Department of Physics, University of Colorado–Boulder, Boulder, Colorado 80309 (United States)] [Department of Physics, University of Colorado–Boulder, Boulder, Colorado 80309 (United States); Eastwood, J. P. [The Blackett Laboratory, Imperial College London, London SW7 2AZ (United Kingdom)] [The Blackett Laboratory, Imperial College London, London SW7 2AZ (United Kingdom)

2013-07-15T23:59:59.000Z

5

Laser ion source with solenoid for Brookhaven National Laboratory-electron beam ion source  

SciTech Connect

The electron beam ion source (EBIS) preinjector at Brookhaven National Laboratory (BNL) is a new heavy ion-preinjector for relativistic heavy ion collider (RHIC) and NASA Space Radiation Laboratory (NSRL). Laser ion source (LIS) is a primary ion source provider for the BNL-EBIS. LIS with solenoid at the plasma drift section can realize the low peak current ({approx}100 {mu}A) with high charge ({approx}10 nC) which is the BNL-EBIS requirement. The gap between two solenoids does not cause serious plasma current decay, which helps us to make up the BNL-EBIS beamline.

Kondo, K.; Okamura, M. [Collider-Accelerator Department, Brookhaven National Laboratory, New York (United States); Yamamoto, T. [Cooperative Major in Nuclear Energy, Waseda University, Tokyo (Japan); Sekine, M. [Department of Nuclear Engineering, Tokyo Institute of Technology, Tokyo (Japan)

2012-02-15T23:59:59.000Z

6

Laser ion source with solenoid for Brookhaven National Laboratory-electron beam ion source  

SciTech Connect

The electron beam ion source (EBIS) preinjector at Brookhaven National Laboratory (BNL) is a new heavy ion-preinjector for relativistic heavy ion collider (RHIC) and NASA Space Radiation Laboratory (NSRL). Laser ion source (LIS) is a primary ion source provider for the BNL-EBIS. LIS with solenoid at the plasma drift section can realize the low peak current ({approx}100 {micro}A) with high charge ({approx}10 nC) which is the BNL-EBIS requirement. The gap between two solenoids does not cause serious plasma current decay, which helps us to make up the BNL-EBIS beamline.

Kondo K.; Yamamoto, T.; Sekine, M.; Okamura, M.

2012-02-22T23:59:59.000Z

7

New Ion Beam Materials Laboratory for Materials Modification and Irradiation Effects Research  

SciTech Connect

A new multifunctional ion beam materials laboratory (IBML) has been established at the University of Tennessee, in partnership with Oak Ridge National Laboratory. The IBML is currently equipped with two ion sources, a 3 MV tandem accelerator, three beamlines and three endstations. The IBML is primarily dedicated to fundamental research on ion-solid interaction, ion beam analysis, ion beam modification, and other basic and applied research on irradiation effects in a wide range of materials. An overview of the IBML facility is provided, and experimental results are reported to demonstrate the specific capabilities.

Zhang, Yanwen [ORNL; Crespillo, Miguel L [University of Tennessee (UT); Xue, Haizhou [University of Tennessee, Knoxville (UTK); Jin, Ke [University of Tennessee, Knoxville (UTK); Chen, Chien-Hung [University of Tennessee, Knoxville (UTK); Fontana, Cristiano L [ORNL; Graham, Dr. Joseph T. [The University of Tennessee; Weber, William J [ORNL

2014-01-01T23:59:59.000Z

8

Ion Beam Materials Lab  

NLE Websites -- All DOE Office Websites (Extended Search)

Facilities » Facilities » Ion Beam Materials Lab Ion Beam Materials Lab A new research frontier awaits! Our door is open and we thrive on mutually beneficial partnerships, collaborations that drive innovations and new technologies. April 12, 2012 Ion Beam Danfysik Implanter High Voltage Terminal. Contact Yongqiang Wang (505) 665-1596 Email Devoted to the characterization and modification of surfaces through the use of ion beams The Ion Beam Materials Laboratory (IBML) is a Los Alamos National Laboratory resource devoted to the characterization and modification of surfaces through the use of ion beams. The IBML provides and operates the core facilities, while supporting the design and implementation of specific apparati needed for experiments requested by users of the facility. The result is a facility with

9

Characteristics of ion-acoustic solitary wave in a laboratory dusty plasma under the influence of ion-beam  

SciTech Connect

We study the influence of ion beam and charged dust impurity on the propagation of dust ion-acoustic solitary wave in an unmagnetized plasma consisting of Boltzmann distributed electrons, positive ions, positive ion beam, and negatively charged immobile dusts in a double plasma device. On interacting with an ion beam, the solitary wave is bifurcated into a compressive fast and a rarefactive slow beam mode, and appears along with the primary wave. However, there exists a critical velocity of the beam beyond which the amplitude of the fast solitary wave starts diminishing and rarefactive slow beam mode propagates with growing amplitude. Whereas, the presence of charged dust impurity in the plasma reduces this critical beam velocity and a substantial modification in the phase velocity of the slow beam mode is observed with increasing dust density. Furthermore, the nonlinear wave velocity (Mach number) as well as the width of the compressive solitons are measured for different beam velocity and dust density, and are compared with those obtained from the K-dV equation. The experimental results are found in a well agreement with the theoretical predictions.

Deka, M. K.; Adhikary, N. C.; Bailung, H. [Physical Sciences Division, Institute of Advanced Study in Science and Technology, Vigyan Path, Paschim Boragaon, Garchuk, Guwahati 781035, Assam (India); Misra, A. P. [Department of Mathematics, Siksha Bhavana, Visva-Bharati University, Santiniketan 731 235 (India); Nakamura, Y. [Department of Physics, Faculty of Engineering, Yokohama National University, 79-5 Tokiwadai, Hodogaya-ku, Yokohama 240-8501 (Japan)

2012-10-15T23:59:59.000Z

10

IonBeamMicroFab  

NLE Websites -- All DOE Office Websites (Extended Search)

Ion Beam Manufacture of Microscale Ion Beam Manufacture of Microscale Tools and Components Manufacturing Technologies Sandia Manufacturing Science &Technology's Focused Ion Beam (FIB) laboratory provides an opportunity for research, development and prototyping. Currently, our scientists are devel- oping methods for ion beam sculpting microscale tools, components and devices. This includes shaping of specialty tools such as end-mills, turning tools and indenters. Many of these have been used in ultra-precision machining DOE applications. Additionally, staff are developing the capability to ion mill geo- metrically-complex features and substrates. This includes the ability to sputter predeter- mined curved shapes of various symmetries and periodicities. Capabilities and Expertise * Two custom-built focused ion beam sys-

11

Enforcement Letter - Evaluation of Deficiencies Operational Emergency at Building 6000, Holifield Radioactive Ion Beam Facility, Oak Ridge National Laboratory  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3,2009 3,2009 Dr. Thom Mason President and CEO UT-Battelle Oak Ridge National Laboratory P.O. Box 2008 Oak Ridge, Tennessee 37831-6255 Dear Dr. Mason: The Department of Energy's Office of Enforcement within the Office of Health, Safety and Security has conducted an evaluation of the deficiencies described in Noncompliance Tracking System (NTS) report NTS-ORO--0RNL-XlOPHYSICS-2008-0001, Operational Emergency at Building 6000, Holzfield Radioactive Ion Beam Facility. Our evaluation included a review of the Oak Ridge National Laboratory (ORNL) Management Investigation Team Report dated November 19,2008, the associated corrective action plan, and discussions with site personnel. The subject NTS report described a series of deficiencies at the Holifield Radioactive Ion

12

Electron Beam Ion Sources  

E-Print Network (OSTI)

Electron beam ion sources (EBISs) are ion sources that work based on the principle of electron impact ionization, allowing the production of very highly charged ions. The ions produced can be extracted as a DC ion beam as well as ion pulses of different time structures. In comparison to most of the other known ion sources, EBISs feature ion beams with very good beam emittances and a low energy spread. Furthermore, EBISs are excellent sources of photons (X-rays, ultraviolet, extreme ultraviolet, visible light) from highly charged ions. This chapter gives an overview of EBIS physics, the principle of operation, and the known technical solutions. Using examples, the performance of EBISs as well as their applications in various fields of basic research, technology and medicine are discussed.

Zschornacka, G; Thorn, A

2013-01-01T23:59:59.000Z

13

The Electron Beam Ion Source (EBIS)  

ScienceCinema (OSTI)

Brookhaven National Lab has successfully developed a new pre-injector system, called the Electron Beam Ion Source, for the Relativistic Heavy Ion Collider (RHIC) and NASA Space Radiation Laboratory science programs. The first of several planned improvemen

Brookhaven Lab

2010-01-08T23:59:59.000Z

14

The Electron Beam Ion Source (EBIS)  

SciTech Connect

Brookhaven National Lab has successfully developed a new pre-injector system, called the Electron Beam Ion Source, for the Relativistic Heavy Ion Collider (RHIC) and NASA Space Radiation Laboratory science programs. The first of several planned improvemen

Brookhaven Lab

2009-06-09T23:59:59.000Z

15

Focused ion beam system  

DOE Patents (OSTI)

A focused ion beam (FIB) system produces a final beam spot size down to 0.1 {mu}m or less and an ion beam output current on the order of microamps. The FIB system increases ion source brightness by properly configuring the first (plasma) and second (extraction) electrodes. The first electrode is configured to have a high aperture diameter to electrode thickness aspect ratio. Additional accelerator and focusing electrodes are used to produce the final beam. As few as five electrodes can be used, providing a very compact FIB system with a length down to only 20 mm. Multibeamlet arrangements with a single ion source can be produced to increase throughput. The FIB system can be used for nanolithography and doping applications for fabrication of semiconductor devices with minimum feature sizes of 0.1 m or less. 13 figs.

Leung, K.; Gough, R.A.; Ji, Q.; Lee, Y.Y.

1999-08-31T23:59:59.000Z

16

Ion Beams - Radiation Effects Facility / Cyclotron Institute...  

NLE Websites -- All DOE Office Websites (Extended Search)

Ion Beams Available Beams Beam Change Times Measurements Useful Graphs Various ion beams have been developed specifically for the Radiation Effects Facility. These beams...

17

Ion-beam superpinch  

Science Journals Connector (OSTI)

Intense nonrelativistic light-ion beams generated in magnetically insulated diodes can reach total beam currents large enough to confine charged fusion products within pinch channels which are formed by these beams if they are projected onto thermonuclear material. Furthermore, since the required beam currents are still below the critical Alfvén current, these pinch channels are magnetohydrodynamically stable. However, because the time these beams last is very short and of the order of 10 nsec, the thermonuclear target must have a density at least as large as solid-state density to satisfy the Lawson criterion. This large target density makes it necessary that the beam be focused down to a radius less than ? 10-2 cm, to balance the plasma pressure against the magnetic pressure. To make this focusing possible a new kind of a low-emittance intense ion source is proposed. It consists of pointlike pulsed dense plasma positioned in the field-free space behind a meshlike anode. The focusing itself can be done in three steps, first by sufficiently good ion optics, second by wall focusing, and third by radiation cooling. This inertial-confinement fusion concept avoids the problems of reaching this goal through highdensity target compression by ablative implosion.

F. Winterberg

1981-10-01T23:59:59.000Z

18

Pulsed ion beam source  

DOE Patents (OSTI)

An improved pulsed ion beam source is disclosed having a new biasing circuit for the fast magnetic field. This circuit provides for an initial negative bias for the field created by the fast coils in the ion beam source which pre-ionize the gas in the source, ionize the gas and deliver the gas to the proper position in the accelerating gap between the anode and cathode assemblies in the ion beam source. The initial negative bias improves the interaction between the location of the nulls in the composite magnetic field in the ion beam source and the position of the gas for pre-ionization and ionization into the plasma as well as final positioning of the plasma in the accelerating gap. Improvements to the construction of the flux excluders in the anode assembly are also accomplished by fabricating them as layered structures with a high melting point, low conductivity material on the outsides with a high conductivity material in the center. 12 figs.

Greenly, J.B.

1997-08-12T23:59:59.000Z

19

Measurements - Ion Beams - Radiation Effects Facility / Cyclotron...  

NLE Websites -- All DOE Office Websites (Extended Search)

Ion Beams Available Beams Beam Change Times Measurements Useful Graphs Measurements The beam uniformity and flux are determined using an array of five detectors. Each...

20

ORISE: University Radioactive Ion Beam Consortium  

NLE Websites -- All DOE Office Websites (Extended Search)

UNIRIB UNIRIB Research Overview Physics Topics Equipment Development Education and Training People Publications Overview 2009 Bibliography 2008 Bibliography 2007 Bibliography 2006 Bibliography How to Work With Us Contact Us Oak Ridge Institute for Science Education University Radioactive Ion Beam Consortium The University Radioactive Ion Beam (UNIRIB) consortium is a division of the Oak Ridge Institute for Science and Education (ORISE) focused on cutting-edge nuclear physics research. UNIRIB is a collaborative partnership involving Oak Ridge National Laboratory (ORNL) and nine member universities that leverages national laboratory and university resources to effectively accomplish the U.S. Department of Energy's (DOE) strategic goals in the fundamental structure of nuclei.

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Experiments at The Virtual National Laboratory for Heavy Ion Fusion  

E-Print Network (OSTI)

Heavy Ion Beam Driven Fusion Reactor Study", KfK 3840,between the reactor chamber wall and the fusion target. Thereactor chambers. INTRODUCTION The USA Virtual National Laboratory for Heavy Ion Fusion

2000-01-01T23:59:59.000Z

22

Laser acceleration of ion beams  

E-Print Network (OSTI)

We consider methods of charged particle acceleration by means of high-intensity lasers. As an application we discuss a laser booster for heavy ion beams provided, e.g. by the Dubna nuclotron. Simple estimates show that a cascade of crossed laser beams would be necessary to provide additional acceleration to gold ions of the order of GeV/nucleon.

I. A. Egorova; A. V. Filatov; A. V. Prozorkevich; S. A. Smolyansky; D. B. Blaschke; M. Chubaryan

2007-02-01T23:59:59.000Z

23

Neon Ion Beam Lithography (NIBL)  

E-Print Network (OSTI)

Existing techniques for electron- and ion-beam lithography, routinely employed for nanoscale device fabrication and mask/mold prototyping, do not simultaneously achieve efficient (low fluence) exposure and high resolution. ...

Winston, Donald

24

The Heavy Ion Fusion Virtual National Laboratory The Heavy Ion Path to Fusion Energy  

E-Print Network (OSTI)

-consistent power plant design for a multi- beam induction linac, final focus and chamber propagationThe Heavy Ion Fusion Virtual National Laboratory The Heavy Ion Path to Fusion Energy Grant Logan Director Heavy-Ion Fusion Virtual National Laboratory Presented to FESAC Workshop on Development Paths

25

High energy density physics generated by intense heavy ion beams  

Science Journals Connector (OSTI)

Intense ion beams from accelerators are now available to generate high energy density matter and to study astrophysical phenomena in the laboratory under controlled and reproducible conditions. A detailed unde...

D. H. H. Hoffmann; V. E. Fortov; M. Kuster; V. Mintsev…

2009-08-01T23:59:59.000Z

26

Focused Ion Beam (FIB):  

Science Journals Connector (OSTI)

...al., 1990; Basile et al., 1992; Overwijk et al., 1993). Focused gallium ion...detailed descriptions are given elsewhere (Overwijk et al., 1993; Heaney et al., 2001...Kluwer Academic Publishers, 316 pp. Overwijk, M.H.E., van den Heuvel, F...

Richard WIRTH

27

MIS-1 electron-beam ion source  

Science Journals Connector (OSTI)

The Institute of Nuclear Physics (INP) has developed and produced electron-beam multiply charged ion sources. These ion sources give the electron beam its high density in the ionization...3 A/cm2.... They produce...

V. G. Abdulmanov; N. S. Dikansky

2010-12-01T23:59:59.000Z

28

Oxygen ion-beam microlithography  

DOE Patents (OSTI)

A method of providing and developing a resist on a substrate for constructing integrated circuit (IC) chips includes the following steps: of depositing a thin film of amorphous silicon or hydrogenated amorphous silicon on the substrate and exposing portions of the amorphous silicon to low-energy oxygen ion beams to oxidize the amorphous silicon at those selected portions. The nonoxidized portions are then removed by etching with RF-excited hydrogen plasma. Components of the IC chip can then be constructed through the removed portions of the resist. The entire process can be performed in an in-line vacuum production system having several vacuum chambers. Nitrogen or carbon ion beams can also be used. 5 figures.

Tsuo, Y.S.

1991-08-20T23:59:59.000Z

29

Oxygen ion-beam microlithography  

DOE Patents (OSTI)

A method of providing and developing a resist on a substrate for constructing integrated circuit (IC) chips includes the following steps: of depositing a thin film of amorphous silicon or hydrogenated amorphous silicon on the substrate and exposing portions of the amorphous silicon to low-energy oxygen ion beams to oxidize the amorphous silicon at those selected portions. The nonoxidized portions are then removed by etching with RF-excited hydrogen plasma. Components of the IC chip can then be constructed through the removed portions of the resist. The entire process can be performed in an in-line vacuum production system having several vacuum chambers. Nitrogen or carbon ion beams can also be used.

Tsuo, Y. Simon (Lakewood, CO)

1991-01-01T23:59:59.000Z

30

Monte Carlo Modeling of Ion Beam Induced Secondary Electrons.  

E-Print Network (OSTI)

??Modeling ion beam induced secondary electron (iSE) production within matter for simulating ion beam induced images has been studied. When the complex nature of ion… (more)

Huh, Uk

2014-01-01T23:59:59.000Z

31

Are Cluster Ion Analysis Beams Good Choices for Hydrogen Depth...  

NLE Websites -- All DOE Office Websites (Extended Search)

Cluster Ion Analysis Beams Good Choices for Hydrogen Depth Profiling Using Time-of-Flight Secondary Ion Mass Spectrometry? Are Cluster Ion Analysis Beams Good Choices for Hydrogen...

32

Structural Modification of Nanocrystalline Ceria by Ion Beams...  

NLE Websites -- All DOE Office Websites (Extended Search)

Modification of Nanocrystalline Ceria by Ion Beams. Structural Modification of Nanocrystalline Ceria by Ion Beams. Abstract: Using energetic ions, we have demonstrated effective...

33

Molecular Ion Beam Transportation for Low Energy Ion Implantation  

SciTech Connect

A joint research and development of steady state intense boron ion sources for 100's of electron-volt ion implanters has been in progress for the past five years. Current density limitation associated with extracting and transporting low energy ion beams result in lower beam currents that in turn adversely affects the process throughput. The transport channel with electrostatic lenses for decaborane (B{sub 10}H{sub 14}) and carborane (C{sub 2}B{sub 10}H{sub 12}) ion beams transportation was developed and investigated. The significant increase of ion beam intensity at the beam transport channel output is demonstrated. The transport channel simulation, construction and experimental results of ion beam transportation are presented.

Kulevoy, T. V.; Kropachev, G. N.; Seleznev, D. N.; Yakushin, P. E.; Kuibeda, R. P.; Kozlov, A. V.; Koshelev, V. A. [Institute for Theoretical and Experimental Physics, Moscow, 117218 (Russian Federation); Hershcovitch, A.; Johnson, B. M. [Brookhaven National Laboratory, Upton, New York 11973 (United States); Gushenets, V. I.; Oks, E. M. [High Current Electronics Institute Russian Academy of Sciences, Tomsk, 634055 (Russian Federation); Polozov, S. M. [Moscow Engineering Physics Institute, Kashirskoe sh. 31, Moscow, 115409 (Russian Federation); Poole, H. J. [PVI, Oxnard, California 93031-5023 (United States)

2011-01-07T23:59:59.000Z

34

Feasibility study of a laser ion source for primary ion injection into the Relativistic Heavy Ion Collider electron beam ion sourcea...  

E-Print Network (OSTI)

Collider electron beam ion sourcea... Takeshi Kanesue Department of Applied Quantum Physics and Nuclear Okamura Collider-Accelerator Department, Brookhaven National Laboratory, Upton, New York 11973, USA are in the vacuum of about 10-4 Pa and are isolated from the rest of the beam line to allow the extraction of ions

35

Useful Graphs and Charts - Ion Beams - Radiation Effects Facility...  

NLE Websites -- All DOE Office Websites (Extended Search)

Ion Beams Available Beams Beam Change Times Measurements Useful Graphs Useful Graphs and Charts LET vs. Range in Si Graphs: 15 MeVu Beams 24.8 MeVu Beams 40 MeVu Beams...

36

Focused ion beam source method and apparatus  

DOE Patents (OSTI)

A focused ion beam having a cross section of submicron diameter, a high ion current, and a narrow energy range is generated from a target comprised of particle source material by laser ablation. The method involves directing a laser beam having a cross section of critical diameter onto the target, producing a cloud of laser ablated particles having unique characteristics, and extracting and focusing a charged particle beam from the laser ablated cloud. The method is especially suited for producing focused ion beams for semiconductor device analysis and modification.

Pellin, Michael J. (Naperville, IL); Lykke, Keith R. (Gaithersburg, MD); Lill, Thorsten B. (Sunnyvale, CA)

2000-01-01T23:59:59.000Z

37

Risk Management Plan Electron Beam Ion Source Project  

E-Print Network (OSTI)

, with the appropriate management oversight, can establish the specific approaches to addressing the individual riskRisk Management Plan for the Electron Beam Ion Source Project (EBIS) Project # 06-SC-002 at Brookhaven National Laboratory Upton, NY For the U.S. Department of Energy Office of Science Office

38

Long Plasma Source for Heavy Ion Beam Charge Neutralization  

E-Print Network (OSTI)

neutralizing plasma column the heavy ion beam can focus to aPlasmas are a source of unbound electrons for charge neutralizing intense heavy ion beams to focus

Efthimion, P.C.

2009-01-01T23:59:59.000Z

39

Applications of High Energy Ion Beam Techniques in Environmental...  

NLE Websites -- All DOE Office Websites (Extended Search)

High Energy Ion Beam Techniques in Environmental Science: Investigation Associated with Glass and Ceramic Waste Applications of High Energy Ion Beam Techniques in Environmental...

40

Plasma ion sources and ion beam technology inmicrofabrications  

SciTech Connect

For over decades, focused ion beam (FIB) has been playing a very important role in microscale technology and research, among which, semiconductor microfabrication is one of its biggest application area. As the dimensions of IC devices are scaled down, it has shown the need for new ion beam tools and new approaches to the fabrication of small-scale devices. In the meanwhile, nanotechnology has also deeply involved in material science research and bioresearch in recent years. The conventional FIB systems which utilize liquid gallium ion sources to achieve nanometer scale resolution can no longer meet the various requirements raised from such a wide application area such as low contamination, high throughput and so on. The drive towards controlling materials properties at nanometer length scales relies on the availability of efficient tools. In this thesis, three novel ion beam tools have been developed and investigated as the alternatives for the conventional FIB systems in some particular applications. An integrated focused ion beam (FIB) and scanning electron microscope (SEM) system has been developed for direct doping or surface modification. This new instrument employs a mini-RF driven plasma source to generate focused ion beam with various ion species, a FEI two-lens electron (2LE) column for SEM imaging, and a five-axis manipulator system for sample positioning. An all-electrostatic two-lens column has been designed to focus the ion beam extracted from the source. Based on the Munro ion optics simulation, beam spot sizes as small as 100 nm can be achieved at beam energies between 5 to 35 keV if a 5 {micro}m-diameter extraction aperture is used. Smaller beam spot sizes can be obtained with smaller apertures at sacrifice of some beam current. The FEI 2LE column, which utilizes Schottky emission, electrostatic focusing optics, and stacked-disk column construction, can provide high-resolution (as small as 20 nm) imaging capability, with fairly long working distance (25 mm) at 25 keV beam voltage. Such an integrated FIB/SEM dual-beam system will not only improve the accuracy and reproducibility when performing ion beam sculpting and direct implantation processes, but will also enable researchers to perform cross-sectioning, imaging, and analysis with the same tool. A major advantage of this approach is the ability to produce a wide variety of ion species tailored to the application.

Ji, Lili

2007-09-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Flow-through ion beam source  

DOE Patents (OSTI)

A method and an apparatus for forming a charge neutral ion beam which is useful in producing thin films of material on electrically conductive or non-conductive substrates are provided. 4 figs.

Springer, R.W.

1997-02-11T23:59:59.000Z

42

A Micromachined Electron Beam Ion Source  

Science Journals Connector (OSTI)

The complete ion source consists of two parts: an RF-plasma electron source, the linked up optic which focuses the electron beam into the second part, the ionization...

G. Petzold; P. Siebert; J. Müller

2000-01-01T23:59:59.000Z

43

Ion beam processing of advanced electronic materials  

SciTech Connect

This report contains research programs discussed at the materials research society symposia on ion beam processing of advanced electronic materials. Major topics include: shallow implantation and solid-phase epitaxy; damage effects; focused ion beams; MeV implantation; high-dose implantation; implantation in III-V materials and multilayers; and implantation in electronic materials. Individual projects are processed separately for the data bases. (CBS)

Cheung, N.W.; Marwick, A.D.; Roberto, J.B. (eds.) (California Univ., Berkeley, CA (USA); International Business Machines Corp., Yorktown Heights, NY (USA). Thomas J. Watson Research Center; Oak Ridge National Lab., TN (USA))

1989-01-01T23:59:59.000Z

44

Engineering embedded metal nanoparticles with ion beam technology  

E-Print Network (OSTI)

2002) Engineering embedded metal nanoparticles with ion beam3 Engineering embedded metal nanoparticles with ion beamcompara- Engineering embedded metal nanoparticles with ion

Ren, Feng; Xiao, Xiang Heng; Cai, Guang Xu; Wang, Jian Bo; Jiang, Chang Zhong

2009-01-01T23:59:59.000Z

45

A pencil beam algorithm for helium ion beam therapy  

SciTech Connect

Purpose: To develop a flexible pencil beam algorithm for helium ion beam therapy. Dose distributions were calculated using the newly developed pencil beam algorithm and validated using Monte Carlo (MC) methods. Methods: The algorithm was based on the established theory of fluence weighted elemental pencil beam (PB) kernels. Using a new real-time splitting approach, a minimization routine selects the optimal shape for each sub-beam. Dose depositions along the beam path were determined using a look-up table (LUT). Data for LUT generation were derived from MC simulations in water using GATE 6.1. For materials other than water, dose depositions were calculated by the algorithm using water-equivalent depth scaling. Lateral beam spreading caused by multiple scattering has been accounted for by implementing a non-local scattering formula developed by Gottschalk. A new nuclear correction was modelled using a Voigt function and implemented by a LUT approach. Validation simulations have been performed using a phantom filled with homogeneous materials or heterogeneous slabs of up to 3 cm. The beams were incident perpendicular to the phantoms surface with initial particle energies ranging from 50 to 250 MeV/A with a total number of 10{sup 7} ions per beam. For comparison a special evaluation software was developed calculating the gamma indices for dose distributions. Results: In homogeneous phantoms, maximum range deviations between PB and MC of less than 1.1% and differences in the width of the distal energy falloff of the Bragg-Peak from 80% to 20% of less than 0.1 mm were found. Heterogeneous phantoms using layered slabs satisfied a {gamma}-index criterion of 2%/2mm of the local value except for some single voxels. For more complex phantoms using laterally arranged bone-air slabs, the {gamma}-index criterion was exceeded in some areas giving a maximum {gamma}-index of 1.75 and 4.9% of the voxels showed {gamma}-index values larger than one. The calculation precision of the presented algorithm was considered to be sufficient for clinical practice. Although only data for helium beams was presented, the performance of the pencil beam algorithm for proton beams was comparable. Conclusions: The pencil beam algorithm developed for helium ions presents a suitable tool for dose calculations. Its calculation speed was evaluated to be similar to other published pencil beam algorithms. The flexible design allows easy customization of measured depth-dose distributions and use of varying beam profiles, thus making it a promising candidate for integration into future treatment planning systems. Current work in progress deals with RBE effects of helium ions to complete the model.

Fuchs, Hermann; Stroebele, Julia; Schreiner, Thomas; Hirtl, Albert; Georg, Dietmar [Christian Doppler Laboratory for Medical Radiation Research for Radiation Oncology, Medical University of Vienna, 1090 Vienna (Austria); Department of Radiation Oncology, Medical University of Vienna/AKH Vienna, 1090 Vienna (Austria) and Comprehensive Cancer Center, Medical University of Vienna/AKH Vienna, 1090 Vienna (Austria); Department of Radiation Oncology, Medical University of Vienna/AKH Vienna (Austria) and Comprehensive Cancer Center, Medical University of Vienna/AKH Vienna, 1090 Vienna (Austria); PEG MedAustron, 2700 Wiener Neustadt (Austria); Department of Nuclear Medicine, Medical University of Vienna, 1090 Vienna (Austria); Christian Doppler Laboratory for Medical Radiation Research for Radiation Oncology, Medical University of Vienna, 1090 Vienna (Austria); Department of Radiation Oncology, Medical University of Vienna/AKH Vienna, 1090 Vienna (Austria) and Comprehensive Cancer Center, Medical University of Vienna/AKH Vienna, 1090 Vienna (Austria)

2012-11-15T23:59:59.000Z

46

Beam current controller for laser ion source  

DOE Patents (OSTI)

The present invention relates to the design and use of an ion source with a rapid beam current controller for experimental and medicinal purposes. More particularly, the present invention relates to the design and use of a laser ion source with a magnetic field applied to confine a plasma flux caused by laser ablation.

Okamura, Masahiro

2014-10-28T23:59:59.000Z

47

World record neutron beam at Los Alamos National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

World record neutron beam at LANL World record neutron beam at Los Alamos National Laboratory Scientists have created the largest neutron beam ever made by a short-pulse laser,...

48

The Particle Beam Optics Interactive Computer Laboratory  

SciTech Connect

The Particle Beam Optics Interactive Computer Laboratory (PBO Lab) is an educational software concept to aid students and professionals in learning about charged particle beams and particle beam optical systems. The PBO Lab is being developed as a cross-platform application and includes four key elements. The first is a graphic user interface shell that provides for a highly interactive learning session. The second is a knowledge database containing information on electric and magnetic optics transport elements. The knowledge database provides interactive tutorials on the fundamental physics of charged particle optics and on the technology used in particle optics hardware. The third element is a graphical construction kit that provides tools for students to interactively and visually construct optical beamlines. The final element is a set of charged particle optics computational engines that compute trajectories, transport beam envelopes, fit parameters to optical constraints and carry out similar calculations for the student designed beamlines. The primary computational engine is provided by the third-order TRANSPORT code. Augmenting TRANSPORT is the multiple ray tracing program TURTLE and a first-order matrix program that includes a space charge model and support for calculating single particle trajectories in the presence of the beam space charge. This paper describes progress on the development of the PBO Lab.

Gillespie, George H.; Hill, Barrey W.; Brown, Nathan A.; Babcock, R. Chris; Martono, Hendy; Carey, David C. [G. H. Gillespie Associates, Inc., P.O. Box 2961, Del Mar, California 92014, United States of America (United States); G. H. Gillespie Associates, Inc., P.O. Box 2961, Del Mar, California 92014, United States of America (United States); Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, Illinois 60510 (United States)

1997-02-01T23:59:59.000Z

49

The Particle Beam Optics Interactive Computer Laboratory  

SciTech Connect

The Particle Beam Optics Interactive Computer Laboratory (PBO Lab) is an educational software concept to aid students and professionals in learning about charged particle beams and particle beam optical systems. The PBO Lab is being developed as a cross-platform application and includes four key elements. The first is a graphic user interface shell that provides for a highly interactive learning session. The second is a knowledge database containing information on electric and magnetic optics transport elements. The knowledge database provides interactive tutorials on the fundamental physics of charged particle optics and on the technology used in particle optics hardware. The third element is a graphical construction kit that provides tools for students to interactively and visually construct optical beamlines. The final element is a set of charged particle optics computational engines that compute trajectories, transport beam envelopes, fit parameters to optical constraints and carry out similar calculations for the student designed beamlines. The primary computational engine is provided by the third-order TRANSPORT code. Augmenting TRANSPORT is the multiple ray tracing program TURTLE and a first-order matrix program that includes a space charge model and support for calculating single particle trajectories in the presence of the beam space charge. This paper describes progress on the development of the PBO Lab. {copyright} {ital 1997 American Institute of Physics.}

Gillespie, G.H.; Hill, B.W.; Brown, N.A.; Babcock, R.C.; Martono, H. [G. H. Gillespie Associates, Inc., P.O. Box 2961, Del Mar, California 92014 (United States of America); Carey, D.C. [G. H. Gillespie Associates, Inc., P.O. Box 2961, Del Mar, California 92014 (United States of America)]|[Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, Illinois 60510 (United States)

1997-02-01T23:59:59.000Z

50

The uses of electron beam ion traps in the study of highly charged ions  

SciTech Connect

The Electron Beam Ion Trap (EBIT) is a relatively new tool for the study of highly charged ions. Its development has led to a variety of new experimental opportunities; measurements have been performed with EBITs using techniques impossible with conventional ion sources or storage rings. In this paper, I will highlight the various experimental techniques we have developed and the results we have obtained using the EBIT and higher-energy Super-EBIT built at the Lawrence Livermore National Laboratory. The EBIT employs a high-current-density electron beam to trap, ionize, and excite a population of ions. The ions can be studied in situ or extracted from the trap for external experiments. The trapped ions form an ionization-state equilibrium determined by the relative ionization and recombination rates. Ions of several different elements may simultaneously be present in the trap. The ions are nearly at rest, and, for most systems, all in their ground-state configurations. The electron-ion interaction energy has a narrow distribution and can be varied over a wide range. We have used the EBIT devices for the measurement of electron-ion interactions, ion structure, ion-surface interactions, and the behavior of low-density plasmas.

Knapp, D.

1994-11-02T23:59:59.000Z

51

Study of a liquid metal ion source for external ion injection into electron-beam ion source  

E-Print Network (OSTI)

Study of a liquid metal ion source for external ion injection into electron-beam ion source A into electron-beam ion source EBIS . It does not use a buffer gas and therefore it provides only a very small types of low-charged ion sources have been used for external ion injection into BNL electron-beam ion

52

Generation, transport and focusing of high-brightness heavy ion beams  

E-Print Network (OSTI)

The Neutralized Transport Experiment (NTX) has been built at the Heavy Ion Fusion Virtual National Laboratory. NTX is the first successful integrated beam system experiment that explores various physical phenomena, and ...

Henestroza, Enrique

2006-01-01T23:59:59.000Z

53

High-powered pulsed-ion-beam acceleration and transport  

SciTech Connect

The state of research on intense ion beam acceleration and transport is reviewed. The limitations imposed on ion beam transport by space charge effects and methods available for neutralization are summarized. The general problem of ion beam neutralization in regions free of applied electric fields is treated. The physics of acceleration gaps is described. Finally, experiments on multi-stage ion acceleration are summarized.

Humphries, S. Jr.; Lockner, T.R.

1981-11-01T23:59:59.000Z

54

Ion beam induced surface and interface engineering  

Science Journals Connector (OSTI)

The injection of material into a target specimen in the form of an accelerated ion beam offers a most valuable tool for altering its physical, chemical, structural, surface and interface properties in a controlled manner and tailoring new materials for basic and applied research for science and technology. The present review describes experimental, theoretical and recent aspects of ion beam modifications at various solids, thin films, and multilayered systems covering wider energy ranges including the older basic concepts which are now of interest. These results reveal that the ion–solid interaction physics provides a unique way for controlling the produced defects of the desired type at a desired location. These interests have been stimulated by the possibilities of synthesizing novel materials with potential applications in the field of thin films, surfaces and interface science. Many applications of ion induced engineering are being developed for various sciences of high technological interest for future aspects.

I.P. Jain; Garima Agarwal

2011-01-01T23:59:59.000Z

55

Focused ion beam micromilling and articles therefrom  

DOE Patents (OSTI)

An ultrahigh vacuum focused ion beam micromilling apparatus and process are isclosed. Additionally, a durable data storage medium using the micromilling process is disclosed, the durable data storage medium capable of storing, e.g., digital or alphanumeric characters as well as graphical shapes or characters.

Lamartine, Bruce C. (Los Alamos, NM); Stutz, Roger A. (Los Alamos, NM)

1998-01-01T23:59:59.000Z

56

Focused ion beam micromilling and articles therefrom  

DOE Patents (OSTI)

An ultrahigh vacuum focused ion beam micromilling apparatus and process are disclosed. Additionally, a durable data storage medium using the micromilling process is disclosed, the durable data storage medium capable of storing, e.g., digital or alphanumeric characters as well as graphical shapes or characters. 6 figs.

Lamartine, B.C.; Stutz, R.A.

1998-06-30T23:59:59.000Z

57

Inertial Confinement Fusion with Light Ion Beams  

Science Journals Connector (OSTI)

...plasma can be formed without significant contribution of the ion thermal velocity to the beam divergence. The large ionization energy...3. P. L. Dreike, C. Eichenberger, S. Humphries, R. Sudan, J. Appi. Phys. 47, 85 (1986). 4. J. D. Lindi and...

J. PACE VANDEVENDER; DONALD L. COOK

1986-05-16T23:59:59.000Z

58

Ferroelectric Plasma Source for Heavy Ion Beam Charge Neutralization  

E-Print Network (OSTI)

Heavy Ion Beam Driven Fusion Reactor Study”, KfK-3480,a possible heavy ion fusion reactor design [1]. The final

2005-01-01T23:59:59.000Z

59

Applications of focused ion beam SIMS in materials science  

Science Journals Connector (OSTI)

Focused ion beam instruments (FIB) can be used both for materials processing and materials analysis, since the ion beam used in the FIB milling process generates several potentially useful analytical signals such...

David S. McPhail; Richard J. Chater; Libing Li

2008-06-01T23:59:59.000Z

60

Engineering of Materials by Swift Heavy Ion Beam Mixing  

Science Journals Connector (OSTI)

Ion beam mixing (IBM) is a phenomenon, at interface between two layers, in which the atoms of one layer mingle with the atoms of the other elements under the influence of ion beam traversal through them. When ...

D. K. Avasthi…

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

The Heavy Ion Fusion Virtual National Laboratory Status and new physics directions for heavy-ion-driven  

E-Print Network (OSTI)

Laboratories First Point Scientific University of Maryland Tech-X University of Missouri FAR-Tech Stanford Linear Accelerator Center Advanced Magnet Laboratory Idaho National Environmental and Engineering scientific question fundamental to future applications of heavy ion beams to both high energy density physics

62

High sensitivity charge amplifier for ion beam uniformity monitor  

DOE Patents (OSTI)

An ion beam uniformity monitor for very low beam currents using a high-sensitivity charge amplifier with bias compensation. The ion beam monitor is used to assess the uniformity of a raster-scanned ion beam, such as used in an ion implanter, and utilizes four Faraday cups placed in the geometric corners of the target area. Current from each cup is integrated with respect to time, thus measuring accumulated dose, or charge, in Coulombs. By comparing the dose at each corner, a qualitative assessment of ion beam uniformity is made possible. With knowledge of the relative area of the Faraday cups, the ion flux and areal dose can also be obtained.

Johnson, Gary W. (Livermore, CA)

2001-01-01T23:59:59.000Z

63

Ion energy distribution near a plasma meniscus with beam extraction for multi element focused ion beams  

SciTech Connect

An earlier study of the axial ion energy distribution in the extraction region (plasma meniscus) of a compact microwave plasma ion source showed that the axial ion energy spread near the meniscus is small ({approx}5 eV) and comparable to that of a liquid metal ion source, making it a promising candidate for focused ion beam (FIB) applications [J. V. Mathew and S. Bhattacharjee, J. Appl. Phys. 105, 96101 (2009)]. In the present work we have investigated the radial ion energy distribution (IED) under the influence of beam extraction. Initially a single Einzel lens system has been used for beam extraction with potentials up to -6 kV for obtaining parallel beams. In situ measurements of IED with extraction voltages upto -5 kV indicates that beam extraction has a weak influence on the energy spread ({+-}0.5 eV) which is of significance from the point of view of FIB applications. It is found that by reducing the geometrical acceptance angle at the ion energy analyzer probe, close to unidirectional distribution can be obtained with a spread that is smaller by at least 1 eV.

Mathew, Jose V.; Paul, Samit; Bhattacharjee, Sudeep [Department of Physics, Indian Institute of Technology, Kanpur 208016, Uttar Pradesh (India)

2010-05-15T23:59:59.000Z

64

Electron Beam Ion Source Pre-Injector Diagnostics  

E-Print Network (OSTI)

Electron Beam Ion Source Pre-Injector Diagnostics M. Wilinski, J. Alessi, E. Beebe, S. Bellavia, A. This pre-injector is based on an Electron Beam Ion Source (EBIS), a Radio Frequency Quadrupole (RFQ, current transformer, pepperpot, electron beam ion source PACS: 29.17.+w, 29.25.Ni, 29.27.Fh INTRODUCTION

65

MIT Lincoln Laboratory Plasma and Ions-1  

E-Print Network (OSTI)

them anions · Fire, lightning, fluorescent lamps, and the Sun and stars all contain plasma ­ In fact include fluorescent lamps, neon signs, plasma globes, plasma TVs ­ They easily form at room temperature lightning carbon arc nuclear blast #12;MIT Lincoln LaboratoryPlasma and Ions-4 A. Siegel 5/12/07 How Does

Wurtman, Richard

66

Persistent ion beam induced conductivity in zinc oxide nanowires  

SciTech Connect

We report persistently increased conduction in ZnO nanowires irradiated by ion beam with various ion energies and species. This effect is shown to be related to the already known persistent photo conduction in ZnO and dubbed persistent ion beam induced conduction. Both effects show similar excitation efficiency, decay rates, and chemical sensitivity. Persistent ion beam induced conduction will potentially allow countable (i.e., single dopant) implantation in ZnO nanostructures and other materials showing persistent photo conduction.

Johannes, Andreas; Niepelt, Raphael; Gnauck, Martin; Ronning, Carsten [Institute of Solid State Physics, Friedrich-Schiller-University Jena, Max-Wien-Platz 1, 07743 Jena (Germany)

2011-12-19T23:59:59.000Z

67

Electron beam diagnostic for space charge measurement of an ion beam  

SciTech Connect

A non-perturbing electron beam diagnostic system for measuring the charge distribution of an ion beam is developed for Heavy Ion Fusion (HIF) beam physics studies. Conventional diagnostics require temporary insertion of sensors into the beam, but such diagnostics stop the beam, or significantly alter its properties. In this diagnostic a low energy, low current electron beam is swept transversely across the ion beam; the measured electron beam deflection is used to infer the charge density profile of the ion beam. The initial application of this diagnostic is to the Neutralized Transport Experiment (NTX), which is exploring the physics of space-charge-dominated beam focusing onto a small spot using a neutralizing plasma. Design and development of this diagnostic and performance with the NTX ion beamline is presented.

Roy, Prabir K.; Yu, Simon S.; Henestroza, Enrique; Eylon, Shmuel; Shuman, Derek B.; Ludvig, Jozsef; Bieniosek, Frank M.; Waldron, William L.; Greenway, Wayne G.; Vanecek, David L.; Hannink, Ryan; Amezcua, Monserrat

2004-09-25T23:59:59.000Z

68

Ion Beam Collimation For Improved Resolution In Associated Particle Imaging  

SciTech Connect

Beam spot size on target for a Penning ion source has been measured under different source operating pressures as a function of the extraction channel length and beam energy. A beam halo/core structure was observed for ion extraction at low extraction voltages, and was greatly reduced at higher beam energy. Collimation through use of longer extraction channels results in reduced ion current on target; the resultant reduction in neutron yield for an API system driven by such an ion source can be compensated for by use of even higher beam energies.

Sy, Amy [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Department of Nuclear Engineering, University of California, Berkeley, Berkeley, CA 94720 (United States); Ji Qing [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States)

2011-06-01T23:59:59.000Z

69

Development of a focused ion beam micromachining system  

SciTech Connect

Focused ion beams are currently being investigated for many submicron fabrication and analytical purposes. An FIB micromachining system consisting of a UHV vacuum system, a liquid metal ion gun, and a control and data acquisition computer has been constructed. This system is being used to develop nanofabrication and nanomachining techniques involving focused ion beams and scanning tunneling microscopes.

Pellerin, J.G.; Griffis, D.; Russell, P.E.

1988-12-01T23:59:59.000Z

70

Nanostructure fabrication by electron and ion beam patterning of nanoparticles  

E-Print Network (OSTI)

Two modes of energetic beam-mediated fabrication have been investigated, namely focused ion beam (FIB) direct-writing of nanoparticles, and a technique for electrostatically patterning ionized inorganic nanoparticles, ...

Kong, David Sun, 1979-

2004-01-01T23:59:59.000Z

71

Ion beam requirements for fast ignition of inertial fusion targets  

E-Print Network (OSTI)

Ion beam requirements for fast ignition are investigated by numerical simulation taking into account new effects such as ion beam divergence not included before. We assume that ions are generated by the TNSA scheme in a curved foil placed inside a re-entrant cone and focused on the cone apex or beyond. From the focusing point to the compressed core ions propagate with a given divergence angle. Ignition energies are obtained for two compressed fuel configurations heated by proton and carbon ion beams. The dependence of the ignition energies on the beam divergence angle and on the position of the ion beam focusing point have been analysed. Comparison between TNSA and quasi-monoenergetic ions is also shown.

Honrubia, J J

2015-01-01T23:59:59.000Z

72

Experimental study of electron-and ion-beam properties on the BNL electron-beam ion source and comparison with theoretical models  

E-Print Network (OSTI)

Experimental study of electron- and ion-beam properties on the BNL electron-beam ion source of the BNL Test electron-beam ion source EBIS has been measured for different electron-beam currents With high electron current operation up to 10 A the BNL Test electron-beam ion source EBIS has demonstrated

73

Methods and apparatus for altering material using ion beams  

DOE Patents (OSTI)

A method and apparatus for treating material surfaces using a repetitively pulsed ion beam. In particular, a method of treating magnetic material surfaces in order to reduce surface defects, and produce amorphous fine grained magnetic material with properties that can be tailored by adjusting treatment parameters of a pulsed ion beam. In addition to a method of surface treating materials for wear and corrosion resistance using pulsed particle ion beams.

Bloomquist, Douglas D. (Albuquerque, NM); Buchheit, Rudy (Albuquerque, NM); Greenly, John B. (Lansing, NY); McIntyre, Dale C. (Albuquerque, NM); Neau, Eugene L. (Albuquerque, NM); Stinnett, Regan W. (Albuquerque, NM)

1996-01-01T23:59:59.000Z

74

Characterization of oxygen ion beams emitted from plasma focus  

Science Journals Connector (OSTI)

Abstract The Lee model is modified to include oxygen in addition to other gases. It is then applied to characterize the ion beams emitted from the low energy plasma focus PF 1 kJ device operated with oxygen gas. The numerical experiments give the following results: ion fluence- 3 × 1018 ions m?2, ion flux- 2.4 × 1026 ions m?2 s?1, ion energy- 261 keV, ion number- 3.5 × 1013, ion current- 3.5 kA, and damage factor- 1.12 × 109 Wm?2 s0.5. Numerical experiments are systematically carried out on other plasma focus devices of various energies. Scaling trends are suggested for oxygen ion beam characteristics. These results provide much needed benchmark reference values and scaling trends for ion beams of a plasma focus operated in oxygen gas.

Mohamad Akel; Sami Alsheikh Salo; Sor Heoh Saw; Sing Lee

2014-01-01T23:59:59.000Z

75

Performance and Controllability of Pulsed Ion Beam Ablation Propulsion  

SciTech Connect

We propose novel propulsion driven by ablation plasma pressures produced by the irradiation of pulsed ion beams onto a propellant. The ion beam ablation propulsion demonstrates by a thin foil (50 {mu}mt), and the flyer velocity of 7.7 km/s at the ion beam energy density of 2 kJ/cm2 adopted by using the Time-of-flight method is observed numerically and experimentally. We estimate the performance of the ion beam ablation propulsion as specific impulse of 3600 s and impulse bit density of 1700 Ns/m2 obtained from the demonstration results. In the numerical analysis, a one-dimensional hydrodynamic model with ion beam energy depositions is used. The control of the ion beam kinetic energy is only improvement of the performance but also propellant consumption. The spacecraft driven by the ion beam ablation provides high performance efficiency with short-pulsed ion beam irradiation. The numerical results of the advanced model explained latent heat and real gas equation of state agreed well with experimental ones over a wide range of the incident ion beam energy density.

Yazawa, Masaru; Buttapeng, Chainarong; Harada, Nobuhiro [Nagaoka University of Technology, Department of Electrical Engineering, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Suematsu, Hisayuki; Jiang Weihua; Yatsui, Kiyoshi [Nagaoka University of Technology, Extreme Energy-Density Research Institute, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan)

2006-05-02T23:59:59.000Z

76

Caborane beam from ITEP Bernas ion source for semiconductor implanters  

SciTech Connect

A joint research and development of steady state intense boron ion sources for hundreds of electron-volt ion implanters has been in progress for the past 5 years. The difficulties of extraction and transportation of low energy boron beams can be solved by implanting clusters of boron atoms. In Institute for Theoretical and Experimental Physics (ITEP) the Bernas ion source successfully generated the beam of decaborane ions. The carborane (C{sub 2}B{sub 10}H{sub 12}) ion beam is more attractive material due to its better thermal stability. The results of carborane ion beam generation are presented. The result of the beam implantation into the silicon wafer is presented as well.

Seleznev, D.; Hershcovitch, A.; Kropachev, G.; Kozlov, A.; Kuibeda, R.; Koshelev, V.; Kulevoy, T.; Jonson, B.; Poole, J.; Alexeyenko, O.; Gurkova, E.; Oks, E.; Gushenets, V.; Polozov, S.; Masunov, E.

2010-02-01T23:59:59.000Z

77

Observation of Beam ION Instability in Spear3  

SciTech Connect

Weak vertical coupled bunch instability with oscillation amplitude at {mu}m level has been observed in SPEAR3. The instability becomes stronger when there is a vacuum pressure rise by partially turning off vacuum pumps and it becomes weaker when the vertical beam emittance is increased by turning off the skew quadrupole magnets. These confirmed that the instability was driven by ions in the vacuum. The threshold of the beam ion instability when running with a single bunch train is just under 200 mA. This paper presents the comprehensive observations of the beam ion instability in SPEAR3. The effects of vacuum pressure, beam current, beam filling pattern, chromaticity, beam emittance and bunch-by-bunch feedback are investigated in great detail. In an electron accelerator, ions generated from the residual gas molecules can be trapped by the beam. Then these trapped ions interact resonantly with the beam and cause beam instability and emittance blow-up. Most existing light sources use a long single bunch train filling pattern, followed by a long gap to avoid multi-turn ion trapping. However, such a gap does not preclude ions from accumulating during one passage of the single bunch train beam, and those ions can still cause a Fast Ion Instability (FII) as predicted by Raubenheimer and Zimmermann. FII has been observed in ALS, and PLS by artificially increasing the vacuum pressure by injecting helium gas into the vacuum chamber or by turning off the ion pumps in order to observe the beam ion instability. In some existing rings, for instance B factory, the beam ion instability was observed at the beginning of the machine operation after a long period of shutdown and then it automatically disappeared when the vacuum was better. However, when the beam emittance becomes smaller, the FII can occur at nominal conditions as observed in PLS, SOLEIL and SSRF. This paper reports the observations of beam ion instabilities in SPEAR3 under different condition during a period of one year, which includes single bunch train instability (FII) and multi-bunch train instability. Note that the instability may be not the same even with the same beam due to the change of the vacuum with time. SPEAR3 has a circumference of 234 m with a harmonic number of 372. SPEAR3 runs with six bunch train filling pattern in order to suppress the possible beam ion instability. Table 1 lists the main parameters of SPEAR3. The vacuum of SPEAR3 ranges from 0.1 to 0.5 nTorr, which varies from section to section.

Teytelman, D.; /Dimtel, Redwood City; Cai, Y.; Corbett, W.J.; Raubenheimer, T.O.; Safranek, J.A.; Schmerge, J.F.; Sebek, J.J.; Wang, L.; /SLAC

2011-12-14T23:59:59.000Z

78

Project Execution Plan Electron Beam Ion Source Project  

E-Print Network (OSTI)

Project Execution Plan for the Electron Beam Ion Source Project (EBIS) Project # 07-SC-02 of Nuclear Physics (SC ­ 26) Rev. 1 May 2008 #12;#12;#12;4 Project Execution Plan for the Electron Beam Ion Source Project (EBIS) Change Log Revision No. Pages Affected Effective Date Revision 0 Baseline Document

79

Design and operation of the electron beam ion trap  

SciTech Connect

This report describes the basic features and operating principles of the Electron Beam Ion Trap. The differences between EBIT and other sources of highly charged ions are outlined. Its features and operating parameters are discussed. The report also explains why certain design choices were necessary and the constraints involved in building an electron beam ion trap. EBIT's evaporation cooling system is described in detail. 13 refs., 8 figs.

Vogel, D.

1990-05-30T23:59:59.000Z

80

Phase and Shape Evolutions of Ion Beam Synthesized Ge Based Nanostructures  

E-Print Network (OSTI)

ion beam synthesized Ge nanocrystals," in Department of materials science and engineering:nanoscale engineering. In Chapter 5, ion beam and electronIon Beam Synthesized Ge Based Nanostructures by Swanee Shin Doctor of Philosophy in Engineering –

Shin, Swanee

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

EXTRACTION COMPRESSION AND ACCELERATION OF HIGH LINE CHARGE DENSITY ION BEAMS  

E-Print Network (OSTI)

on compression of heavy ion beams for creating high energyet al, “Highly Compressed Ion Beams for High Energy DensityPulsed Solenoid for Intense Ion Beam Transport,” these Proc:

Henestroza, E.

2008-01-01T23:59:59.000Z

82

Development of ion injection into the BNL test electron beam ion source using a prototype low energy beam transfer switchyard and a hollow  

E-Print Network (OSTI)

Development of ion injection into the BNL test electron beam ion source using a prototype low-to-pulse basis, the BNL RHIC electron beam ion source EBIS will use injection of primary "seed" ions from energy beam transfer switchyard and a hollow cathode ion source ,,abstract...a...,b... E. N. Beebe, J. G

83

Method and apparatus for efficient photodetachment and purification of negative ion beams  

DOE Patents (OSTI)

Methods and apparatus are described for efficient photodetachment and purification of negative ion beams. A method of purifying an ion beam includes: inputting the ion beam into a gas-filled multipole ion guide, the ion beam including a plurality of ions; increasing a laser-ion interaction time by collisional cooling the plurality of ions using the gas-filled multipole ion guide, the plurality of ions including at least one contaminant; and suppressing the at least one contaminant by selectively removing the at least one contaminant from the ion beam by electron photodetaching at least a portion of the at least one contaminant using a laser beam.

Beene, James R. (Oak Ridge, TN) [Oak Ridge, TN; Liu, Yuan (Knoxville, TN) [Knoxville, TN; Havener, Charles C. (Knoxville, TN) [Knoxville, TN

2008-02-26T23:59:59.000Z

84

Effect of beam limiting aperture and collector potential on multi-element focused ion beams  

SciTech Connect

A compact microwave driven plasma based multi-element focused ion beam system has been developed. In the present work, the effect of reduced beam limiter (BL) aperture on the focused ion beam parameters, such as current and spot size, and a method of controlling beam energy independently by introducing a biased collector at focal point (FP) are investigated. It is found that the location of FP does not change due to the reduction of BL aperture. The location of FP and beam size are found to be weakly dependent on the collector potential in the range from -8 kV to -18 kV.

Paul, Samit; Chowdhury, Abhishek; Bhattacharjee, Sudeep [Department of Physics, Indian Institute of Technology, Kanpur, Uttar Pradesh (India)

2012-02-15T23:59:59.000Z

85

Physics with energetic radioactive ion beams  

SciTech Connect

Beams of short-lived, unstable nuclei have opened new dimensions in studies of nuclear structure and reactions. Such beams also provide key information on reactions that take place in our sun and other stars. Status and prospects of the physics with energetic radioactive beams are summarized.

Henning, W.F.

1996-12-31T23:59:59.000Z

86

EBIT - Electronic Beam Ion Trap: N Divison experimental physics annual report 1995  

SciTech Connect

The multi-faceted research effort of the EBIT (Electron Beam Ion Trap) program in N-Division of the Physics and Space Technology Department at Lawrence Livermore National Laboratory (LLNL) continues to contribute significant results to the physical sciences from studies with low energy very highly charged heavy ions. The EBIT program attracts a number of collaborators from the US and abroad for the different projects. The collaborations are partly carried out through participating graduate students demonstrating the excellent educational capabilities at the LLNL EBIT facilities. Moreover, participants from Historically Black Colleges and Universities are engaged in the EBIT project. This report describes EBIT work for 1995 in atomic structure measurements and radiative transition probabilities, spectral diagnostics for laboratory and astrophysical plasmas, ion/surface interaction studies, electron-ion interactions studies, retrap and ion collisions, and instrumental development.

Schneider, D. [ed.

1996-10-01T23:59:59.000Z

87

Fast fall-time ion beam in neutron generators  

E-Print Network (OSTI)

ion beam in neutron generators Q. Ji, J. Kwan, M. Regis, Y.useful in building neutron generators for the application offall-time pulsed neutron generator using an array of 20×20

Ji, Q.

2009-01-01T23:59:59.000Z

88

Ion beam figuring of small optical components Thomas W. Drueding  

E-Print Network (OSTI)

Ion beam figuring of small optical components Thomas W. Drueding Boston University College of Engineering Aerospace and Mechanical Engineering Department Boston, Massachusetts 02215 Steven C. Fawcett Albuquerque, New Mexico 87107 Thomas G. Bifano Boston University College of Engineering Aerospace

89

Excitation of lower hybrid waves by a gyrating ion beam in a negative ion plasma  

SciTech Connect

A gyrating ion beam propagating through a magnetized plasma cylinder containing K{sup +} positive ions, electrons, and SF{sub 6}{sup -} negative ions drives electrostatic lower hybrid waves to instability via Cyclotron interaction. Numerical calculations of the unstable mode frequencies and growth rates of both the unstable positive ion and negative ion modes have been carried out for the existing negative ion plasma parameters. It is found that the unstable mode frequencies of both the modes increase, with the relative density of negative ions. In addition, the growth rates of both the unstable modes also increases with relative density of negative ions. Moreover, the growth rates of both the unstable modes scale as the one-third power of the beam density. The frequencies of both the unstable modes also increase with the magnetic fields. The real part of the unstable wave frequency increases as almost the square root of the beam energy.

Sharma, Jyotsna; Jain, V. K. [Physics Group, School of Environmental Sciences, Jawaharlal Nehru University, New Delhi 110 067 (India); Sharma, Suresh C. [Department of Applied Physics, Delhi Technological University, Shahbad Daulatpur, Bawana Road, Delhi 110 042 (India); Gahlot, Ajay [Department of Physics, Maharaja Surajmal Institute of Technology, Janakpuri, New Delhi (India)

2013-03-15T23:59:59.000Z

90

New ion source for KSTAR neutral beam injection system  

SciTech Connect

The neutral beam injection system (NBI-1) of the KSTAR tokamak can accommodate three ion sources; however, it is currently equipped with only one prototype ion source. In the 2010 and 2011 KSTAR campaigns, this ion source supplied deuterium neutral beam power of 0.7-1.6 MW to the KSTAR plasma with a beam energy of 70-100 keV. A new ion source will be prepared for the 2012 KSTAR campaign with a much advanced performance compared with the previous one. The newly designed ion source has a very large transparency ({approx}56%) without deteriorating the beam optics, which is designed to deliver a 2 MW injection power of deuterium beams at 100 keV. The plasma generator of the ion source is of a horizontally cusped bucket type, and the whole inner wall, except the cathode filaments and plasma grid side, functions as an anode. The accelerator assembly consists of four multi-circular aperture grids made of copper and four electrode flanges made of aluminum alloy. The electrodes are insulated using PEEK. The ion source will be completed and tested in 2011.

Kim, Tae-Seong; Jeong, Seung Ho; In, Sang-Ryul [Department of Nuclear Fusion Engineering Development, Korea Atomic Energy Research Institute, Daejeon 305-353 (Korea, Republic of)

2012-02-15T23:59:59.000Z

91

Ion-matter interactions and applications Physical Research Laboratory  

E-Print Network (OSTI)

of high energy (MeV) protons or ions to pattern materials at nanodimensions. Ions travel in an almost Experiments #12;C. Energy Loss in matter Energy loss depends on the speed At high speeds, interaction time2. Tumor Therapy Disadvantages Needs high energy beams Needs energy tuning Elaborate accelerator

Bapat, Bhas

92

Negative hydrogen ion beam extracted from a Bernas-type ion source  

SciTech Connect

Negative hydrogen (H{sup -}) ion beam was produced without cesium seeding by a Bernas-type ion source with a coaxial hot cathode. The amount of H{sup -} ion beam current extracted from an original Bernas-type ion source using a hairpin shape filament as a hot cathode was 1 {mu}A with the 0.4 A arc current, while that 300 eV beam energy. In the other hand, H{sup -} ion beam current using the Bernas-type ion source with a coaxial hot cathode reached 4 {mu}A under the same condition. Production efficiency was enhanced by the focused plasma produced by a coaxial hot cathode.

Miyamoto, N.; Wada, M. [Graduate School of Engineering, Doshisha University, Kyotanabe, Kyoto 610-0321 (Japan)

2011-09-26T23:59:59.000Z

93

HIGHLY COMPRESSED ION BEAMS FOR HIGH ENERGY DENSITY SCIENCE  

E-Print Network (OSTI)

HIGHLY COMPRESSED ION BEAMS FOR HIGH ENERGY DENSITY SCIENCE A. Friedman1,2 , J.J.Barnard1,2 , R Energy Density regimes required for Inertial Fu- sion Energy and other applications. An interim goal we are pursuing, low to medium mass ions with energies just above the Bragg peak are directed onto

Wurtele, Jonathan

94

Solenoidal Fields for Ion Beam Transport and Focusing  

SciTech Connect

In this report we calculate time-independent fields of solenoidal magnets that are suitable for ion beam transport and focusing. There are many excellent Electricity and Magnetism textbooks that present the formalism for magnetic field calculations and apply it to simple geometries [1-1], but they do not include enough relevant detail to be used for designing a charged particle transport system. This requires accurate estimates of fringe field aberrations, misaligned and tilted fields, peak fields in wire coils and iron, external fields, and more. Specialized books on magnet design, technology, and numerical computations [1-2] provide such information, and some of that is presented here. The AIP Conference Proceedings of the US Particle Accelerator Schools [1-3] contain extensive discussions of design and technology of magnets for ion beams - except for solenoids. This lack may be due to the fact that solenoids have been used primarily to transport and focus particles of relatively low momenta, e.g. electrons of less than 50 MeV and protons or H- of less than 1.0 MeV, although this situation may be changing with the commercial availability of superconducting solenoids with up to 20T bore field [1-4]. Internal reports from federal laboratories and industry treat solenoid design in detail for specific applications. The present report is intended to be a resource for the design of ion beam drivers for Inertial Fusion Energy [1-5] and Warm Dense Matter experiments [1-6], although it should also be useful for a broader range of applications. The field produced by specified currents and material magnetization can always be evaluated by solving Maxwell's equations numerically, but it is also desirable to have reasonably accurate, simple formulas for conceptual system design and fast-running beam dynamics codes, as well as for general understanding. Most of this report is devoted to such formulas, but an introduction to the Tosca{copyright} code [1-7] and some numerical results obtained with it are also presented. Details of design, fabrication, installation, and operation of magnet systems are not included; here we are concerned with calculations that precede or supplement detailed design. Mathematical derivations are presented with only a moderate number of steps. While there is no claim of originality, except for various numerical approximations and a conceptual induction module design in section 20, many of the results and discussions are not readily available elsewhere. Our primary topic is axisymmetric solenoidal systems with no magnetic materials. These simplifying features allow useful analytical calculations, which occupy sections 2-13. Deviations from axisymmetry are considered in sections 14, 15, 21, 22, and 23 and the effects of magnetic materials are treated in sections 16-20. Since magnetic aberrations are mixed with geometric aberrations in computing ion orbits, section 22 on the ion equations of motion in an arbitrary field is included.

Lee, Edward P.; Leitner, Matthaeus

2007-11-01T23:59:59.000Z

95

Fail-safe ion chamber errant beam detector tailored for personnel protection  

SciTech Connect

This fail-safe ion chamber system is designed to be part of the personnel safety system (PSS) for the Los Alamos Neutron Scattering Center (LANSCE) at the Los Alamos National Laboratory. Its job is to protect the occupants of the experimental areas from large radiation doses caused by errant beam conditions during beam transport from the Proton Storage Ring (PSR) to the LANSCE neutron spallation target. The worst case beam spill scenario is calculated to result in a personnel exposure of about 0.01 Gys/s (1 rad/s). Although the preferred solution is to increase the bulk shielding between the beam line and the experimental area, the physical dimensions of the site do not permit an adequate amount of shielding to be added. The solution adopted is a layered system of three types of highly reliable detector systems: a current limiter system located in the beam line, a neutron detector system located in the experimental areas, and an ion chamber system located on the walls of the beam line tunnels. The ion chamber system is capable of shutting off the beam in less than 0.5 s, resulting in a worst case personnel exposure of 0.005 Gys (0.5 rad). 4 figs.

Plum, M.A.; Browman, A.A.; Brown, D.; Lee, D.M.; McCabe, C.W.

1989-01-01T23:59:59.000Z

96

Study of beam optics and beam halo by integrated modeling of negative ion beams from plasma meniscus formation to beam acceleration  

SciTech Connect

To understand the physical mechanism of the beam halo formation in negative ion beams, a two-dimensional particle-in-cell code for simulating the trajectories of negative ions created via surface production has been developed. The simulation code reproduces a beam halo observed in an actual negative ion beam. The negative ions extracted from the periphery of the plasma meniscus (an electro-static lens in a source plasma) are over-focused in the extractor due to large curvature of the meniscus.

Miyamoto, K. [Naruto University of Education, 748 Nakashima, Takashima, Naruto-cho, Naruto-shi, Tokushima 772-8502 (Japan)] [Naruto University of Education, 748 Nakashima, Takashima, Naruto-cho, Naruto-shi, Tokushima 772-8502 (Japan); Okuda, S.; Hatayama, A. [Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan)] [Faculty of Science and Technology, Keio University, 3-14-1 Hiyoshi, Kohoku-ku, Yokohama 223-8522 (Japan); Hanada, M.; Kojima, A. [Japan Atomic Energy Agency, 801-1 Mukouyama, Naka 319-0913 (Japan)] [Japan Atomic Energy Agency, 801-1 Mukouyama, Naka 319-0913 (Japan)

2013-01-14T23:59:59.000Z

97

Suppression of Beam-Ion Instability in Electron Rings with Multi-Bunch Train Beam Fillings  

SciTech Connect

The ion-caused beam instability in the future light sources and electron damping rings can be serious due to the high beam current and ultra-small emittance of picometer level. One simple and effective mitigation of the instability is a multi-bunch train beam filling pattern which can significantly reduce the ion density near the beam, and therefore reduce the instability growth rate up to two orders of magnitude. The suppression is more effective for high intensity beams with low emittance. The distribution and the field of trapped ions are benchmarked to validate the model used in the paper. The wake field of ion-cloud and the beam-ion instability is investigated both analytically and numerically. We derived a simple formula for the build-up of ion-cloud and instability growth rate with the multi-bunch-train filling pattern. The ion instabilities in ILC damping ring, SuperKEKB and SPEAR3 are used to compare with our analyses. The analyses in this paper agree well with simulations.

Wang, L.; Cai, Y.; Raubenheimer, T.O.; /SLAC; Fukuma, H.; /KEK, Tsukuba

2011-08-18T23:59:59.000Z

98

A microsecond-pulsewidth, intense, light-ion beam accelerator  

SciTech Connect

A relatively long-pulsewidth (0.1-1 {mu}s) intense ion beam accelerator has been built for materials processing applications. An applied-B{sub r}, magnetically-insulated extraction ion diode with dielectric flashover ion source is installed directly onto the output of a 1.2-MV, 300-kJ Marx generator. Initial operation of the accelerator at 0.4 MV indicates satisfactory performance without the need for additional pulse-shaping.

Rej, D.J.; Bartsch, R.R.; Davis, H.A.; Greenly, J.B.; Waganaar, W.J.

1993-07-01T23:59:59.000Z

99

Multiple electron stripping of heavy ion beams D. MUELLER,1  

E-Print Network (OSTI)

.L. WATSON,2 V. HORVAT,2 K.E. ZAHARAKIS,2 and Y. PENG2 1 Princeton University Plasma Physics Laboratory. Such beams will lose electrons while passing through background gas in the target chamber, and therefore it is necessary to assess the rate at which the charge state of the incident beam evolves on the way to the target

Kaganovich, Igor

100

Developing high brightness beams for heavy ion driven inertial fusion  

SciTech Connect

Heavy ion fusion (HIF) drivers require large currents and bright beams. In this paper we review the two different approaches for building HIF injectors and the corresponding ion source requirements. The traditional approach uses large aperture, low current density ion sources, resulting in a very large injector system. A more recent conceptual approach merges high current density mini-beamlets into a large current beam in order to significantly reduce the size of the injector. Experiments are being prepared to demonstrate the feasibility of this new approach.

Kwan, J.W.; Ahle, L.A.; Anders, A.; Bieniosek, F.M.; Chacon-Golcher, E.; Grote, D.P.; Henestroza, E.; Leung, K.N.; Molvik, A.W.

2001-08-29T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Shunting arc plasma source for pure carbon ion beam  

SciTech Connect

A plasma source is developed using a coaxial shunting arc plasma gun to extract a pure carbon ion beam. The pure carbon ion beam is a new type of deposition system for diamond and other carbon materials. Our plasma device generates pure carbon plasma from solid-state carbon material without using a hydrocarbon gas such as methane gas, and the plasma does not contain any hydrogen. The ion saturation current of the discharge measured by a double probe is about 0.2 mA/mm{sup 2} at the peak of the pulse.

Koguchi, H.; Sakakita, H.; Kiyama, S.; Shimada, T.; Sato, Y.; Hirano, Y. [Energy Technology Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Umezono, Tsukuba, Ibaraki 305-8568 (Japan)

2012-02-15T23:59:59.000Z

102

A self-sputtering ion source: A new approach to quiescent metal ion beams  

SciTech Connect

A new metal ion source is presented based on sustained self-sputtering plasma in a magnetron discharge. Metals exhibiting high self-sputtering yield like Cu, Ag, Zn, and Bi can be used in a high-power impulse magnetron sputtering (HIPIMS) discharge such that the plasma almost exclusively contains singly charged metal ions of the target material. The plasma and extracted ion beam are quiescent. The ion beams consist mostly of singly charged ions with a space-charge limited current density which reached about 10 mA/cm2 at an extraction voltage of 45 kV and a first gap spacing of 12 mm.

Oks, Efim M.; Anders, Andre

2009-09-03T23:59:59.000Z

103

Fusion Induced by Radioactive Ion Beams  

E-Print Network (OSTI)

The use of radioactive beams opens a new frontier for fusion studies. The coupling to the continuum can be explored with very loosely bound nuclei. Experiments were performed with beams of nuclei at or near the proton and neutron drip-lines to measure fusion and associated reactions in the vicinity of the Coulomb barrier. In addition, the fusion yield is predicted to be enhanced in reactions involving very neutron-rich unstable nuclei. Experimental measurements were carried out to investigate if it is feasible to use such beams to produce new heavy elements. The current status of these experimental activities is given in this review.

J. F. Liang; C. Signorini

2005-04-26T23:59:59.000Z

104

Improved production of N{sup +} ions from a multicusp ion beam apparatus  

SciTech Connect

This invention is comprised of a method of generating a high purity (at least 98%) N{sup +} ion beam using a multicusp ion source having a chamber formed by a cylindrical chamber wall surrounded by a plurality of magnets, a filament centrally disposed in said chamber, a plasma electrode having an extraction orifice at one end of the chamber, a magnetic filter having two parallel magnets spaced from said plasma electrode and dividing the chamber into arc discharge and extraction regions. The method includes ionizing nitrogen gas in the arc discharge region of the chamber, maintaining the chamber wall at a positive voltage relative to the filament and at a magnitude for an optimum percentage of N{sup +} ions in the extracted ion beam, disposing a hot liner within the chamber and near the chamber wall to limit recombination of N{sup +} ions into the N{sub 2}{sup +} ions, spacing the magnets of the magnetic filter from each other for optimum percentage of N{sup +} ions in the extracted ion beams, and maintaining a relatively low pressure downstream of the extraction orifice and of a magnitude (preferably within the range of 3--8 {times} 10{sup {minus}4} torr) for an optimum percentage of N{sup +} ions in the extracted ion beam.

Leung, Ka-Ngo; Kunkel, W.B.; Walther, S.R.

1991-12-31T23:59:59.000Z

105

Inertial Fusion Driven by Intense Heavy-Ion Beams  

NLE Websites -- All DOE Office Websites (Extended Search)

INERTIAL FUSION DRIVEN BY INTENSE HEAVY-ION BEAMS INERTIAL FUSION DRIVEN BY INTENSE HEAVY-ION BEAMS * W. M. Sharp # , A. Friedman, D. P. Grote, J. J. Barnard, R. H. Cohen, M. A. Dorf, S. M. Lund, L. J. Perkins, M. R. Terry, LLNL, Livermore, CA, USA B. G. Logan, F. M. Bieniosek, A. Faltens, E. Henestroza, J.-Y. Jung, J. W. Kwan, E. P. Lee, S. M. Lidia, P. A. Ni, L. L. Reginato, P. K. Roy, P. A. Seidl, J. H. Takakuwa, J.-L. Vay, W. L. Waldron, LBNL, Berkeley, CA, USA R. C. Davidson, E. P. Gilson, I. D. Kaganovich, H. Qin, E. Startsev, PPPL, Princeton, NJ, USA I. Haber, R. A. Kishek, University of Maryland, College Park, MD, USA A. E. Koniges, NERSC, Berkeley, CA, USA Abstract Intense heavy-ion beams have long been considered a promising driver option for inertial-fusion energy production. This paper briefly compares inertial

106

Multiple beam induction accelerators for heavy ion fusion  

Science Journals Connector (OSTI)

Abstract Induction accelerators are appealing for heavy-ion driven inertial fusion energy (HIF) because of their high efficiency and their demonstrated capability to accelerate high beam current (?10 kA in some applications). For the HIF application, accomplishments and challenges are summarized. HIF research and development has demonstrated the production of single ion beams with the required emittance, current, and energy suitable for injection into an induction linear accelerator. Driver scale beams have been transported in quadrupole channels of the order of 10% of the number of quadrupoles of a driver. We review the design and operation of induction accelerators and the relevant aspects of their use as drivers for HIF. We describe intermediate research steps that would provide the basis for a heavy-ion research facility capable of heating matter to fusion relevant temperatures and densities, and also to test and demonstrate an accelerator architecture that scales well to a fusion power plant.

Peter A. Seidl; John J. Barnard; Andris Faltens; Alex Friedman; William L. Waldron

2014-01-01T23:59:59.000Z

107

Oxygen-ion-beam-driven electrostatic ion cyclotron instability of hydrogen plasma  

SciTech Connect

The electrostatic ion cyclotron instability of hydrogen plasma driven by an oxygen ion beam and resulting turbulent heating of both ion species is investigated. The instability growth rate exceeds the oxygen ion gyrofrequency, so that the oxygen ions may be considered as unmagnetized during the process of waves growth. As a result the instability is developed due to inverse Landau damping of the ion cyclotron waves caused by thermal motion of oxygen ions across the magnetic field. The quasilinear analysis of the turbulent heating of both ion species resulted from their interactions with ion cyclotron turbulence indicates that this instability may be responsible for the observed anisotropic heating of auroral outflowing oxygen O{sup +} ions in the ionosphere.

Chibisov, D. V.; Mikhailenko, V. S.; Stepanov, K. N. [Kharkov National University, 61108 Kharkov (Ukraine)

2009-07-15T23:59:59.000Z

108

Electromagnetic Ion-Beam Instabilities in the Solar Wind  

Science Journals Connector (OSTI)

The stability of a plasma consisting of two, unequal, isotropic, ion beams streaming along a uniform magnetic field has been investigated by numerically solving the full electromagnetic, Vlasov, linear dispersion relation for high-? plasmas. Three instabilities are found: One is closely associated with the usual Alfvén mode and the two others with the "fast" or magnetosonic mode. The importance of these instabilities for certain neutral-beam-injection experiments and in the solar wind is emphasized.

Michael D. Montgomery; S. Peter Gary; D. W. Forslund; W. C. Feldman

1975-09-08T23:59:59.000Z

109

Slit disk for modified faraday cup diagnostic for determining power density of electron and ion beams  

DOE Patents (OSTI)

A diagnostic system for characterization of an electron beam or an ion beam includes an electrical conducting disk of refractory material having a circumference, a center, and a Faraday cup assembly positioned to receive the electron beam or ion beam. At least one slit in the disk provides diagnostic characterization of the electron beam or ion beam. The at least one slit is located between the circumference and the center of the disk and includes a radial portion that is in radial alignment with the center and a portion that deviates from radial alignment with the center. The electron beam or ion beam is directed onto the disk and translated to the at least one slit wherein the electron beam or ion beam enters the at least one slit for providing diagnostic characterization of the electron beam or ion beam.

Teruya, Alan T. (Livermore, CA); Elmer; John W. (Danville, CA); Palmer, Todd A. (State College, PA)

2011-03-08T23:59:59.000Z

110

MHD Induced Neutral Beam Ion Loss from NSTX Plasmas  

SciTech Connect

Bursts of ~60 kHz activity on Mirnov coils occur frequently in NSTX plasmas and these are accompanied by bursts of neutral beam ion loss over a range in pitch angles. These losses have been measured with a scintillator type loss probe imaged with a high speed (>10,000 frames/s) video camera, giving the evolution of the energy and pitch angle distributions of the lost neutral beam ions over the course of the events. The instability occurs below the TAE frequency in NSTX (~100 kHz) in high beta plasmas and may be a beta driven Alfvén acoustic (BAAE) mode.

D.S. Darrow, E.D. Fredrickson, N.N. Gorelenkov, A.L. Roquemore, and K. Shinohara

2007-12-13T23:59:59.000Z

111

CONTROLS AND DIAGNOSTICS FOR THE HIGH CURRENT ELECTRON BEAM ION SOURCE AT BNL *  

E-Print Network (OSTI)

CONTROLS AND DIAGNOSTICS FOR THE HIGH CURRENT ELECTRON BEAM ION SOURCE AT BNL * E. Beebe, J Test Stand (EBTS), is a full electron beam power, half ion trap length prototype for an Electron Beam Ion Source (EBIS) that could meet requirements for the Relativistic Heavy Ion Collider (RHIC

112

Fast fall-time ion beam in neutron generators  

SciTech Connect

Ion beam with a fast fall time is useful in building neutron generators for the application of detecting hidden, gamma-shielded SNM using differential die-away (DDA) technique. Typically a fall time of less than 1 {micro}s can't be achieved by just turning off the power to the ion source due to the slow decay of plasma density (partly determined by the fall time of the RF power in the circuit). In this paper, we discuss the method of using an array of mini-apertures (instead of one large aperture beam) such that gating the beamlets can be done with low voltage and a small gap. This geometry minimizes the problem of voltage breakdown as well as reducing the time of flight to produce fast gating. We have designed and fabricated an array of 16 apertures (4 x 4) for a beam extraction experiment. Using a gating voltage of 1400 V and a gap distance of 1 mm, the fall time of extracted ion beam pulses is less than 1 {micro}s at various beam energies ranging between 400 eV to 800 eV. Usually merging an array of beamlets suffers the loss of beam brightness, i.e., emittance growth, but that is not an important issue for neutron source applications.

Ji, Q.; Kwan, J.; Regis, M.; Wu, Y.; Wilde, S.B.; Wallig, J.

2008-08-10T23:59:59.000Z

113

Model simulations of continuous ion injection into electron-beam ion source trap with slanted electrostatic mirrora...  

E-Print Network (OSTI)

Model simulations of continuous ion injection into electron-beam ion source trap with slanted developed by this group on DIONE electron-beam ion source EBIS .2­4 The most popular method of injecting 2 December 2007; published online 19 February 2008 The efficiency of trapping ions in an electron

114

Chemical characterization of hair using ion beams  

E-Print Network (OSTI)

"'" ' '. I ity Countin =ystens X-ray Cour tinE ~ Car!r~a ? ra?. Cour t i!re Cele uiat tons CI AP'I'EB III. CG "rBIi E!D E'. iCI LAB A~iD ATDA IC ACTTVATIGM Taco e I ical Con=ider at ions Bes!!its ar!d Discussions Proton Excitat. 'on Deut =' on B: c...!i th! scalp can be cor = elated, !ith the mineinal concentration . in an ir!di. vi!iual. at s!tr!, r 'on t-'me (li I . In pnacti ce hair has a panther' ad!ants;ie !r. that . It a !ceadilv obtainable b topsy '-!rr!, pie. i'!ao, ha;ac . erizat ion...

Yulo, Ma. Melinda S

2012-06-07T23:59:59.000Z

115

Ultrahigh vacuum focused ion beam micromill and articles therefrom  

DOE Patents (OSTI)

An ultrahigh vacuum focused ion beam micromilling apparatus and process are isclosed. Additionally, a durable data storage medium using the micromilling process is disclosed, the durable data storage medium capable of storing, e.g., digital or alphanumeric characters as well as graphical shapes or characters.

Lamartine, Bruce C. (Los Alamos, NM); Stutz, Roger A. (Los Alamos, NM)

1998-01-01T23:59:59.000Z

116

Hydrodynamic Efficiency of Ablation Propulsion with Pulsed Ion Beam  

SciTech Connect

This paper presents the hydrodynamic efficiency of ablation plasma produced by pulsed ion beam on the basis of the ion beam-target interaction. We used a one-dimensional hydrodynamic fluid compressible to study the physics involved namely an ablation acceleration behavior and analyzed it as a rocketlike model in order to investigate its hydrodynamic variables for propulsion applications. These variables were estimated by the concept of ablation driven implosion in terms of ablated mass fraction, implosion efficiency, and hydrodynamic energy conversion. Herein, the energy conversion efficiency of 17.5% was achieved. In addition, the results show maximum energy efficiency of the ablation process (ablation efficiency) of 67% meaning the efficiency with which pulsed ion beam energy-ablation plasma conversion. The effects of ion beam energy deposition depth to hydrodynamic efficiency were briefly discussed. Further, an evaluation of propulsive force with high specific impulse of 4000s, total impulse of 34mN and momentum to energy ratio in the range of {mu}N/W was also analyzed.

Buttapeng, Chainarong; Yazawa, Masaru; Harada, Nobuhiro [Department of Electrical Engineering, Nagaoka University of Technology, 1603-1, Kamitomioka, Nagaoka 940-2188 (Japan); Suematsu, Hisayuki; Jiang Weihua; Yatsui, Kiyoshi [Extreme Energy-Density Research Institute, Nagaoka University of Technology, 1603-1, Kamitomioka, Nagaoka 940-2188 (Japan)

2006-05-02T23:59:59.000Z

117

Investigation of the reaction of OH and CO to form H and CO? by photoelectron-photofragment coincidence spectroscopy in a cryogenic ion beam trap  

E-Print Network (OSTI)

spectroscopy in a cryogenic ion beam trap A dissertationspectroscopy in a cryogenic ion beam trap by Christopherof the inclusion of a cryogenic ion beam trap, and its

Johnson, Christopher Joseph

2011-01-01T23:59:59.000Z

118

Ion-Beam-Induced Chemical Mixing at a Nanocrystalline CeO2&ndash...  

NLE Websites -- All DOE Office Websites (Extended Search)

collisions between the incoming ion and the lattice atoms. This may hold promise in ion beam engineering of cerium silicates for microelectronic applications e.g., the...

119

Develpoment of a one-meter plasma source for heavy ion beam charge neutralization  

E-Print Network (OSTI)

Heavy Ion Beam Driven Fusion Reactor Study”, KfK-3480,is a possible heavy ion fusion reactor design [1]. The final

2005-01-01T23:59:59.000Z

120

Excitation of electrostatic ion-cyclotron waves by an ion beam in a two-ion component plasma  

SciTech Connect

An ion beam propagating through a magnetized plasma cylinder containing electrons, light positive potassium ions (K{sup +}), and heavy positive cesium ions (Cs{sup +}) drives electrostatic ion cyclotron (EIC) waves to instability via Cerenkov interaction. Two EIC wave modes are present, the K{sup +} and Cs{sup +} modes. The unstable wave frequencies and the growth rate of both the light positive ion and heavy positive ion modes increase with an increase in their relative ion concentrations. The growth rate of both the unstable modes (K{sup +} and Cs{sup +}) scales one-third power of the beam density. The real part of the frequency of both the unstable modes (K{sup +} and Cs{sup +}) increases with the beam energy and scales as almost one-half power of the beam energy. Numerical calculations of the growth rate and mode frequencies have been carried out for the parameters of the experiment of Suszcynsky et al. [J. Geophys. Res. 94, 8966 (1989)]. It is found that the unstable wave frequencies of both the light positive ion and heavy positive ion modes increase with the magnetic fields in accordance with the experimental observations.

Sharma, Jyotsna [Department of Physics, KIIT College of Engineering, Bhondsi Gurgaon 122102 (India); Sharma, Suresh C. [Department of Physics, Maharaja Agrasen Institute of Technology, PSP Area Plot No.-1, Sector-22, Rohini, Delhi 110086 (India)

2010-12-15T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Heavy-ion-beam–induced hydrodynamic effects in solid targets  

Science Journals Connector (OSTI)

It is expected that after the completion of a new high current injector, the heavy-ion synchrotron (SIS) at the Gesellschaft für Schwerionforschung (GSI) Darmstadt will accelerate U+28 ions to energies of the order of 200 MeV/u. The use of a powerful rf buncher will reduce the pulse length to about 50 ns, and employment of a multiturn injection scheme will provide 2×1011 particles in the beam that correspond to a total energy of the order of 1 kJ. This upgrade of the SIS, hopefully, will be completed by the end of the year 2001. These beam parameters lead to a specific power deposition of the order of 1–2 TW/g in solid matter that will provide temperatures of about 10 eV. Such low specific power deposition will induce hydrodynamic effects in solid materials, and one may design appropriate beam-target interaction experiments that could be used to investigate the equation of state of matter under extreme conditions. The purpose of this paper is to propose suitable target designs with optimized parameters for the future GSI experiments with the help of one and two-dimensional hydrodynamic simulations. Cylindrical geometry is the natural geometry for highly focused ion beams, and therefore cylindrical targets are the most appropriate for this type of interaction experiments. The numerical simulations presented in this paper show that one can experimentally measure the characteristic sound speed in beam heated targets which is an important physical parameter. Moreover, one can study the propagation of ion-beam-induced shock waves in the solid materials. Different values for the specific power deposition, namely, 10, 25, 50, and 100 kJ/g, have been used. In some cases the pulse length is assumed to be 40 ns while in others it is considered to be 50 ns. Various materials including lead, aluminum, and solid neon have been used.

N. A. Tahir, D. H. H. Hoffmann, J. A. Maruhn, P. Spiller, and R. Bock

1999-10-01T23:59:59.000Z

122

Focused Ion Beam Induced Effects on MOS Transistor Parameters  

SciTech Connect

We report on recent studies of the effects of 50 keV focused ion beam (FIB) exposure on MOS transistors. We demonstrate that the changes in value of transistor parameters (such as threshold voltage, V{sub t}) are essentially the same for exposure to a Ga+ ion beam at 30 and 50 keV under the same exposure conditions. We characterize the effects of FIB exposure on test transistors fabricated in both 0.5 {micro}m and 0.225 {micro}m technologies from two different vendors. We report on the effectiveness of overlying metal layers in screening MOS transistors from FIB-induced damage and examine the importance of ion dose rate and the physical dimensions of the exposed area.

Abramo, Marsha T.; Antoniou, Nicholas; Campbell, Ann N.; Fleetwood, Daniel M.; Hembree, Charles E.; Jessing, Jeffrey R.; Soden, Jerry M.; Swanson, Scot E.; Tangyunyong, Paiboon; Vanderlinde, William E.

1999-07-28T23:59:59.000Z

123

E-Print Network 3.0 - accelerated ion beams Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

ion beams Search Powered by Explorit Topic List Advanced Search Sample search results for: accelerated ion beams Page: << < 1 2 3 4 5 > >> 1 Siberian Branch of Russian Academy of...

124

A macroscopic model for focused?ion?beam?induced deposition  

Science Journals Connector (OSTI)

A time?dependent model for focused?ion?beam?induced deposition is presented which explicitly takes the scanning strategy of the beam during deposition into account. The model differentiates between the contribution of the beam center and that of the beam wings and contains all major experimental variables such as current density focus size scan speed and frame time. The deposition rate has been measured for tungsten as a function of the major experimental variables. The model has been fitted to these data and is found to describe the various dependences very well. By use of the model inclusive of the parameters obtained from the fit we can predict optimum deposition conditions. Furthermore the model clarifies effects observed during deposition on the structuredsurface of an integrated circuit such as redeposition of sputtered material and poor step coverage due to an impeded gas flow.

M. H. F. Overwijk; F. C. van den Heuvel

1993-01-01T23:59:59.000Z

125

Electrostatic dispersion lenses and ion beam dispersion methods  

DOE Patents (OSTI)

An EDL includes a case surface and at least one electrode surface. The EDL is configured to receive through the EDL a plurality of ion beams, to generate an electrostatic field between the one electrode surface and either the case surface or another electrode surface, and to increase the separation between the beams using the field. Other than an optional mid-plane intended to contain trajectories of the beams, the electrode surface or surfaces do not exhibit a plane of symmetry through which any beam received through the EDL must pass. In addition or in the alternative, the one electrode surface and either the case surface or the other electrode surface have geometries configured to shape the field to exhibit a less abrupt entrance and/or exit field transition in comparison to another electrostatic field shaped by two nested, one-quarter section, right cylindrical electrode surfaces with a constant gap width.

Dahl, David A. (Idaho Falls, ID) [Idaho Falls, ID; Appelhans, Anthony D. (Idaho Falls, ID) [Idaho Falls, ID

2010-12-28T23:59:59.000Z

126

Method for measuring and controlling beam current in ion beam processing  

DOE Patents (OSTI)

A method for producing film thickness control of ion beam sputter deposition films. Great improvements in film thickness control is accomplished by keeping the total current supplied to both the beam and suppressor grids of a radio frequency (RF) in beam source constant, rather than just the current supplied to the beam grid. By controlling both currents, using this method, deposition rates are more stable, and this allows the deposition of layers with extremely well controlled thicknesses to about 0.1%. The method is carried out by calculating deposition rates based on the total of the suppressor and beam currents and maintaining the total current constant by adjusting RF power which gives more consistent values.

Kearney, Patrick A. (Livermore, CA); Burkhart, Scott C. (Livermore, CA)

2003-04-29T23:59:59.000Z

127

DUHOCAMIS: A dual hollow cathode ion source for metal ion beams  

SciTech Connect

In this paper we describe a novel ion source named DUHOCAMIS for multiply charged metal ion beams. This ion source is derived from the hot cathode Penning ion gauge ion source (JINR, Dubna, 1957). A notable characteristic is the modified Penning geometry in the form of a hollow sputter electrode, coaxially positioned in a compact bottle-magnetic field along the central magnetic line of force. The interaction of the discharge geometry with the inhomogeneous but symmetrical magnetic field enables this device to be operated as hollow cathode discharge and Penning discharge as well. The main features of the ion source are the very high metal ion efficiency (up to 25%), good operational reproducibility, flexible and efficient operations for low charged as well as highly charged ions, compact setup, and easy maintenance. For light ions, e.g., up to titanium, well-collimated beams in the range of several tens of milliamperes of pulsed ion current (1 ms, 10/s) have been reliably performed in long time runs.

Zhao, W. J.; Mueller, M. W. O.; Janik, J.; Liu, K. X.; Ren, X. T. [Institute of Heavy Ion Physics, Peking University, Beijing 100871 (China) and State Key Laboratory of Nuclear Physics and Technology, Peking University, Beijing, 100871 (China); GSI, D64291 Darmstadt (Germany) and Sentastr. 12, D68199, Mannheim (Germany); Institute of Microelectronics, Slovak Technical University, Bratislava, Llcovicova 3 (Slovakia); Institute of Heavy Ion Physics, Peking University, Beijing, 100871 (China) and State Key Laboratory of Nuclear Physics and Technology, Peking University, Beijing, 100871 (China)

2008-02-15T23:59:59.000Z

128

Dynamics of Ion Beam Stimulated Surface Mass Transport to Nanopores David P. Hoogerheide1  

E-Print Network (OSTI)

Dynamics of Ion Beam Stimulated Surface Mass Transport to Nanopores David P. Hoogerheide1 membrane, from the substrate side, by rastering a 10-nm diameter, 50 keV gallium ion beam produced by a FEI We explore the ion beam-induced dynamics of the formation of large features at the edges of nanopores

129

Laser-Cooled Lithium Atoms: A New Source for Focused Ion Beams  

E-Print Network (OSTI)

Laser-Cooled Lithium Atoms: A New Source for Focused Ion Beams P R O J E C T L E A D E R : Jabez Mc) to provide ions for a focused ion beam (FIB) capable of non-destructive imaging. K E Y A C C O M P L I S H M mounted on a commercial focused ion beam system, creating the world's first lithium ion microscope

130

Microchip and wedge ion funnels and planar ion beam analyzers using same  

DOE Patents (OSTI)

Electrodynamic ion funnels confine, guide, or focus ions in gases using the Dehmelt potential of oscillatory electric field. New funnel designs operating at or close to atmospheric gas pressure are described. Effective ion focusing at such pressures is enabled by fields of extreme amplitude and frequency, allowed in microscopic gaps that have much higher electrical breakdown thresholds in any gas than the macroscopic gaps of present funnels. The new microscopic-gap funnels are useful for interfacing atmospheric-pressure ionization sources to mass spectrometry (MS) and ion mobility separation (IMS) stages including differential IMS or FAIMS, as well as IMS and MS stages in various configurations. In particular, "wedge" funnels comprising two planar surfaces positioned at an angle and wedge funnel traps derived therefrom can compress ion beams in one dimension, producing narrow belt-shaped beams and laterally elongated cuboid packets. This beam profile reduces the ion density and thus space-charge effects, mitigating the adverse impact thereof on the resolving power, measurement accuracy, and dynamic range of MS and IMS analyzers, while a greater overlap with coplanar light or particle beams can benefit spectroscopic methods.

Shvartsburg, Alexandre A; Anderson, Gordon A; Smith, Richard D

2012-10-30T23:59:59.000Z

131

Applied Physics B28, 2/3 239 cw Ion Lasers Pumpedby Electron Beams  

E-Print Network (OSTI)

Applied Physics B28, 2/3 239 cw Ion Lasers Pumpedby Electron Beams J. J. Rocca, J. D. Meyer, Zeng, and As by exciting He metal-vapor mixtures with a dc electron beam. The beam is generated by glow discharge electron obtained using electron beam excitation. The conventional manner of exciting cw ion lasers is to use

Rocca, Jorge J.

132

Carbon ion beam focusing using laser irradiated heated diamond hemispherical shells  

SciTech Connect

Experiments preformed at the Los Alamos National Laboratory's Trident Laser Facility were conducted to observe the acceleration and focusing of carbon ions via the TNSA mechanism using hemispherical diamond targets. Trident is a 200TW class laser system with 80J of 1 {micro}m, short-pulse light delivered in 0.5ps, with a peak intensity of 5 x 10{sup 20} W/cm{sup 2}. Targets where Chemical Vapor Deposition (CVD) diamonds formed into hemispheres with a radius of curvature of 400{micro}m and a thickness of 5{micro}m. The accelerated ions from the hemisphere were diagnosed by imaging the shadow of a witness copper mesh grid located 2mm behind the target onto a film pack located 5cm behind the target. Ray tracing was used to determine the location of the ion focal spot. The TNSA mechanism favorably accelerates hydrogen found in and on the targets. To make the carbon beam detectable, targets were first heated to several hundred degrees Celsius using a CW, 532nm, 8W laser. Imaging of the carbon beam was accomplished via an auto-radiograph of a nuclear activated lithium fluoride window in the first layer of the film pack. The focus of the carbon ion beam was determined to be located 630 {+-} 110 {micro}m from the vertex of the hemisphere.

Offermann, Dustin T [Los Alamos National Laboratory; Flippo, Kirk A [Los Alamos National Laboratory; Gaillard, Sandrine A [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

133

Proton Beam Lithography at the University of Surrey's Ion Beam Centre , I. Gomez-Morilla  

E-Print Network (OSTI)

the Ion Scan software developed by the National University of Singapore [4]. Simulations with the SRIM in photosensitive glass [3]. This technique has clear advantages in comparison with electron beam lithography and X energy protons have a long range and a low lateral spread making them ideal for exposing thick resist

Webb, Roger P.

134

EBIT (Electron Beam Ion Trap), N-Division Experimental Physics. Annual report, 1994  

SciTech Connect

The experimental groups in the Electron Beam Ion Trap (EBIT) program continue to perform front-line research with trapped and extracted highly charged ions (HCI) in the areas of ion/surface interactions, atomic spectroscopy, electron-ion interaction and structure measurements, highly charged ion confinement, and EBIT development studies. The ion surface/interaction studies which were initiated five years ago have reached a stage where they an carry out routine investigations, as well as produce breakthrough results towards the development of novel nanotechnology. At EBIT and SuperEBIT studies of the x-ray emission from trapped ions continue to produce significant atomic structure data with high precision for few electron systems of high-Z ions. Furthermore, diagnostics development for magnetic and laser fusion, supporting research for the x-ray laser and weapons programs, and laboratory astrophysics experiments in support of NASA`s astrophysics program are a continuing effort. The two-electron contributions to the binding energy of helium like ions were measured for the first time. The results are significant because their precision is an order of magnitude better than those of competing measurements at accelerators, and the novel technique isolates the energy corrections that are the most interesting. The RETRAP project which was initiated three years ago has reached a stage where trapping, confining and electronic cooling of HCI ions up to Th{sup 80+} can be performed routinely. Measurements of the rates and cross sections for electron transfer from H{sub 2} performed to determine the lifetime of HCI up to Xe{sup q+} and Th{sup q+} (35 {le} q {le} 80) have been studied at mean energies estimated to be {approximately} 5 q eV. This combination of heavy ions with very high charges and very low energies is rare in nature, but may be encountered in planned fusion energy demonstration devices, in highly charged ion sources, or in certain astrophysical events.

Schneider, D. [ed.

1995-10-01T23:59:59.000Z

135

Heavy ion beam loss mechanisms at an electron-ion collider  

E-Print Network (OSTI)

There are currently several proposals to build a high-luminosity electron-ion collider, to study the spin structure of matter and measure parton densities in heavy nuclei, and to search for gluon saturation and new phenomena like the colored glass condensate. These measurements require operation with heavy-nuclei. We calculate the cross-sections for two important processes that will affect accelerator and detector operations: bound-free pair production, and Coulomb excitation of the nuclei. Both of these reactions have large cross-sections, 28-56 mb, which can lead to beam ion losses, produce beams of particles with altered charge:mass ratio, and produce a large flux of neutrons in zero degree calorimeters. The loss of beam particles limits the sustainable electron-ion luminosity to levels of several times $10^{32}/$cm$^2$/s.

Spencer R. Klein

2014-09-18T23:59:59.000Z

136

Temporal Development of Ion Beam Mean Charge State in PulsedVacuum Arc Ion Sources  

SciTech Connect

Vacuum arc ion sources, commonly also known as "Mevva" ionsources, are used to generate intense pulsed metal ion beams. It is knownthat the mean charge state of the ion beam lies between 1 and 4,depending on cathode material, arc current, arc pulse duration, presenceor absence of magnetic field at the cathode, as well background gaspressure. A characteristic of the vacuum arc ion beam is a significantdecrease in ion charge state throughout the pulse. This decrease can beobserved up to a few milliseconds, until a "noisy" steady-state value isestablished. Since the extraction voltage is constant, a decrease in theion charge state has a proportional impact on the average ion beamenergy. This paper presents results of detailed investigations of theinfluence of arc parameters on the temporal development of the ion beammean charge state for a wide range of cathode materials. It is shown thatfor fixed pulse duration, the charge state decrease can be reduced bylower arc current, higher pulse repetition rate, and reduction of thedistance between cathode and extraction region. The latter effect may beassociated with charge exchange processes in the dischargeplasma.

Oks, Efim M.; Yushkov, Georgy Yu.; Anders, Andre

2007-06-21T23:59:59.000Z

137

Beam Loss Ion Chamber System Upgrade for Experimental Halls  

SciTech Connect

The Beam loss Ion Chamber System (BLICS) was developed to protect Jefferson Labs transport lines, targets and beam dumps from a catastrophic ''burn through''. Range changes and testing was accomplished manually requiring the experiment to be shut down. The new upgraded system is based around an ''off the shelf'' Programmable Logic Controller located in a single control box supporting up to ten individual detectors. All functions that formerly required an entry into the experimental hall and manual adjustment can be accomplished from the Machine Control Center (MCC). A further innovation was the addition of a High Voltage ''Brick'' at the detector location. A single cable supplies the required voltage for the Brick and a return line for the ion chamber signal. The read back screens display range, trip point, and accumulated dose for each location. The new system is very cost effective and significantly reduces the amount of lost experimental time.

D.W. Dotson; D.J. Seidman

2005-05-16T23:59:59.000Z

138

Hybrid simulation of ion beams in background plasma  

SciTech Connect

We present a 2 1/2-dimensional (r, z,v/sub r/, v/sub theta/, v/sub z/; partial/partialtheta = 0) quasineutral hybrid code suitable for studying a broad class of plasma and beam-plasma and configurations. Ions are represented by particles and electrons by an inertialess thermal fluid which obeys a generalized Ohm's law. Fields are solved in the quasineutral Darwin approximation. Several collisional and atomic processes are also included in the model. The code has been applied to the problem of propagation of intense ion beams through performed z-pinch plasma channels, a scenario of interest for inertial confinement fusion devices. copyright 1987 Academic Press, Inc.

Mankofsky, A.; Sudan, R.N.; Denavit, J.

1987-05-01T23:59:59.000Z

139

Formation of nanosize structures on a silicon substrate by method of focused ion beams  

SciTech Connect

The results of experimental studies of modes in which nanosize structures are formed on a silicon substrate by method of focused ion beams are presented. Dependences of the diameter and depth of the nanosize structures on the ion beam current and time of exposure to the ion beam at a point are obtained. It is demonstrated that the main factor determining the rate of ion-beam milling is the ion beam current. The results of the study can be used in the development of technological processes for the fabrication of components for nanoelectronics and nanosystems engineering.

Ageev, O. A.; Kolomiytsev, A. S.; Konoplev, B. G., E-mail: kbg@tsure.ru [Technological Institute of the Southern Federal University (Russian Federation)

2011-12-15T23:59:59.000Z

140

Negative Ion Based Heating and Diagnostic Neutral Beams for ITER  

SciTech Connect

To meet the requirements of the four operating and one start-up scenarios foreseen in the International Tokamak Experimental Reactor (ITER) a flexible heating mix will be required, which has to include a reliable contribution from neutral beams. The current baseline of ITER foresees 2 Heating Neutral Beam (HNB) systems based on negative ion technology, each operating at 1 MeV 40 A D{sup -} ions, and each capable of delivering up to 16.7 MW of D deg. to the ITER plasma. A 3rd HNB injector is foreseen as an upgrade option. In addition a dedicated Diagnostic Neutral Beam (DNB) injecting 100 keV 60 A of negative hydrogen ions will be available for charge exchange resonant spectroscopy (CXRS). The significant R and D effort necessary to meet the design requirements will be provided in the Neutral Beam Test Facility (NBTF), which is to be constructed in Padua, Italy. This paper gives an overview of the current status of the neutral beam (NB) systems and the chosen configuration. The ongoing integration effort into the ITER plant is highlighted and open interface issues are identified. It is shown how installation and maintenance logistics has influenced the design. ITER operating scenarios are briefly discussed, including start-up and commissioning. For example it is now envisaged to have a low current hydrogen phase of ITER operations, essentially for commissioning of the many auxiliary systems used on ITER. The low current limits the achievable plasma density, and hence the NB energy due to shine through limitations. Therefore a possible reconfiguration of the auxiliary heating systems is now being discussed. Other NB related issues identified by the ongoing design review process are emphasized and possible impact on the implementations of the HNB and DNB systems is indicated.

Schunke, B.; Bora, D.; Cordier, J.-J.; Hemsworth, R.; Tanga, A. [ITER Organization, Cadarache, 13108 St.-Paul-lez-Durance (France); Antoni, V. [Consorzio RFX, EURATOM-ENEA Association, Corso Stati Uniti 4, I-35127 (Italy); Bonicelli, T. [IPR, Bhat, Gandhinagar, Gujarat, 382428 (India); Chakraborty, A. [EFDA CSU, Boltzmannstrasse 2, D-85748, Garching (Germany); Inoue, T.; Watanabe, K. [JAEA, 801-1 Mukouyama, Naka-machi, Naka-gun, Ibaraki-ken 311-0193 (Japan)

2008-04-07T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Brookhaven National Laboratory The Relativistic Heavy Ion Collider (RHIC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Relativistic Heavy Ion Collider (RHIC) Relativistic Heavy Ion Collider (RHIC) An Exciting Beginning and a Compelling Future At the Relativistic Heavy Ion Collider (RHIC), a world-class particle accelerator at Brookhaven National Laboratory, physicists are exploring the most fundamental forces and properties of matter and the early universe, with important implications for our understanding of the world around us. Operated with funding from the U.S. Department of Energy's Office of Science, the Relativistic Heavy Ion Collider (RHIC), was designed to recreate a state of matter thought to have existed immediately after the Big Bang some 13 billion years ago, and to investigate how the proton gets its spin and intrinsic magnetism from its quark and gluon constituents. Large detectors located

142

Rare earth focused ion beam implantation utilizing Er and Pr liquid alloy ion sources  

E-Print Network (OSTI)

Pr,10,11 Eu,12 Dy,13 Er,13­15 and Tm16 doped GaN. Rare earth elements were added during growthRare earth focused ion beam implantation utilizing Er and Pr liquid alloy ion sources L. C. Chao, B write implantation. © 1999 American Vacuum Society. S0734-211X 99 08306-7 I. INTRODUCTION Rare earth

Steckl, Andrew J.

143

Direct-write milling of diamond by a focused oxygen ion beam  

E-Print Network (OSTI)

Recent advances in focused ion beam technology have enabled high-resolution, direct-write nanofabrication using light ions. Studies with light ions to date have, however, focused on milling of materials where sub-surface ion beam damage does not inhibit device performance. Here we report on direct-write milling of single crystal diamond using a focused beam of oxygen ions. Material quality is assessed by Raman and luminescence analysis, and reveals that the damage layer generated by oxygen ions can be removed by nonintrusive post-processing methods such as localised electron beam induced chemical etching.

Martin, Aiden A; Botman, Aurelien; Toth, Milos; Aharonovich, Igor

2015-01-01T23:59:59.000Z

144

Reduction of Glass Surface Reflectance by Ion Beam Surface Modification  

SciTech Connect

This is the final report for DOE contract DE-EE0000590. The purpose of this work was to determine the feasibility of the reduction of the reflection from the front of solar photovoltaic modules. Reflection accounts for a power loss of approximately 4%. A solar module having an area of one square meter with an energy conversion efficiency of 18% generates approximately 180 watts. If reflection loss can be eliminated, the power output can be increased to 187 watts. Since conventional thin-film anti-reflection coatings do not have sufficient environmental stability, we investigated the feasibility of ion beam modification of the glass surface to obtain reduction of reflectance. Our findings are generally applicable to all solar modules that use glass encapsulation, as well as commercial float glass used in windows and other applications. Ion implantation of argon, fluorine, and xenon into commercial low-iron soda lime float glass, standard float glass, and borosilicate glass was studied by implantation, annealing, and measurement of reflectance. The three ions all affected reflectance. The most significant change was obtained by argon implantation into both low-iron and standard soda-lime glass. In this way samples were formed with reflectance lower than can be obtained with a single-layer coatings of magnesium fluoride. Integrated reflectance was reduced from 4% to 1% in low-iron soda lime glass typical of the glass used in solar modules. The reduction of reflectance of borosilicate glass was not as large; however borosilicate glass is not typically used in flat plate solar modules. Unlike conventional semiconductor ion implantation doping, glass reflectance reduction was found to be tolerant to large variations in implant dose, meaning that the process does not require high dopant uniformity. Additionally, glass implantation does not require mass analysis. Simple, high current ion implantation equipment can be developed for this process; however, before the process can be employed on full scale solar modules, equipment must be developed for ion implanting large sheets of glass. A cost analysis shows that the process can be economical. Our finding is that the reduction of reflectance by ion beam surface modification is technically and economically feasible. The public will benefit directly from this work by the improvement of photovoltaic module efficiency, and indirectly by the greater understanding of the modification of glass surfaces by ion beams.

Mark Spitzer

2011-03-11T23:59:59.000Z

145

Rare-earth neutral metal injection into an electron beam ion trap plasma  

SciTech Connect

We have designed and implemented a neutral metal vapor injector on the SuperEBIT high-energy electron beam ion trap at the Lawrence Livermore National Laboratory. A horizontally directed vapor of a europium metal is created using a thermal evaporation technique. The metal vapor is then spatially collimated prior to injection into the trap. The source's form and quantity constraints are significantly reduced making plasmas out of metal with vapor pressures ?10{sup ?7} Torr at ?1000?°C more obtainable. A long pulsed or constant feed metal vapor injection method adds new flexibility by varying the timing of injection and rate of material being introduced into the trap.

Magee, E. W., E-mail: magee1@llnl.gov; Beiersdorfer, P.; Brown, G. V. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Hell, N. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Dr. Remeis-Sternwarte and ECAP, Universität Erlangen-Nürnberg, 96049 Bamberg (Germany)

2014-11-15T23:59:59.000Z

146

An ultra-low energy (30-200 eV) ion-atomic beam source for ion-beam-assisted deposition in ultrahigh vacuum  

SciTech Connect

The paper describes the design and construction of an ion-atomic beam source with an optimized generation of ions for ion-beam-assisted deposition under ultrahigh vacuum (UHV) conditions. The source combines an effusion cell and an electron impact ion source and produces ion beams with ultra-low energies in the range from 30 eV to 200 eV. Decreasing ion beam energy to hyperthermal values ({approx_equal}10{sup 1} eV) without loosing optimum ionization conditions has been mainly achieved by the incorporation of an ionization chamber with a grid transparent enough for electron and ion beams. In this way the energy and current density of nitrogen ion beams in the order of 10{sup 1} eV and 10{sup 1} nA/cm{sup 2}, respectively, have been achieved. The source is capable of growing ultrathin layers or nanostructures at ultra-low energies with a growth rate of several MLs/h. The ion-atomic beam source will be preferentially applied for the synthesis of GaN under UHV conditions.

Mach, Jindrich; Kolibal, Miroslav; Sikola, Tomas [Institute of Physical Engineering, Brno University of Technology, Technicka 2, 616 69 Brno (Czech Republic); CEITEC BUT, Brno University of Technology, Technicka 10, 61669 Brno (Czech Republic); Samoril, Tomas; Voborny, Stanislav; Zlamal, Jakub; Spousta, Jiri; Dittrichova, Libuse [Institute of Physical Engineering, Brno University of Technology, Technicka 2, 616 69 Brno (Czech Republic)

2011-08-15T23:59:59.000Z

147

Characteristics of low-energy ion beams extracted from a wire electrode geometry  

SciTech Connect

Beams of argon ions with energies less than 50 eV were extracted from an ion source through a wire electrode extractor geometry. A retarding potential energy analyzer (RPEA) was constructed in order to characterize the extracted ion beams. The single aperture RPEA was used to determine the ion energy distribution function, the mean ion energy and the ion beam energy spread. The multi-cusp hot cathode ion source was capable of producing a low electron temperature gas discharge to form quiescent plasmas from which ion beam energy as low as 5 eV was realized. At 50 V extraction potential and 0.1 A discharge current, the ion beam current density was around 0.37 mA/cm{sup 2} with an energy spread of 3.6 V or 6.5% of the mean ion energy. The maximum ion beam current density extracted from the source was 0.57 mA/cm{sup 2} for a 50 eV ion beam and 1.78 mA/cm{sup 2} for a 100 eV ion beam.

Vasquez, M. Jr.; Tokumura, S.; Kasuya, T. [Graduate School of Engineering, Doshisha University, Kyotanabe, Kyoto 610-0321 (Japan); Maeno, S. [Novelion Systems Co. Ltd., Kyotanabe, Kyoto 610-0332 (Japan); Wada, M. [Faculty of Life and Medical Sciences, Doshisha University, Kyotanabe, Kyoto 610-0321 (Japan)

2012-02-15T23:59:59.000Z

148

Nuclear Spectroscopy Using Radioactive Ion Beams from the HRIBF  

SciTech Connect

Exciting opportunities in the study of nuclei far from stability in both the neutron and proton rich side are opening with the recent availability of radioactive ion beams (RIBs) at energies above the Coulomb barrier at the Holifield Radioactive Ion Beam Facility (HRIBF). These RIBs provide a unique opportunity for a whole class of measurements that could never before be realized. A recent highlight has been the acceleration of 'pure' beams of fission fragments such as 82Ge (T1/2=4.6s) and 132Sn (T1/2=40s). These semi-magic and doubly-magic nuclei are important benchmarks within the chart of nuclides, because they are constraints for the shell-model parameter sets. We are currently developing the required experimental tools and specialized techniques for studies in nuclear astrophysics, reaction spectroscopy, and nuclear structure research with RIBs. I will discuss some of the challenges encountered with examples from selected topical areas with which I have been involved.

Galindo-Uribarri, A. [Physics Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831 (United States)

2004-02-27T23:59:59.000Z

149

Nuclear Spectroscopy Using Radioactive Ion Beams from the HRIBF  

SciTech Connect

Exciting opportunities in the study of nuclei far from stability in both the neutron and proton rich side are opening with the recent availability of radioactive ion beams (RIBs) at energies above the Coulomb barrier at the Holifield Radioactive Ion Beam Facility (HRIBF). These RIBs provide a unique opportunity for a whole class of measurements that could never before be realized. A recent highlight has been the acceleration of 'pure' beams of fission fragments such as 82Ge (T1/2=4.6s) and 132Sn (T1/2=40s). These semi-magic and doubly-magic nuclei are important benchmarks within the chart of nuclides, because they are constraints for the shell-model parameter sets. We are currently developing the required experimental tools and specialized techniques for studies in nuclear astrophysics, reaction spectroscopy, and nuclear structure research with RIBs. I will discuss some of the challenges encountered with examples from selected topical areas with which I have been involved.

Galindo-Uribarri, Alfredo {nmn} [ORNL

2004-01-01T23:59:59.000Z

150

Limited Diffraction Array Beams Ultrasound Research Laboratory, Department of Physiology and Biophysics, Mayo Clinic and Foundation,  

E-Print Network (OSTI)

Limited Diffraction Array Beams Jian-yu Lu Ultrasound Research Laboratory, Department of Physiology and Biophysics, Mayo Clinic and Foundation, Rochester, MN 55905 ABSTRACT: Limited diffraction beams have a large applications. In this article, new limited diffrac- beam patterns near the cone surface, these devices

Lu, Jian-yu

151

Laboratories, Oxide Molecular Beam Epitaxy Group, Condensed Matter Physics  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratories: Photo Tour Laboratories: Photo Tour MBE Laboratory MBE Laboratory MBE Chamber MBE Chamber Temperature Controllers MBE Computers and Servers Pneumatic Hoses Transport between MBE Laboratory and Nano-Lithography Laboratory Backside of MBE chamber during growth, lit by Nano-Lithography Laboratory Nano-Lithography Laboratory Processing Chamber Laminar Flow Hood Mask Aligner Profilometer Probe Station Wire Bonder X-Ray Diffraction and Chemistry Laboratory X-Ray Diffraction System X-Ray Diffraction System X-Ray Diffraction System Chemistry Laboratory Chemistry Laboratory Mutual Inductance, Transport and Field Effect Laboratory Field Effect Measurement system Liquid Helium-4 Dipstick for Mutual Inductance Transport Measurement System COMBI Hall Effect, COMBI Transport and Mutual Inductance Measurements Laboratory

152

High energy heavy ion jets emerging from laser plasma generated by long pulse laser beams from  

E-Print Network (OSTI)

, Albuquerque, New Mexico. ~Received 21 February 2005; Accepted 20 April 2005! Abstract High energy heavy ions to the fast ion emission process. The interest in laser plasmas and interaction phenomena of heavy ion beams!. Thus there is a tradition to investigate accelerator related issues like beam transport phenomena

153

Production of intense negative hydrogen beams with polarized nuclei by selective neutralization of cold negative ions  

DOE Patents (OSTI)

A process for selectively neutralizing H/sup -/ ions in a magnetic field to produce an intense negative hydrogen ion beam with spin polarized protons. Characteristic features of the process include providing a multi-ampere beam of H/sup -/ ions that are

Hershcovitch, A.

1984-02-13T23:59:59.000Z

154

Surface engineering with ion beams: from self-organized nanostructures to ultra-smooth surfaces  

Science Journals Connector (OSTI)

Low-energy ion-beam sputtering, i.e. the removal ... a surface due to the impact of energetic ions or atoms, is an inherent part of ... pattern formation and surface smoothing by low-energy ion-beam erosion of Si...

F. Frost; B. Ziberi; A. Schindler; B. Rauschenbach

2008-06-01T23:59:59.000Z

155

Ion acceleration from thin foil and extended plasma targets by slow electromagnetic wave and related ion-ion beam instability  

SciTech Connect

When ions are accelerated by the radiation pressure of a laser pulse, their velocity cannot exceed the pulse group velocity which can be considerably smaller than the speed of light in vacuum. This is demonstrated in two cases corresponding to a thin foil target irradiated by high intensity laser light and to the hole boring produced in an extended plasma by the laser pulse. It is found that the beams of accelerated ions are unstable against Buneman-like and Weibel-like instabilities which results in the broadening of the ion energy spectrum.

Bulanov, S. V. [QuBS, Japan Atomic Energy Agency, Kizugawa, Kyoto, 619-0215 (Japan); A. M. Prokhorov Institute of General Physics RAS, Moscow, 119991 (Russian Federation); Esirkepov, T. Zh.; Kando, M. [QuBS, Japan Atomic Energy Agency, Kizugawa, Kyoto, 619-0215 (Japan); Pegoraro, F. [Physical Department, University of Pisa, Pisa 56127 (Italy); Bulanov, S. S. [University of California, Berkeley, California 94720 (United States); Geddes, C. G. R.; Schroeder, C. B.; Esarey, E. [Lawrence Berkeley National Laboratory, Berkeley, California, 94720 (United States); Leemans, W. P. [University of California, Berkeley, California 94720 (United States); Lawrence Berkeley National Laboratory, Berkeley, California, 94720 (United States)

2012-10-15T23:59:59.000Z

156

Method and means of directing an ion beam onto an insulating surface for ion implantation or sputtering  

DOE Patents (OSTI)

A beam of ions is directed under control onto an insulating surface by supplying simultaneously a stream of electrons directed at the same surface in a quantity sufficient to neutralize the overall electric charge of the ion beam and result in a net zero current flow to the insulating surface. The ion beam is adapted particularly both to the implantation of ions in a uniform areal disposition over the insulating surface and to the sputtering of atoms or molecules of the insulator onto a substrate.

Gruen, Dieter M. (Downers Grove, IL); Krauss, Alan R. (Naperville, IL); Siskind, Barry (Downers Grove, IL)

1981-01-01T23:59:59.000Z

157

Physics of neutralization of intense high-energy ion beam pulses by electronsa...  

E-Print Network (OSTI)

Physics of neutralization of intense high-energy ion beam pulses by electronsa... I. D. Kaganovich beams,13 the physics of solar flares,14 high-intensity high- energy particle beam propagation Neutralization and focusing of intense charged particle beam pulses by electrons form the basis for a wide range

Kaganovich, Igor

158

E-Print Network 3.0 - alkali ion beams Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

beams Search Powered by Explorit Topic List Advanced Search Sample search results for: alkali ion beams Page: << < 1 2 3 4 5 > >> 1 METHOD FOR EFFICIENCY AND TIME RESPONSE...

159

BNL-73700-2005-IR ELECTRON BEAM ION SOURCE PRE-INJECTOR PROJECT  

E-Print Network (OSTI)

BNL-73700-2005-IR ELECTRON BEAM ION SOURCE PRE-INJECTOR PROJECT (EBIS) CONCEPTUAL DESIGN REPORT J.2. THE EBIS SOURCE .........................................................................................14 4.2. DEMONSTRATION OF HIGH CURRENT ELECTRON BEAM FORMATION AND PROPAGATION

160

Backward high energy ion beams from plasma focus  

Science Journals Connector (OSTI)

High energyneutrons more than 2.45 MeV from deuteron-deuteron fusion reaction have been measured in backward direction of plasma focusdevices in many laboratories. However the experimental evidence for high energy deuterons responsible for such neutrons has not been reported so far. In this brief communication backward high energy deuteron beam from NX2 plasma focus [M. V. Roshan et al. Phys. Lett. A373 851 (2009)] is reported which was measured with a direct and unambiguous technique of nuclear activation. The relevant nuclear reaction for the target activation is C 12 ( d n ) N 13 which has a deuteron threshold energy of 328 keV.

M. V. Roshan; P. Lee; S. Lee; A. Talebitaher; R. S. Rawat; S. V. Springham

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

MEASUREMENT OF ION BEAM FROM LASER ION SOURCE FOR RHIC Takeshi Kanesue, Kyushu University, Fukuoka 819-0395, Japan  

E-Print Network (OSTI)

, Fukuoka 819-0395, Japan Jun Tamura, Tokyo Institute of Technology, Meguro-ku, Tokyo 152-8550, Japan Radiation Laboratory [1]. The low charge state, low emittance and high ion yield laser ion source (LIS

162

Opportunistic Mass Measurements at the Holifield Radioactive Ion Beam Facility  

SciTech Connect

A technique for measuring mass differences has been developed at the Holifield Radioactive Ion Beam Facility (HRIBF) that requires no specialized equipment. Mass differences are measured as position differences between known and unknown-mass isobars, dispersed at the image of the energy-analyzing magnet following the 25MV tandem post-accelerator, and identified by an energy-loss measurement. The technique has been demonstrated on neutron-rich 77 79Cu and 83 86Ge isotopes produced using the isotope separator online (ISOL) method with the 238U(p,fission) reaction, where a mass accuracy of 500 keV was achieved. These nuclides are well suited to the measurement technique, as they readily migrate out of the production target and to the ion source and comprise the most neutron-rich elements of the isobarically mixed beam. Because modest precision mass values can be obtained with only a few tens of counts of the nuclide of interest among orders of magnitude more of the isobaric neighbors closer to stability, the sensitivity of this technique makes it appropriate for initial mass measurements far from stability.

Hausladen, Paul [ORNL; Beene, James R [ORNL; Galindo-Uribarri, Alfredo {nmn} [ORNL; Larochelle, Y [University of Tennessee, Knoxville (UTK); Liang, J Felix [ORNL; Mueller, Paul Edward [ORNL; Shapira, Dan [ORNL; Stracener, Daniel W [ORNL; Thomas, J. S. [Rutgers University; Varner Jr, Robert L [ORNL; Wollnik, Hermann [ORNL

2006-01-01T23:59:59.000Z

163

LAWRENCE BERKELEY LABORATORY YEAR-END-REPORT ON HEAVY-ION FUSION PROGRAM  

E-Print Network (OSTI)

Beams of a Pellet Fusion Reactor by D. Neuffer, GeometricTarget of a Heavy Ion Fusion Reactor: Summary of a meetingTarget of a Heavy Ion Fusion Reactor: Summary of a Meeting

Staff, HIF

2011-01-01T23:59:59.000Z

164

Laser acceleration of quasi-monoenergetic MeV ion beams  

Science Journals Connector (OSTI)

... S. et al. Electron, photon, and ion beams from the relativistic interaction of Petawatt laser pulses with solid targets. Phys. Plasmas 5, 2076–2082 (2000)

B. M. Hegelich; B. J. Albright; J. Cobble; K. Flippo; S. Letzring; M. Paffett; H. Ruhl; J. Schreiber; R. K. Schulze; J. C. Fernández

2006-01-26T23:59:59.000Z

165

Focused ion beam engineered whispering gallery mode resonators with open cavity structure  

Science Journals Connector (OSTI)

We report the realization of an open cavity whispering gallery mode optical resonator, in which the circulating light traverses a free space gap. We utilize focused ion beam...

Aveline, David C; Baumgartel, Lukas; Ahn, Byungmin; Yu, Nan

2012-01-01T23:59:59.000Z

166

E-Print Network 3.0 - ar ion beam Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

University Collection: Materials Science 3 OPERATION STATUS OF HIGH INTENSITY ION BEAMS AT GANIL F. Chautard, G. Sncal, GANIL, Caen, France Summary: OPERATION STATUS OF HIGH...

167

Absorption, structural, and electrical properties of Ge films prepared by ion-beam-assisted deposition  

Science Journals Connector (OSTI)

Effects of ion energy on the optical, microstructure, and electrical properties of Ge films prepared by ion-beam-assisted deposition were investigated. The absorption edge is found to...

Leng, Jian; Zhao, Li; Ji, Yiqin; Liu, Huasong; Zhuang, Kewen

2014-01-01T23:59:59.000Z

168

Orbital effects on pitch angle diffusion of injected fast-ion beams in tokamaks  

E-Print Network (OSTI)

The effects of ion orbits on pitch angle scattering of fast ion beam injection are investigated here for the magnetic equilibrium of the ITER tokamak. Two methods are used to calculate distributions in the presence of ...

Wleklinski, Joseph J., 1974-

2005-01-01T23:59:59.000Z

169

Heating of beam ions by ion acoustic waves A. Vaivads, K. Ro nnmark, T. Oscarsson, and M. Andre  

E-Print Network (OSTI)

spectral density at frequencies much below the ion gyrofrequency. The wave power decreases with increasingHeating of beam ions by ion acoustic waves A. Vaivads, K. RoÃ? nnmark, T. Oscarsson, and M. AndreÃ? Swedish Institute of Space Physics, University of UmeaÃ? , S-901 87 UMEAÃ? , Sweden Received: 30 April 1997

Paris-Sud XI, Université de

170

Direct Drive Heavy-Ion-Beam Inertial Fusion at High Coupling Efficiency  

SciTech Connect

Issues with coupling efficiency, beam illumination symmetry and Rayleigh Taylor (RT) instability are discussed for spherical heavy-ion-beam-driven targets with and without hohlraums. Efficient coupling of heavy ion beams to compress direct-drive inertial fusion targets without hohlraums is found to require ion range increasing several-fold during the drive pulse. One-dimensional implosion calculations using the LASNEX ICF target physics code shows the ion range increasing four-fold during the drive pulse to keep ion energy deposition following closely behind the imploding ablation front, resulting in high coupling efficiencies (shell kinetic energy/incident beam energy of 16 to 18%). Ways to increase beam ion range while mitigating Rayleigh-Taylor instabilities are discussed for future work.

Logan, B. Grant; Logan, B. Grant; Perkins, L.J.; Barnard, J.J.

2007-06-25T23:59:59.000Z

171

Ion beam sputter target and method of manufacture  

DOE Patents (OSTI)

A target for use in an ion beam sputtering apparatus made of at least two target tiles where at least two of the target tiles are made of different chemical compositions and are mounted on a main tile and geometrically arranged on the main tile to yield a desired chemical composition on a sputtered substrate. In an alternate embodiment, the tiles are of varied thickness according to the desired chemical properties of the sputtered film. In yet another alternate embodiment, the target is comprised of plugs pressed in a green state which are disposed in cavities formed in a main tile also formed in a green state and the assembly can then be compacted and then sintered.

Higdon, Clifton; Elmoursi, Alaa A.; Goldsmith, Jason; Cook, Bruce; Blau, Peter; Jun, Qu; Milner, Robert

2014-09-02T23:59:59.000Z

172

Electrostatic particle trap for ion beam sputter deposition  

DOE Patents (OSTI)

A method and apparatus for the interception and trapping of or reflection of charged particulate matter generated in ion beam sputter deposition. The apparatus involves an electrostatic particle trap which generates electrostatic fields in the vicinity of the substrate on which target material is being deposited. The electrostatic particle trap consists of an array of electrode surfaces, each maintained at an electrostatic potential, and with their surfaces parallel or perpendicular to the surface of the substrate. The method involves interception and trapping of or reflection of charged particles achieved by generating electrostatic fields in the vicinity of the substrate, and configuring the fields to force the charged particulate material away from the substrate. The electrostatic charged particle trap enables prevention of charged particles from being deposited on the substrate thereby enabling the deposition of extremely low defect density films, such as required for reflective masks of an extreme ultraviolet lithography (EUVL) system.

Vernon, Stephen P. (Pleasanton, CA); Burkhart, Scott C. (Livermore, CA)

2002-01-01T23:59:59.000Z

173

Focused ion beam damage to MOS integrated circuits  

SciTech Connect

Commercial focused ion beam (FIB) systems are commonly used to image integrated circuits (ICS) after device processing, especially in failure analysis applications. FIB systems are also often employed to repair faults in metal lines for otherwise functioning ICS, and are being evaluated for applications in film deposition and nanofabrication. A problem that is often seen in FIB imaging and repair is that ICS can be damaged during the exposure process. This can result in degraded response or out-right circuit failure. Because FIB processes typically require the surface of an IC to be exposed to an intense beam of 30--50 keV Ga{sup +} ions, both charging and secondary radiation damage are potential concerns. In previous studies, both types of effects have been suggested as possible causes of device degradation, depending on the type of device examined and/or the bias conditions. Understanding the causes of this damage is important for ICS that are imaged or repaired by a FIB between manufacture and operation, since the performance and reliability of a given IC is otherwise at risk in subsequent system application. In this summary, the authors discuss the relative roles of radiation damage and charging effects during FIB imaging. Data from exposures of packaged parts under controlled bias indicate the possibility for secondary radiation damage during FIB exposure. On the other hand, FIB exposure of unbiased wafers (a more common application) typically results in damage caused by high-voltage stress or electrostatic discharge. Implications for FIB exposure and subsequent IC use are discussed.

FLEETWOOD,D.M.; CAMPBELL,ANN N.; HEMBREE,CHARLES E.; TANGYUNYONG,PAIBOON; JESSING,JEFFREY R.; SODEN,JERRY M.

2000-05-10T23:59:59.000Z

174

Present and future perspectives for high energy density physics with intense heavy ion and laser beams  

E-Print Network (OSTI)

Present and future perspectives for high energy density physics with intense heavy ion and laser18, deliver an intense uranium beam that deposit about 1 kJ0g specific energy in solid matter. Using 2004! Abstract Intense heavy ion beams from the Gesellschaft für Schwerionenforschung ~GSI, Darmstadt

175

Nuclear reactions with 11C and 14O radioactive ion beams  

SciTech Connect

Radioactive ion beams (RIBs) have been shown to be a useful tool for studying proton-rich nuclides near and beyond the proton dripline and for evaluating nuclear models. To take full advantage of RIBs, Elastic Resonance Scattering in Inverse Kinematics with Thick Targets (ERSIKTT), has proven to be a reliable experimental tool for investigations of proton unbound nuclei. Following several years of effort, Berkeley Experiments with Accelerated Radioactive Species (BEARS), a RIBs capability, has been developed at the Lawrence Berkeley National Laboratory's 88-Inch Cyclotron. The current BEARS provides two RIBs: a 11C beam of up to 2x108 pps intensity on target and an 14O beam of up to 3x104 pps intensity. While the development of the 11C beam has been relatively easy, a number of challenges had to be overcome to obtain the 14O beam. The excellent 11C beam has been used to investigate several reactions. The first was the 197Au(11C,xn)208-xnAt reaction, which was used to measure excitation functions for the 4n to 8n exit channels. The measured cross sections were generally predicted quite well using the fusion-evaporation code HIVAP. Possible errors in the branching ratios of ?? decays from At isotopes as well as the presence of incomplete fusion reactions probably contribute to specific overpredictions. 15F has been investigated by the p(14O,p)14O reaction with the ERSIKTT technology. Several 14O+p runs have been performed. Excellent energy calibration was obtained using resonances from the p(14N,p)14N reaction in inverse kinematics, and comparing the results to those obtained earlier with normal kinematics. The differences between 14N+p and 14O+p in the stopping power function have been evaluated for better energy calibration. After careful calibration, the energy levels of 15F were fitted with an R-matrix calculation. Spins and parities were assigned to the two observed resonances. This new measurement of the 15F ground state supports the disappearance of the Z = 8 proton magic number for odd Z, Tz=-3/2 nuclei. It is expected that future work on proton-rich nuclides will rely heavily on RIBs and/or mass separators. Currently, radioactive ion beam intensities are sufficient for the study of a reasonable number of very proton-rich nuclides.

Guo, Fanqing

2004-12-09T23:59:59.000Z

176

Study of Nuclear Reactions with 11C and 15O Radioactive Ion Beams  

SciTech Connect

Nuclear reaction study with radioactive ion beams is one of the most exciting research topics in modern nuclear physics. The development of radioactive ion beams has allowed nuclear scientists and engineers to explore many unknown exotic nuclei far from the valley of nuclear stability, and to further our understanding of the evolution of the universe. The recently developed radioactive ion beam facility at the Lawrence Berkeley National Laboratory's 88-inch cyclotron is denoted as BEARS and provides {sup 11}C, {sup 14}O and {sup 15}O radioactive ion beams of high quality. These moderate to high intensity, proton-rich radioactive ion beams have been used to explore the properties of unstable nuclei such as {sup 12}N and {sup 15}F. In this work, the proton capture reaction on {sup 11}C has been evaluated via the indirect d({sup 11}C, {sup 12}N)n transfer reaction using the inverse kinematics method coupled with the Asymptotic Normalization Coefficient (ANC) theoretical approach. The total effective {sup 12}N {yields} {sup 11}C+p ANC is found to be (C{sub eff}{sup 12{sub N}}){sup 2} = 1.83 {+-} 0.27 fm{sup -1}. With the high {sup 11}C beam intensity available, our experiment showed excellent agreement with theoretical predictions and previous experimental studies. This study also indirectly confirmed that the {sup 11}C(p,{gamma}) reaction is a key step in producing CNO nuclei in supermassive low-metallicity stars, bypassing the slow triple alpha process. The newly developed {sup 15}O radioactive ion beam at BEARS was used to study the poorly known level widths of {sup 16}F via the p({sup 15}O,{sup 15}O)p reaction. Among the nuclei in the A=16, T=1 isobaric triad, many states in {sup 16}N and {sup 16}O have been well established, but less has been reported on {sup 16}F. Four states of {sup 16}F below 1 MeV have been identified experimentally: 0{sup -}, 1{sup -}, 2{sup -}, and 3{sup -} (E{sub x} = 0.0, 0.19, 0.42, and 0.72 MeV, respectively). Our study utilized R-matrix analysis and found that the 0- state has a level width of 23.1 {+-} 2.2 keV, and that the broader 1- state has a width of 91.1 {+-} 9.9 keV. The level width of the 2{sup -} state is found to be 3.3 {+-} 0.6 keV which is much narrower than the compiled value of 40 {+-} 30 keV, while a width of 14.1 {+-} 1.7 keV for the 3{sup -} state is in good agreement with the reported value (< 15 keV). These experimental level widths of all four levels are also in accordance with theoretical predictions using single particle shell model calculation.

Lee, Dongwon

2007-05-14T23:59:59.000Z

177

Characterization of polymeric films subjected to lithium ion beam irradiation  

SciTech Connect

Two different polymeric materials that are candidate materials for use as binders for mixed uranium–plutonium oxide nuclear fuel pellets were subjected to Li ion beam irradiation, in order to simulate intense alpha irradiation. The materials (a polyethylene glycol 8000 and a microcrystalline wax) were then analyzed using a combination of mass spectrometry (MS) approaches and X-ray photoelectron spectroscopy (XPS). Samples of the irradiated PEG materials were dissolved in H2O and then analyzed using electrospray ionization-MS, which showed the formation of a series of small oligomers in addition to intact large PEG oligomers. The small oligomers were likely formed by radiation-induced homolytic scissions of the C–O and C–C bonds, which furnish radical intermediates that react by radical recombination with Hradical dot and OHradical dot. Surface analysis using SIMS revealed a heterogeneous surface that contained not only PEG-derived polymers, but also hydrocarbon-based entities that are likely surface contaminants. XPS of the irradiated PEG samples indicated the emergence of different carbon species, with peak shifts suggesting the presence of sp2 carbon atoms. Analysis of the paraffinic film using XPS showed the emergence of oxygen on the surface of the sample, and also a broadening and shifting of the C1s peak, demonstrating a change in the chemistry on the surface. The paraffinic film did not dissolve in either H2O or a H2O–methanol solution, and hence the bulk of the material could not be analyzed using electrospray. However a series of oligomers was leached from the bulk material that produced ion series in the ESI-MS analyses that were identified octylphenyl ethoxylate oligomers. Upon Li ion bombardment, these shifted to a lower average molecular weight, but more importantly showed the emergence of three new ion series that are being formed as a result of radiation damage. Surface analysis of the paraffinic polymers using SIMS produced spectra that were wholly dominated by hydrocarbon ion series, and no difference was observed between unirradiated and irradiated samples. The studies demonstrate that for the PEG-based polymers, direct evidence for radiolytic scission can be observed using ESI-MS, and suggests that both radiolytic pathways and efficiencies as a function of dose should be measurable by calibrating instrument response to the small oligomeric degradation products.

Gary S. Groenewold; W. Roger Cannon; Paul A. Lessing; Recep Avci; Muhammedin Deliorman; Mark Wolfenden; Doug W. Akers; J. Keith Jewell

2013-02-01T23:59:59.000Z

178

Negative ion beam injection apparatus with magnetic shield and electron removal means  

DOE Patents (OSTI)

A negative ion source is constructed to produce H.sup.- ions without using Cesium. A high percentage of secondary electrons that typically accompany the extracted H.sup.- are trapped and eliminated from the beam by permanent magnets in the initial stage of acceleration. Penetration of the magnetic field from the permanent magnets into the ion source is minimized. This reduces the destructive effect the magnetic field could have on negative ion production and extraction from the source. A beam expansion section in the extractor results in a strongly converged final beam.

Anderson, Oscar A. (Berkeley, CA); Chan, Chun F. (Hayward, CA); Leung, Ka-Ngo (Hercules, CA)

1994-01-01T23:59:59.000Z

179

Dynamics of neutralizing electrons during the focusing of intense heavy ions beams inside a heavy fusion reactor chamber  

E-Print Network (OSTI)

beams inside a heavy ion fusion reactor chamber * Agustin F.efficiency of a Heavy Ion Fusion reactor heavily depends on

Lifschitz, Agustin F.; Maynard, Gilles; Vay, Jean-Luc; Lenglet, Andrian

2006-01-01T23:59:59.000Z

180

A Novel Detector Design for Imaging Low-Intensity Diffuse Ion Beams  

E-Print Network (OSTI)

A Novel Detector Design for Imaging Low- Intensity Diffuse Ion Beams J. Schmidt, R. de Souza, S for signal processing To image the beam scintillating fibers are used. Ionizing particles, when incident readouts for each dimension. Right: example of a beam profile. Above: EZ10EN drive electronics to control

de Souza, Romualdo T.

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Theoretical and experimental study of space charge in intense ion beams  

Science Journals Connector (OSTI)

The highly collimated beams of energetic neutral atoms used in controlled thermonuclear fusion research (CTR) require the virtual elimination of space-charge forces in the primary ion beam in order to minimize the angular divergence. A model is presented which describes the behavior of an intense ion beam passing through a gas cell. This theory is used to derive the space-charge field produced by such a beam and shows how its effect can be minimized. This model agrees well with experimental measurements and enables emittance-dominated beams of very high brightness to be obtained which could find applications in fields other than CTR.

A. J. T. Holmes

1979-01-01T23:59:59.000Z

182

Proceedings of the workshop on the science of intense radioactive ion beams  

SciTech Connect

This report contains the proceedings of a 2-1/2 day workshop on the Science of Intense Radioactive Ion Beams which was held at the Los Alamos National Laboratory on April 10--12, 1990. The workshop was attended by 105 people, representing 30 institutions from 10 countries. The thrust of the workshop was to develop the scientific opportunities which become possible with a new generation intense Radioactive Ion Beam (RIB) facility, currently being discussed within North America. The workshop was organized around five primary topics: (1) reaction physics; (2) nuclei far from stability/nuclear structure; (3) nuclear astrophysics; (4) atomic physics, material science, and applied research; and (5) facilities. Overview talks were presented on each of these topics, followed by 1-1/2 days of intense parallel working group sessions. The final half day of the workshop was devoted to the presentation and discussion of the working group summary reports, closing remarks and a discussion of future plans for this effort.

McClelland, J.B.; Vieira, D.J. (comps.)

1990-10-01T23:59:59.000Z

183

Implementation of focused ion beam (FIB) system in characterization of nuclear fuels and materials  

SciTech Connect

Beginning in 2007, a program was established at the Idaho National Laboratory to update key capabilities enabling microstructural and micro-chemical characterization of highly irradiated and/or radiologically contaminated nuclear fuels and materials at scales that previously had not been achieved for these types of materials. Such materials typically cannot be contact handled and pose unique hazards to instrument operators, facilities, and associated personnel. One of the first instruments to be acquired was a Dual Beam focused ion beam (FIB)-scanning electron microscope (SEM) to support preparation of transmission electron microscopy and atom probe tomography samples. Over the ensuing years, techniques have been developed and operational experience gained that has enabled significant advancement in the ability to characterize a variety of fuel types including metallic, ceramic, and coated particle fuels, obtaining insights into in-reactor degradation phenomena not obtainable by any other means. The following article describes insights gained, challenges encountered, and provides examples of unique results obtained in adapting Dual Beam FIB technology to nuclear fuels characterization.

A. Aitkaliyeva; J. W. Madden; B. D. Miller; J I Cole; T A Hyde

2014-10-01T23:59:59.000Z

184

Low energy ion beam assisted deposition of a spin valve J. J. Quan,a  

E-Print Network (OSTI)

Low energy ion beam assisted deposition of a spin valve J. J. Quan,a S. A. Wolf, and H. N. G. Wadley Department of Materials Science and Engineering, School of Engineering and Applied Science interfacial structures can be created using low energy, ion assisted vapor deposition techniques with ion

Wadley, Haydn

185

Magnetic domain structures of focused ion beam-patterned cobalt films using scanning ion microscopy with polarization analysis  

E-Print Network (OSTI)

Magnetic domain structures of focused ion beam-patterned cobalt films using scanning ion microscopy Studies of magnetic domain distributions in patterned magnetic materials are of pivotal importance in the areas of ultrahigh density magnetic recording, MRAM design, and miniaturized magnetic sensor arrays

Rau, Carl

186

Beam Compression in Heavy-Ion Induction Linacs  

E-Print Network (OSTI)

CA 94720, USA 4 Princeton Plasma Physics Laboratory,Berkeley, CA 94720, USA Princeton Plasma Physics Laboratory,

Seidl, P.A.

2009-01-01T23:59:59.000Z

187

Drift compression of an intense neutralized ion beam  

E-Print Network (OSTI)

AC02-76CH03073 with Princeton Plasma Physics Laboratory. Weand R. C. Davidson Princeton Plasma Physics Laboratory, New

2005-01-01T23:59:59.000Z

188

An Ion Guide for the Production of a Low Energy Ion Beam of Daughter Products of $?$-Emitters  

E-Print Network (OSTI)

A new ion guide has been modeled and tested for the production of a low energy ($\\approx$ 40 kV) ion beam of daughter products of alpha-emitting isotopes. The guide is designed to evacuate daughter recoils originating from the $\\alpha$-decay of a $^{233}$U source. The source is electroplated onto stainless steel strips and mounted along the inner walls of an ion guide chamber. A combination of electric fields and helium gas flow transport the ions through an exit hole for injection into a mass separator. Ion guide efficiencies for the extraction of $^{229}$Th$^{+}$ (0.06%), $^{221}$Fr$^{+}$ (6%), and $^{217}$At$^{+}$ (6%) beams have been measured. A detailed study of the electric field and gas flow influence on the ion guide efficiency is described for two differing electric field configurations.

B. Tordoff; T. Eronen; V. V. Elomaa; S. Gulick; U. Hager; P. Karvonen; T. Kessler; J. Lee; I. Moore; A. Popov; S. Rahaman; S. Rinta-Antila; T. Sonoda; J. Aysto

2006-05-22T23:59:59.000Z

189

ECR plasma source for heavy ion beam charge neutralization  

E-Print Network (OSTI)

resonance. Keywords: Plasma focus; RF plasma; Beam charge neutralization 1. INTRODUCTION A possible heavy

Gilson, Erik

190

Ion-beam apparatus and method for analyzing and controlling integrated circuits  

DOE Patents (OSTI)

An ion-beam apparatus and method for analyzing and controlling integrated circuits are disclosed. The ion-beam apparatus comprises a stage for holding one or more integrated circuits (ICs); a source means for producing a focused ion beam; and a beam-directing means for directing the focused ion beam to irradiate a predetermined portion of the IC for sufficient time to provide an ion-beam-generated electrical input signal to a predetermined element of the IC. The apparatus and method have applications to failure analysis and developmental analysis of ICs and permit an alteration, control, or programming of logic states or device parameters within the IC either separate from or in combination with applied electrical stimulus to the IC for analysis thereof. Preferred embodiments of the present invention including a secondary particle detector and an electron floodgun further permit imaging of the IC by secondary ions or electrons, and allow at least a partial removal or erasure of the ion-beam-generated electrical input signal. 4 figs.

Campbell, A.N.; Soden, J.M.

1998-12-01T23:59:59.000Z

191

Ion-beam apparatus and method for analyzing and controlling integrated circuits  

DOE Patents (OSTI)

An ion-beam apparatus and method for analyzing and controlling integrated circuits. The ion-beam apparatus comprises a stage for holding one or more integrated circuits (ICs); a source means for producing a focused ion beam; and a beam-directing means for directing the focused ion beam to irradiate a predetermined portion of the IC for sufficient time to provide an ion-beam-generated electrical input signal to a predetermined element of the IC. The apparatus and method have applications to failure analysis and developmental analysis of ICs and permit an alteration, control, or programming of logic states or device parameters within the IC either separate from or in combination with applied electrical stimulus to the IC for analysis thereof. Preferred embodiments of the present invention including a secondary particle detector and an electron floodgun further permit imaging of the IC by secondary ions or electrons, and allow at least a partial removal or erasure of the ion-beam-generated electrical input signal.

Campbell, Ann N. (Albuquerque, NM); Soden, Jerry M. (Placitas, NM)

1998-01-01T23:59:59.000Z

192

Plasma focus ion beam fluence and flux—For various gases  

Science Journals Connector (OSTI)

A recent paper derived benchmarks for deuteron beam fluence and flux in a plasma focus (PF) [S. Lee and S. H. Saw Phys. Plasmas 19 112703 (2012)]. In the present work we start from first principles derive the flux equation of the ion beam of any gas; link to the Lee Model code and hence compute the ion beam properties of the PF. The results show that for a given PF the fluence flux ion number and ion current decrease from the lightest to the heaviest gas except for trend-breaking higher values for Ar fluence and flux. The energy fluence energy flux power flow and damage factors are relatively constant from H2 to N2 but increase for Ne Ar Kr and Xe due to radiative cooling and collapse effects. This paper provides much needed benchmark reference values and scaling trends for ion beams of a PF operated in any gas.

S. Lee; S. H. Saw

2013-01-01T23:59:59.000Z

193

Fast ignition driven by quasi-monoenergetic ions: Optimal ion type and reduction of ignition energies with an ion beam array  

E-Print Network (OSTI)

Fast ignition of inertial fusion targets driven by quasi-monoenergetic ion beams is investigated by means of numerical simulations. Light and intermediate ions such as lithium, carbon, aluminium and vanadium have been considered. Simulations show that the minimum ignition energies of an ideal configuration of compressed Deuterium-Tritium are almost independent on the ion atomic number. However, they are obtained for increasing ion energies, which scale, approximately, as Z^2, where Z is the ion atomic number. Assuming that the ion beam can be focused into 10 {\\mu}m spots, a new irradiation scheme is proposed to reduce the ignition energies. The combination of intermediate Z ions, such as 5.5 GeV vanadium, and the new irradiation scheme allows a reduction of the number of ions required for ignition by, roughly, three orders of magnitude when compared with the standard proton fast ignition scheme.

Honrubia, J J; Hegelich, B M; Murakami, M; Enriquez, C D

2014-01-01T23:59:59.000Z

194

Ion beam analyses of radionuclide migration in heterogeneous rocks  

Science Journals Connector (OSTI)

The migration of radionuclides (RN) in the environment is a topic of general interest for its implications on public health and it is an issue for the long-term safety studies of deep geological repositories (DGR) for high-level radioactive waste. The role played by colloids on RN migration is also of great concern. Diffusion and sorption are fundamental mechanisms controlling RN migration in rocks and many experimental approaches are applied to determine transport parameters for low sorbing RN in homogeneous rocks. However it is difficult to obtain relevant data for high sorbing RN or colloids for which diffusion lengths are extremely short or within heterogeneous rocks where transport might be different in different minerals. The ion beam techniques Rutherford Backscattering Spectrometry (RBS) and micro-Particle Induced X-Ray Emission (?PIXE) rarely applied in the field were selected for their micro-analytical potential to study RN diffusion and surface retention within heterogeneous rocks. Main achievements obtained during last 12 years are highlighted.

Valentino Rigato

2013-01-01T23:59:59.000Z

195

Formation of Cobalt Silicide Films by Ion Beam Deposition  

SciTech Connect

Thin films of cobalt silicide are widely used as metallization in very large-scale integrated electronic circuits. In this study, Co ions were deposited on Si (111) wafers by a high beam current filter metal vacuum arc deposition (FMEVAD) system. Surface silicide films were formed after annealing from 500 to 700 C for 30 minutes. Cobalt depth profiles and contaminations were determined using Rutherford backscattering spectrometry (RBS) and time-of-flight energy elastic recoil detection analysis (ToF-E ERDA). The polycrystalline cobalt silicide phases formed were characterized by grazing-incidence x-ray diffraction (GIXRD). The surface topography development and interfaces have been investigated by transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The results show that a thin CoSi2 surface layer with both a smooth surface topography and sharp interface can be achieved by annealing at 700 C. The CoSi phase and O contamination were observed in the samples that were annealed at lower temperatures.

Zhang, Yanwen; McCready, David E.; Wang, Chong M.; Young, James S.; Mckinley, Mathew I.; Whitlow, Harry J.; Razpet, Alenka; Possnert, Göran; Zhang, Tonghe; Wu, Yuguang

2006-01-01T23:59:59.000Z

196

Ion beam sputter etching of galliumnitride grown by chloride transport LP–CVD  

Science Journals Connector (OSTI)

Galliumnitrid (GaN) layers, grown by chloride transport LP–CVD, were etched by ion beam sputtering with carbon dioxide (CO2). Before etching all samples were masked by electron beam evaporated titanium. We report on the dependence of the etch rate on the angle of incidence of the ion beam. Furthermore we present structural examinations of the surface before and after ion etching as well as an analysis of masking effects. Surface roughening and structural defects were investigated by optical microscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM).

Michael Topf; Fehmi Cavas; Bruno K Meyer; Bertilo Kempf; Walter Betz; Peter Veit

1999-01-01T23:59:59.000Z

197

Progress toward a microsecond duration, repetitive, intense-ion beam for active spectroscopic measurements on ITER  

SciTech Connect

The authors describe the design of an intense, pulsed, repetitive, neutral beam based on magnetically insulated diode technology for injection into ITER for spectroscopic measurements of thermalizing alpha particle and thermal helium density profiles, ion temperature, plasma rotation, and low Z impurity concentrations in the confinement region. The beam is being developed to enhance low signal-to-noise ratios expected with conventional steady-state ion beams because of severe beam attenuation and intense bremstrahlung emission. A 5 GW (e.g., 100 keV, 50 kA) one-microsecond-duration beam would increase the signal by 10{sup 3} compared to a conventional 5 MW beam with signal-to-noise ratios comparable to those from a chopped conventional beam in one second.

Davis, H.A.; Bartsch, R.R.; Barnes, C.W. [and others

1996-06-01T23:59:59.000Z

198

Survey of Collective Instabilities and Beam-Plasma Interactions in Intense Heavy Ion Beams  

E-Print Network (OSTI)

H. Qin, Phys. Rev. ST Accel. Beams 4, 104401 (2001). [30] S.Davidson, Phys. Rev. ST Accel. Beams 5, 021001 (2002). [31]Channell, Phys. Rev. ST Accel. Beams 2, 074401 (1999); [32

Davidson, Ronald C.

2009-01-01T23:59:59.000Z

199

Helium ion beam milling to create a nano-structured domain wall magnetoresistance spin valve  

Science Journals Connector (OSTI)

We have fabricated and measured single domain wall magnetoresistance devices with sub-20 nm gap widths using a novel combination of electron beam lithography and helium ion beam milling. The measurement wires and external profile of the spin valve are fabricated by electron beam lithography and lift-off. The critical bridge structure is created using helium ion beam milling, enabling the formation of a thinner gap (and so a narrower domain wall) than that which is possible with electron beam techniques alone. Four-point probe resistance measurements and scanning electron microscopy are used to characterize the milled structures and optimize the He ion dose. Successful operation of the device as a spin valve is demonstrated, with a 0.2% resistance change as the external magnetic field is cycled. The helium ion beam milling efficiency as extracted from electrical resistance measurements is 0.044 atoms/ion, about half the theoretical value. The gap in the device is limited to a maximum of 20 nm with this technique due to sub-surface swelling caused by injected ions which can induce catastrophic failure in the device. The fine patterning capabilities of the helium ion microscope milling technique indicate that sub-5 nm constriction widths could be possible.

Yudong Wang; S A Boden; D M Bagnall; H N Rutt; C H de Groot

2012-01-01T23:59:59.000Z

200

Influence of the equation of state of matter and ion beam characteristics on target heating and compression  

Science Journals Connector (OSTI)

The subject of high-energy density (HED) in matter is of considerable interest to many branches of physics. Intense beams of energetic heavy ions are a promising tool for creating large samples of HED matter which can be used to study the equation-of-state properties of such exotic states of matter experimentally. The Gesellschaft für Schwerionenforschung (GSI), Darmstadt, is a unique laboratory worldwide which has a heavy ion synchrotron facility, SIS18 (with a magnetic rigidity of 18 Tm), that delivers intense heavy ion beams. Using the beams generated at this present facility, interesting experimental work has been carried out in the field of HED matter [D.?H.?H. Hoffmann et al., Nucl. Instrum. Methods Phys. Res., Sect. B 161–162, 9 (2000)]. The GSI is planning to significantly expand its accelerator capabilities with construction of a new synchrotron ring, SIS100, which will have a magnetic rigidity of 100 Tm. This new facility will deliver a uranium beam which will have orders of magnitude higher intensity than the existing facility and will also have the possibility of multibeam acceleration. This paper presents two-dimensional hydrodynamic simulations of different target geometries including solid as well as hollow cylinders that are irradiated with beams having different shapes of the focal spot which will be available at the SIS100 facility. These include a circular focal spot, an annular focal spot, and an elliptic focal spot, respectively. The purpose of this study is to determine the region of the physical parameters including density, temperature, and pressure that can be accessed using the SIS100 beam. This information, we hope, will be useful for designing experiments on the studies of thermophysical properties of matter including the designing of appropriate diagnostic tools.

N. A. Tahir, A. Shutov, D. Varentsov, P. Spiller, S. Udrea, D. H. H. Hoffmann, I. V. Lomonosov, J. Wieser, M. Kirk, R. Piriz, V. E. Fortov, and R. Bock

2003-02-19T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Ion beam energy spectrum calculation via dosimetry data deconvolution.  

SciTech Connect

The energy spectrum of a H{sup +} beam generated within the HERMES III accelerator is calculated from dosimetry data to refine future experiments. Multiple layers of radiochromic film are exposed to the beam. A graphic user interface was written in MATLAB to align the film images and calculate the beam's dose depth profile. Singular value regularization is used to stabilize the unfolding and provide the H{sup +} beam's energy spectrum. The beam was found to have major contributions from 1 MeV and 8.5 MeV protons. The HERMES III accelerator is typically used as a pulsed photon source to experimentally obtain photon impulse response of systems due to high energy photons. A series of experiments were performed to explore the use of Hermes III to generate an intense pulsed proton beam. Knowing the beam energy spectrum allows for greater precision in experiment predictions and beam model verification.

Harper-Slaboszewicz, Victor Jozef; Sharp, Andrew Clinton (A& M University, College Station, TX)

2010-10-01T23:59:59.000Z

202

Electrons and gas versus high brightness ion beams  

E-Print Network (OSTI)

Review 1/11/05 beam Gas-Electron Source Diagnostic (GESD)and mitigation Gas-electron source diagnostic (GESD) [beam Measure each source of electrons Measure electron

2005-01-01T23:59:59.000Z

203

Stochastic Orbit Loss of Neutral Beam Ions From NSTX Due to Toroidal Alfven Eigenmode Avalanches  

SciTech Connect

Short toroidal Alfven eigenmode (TAE) avalanche bursts in the National Spherical Torus Experiment (NSTX) cause a drop in the neutron rate and sometimes a loss of neutral beam ions at or near the full injection energy over an extended range of pitch angles. The simultaneous loss of wide ranges of pitch angle suggests stochastic transport of the beam ions occurs. When beam ion orbits are followed with a guiding center code that incorporates plasma's magnetic equilibrium plus the measured modes, the predicted ranges of lost pitch angle are similar to those seen in the experiment, with distinct populations of trapped and passing orbits lost. These correspond to domains where the stochasticity extends in the orbit phase space from the region of beam ion deposition to the loss boundary.

Darrow, D S; Fredrickson, E D; Gorelenkov, N N; Gorelenkova, M; Kubota, S; Medley, S S; Podesta, M; Shi, L

2012-07-11T23:59:59.000Z

204

Pulsed-ion-beam nitriding and smoothing of titanium surface in a vacuum  

SciTech Connect

Both nitriding and smoothing of titanium have been achieved under irradiation of intense pulsed ion beam in a vacuum of 2x10{sup -2} Pa. Applying a screening method, we find that medium ion-beam intensity and multi-shot irradiation are effective for the processing, where repetitive surface melting with limited ablation favored Ti nitride formation as well as surface smoothing. The present results demonstrate that ambient gas atoms/molecules can be efficiently incorporated in metal matrices to form compounds under the ion-beam irradiation. The finding is of great significance for extending application scope of the ion-beam technique in materials research and processing, combined with the recent success in introducing ambient gas into the processing chamber.

Zhu, X.P.; Suematsu, Hisayuki; Jiang Weihua; Yatsui, Kiyoshi; Lei, M.K. [Extreme Energy-Density Research Institute, Nagaoka University of Technology, 1603-1 Kamitomioka, Nagaoka, Niigata 940-2188 (Japan); Surface Engineering Laboratory, Department of Materials Engineering, Dalian University of Technology, Dalian 116024 (China)

2005-08-29T23:59:59.000Z

205

Intermediate and high-mass ion beams from a 10-cm Duopigatron  

Science Journals Connector (OSTI)

Experimental studies of a 10-cm Duopigatron as a source of argon, krypton, and xenon ion beams are reported. Source plasma instabilities ... are examined, and the mass dependence of oscillation frequencies and in...

P. D. Weber; R. M. Gilgenbach

1984-06-01T23:59:59.000Z

206

Direct drive heavy-ion-beam inertial fusion at high coupling efficiency  

E-Print Network (OSTI)

M J of fusion yield. This NIF capsule design ab- sorbs 200capsules the size of the NIF capsule with heavy-ion beams (designs emerge, and, if the NIF's ignition campaign is also

Logan, B.G.

2008-01-01T23:59:59.000Z

207

Direct Drive Heavy-Ion-Beam Inertial Fusion at High Coupling Efficiency  

E-Print Network (OSTI)

of fusion yield [16]. This NIF capsule design absorbs 200 kJcapsules the size of the NIF capsule with heavy ion beams (designs emerge, and, i f the NIF's ignition campaign is also

Logan, B. Grant

2008-01-01T23:59:59.000Z

208

Ion-beam engineering of Co/TiO2 multilayer nanostructures  

Science Journals Connector (OSTI)

Multilayer structures consisting of Co/TiO2 bilayers with partial layer thicknesses varied within several nanometers and a total thickness of up to 100 nm were obtained using the ion-beam sputter deposition metho...

A. I. Stognij; M. V. Pashkevich; N. N. Novitskii…

2010-05-01T23:59:59.000Z

209

Concepts for the magnetic design of the MITICA neutral beam test facility ion accelerator  

SciTech Connect

The megavolt ITER injector concept advancement neutral injector test facility will be constituted by a RF-driven negative ion source and by an electrostatic Accelerator, designed to produce a negative Ion with a specific energy up to 1 MeV. The beam is then neutralized in order to obtain a focused 17 MW neutral beam. The magnetic configuration inside the accelerator is of crucial importance for the achievement of a good beam efficiency, with the early deflection of the co-extracted and stripped electrons, and also of the required beam optic quality, with the correction of undesired ion beamlet deflections. Several alternative magnetic design concepts have been considered, comparing in detail the magnetic and beam optics simulation results, evidencing the advantages and drawbacks of each solution both from the physics and engineering point of view.

Chitarin, G. [Consorzio RFX, Corso Stati Uniti 4, 35127 Padova (Italy); Department of Engineering and Management, University of Padova, Vicenza (Italy); Agostinetti, P.; Marconato, N.; Marcuzzi, D.; Sartori, E.; Serianni, G.; Sonato, P. [Consorzio RFX, Corso Stati Uniti 4, 35127 Padova (Italy)

2012-02-15T23:59:59.000Z

210

Investigation into direct conversion with medium energy He-ion beams  

E-Print Network (OSTI)

INVESTIGATION INTO DIRECT ENERGY CONVERSION WITH MEDIUM ENERGY HELIUM-ION BEAMS A Thesis by AVERY ALLAN GUILD-BINGHAM Submitted to the Office of Graduate Studies of Texas A&M University in partial... fulfillment of the requirements for the degree of MASTER OF SCIENCE December 2004 Major Subject: Nuclear Engineering INVESTIGATION INTO DIRECT ENERGY CONVERSION WITH MEDIUM ENERGY HELIUM-ION BEAMS A Thesis...

Guild-Bingham, Avery A.

2005-02-17T23:59:59.000Z

211

EIS-0291: High Flux Beam Reactor (HFBR) Transition Project at the Brookhaven National Laboratory, Upton, New York  

Energy.gov (U.S. Department of Energy (DOE))

The EIS evaluates the range of reasonable alternatives and their impacts regarding the future management of the High Flux Beam Reactor (HFBR) at Brookhaven National Laboratory (BNL).

212

INDEPENDENT VERIFICATION SURVEY OF THE HIGH FLUX BEAM REACTOR DECOMMISSIONING PROJECT OUTSIDE AREAS BROOKHAVEN NATIONAL LABORATORY UPTON, NEW YORK  

SciTech Connect

5098-SR-03-0 FINAL REPORT- INDEPENDENT VERIFICATION SURVEY OF THE HIGH FLUX BEAM REACTOR DECOMMISSIONING PROJECT OUTSIDE AREAS, BROOKHAVEN NATIONAL LABORATORY

P.C. Weaver

2010-12-15T23:59:59.000Z

213

Concentrated ion beam emitted from an enlarged cylindrical-anode-layer Hall plasma accelerator and mechanism  

SciTech Connect

An enlarged cylindrical-anode-layer Hall plasma accelerator with an outlet diameter of 150 mm is experimentally demonstrated to produce a concentrated ion beam, especially at a high discharge voltage, with a high current utilization efficiency of up to {approx}0.9. Numerical investigation based on the three-dimensional particle-in-cell method is performed to study the ion dynamics and elucidate the origin of the ion beam characteristics. The simulation results reveal that the equipotential lines play an important role in the surface near the anode emitting the ions. The ion emitting surface is determined by the magnetic field lines near the anode and the magnetic mirror contributes to the concentrated beam significantly. The high current utilization efficiency results from the appropriate obliquity of the magnetic mirror.

Geng, S. F.; Wang, C. X. [Southwestern Institute of Physics, Chengdu 610041 (China); Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon (Hong Kong); Tang, D. L.; Qiu, X. M. [Southwestern Institute of Physics, Chengdu 610041 (China); Chu, Paul K. [Department of Physics and Materials Science, City University of Hong Kong, Tat Chee Avenue, Kowloon (Hong Kong)

2013-01-28T23:59:59.000Z

214

Saturation of multi-laser beams laser-plasma instabilities from stochastic ion heating  

SciTech Connect

Cross-beam energy transfer (CBET) has been used as a tool on the National Ignition Facility (NIF) since the first energetics experiments in 2009 to control the energy deposition in ignition hohlraums and tune the implosion symmetry. As large amounts of power are transferred between laser beams at the entrance holes of NIF hohlraums, the presence of many overlapping beat waves can lead to stochastic ion heating in the regions where laser beams overlap [P. Michel et al., Phys. Rev. Lett. 109, 195004 (2012)]. This increases the ion acoustic velocity and modifies the ion acoustic waves’ dispersion relation, thus reducing the plasma response to the beat waves and the efficiency of CBET. This pushes the plasma oscillations driven by CBET in a regime where the phase velocities are much smaller than both the electron and ion thermal velocities. CBET gains are derived for this new regime and generalized to the case of multi ion species plasmas.

Michel, P.; Williams, E. A.; Divol, L.; Berger, R. L.; Glenzer, S. H.; Callahan, D. A. [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States)] [Lawrence Livermore National Laboratory, Livermore, California 94551 (United States); Rozmus, W. [Theoretical Physics Institute, University of Alberta, Edmonton, Alberta T6G2G7 (Canada) [Theoretical Physics Institute, University of Alberta, Edmonton, Alberta T6G2G7 (Canada); Lawrence Livermore National Laboratory, Livermore, California 94551 (United States)

2013-05-15T23:59:59.000Z

215

National High Magnetic Field Laboratory - Ion Cyclotron Resonance...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Radial Ion Motion in RF-Only Multipole Ion Guides Immersed in a Strong Magnetic Field Gradient, J. Am. Soc. Mass Spectr., 22, 591-601 (2011) 2 Blakney, G.T.; Hendrickson,...

216

Flyer Acceleration by Pulsed Ion Beam Ablation and Application for Space Propulsion  

SciTech Connect

Flyer acceleration by ablation plasma pressure produced by irradiation of intense pulsed ion beam has been studied. Acceleration process including expansion of ablation plasma was simulated based on fluid model. And interaction between incident pulsed ion beam and a flyer target was considered as accounting stopping power of it. In experiments, we used ETIGO-II intense pulsed ion beam generator with two kinds of diodes; 1) Magnetically Insulated Diode (MID, power densities of <100 J/cm2) and 2) Spherical-focused Plasma Focus Diode (SPFD, power densities of up to 4.3 kJ/cm2). Numerical results of accelerated flyer velocity agreed well with measured one over wide range of incident ion beam energy density. Flyer velocity of 5.6 km/s and ablation plasma pressure of 15 GPa was demonstrated by the present experiments. Acceleration of double-layer target consists of gold/aluminum was studied. For adequate layer thickness, such a flyer target could be much more accelerated than a single layer. Effect of waveform of ion beam was also examined. Parabolic waveform could accelerate more efficiently than rectangular waveform. Applicability of ablation propulsion was discussed. Specific impulse of 7000{approx}8000 seconds and time averaged thrust of up to 5000{approx}6000N can be expected. Their values can be controllable by changing power density of incident ion beam and pulse duration.

Harada, Nobuhiro; Buttapeng, Chainarong; Yazawa, Masaru [Department of Electrical Engineering, Nagaoka University of Technology, 1603 Kamitomioka, Nagaoka 940-2188 (Japan); Kashine, Kenji [Department of Electrical and Electronic Engineering, Kagoshima National College of Technology, 1460-1 Shinko, Hayato-cho, Aira-gun, Kagoshima 899-5193 (Japan); Jiang Weihua; Yatsui, Kiyoshi [Extreme Energy Density Research Institute, Nagaoka University of Technology, 1603 Kamitomioka, Nagaoka 940-2188 (Japan)

2004-02-04T23:59:59.000Z

217

Engineering embedded metal nanoparticles with ion beam technology  

Science Journals Connector (OSTI)

In this paper, we summarize our recent results of study on how to engineer the embedded metal nanoparticles in silica by ion implantation and ion irradiation technologies, including controlling the size,...

Feng Ren; Xiang Heng Xiao; Guang Xu Cai; Jian Bo Wang…

2009-08-01T23:59:59.000Z

218

Ion source developments for the production of radioactive isotope beams at TRIUMF  

SciTech Connect

At the ISAC facility at TRIUMF radioactive ions are produced by bombarding solid targets with up to 100 ?A of 500 MeV protons. The reaction products have to diffuse out of the hot target into an ion source. Normally, singly charged ions are extracted. They can be transported either directly to experiments or via an ECR charge state breeder to a post accelerator. Several different types of ion sources have to be used in order to deliver a large variety of rare isotope beams. At ISAC those are surface ion sources, forced electron beam arc discharge (FEBIAD) ion sources and resonant laser ionization sources. Recent development activities concentrated on increasing the selectivity for the ionization to suppress isobaric contamination in the beam. Therefore, a surface ion rejecting resonant laser ionization source (SIRLIS) has been developed to suppress ions from surface ionization. For the FEBIAD ion source a cold transfer line has been introduced to prevent less volatile components from reaching the ion source.

Ames, F., E-mail: ames@triumf.ca; Bricault, P.; Heggen, H.; Kunz, P.; Lassen, J.; Mjøs, A.; Raeder, S.; Teigelhöfer, A. [TRIUMF, 4004 Wesbrook Mall, Vancouver, British Columbia V6T2A3 (Canada)] [TRIUMF, 4004 Wesbrook Mall, Vancouver, British Columbia V6T2A3 (Canada)

2014-02-15T23:59:59.000Z

219

Improving beam spectral and spatial quality by double-foil target in laser ion acceleration for ion-driven fast ignition  

SciTech Connect

Mid-Z ion driven fast ignition inertial fusion requires ion beams of 100s of MeV energy and < 10% energy spread. An overdense run-scale foil target driven by a high intensity laser pulse can produce an ion beam that has attractive properties for this application. The Break Out Afterburner (BOA) is one laser-ion acceleration mechanism proposed to generate such beams, however the late stages of the BOA tend to produce too large of an energy spread. The spectral and spatial qualities of the beam quickly evolve as the ion beam and co-moving electrons continue to interact with the laser. Here we show how use of a second target foil placed behind a nm-scale foil can substantially reduce the temperature of the co-moving electrons and improve the ion beam energy spread. Particle-In-Cell simulations reveal the dynamics of the ion beam under control. Optimal conditions for improving the spectral and spatial spread of the ion beam is explored for current laser and target parameters, leading to generation of ion beams of energy 100s of MeV and 6% energy spread, a vital step for realizing ion-driven fast ignition.

Huang, Chenkun [Los Alamos National Laboratory; Albright, Brian J [Los Alamos National Laboratory

2010-01-01T23:59:59.000Z

220

Experiments with planar inductive ion source meant for creation of H+ Beams  

E-Print Network (OSTI)

Plasma Physics Laboratory (PPPL) (see ?gure 2) and driverInc. (see ?g- ure 3). In the PPPL source extraction apertureion beams, in addition PPPL source also needs to have

Vainionpaa, J.H.; Kalvas, T.; Hahto, S.K.; Reijonen, J.

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Design and Implementation of an Ion Beam Profiling System.  

E-Print Network (OSTI)

?? The work describes the development of a reliable device for profiling anion beam in the intensity cross section. A sensor head consisting of a… (more)

Stude, Joan

2009-01-01T23:59:59.000Z

222

The Application of Intense Ion Beams to the Creation of Hot Dense Plasmas [and Discussion  

Science Journals Connector (OSTI)

...small targets. Emphasis is placed throughout on the use of ion beams for heating targets of deuterium-tritium mixtures to thermonuclear ignition. It is probably true to claim that calculation of energy-range relations for energetic ions in cold materials...

1981-01-01T23:59:59.000Z

223

Beam current enhancement of microwave plasma ion source utilizing double-port rectangular cavity resonator  

SciTech Connect

Microwave plasma ion source with rectangular cavity resonator has been examined to improve ion beam current by changing wave launcher type from single-port to double-port. The cavity resonators with double-port and single-port wave launchers are designed to get resonance effect at TE-103 mode and TE-102 mode, respectively. In order to confirm that the cavities are acting as resonator, the microwave power for breakdown is measured and compared with the E-field strength estimated from the HFSS (High Frequency Structure Simulator) simulation. Langmuir probe measurements show that double-port cavity enhances central density of plasma ion source by modifying non-uniform plasma density profile of the single-port cavity. Correspondingly, beam current from the plasma ion source utilizing the double-port resonator is measured to be higher than that utilizing single-port resonator. Moreover, the enhancement in plasma density and ion beam current utilizing the double-port resonator is more pronounced as higher microwave power applied to the plasma ion source. Therefore, the rectangular cavity resonator utilizing the double-port is expected to enhance the performance of plasma ion source in terms of ion beam extraction.

Lee, Yuna; Park, Yeong-Shin; Jo, Jong-Gab; Yang, J. J.; Hwang, Y. S. [Department of Nuclear Engineering, Seoul National University, Seoul 151-744 (Korea, Republic of)

2012-02-15T23:59:59.000Z

224

Pulsed Helium Ion Beam Induced Deposition: A Means to High Growth Rates  

SciTech Connect

The sub-nanometer beam of a helium ion microscope was used to study and optimize helium-ion beam induced deposition of PtC nanopillars with the (CH{sub 3}){sub 3}Pt(CPCH{sub 3}) precursor. The beam current, beam dwell time, precursor refresh time, and beam focus have been independently varied. Continuous beam exposure resulted in narrow but short pillars, while pulsed exposure resulted in thinner and higher ones. Furthermore, at short dwell times the deposition efficiency was very high, especially for a defocused beam. Efficiencies were measured up to 20 times the value for continuous exposure conditions. The interpretation of the experimental data was aided by a Monte Carlo simulation of the deposition. The results indicate that two regimes are operational in ion beam induced deposition (IBID). In the first one, the adsorbed precursor molecules originally present in the beam interaction region decompose. After the original precursor layer is consumed, further depletion is averted and growth continues by the supply of molecules via adsorption and surface diffusion. Depletion around the beam impact site can be distinguished from depletion on the flanges of the growing pillars. The Monte Carlo simulations for low precursor surface coverage reproduce measured growth rates, but predict considerably narrower pillars, especially at short dwell times. Both the experiments and the simulations show that the pillar width rapidly increases with increasing beam diameter. Optimal writing strategy, good beam focusing, and rapid beam positioning are needed for efficient and precise fabrication of extended and complex nanostructures by He-IBID.

Alkemade, Paul F. A. [Delft University of Technology, Delft, Netherlands; Miro, Hozanna [Delft University of Technology, Delft, Netherlands; Van Veldhoven, Emile [TNO Van Leeuwenhoek Laboratory; Maas, Diederick [TNO Van Leeuwenhoek Laboratory; Smith, Daryl [University of Tennessee, Knoxville (UTK); Rack, P. D. [University of Tennessee, Knoxville (UTK)

2011-01-01T23:59:59.000Z

225

Electrostatic bottle for long-time storage of fast ion beams  

Science Journals Connector (OSTI)

A technique for storage of fast-ion beams (keV) using only electrostatic fields is presented. The fast-ion trap is designed like an optical resonator, whose electrode configuration allows for a very large field-free region, easy access into the trap by various probes, a simple ion loading technique, and a broad acceptance range for the initial kinetic energies of the ions. Such a fast-ion storage device opens up many experimental possibilities, a few of which are presented.

D. Zajfman; O. Heber; L. Vejby-Christensen; I. Ben-Itzhak; M. Rappaport; R. Fishman; M. Dahan

1997-03-01T23:59:59.000Z

226

Measurements of Linac4 H Ion Source Beam with a Magnetized Einzel Lens Electron Dump  

E-Print Network (OSTI)

Linac4 is a part of the upgrade of CERN’s accelerator complex for increased luminosity in the LHC. A new system to extract the ion beam from the plasma generator has been designed and tested, in order to improve the reliability and beam optics of the pulsed H- ion source. This paper presents the successfully implemented extraction system and three different beam measurements. The simulations compare well to the measurements and show that the plasma density was too low for the extraction system design during the measurements.

Midttun, O; Scrivens, R

2013-01-01T23:59:59.000Z

227

LEEM investigations of clean surfaces driven by energetic ion beams  

SciTech Connect

The original purpose of this award was to use low?energy electron microscopy (LEEM) to explore the dynamics of surfaces of clean single crystal surfaces when driven by a beam of energetic ions. The goal was to understand the nanoscience of hyperthermal growth, surface erosion by sublimation and irradiation, operation of surface sinks in irradiated materials, diffusion on driven surfaces, and the creation of structural patterns. This project was based on a novel LEEM system constructed by C. P. Flynn, which provided real?time imaging of surface dynamics by scattering low energy electrons. With the passing of Prof. Flynn in late 2011, this project was completed under a slightly different scope by constructing a low?energy, inelastic electron scattering (?EELS?) instrument. Consistent with Flynn?s original objectives for his LEEM system, this device probes the dynamics of crystal surfaces. However the measurements are not carried out in real time, but instead are done in the frequency domain, through the energy lost from the probe electrons. The purpose of this device is to study the collective bosonic excitations in a variety of materials, including high temperature superconductors, topological insulators, carbon allotropes including (but not limited to) graphene, etc. The ultimate goal here is to identify the bosons that mediate interactions in these and other materials, with hopes of shedding light on the origin of many exotic phenomena including high temperature superconductivity. We completed the construction of a low?energy EELS system that operates with an electron kinetic energy of 7 - 10 eV. With this instrument now running, we hope to identify, among other things, the bosons that mediate pairing in high temperature superconductors. Using this instrument, we have already made our first discovery. Studying freshly cleaved single crystals of Bi{sub 2}Se{sub 3}, which is a topological insulator, we have observed a surface excitation at an energy loss of ~ 90 meV. This excitation disperses quadratically, exhibits a critical momentum of q{sub c} = 0.11 ?{sup ?1}, and may be identified as the surface collective mode of the helical Dirac liquid. To make a stronger connection between the behavior of this excitation and the known surface physics of Bi{sub 2}Se{sub 3}, we are carrying out a doping?dependent study, as a function of Se vacancy content, of this excitation. From this study we will be able to quantify the strength of interactions in the spin?polarized surface states in a manner analogous to our past work on graphene.

Abbamonte, Peter M. [University of Illinois] University of Illinois

2013-04-24T23:59:59.000Z

228

Theoretical and Experimental Studies of the Extracted MCI Beam from an ECR Ion Source  

SciTech Connect

With the development of Electron Cyclotron Resonance Ion Source (ECRIS), very high performance ECRIS nowadays have been set up one by one around the world, such as the GTS in Grenoble, SERSE in Catania, LECR3 in Lanzhou and etc, which can produce very intense Multiply Charged Ion (MCI) beam. But till now, the study of the extracted MCI beam from an ECRIS remains open. In this article, we present a theoretical and experimental study of the extracted MCI beam. In the theoretical part, the influences of the extraction system on the extracted ion beam quality are mainly analyzed. The aspects that have influences on the extracted ion beam quality have been analyzed. With the instruction of the analysis, the PBGUNS code is used to simulate the influences of some important aspects concerning the extraction system. The influences of the extraction system geometry design, magnetic field, and the space charge effect will be detailedly presented in this article. In the experimental part, with an Electric-Sweep Scanner (ESS) emittance detection system, the influences on the extracted ion beam emittance of some typical parameters of ECRIS have been researched, such as the injected RF power, the RF frequency, the magnetic field and etc. The obtained results and the corresponding explanations are presented. Some of the results are well in accord with some empirical laws, but some other results seem to be disputed.

Sun, L.T.; Cao, Y.; Zhao, H.W.; Guo, X.H.; Zhang, Z.M.; Feng, Y.C.; Li, J.Y.; Ma, L.; Li, J.; Zhao, H.Y.; He, W.; Li, X.X. [Institute of Modern Physics (IMP), Chinese Academy of Sciences, Lanzhou (China); Hitz, D.; Girard, A. [CEA-Grenoble, Departement de Recherche Fondamentale sur la Matiere Condensee, Service des Basses Temperatures, 17 Rue des Martyrs, 38054 Grenoble Cedex 9 (France)

2005-03-15T23:59:59.000Z

229

High-energy-density physics experiments with intense heavy ion beams  

Science Journals Connector (OSTI)

In this paper we discuss physical and technical issues of high-energy-density physics (HEDP) experiments with intense heavy ion beams that are being performed at the Gesellschaft für Schwerionenforschung (GSI), Darmstadt. Special attention is given to a comparison of some recent results on expansion dynamics of evaporating lead that have been obtained in heavy ion beam driven HIHEX (Heavy-Ion Heating and Expansion) experiments at GSI-Darmstadt and in high-explosive driven shock wave loading and release experiments at IPCP–Chernogolovka.

D. Varentsov; V. Ya. Ternovoi; M. Kulish; D. Fernengel; A. Fertman; A. Hug; J. Menzel; P. Ni; D.N. Nikolaev; N. Shilkin; V. Turtikov; S. Udrea; V.E. Fortov; A.A. Golubev; V.K. Gryaznov; D.H.H. Hoffmann; V. Kim; I.V. Lomonosov; V. Mintsev; B.Yu. Sharkov; A. Shutov; P. Spiller; N.A. Tahir; H. Wahl

2007-01-01T23:59:59.000Z

230

A pepper-pot emittance meter for low-energy heavy-ion beams  

SciTech Connect

A novel emittance meter has been developed to measure the four-dimensional, transverse phase-space distribution of a low-energy ion beam using the pepper-pot technique. A characteristic feature of this instrument is that the pepper-pot plate, which has a linear array of holes in the vertical direction, is scanned horizontally through the ion beam. This has the advantage that the emittance can also be measured at locations along the beam line where the beam has a large horizontal divergence. A set of multi-channel plates, scintillation screen, and ccd camera is used as a position-sensitive ion detector allowing a large range of beam intensities that can be handled. This paper describes the design, construction, and operation of the instrument as well as the data analysis used to reconstruct the four-dimensional phase-space distribution of an ion beam. Measurements on a 15 keV He{sup +} beam are used as an example.

Kremers, H. R.; Beijers, J. P. M.; Brandenburg, S. [Kernfysisch Versneller Instituut, University of Groningen, Zernikelaan 25, 9747 AA Groningen (Netherlands)

2013-02-15T23:59:59.000Z

231

Low-damage milling of an amino acid thin film with cluster ion beam  

SciTech Connect

In this work, we characterized the surface damage layer and sputtering yield of polycrystalline L-leucine films before and after irradiation with Ar cluster or monomer ion beams with x ray photoelectron spectroscopy and ellipsometry. Irradiation with Ar monomer ion beams induced heavy damage on the surface of L-leucine films, such as bond breaking and carbonization. In contrast, no significant surface damage was observed in the films irradiated with Ar cluster ion beams. The sputtering yield of L-leucine decreased dramatically with increasing fluence of monomer Ar ions and approached the value of the sputtering yield of graphite; but under irradiation with Ar cluster ion beams, the sputtering yield remained constant with fluence. The differences in sputtering yield behavior were explained in relation with the surface damage layer on organic materials. Thus, cluster ion beams could potentially be used to mill down biological materials without significant damage on the surface and could contribute to various applications in the analysis and processing of life matter.

Hada, Masaki; Ibuki, Sachi; Ninomiya, Satoshi; Matsuo, Jiro [Quantum Science and Engineering Center, Kyoto University, Uji 611-0011 (Japan); Hontani, Yusaku; Yamamoto, Yasuyuki; Ichiki, Kazuya; Seki, Toshio [Department of Nuclear Engineering, Kyoto University, Kyoto 606-8501 (Japan); Aoki, Takaaki [Department of Electronic Science and Engineering, Kyoto University, Kyoto 615-8530 (Japan)

2011-11-01T23:59:59.000Z

232

Survey of Collective Instabilities and Beam-Plasma Interactions in Intense Heavy Ion Beams  

E-Print Network (OSTI)

Background Plasma”, Princeton Plasma Physics Laboratoryand Edward A. Startsev Princeton Plasma Physics Laboratory,and Edward A. Startsev Princeton Plasma Physics Laboratory,

Davidson, Ronald C.

2009-01-01T23:59:59.000Z

233

BNL test electron beam ion source operation on a 100 kV platform ,,abstract...a...,b...  

E-Print Network (OSTI)

BNL test electron beam ion source operation on a 100 kV platform ,,abstract...a...,b... E. N. Beebe to build an electron beam ion source EBIS that will satisfy the requirements of the relativistic heavy ion program. Development studies continue to be carried out on the BNL test EBIS, a half-length full electron

234

JCESR: Moving Beyond Lithium-Ion | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

JCESR: Moving Beyond Lithium-Ion Share Topic Energy Energy usage Energy storage Batteries Browse By - Any - Energy -Energy efficiency --Vehicles ---Alternative fuels ---Automotive...

235

Sandia National Laboratories: lithium-ion-based solid electrolyte...  

NLE Websites -- All DOE Office Websites (Extended Search)

lithium-ion-based solid electrolyte battery Sandia Labs, Front Edge Technology, Inc., Pacific Northwest National Lab, Univ. of California-Los Angeles: Micro Power Source On March...

236

Neutralization of an ion beam from the end-Hall ion source by a plasma electron source based on a discharge in crossed E × H fields  

Science Journals Connector (OSTI)

The possibility of using a plasma electron source (PES) with a discharge in crossed E × H...field for compensating the ion beam from an end-Hall ion source (EHIS) is analyzed. The PES used ... and acceleration re...

A. P. Dostanko; D. A. Golosov

2009-10-01T23:59:59.000Z

237

Beam Ion Instability in ILC Damping Ring with Multi-Gas Species  

SciTech Connect

Ion induced beam instability is one critical issue for the electron damping ring of the International Linear Collider (ILC) due to its ultra small emittance of 2 pm. The beam ion instability with various beam filling patterns for the latest lattice DTC02 is studied using PIC code. The code has been benchmarked with SPEAR3 experimental data and there is a good agreement between the simulation and observations. It uses the optics from MAD and can handle arbitrary beam filling pattern and vacuum. Different from previous studies, multi-gas species and exact beam filling patterns have been modeled simultaneously in the study. This feature makes the study more realistic. Analyses have been done to compare with the simulations.

Wang, Lanfa; Pivi, Mauro; /SLAC

2012-05-30T23:59:59.000Z

238

ION-MOLECULE INTERACTIONS IN CROSSED-BEAMS  

E-Print Network (OSTI)

dependence on electron energy and source pressure, it waspresent apparatus Ion source (electron impact source shown).tube. A low pressure electron impact source similar to that

Hansen, Steven George

2010-01-01T23:59:59.000Z

239

Radiological safety at Argonne national laboratory's heavy ion research facility  

Science Journals Connector (OSTI)

This paper discusses the radiological safety system to be employed at the Argonne tandem—linac accelerator system (ATLAS). The design parameters of ATLAS that affect safety have remained unchanged since ATLAS construction began in 1982. The specialized radiological safety considerations of ATLAS were discussed in 1982 [1]. This paper will present the details of the hardware, the administrative controls, and the radiation monitoring that will be in effect when beam is produced in April 1985. The experimental hall utilizing the maximum energy beam ( ? 27 MeV per nucleon) from the completed ATLAS has been partitioned with shielding blocks into its final configuration. Because scientists want access to some of the partitioned-off areas while beam is present in other areas, an interlock and logic system allowing such occupancy has been designed. The rationale and hardware of the system will be discussed. Since one of the potential radiation hazards is high-energy forward-directed neutrons from any location where the beam impinges (such as collimators, bending and focussing systems, experimental targets, and beam stops), radiation surveys and hazard assessments are necessary for the administrative controls that allow occupancy of various areas. Because of the various uses of ATLAS, neutrons (the dominant beam hazard) will be non-existent in some experiments and will be of energies ? 10 MeV for a few experiments. These conditions may exist at specific locations during beam preparation but may change rapidly when beam is finally delivered to an experimental area. Monitoring and assessing such time varying and geographically changing hazards will be a challenge since little data will be available on source terms until various beams are produced of sufficient intensity and energy to make measurements. How the operating division for ATLAS and the Argonne safety division are addressing this aspect through administrative controls will also be discussed.

R.H. Cooke; R.A. Wynveen

1985-01-01T23:59:59.000Z

240

ION-MOLECULE INTERACTIONS IN CROSSED-BEAMS  

E-Print Network (OSTI)

of 160 eV electrons on CF4, in H2. The pressure correctionimpact of 160 eV electrons on Cf4. The small cross denotesto that obtained using CF4 (see Chapter 6). The beam is

Hansen, Steven George

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Figures of merit for focusing mega-electron-volt ion beams in biomedical imaging and proton beam writing  

SciTech Connect

A figure of merit (FOM) has been developed for focusing quadrupole multiplet lenses for ion micro- and nanobeam systems. The method which is based on measurement of the central peak of the two-dimensional autocorrelation function of an image provides separate FOM for the horizontal and vertical directions. The approach has been tested by comparison with the edge widths obtained by nonlinear fitting the edge widths of a Ni grid and found to be reliable. The FOM has the important advantage for ion beam imaging of biomedical samples that the fluence needed is considerably lower than for edge fitting.

Ren Minqin; Whitlow, Harry J.; Ananda Sagari, A. R.; Kan, Jeroen A. van; Osipowicz, Thomas; Watt, Frank [Department of Physics, University of Jyvaeskylae, P.O. Box 35 (YFL), FIN-40014 (Finland); Centre for Ion Beam Applications, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore)

2008-01-01T23:59:59.000Z

242

Issues concerning high current lower energy electron beams required for ion cooling between EBIS LINAC and booster  

SciTech Connect

Some issues, regarding a low energy high current electron beam that will be needed for electron beam cooling to reduce momentum of gold ions exiting the EBIS LINAC before injection into the booster, are examined. Options for propagating such an electron beam, as well as the effect of neutralizing background plasma on electron and ion beam parameters are calculated. Computations and some experimental data indicate that none of these issues is a show stopper.

Hershcovitch,A.

2009-03-01T23:59:59.000Z

243

Effects of Ga ion-beam irradiation on monolayer graphene  

SciTech Connect

The effects of Ga ion on the single layer graphene (SLG) have been studied by Raman spectroscopy (RS), SEM, and field-effect characterization. Under vacuum conditions, Ga ion-irradiation can induce disorders and cause red shift of 2D band of RS, rather than lattice damage in high quality SLG. The compressive strain induced by Ga ion decreases the crystalline size in SLG, which is responsible for the variation of Raman scattering and electrical properties. Nonlinear out-put characteristic and resistance increased are also found in the I-V measurement. The results have important implications during CVD graphene characterization and related device fabrication.

Wang, Quan; Mao, Wei; Zhang, Yanmin; Shao, Ying; Ren, Naifei [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China)] [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China); Ge, Daohan [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China) [School of Mechanical Engineering, Jiangsu University, Zhenjiang 212013 (China); State Key Laboratory of Transducer Technology, Chinese Academy of Sciences, Shanghai 200050 (China)

2013-08-12T23:59:59.000Z

244

Reactive ion beam etching of HfO{sub 2} film and removal of sidewall redeposition  

SciTech Connect

Comparative studies on ion beam etching (IBE) and reactive ion beam etching (RIBE) of HfO{sub 2} film have been carried out using photoresist as the masking layer. The etching rates of HfO{sub 2} film and photoresist mask in pure Ar and Ar/CHF{sub 3} mixture plasmas were measured as a function of ion energy, plasma composition, and ion beam incident angle. It has been found that the RIBE with Ar/CHF{sub 3} plasma is capable of lowering the threshold energy of ion beam and increasing sputtering yield, compared to the IBE with pure Ar. The redeposition of photoresist sidewall is a major issue, due to the formation of nonvolatile etching products during sputtering of HfO{sub 2} film in both IBE and RIBE. However, the sidewall redeposition can be easily removed in HCl solutions with assistance of ultrasonic wave for RIBE with Ar/CHF{sub 3} plasma. Alternatively, the sidewall redeposition can be eliminated by controlling the slope of photoresist sidewall or combined with ion incident angle.

Wang Xudi; Liu Ying; Xu Xiangdong; Fu Shaojun; Cui Zheng [National Synchrotron Radiation Laboratory, University of Science and Technology of China, Hefei 230026 (China) and School of Mechanical and Automobile Engineering, Hefei University of Technology, Hefei 230009 (China); National Synchrotron Radiation Laboratory, University of Science and Technology of China, Hefei 230026 (China); Central Microstructure Facility, Rutherford Appleton Laboratory, Chilton, Didcot, Oxon OX11 0QX (United Kingdom)

2006-07-15T23:59:59.000Z

245

H-mode accelerating structures with PMQ focusing for low-beta ion beams  

SciTech Connect

We are developing high-efficiency normal-conducting RF accelerating structures based on inter-digital H-mode (IH) cavities and the transverse beam focusing with permanent-magnet quadrupoles (PMQ), for beam velocities in the range of a few percent of the speed of light. Such IH-PMQ accelerating structures following a short RFQ can be used in the front end of ion linacs or in stand-alone applications, e.g. a compact deuteron-beam accelerator up to the energy of several MeV. Results of combined 3-D modeling for a full IH-PMQ accelerator tank - electromagnetic computations, beam-dynamics simulations with high currents, and thermal-stress analysis - are presented. The accelerating field profile in the tank is tuned to provide the best beam propagation using coupled iterations of electromagnetic and beam-dynamics modeling. A cold model of the IH-PMQ tank is being manufactured.

Kurennoy, Sergey S [Los Alamos National Laboratory; O' Hara, James F [Los Alamos National Laboratory; Olivas, Eric R [Los Alamos National Laboratory; Rybarcyk, Lawrence J [Los Alamos National Laboratory

2010-01-01T23:59:59.000Z

246

Development of the front end test stand and vessel for extraction and source plasma analyses negative hydrogen ion sources at the Rutherford Appleton Laboratory  

SciTech Connect

The ISIS pulsed spallation neutron and muon facility at the Rutherford Appleton Laboratory (RAL) in the UK uses a Penning surface plasma negative hydrogen ion source. Upgrade options for the ISIS accelerator system demand a higher current, lower emittance beam with longer pulse lengths from the injector. The Front End Test Stand is being constructed at RAL to meet the upgrade requirements using a modified ISIS ion source. A new 10% duty cycle 25 kV pulsed extraction power supply has been commissioned and the first meter of 3 MeV radio frequency quadrupole has been delivered. Simultaneously, a Vessel for Extraction and Source Plasma Analyses is under construction in a new laboratory at RAL. The detailed measurements of the plasma and extracted beam characteristics will allow a radical overhaul of the transport optics, potentially yielding a simpler source configuration with greater output and lifetime.

Lawrie, S. R., E-mail: scott.lawrie@stfc.ac.uk [STFC ISIS Pulsed Spallation Neutron and Muon Facility, Rutherford Appleton Laboratory, Harwell Oxford, Harwell (United Kingdom); John Adams Institute of Accelerator Science, University of Oxford, Oxford (United Kingdom); Faircloth, D. C.; Letchford, A. P.; Perkins, M.; Whitehead, M. O.; Wood, T. [STFC ISIS Pulsed Spallation Neutron and Muon Facility, Rutherford Appleton Laboratory, Harwell Oxford, Harwell (United Kingdom)] [STFC ISIS Pulsed Spallation Neutron and Muon Facility, Rutherford Appleton Laboratory, Harwell Oxford, Harwell (United Kingdom); Gabor, C. [ASTeC Intense Beams Group, Rutherford Appleton Laboratory, Harwell Oxford, Harwell (United Kingdom)] [ASTeC Intense Beams Group, Rutherford Appleton Laboratory, Harwell Oxford, Harwell (United Kingdom); Back, J. [High Energy Physics Department, University of Warwick, Coventry (United Kingdom)] [High Energy Physics Department, University of Warwick, Coventry (United Kingdom)

2014-02-15T23:59:59.000Z

247

Progress on shock accelerated ion beam production on ATF  

NLE Websites -- All DOE Office Websites (Extended Search)

at hole boring velocity v(2Ic) 12 * Stationary ions in advance of the shock get accelerated by the same space charge field effectively bouncing off the shock front.* *...

248

Properties of Ion Beams Generated by Nitrogen Plasma Focus  

Science Journals Connector (OSTI)

Numerical experiments have been systematically carried out using the modified Lee model code on various plasma focus devices operated with nitrogen gas. The ion ... flow density, and damage factor) of the plasma focus

M. Akel; S. Alsheikh Salo; S. H. Saw; S. Lee

2014-04-01T23:59:59.000Z

249

A study of prompt fast ion losses from neutral beam injection in the DIII-D tokamak  

E-Print Network (OSTI)

A study of the prompt losses of injected neutral beam born fast ions was conducted on the DIII-D tokamak at General Atomics using scintillator based fast ion loss detectors (FILD) and a reverse orbit calculation code. ...

Sutherland, Derek A. (Derek Aiden)

2012-01-01T23:59:59.000Z

250

Simulation and design of an electron beam ion source charge breeder for the californium rare isotope breeder upgrade  

Science Journals Connector (OSTI)

An electron beam ion source (EBIS) will be constructed and used to charge breed ions from the californium rare isotope breeder upgrade (CARIBU) for postacceleration into the Argonne tandem linear accelerator system (ATLAS). Simulations of the EBIS charge breeder performance and the related ion transport systems are reported. Propagation of the electron beam through the EBIS was verified, and the anticipated incident power density within the electron collector was identified. The full normalized acceptance of the charge breeder with a 2 A electron beam, 0.024???mm?mrad for nominal operating parameters, was determined by simulating ion injection into the EBIS. The optics of the ion transport lines were carefully optimized to achieve well-matched ion injection, to minimize emittance growth of the injected and extracted ion beams, and to enable adequate testing of the charge bred ions prior to installation in ATLAS.

Clayton Dickerson; Brahim Mustapha; Alexander Pikin; Sergey Kondrashev; Peter Ostroumov; Anthony Levand; Rick Fischer

2013-02-15T23:59:59.000Z

251

The HypHI project: Hypernuclear spectroscopy with stable heavy ion beams and rare isotope beams at GSI and FAIR  

E-Print Network (OSTI)

The HypHI collaboration aims to perform a precise hypernuclear spectroscopy with stable heavy ion beams and rare isotope beams at GSI and fAIR in order to study hypernuclei at extreme isospin, especially neutron rich hypernuclei to look insight hyperon-nucleon interactions in the neutron rich medium, and hypernuclear magnetic moments to investigate baryon properties in the nuclei. We are currently preparing for the first experiment with $^6$Li and $^{12}$C beams at 2 AGeV to demonstrate the feasibility of a precise hypernuclear spectroscopy by identifying $^{3}_{\\Lambda}$H, $^{4}_{\\Lambda}$H and $^{5}_{\\Lambda}$He. The first physics experiment on these hypernuclei is planned for 2009. In the present document, an overview of the HypHI project and the details of this first experiment will be discussed.

S. Bianchin; P. Achenbach; S. Ajimura; O. Borodina; T. Fukuda; J. Hoffmann; M. Kavatsyuk; K. Koch; T. Koike; N. Kurz; F. Maas; S. Minami; Y. Mizoi; T. Nagae; D. Nakajima; A. Okamura; W. Ott; B. Özel; J. Pochodzalla; C. Rappold; T. R. Saito; A. Sakaguchi; M. Sako; M. Sekimoto; H. Sugimura; T. Takahashi; H. Tamura; K. Tanida; W. Trautmann

2008-12-22T23:59:59.000Z

252

Site-controlled fabrication of Ga nanodroplets by focused ion beam  

SciTech Connect

Ga droplets are created by focused ion beam irradiation of GaAs surface. We report that ordered Ga droplets can be formed on the GaAs surface without any implantation damage. The droplets are characterized with bigger sizes than those droplets formed on damaged area. These aligned Ga droplets are formed via the migration of Ga atoms from ion irradiation area to the edge of undamaged GaAs surface and further nucleation into droplets. The morphological evolution and size distribution of these nanodroplets are investigated systematically with different beam irradiation time and incident angles. Based on this method, well positioned Ga nanodroplets, such as chains, are achieved by using focus ion beam patterning. The controllable assembly of droplets on undamaged semiconductor surface can be used to fabricate templates, to fabricate quantum structures and quantum devices by droplet epitaxy technique.

Xu, Xingliang; Wang, Zhiming M., E-mail: zhmwang@gmail.com [State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, Sichuan 610054 (China); Engineering Research Center for Semiconductor Integrated Technology, Institute of Semiconductors, Chinese Academy of Science, Beijing 100083 (China); Wu, Jiang; Li, Handong; Zhou, Zhihua [State Key Laboratory of Electronic Thin Film and Integrated Devices, University of Electronic Science and Technology of China, Chengdu, Sichuan 610054 (China); Wang, Xiaodong [Engineering Research Center for Semiconductor Integrated Technology, Institute of Semiconductors, Chinese Academy of Science, Beijing 100083 (China)

2014-03-31T23:59:59.000Z

253

Investigation of the effect of low energy ion beam irradiation on mono-layer graphene  

SciTech Connect

In this paper, the effect of low energy irradiation on mono-layer graphene was studied. Mono-layer graphene films were irradiated with B, N and F ions at different energy and fluence. X-ray photoelectron spectroscopy indicates that foreign ions implanted at ion energies below 35 eV could dope into the graphene lattice and form new chemical bonds with carbon atoms. The results of Raman measurement indicate that ion beam irradiation causes defects and disorder to the graphene crystal structure, and the level of defects increases with increasing of ion energy and fluence. Surface morphology images also prove that ion beam irradiation creates damages to graphene film. The experiment results suggest that low-energy irradiation with energies of about 30 eV and fluences up to 5·10{sup 14} cm{sup ?2} could realize small amount of doping, while introducing weak damage to graphene. Low energy ion beam irradiation, provides a promising approach for controlled doping of graphene.

Xu, Yijun [College of Physics science and technology, Soochow University, Suzhou215006 (China) [College of Physics science and technology, Soochow University, Suzhou215006 (China); II. Physikalisches Institut, Universität Göttingen, Friedrich- Hund- Platz 1, 37077 Göttingen (Germany); State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China); Zhang, Kun; Brüsewitz, Christoph; Hofsäss, Hans Christian [II. Physikalisches Institut, Universität Göttingen, Friedrich- Hund- Platz 1, 37077 Göttingen (Germany)] [II. Physikalisches Institut, Universität Göttingen, Friedrich- Hund- Platz 1, 37077 Göttingen (Germany); Wu, Xuemei [College of Physics science and technology, Soochow University, Suzhou215006 (China) [College of Physics science and technology, Soochow University, Suzhou215006 (China); State Key Laboratory of Functional Materials for Informatics, Shanghai Institute of Microsystem and Information Technology, Chinese Academy of Sciences, 865 Changning Road, Shanghai 200050 (China)

2013-07-15T23:59:59.000Z

254

Effect of space charge on the energy spectrum of a multispecies ion beam  

SciTech Connect

The parameters of a multispecies metal ion beam extracted with the help of a set of grids from a plasma jet of a pulsed vacuum arc are studied experimentally. It is shown that the beam contains ions with energies that are both significantly lower and higher than the expected energy E{sub Z} = Z-bar eU{sub acc}, where Z-bar is the average ion charge number and U{sub acc} is the extracting voltage. As a result, the mean ion energy is lower than E{sub Z} and the ion energy spectrum is substantially wider than that in the plasma jet. It is found that this effect weakens with decreasing discharge current amplitude and that the shape of the spectrum depends on the accelerating voltage. Probe measurements show that, at accelerating voltages higher than 1 kV, a positive space charge forms in the drift gap, due to which the electric potential in the drift gap increases to a few hundred electronvolts. Analysis of experimental data indicates that the observed features of the ion spectrum can be attributed to the effect of the unsteady electric field of the space charge of the ion beam transported through the drift gap.

Paperny, V. L.; Chernykh, A. A. [Irkutsk State University (Russian Federation); Shklyaev, V. A. [Russian Academy of Sciences, Institute of High-Current Electronics, Siberian Branch (Russian Federation)

2009-02-15T23:59:59.000Z

255

Coronal ion-cyclotron beam instabilities within the multi-fluid description  

E-Print Network (OSTI)

Spectroscopic observations and theoretical models suggest resonant wave-particle interactions, involving high-frequency ion-cyclotron waves, as the principal mechanism for heating and accelerating ions in the open coronal holes. However, the mechanism responsible for the generation of the ion-cyclotron waves remains unclear. One possible scenario is that ion beams originating from small-scale reconnection events can drive micro-instabilities that constitute a possible source for the excitation of ion-cyclotron waves. In order to study ion beam-driven electromagnetic instabilities, the multi-fluid model in the low-beta coronal plasma is used. While neglecting the electron inertia this model allows one to take into account ion-cyclotron wave effects that are absent from the one-fluid MHD model. Realistic models of density and temperature as well as a 2-D analytical magnetic field model are used to define the background plasma in the open-field funnel region of a polar coronal hole. Considering the WKB approximation, a Fourier plane-wave linear mode analysis is employed in order to derive the dispersion relation. Ray-tracing theory is used to compute the ray path of the unstable wave as well as the evolution of the growth rate of the wave while propagating in the coronal funnel. We demonstrate that, in typical coronal holes conditions and assuming realistic values of the beam velocity, the free energy provided by the ion beam propagating parallel the ambient field can drive micro-instabilities through resonant ion-cyclotron excitation.

R. Mecheri; E. Marsch

2007-06-06T23:59:59.000Z

256

Ion-beam-induced bending of freestanding amorphous nanowires: The importance of the substrate material and charging  

SciTech Connect

Ion-beam irradiation offers great flexibility and controllability in the construction of freestanding nanostructures with multiple advanced functionalities. Here, we present and discuss the bending of free-standing nanowires, against, towards, and ultimately parallel to a flux of directional ion irradiation. Bending components both along and perpendicular to the incident ion beam were observed, and the bending behavior was found to depend both on the ion beam scanning strategy and on the conductivity of the supporting substrate. This behavior is explained by an ion-irradiation-related electrostatic interaction. Our findings suggest the prospect of exploiting this technique to engineer 3D nanostructures for advanced applications.

Cui, Ajuan; Li, Wuxia; Liu, Zhe; Luo, Qiang; Gu, Changzhi [Beijing National Laboratory of Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China)] [Beijing National Laboratory of Condensed Matter Physics, Institute of Physics, Chinese Academy of Sciences, Beijing 100190 (China); Fenton, J. C. [London Centre for Nanotechnology, University College London, London WC1E 7JE (United Kingdom)] [London Centre for Nanotechnology, University College London, London WC1E 7JE (United Kingdom); Shen, Tiehan H. [Joule Physics Laboratory, University of Salford, Manchester M5 4WT (United Kingdom)] [Joule Physics Laboratory, University of Salford, Manchester M5 4WT (United Kingdom)

2013-05-27T23:59:59.000Z

257

Beam pinging, sweeping, shaking, and electron/ion collecting, at the Proton Storage Ring  

SciTech Connect

We have built, installed and tested a pinger for use as a general diagnostic at the Los Alamos Proton Storage Ring (PSR). Two 4-m-long parallel-plate electrodes with a plate spacing of 10.2 cm provide kicks of up to 1.1 mrad. A pair of solid-state pulsers may be operated in a single-pulse mode for beam pinging (tune measurements) or in a burst mode at up to 700 kHz pulse rates for beam sweeping. During our 1992 operating period we used the pinger for beam sweeping, for beam shaking, for measuring the tune shift, and we have used it as an ion chamber. Using the pinger as an ion chamber during production conditions has yielded some surprising results.

Hardek, T.W.; Macek, R.J.; Plum, M.A.; Wang, T.S.F.

1993-06-01T23:59:59.000Z

258

Beam pinging, sweeping, shaking, and electron/ion collecting, at the Proton Storage Ring  

SciTech Connect

We have built, installed and tested a pinger for use as a general diagnostic at the Los Alamos Proton Storage Ring (PSR). Two 4-m-long parallel-plate electrodes with a plate spacing of 10.2 cm provide kicks of up to 1.1 mrad. A pair of solid-state pulsers may be operated in a single-pulse mode for beam pinging (tune measurements) or in a burst mode at up to 700 kHz pulse rates for beam sweeping. During our 1992 operating period we used the pinger for beam sweeping, for beam shaking, for measuring the tune shift, and we have used it as an ion chamber. Using the pinger as an ion chamber during production conditions has yielded some surprising results.

Hardek, T.W.; Macek, R.J.; Plum, M.A.; Wang, T.S.F.

1993-01-01T23:59:59.000Z

259

The effect of boundaries on the ion acoustic beam-plasma instability in experiment and simulation  

SciTech Connect

The ion acoustic beam-plasma instability is known to excite strong solitary waves near the Earth's bow shock. Using a double plasma experiment, tightly coupled with a 1-dimensional particle-in-cell simulation, the results presented here show that this instability is critically sensitive to the experimental conditions. Boundary effects, which do not have any counterpart in space or in most simulations, unavoidably excite parasitic instabilities. Potential fluctuations from these instabilities lead to an increase of the beam temperature which reduces the growth rate such that non-linear effects leading to solitary waves are less likely to be observed. Furthermore, the increased temperature modifies the range of beam velocities for which an ion acoustic beam plasma instability is observed.

Rapson, Christopher, E-mail: chris.rapson@ipp.mpg.de [Max Planck Institute for Plasma Physics, Boltzmannstr. 2, D-85748 Garching (Germany)] [Max Planck Institute for Plasma Physics, Boltzmannstr. 2, D-85748 Garching (Germany); Grulke, Olaf [Max Planck Institute for Plasma Physics, Wendelsteinstr. 1, 17491 Greifswald (Germany)] [Max Planck Institute for Plasma Physics, Wendelsteinstr. 1, 17491 Greifswald (Germany); Matyash, Konstantin [Institut für Physik, Ernst-Moritz-Arndt Universität, Domstr. 10a, 17489 Greifswald (Germany)] [Institut für Physik, Ernst-Moritz-Arndt Universität, Domstr. 10a, 17489 Greifswald (Germany); Klinger, Thomas [Max Planck Institute for Plasma Physics, Wendelsteinstr. 1, 17491 Greifswald (Germany) [Max Planck Institute for Plasma Physics, Wendelsteinstr. 1, 17491 Greifswald (Germany); Institut für Physik, Ernst-Moritz-Arndt Universität, Domstr. 10a, 17489 Greifswald (Germany)

2014-05-15T23:59:59.000Z

260

Parametric coupling of lower hybrid wave with gyrating ion beam driven ion cyclotron instability in a plasma  

SciTech Connect

A lower hybrid wave, launched into a tokamak for supplementary heating in the presence of neutral beam turned gyrating ion beam, is seen to excite some prominent channels of parametric decay. The beam driven deuterium cyclotron mode is further destabilized by the lower hybrid pump through the nonlinear 4-wave coupling, involving higher and lower frequency lower hybrid sidebands, when ?{sub 0}/k{sub 0z}v{sub 0z}=(1??{sub LH}{sup 2}/?{sub 0}{sup 2}) , where ?{sub LH} is the lower hybrid frequency, ?{sub 0} and k{sub 0z} are the frequency and parallel wave number of the pump wave, and v{sub 0z} is the velocity of ion beam parallel to the magnetic field. The growth rate increases with parallel wave number of the ion-cyclotron mode. The pump is also susceptible to parametric upconversion into an upper sideband shifted by the frequency of the negative energy deuterium cyclotron mode. For typical parameters, the growth rate of this channel is around one fiftieth of deuterium cyclotron frequency and falls off with the transverse wave number of the mode.

Singh, Rohtash; Tripathi, V. K. [Physics Department, Indian Institute of Technology Delhi, New Delhi 110016 (India)] [Physics Department, Indian Institute of Technology Delhi, New Delhi 110016 (India)

2013-07-15T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Development of a plasma generator for a long pulse ion source for neutral beam injectors  

SciTech Connect

A plasma generator for a long pulse H{sup +}/D{sup +} ion source has been developed. The plasma generator was designed to produce 65 A H{sup +}/D{sup +} beams at an energy of 120 keV from an ion extraction area of 12 cm in width and 45 cm in length. Configuration of the plasma generator is a multi-cusp bucket type with SmCo permanent magnets. Dimension of a plasma chamber is 25 cm in width, 59 cm in length, and 32.5 cm in depth. The plasma generator was designed and fabricated at Japan Atomic Energy Agency. Source plasma generation and beam extraction tests for hydrogen coupling with an accelerator of the KSTAR ion source have been performed at the KSTAR neutral beam test stand under the agreement of Japan-Korea collaborative experiment. Spatial uniformity of the source plasma at the extraction region was measured using Langmuir probes and {+-}7% of the deviation from an averaged ion saturation current density was obtained. A long pulse test of the plasma generation up to 200 s with an arc discharge power of 70 kW has been successfully demonstrated. The arc discharge power satisfies the requirement of the beam production for the KSTAR NBI. A 70 keV, 41 A, 5 s hydrogen ion beam has been extracted with a high arc efficiency of 0.9 -1.1 A/kW at a beam extraction experiment. A deuteron yield of 77% was measured even at a low beam current density of 73 mA/cm{sup 2}.

Watanabe, K.; Dairaku, M.; Tobari, H.; Kashiwagi, M.; Inoue, T.; Hanada, M. [Japan Atomic Energy Agency, 801-1 Mukouyama, Naka, Ibaraki-ken 311-0193 (Japan); Jeong, S. H.; Chang, D. H.; Kim, T. S.; Kim, B. R.; Seo, C. S.; Jin, J. T.; Lee, K. W.; In, S. R.; Oh, B. H. [Korea Atomic Energy Research Institute, 1045 Daedeokdaero, Daejeon 305-353 (Korea, Republic of); Kim, J. [ProScience, San Diego, California 92025 (United States); Bae, Y. S. [National Fusion Research Institute, 113 Gwahangno, Daejeon 305-333 (Korea, Republic of)

2011-06-15T23:59:59.000Z

262

The Heavy Ion Fusion Science Virtual National Laboratory  

E-Print Network (OSTI)

-filled ATA Blumlein voltage sources oil-filled ATA transmission lines custom long- pulse voltage sources #12 on the beam axis at the midplane of the 8 T Final Focusing Solenoid (FFS). A 3 kV pulse drives 800 A peak solenoid and target chamber (existing) neutralized drift compression line with plasma sources water

Gilson, Erik

263

Photo-neutralization of Negative Ion Beam for Future Fusion Reactor  

SciTech Connect

An exploratory study of negative ion beam photo-neutralization for future fusion reactors is explained. A refolded Fabry-Perot cavity system is proposed, with which a 60% neutralisation efficiency could be reached with low electric power consumption. The system would make use of sophisticated optical-cavity locking systems, which have been developed recently for gravitational-wave optical detection. The ITER Neutral beam Injector is taken as an example.

Chaibi, W.; Simonin, A. [CEA, IRFM, F-13108 St Paul lez Durance (France); Blondel, C.; Cabaret, L.; Delsart, C.; Drag, C. [Laboratoire Aime Cotton, CNRS-Universite Paris XI, Bat 505 Campus d'Orsay 91405 Orsay (France)

2009-03-12T23:59:59.000Z

264

Ion source and beam guiding studies for an API neutron generator  

SciTech Connect

Recently developed neutron imaging methods require high neutron yields for fast imaging times and small beam widths for good imaging resolution. For ion sources with low current density to be viable for these types of imaging methods, large extraction apertures and beam focusing must be used. We present recent work on the optimization of a Penning-type ion source for neutron generator applications. Two multi-cusp magnet configurations have been tested and are shown to increase the extracted ion current density over operation without multi-cusp magnetic fields. The use of multi-cusp magnetic confinement and gold electrode surfaces have resulted in increased ion current density, up to 2.2 mA/cm{sup 2}. Passive beam focusing using tapered dielectric capillaries has been explored due to its potential for beam compression without the cost and complexity issues associated with active focusing elements. Initial results from first experiments indicate the possibility of beam compression. Further work is required to evaluate the viability of such focusing methods for associated particle imaging (API) systems.

Sy, A. [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 USA and Department of Nuclear Engineering, University of California, Berkeley, Berkeley, CA 94720 (United States); Ji, Q.; Persaud, A.; Ludewigt, B. A.; Schenkel, T. [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States)

2013-04-19T23:59:59.000Z

265

X-Ray Entangled Photon Production in Collisions of Laser Beams with Relativistic Ions  

E-Print Network (OSTI)

A method is suggested to produce, with the help of colliding laser photons with bunches of relativistic ions having two energy levels, both intense beams of monochromatic polarized X-ray fluorescence photons and significant number of X-ray entangled photons, via double Doppler transformation. Nonlinear susceptibility of the ions, the cross section and the rate of production of such photons at RHIC are estimated. Such beams of X-ray photons can be detected and applied to solve various problems, in a manner similar to the usage of optical photons.

K. A. Ispirian; M. K. Ispiryan

2010-04-02T23:59:59.000Z

266

Ion beams extraction and measurements of plasma parameters on a multi-frequencies microwaves large bore ECRIS with permanent magnets  

SciTech Connect

We have developed an all-permanent magnet large bore electron cyclotron resonance ion source (ECRIS) for broad ion beam processing. The cylindrically comb-shaped magnetic field configuration is adopted for efficient plasma production and good magnetic confinement. To compensate for disadvantages of fixed magnetic configuration, a traveling wave tube amplifier (TWTA) is used. In the comb-shaped ECRIS, it is difficult to achieve controlling ion beam profiles in the whole inside the chamber by using even single frequency-controllable TWTA (11-13GHz), because of large bore size with all-magnets. We have tried controlling profiles of plasma parameters and then those of extracted ion beams by launching two largely different frequencies simultaneously, i.e., multi-frequencies microwaves. Here we report ion beam profiles and corresponding plasma parameters under various experimental conditions, dependence of ion beams against extraction voltages, and influence of different electrode positions on the electron density profile.

Nozaki, Dai; Kiriyama, Ryutaro; Takenaka, Tomoya; Kurisu, Yosuke; Yano, Keisuke; Sato, Fuminobu; Kato, Yushi; Iida, Toshiyuki [Division of Electrical, Electronic and Information Engineering, Graduate School of Engineering, Osaka Univ., 2-1 Yamadaoka, Suita-shi, Osaka, 565-0871 (Japan)

2012-11-06T23:59:59.000Z

267

Parametic Study of the current limit within a single driver-scaletransport beam line of an induction Linac for Heavy Ion Fusion  

SciTech Connect

The High Current Experiment (HCX) at Lawrence Berkeley National Laboratory is part of the US program that explores heavy-ion beam as the driver option for fusion energy production in an Inertial Fusion Energy (IFE) plant. The HCX is a beam transport experiment at a scale representative of the low-energy end of an induction linear accelerator driver. The primary mission of this experiment is to investigate aperture fill factors acceptable for the transport of space-charge-dominated heavy-ion beams at high intensity (line charge density {approx}0.2 {micro}C/m) over long pulse durations (4 {micro}s) in alternating gradient focusing lattices of electrostatic or magnetic quadrupoles. This experiment is testing transport issues resulting from nonlinear space-charge effects and collective modes, beam centroid alignment and steering, envelope matching, image charges and focusing field nonlinearities, halo and, electron and gas cloud effects. We present the results for a coasting 1 MeV K{sup +} ion beam transported through ten electrostatic quadrupoles. The measurements cover two different fill factor studies (60% and 80% of the clear aperture radius) for which the transverse phase-space of the beam was characterized in detail, along with beam energy measurements and the first halo measurements. Electrostatic quadrupole transport at high beam fill factor ({approx}80%) is achieved with acceptable emittance growth and beam loss. We achieved good envelope control, and re-matching may only be needed every ten lattice periods (at 80% fill factor) in a longer lattice of similar design. We also show that understanding and controlling the time dependence of the envelope parameters is critical to achieving high fill factors, notably because of the injector and matching section dynamics.

Prost, Lionel Robert

2007-02-14T23:59:59.000Z

268

A diagnosis of intense ion beam by CR-39 detectors analyzing the back scattered particles  

SciTech Connect

A new diagnosis method has been developed utilizing back scattered particles for high energy intense ion beams. The CR-39 detector mounted on the uniform back-scatterer was irradiated with {sup 4}He{sup 2+} ions with an energy 25 MeV/n, which is never recorded as etchable track in CR-39. We found that it is possible to diagnose by analyzing the etch pits on the rear surface of CR-39 that directly contacted on the back-scatterers. It turns out that most of etch pits in the rear surface are made by the backscattered particles by investigating the growth pattern of each etch pit with multi-step etching technique. This method allows simple diagnosis of the ion beam profile and intensity distribution in mixed radiation field such as laser-driven ion acceleration experiments.

Kanasaki, Masato; Yamauchi, Tomoya; Fukuda, Yuji; Sakaki, Hironao; Hori, Toshihiko; Tampo, Motonobu; Kurashima, Satoshi; Kamiya, Tomihiro; Oda, Keiji; Kondo, Kiminori [Graduate School of Maritime Sciences, Kobe University, Kobe 658-0022, Japan and Japan Atomic Energy Agency, Kizugawa, Kyoto 619-0215 (Japan); Graduate School of Maritime Sciences, Kobe University, Kobe 658-0022 (Japan); Japan Atomic Energy Agency, Kizugawa, Kyoto 619-0215 (Japan); Japan Atomic Energy Agency, Takasaki, Gunma 370-1292 (Japan); Graduate School of Maritime Sciences, Kobe University, Kobe 658-0022 (Japan); Japan Atomic Energy Agency, Kizugawa, Kyoto 619-0215 (Japan)

2012-07-11T23:59:59.000Z

269

Model for nonlinear evolution of localized ion ring beam in magnetoplasma  

SciTech Connect

An electrostatic hybrid model, which investigates the nonlinear evolution of a localized ion ring beam in a magnetoplasma, is described and applied to the generation and evolution of turbulence in the very low frequency (VLF) ({Omega}{sub ci}<{omega}<{Omega}{sub ce}) range, where {Omega}{sub ci(e)} is the ion (electron) gyro frequency. Electrons are treated as a fluid and the ions with the particle-in-cell method. Although the model is electrostatic, it includes the effects of energy loss by convection of electromagnetic VLF waves out of the instability region by utilizing a phenomenological model for effective collisions with the fluid electrons. In comparison with a more conventional electrostatic hybrid model, the new model shows much more efficient extraction of energy from the ion ring beam and reduced background plasma heating over a range of parameters.

Scales, W. A. [Bradley Department of Electrical and Computer Engineering, Virginia Tech, Blacksburg, Virginia 24061-0111 (United States); Ganguli, G.; Mithaiwala, M. [Plasma Physics Division, Naval Research Laboratory, Washington D.C. 20375 (United States); Rudakov, L. [Icarus Research, Inc., P.O. Box 30780, Bethesda, Maryland 20824-0780 (United States)

2012-06-15T23:59:59.000Z

270

Ion beam divergence from unstable fluctuations in applied-[ital B] diodes  

SciTech Connect

An electron plasma oscillation driven unstable by ion streaming is identified with the low-frequency mode observed in QUICKSILVER [[ital Computational] [ital Physics], edited by A. Tenner (World Scientific, Singapore, 1991), pp. 475--482] numerical simulations. This mode heats the electrons along the magnetic field and is ultimately stabilized by the thermal spread. A quasilinear theory determines the saturation level of the fluctuations, the ion divergence, and the ion energy and momentum spread as they exit the diode. The ion divergence is predicted to be independent of the ion mass for fixed diode voltage and scales as the product of the effective gap and the ion beam enhancement factor over Child--Langmuir current.

Sudan, R.N.; Longcope, D.W. (Laboratory of Plasma Studies, Cornell University, Ithaca, New York 14853 (United States))

1993-05-01T23:59:59.000Z

271

Proceedings of the workshop on prospects for research with radioactive beams from heavy ion accelerators  

SciTech Connect

The SuperHILAC Users Executive Committee organized a workshop on Prospects for Research with Radioactive Beams from Heavy Ion Accelerators. The main purpose of the workshop was to bring together a diverse group of scientists who had already done experients with radioactive beams or were interested in their use in the future. The topics of the talks ranged from general nuclear physics, astrophysics, production of radioactive beams and high energy projectile fragmentation to biomedical applications. This publication contains the abstracts of the talks given at the workshop and copies of the viewgraphs as they were supplied to the editor.

Nitschke, J.M. (ed.)

1984-04-01T23:59:59.000Z

272

Development of ion source with a washer gun for pulsed neutral beam injection  

SciTech Connect

A new type of economical neutral beam source has been developed by using a single washer gun, pulsed operation, and a simple electrode system. We replaced the conventional hot filaments for arc-discharge-type plasma formation with a single stainless-steel washer gun, eliminating the entire dc power supply for the filaments and the cooling system for the electrodes. Our initial experiments revealed successful beam extraction up to 10 kV and 8.6 A, based on spatial profile measurements of density and temperature in the plasma source. The system also shows the potential to control the beam profile by controlling the plasma parameters in the ion accumulation chamber.

Asai, T.; Yamaguchi, N.; Kajiya, H.; Takahashi, T. [College of Science and Technology, Nihon University, Tokyo 101-8308 (Japan); Imanaka, H.; Takase, Y.; Ono, Y. [Graduate School of Frontier Sciences, University of Tokyo, Tokyo 113-8656 (Japan); Sato, K. N. [Research Institute for Applied Mechanics, Kyushu University, Fukuoka 816-8580 (Japan)

2008-06-15T23:59:59.000Z

273

Ion Beam Radiation Effects in Monazite , X. Deschanels2  

E-Print Network (OSTI)

for conditioning minor actinides arising from spent fuel reprocessing. The matrix behavior under irradiation must.27PO4. Irradiation by gold ions results in major changes in the material properties. At a damage level (swelling) in the materials as a result of cumulative irradiation damage arising from alpha decay

Boyer, Edmond

274

Monochromatic short pulse laser produced ion beam using a compact passive magnetic device  

SciTech Connect

High-intensity laser accelerated protons and ions are emerging sources with complementary characteristics to those of conventional sources, namely high charge, high current, and short bunch duration, and therefore can be useful for dedicated applications. However, these beams exhibit a broadband energy spectrum when, for some experiments, monoenergetic beams are required. We present here an adaptation of conventional chicane devices in a compact form (10 cm × 20 cm) which enables selection of a specific energy interval from the broadband spectrum. This is achieved by employing magnetic fields to bend the trajectory of the laser produced proton beam through two slits in order to select the minimum and maximum beam energy. The device enables a production of a high current, short duration source with a reproducible output spectrum from short pulse laser produced charged particle beams.

Chen, S. N.; Gauthier, M.; Higginson, D. P.; Dorard, S.; Marquès, J.-R.; Fuchs, J. [LULI, École Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau (France)] [LULI, École Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau (France); Mangia, F.; Atzeni, S. [Dipartimento SBAI, Università di Roma “La Sapienza,” Roma (Italy)] [Dipartimento SBAI, Università di Roma “La Sapienza,” Roma (Italy); Riquier, R. [LULI, École Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau (France) [LULI, École Polytechnique, CNRS, CEA, UPMC, 91128 Palaiseau (France); CEA, DAM, DIF, F-91297 Arpajon (France)

2014-04-15T23:59:59.000Z

275

Production of low axial energy spread ion beams with multicusp sources  

SciTech Connect

Multicusp ion sources are capable of producing ions with low axial energy spread which are necessary in applications such as: ion projection lithography (IPL) and focused ion beams for the next generation lithographic tools and nuclear science experiments such as radioactive ion beam production. The axial ion energy spread for multicusp source is approximately 6 eV which is too large for IPL and radioactive ion beam applications. The addition of a magnetic filter which consists of a pair of permanent magnets to the multicusp source reduces the energy spread considerably. The reduction is due to the improvement in the uniformity of the axial plasma potential distribution in the discharge region. Axial ion energy spread of the filament driven ion source has been measured using three different techniques. In all cases, it was found to be less than 2 eV. Energy spread of the radio frequency (RF) driven source has also been explored, and it was found to be less than 3 eV with the proper RF-shielding. A new multicusp source configuration has been designed and constructed to further reduce the energy spread. To achieve a more uniform axial plasma potential distribution, a cylindrical magnetic filter has been designed and constructed for a 2-cm-diameter source. This new source configuration, the co-axial source, is new in its kind. The energy spread in this source has been measured to be a record low of 0.6 eV. Because of the novelty of this device, some plasma parameters inside the source have been studied. Langmuir probe has been used to measure the plasma potential, the electron temperature and the density distribution.

Lee, Y.H.Y. [Univ. of California, Berkeley, CA (United States)

1998-05-01T23:59:59.000Z

276

Excited-Level Lifetimes and Hyperfine-Structure Measurements on Ions using Collinear Laser Ion-Beam Spectroscopy  

E-Print Network (OSTI)

The mean lifetimes tau of the Ca II 4p P-2(1/2) and 4p P-2(3/2) levels, and the Cl-35 II 4p' F-1(3) level, have been measured by a variant of the collinear laser-ion-beam lifetime technique applied previously to the Ar II 4p' F-2(7/2)o level [Jian...

Jin, J.; Church, David A.

1994-01-01T23:59:59.000Z

277

Tailoring surface topographies of polymers by using ion beam: Recent advances and the potential applications in biomedical and tissue engineering  

Science Journals Connector (OSTI)

Ion beam technique has recently been actively employed to create various patterns on the surface of polymers. In this paper, we highlight some of the recent advances in tailoring surface topographies of polymers by using ion beam and present a brief discussion on the potential applications in biomedical and tissue engineering.

Terumitsu Hasebe; So Nagashima; Yukihiro Yoshimoto; Atsushi Hotta; Tetsuya Suzuki

2012-01-01T23:59:59.000Z

278

2D electron density profile measurement in tokamak by laser-accelerated ion-beam probe  

SciTech Connect

A new concept of Heavy Ion Beam Probe (HIBP) diagnostic has been proposed, of which the key is to replace the electrostatic accelerator of traditional HIBP by a laser-driven ion accelerator. Due to the large energy spread of ions, the laser-accelerated HIBP can measure the two-dimensional (2D) electron density profile of tokamak plasma. In a preliminary simulation, a 2D density profile was reconstructed with a spatial resolution of about 2 cm, and with the error below 15% in the core region. Diagnostics of 2D density fluctuation is also discussed.

Chen, Y. H.; Yang, X. Y.; Lin, C., E-mail: linchen0812@pku.edu.cn, E-mail: cjxiao@pku.edu.cn; Wang, X. G.; Xiao, C. J., E-mail: linchen0812@pku.edu.cn, E-mail: cjxiao@pku.edu.cn [State Key Lab of Nuclear Physics and Technology, School of Physics, Peking University, Beijing 100871 (China); Wang, L. [Institute of Physics, Chinese Academy of Sciences, P. O. Box 603, Beijing 100190 (China); Xu, M. [Center for Fusion Science of Southwestern Institute of Physics, P. O. Box 432, Chengdu 610041 (China)

2014-11-15T23:59:59.000Z

279

Method for forming metallic silicide films on silicon substrates by ion beam deposition  

SciTech Connect

This patent describes metallic silicide films formed on silicon substrates by contacting the substrates with a low-energy ion beam of metal ions while moderately heating the substrate. The heating of the substrate provides for the diffusion of silicon atoms through the film as it is being formed to the surface of the film for interaction with the metal ions as they contact the diffused silicon. The metallic silicide films provided by the invention are contaminant free, of uniform stoichiometry, large grain size, and exhibit low resistivity values which are of particular usefulness for integrated circuit production.

Zuhr, R.A.; Holland, O.W.

1990-03-13T23:59:59.000Z

280

Method for forming metallic silicide films on silicon substrates by ion beam deposition  

DOE Patents (OSTI)

Metallic silicide films are formed on silicon substrates by contacting the substrates with a low-energy ion beam of metal ions while moderately heating the substrate. The heating of the substrate provides for the diffusion of silicon atoms through the film as it is being formed to the surface of the film for interaction with the metal ions as they contact the diffused silicon. The metallic silicide films provided by the present invention are contaminant free, of uniform stoichiometry, large grain size, and exhibit low resistivity values which are of particular usefulness for integrated circuit production.

Zuhr, Raymond A. (Oak Ridge, TN); Holland, Orin W. (Oak Ridge, TN)

1990-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Method for forming metallic silicide films on silicon substrates by ion beam deposition  

SciTech Connect

Metallic silicide films are formed on silicon substrates by contacting the substrates with a low-energy ion beam of metal ions while moderately heating the substrate. The heating of the substrate provides for the diffusion of silicon atoms through the film as it is being formed to the surface of the film for interaction with the metal ions as they contact the diffused silicon. The metallic silicide films provided by the present invention are contaminant free, of uniform stoichiometry, large grain size, and exhibit low resistivity values which are of particular usefulness for integrated circuit production.

Zuhr, R.A.; Holland, O.W.

1989-01-24T23:59:59.000Z

282

Ion-beam-induced damage formation in CdTe  

SciTech Connect

Damage formation in <111>- and <112>-oriented CdTe single crystals irradiated at room temperature and 15 K with 270 keV Ar or 730 keV Sb ions was investigated in situ using Rutherford backscattering spectroscopy (RBS) in channeling configuration. Defect profiles were calculated from the RBS spectra using the computer code DICADA and additional energy-dependent RBS measurements were performed to identify the type of defects. At both temperatures no formation of a buried amorphous layer was detected even after prolonged irradiation with several 10{sup 16} ions/cm{sup 2}. The fact that CdTe is not rendered amorphous even at 15 K suggests that the high resistance to amorphization is caused by the high ionicity of CdTe rather than thermal effects. The calculated defect profiles show the formation of a broad defect distribution that extends much deeper into the crystal than the projected range of the implanted ions at both temperatures. The post-range defects in CdTe thus do not seem to be of thermal origin either, but are instead believed to result from migration driven by the electronic energy loss.

Rischau, C. W.; Schnohr, C. S.; Wendler, E.; Wesch, W. [Institut fuer Festkoerperphysik, Friedrich-Schiller-Universitaet Jena, Max-Wien-Platz 1, D-07743 Jena (Germany)

2011-06-01T23:59:59.000Z

283

Focused ion beam specimen preparation for electron holography of electrically biased thin film solar cells  

E-Print Network (OSTI)

, biased TEM specimen, thin film solar cell, FIB Thin films of hydrogenated Si (Si:H) can be used as active for electron holography of a thin film solar cell using conventional lift-out specimen preparation and a homeFocused ion beam specimen preparation for electron holography of electrically biased thin film

Dunin-Borkowski, Rafal E.

284

Microdosimetric Approach to NIRS-defined Biological Dose Measurement for Carbon-ion Treatment Beam  

Science Journals Connector (OSTI)

......value into the lineal energy, yi. The Ny value was...function of the linear energy transfer (LET) of mono-energetic...with an initial kinetic energy of 290 MeV/u with a...pulse by defocusing car- bon-ions with electric...low-intensity beam. So, an alternative parallel-plate ionization......

Yuki Kase; Tatsuaki Kanai; Makoto Sakama; Yuji Tameshige; Takeshi Himukai; Hiroyuki Nose; Naruhiro Matsufuji

2011-01-01T23:59:59.000Z

285

Short communication Ion beam-mixed Ge electrodes for high capacity Li rechargeable batteries  

E-Print Network (OSTI)

Short communication Ion beam-mixed Ge electrodes for high capacity Li rechargeable batteries N a Department of Materials Science and Engineering, University of Florida, 100 Rhines Hall, PO Box 116400, Gainesville, FL 32611-6400, USA b Department of Electronic Materials Engineering, Research School of Physics

Volinsky, Alex A.

286

Sculpting on polymers using focused ion beam M.-W. Moon a  

E-Print Network (OSTI)

Sculpting on polymers using focused ion beam M.-W. Moon a , E.-K. Her b , K.H. Oh b , K.-R. Lee and Engineering, Seoul National University, San 56-1 Shillim, Kwanak, Seoul, 151-744, Republic of Korea c Department of Mechanical and Industrial Engineering, Northeastern University, Boston, MA 02115, USA A B S T R

Vaziri, Ashkan

287

Controlled formation of nanoscale wrinkling patterns on polymers using focused ion beam  

E-Print Network (OSTI)

Controlled formation of nanoscale wrinkling patterns on polymers using focused ion beam Myoung of Engineering and Applied Sciences, Harvard University, 29 Oxford Street, Cambridge, MA 02138, USA b Department of Materials Science and Engineering, Seoul National University, San 56-1 Shillim, Kwanak, Seoul 151

Hutchinson, John W.

288

Transport in JET H-mode Plasmas with Beam and Ion Cyclotron Heating  

SciTech Connect

Ion Cyclotron (IC) Range of Frequency waves and neutral beam (NB) injection are planned for heating in ITER and other future tokamaks. It is important to understand transport in plasmas with NB and IC to plan, predict, and improve transport and confinement. Transport predictions require simulations of the heating profiles, and for this, accurate modeling of the IC and NB heating is needed.

R.V. Budny, et. al.

2012-07-13T23:59:59.000Z

289

Coronal ion-cyclotron beam instabilities within the multi-fluid description  

E-Print Network (OSTI)

Spectroscopic observations and theoretical models suggest resonant wave-particle interactions, involving high-frequency ion-cyclotron waves, as the principal mechanism for heating and accelerating ions in the open coronal holes. However, the mechanism responsible for the generation of the ion-cyclotron waves remains unclear. One possible scenario is that ion beams originating from small-scale reconnection events can drive micro-instabilities that constitute a possible source for the excitation of ion-cyclotron waves. In order to study ion beam-driven electromagnetic instabilities, the multi-fluid model in the low-beta coronal plasma is used. While neglecting the electron inertia this model allows one to take into account ion-cyclotron wave effects that are absent from the one-fluid MHD model. Realistic models of density and temperature as well as a 2-D analytical magnetic field model are used to define the background plasma in the open-field funnel region of a polar coronal hole. Considering the WKB approxima...

Mecheri, R

2007-01-01T23:59:59.000Z

290

z-pinch plasma lens focusing of a heavy-ion beam  

Science Journals Connector (OSTI)

For the first time a heavy-ion beam was focused using a z-pinch plasma lens. The diameter of an incident, parallel, 460-MeV argon-ion beam was reduced from ?8 mm (FWHM) to ?2 mm within 230 mm downstream of the plasma. Inside a cylindrically symmetric plasma column a high-gradient, azimuthal magnetic field is produced during a z-pinch discharge. For axially moving, high-energy charged particles this field configuration provides strong, first-order focusing simultaneously in both transversal planes. The measured spot size agrees with numerical calculations taking into account the finite beam emittance, and charge exchange as well as energy-loss processes contributing to aberrations.

E. Boggasch; J. Jacoby; H. Wahl; K.-G. Dietrich; D. H. H. Hoffmann; W. Laux; M. Elfers; C. R. Haas; V. P. Dubenkov; A. A. Golubev

1991-04-01T23:59:59.000Z

291

Heavy-ion beams for single-event research at Brookhaven - present and future  

SciTech Connect

Since low energy nuclear physics research was discontinued at Brookhaven and replaced by a relativistic heavy ion program, large blocks of time became available at the Tandem Van de Graaff Facility for technological applications and for research in other areas. The main technological application has been the single event upset (SEU) testing of microelectronic devices and this activity has been steadily increasing over the last few years. The ion beam requirements for this type of work are discussed and a description is given of methods used for satisfying these requirements at the Brookhaven facility. Available ion species, energies, ranges, LETs and beam intensities, purity and uniformity are discussed. Characteristics are summarized of a sophisticated and extremely user friendly test chamber and associated hardware and software installed at Brookhaven by a coalition of government agencies and made available for general use. The possibility is mentioned of extending SEU testing to higher energies by using heavy ion beams from a Booster synchrotron now under construction and from the existing large Alternating Gradient Synchrotron (AGS). Finally a brief discussion is given of compatibility with other programs and of future availability of low and high energy heavy ions for SEU testing at Brookhaven. 13 refs., 3 figs.

Thieberger, P.; Zajic, V. (Brookhaven National Lab., Upton, NY (USA)); Stassinopoulos, E.G. (National Aeronautics and Space Administration, Greenbelt, MD (USA). Goddard Space Flight Center); Van Gunten, O. (Maryland Univ., College Park, MD (USA). Lab. for Physical Sciences)

1990-01-01T23:59:59.000Z

292

Particle simulation of collision dynamics for ion beam injection into a rarefied gas  

SciTech Connect

This study details a comparison of ion beam simulations with experimental data from a simplified plasma test cell in order to study and validate numerical models and environments representative of electric propulsion devices and their plumes. The simulations employ a combination of the direct simulation Monte Carlo and particle-in-cell methods representing xenon ions and atoms as macroparticles. An anisotropic collision model is implemented for momentum exchange and charge exchange interactions between atoms and ions in order to validate the post-collision scattering behaviors of dominant collision mechanisms. Cases are simulated in which the environment is either collisionless or non-electrostatic in order to prove that the collision models are the dominant source of low- and high-angle particle scattering and current collection within this environment. Additionally, isotropic cases are run in order to show the importance of anisotropy in these collision models. An analysis of beam divergence leads to better characterization of the ion beam, a parameter that requires careful analysis. Finally, suggestions based on numerical results are made to help guide the experimental design in order to better characterize the ion environment.

Giuliano, Paul N.; Boyd, Iain D. [Department of Aerospace Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States)

2013-03-15T23:59:59.000Z

293

Simulation and optimization of a 10 A electron gun with electrostatic compression for the electron beam ion source  

SciTech Connect

Increasing the current density of the electron beam in the ion trap of the Electron Beam Ion Source (EBIS) in BNL's Relativistic Heavy Ion Collider facility would confer several essential benefits. They include increasing the ions' charge states, and therefore, the ions' energy out of the Booster for NASA applications, reducing the influx of residual ions in the ion trap, lowering the average power load on the electron collector, and possibly also reducing the emittance of the extracted ion beam. Here, we discuss our findings from a computer simulation of an electron gun with electrostatic compression for electron current up to 10 A that can deliver a high-current-density electron beam for EBIS. The magnetic field in the cathode-anode gap is formed with a magnetic shield surrounding the gun electrodes and the residual magnetic field on the cathode is (5 Division-Sign 6) Gs. It was demonstrated that for optimized gun geometry within the electron beam current range of (0.5 Division-Sign 10) A the amplitude of radial beam oscillations can be maintained close to 4% of the beam radius by adjusting the injection magnetic field generated by a separate magnetic coil. Simulating the performance of the gun by varying geometrical parameters indicated that the original gun model is close to optimum and the requirements to the precision of positioning the gun elements can be easily met with conventional technology.

Pikin, A.; Beebe, E. N.; Raparia, D. [Brookhaven National Laboratory, Upton, New York 11973 (United States)

2013-03-15T23:59:59.000Z

294

Resolution Improvement and Pattern Generator Development for theMaskless Micro-Ion-Beam Reduction Lithography System  

SciTech Connect

The shrinking of IC devices has followed the Moore's Law for over three decades, which states that the density of transistors on integrated circuits will double about every two years. This great achievement is obtained via continuous advance in lithography technology. With the adoption of complicated resolution enhancement technologies, such as the phase shifting mask (PSM), the optical proximity correction (OPC), optical lithography with wavelength of 193 nm has enabled 45 nm printing by immersion method. However, this achievement comes together with the skyrocketing cost of masks, which makes the production of low volume application-specific IC (ASIC) impractical. In order to provide an economical lithography approach for low to medium volume advanced IC fabrication, a maskless ion beam lithography method, called Maskless Micro-ion-beam Reduction Lithography (MMRL), has been developed in the Lawrence Berkeley National Laboratory. The development of the prototype MMRL system has been described by Dr. Vinh Van Ngo in his Ph.D. thesis. But the resolution realized on the prototype MMRL system was far from the design expectation. In order to improve the resolution of the MMRL system, the ion optical system has been investigated. By integrating a field-free limiting aperture into the optical column, reducing the electromagnetic interference and cleaning the RF plasma, the resolution has been improved to around 50 nm. Computational analysis indicates that the MMRL system can be operated with an exposure field size of 0.25 mm and a beam half angle of 1.0 mrad on the wafer plane. Ion-ion interactions have been studied with a two-particle physics model. The results are in excellent agreement with those published by the other research groups. The charge-interaction analysis of MMRL shows that the ion-ion interactions must be reduced in order to obtain a throughput higher than 10 wafers per hour on 300-mm wafers. In addition, two different maskless lithography strategies have been studied. The dependence of the throughput with the exposure field size and the speed of the mechanical stage has been investigated. In order to perform maskless lithography, different micro-fabricated pattern generators have been developed for the MMRL system. Ion beamlet switching has been successfully demonstrated on the MMRL system. A positive bias voltage around 10 volts is sufficient to switch off the ion current on the micro-fabricated pattern generators. Some unexpected problems, such as the high-energy secondary electron radiations, have been discovered during the experimental investigation. Thermal and structural analysis indicates that the aperture displacement error induced by thermal expansion can satisfy the 3{delta} CD requirement for lithography nodes down to 25 nm. The cross-talking effect near the surface and inside the apertures of the pattern generator has been simulated in a 3-D ray-tracing code. New pattern generator design has been proposed to reduce the cross-talking effect. In order to eliminate the surface charging effect caused by the secondary electrons, a new beam-switching scheme in which the switching electrodes are immersed in the plasma has been demonstrated on a mechanically fabricated pattern generator.

Jiang, Ximan

2006-05-18T23:59:59.000Z

295

Radioactive ion beam transportation for the fundamental symmetry study with laser-trapped atomsa)  

Science Journals Connector (OSTI)

The search for the violation of the fundamental symmetry in a radioactive atom is the promising candidate for precision tests of the standard model and its possible extensions. The subtle signal arising from the symmetry violation is enhanced in heavy atoms such as a francium (Fr). To realize high precision measurements a large amount of radioactive isotopes is required. The Fr is produced via a nuclear fusion reaction using a melted gold target with a 18O primary beam at Cyclotron and Radioisotope Center Tohoku University. The maximum extraction efficiency of the Fr ion was achieved at approximately 35%. The beam line consists of an electrostatic deflector three electrostatic quadrupole triplets to the measurement area at 10 m away from the reaction point and several beam diagnosis systems. We optimized parameters of the beam line.

H. Kawamura; K. Hatanaka; K. Imai

2014-01-01T23:59:59.000Z

296

Clinical output factors for carbon-ion beams passing through polyethylene  

E-Print Network (OSTI)

Purpose: A recent study suggested that polyethylene (PE) range compensators would cause extra carbon-ion attenuation by 0.45%/cm due to limitations in water equivalence. The present study aims to assess its influence on tumor dose in carbon-ion radiotherapy. Methods: Carbon-ion radiation was modeled to be composed of primary carbon ions and secondary particles. For these components, tumor dose fraction and relative biological effectiveness (RBE) were estimated at a reference depth in the middle of spread-out Bragg peak. The PE effect was estimated for clinical carbon-ion beams and was partially tested by experiment. The two-component model was integrated into a treatment-planning system, with which the PE effect on tumor dose was investigated in two clinical cases. Results: The fluence and clinical attenuation coefficients for dose decrease per polyethylene thickness were estimated to be 0.1%-0.3%/cm and 0.2%-0.4%/cm, depending on energy and modulation of clinical carbon-ion beams. In the treatment-planning s...

Kanematsu, Nobuyuki; Ogata, Risa; Himukai, Takeshi

2013-01-01T23:59:59.000Z

297

High-Power Negative Ion Sources for Neutral Beam Injectors in Large Helical Device  

SciTech Connect

Large-scaled hydrogen negative-ion sources, in which cesium is introduced in the source plasma, have been developed for neutral beam injectors in Large Helical Device, and their operational characteristics are reviewed. For high-efficient negative ion production, configuration of the magnetic filter field and the cusp magnetic field was optimized, resulting in a high arc efficiency for the negative ion production of 0.23A/kW. With use of a multi-slotted grounded grid, the gas pressure in the acceleration gap is lowered, leading to reduction of the heat load of the grounded grid. As a result, the voltage holding ability is much improved, and the rated energy of 180 keV is achieved in a short conditioning period of 4 days. The injection power is increased linearly to the 5/2 power of the beam energy and reached 5.7MW with an energy of 184keV, which exceeds the specified value of 180keV-5MW. Beam uniformity has been improved with an individual control of the local arc discharge by adjusting 12-divided output voltages of the arc and filament power supplies. The injection duration has been extended to 120sec with a reduced power. Spectroscopic measurement has been carried out for the source plasma. The cesium-ion line is observed in the plasma volume, and, however, the negative ion production is not influenced by the cesium ions in the plasma because the negative ions should be produced on the cesium-covered plasma grid surface.

Takeiri, Y.; Kaneko, O.; Tsumori, K.; Ikeda, K.; Nagaoka, K.; Osakabe, M.; Oka, Y.; Asano, E.; Kondo, T.; Sato, M.; Shibuya, M.; Komada, S. [National Institute for Fusion Science, Toki 509-5292 (Japan); Fantz, U. [Max-Planck-Institut fuer Plasmaphysik, Boltzmannstr. 2, Garching (Germany)

2007-08-10T23:59:59.000Z

298

Contribution of ion beam analysis methods to the development of 2nd generation high temperature superconducting (HTS) wires  

SciTech Connect

One of the crucial steps in the second generation high temperature superconducting wire program was development of the buffer layer architecture. The architecture designed at the Superconductivity Technology Center at Los Alamos National Laboratory consists of several oxide layers wherein each layer plays a specific role, namely: nucleation layer, diffusion barrier, biaxially textured template, and an intermediate layer with a good match to the lattice parameter of superconducting Y{sub 1}Ba{sub 2}Cu{sub 3}O{sub 7} (YBCO) compound. This report demonstrates how a wide range of ion beam analysis techniques (SIMS, RBS, channeling, PIXE, PIGE, NRA, ERD) was employed for analysis of each buffer layer and the YBCO films. These results assisted in understanding of a variety of physical processes occurring during the buffet layer fabrication and helped to optimize the buffer layer architecture as a whole.

Usov, Igor O [Los Alamos National Laboratory; Arendt, Paul N [Los Alamos National Laboratory; Stan, Liliana [Los Alamos National Laboratory; Holesinger, Terry G [Los Alamos National Laboratory; Foltyn, Steven R [Los Alamos National Laboratory; Depaula, Raymond F [Los Alamos National Laboratory

2009-01-01T23:59:59.000Z

299

Charge steering of laser plasma accelerated fast ions in a liquid spray — creation of MeV negative ion and neutral atom beams  

SciTech Connect

The scenario of “electron capture and loss” has been recently proposed for the formation of negative ion and neutral atom beams with up to MeV kinetic energy [S. Ter-Avetisyan, et al., Appl. Phys. Lett. 99, 051501 (2011)]. Validation of these processes and of their generic nature is here provided in experiments where the ion source and the interaction medium have been spatially separated. Fast positive ions accelerated from a laser plasma source are sent through a cold spray where their charge is changed. Such formed neutral atom or negative ion has nearly the same momentum as the original positive ion. Experiments are released for protons, carbon, and oxygen ions and corresponding beams of negative ions and neutral atoms have been obtained. The electron capture and loss phenomenon is confirmed to be the origin of the negative ion and neutral atom beams. The equilibrium ratios of different charge components and cross sections have been measured. Our method is general and allows the creation of beams of neutral atoms and negative ions for different species which inherit the characteristics of the positive ion source.

Schnürer, M.; Abicht, F.; Priebe, G.; Braenzel, J. [Max Born Institute for Nonlinear Optics and Short Pulse Spectroscopy, 12489 Berlin (Germany)] [Max Born Institute for Nonlinear Optics and Short Pulse Spectroscopy, 12489 Berlin (Germany); Prasad, R. [Institute for Laser and Plasma Physics, Heinrich Heine University, Duesseldorf 40225 (Germany)] [Institute for Laser and Plasma Physics, Heinrich Heine University, Duesseldorf 40225 (Germany); Borghesi, M. [School of Mathematics and Physics, The Queen's University of Belfast, Belfast BT7 1NN (United Kingdom) [School of Mathematics and Physics, The Queen's University of Belfast, Belfast BT7 1NN (United Kingdom); ELI–Beamlines, Institute of Physics, Czech Academy of Science, 18221 Prague (Czech Republic); Andreev, A. [Max Born Institute for Nonlinear Optics and Short Pulse Spectroscopy, 12489 Berlin (Germany) [Max Born Institute for Nonlinear Optics and Short Pulse Spectroscopy, 12489 Berlin (Germany); Vavilov State Optical Institute, 119034 St. Petersburg (Russian Federation); Nickles, P. V. [WCU Department of Nanobio Materials and Electronics, Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of)] [WCU Department of Nanobio Materials and Electronics, Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of); Jequier, S.; Tikhonchuk, V. [Centre Lasers Intenses et Applications, University of Bordeaux, CEA, CNRS, 33405 Talence (France)] [Centre Lasers Intenses et Applications, University of Bordeaux, CEA, CNRS, 33405 Talence (France); Ter-Avetisyan, S. [ELI–Beamlines, Institute of Physics, Czech Academy of Science, 18221 Prague (Czech Republic)] [ELI–Beamlines, Institute of Physics, Czech Academy of Science, 18221 Prague (Czech Republic)

2013-11-15T23:59:59.000Z

300

Atomic physics with relativistic ion beams, using the Brookhaven 200 MeV linac and 1. 5 GeV Booster Synchrotron  

SciTech Connect

A survey of atomic physics experiments with relativistic ion beams at the Brookhaven Neutral Beam Test Facility is presented and special techniques using 150 m flight paths and precision particle and laser beam optics are described. 5 refs.

Wimmersperg, U. von; Jones, K.W.; McKenzie-Wilson, R.B.; Ward, T.E.; Snead, C.L. Jr.

1990-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto

2007-09-01T23:59:59.000Z

302

Electrostatic ion-acoustic-like instabilities in the solar wind with a backstreaming alpha particle beam  

SciTech Connect

Nonlinear electrostatic instabilities have been shown to occur frequently and under very different conditions in plasma with two ion beams such as the fast solar wind. These instabilities can be triggered when the phase velocity of electrostatic ion-acoustic waves propagating forward and backward relative to the interplanetary magnetic field overlaps due to the presence of a finite amplitude of circularly polarized wave. The instabilities can be triggered by waves supported by the same ion component, or by waves supported by different ion components. By assuming a beam of alpha particles moving backward relative to the external magnetic field, as observed in some events in the fast solar wind, it is shown that a very small negative drift velocity of the alpha particle beam relative to the core plasma--a few percent of the local Alfven velocity--can trigger a very rich variety of nonlinear electrostatic acousticlike instabilities. Their growth rates can be rather large and they persist for larger negative alpha particles drift velocities and temperatures.

Gomberoff, L. [Departamento de Fisica, Facultad de Ciencias, Universidad de Chile, Santiago (Chile); Gomberoff, K. [Department of Physics, Technion, Haifa 32000 (Israel); Deutsch, A. [Rafael, P.O. Box 2250, Haifa 31021 (Israel)

2010-06-15T23:59:59.000Z

303

Deposition of biaxially textured yttria-stabilized zirconia by ion-beam-assisted deposition.  

SciTech Connect

Biaxially textured yttria (8 mol %)-stabilized zirconia (YSZ) thin films were deposited on randomly oriented Hastelloy C and Stainless Steel 304 at room temperature as a buffer layer for subsequent deposition of oriented YBa{sub 2}Cu{sub 3}O{sub x} films. The 0.16-1.3 {micro}m thick YSZ films were deposited by e-beam evaporation at rates of 1.2-3.2 {angstrom}/sec. Biaxially textured films were produced with an Ar/O{sub 2} ion beam directed at the substrate during film growth. X-ray diffraction was used to study in-plane and out-of-plane orientation as a function of ion-bombardment angle, film thickness, ion-to-atom flux ratio, and substrate material. In-plane and out-of-plane average-misorientation angles on these YSZ films that were deposited by ion-beam-assisted deposition were as low as 17 and 5.4{degree}, respectively, on as-received substrates.

Chudzik, M. P.

1998-09-17T23:59:59.000Z

304

The Heavy Ion Fusion Science Virtual National Laboratory Heavy Ion Fusion*  

E-Print Network (OSTI)

under the auspices of the U.S. Department of Energy by the Lawrence Berkeley and Lawrence Livermore Lawrence Berkeley National Laboratory, Lawrence Livermore National Laboratory, and Princeton Plasma Physics for dynamic vacuum/e-cloud accelerator R&D @ 5 Hz; 4. Defer down-selections on HIF target options until NIF

305

The production of dense lead-ion beams for the CERN LHC  

E-Print Network (OSTI)

To reach the design luminosity for lead-ions in the LHC, the present Low Energy Antiproton Ring (LEAR) has to be converted into a Low Energy Ion Ring (LEIR). Since the present ECR lead-ion source does not provide sufficient intensity, the main goal of LEIR is to act as a low-energy (4.2MeV/u) accumulator where the ion beam is stacked and cooled (with the help of an electron-cooler) to reach the required intensity and emittances. An experimental program has been carried out at LEAR in recent years in order to test the cooling and stacking process with the present electron-cooler. A variety of results have been reported at previous conferences. This paper will focus on the electron cooling aspects resulting from the afore mentioned experiments. Taking into account the experience

Bosser, Jacques; Chanel, M; MacCaferri, R; Molinari, G; Maury, S; Möhl, D; Tranquille, G

2000-01-01T23:59:59.000Z

306

Z-petawatt driven ion beam radiography development.  

SciTech Connect

Laser-driven proton radiography provides electromagnetic field mapping with high spatiotemporal resolution, and has been applied to many laser-driven High Energy Density Physics (HEDP) experiments. Our report addresses key questions about the feasibility of ion radiography at the Z-Accelerator (%E2%80%9CZ%E2%80%9D), concerning laser configuration, hardware, and radiation background. Charged particle tracking revealed that radiography at Z requires GeV scale protons, which is out of reach for existing and near-future laser systems. However, it might be possible to perform proton deflectometry to detect magnetic flux compression in the fringe field region of a magnetized liner inertial fusion experiment. Experiments with the Z-Petawatt laser to enhance proton yield and energy showed an unexpected scaling with target thickness. Full-scale, 3D radiation-hydrodynamics simulations, coupled to fully explicit and kinetic 2D particle-in-cell simulations running for over 10 ps, explain the scaling by a complex interplay of laser prepulse, preplasma, and ps-scale temporal rising edge of the laser.

Schollmeier, Marius; Geissel, Matthias; Rambo, Patrick K.; Schwarz, Jens; Sefkow, Adam B.

2013-09-01T23:59:59.000Z

307

Ion-beam and electron-beam irradiation of synthetic britholite S. Utsunomiya a  

E-Print Network (OSTI)

on previously amorphized britholite (N56) with an electron flux of 1.07 · 1025 e� /m2 /s. The ionizing radiation resulted in recrystallization at the absorbed dose of 6.2 · 1013 Gy. This result suggests that the ionizingV Kr2þ and 1.5 MeV Xeþ over the temperature range of 50­973 K. The process of ion irradiation

Utsunomiya, Satoshi

308

Metal etching with reactive gas cluster ion beams using pickup cell  

SciTech Connect

Mixed gas cluster ion beams were formed using pickup cell for metal etching. O{sub 2} neutral clusters pick up acetic acid and formed mixed cluster beam. By using O{sub 2}-GCIB with acetic acid, enhancement of Cu etching was observed. Because of dense energy deposition by GCIB, etching of Cu proceeds by CuO formation, enhancement of chemical reaction with acetic acid and desorption of etching products. Surface roughening was not observed on poly crystalline Cu because of the small dependence of etching rate on crystal orientation. Halogen free and low-temperature metal etching with GCIB using pickup cell is possible.

Toyoda, Noriaki; Yamada, Isao [Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeij, Hyogo, 671-2280 (Japan)

2012-11-06T23:59:59.000Z

309

.Jet Propul.ion Laboratory 1978 Annual Report Flight Projects 5  

E-Print Network (OSTI)

Office of Energy and Technology Applications is spearheaded by the Solar Energy Program. The U.Jet Propul.ion Laboratory 1978 Annual Report #12;Contents Flight Projects 5 Technology and Space Program Development 15 1- Tracking and Data Acquisition 20 Energy & Technology Applications 23 Other

Waliser, Duane E.

310

Monte Carlo calculations for reference dosimetry of electron beams with the PTW Roos and NE2571 ion chambers  

SciTech Connect

Purpose: To investigate recommendations for reference dosimetry of electron beams and gradient effects for the NE2571 chamber and to provide beam quality conversion factors using Monte Carlo simulations of the PTW Roos and NE2571 ion chambers. Methods: The EGSnrc code system is used to calculate the absorbed dose-to-water and the dose to the gas in fully modeled ion chambers as a function of depth in water. Electron beams are modeled using realistic accelerator simulations as well as beams modeled as collimated point sources from realistic electron beam spectra or monoenergetic electrons. Beam quality conversion factors are calculated with ratios of the doses to water and to the air in the ion chamber in electron beams and a cobalt-60 reference field. The overall ion chamber correction factor is studied using calculations of water-to-air stopping power ratios. Results: The use of an effective point of measurement shift of 1.55 mm from the front face of the PTW Roos chamber, which places the point of measurement inside the chamber cavity, minimizes the difference betweenR{sub 50}, the beam quality specifier, calculated from chamber simulations compared to that obtained using depth-dose calculations in water. A similar shift minimizes the variation of the overall ion chamber correction factor with depth to the practical range and reduces the root-mean-square deviation of a fit to calculated beam quality conversion factors at the reference depth as a function of R{sub 50}. Similarly, an upstream shift of 0.34 r{sub cav} allows a more accurate determination of R{sub 50} from NE2571 chamber calculations and reduces the variation of the overall ion chamber correction factor with depth. The determination of the gradient correction using a shift of 0.22 r{sub cav} optimizes the root-mean-square deviation of a fit to calculated beam quality conversion factors if all beams investigated are considered. However, if only clinical beams are considered, a good fit to results for beam quality conversion factors is obtained without explicitly correcting for gradient effects. The inadequacy of R{sub 50} to uniquely specify beam quality for the accurate selection of k{sub Q} factors is discussed. Systematic uncertainties in beam quality conversion factors are analyzed for the NE2571 chamber and amount to between 0.4% and 1.2% depending on assumptions used. Conclusions: The calculated beam quality conversion factors for the PTW Roos chamber obtained here are in good agreement with literature data. These results characterize the use of an NE2571 ion chamber for reference dosimetry of electron beams even in low-energy beams.

Muir, B. R., E-mail: bmuir@physics.carleton.ca; Rogers, D. W. O., E-mail: drogers@physics.carleton.ca [Physics Department, Carleton Laboratory for Radiotherapy Physics, Carleton University, 1125 Colonel By Drive, Ottawa, Ontario K1S 5B6 (Canada)] [Physics Department, Carleton Laboratory for Radiotherapy Physics, Carleton University, 1125 Colonel By Drive, Ottawa, Ontario K1S 5B6 (Canada)

2013-12-15T23:59:59.000Z

311

The development of the radio frequency driven negative ion source for neutral beam injectors (invited)  

SciTech Connect

Large and powerful negative hydrogen ion sources are required for the neutral beam injection (NBI) systems of future fusion devices. Simplicity and maintenance-free operation favors RF sources, which are developed intensively at the Max-Planck-Institut fuer Plasmaphysik (IPP) since many years. The negative hydrogen ions are generated by caesium-enhanced surface conversion of atoms and positive ions on the plasma grid surface. With a small scale prototype the required high ion current density and the low fraction of co-extracted electrons at low pressure as well as stable pulses up to 1 h could be demonstrated. The modular design allows extension to large source dimensions. This has led to the decision to choose RF sources for the NBI of the international fusion reactor, ITER. As an intermediate step towards the full size ITER source at IPP, the development will be continued with a half-size source on the new ELISE testbed. This will enable to gain experience for the first time with negative hydrogen ion beams from RF sources of these dimensions.

Kraus, W.; Fantz, U.; Franzen, P.; Froeschle, M.; Heinemann, B.; Riedl, R.; Wuenderlich, D. [Max-Planck-Institut fuer Plasmaphysik, EURATOM Association, 85748 Garching (Germany)

2012-02-15T23:59:59.000Z

312

Plasma focus ion beam fluence and flux—Scaling with stored energy  

Science Journals Connector (OSTI)

Measurements on plasma focusion beams include various advanced techniques producing a variety of data which has yet to produce benchmark numbers [A Bernard et al. J. Mosc. Phys. Soc. 8 93-170 (1998)]. This present paper uses the Lee Model code [S Lee http://www.plasmafocus.net (2012)] integrated with experimental measurements to provide the basis for reference numbers and the scaling of deuteron beams versus stored energy E0. The ion number fluence (ions m?2) and energy fluence (J m?2) computed as 2.4?7.8?×?1020 and 2.2?33?×?106 respectively are found to be independent of E0 from 0.4 to 486?kJ. Typical inductance machines (33–55 nH) produce 1.2?2?×?1015 ions per kJ carrying 1.3%–4% E0 at mean ion energy 50–205?keV dropping to 0.6?×?1015 ions per kJ carrying 0.7% E0 for the high inductance INTI PF.

S. Lee; S. H. Saw

2012-01-01T23:59:59.000Z

313

Radiobiologic Significance of Response of Intratumor Quiescent Cells In Vivo to Accelerated Carbon Ion Beams Compared With {gamma}-Rays and Reactor Neutron Beams  

SciTech Connect

Purpose: To clarify the radiosensitivity of intratumor quiescent cells in vivo to accelerated carbon ion beams and reactor neutron beams. Methods and Materials: Squamous cell carcinoma VII tumor-bearing mice were continuously given 5-bromo-2'-deoxyuridine to label all intratumor proliferating cells. Next, they received accelerated carbon ion or {gamma}-ray high-dose-rate (HDR) or reduced-dose-rate (RDR) irradiation. Other tumor-bearing mice received reactor thermal or epithermal neutrons with RDR irradiation. Immediately after HDR and RDR irradiation or 12 h after HDR irradiation, the response of quiescent cells was assessed in terms of the micronucleus frequency using immunofluorescence staining for 5-bromo-2'-deoxyuridine. The response of the total (proliferating plus quiescent) tumor cells was determined from the 5-bromo-2'-deoxyuridine nontreated tumors. Results: The difference in radiosensitivity between the total and quiescent cell populations after {gamma}-ray irradiation was markedly reduced with reactor neutron beams or accelerated carbon ion beams, especially with a greater linear energy transfer (LET) value. Clearer repair in quiescent cells than in total cells through delayed assay or a decrease in the dose rate with {gamma}-ray irradiation was efficiently inhibited with carbon ion beams, especially with a greater LET. With RDR irradiation, the radiosensitivity to accelerated carbon ion beams with a greater LET was almost similar to that to reactor thermal and epithermal neutron beams. Conclusion: In terms of tumor cell-killing effect as a whole, including quiescent cells, accelerated carbon ion beams, especially with greater LET values, are very useful for suppressing the dependency on the heterogeneity within solid tumors, as well as depositing the radiation dose precisely.

Masunaga, Shin-ichiro [Particle Radiation Oncology Research Center, Research Reactor Institute, Kyoto University, Kumatori, Osaka (Japan)], E-mail: smasuna@rri.kyoto-u.ac.jp; Ando, Koichi; Uzawa, Akiko; Hirayama, Ryoichi; Furusawa, Yoshiya; Koike, Sachiko [Heavy-Ion Radiobiology Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba (Japan); Sakurai, Yoshinori [Department of Physics, Faculty of Medicine, Sapporo Medical University, Sapporo (Japan); Nagata, Kenji; Suzuki, Minoru; Kashino, Genro [Particle Radiation Oncology Research Center, Research Reactor Institute, Kyoto University, Kumatori, Osaka (Japan); Kinashi, Yuko [Department of Radiation Safety and Control, Research Reactor Institute, Kyoto University, Kumatori, Osaka (Japan); Tanaka, Hiroki; Maruhashi, Akira [Department of Radiation Medical Physics, Research Reactor Institute, Kyoto University, Kumatori, Osaka (Japan); Ono, Koji [Particle Radiation Oncology Research Center, Research Reactor Institute, Kyoto University, Kumatori, Osaka (Japan)

2008-01-01T23:59:59.000Z

314

Novel EBSD preparation method for Cu/Sn microbumps using a focused ion beam  

SciTech Connect

We proposed a novel technique developed from focused ion beam (FIB) polishing for sample preparation of electron backscatter diffraction (EBSD) measurement. A low-angle incident gallium ion beam with a high acceleration voltage of 30 kV was used to eliminate the surface roughness of cross-sectioned microbumps resulting from mechanical polishing. This work demonstrates the application of the FIB polishing technique to solders for a high-quality sample preparation for EBSD measurement after mechanical polishing. - Highlights: Black-Right-Pointing-Pointer The novel FIB technique of sample preparation is fast, effective and low-cost. Black-Right-Pointing-Pointer It can enhance the process precision to the specific area of the sample. Black-Right-Pointing-Pointer It is convenient for analyzing the metallurgy of the microbump in 3DIC packaging. Black-Right-Pointing-Pointer The EBSD image quality can be enhanced by just using a common FIB instrument.

Liu, Tao-Chi; Chen, Chih [National Chiao Tung University, Department of Materials Science and Engineering, Hsinchu 30010, Taiwan, ROC (China)] [National Chiao Tung University, Department of Materials Science and Engineering, Hsinchu 30010, Taiwan, ROC (China); Chiu, Kuo-Jung [Integrated Service Technology Inc., No. 19, Pu-ding Rd., Hsinchu 30072, Taiwan, ROC (China)] [Integrated Service Technology Inc., No. 19, Pu-ding Rd., Hsinchu 30072, Taiwan, ROC (China); Lin, Han-Wen [National Chiao Tung University, Department of Materials Science and Engineering, Hsinchu 30010, Taiwan, ROC (China)] [National Chiao Tung University, Department of Materials Science and Engineering, Hsinchu 30010, Taiwan, ROC (China); Kuo, Jui-Chao, E-mail: jckuo@mail.ncku.edu.tw [National Cheng Kung University, Department of Materials Science and Engineering, Tainan, Taiwan, ROC (China)] [National Cheng Kung University, Department of Materials Science and Engineering, Tainan, Taiwan, ROC (China)

2012-12-15T23:59:59.000Z

315

Metallization of hydrogen using heavy-ion-beam implosion of multilayered cylindrical targets  

Science Journals Connector (OSTI)

Employing a two-dimensional simulation model, this paper presents a suitable design for an experiment to study metallization of hydrogen in a heavy-ion beam imploded multilayered cylindrical target that contains a layer of frozen hydrogen. Such an experiment will be carried out at the upgraded heavy-ion synchrotron facility (SIS-18) at the Gesellschaft für Schwerionenforschung, Darmstadt by the end of the year 2001. In these calculations we consider a uranium beam that will be available at the upgraded SIS-18. Our calculations show that it may be possible to achieve theoretically predicted physical conditions necessary to create metallic hydrogen in such experiments. These include a density of about 1 g/cm3, a pressure of 3–5 Mbar, and a temperature of a few 0.1 eV.

N. A. Tahir, D. H. H. Hoffmann, A. Kozyreva, A. Tauschwitz, A. Shutov, J. A. Maruhn, P. Spiller, U. Neuner, J. Jacoby, M. Roth, R. Bock, H. Juranek, and R. Redmer

2000-12-19T23:59:59.000Z

316

Nanostructured ion beam-modified Ge films for high capacity Li ion battery N. G. Rudawski, B. L. Darby, B. R. Yates, K. S. Jones, R. G. Elliman et al.  

E-Print Network (OSTI)

Nanostructured ion beam-modified Ge films for high capacity Li ion battery anodes N. G. Rudawski, B718 (2012) Thermal properties of the hybrid graphene-metal nano-micro-composites: Applications://apl.aip.org/authors #12;Nanostructured ion beam-modified Ge films for high capacity Li ion battery anodes N. G. Rudawski,1

Florida, University of

317

Note: Production of a mercury beam with an electron cyclotron resonance ion source  

SciTech Connect

An electron cyclotron resonance ion source has been utilized to produce mercury beams with intensities of 4.5 e?A of {sup 202}Hg{sup 29+} and 3.0 e?A of {sup 202}Hg{sup 31+} from natural abundance mercury metal. The production technique relies on the evaporation of liquid mercury into the source plasma vacuum region and utilizes elemental mercury instead of a volatile organic compound as the neutral feed material.

Vondrasek, R.; Pardo, R.; Scott, R. [Physics Division, Argonne National Laboratory, Lemont, Illinois 60439 (United States)] [Physics Division, Argonne National Laboratory, Lemont, Illinois 60439 (United States)

2013-11-15T23:59:59.000Z

318

Effect of ion beam mixing on wear and friction of Fe?Ti multilayered structure on AISI 304 stainless steel  

Science Journals Connector (OSTI)

Dry sliding properties of ion beam mixed multilayered Fe?Ti structures deposited on AISI 304 stainless steel were studied over the composition range 0–100% Ti using samples with a linearly varying composition of constituents. Our measurements revealed that a ductilesurface was formed with good sliding properties over the wide composition range by ion beammixing of deposited layers. These beneficial effects were not obtained on as?deposited samples or by ion bombardment of either a substrate or pure iron layer deposited on a substrate. Thus it is concluded that both the ion beam processing and composition as well as the resulting microstructure are essential for improved tribology.

J?P. Hirvonen; M. Nastasi; J. W. Mayer

1986-01-01T23:59:59.000Z

319

Arc discharge regulation of a megawatt hot cathode bucket ion source for the experimental advanced superconducting tokamak neutral beam injector  

SciTech Connect

Arc discharge of a hot cathode bucket ion source tends to be unstable what attributes to the filament self-heating and energetic electrons backstreaming from the accelerator. A regulation method, which based on the ion density measurement by a Langmuir probe, is employed for stable arc discharge operation and long pulse ion beam generation. Long pulse arc discharge of 100 s is obtained based on this regulation method of arc power. It establishes a foundation for the long pulse arc discharge of a megawatt ion source, which will be utilized a high power neutral beam injection device.

Xie Yahong; Hu Chundong; Liu Sheng; Jiang Caichao; Li Jun; Liang Lizhen [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Collaboration: NBI Team

2012-01-15T23:59:59.000Z

320

Beta Beams for Neutrino Production Heat Deposition from Decaying Ions in Superconducting Magnets  

E-Print Network (OSTI)

This report describes studies of energy deposition in superconducting magnets from secondary ions in the "beta beam" decay ring as described in the base-line scenario of the EURISOL Beta Beam Design Study. The lattice structure proposed in the Design Study has absorber elements inserted between the superconducting magnets to protect the magnet coils. We describe an efficient and small model made to carry out the study. The specially developed options in the beam code "ACCSIM" to track largely off-momentum particles has permitted to extract the necessary information to interface the transport and interaction code "FLUKA" with the aim to calculate the heat deposition in the magnets and the absorbers. The two beta emitters 18Ne10+ and 6He2+ used for neutrino and anti-neutrino production and their daughter ions have been tracked. The absorber system proposed in the Design Study is efficient to intercept the ions decayed in the arc straight sections as foreseen, however, the continuous decay in the dipoles induce ...

Wildner, Elena; Cerutti, F

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Beta Beams for neutrino production: Heat deposition from decaying ions in superconducting magnets  

E-Print Network (OSTI)

This note describes studies of energy deposition in superconducting magnets from secondary ions in the “beta beam” decay ring as described in the base-line scenario of the EURISOL Beta Beam Design Study. The lattice structure proposed in the Design Study has absorber elements inserted between the superconducting magnets to protect the magnet coils. We describe an efficient and small model made to carry out the study. The specially developed options in the beam code “ACCSIM” to track largely off-momentum particles has permitted to extract the necessary information to interface the transport and interaction code “FLUKA” with the aim to calculate the heat deposition in the magnets and the absorbers. The two beta emitters 18Ne10+ and 6He2+ used for neutrino and anti-neutrino production and their daughter ions have been tracked. The absorber system proposed in the Design Study is efficient to intercept the ions decayed in the arc straight sections as foreseen, however, the continuous decay in the dipol...

Wildner, Elena; Cerutti, Francesco

322

Isobar separation by time-of-flight mass spectrometry for low-energy radioactive ion beam facilities  

Science Journals Connector (OSTI)

A multiple-reflection time-of-flight mass spectrometer (MR-TOF-MS) system for low-energy radioactive ion beam facilities has been developed, which can be used for (i) isobar separation and (ii) direct mass measurements of very short-lived nuclei with half-lives of about 1 ms or longer, and (iii) for identification and diagnosis of the ion beam by mass spectrometry. The system has been designed and simulated, and individual subsystems have been built and characterized experimentally. An injection trap for cooling and bunching of the ion beam has been developed, and cooling times of less than one millisecond have been achieved. The performance of the MR-TOF-MS was characterized using the isobaric doublet of carbon monoxide and nitrogen molecular ions. A mass resolving power of 105 (FWHM) has been obtained even with an uncooled ion population. The separator capabilities of the MR-TOF-MS have been demonstrated by removing either carbon monoxide or nitrogen ions from the beam in a Bradbury-Nielsen Gate after a flight time of 320 ?s. The separation power achieved is thus at least 7000 (FWHM) and increases for longer time-of-flight. An energy buncher stage has been designed that compresses the energy spread of the beam after the separation and facilitates efficient injection of the selected ions into an accumulation trap prior to transfer of the ions to experiments downstream of the MR-TOF-MS.

Wolfgang R. Plaß; Timo Dickel; Ulrich Czok; Hans Geissel; Martin Petrick; Katrin Reinheimer; Christoph Scheidenberger; Mikhail I.Yavor

2008-01-01T23:59:59.000Z

323

Profiles of ion beams and plasma parameters on a multi-frequencies microwaves large bore electron cyclotron resonance ion source with permanent magnets  

SciTech Connect

In order to contribute to various applications of plasma and beams based on an electron cyclotron resonance, a new concept on magnetic field with all magnets on plasma production and confinement has been proposed with enhanced efficiency for broad and dense ion beam. The magnetic field configuration consists of a pair of comb-shaped magnet surrounding plasma chamber cylindrically. Resonance zones corresponding for 2.45 GHz and 11-13 GHz frequencies are positioned at spatially different positions. We launch simultaneously multiplex frequencies microwaves operated individually, try to control profiles of the plasma parameters and the extracted ion beams, and to measure them in detail.

Kato, Yushi; Sakamoto, Naoki; Kiriyama, Ryutaro; Takenaka, Tomoya; Kurisu, Yosuke; Nozaki, Dai; Sato, Fuminobu; Iida, Toshiyuki [Division of Electrical, Electronic and Information Engineering, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita-shi, Osaka 565-0871 (Japan)

2012-02-15T23:59:59.000Z

324

Ion-Beam-Induced Chemical Mixing at a Nanocrystalline CeO2 Si Interface  

SciTech Connect

Thin films of nanocrystalline ceria deposited onto a silicon substrate have been irradiated with 3 MeV Au+ ions to a total dose of 34 displacements per atom to examine the film/substrate interfacial response upon displacement damage. Under irradiation, a band of contrast is observed to form that grows under further irradiation. Scanning and high-resolution transmission electron microscopy imaging and analysis suggest that this band of contrast is a cerium silicate phase with an approximate Ce:Si:O composition ratio of 1:1:3 in an amorphous nature. The slightly nonstoichiometric composition arises due to the loss of mobile oxygen within the cerium silicate phase under the current irradiation condition. This nonequilibrium phase is formed as a direct result of ion-beam-induced chemical mixing caused by ballistic collisions between the incoming ion and the lattice atoms. This may hold promise in ion beam engineering of cerium silicates for microelectronic applications e.g., the fabrication of blue LEDs.

Edmondson, Dr. Philip [University of Oxford; Young, Neil P. [Department of Materials, University of Oxford, Parks Rd, Oxford, OX1 3PH, UK; Parish, Chad M [ORNL; Moll, Sandra [CEA, Saclay, France; Namavar, Fereydoon [University of Nebraska Medical Center; Weber, William J [ORNL; Zhang, Yanwen [ORNL

2013-01-01T23:59:59.000Z

325

Ion-Beam-Induced Chemical Mixing at a Nanocrystalline CeO2–Si Interface  

SciTech Connect

Thin films of nanocrystalline ceria deposited onto a silicon substrate have been irradiated with 3 MeV Au+ ions to a total dose of 34 displacements per atom to examine the film/substrate interfacial response upon displacement damage. Under irradiation, a band of contrast is observed to form that grows under further irradiation. Scanning and high-resolution transmission electron microscopy imaging and analysis suggest that this band of contrast is a cerium silicate phase with an approximate Ce:Si:O composition ratio of 1:1:3 in an amorphous nature. The slightly nonstoichiometric composition arises due to the loss of mobile oxygen within the cerium silicate phase under the current irradiation condition. This nonequilibrium phase is formed as a direct result of ion-beam-induced chemical mixing caused by ballistic collisions between the incoming ion and the lattice atoms. This may hold promise in ion beam engineering of cerium silicates for microelectronic applications e.g., the fabrication of blue LEDs.

Edmondson, P. D.; Young, Niel P.; Parish, Chad M.; Moll, Sandra J.; Namavar, Fereydoon; Weber, William J.; Zhang, Yanwen

2013-02-28T23:59:59.000Z

326

Subcellular Spatial Correlation of Particle Traversal and Biological Response in Clinical Ion Beams  

SciTech Connect

Purpose: To report on the spatial correlation of physical track information (fluorescent nuclear track detectors, FNTDs) and cellular DNA damage response by using a novel hybrid detector (Cell-Fit-HD). Methods and Materials: The FNTDs were coated with a monolayer of human non-small cell lung carcinoma (A549) cells and irradiated with carbon ions (270.55 MeV u{sup ?1}, rising flank of the Bragg peak). Phosphorylated histone variant H2AX accumulating at the irradiation-induced double-strand break site was labeled (RIF). The position and direction of ion tracks in the FNTD were registered with the location of the RIF sequence as an ion track surrogate in the cell layer. Results: All RIF sequences could be related to their corresponding ion tracks, with mean deviations of 1.09 ?m and ?1.72 ?m in position and of 2.38° in slope. The mean perpendicular between ion track and RIF sequence was 1.58 ?m. The mean spacing of neighboring RIFs exhibited a regular rather than random spacing. Conclusions: Cell-Fit-HD allows for unambiguous spatial correlation studies of cell damage with respect to the intracellular ion traversal under therapeutic beam conditions.

Niklas, Martin, E-mail: m.niklas@dkfz.de [Division of Medical Physics in Radiation Oncology, German Cancer Research Center, Heidelberg (Germany); German Cancer Consortium, National Center for Radiation Research in Oncology, Heidelberg Institute of Radiation Oncology, Heidelberg (Germany); Abdollahi, Amir [German Cancer Consortium, National Center for Radiation Research in Oncology, Heidelberg Institute of Radiation Oncology, Heidelberg (Germany); Molecular and Translational Radiation Oncology, Heidelberg Ion-Beam Therapy Center, University of Heidelberg Medical School and National Center for Tumor Diseases, German Cancer Research Center, Heidelberg (Germany); Department of Radiation Oncology and Radiation Therapy, University Hospital Heidelberg, Heidelberg (Germany); Heidelberg Ion-Beam Therapy Center, Heidelberg (Germany); Akselrod, Mark S. [Stillwater Crystal Growth Division, Landauer Inc, Stillwater, Oklahoma (United States); Debus, Jürgen [German Cancer Consortium, National Center for Radiation Research in Oncology, Heidelberg Institute of Radiation Oncology, Heidelberg (Germany); Molecular and Translational Radiation Oncology, Heidelberg Ion-Beam Therapy Center, University of Heidelberg Medical School and National Center for Tumor Diseases, German Cancer Research Center, Heidelberg (Germany); Department of Radiation Oncology and Radiation Therapy, University Hospital Heidelberg, Heidelberg (Germany); Heidelberg Ion-Beam Therapy Center, Heidelberg (Germany); Jäkel, Oliver [Division of Medical Physics in Radiation Oncology, German Cancer Research Center, Heidelberg (Germany); German Cancer Consortium, National Center for Radiation Research in Oncology, Heidelberg Institute of Radiation Oncology, Heidelberg (Germany); Department of Radiation Oncology and Radiation Therapy, University Hospital Heidelberg, Heidelberg (Germany); Heidelberg Ion-Beam Therapy Center, Heidelberg (Germany); and others

2013-12-01T23:59:59.000Z

327

Mechanisms for covalent immobilization of horseradish peroxi-dase on ion beam treated polyethylene  

E-Print Network (OSTI)

The mechanism that provides the observed strong binding of biomolecules to polymer sur-faces modified by ion beams is investigated. The surface of polyethylene (PE) was modified by plasma immersion ion implantation with nitrogen ions. Structure changes including car-bonization and oxidation were observed in the modified surface layer of PE by Raman spec-troscopy, FTIR ATR spectroscopy, atomic force microscopy, surface energy measurement and XPS spectroscopy. An observed high surface energy of the modified polyethylene was attributed to the presence of free radicals on the surface. The surface energy decay with stor-age time after PIII treatment was explained by a decay of the free radical concentration while the concentration of oxygen-containing groups increased with storage time. Horseradish per-oxidase was covalently attached onto the modified PE surface. The enzymatic activity of co-valently attached protein remained high. A mechanism based on the covalent attachment by the reaction of protein with free r...

Kondyurin, Alexey V; Tilley, Jennifer M R; Nosworthy, Neil J; Bilek, Marcela M M; McKenzie, David R

2011-01-01T23:59:59.000Z

328

Molecular Beam Epitaxy on Gas Cluster Ion Beam Prepared GaSb Substrates: Towards Improved Surfaces and Interfaces  

SciTech Connect

A key problem in producing mid-infrared optoelectronic and low-power electronic devices in the GaSb material system is the lack of substrates with appropriate surfaces for epitaxial growth. Chemical mechanical polishing (CMP) of GaSb results in surface damage accompanied by tenacious oxides that do not easily desorb. To overcome this, we have developed a process using gas cluster ion beams (GCIB) to remove surface damage and produce engineered surface oxides. In this paper, we present surface modification results on GaSb substrates using O2-, CF4/O2-, and HBr-GCIB processes. X-ray photoelectron spectroscopy of GCIB produced surface layers showed the presence of mixed Ga- and Sb-oxides, with mostly Ga-oxides at the interface, desorbing at temperatures ranging 530°C to 560°C. Cross-sectional transmission electron microscopy of molecular beam epitaxy grown GaSb/AlGaSb layers showed that GCIB surfaces yielded smooth defect free substrate to epi transitions as compared to CMP surfaces. Furthermore, HBr-GCIB surfaces exhibited neither dislocation layers nor discernable interfaces, indicating complete oxide desorbtion prior to epigrowth on a clean single crystal template. Atomic force microscopy of GCIB epilayers exhibited smooth surfaces with characteristic step-terrace formations comprising monatomic steps and wide terraces. The HBr-GCIB process can be easily adapted to a large scale manufacturing process for epi-ready GaSb.

Krishnaswami, Kannan; Shivashankar, Vangala; Dauplaise, Helen; Allen, Lisa; Dallas, Gordon; Bakken, Daniel; Bliss, David; Goodhue, William

2008-04-01T23:59:59.000Z

329

Enhanced Self-Focusing of an Ion Beam Pulse Propagating through a Background Plasma along a Solenoidal Magnetic Field  

E-Print Network (OSTI)

Enhanced Self-Focusing of an Ion Beam Pulse Propagating through a Background Plasma along.58.Lq, 52.59.Ã?f Neutralization and focusing of charged particle beam pulses by a background plasma form plasma elec- trons. The effects of the enhanced self-focusing are of particular importance

Kaganovich, Igor

330

Characterization of plasma ion source utilizing anode spot with positively biased electrode for stable and high-current ion beam extraction  

SciTech Connect

The operating conditions of a rf plasma ion source utilizing a positively biased electrode have been investigated to develop a stably operating, high-current ion source. Ion beam characteristics such as currents and energies are measured and compared with bias currents by varying the bias voltages on the electrode immersed in the ambient rf plasma. Current-voltage curves of the bias electrode and photographs confirm that a small and dense plasma, so-called anode spot, is formed near an extraction aperture and plays a key role to enhance the performance of the plasma ion source. The ion beam currents from the anode spot are observed to be maximized at the optimum bias voltage near the knee of the characteristic current-voltage curve of the anode spot. Increased potential barrier to obstruct beam extraction is the reason for the reduction of the ion beam current in spite of the increased bias current indicating the density of the anode spot. The optimum bias voltage is measured to be lower at higher operating pressure, which is favorable for stable operation without severe sputtering damage on the electrode. The ion beam current can be further enhanced by increasing the power for the ambient plasma without increasing the bias voltage. In the same manner, noble gases with higher atomic number as a feedstock gas are preferable for extracting higher beam current more stably. Therefore, performance of the plasma ion source with a positively biased electrode can be enhanced by controlling the operating conditions of the anode spot in various manners.

Park, Yeong-Shin; Lee, Yuna; Chung, Kyoung-Jae; Hwang, Y. S. [Department of Nuclear Engineering, Seoul National University, Seoul 151-742 (Korea, Republic of)

2011-12-15T23:59:59.000Z

331

PROJECT-SPECIFIC TYPE A VERIFICATION FOR THE HIGH FLUX BEAM REACTOR UNDERGROUND UTILITIES REMOVAL PHASE 3 TRENCH 5, BROOKHAVEN NATIONAL LABORATORY UPTON, NEW YORK  

SciTech Connect

5098-SR-04-0 PROJECT-SPECIFIC TYPE A VERIFICATION FOR THE HIGH FLUX BEAM REACTOR UNDERGROUND UTILITIES REMOVAL PHASE 3 TRENCH 5, BROOKHAVEN NATIONAL LABORATORY

P.C. Weaver

2010-11-03T23:59:59.000Z

332

PROJECT-SPECIFIC TYPE A VERIFICATION FOR THE HIGH FLUX BEAM REACTOR UNDERGROUND UTILITIES REMOVAL PHASE 3 TRENCH 1, BROOKHAVEN NATIONAL LABORATORY UPTON, NEW YORK  

SciTech Connect

5098-SR-05-0 PROJECT-SPECIFIC TYPE A VERIFICATION FOR THE HIGH FLUX BEAM REACTOR UNDERGROUND UTILITIES REMOVAL PHASE 3 TRENCH 1 BROOKHAVEN NATIONAL LABORATORY

E.M. Harpenau

2010-12-15T23:59:59.000Z

333

Solenoid transport of a heavy ion beam for warm dense matterstudies and inertial confinement fusion  

SciTech Connect

From February to July 2006, I have been doing research as a guest at Lawrence Berkeley National Laboratory (LBNL), in the Heavy Ion Fusion group. This internship, which counts as one semester in my master's program in France, I was very pleased to do it in a field that I consider has the beauty of fundamental physics, and at the same time the special appeal of a quest for a long-term and environmentally-respectful energy source. During my stay at LBNL, I have been involved in three projects, all of them related to Neutralized Drift Compression Experiment (NDCX). The first one, experimental and analytical, has consisted in measuring the effects of the eddy currents induced by the pulsed magnets in the conducting plates of the source and diagnostic chambers of the Solenoid Transport Experiment (STX, which is a subset of NDCX). We have modeled the effect and run finite-element simulations that have reproduced the perturbation to the field. Then, we have modified WARP, the Particle-In-Cell code used to model the whole experiment, in order to import realistic fields including the eddy current effects and some details of each magnet. The second project has been to take part in a campaign of WARP simulations of the same experiment to understand the leakage of electrons that was observed in the experiment as a consequence to some diagnostics and the failure of the electrostatic electron trap. The simulations have shown qualitative agreement with the measured phenomena, but are still in progress. The third project, rather theoretical, has been related to the upcoming target experiment of a thin aluminum foil heated by a beam to the 1-eV range. At the beginning I helped by analyzing simulations of the hydrodynamic expansion and cooling of the heated material. But, progressively, my work turned into making estimates for the nature of the liquid/vapor two-phase flow. In particular, I have been working on criteria and models to predict the formation of droplets, their size, and their partial or total evaporation in the expanding flow.

Armijo, Julien

2006-10-01T23:59:59.000Z

334

Direct Measurement of Ion Beam Induced, Nanoscale Roughening of GaN Bentao Cui and P. I. Cohen  

E-Print Network (OSTI)

Direct Measurement of Ion Beam Induced, Nanoscale Roughening of GaN Bentao Cui and P. I. Cohen of a surface roughening term due to curvature-dependent sputtering or asymmetric attachment of vacancies change using atomic force microscopy, we show a method to measure the ion-roughening coefficient. Using

Cohen, Philip I.

335

2 Dynamic analysis of mixed ion beams/materials effects on the performance 3 of ITER-like devices  

E-Print Network (OSTI)

1 2 Dynamic analysis of mixed ion beams/materials effects on the performance 3 of ITER-like devices 4 Tatyana Sizyuk ,1 , Ahmed Hassanein 5 School of Nuclear Engineering, Center for Materials undersimultaneous ion penetration and mixing, scattering, reflection, physical and chemical sputtering, 20dynamic

Harilal, S. S.

336

Recent U.S. advances in ion-beam-driven high energy density physics and heavy ion fusion  

E-Print Network (OSTI)

Sefkow, E.A. Startsev Princeton Plasma Physics Laboratory,Eng-48, and by the Princeton Plasma Physics Laboratory underLaboratory, and Princeton Plasma Physics Laboratory (the

2006-01-01T23:59:59.000Z

337

Nanostructure formation during ion assisted growth of GaN by molecular beam epitaxy Bentao Cui and P.I. Cohen  

E-Print Network (OSTI)

Nanostructure formation during ion assisted growth of GaN by molecular beam epitaxy Bentao Cui and P.I. Cohen Department of Electrical and Computer Engineering and Department of Chemical Engineering Prairie, MN 55344 (Dated: March 4, 2005) Ion beam assisted molecular beam epitaxy was used to grow Ga

Cohen, Philip I.

338

Three dimensional simulations of space charge dominated heavy ion beams with applications to inertial fusion energy  

SciTech Connect

Heavy ion fusion requires injection, transport and acceleration of high current beams. Detailed simulation of such beams requires fully self-consistent space charge fields and three dimensions. WARP3D, developed for this purpose, is a particle-in-cell plasma simulation code optimized to work within the framework of an accelerator`s lattice of accelerating, focusing, and bending elements. The code has been used to study several test problems and for simulations and design of experiments. Two applications are drift compression experiments on the MBE-4 facility at LBL and design of the electrostatic quadrupole injector for the proposed ILSE facility. With aggressive drift compression on MBE-4, anomalous emittance growth was observed. Simulations carried out to examine possible causes showed that essentially all the emittance growth is result of external forces on the beam and not of internal beam space-charge fields. Dominant external forces are the dodecapole component of focusing fields, the image forces on the surrounding pipe and conductors, and the octopole fields that result from the structure of the quadrupole focusing elements. Goal of the design of the electrostatic quadrupole injector is to produce a beam of as low emittance as possible. The simulations show that the dominant effects that increase the emittance are the nonlinear octopole fields and the energy effect (fields in the axial direction that are off-axis). Injectors were designed that minimized the beam envelope in order to reduce the effect of the nonlinear fields. Alterations to the quadrupole structure that reduce the nonlinear fields further were examined. Comparisons were done with a scaled experiment resulted in very good agreement.

Grote, D.P.

1994-11-01T23:59:59.000Z

339

Inertial fusion energy issues of intense heavy ion and laser beams interacting with ionized matter studied at GSI-Darmstadt  

Science Journals Connector (OSTI)

European activities on inertial fusion energy are coordinated by “keep in touch activities” of the European Fusion Programme coordinated by the European Commission. There is no general inertial fusion program in Europe. Instead, a number of activities relevant to inertial fusion are carried out by university groups and research centers. The Helmholtz-Research Center GSI-Darmstadt (Gesellschaft für Schwerionenforschung) operates accelerator facilities which provide the highest intensity for heavy ion beams and therefore key issues of ion beam driven fusion can be addressed. In addition to the accelerator facilities, one high-energy laser system is available (nhelix: nanosecond high-energy laser for ion experiments) and another one is under construction (PHELIX: petawatt high-energy laser for ion experiments). The heavy ion synchrotron facility, SIS18 (Schwer-Ionen-Synchrotron 18) recently delivered an intense uranium beam that deposits about 1 kJ/g specific energy in solid matter. Using this beam, experiments have been performed where solid Pb- and Ta-targets have been heated to the level of 1 eV. Experiments to study interaction mechanism of heavy ion beams with matter have been continued and are reported here.

D.H.H. Hoffmann; A. Blazevic; S. Korostiy; P. Ni; S.A. Pikuz; B. Rethfeld; O. Rosmej; M. Roth; N.A. Tahir; S. Udrea; D. Varentsov; K. Weyrich; B.Yu. Sharkov; Y. Maron

2007-01-01T23:59:59.000Z

340

Observation of Ion Acceleration and Heating during Collisionless Magnetic Reconnection in a Laboratory Plasma  

Office of Scientific and Technical Information (OSTI)

Prepared for the U.S. Department of Energy under Contract Prepared for the U.S. Department of Energy under Contract DE-AC02-09CH11466. Princeton Plasma Physics Laboratory PPPL- 4835 PPPL- 4835 Observation of Ion Acceleration and Heating during Collisionless Magnetic Reconnection in a Laboratory Plasma December, 2012 Jongsoo Yoo, Masaaki Yamada, HantaoJi and Clayton E. Myers Princeton Plasma Physics Laboratory Report Disclaimers Full Legal Disclaimer This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, nor any of their contractors, subcontractors or their employees, makes any

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Active beam position stabilization of pulsed lasers for long-distance ion profile diagnostics at the Spallation Neutron Source (SNS)  

SciTech Connect

A high peak-power Q-switched laser has been used to monitor the ion beam profiles in the superconducting linac at the Spallation Neutron Source (SNS). The laser beam suffers from position drift due to movement, vibration, or thermal effects on the optical components in the 250-meter long laser beam transport line. We have designed, bench-tested, and implemented a beam position stabilization system by using an Ethernet CMOS camera, computer image processing and analysis, and a piezo-driven mirror platform. The system can respond at frequencies up to 30 Hz with a high position detection accuracy. With the beam stabilization system, we have achieved a laser beam pointing stability within a range of 2 rad (horizontal) to 4 rad (vertical), corresponding to beam drifts of only 0.5 mm 1 mm at the furthest measurement station located 250 meters away from the light source.

Hardin, Robert A [ORNL; Liu, Yun [ORNL; Long, Cary D [ORNL; Aleksandrov, Alexander V [ORNL; Blokland, Willem [ORNL

2011-01-01T23:59:59.000Z

342

Prospects for advanced electron cyclotron resonance and electron beam ion source charge breeding methods for EURISOL  

SciTech Connect

As the most ambitious concept of isotope separation on line (ISOL) facility, EURISOL aims at producing unprecedented intensities of post-accelerated radioactive isotopes. Charge breeding, which transforms the charge state of radioactive beams from 1+ to an n+ charge state prior to post-acceleration, is a key technology which has to overcome the following challenges: high charge states for high energies, efficiency, rapidity and purity. On the roadmap to EURISOL, a dedicated R and D is being undertaken to push forward the frontiers of the present state-of-the-art techniques which use either electron cyclotron resonance or electron beam ion sources. We describe here the guidelines of this R and D.

Delahaye, P.; Jardin, P.; Maunoury, L.; Traykov, E.; Varenne, F. [GANIL, CEA/DSM-CNRS/IN2P3, Bd. Becquerel, BP 55027, 14076 Caen Cedex 05 (France); Galata, A.; Porcellato, A. M.; Prete, G. F. [INFN-Laboratori Nazionali di Legnaro, Viale dell'Universita 2, 35020 Legnaro, Padova (Italy); Angot, J.; Lamy, T.; Sortais, P.; Thuillier, T. [LPSC Grenoble, 53, rue des Martyrs, 38026 Grenoble Cedex (France); Ban, G. [LPC Caen, 6 bd Marechal Juin, 14050 Caen Cedex (France); Celona, L.; Lunney, D. [INFN-Laboratori Nazionali del Sud, via S.Sofia 62, 95125 Catania (Italy); Choinski, J.; Gmaj, P.; Jakubowski, A.; Steckiewicz, O. [Heavy Ion Laboratory, University of Warsaw, ul. Pasteura 5a, 02 093 Warsaw (Poland); Kalvas, T. [Department of Physics, University of Jyvaeskylae, PB 35 (YFL) 40351 Jyvaeskylae (Finland); and others

2012-02-15T23:59:59.000Z

343

Implosion of multilayered cylindrical targets driven by intense heavy ion beams  

Science Journals Connector (OSTI)

An analytical model for the implosion of a multilayered cylindrical target driven by an intense heavy ion beam has been developed. The target is composed of a cylinder of frozen hydrogen or deuterium, which is enclosed in a thick shell of solid lead. This target has been designed for future high-energy-density matter experiments to be carried out at the Gesellschaft für Schwerionenforschung, Darmstadt. The model describes the implosion dynamics including the motion of the incident shock and the first reflected shock and allows for calculation of the physical conditions of the hydrogen at stagnation. The model predicts that the conditions of the compressed hydrogen are not sensitive to significant variations in target and beam parameters. These predictions are confirmed by one-dimensional numerical simulations and thus allow for a robust target design.

A. R. Piriz, R. F. Portugues, N. A. Tahir, and D. H. H. Hoffmann

2002-11-11T23:59:59.000Z

344

Optimizing Laser-accelerated Ion Beams for a Collimated Neutron Source  

SciTech Connect

High-flux neutrons for imaging and materials analysis applications have typically been provided by accelerator- and reactor-based neutron sources. A novel approach is to use ultraintense (>1018W/cm2) lasers to generate picosecond, collimated neutrons from a dual target configuration. In this article, the production capabilities of present and upcoming laser facilities are estimated while independently maximizing neutron yields and minimizing beam divergence. A Monte-Carlo code calculates angular and energy distributions of neutrons generated by D-D fusion events occurring within a deuterated target for a given incident beam of D+ ions. Tailoring of the incident distribution via laser parameters and microlens focusing modifies the emerging neutrons. Projected neutron yields and distributions are compared to conventional sources, yielding comparable on-target fluxes per discharge, shorter time resolution, larger neutron energies and greater collimation.

C.L. Ellison and J. Fuchs

2010-09-23T23:59:59.000Z

345

Experimental analysis of general ion recombination in a liquid-filled ionization chamber in high-energy photon beams  

SciTech Connect

Purpose: To study experimentally the general ion recombination effect in a liquid-filled ionization chamber (LIC) in high-energy photon beams. Methods: The general ion recombination effect on the response of a micro liquid ion chamber (microLion) was investigated with a 6 MV photon beam in normal and SRS modes produced from a Varian{sup Registered-Sign} Novalis Tx{sup TM} linear accelerator. Dose rates of the linear accelerator were set to 100, 400, and 1000 MU/min, which correspond to pulse repetition frequencies of 60, 240, and 600 Hz, respectively. Polarization voltages applied to the microLion were +800 and +400 V. The relative collection efficiency of the microLion response as a function of dose per pulse was experimentally measured with changing polarization voltage and pulse repetition frequencies and was compared with the theoretically calculated value. Results: For the 60 Hz pulse repetition frequency, the experimental relative collection efficiency was not different from the theoretical one for a pulsed beam more than 0.3% for both polarization voltages. For a pulsed radiation beam with a higher pulse repetition frequency, the experimental relative collection efficiency converged to the theoretically calculated efficiency for continuous beams. This result indicates that the response of the microLion tends toward the response to a continuous beam with increasing pulse repetition frequency of a pulsed beam because of low ion mobility in the liquid. Conclusions: This work suggests an empirical method to correct for differences in general ion recombination of a LIC between different radiation fields. More work is needed to quantitatively explain the LIC general ion recombination behavior in pulsed beams generated from linear accelerators.

Chung, Eunah; Seuntjens, Jan [Medical Physics Unit, McGill University, Montreal General Hospital (L5-113), 1650 Cedar Avenue, Montreal, Quebec H3G 1A4 (Canada); Davis, Stephen [Department of Medical Physics, McGill University Health Centre, Montreal General Hospital (L5-112), 1650 Cedar Avenue, Montreal, Quebec H3G 1A4 (Canada)

2013-06-15T23:59:59.000Z

346

Interface and process for enhanced transmission of non-circular ion beams between stages at unequal pressure  

DOE Patents (OSTI)

The invention discloses a new interface with non-circular conductance limit aperture(s) useful for effective transmission of non-circular ion beams between stages with different gas pressure. In particular, the invention provides an improved coupling of field asymmetric waveform ion mobility spectrometry (FAIMS) analyzers of planar or side-to-side geometry to downstream stages such as mass spectrometry or ion mobility spectrometry. In this case, the non-circular aperture is rectangular; other geometries may be optimum in other applications. In the preferred embodiment, the non-circular aperture interface is followed by an electrodynamic ion funnel that may focus wide ion beams of any shape into tight circular beams with virtually no losses. The jet disrupter element of the funnel may also have a non-circular geometry, matching the shape of arriving ion beam. The improved sensitivity of planar FAIMS/MS has been demonstrated in experiments using a non-contiguous elongated aperture but other embodiments (e.g., with a contiguous slit aperture) may be preferable, especially in conjunction with an ion funnel operated at high pressures.

Tang, Keqi (Richland, WA); Shvartsburg, Alexandre A. (Richland, WA); Smith, Richard D. (Richland, WA)

2008-03-04T23:59:59.000Z

347

Induced Optical Losses in Optoelectronic Devices due to Focused Ion Beam Damages  

E-Print Network (OSTI)

A study of damages caused by gallium focused ion beam (FIB) into III-V compounds is presented. Potential damages caused by local heating, ion implantation, and selective sputtering are presented. Preliminary analysis shows that local heating is negligible. Gallium implantation is shown to occur over areas tens of nanometers thick. Gallium accumulation as well as selective sputtering during III-V compounds milling is expected. Particularly, for GaAs, this effect leads to gallium segregation and formation of metallic clusters. Microdisk resonators were fabricated using FIB milling with different emission currents to analyze these effects on a device. It is shown that for higher emission current, thus higher implantation doses, the cavity quality factor rapidly decreases due to optical scattering losses induced by implanted gallium atoms.

Vallini, Felipe; Reis, Elohim Fonseca dos; von Zuben, Antônio Augusto; Frateschi, Newton Cesário

2012-01-01T23:59:59.000Z

348

Polarized neutron reflectometry study on a magnetic film with an ion beam imprinted stripe pattern  

Science Journals Connector (OSTI)

We used polarized neutron reflectometry for a quantitative study of the field dependent arrangement of the magnetization vector in the different regions of an ion beam imprinted stripe pattern in a magnetic film. For the magnetic patterning of the Co70Fe30 film we took advantage of the exchange bias to an antiferromagnetic Mn83Ir17 layer which was changed locally by He-ion bombardment. The exchange bias was set to be antiparallel in the two different striped regions. We found that after magnetization reversal of half of the stripes the magnetization in neighbouring regions is periodically canted with respect to the stripe axis so that the net magnetization of the ferromagnetic film turns almost perpendicular to the stripes. At the same time the projection of the magnetization vector onto the stripe axis has a periodically alternating sign.

K. Theis-Bröhl; B.P. Toperverg; A. Westphalen; H. Zabel; J. McCord; V. Höink; J. Schmalhorst; G. Reiss; T. Weis; D. Engel; A. Ehresmann; U. Rücker

2007-01-01T23:59:59.000Z

349

Study of the fundamental properties of matter at high energy density created by an intense ion beam  

Science Journals Connector (OSTI)

Russian institutes will participate in setting up the experiments HIHEX (Heavy Ion Heating and Expansion) and LAPLAS (Laboratory Planetary Sciences) as part of the FAIR program of scientific research. The appr...

A. A. Golubev; V. B. Mintsev

2012-06-01T23:59:59.000Z

350

Helicon plasma generator-assisted surface conversion ion source for the production of H{sup -} ion beams at the Los Alamos Neutron Science Center  

SciTech Connect

The converter-type negative ion source currently employed at the Los Alamos Neutron Science Center (LANSCE) is based on cesium enhanced surface production of H{sup -} ion beams in a filament-driven discharge. In this kind of an ion source the extracted H{sup -} beam current is limited by the achievable plasma density which depends primarily on the electron emission current from the filaments. The emission current can be increased by increasing the filament temperature but, unfortunately, this leads not only to shorter filament lifetime but also to an increase in metal evaporation from the filament, which deposits on the H{sup -} converter surface and degrades its performance. Therefore, we have started an ion source development project focused on replacing these thermionic cathodes (filaments) of the converter source by a helicon plasma generator capable of producing high-density hydrogen plasmas with low electron energy. In our studies which have so far shown that the plasma density of the surface conversion source can be increased significantly by exciting a helicon wave in the plasma, and we expect to improve the performance of the surface converter H{sup -} ion source in terms of beam brightness and time between services. The design of this new source and preliminary results are presented, along with a discussion of physical processes relevant for H{sup -} ion beam production with this novel design. Ultimately, we perceive this approach as an interim step towards our long-term goal, combining a helicon plasma generator with an SNS-type main discharge chamber, which will allow us to individually optimize the plasma properties of the plasma cathode (helicon) and H{sup -} production (main discharge) in order to further improve the brightness of extracted H{sup -} ion beams.

Tarvainen, O.; Rouleau, G.; Keller, R.; Geros, E.; Stelzer, J.; Ferris, J. [Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)

2008-02-15T23:59:59.000Z

351

Development of mass spectrometry by high energy focused heavy ion beam: MeV SIMS with 8 MeV Cl7+ beam  

Science Journals Connector (OSTI)

Abstract Particle induced X-ray emission (PIXE) at microprobe of Jožef Stefan Institute is used to measure two-dimensional quantitative elemental maps of biological tissue. To improve chemical and biological understanding of the processes in vivo, supplementary information about chemical bonding and/or molecular distributions could be obtained by heavy-ion induced molecular desorption and a corresponding mass spectroscopy with Time-Of-Flight (TOF) mass spectrometer. As the method combines the use of heavy focused ions in MeV energy range and TOF Secondary Ion Mass Spectrometry, it is denoted as MeV SIMS. At Jožef Stefan Institute, we constructed a linear TOF spectrometer and mount it to our multipurpose nuclear microprobe. A beam of 8 MeV 35Cl7+ could be focused to a diameter of better than 3 ?m × 3 ?m and pulsed by electrostatic deflection at the high-energy side of accelerator. TOF mass spectrometer incorporates an 1 m long drift tube and a double stack microchannel plate (MCP) as a stop detector positioned at the end of the drift path. Secondary ions are focused at MCP using electrostatic cylindrical einzel lens. Time of flight spectra are currently acquired with a single-hit time-to-digital converter. Pulsed ion beam produces a shower of secondary ions that are ejected from positively biased target and accelerated towards MCP. We start our time measurement simultaneously with the start of the beam pulse. Signal of the first ion hitting MCP is used to stop the time measurement. Standard pulses proportional to the time of flight are produced with time to analog converter (TAC) and fed into analog-to-digital converter to obtain a time histogram. To enable efficient detection of desorbed fragments with higher molecular masses, which are of particular interest, we recently implemented a state-of art Field Programmable Gate Array (FPGA)-based multi-hit TOF acquisition. To test the system we used focused 8 MeV 35Cl7+ ion beam with pulse length of 180 ns. Mass resolution of measured SIMS spectra, dominantly determined by the duration of the beam pulse, is in good agreement with resolution estimated from pulse length. With improved high-voltage switching ability that will enable beam pulses with duration of 50 ns, a mass resolution of better than 500 is anticipated.

Luka Jeromel; Zdravko Siketi?; Nina Ogrinc Poto?nik; Primož Vavpeti?; Zdravko Rupnik; Klemen Bu?ar; Primož Pelicon

2014-01-01T23:59:59.000Z

352

Reactive ion beam etching of silicon with a new plasma ion source operated with CF4 : SiO2 over Si selectivity and Si surface modification  

E-Print Network (OSTI)

295 Reactive ion beam etching of silicon with a new plasma ion source operated with CF4 : SiO2 over-SIRE - alimenté en gaz CF4 pur. Ils concernent la silice et le silicium monocristallin et démontrent que les actuels sous plasmas CHF3 ou CF4/H2, pour lesquels les dommages induits par l'hydrogène sont bien connus

Paris-Sud XI, Université de

353

Parametic Study of the current limit within a single driver-scale transport beam line of an induction Linac for Heavy Ion Fusion  

E-Print Network (OSTI)

Physics of Magnetic Fusion Reactors, Rev. of Modern Physicsheavy ion beam driven fusion reactor study, Technical Reporta toroidally shaped fusion reactor (tokamak) such as shown

Prost, Lionel Robert

2007-01-01T23:59:59.000Z

354

Etching Efficiency for Si and SiO2 by CF+x, F+, and C+ Ion Beams Extracted from CF4 Plasmas  

Science Journals Connector (OSTI)

Fluorocarbon (CF+ x), fluorine (F+), and carbon (C+) ion beams with highcurrent density (50ion species on...

T. Yamaguchi; K. Sasaki; K. Kadota

2000-03-01T23:59:59.000Z

355

Electron capture from H-2 to highly charged Th and Xe ions trapped at center-of-mass energies near 6 eV  

E-Print Network (OSTI)

Ions with charge states as high as 80+, produced in the Lawrence Livermore National Laboratory electron beam ion trap were extracted and transferred to a Penning ion trap (RETRAP). RETRAP was operated at cryogenic temperature in the field of a...

Weinberg, G.; Beck, B. R.; Steiger, J.; Church, David A.; McDonald, J.; Schneider, D.

1998-01-01T23:59:59.000Z

356

Ion beam assisted sputter deposition of ZnO for silicon thin-film solar cells  

Science Journals Connector (OSTI)

Ion beam assisted deposition (IBAD) is a promising technique for improving the material quality of ZnO-based thin films. The operation of an auxiliary Ar+ ion source during deposition of ZnO?:?Ga thin films by dc magnetron sputtering led to an improvement in crystalline texture, especially at low temperatures due to momentum transfer from the ions to the growing film. Etching of IBAD-ZnO?:?Ga films in diluted HCl revealed crater-like surface structures with crater diameters of up to 600 nm. These structures are usually achieved after deposition at high substrate temperatures. This is an indication that the grain structure was remarkably changed by bombarding these films during deposition in terms of increasing the compactness of the ZnO?:?Ga films. Subsequent annealing procedures led to an improvement in the electrical and optical properties. Hydrogenated microcrystalline silicon (µc-Si?:?H) solar cells exhibited enhanced efficiency as compared to cells on other low-temperature sputtered reference ZnO films. This improvement was ascribed to light trapping by the modified etching behaviour of the IBAD-ZnO?:?Ga films as well as improved transparency after the vacuum annealing step.

M Warzecha; D Köhl; M Wuttig; J Hüpkes

2014-01-01T23:59:59.000Z

357

Anomalous patterns and nearly defect-free ripples produced by bombarding silicon and germanium with a beam of gold ions  

SciTech Connect

We demonstrate that surface ripples with an exceptionally high degree of order can develop when germanium is bombarded with a broad beam of gold ions. In contrast, if silicon is sputtered with an Au{sup ?} beam, patches of ripples with two distinct wave vectors can emerge. These types of order can be understood if the coupling between the surface morphology and composition is taken into account.

Mollick, Safiul Alam; Ghose, Debabrata [Saha Institute of Nuclear Physics, Sector - I, Block - AF, Bidhan Nagar, Kolkata 700064 (India); Shipman, Patrick D. [Department of Mathematics, Colorado State University, Fort Collins, Colorado 80523 (United States); Mark Bradley, R. [Department of Physics, Colorado State University, Fort Collins, Colorado 80523 (United States)

2014-01-27T23:59:59.000Z

358

Ion-acoustic waves in a plasma consisting of adiabatic warm ions, nonisothermal electrons, and a weakly relativistic electron beam: Linear and higher-order nonlinear effects  

SciTech Connect

The nonlinear propagation of finite amplitude ion acoustic solitary waves in a plasma consisting of adiabatic warm ions, nonisothermal electrons, and a weakly relativistic electron beam is studied via a two-fluid model. A multiple scales technique is employed to investigate the nonlinear regime. The existence of the electron beam gives rise to four linear ion acoustic modes, which propagate at different phase speeds. The numerical analysis shows that the propagation speed of two of these modes may become complex-valued (i.e., waves cannot occur) under conditions which depend on values of the beam-to-background-electron density ratio {alpha}, the ion-to-free-electron temperature ratio {sigma}, and the electron beam velocity v{sub 0}; the remaining two modes remain real in all cases. The basic set of fluid equations are reduced to a Schamel-type equation and a linear inhomogeneous equation for the first and second-order potential perturbations, respectively. Stationary solutions of the coupled equations are derived using a renormalization method. Higher-order nonlinearity is thus shown to modify the solitary wave amplitude and may also deform its shape, even possibly transforming a simple pulse into a W-type curve for one of the modes. The dependence of the excitation amplitude and of the higher-order nonlinearity potential correction on the parameters {alpha}, {sigma}, and v{sub 0} is numerically investigated.

Esfandyari-Kalejahi, A. [Faculty of Science, Department of Physics, Azerbaijan University of Tarbiat Moallem, 51745-406 Tabriz (Iran, Islamic Republic of); Kourakis, I. [Center for Plasma Physics (CPP), Department of Physics and Astronomy, Queen's University Belfast, BT7 1 NN Northern Ireland (United Kingdom); Institut fuer Theoretische Physik IV, Fakultaet fuer Physik und Astronomie, Ruhr-Universitaet Bochum, D-44780 Bochum (Germany); Shukla, P. K. [Institut fuer Theoretische Physik IV, Fakultaet fuer Physik und Astronomie, Ruhr-Universitaet Bochum, D-44780 Bochum (Germany)

2008-02-15T23:59:59.000Z

359

H{sup -} beam extraction from a cesium seeded field effect transistor based radio frequency negative hydrogen ion source  

SciTech Connect

H{sup -} beam was successfully extracted from a cesium seeded ion source operated using a field effect transistor inverter power supply as a radio frequency (RF) wave source. High density hydrogen plasma more than 10{sup 19} m{sup -3} was obtained using an external type antenna with RF frequency of lower than 0.5 MHz. The source was isolated by an isolation transformer and H{sup -} ion beam was extracted from a single aperture. Acceleration current and extraction current increased with the increase of extraction voltage. Addition of a small amount of cesium vapor into the source enhanced the currents.

Ando, A.; Matsuno, T.; Funaoi, T.; Tanaka, N. [School of Engineering, Tohoku University, Sendai 980-8579 (Japan); Tsumori, K.; Takeiri, Y. [National Institute for Fusion Science, Toki 509-5292 (Japan)

2012-02-15T23:59:59.000Z

360

Measurements of electrical resistivity of heavy ion beam produced high energy density matter: Latest results for lead and tungsten  

Science Journals Connector (OSTI)

The high-intensity heavy ion beams provided by the accelerator facilities of the Gesellschaft für Schwerionenforschung (GSI) Darmstadt are an excellent tool to produce large volumes of high energy density (HED) matter. Thermophysical and transport properties of HED matter states are of interest for fundamental as well as for applied research. During the last few years development of new diagnostic techniques allowed for a series of measurements of the electrical resistivity of heavy ion beam generated HED matter. In this report we present the most recent results on electrical resistivity of HED matter at GSI. The experiments on which we report have been performed with targets consisting of tungsten wires and lead foils, respectively. Uranium and argon beam pulses with durations of a few hundred ns, intensities of about 2 × 10 9 and 1 × 10 11 ions / bunch , respectively, and an initial ion energy of 300–350 A MeV have been used as a driver. An energy density deposition of about 1 kJ/g has been achieved by focusing the ion beam down to 1 mm FWHM or less.

Serban Udrea; Vladimir Ternovoi; Nikolay Shilkin; Alexander Fertman; Vladimir E. Fortov; Dieter H.H. Hoffmann; Alexander Hug; Michail I. Kulish; Victor Mintsev; Pavel Ni; Dmitry Nikolaev; Naeem A. Tahir; Vladimir Turtikov; Dmitry Varentsov; Denis Yuriev

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

US Heavy Ion Beam Research for Energy Density Physics Applications and Fusion  

E-Print Network (OSTI)

Laboratory, USA Princeton Plasma Physics Laboratory,Eng-48, and by the Princeton Plasma Physics Laboratory under

2005-01-01T23:59:59.000Z

362

Passive tailoring of laser-accelerated ion beam cut-off energy by using double foil assembly  

SciTech Connect

A double foil assembly is shown to be effective in tailoring the maximum energy produced by a laser-accelerated proton beam. The measurements compare favorably with adiabatic expansion simulations, and particle-in-cell simulations. The arrangement proposed here offers for some applications a simple and passive way to utilize simultaneously highest irradiance lasers that have best laser-to-ion conversion efficiency while avoiding the production of undesired high-energy ions.

Chen, S. N., E-mail: sophia.chen@polytechnique.edu; Brambrink, E.; Mancic, A.; Romagnani, L.; Audebert, P.; Fuchs, J., E-mail: julien.fuchs@polytechnique.fr [Laboratoire pour l'Utilisation des Lasers Intenses, UMR 7605 CNRS-CEA-École Polytechnique-Université Paris VI, Palaiseau (France); Robinson, A. P. L. [Central Laser Facility, STFC Rutherford-Appleton Laboratory, Chilton, Didcot, Oxfordshire OX11 0QX (United Kingdom)] [Central Laser Facility, STFC Rutherford-Appleton Laboratory, Chilton, Didcot, Oxfordshire OX11 0QX (United Kingdom); Antici, P. [Laboratoire pour l'Utilisation des Lasers Intenses, UMR 7605 CNRS-CEA-École Polytechnique-Université Paris VI, Palaiseau (France) [Laboratoire pour l'Utilisation des Lasers Intenses, UMR 7605 CNRS-CEA-École Polytechnique-Université Paris VI, Palaiseau (France); Dipartimento SBAI, Università di Roma « La Sapienza », Via Scarpa 14-16, 00165 Roma (Italy); INRS-Énergie et Matériaux, 1650 bd. L. Boulet, Varennes, J3X1S2 Québec (Canada); D'Humières, E. [Physics Department, MS-220, University of Nevada, Reno, Nevada 89557 (United States) [Physics Department, MS-220, University of Nevada, Reno, Nevada 89557 (United States); Centre de Physique Théorique, CNRS-Ecole Polytechnique, 91128 Palaiseau (France); University of Bordeaux—CNRS—CEA, CELIA, UMR5107, 33405 Talence (France); Gaillard, S. [Physics Department, MS-220, University of Nevada, Reno, Nevada 89557 (United States)] [Physics Department, MS-220, University of Nevada, Reno, Nevada 89557 (United States); Grismayer, T.; Mora, P. [Centre de Physique Théorique, CNRS-Ecole Polytechnique, 91128 Palaiseau (France)] [Centre de Physique Théorique, CNRS-Ecole Polytechnique, 91128 Palaiseau (France); Pépin, H. [INRS-Énergie et Matériaux, 1650 bd. L. Boulet, Varennes, J3X1S2 Québec (Canada)] [INRS-Énergie et Matériaux, 1650 bd. L. Boulet, Varennes, J3X1S2 Québec (Canada)

2014-02-15T23:59:59.000Z

363

Magnetic properties of Fe{sub 7}Co{sub 3} films with gas cluster ion beam irradiations  

SciTech Connect

Gas cluster ion beam (GCIB) irradiation was performed on Fe{sub 7}Co{sub 3} films to examine the magnetic properties. After Ar ion beam etching, the coercive force (H{sub c}) increased from the initial value; this may have been caused by irradiation damage from high-energy Ar ions. H{sub c} decreased after Ar-GCIB irradiation (acceleration voltage (V{sub a}): 20 kV, ion fluence (F): 1 Multiplication-Sign 10{sup 15} ions/cm{sup 2}). Since GCIB is an equivalent low-energy (several eV/atom) ion beam, it shows a damage-recovery effect. When the ionization electron voltage (V{sub e}) was reduced from 200 to 60 V, H{sub c} was observed to further decrease. Since the fraction of multiply charged Ar-GCIB decreased with decreasing V{sub e}, severe damage of Fe{sub 7}Co{sub 3} films can be minimized by employing low V{sub e}.

Toyoda, Noriaki; Fujimoto, Akihiro; Yamada, Isao [Graduate School of Engineering, University of Hyogo, 2167 Shosha, Himeji, Hyogo 671-2280 (Japan)

2013-05-07T23:59:59.000Z

364

Novel scheme for the preparation of transmission electron microscopy specimens with a focused ion beam  

Science Journals Connector (OSTI)

A novel scheme is presented for the preparation of cross?section transmission electron microscopy(TEM) specimens with a focused ion beam(FIB). This scheme is particularly suitable for highly structured substrates such as integrated circuits. The specimen is made by cutting a thin slice of material from the substrate by sputtering with the FIB. The position of the specimen can be selected with submicron resolution. The specimen is subsequently removed from the substrate and transported to a standard TEM?specimen holder. A specimen ready for TEM inspection can be prepared within 2 hs. The samples are of excellent quality as is illustrated with cross?section TEM images of FIB?made specimens of an electrically programmable read?only memory.

M. H. F. Overwijk; F. C. van den Heuvel; C. W. T. Bulle?Lieuwma

1993-01-01T23:59:59.000Z

365

Quantification of Dopant Concentrations in Diluted Magnetic Semiconductors using Ion Beam Techniques  

SciTech Connect

It has recently been demonstrated that magnetically doped TiO2 and SnO2 show ferromagnetism at room-temperature and Curie temperatures above room temperature. However, accurate knowledge of dopant concentrations is necessary to quantify magnetic moments in these materials. Rutherford Backscattering spectrometry (RBS) is one of the powerful techniques to quantify magnetic transition metal dopant concentrations in these materials. However, in some cases, the interference of RBS signals for different dopants and substrate elements in these materials makes analysis difficult. In this work, we demonstrate that particle induced x-ray emission (PIXE) can be successfully used to quantify the magnetic transition element dopants in several room temperature ferromagnetic materials synthesized using three different synthesis methods: oxygen plasma assisted molecular beam epitaxy, ion implantation and wet chemical methods.

Shutthanandan, V.; Thevuthasan, Suntharampillai; Droubay, Timothy C.; Kaspar, Tiffany C.; Punnoose, Alex; Hays, Jason; Chambers, Scott A.

2006-08-01T23:59:59.000Z

366

Assessment of Failure Mechanisms for Thermal Barrier Coatings by Photoluminescence, Electrochemical Impedance and Focused Ion Beam  

NLE Websites -- All DOE Office Websites (Extended Search)

H. Sohn, B. Jayaraj and V.H. Desai H. Sohn, B. Jayaraj and V.H. Desai SCIES Project 02- 01- SR103 DOE COOPERATIVE AGREEMENT DE-FC26-02NT41431 Tom J. George, Program Manager, DOE/NETL Richard Wenglarz, Manager of Research, SCIES Project Awarded (May 1, 2002, 36 Month Duration) $249,766 Total Contract Value ($208,228 DOE UTSR) Assessment of Failure Mechanisms for Thermal Barrier Coatings by Photoluminescence, Electrochemical Impedance and Focused Ion Beam YHS@UCF,10/17/05 Gas Turbine Needs: Reliable and Durable Thermal Barrier Coatings (TBCs) TBCs Provide Thermal Protection of Hot Components in Advanced Gas Turbine Engines Increase in Performance, Efficiency, Reliability and Maintainability. Reduction Life Cycle Costs. Reliable and Durable TBCs Needed as An Integral Part of Component Design.

367

Review of polarized ion sources (invited)  

SciTech Connect

Recent progress in polarized ion sources development is reviewed. New techniques for production of polarized H{sup -} ion (proton), D{sup -} (D{sup +}), and {sup 3}He{sup ++} ion beams are discussed. Feasibility studies of these techniques are in progress at BNL and other laboratories. Polarized deuteron beams will be required for the polarization program at the Dubna Nuclotron and at the deuteron electric dipole moment experiment at BNL. Experiments with polarized {sup 3}He{sup ++} ion beams are a part of the experimental program at the future electron ion collider.

Zelenski, A. [Brookhaven National Laboratory, Upton, New York 11973 (United States)

2010-02-15T23:59:59.000Z

368

Develpoment of a one-meter plasma source for heavy ion beam charge neutralization  

E-Print Network (OSTI)

was constructed at the Princeton Plasma Physics Laboratory (C. Davidson Plasma Physics Laboratory Princeton University,

2005-01-01T23:59:59.000Z

369

Unique capabilities of an intense heavy ion beam as a tool for equation-of-state studies  

Science Journals Connector (OSTI)

Intense heavy ion beams open new possibilities in high-energy-density matter research. Due to the unique feature of the energy deposition process of heavy ions in dense matter (volume character of heating) it is possible to generate high entropy states in matter without the necessity of shock compression. Previously such high entropy states could only be achieved by using the most powerful shock wave generators like nuclear explosions or powerful lasers. In this paper this novel technique of heavy ion heating and expansion is proposed to explore new fascinating regions of the phase diagram including the liquid phase the evaporation region with the critical point and strongly coupled plasmas.

D. H. H. Hoffmann; V. E. Fortov; I. V. Lomonosov; V. Mintsev; N. A. Tahir; D. Varentsov; J. Wieser

2002-01-01T23:59:59.000Z

370

Preparation of TEM samples by focused ion beam (FIB) techniques: applications to the study of clays and phyllosilicates in meteorites  

Science Journals Connector (OSTI)

...focused ion beam (FIB) instrument (Overwijk et al., 1993; Giannuzzi et al...and illustrated previously (e.g. Overwijk et al., 1993; Giannuzzi et al...Planetary Science Letters , 93 , 299-313. Overwijk, M.H.F., van den Heuvel, F...

M. R. Lee; P. A. Bland; G. Graham

371

Abstract ID: WED-AM-B3 Use of ion beam analysis techniques to characterise iron corrosion  

E-Print Network (OSTI)

Abstract ID: WED-AM-B3 Use of ion beam analysis techniques to characterise iron corrosion under 12 MeV proton irradiation on the corrosion behaviour of pure iron. Oxygen and hydrogen playing a crucial role during the corrosion process have been specifically investigated. Heavy desaerated water

Paris-Sud XI, Université de

372

Direct determination of the adiabatic ionization energy of NO2 as measured by guided ion-beam mass spectrometry  

E-Print Network (OSTI)

Direct determination of the adiabatic ionization energy of NO2 as measured by guided ion-beam mass the past 60 years the value for the ionization energy (IE) of nitrogen dioxide has been measured many times, Utah 84112 (Received 16 April 1992; accepted 4 May 1992) The adiabatic ionization energy (IE) of NOa

Clemmer, David E.

373

Highly Ordered Ga Nanodroplets on a GaAs Surface Formed by a Focused Ion Beam Qiangmin Wei,1  

E-Print Network (OSTI)

Highly Ordered Ga Nanodroplets on a GaAs Surface Formed by a Focused Ion Beam Qiangmin Wei,1 Jie Lian,2,3 Wei Lu,4 and Lumin Wang1,5,* 1 Department of Materials Science and Engineering, University Arbor, Michigan 48109, USA 3 Department of Mechanical, Aerospace and Nuclear Engineering, Rensselaer

Lu, Wei

374

Extraction of a nearly monoenergetic ion beam using a pulsed plasma Lin Xu, Demetre J. Economou,a  

E-Print Network (OSTI)

Extraction of a nearly monoenergetic ion beam using a pulsed plasma Lin Xu, Demetre J. Economou,a and Vincent M. Donnelly Department of Chemical Engineering, University of Houston, Houston, Texas 77204-4004 Paul Ruchhoeft Department of Electrical and Computer Engineering, University of Houston, Houston, Texas

Economou, Demetre J.

375

Generation of high charge state metal ion beams by electron cyclotron resonance heating of vacuum arc plasma in cusp trap  

SciTech Connect

A method for generating high charge state heavy metal ion beams based on high power microwave heating of vacuum arc plasma confined in a magnetic trap under electron cyclotron resonance conditions has been developed. A feature of the work described here is the use of a cusp magnetic field with inherent ''minimum-B'' structure as the confinement geometry, as opposed to a simple mirror device as we have reported on previously. The cusp configuration has been successfully used for microwave heating of gas discharge plasma and extraction from the plasma of highly charged, high current, gaseous ion beams. Now we use the trap for heavy metal ion beam generation. Two different approaches were used for injecting the vacuum arc metal plasma into the trap - axial injection from a miniature arc source located on-axis near the microwave window, and radial injection from sources mounted radially at the midplane of the trap. Here, we describe preliminary results of heating vacuum arc plasma in a cusp magnetic trap by pulsed (400 {mu}s) high power (up to 100 kW) microwave radiation at 37.5 GHz for the generation of highly charged heavy metal ion beams.

Nikolaev, A. G.; Savkin, K. P.; Oks, E. M.; Vizir, A. V.; Yushkov, G. Yu. [High Current Electronics Institute, Siberian Division of Russian Academy Science, Tomsk 634055 (Russian Federation); Vodopyanov, A. V.; Izotov, I. V.; Mansfeld, D. A. [Institute of Applied Physics, Russian Academy of Science, Nizhniy Novgorod 603950 (Russian Federation)

2012-02-15T23:59:59.000Z

376

Pulsed ion beam methods for in situ characterization of diamond film deposition processes  

SciTech Connect

Diamond and diamond-like carbon (DLC) have properties which in principle make them ideally suited to a wide variety of thin-film applications. Their widespread use as thin films, however, has been limited for a number of reasons related largely to the lack of understanding and control of the nucleation and growth processes. Real-time, in situ studies of the surface of the growing diamond film are experimentally difficult because these films are normally grown under a relatively high pressure of hydrogen, and conventional surface analytical methods require an ultrahigh vacuum environment. It is believed, however, that the presence of hydrogen during growth is necessary to stabilize the corrugated diamond surface structure and thereby prevent the formation of the graphitic phase. Pulsed ion beam-based analytical methods with differentially pumped ion sources and particle detectors are able to characterize the uppermost atomic layer of a film during, growth at ambient pressures 5-7 orders of magnitude higher than other surface-specific analytical methods. We describe here a system which has been developed for the purpose of determining the hydrogen concentration and bonding sites on diamond surfaces as a function of sample temperature and ambient hydrogen pressure under hot filament CVD growth conditions. It is demonstrated that as the hydrogen partial pressure increases, the saturation hydrogen coverage of the surface of a CVD diamond film increases, but that the saturation level depends on the atomic hydrogen concentration and substrate temperature.

Krauss, A.R.; Smentkowski, V.S.; Zuiker, C.D.; Gruen, D.M. [Argonne National Lab., IL (United States); Im, J. [Argonne National Lab., IL (United States)]|[Northwestern Univ., Evanston, IL (United States). Dept. of Materials Science and Engineering; Schultz, J.A.; Waters, K. [Ionwerks Corp., Houston, TX (United States); Chang, R.P.H. [Northwestern Univ., Evanston, IL (United States). Dept. of Materials Science and Engineering

1995-06-01T23:59:59.000Z

377

Field emission from gadolinium silicide prepared by ion implantation with electron beam annealing  

SciTech Connect

A silicon-based field emission cathode, the rare earth silicide GdSi{sub 2} was prepared by implanting Gd ions into silicon using a metal vapor vacuum arc ion source and subsequently annealed by electron beam. For as-implanted samples, turn-on field was about 21 V/{mu}m at a current density of 1 {mu}A/cm{sup 2} and a field emission current density of 1 mA/cm{sup 2} was reached at an applied field of 34 V/{mu}m. After annealing, the turn-on field could be as low as 9 V/{mu}m and the current density of 1 mA/cm{sup 2} can be reached at an applied field of 14 V/{mu}m. X-ray diffraction with x-ray photoelectron spectroscopy analyses and atomic force microscopy were used to characterize microstructure changes of the samples. The results showed that these excellent field emission characteristics were attributed to the GdSi{sub 2} compounds formed in the samples. The field emission mechanism was discussed in terms of Fowler-Nordheim (FN) theory. It was found that FN plots could be divided into two segments obviously, and this was perhaps because of the thermal effect in the process of field emission.

Duan, H. G.; Xie, E. Q.; Ye, F. [School of Physical Science and Technology, Lanzhou University, Lanzhou 730000 (China)

2007-03-15T23:59:59.000Z

378

Ion-beam irradiation into biodegradable nanofibers for tissue engineering scaffolds  

Science Journals Connector (OSTI)

Tissue engineering scaffolds require cell affinity, biodegradability, and desirable mechanical properties. Poly-L-lactic acid (PLLA) has been investigated for tissue engineering scaffolds owing to its biodegradability and mechanical strength. Electrospun fibers have large surface area and the fibrous structure provides necessary properties for cell attachment, proliferation, differentiation, and sufficient stiffness. PLLA fibers were irradiated with Kr+ at an energy of 50 keV with fluences of 1 × 1013, 1 × 1014, and 1 × 1015 ions/cm2 to improve cell affinity. Morphological change was observed by scanning electron microscopy (SEM). Surface properties were measured by FT-IR–ATR and Raman spectroscopy. L929 cell attachment to Kr+-irradiated fibers was evaluated. After the irradiation, the average fiber diameter decreased with high fluence. From the results of the surface analyses, the original chemical bonds were broken and new carbon structures were induced. L929 cell attachment was dramatically improved compared with non-irradiated fibers. Thus, ion-beam irradiated fibers are suitable for tissue engineering scaffolds. This technique is expected to be useful in repairing defects, such as those in nerve, vascular, and liver, in regenerative medicine.

Toshiyuki Tanaka; Rena Ujiie; Hirofumi Yajima; Kyoichiro Mizutani; Yoshiaki Suzuki; Hitoshi Sakuragi

2011-01-01T23:59:59.000Z

379

Electron cyclotron resonance plasma production by using pulse mode microwaves and dependences of ion beam current and plasma parameters on the pulse condition  

SciTech Connect

We measure the ion beam current and the plasma parameters by using the pulse mode microwave operation in the first stage of a tandem type ECRIS. The time averaged extracted ion beam current in the pulse mode operation is larger than that of the cw mode operation with the same averaged microwave power. The electron density n{sub e} in the pulse mode is higher and the electron temperature T{sub e} is lower than those of the cw mode operation. These plasma parameters are considered to cause in the increase of the ion beam current and are suitable to produce molecular or cluster ions.

Kiriyama, Ryutaro; Takenaka, Tomoya; Kurisu, Yousuke; Nozaki, Dai; Sato, Fuminobu; Kato, Yushi; Iida, Toshiyuki [Division of Electrical, Electronic and Information Engineering, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita-shi, Osaka 565-0871 (Japan)

2012-02-15T23:59:59.000Z

380

Generation and focusing of pulsed intense ion beams. Final progress report, April 1, 1979-September 30, 1979  

SciTech Connect

Theoretical calculations suggest that an intense pulsed approx. 1 MeV proton beam can be used to simulate the characteristics of approx. 1 GeV heavy ion beam propagation in an inertial confinement fusion reactor chamber. Given the present availability of the former beams and the high projected cost for obtaining the latter ones, such experimental simulations appear appropriate. Work was undertaken under the cited contract to apply the technology of intense proton beams to this end. The first task was the development of a high brightness pulsed proton source which could produce a weakly convergent approx. 10 kA proton beam in a field free drift region. This was accomplished at approx. 250 keV, and preliminary beam propagation experiments were performed. It was concluded that a proper simulation experiment would require a higher voltage beam. An upgraded version of the existing generator, which would have produced a 30 kA beam at about 500 keV, and further propagation experiments were proposed as part of our unsuccessful renewal proposal dated October 15, 1979.

Sudan, R.N.; Hammer, D.A.

1981-04-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Investigation of the specific plasma potential oscillations with geodesic acoustic mode frequencies by heavy ion beam probing in the T-10 tokamak  

E-Print Network (OSTI)

by heavy ion beam probing in the T-10 tokamak A V Melnikov1 , L G Eliseev1 , A V Gudozhnik1 , S E Lysenko1 of the specific oscillations with frequencies 15-30 kHz on the T-10 tokamak (R= 150cm, a = 30 cm) with Heavy IonHz) have been discovered in the tokamak by Heavy Ion Beam Probe (HIBP) diagnostic in 1993 [1, 2]. During

Paris-Sud XI, Université de

382

Neutron Beams from Deuteron Breakup at the 88-Inch Cyclotron at Lawrence Berkeley National Laboratory  

E-Print Network (OSTI)

Cross Section (mb/MeV/sr) Neutron Energy (MeV) 29 MeV, Tiand Technology 2007 DOI: Neutron beams from deuteron breakupUSA Abstract. Accelerator-based neutron sources offer many

McMahan, M.A.

2008-01-01T23:59:59.000Z

383

Development of an rf driven multicusp ion source for nuclear science experiments  

Science Journals Connector (OSTI)

A compact 13.56 \\{MHz\\} radio-frequency (rf) driven multicusp ion source is under development at Lawrence Berkeley National Laboratory (LBNL) for radioactive ion beam applications. In this paper we describe the ion source design and the general ion source performance using H2, Ar, Xe gas and a 90% Ar/10% CO gas mixture for generating the discharge plasma. The following ion source characteristics have been analyzed: extractable ion current, ion species distributions, ionization efficiency for nobel gases, axial energy spread and ion beam emittance measurements. This ion source can generate ion current densities of approximately 60 mA/cm2.

D Wutte; S Freedman; R Gough; Y Lee; M Leitner; K.N Leung; C Lyneis; D.S Pickard; M.D Williams; Z.Q Xie

1998-01-01T23:59:59.000Z

384

The Relativistic Heavy Ion Collider (RHIC) cryogenic system at Brookhaven National Laboratory: Review of the modifications and upgrades since 2002 and planned improvements.  

SciTech Connect

Brookhaven National Laboratory continues its multi-year program to improve the operational efficiency, reliability, and stability of the cryogenic system, which also resulted in an improved beam availability of the Relativistic Heavy Ion Collider (RHIC). This paper summarizes the work and changes made after each phase over the past four years to the present, as well as proposed future improvements. Power usage dropped from an initial 9.4 MW to the present 5.1 MW and is expected to drop below 5 MW after the completion of the remaining proposed improvements. The work proceeded in phases, balancing the Collider's schedule of operation, time required for the modifications and budget constraints. The main changes include process control, compressor oil removal and management, elimination of the use of cold compressors and two liquid-helium storage tanks, insulation of the third liquid-helium storage tank, compressor-bypass flow reduction and the addition of a load turbine (Joule-Thomson ex

Than, R.; Tuozzolo, Joseph; Sidi-Yekhlef, Ahmed; Ganni, Venkatarao; Knudsen, Peter; Arenius, Dana

2008-03-01T23:59:59.000Z

385

Energy Amplification and Beam Bunching in a Pulse Line Ion Accelerator  

E-Print Network (OSTI)

Laboratories and the Princeton Plasma Physics Labora- tory,CA 94507, USA and Princeton Plasma Physics Laboratory, New

2006-01-01T23:59:59.000Z

386

Neutralized Drift Compression Experiments (NDCX) with a High Intensity Ion Beam  

E-Print Network (OSTI)

California 94550, USA. Princeton Plasma Physics Laboratory,AC02-76CH03073 with Princeton Plasma Physics Laboratory, and

2006-01-01T23:59:59.000Z

387

Sandia National Laboratories: Research: Facilities: Technology Deployment  

NLE Websites -- All DOE Office Websites (Extended Search)

Ion Beam Laboratory Ion Beam Laboratory Sandia's Ion Beam Analysis (IBA) program is recognized as one of the best in the world. It has the ability to examine a wide spectrum of materials, from semiconductors to metals and ceramics. Some of the accomplishments of the program include: Invented several new ion beam analysis techniques for the quantitative analysis of light elements (H through F), and heavy elements (C through Pu). Enhanced nuclear microprobe-based Single Event Upset (SEU) imaging system to supply submicron images of charge generation and collection in CMOS ICs. This new application of SEU-imaging is important for understanding and decreasing upset susceptibility. Capabilities and Resources The IBA is available to perform the following quantitative/standardless

388

A gas-jet transport and catcher technique for on-line production of radioactive ion beams using an electron cyclotron resonance ion-source  

SciTech Connect

Radioactive ion beams (RIB) have been produced on-line, using a gas-jet recoil transport coupled Electron Cyclotron Resonance (ECR) ion-source at the VECC-RIB facility. Radioactive atoms/molecules carried through the gas-jet were stopped in a catcher placed inside the ECR plasma chamber. A skimmer has been used to remove bulk of the carrier gas at the ECR entrance. The diffusion of atoms/molecules through the catcher has been verified off-line using stable isotopes and on-line through transmission of radioactive reaction products. Beams of {sup 14}O (71 s), {sup 42}K (12.4 h), {sup 43}K (22.2 h), and {sup 41}Ar (1.8 h) have been produced by bombarding nitrogen and argon gas targets with proton and alpha particle beams from the K130 cyclotron at VECC. Typical measured intensity of RIB at the separator focal plane is found to be a few times 10{sup 3} particles per second (pps). About 3.2 Multiplication-Sign 10{sup 3} pps of 1.4 MeV {sup 14}O RIB has been measured after acceleration through a radiofrequency quadrupole linac. The details of the gas-jet coupled ECR ion-source and RIB production experiments are presented along with the plans for the future.

Naik, V.; Chakrabarti, A.; Bhattacharjee, M.; Karmakar, P.; Bandyopadhyay, A.; Dechoudhury, S.; Mondal, M.; Pandey, H. K.; Lavanyakumar, D.; Mandi, T. K.; Dutta, D. P.; Kundu Roy, T.; Bhowmick, D.; Sanyal, D.; Srivastava, S. C. L.; Ray, A.; Ali, Md. S. [Variable Energy Cyclotron Centre (VECC), Sector-1, Block-AF, Bidhan Nagar, Kolkata 700064 (India); Bhattacharjee, S. [UGC-DAE CSR, Kolkata Centre, III/LB-8, Bidhan Nagar, Kolkata 700098 (India)

2013-03-15T23:59:59.000Z

389

Propagation of ion-acoustic solitons in an electron beam-superthermal plasma system with finite ion-temperature: Linear and fully nonlinear investigation  

SciTech Connect

The propagation of ion-acoustic (IA) solitons is studied in a plasma system, comprised of warm ions and superthermal (Kappa distributed) electrons in the presence of an electron-beam by using a hydrodynamic model. In the linear analysis, it is seen that increasing the superthermality lowers the phase speed of the IA waves. On the other hand, in a fully nonlinear investigation, the Mach number range and characteristics of IA solitons are analyzed, parametrically and numerically. It is found that the accessible region for the existence of IA solitons reduces with increasing the superthermality. However, IA solitons with both negative and positive polarities can coexist in the system. Additionally, solitary waves with both subsonic and supersonic speeds are predicted in the plasma, depending on the value of ion-temperature and the superthermality of electrons in the system. It is examined that there are upper critical values for beam parameters (i.e., density and velocity) after which, IA solitary waves could not propagate in the plasma. Furthermore, a typical interaction between IA waves and the electron-beam in the plasma is confirmed.

Saberian, E. [Department of Physics, Faculty of Sciences, Azarbaijan Shahid Madani University, 53714-161 Tabriz (Iran, Islamic Republic of); Department of Physics, Faculty of Basic Sciences, University of Neyshabur, Neyshabur (Iran, Islamic Republic of); Esfandyari-Kalejahi, A.; Rastkar-Ebrahimzadeh, A.; Afsari-Ghazi, M. [Department of Physics, Faculty of Sciences, Azarbaijan Shahid Madani University, 53714-161 Tabriz (Iran, Islamic Republic of)

2013-03-15T23:59:59.000Z

390

Self-consistent mean-field theory of size distribution narrowing during ramped temperature ion beam synthesis  

SciTech Connect

A simple mathematical argument explains a recently identified route for the ion beam synthesis of nanoclusters with a narrowed size distribution. The key idea is that growth conditions for which the average nanocluster size is increasing rapidly can lead to narrowed size distributions. Modeling candidate processes using a self-consistent, mean-field theory shows that normalized nanocluster size distributions with full-width at half-maximum of 17% of the average can be attained.

Mastandrea, J. P.; Sherburne, M. P.; Boswell-Koller, C. N.; Sawyer, C. A.; Guzman, J.; Bustillo, K. C.; Haller, E. E.; Chrzan, D. C. [Department of Materials Science and Engineering, University of California, Berkeley, California 94720 (United States); Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Ager, J. W. [Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States)

2013-12-21T23:59:59.000Z

391

Highly Polarized Ion Sources for Electron Ion Colliders (EIC)  

SciTech Connect

The operation of the RHIC facility at BNL and the Electron Ion Colliders (EIC) under development at Jefferson Laboratory and BNL need high brightness ion beams with the highest polarization. Charge exchange injection into a storage ring or synchrotron and Siberian snakes have the potential to handle the needed polarized beam currents, but first the ion sources must create beams with the highest possible polarization to maximize collider productivity, which is proportional to a high power of the polarization. We are developing one universal H-/D- ion source design which will synthesize the most advanced developments in the field of polarized ion sources to provide high current, high brightness, ion beams with greater than 90% polarization, good lifetime, high reliability, and good power efficiency. The new source will be an advanced version of an atomic beam polarized ion source (ABPIS) with resonant charge exchange ionization by negative ions. An integrated ABPIS design will be prepared based on new materials and an optimized magnetic focusing system. Polarized atomic and ion beam formation, extraction, and transport for the new source will be computer simulated.

V.G. Dudnikov, R.P. Johnson, Y.S. Derbenev, Y. Zhang

2010-03-01T23:59:59.000Z

392

Laboratory Directed Research and Development Program FY 2010  

E-Print Network (OSTI)

Accelerator and Engineering Strategies for Ion Beam CancerAccelerator and Engineering Strategies for Ion Beam CancerAccelerator & Engineering Strategies for Ion Beam Cancer

Hansen, Todd

2011-01-01T23:59:59.000Z

393

A compact molecular beam machine  

SciTech Connect

We have developed a compact, low cost, modular, crossed molecular beam machine. The new apparatus utilizes several technological advancements in molecular beams valves, ion detection, and vacuum pumping to reduce the size, cost, and complexity of a molecular beam apparatus. We apply these simplifications to construct a linear molecular beam machine as well as a crossed-atomic and molecular beam machine. The new apparatus measures almost 50 cm in length, with a total laboratory footprint less than 0.25 m{sup 2} for the crossed-atomic and molecular beam machine. We demonstrate the performance of the apparatus by measuring the rotational temperature of nitric oxide from three common molecular beam valves and by observing collisional energy transfer in nitric oxide from a collision with argon.

Jansen, Paul [Vrije Universiteit, 1081 HV Amsterdam (Netherlands); Chandler, David W.; Strecker, Kevin E. [Sandia National Laboratories, Livermore, California 94551 (United States)

2009-08-15T23:59:59.000Z

394

Deposition of diamond like carbon (DLC) and C-N films using ion beam assisted deposition (IBAD) technique and evaluation of their properties  

Science Journals Connector (OSTI)

Diamond like carbon films and C-N films were prepared using ion beam assisted deposition technique (IBAD). Tribological properties were studied by subjecting DLC coated films to the accelerated wear tests. The...

J Prabhjyot Pal; S C Patil; S B Ogale; S M Kanetkar…

1994-11-01T23:59:59.000Z

395

Ion-beam-induced epitaxial vapor-phase growth: A molecular-dynamics study  

Science Journals Connector (OSTI)

Low-energy ions which bombard a vapor-deposited film of low adatom mobility during growth mobilize surface atoms in the vicinity of the ion impact, causing a modification in the evolving microstructure. In a two-dimensional molecular-dynamics simulation where inert-gas ions strike a growing film of Lennard-Jones particles, it is demonstrated that ion bombardment during growth causes the filling of voids quenched in during vapor condensation and induces homoepitaxial growth. The dependence of film density and degree of homoepitaxial growth on the ion-to-vapor arrival rate ratio and ion energy is studied in detail.

Karl-Heinz Müller

1987-05-15T23:59:59.000Z

396

Present Status And Future Prospects Of Polarized Ion Sources  

SciTech Connect

Recent progress in polarized ion sources development is reviewed. New techniques for production of polarized H{sup -} ion (proton), D{sup -} (D{sup +}) and {sup 3}He{sup ++} ion beams are discussed. Feasibility studies of these techniques are in progress at BNL and other laboratories. Polarized deuteron beams will be required for the polarization program at the Dubna Nuclotron and at the deuteron Electric Dipole Moment experiment at BNL. Experiments with polarized {sup 3}He{sup ++} ion beams are a part of the experimental program at the future Electron Ion Collider.

Belov, A. [INR, Russian Academy of Sciences, Moscow (Russian Federation); Zelenski, A. [Brookhaven National Laboratory, Upton, NY 11973 (United States)

2009-08-04T23:59:59.000Z

397

Radiation-induced ICAM-1 Expression via TGF-?1 Pathway on Human Umbilical Vein Endothelial Cells; Comparison between X-ray and Carbon-ion Beam Irradiation  

Science Journals Connector (OSTI)

......expression in cells irradiated with car- bon-ion beam and the same...HUVE cells at 48 hours after car- bon beam irradiation. ICAM-1...human lymphoblasts and mice are defective in radiation- induced apoptosis...endothelial growth factor in lung car- cinoma cells. Int J Radiat......

Hiroki Kiyohara; Yasuki Ishizaki; Yoshiyuki Suzuki; Hiroyuki Katoh; Nobuyuki Hamada; Tatsuya Ohno; Takeo Takahashi; Yasuhiko Kobayashi; Takashi Nakano

2011-05-01T23:59:59.000Z

398

Dependence of ion beam current on position of mobile plate tuner in multi-frequencies microwaves electron cyclotron resonance ion source  

SciTech Connect

We are constructing a tandem-type electron cyclotron resonance ion source (ECRIS). The first stage of this can supply 2.45 GHz and 11-13 GHz microwaves to plasma chamber individually and simultaneously. We optimize the beam current I{sub FC} by the mobile plate tuner. The I{sub FC} is affected by the position of the mobile plate tuner in the chamber as like a circular cavity resonator. We aim to clarify the relation between the I{sub FC} and the ion saturation current in the ECRIS against the position of the mobile plate tuner. We obtained the result that the variation of the plasma density contributes largely to the variation of the I{sub FC} when we change the position of the mobile plate tuner.

Kurisu, Yosuke; Kiriyama, Ryutaro; Takenaka, Tomoya; Nozaki, Dai; Sato, Fuminobu; Kato, Yushi; Iida, Toshiyuki [Division of Electrical, Electronic and Information Engineering, Graduate School of Engineering, Osaka University, 2-1 Yamadaoka, Suita, Osaka 565-0871 (Japan)

2012-02-15T23:59:59.000Z

399

Planar Josephson junctions and arrays by electron beam lithography and ion damage  

E-Print Network (OSTI)

The beam current was set to CL rough 12 or higher and magni?set the desired current. Typically these CL settings (rough, ?

Cybart, Shane A.

2005-01-01T23:59:59.000Z

400

Excitation and propagation of electromagnetic fluctuations with ion-cyclotron range of frequency in magnetic reconnection laboratory experiment  

SciTech Connect

Large-amplitude electromagnetic fluctuations of ion-cyclotron-frequency range are detected in a laboratory experiment inside the diffusion region of a magnetic reconnection with a guide field. The fluctuations have properties similar to kinetic Alfvén waves propagating obliquely to the guide field. Temporary enhancement of the reconnection rate is observed during the occurrence of the fluctuations, suggesting a relationship between the modification in the local magnetic structure given by these fluctuations and the intermittent fast magnetic reconnection.

Inomoto, Michiaki; Tanabe, Hiroshi; Ono, Yasushi [Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan)] [Graduate School of Frontier Sciences, The University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8561 (Japan); Kuwahata, Akihiro [Graduate School of Engineering, The University of Tokyo,7-3-1 Hongo, Bunkyo, Tokyo 113-8656 (Japan)] [Graduate School of Engineering, The University of Tokyo,7-3-1 Hongo, Bunkyo, Tokyo 113-8656 (Japan); Collaboration: TS Group

2013-06-15T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Reduction of Ion Thermal Diffusivity Associated with the Transition of the Radial Electric Field in Neutral-Beam-Heated Plasmas in the Large Helical Device  

Science Journals Connector (OSTI)

Recent large helical device experiments revealed that the transition from ion root to electron root occurred for the first time in neutral-beam-heated discharges, where no nonthermal electrons exist. The measured values of the radial electric field were found to be in qualitative agreement with those estimated by neoclassical theory. A clear reduction of ion thermal diffusivity was observed after the mode transition from ion root to electron root as predicted by neoclassical theory when the neoclassical ion loss is more dominant than the anomalous ion loss.

K. Ida et al.

2001-06-04T23:59:59.000Z

402

Monte-Carlo Simulation of High Harmonic Fast Wave Heating of Neutral Beam Ions and Effects on MHD Stability: Validation With Experiments  

SciTech Connect

Experimentally, during fast wave (FW) radio frequency (rf) heating in DIII-D L-mode discharges, strong acceleration of neutral beam (NB) deuterium beam ions has been observed. Significant effects on the n/m = 1/1 sawtooth stability are also seen. Simulations using the Monte-Carlo Hamiltonian code ORBIT-RF, coupled to the TORIC full wave code, predict beam ion tails up to a few hundred keV, in agreement with the experiment. The simulations and experiment both clearly show a much greater efficiency for 4th harmonic FW heating than for 8th harmonic heating. Simple analyses of the kinetic contribution to the ideal magnetohydrodynamic (MHD) potential energy from energetic beam ions generated by FW heating yields reasonable consistency with the observations. A more detailed analysis shows a more complicated picture, however. Other physics effects such as geometry, plasma rotation, and the presence of a free boundary, play a significant role.

Chan, V. S.; Turnbull, A. D.; Choi, M.; Chu, M. S.; Lao, L. L. [General Atomics, P.O. Box 85608, San Diego, California 92186-5608 (United States)

2006-11-30T23:59:59.000Z

403

Shockwave-driven, non-ideal plasmas for interaction experiments with heavy-ion beams  

Science Journals Connector (OSTI)

Plasma targets for measuring energy loss and charge-state distribution of heavy ions in non-ideal plasmas have been developed. Ar plasmas with ?-parameters 0.55–1.5 could be realized and the interaction with several ion species studied. Here, the results for 5.9 MeV/u C ions are presented. The energy loss in plasma was reproduced in different experiments.

K Weyrich; H Wahl; D H H Hoffmann; A A Golubev; A V Kantsyrev; B Yu Sharkov; M Kulish; S Dudin; V B Mintsev; V E Fortov; V Gryaznov

2006-01-01T23:59:59.000Z

404

The bremsstrahlung tagged photon beam in Hall B at the Jefferson Laboratory  

SciTech Connect

We describe the design and commissioning of the photon tagging beamline installed in experimental Hall B at the Thomas Jefferson National Accelerator Facility (Jlab). This system can tag photon energies over a range from 20% to 95% of the incident electron energy, and is capable of operation with beam energies up to 6.1 GeV. A single dipole magnet is combined with a hodoscope containing two planar arrays of plastic scintillators to detect energy-degraded electrons from a thin bremsstrahlung radiator. The first layer of 384 partially overlapping small scintillators provides photon energy resolution, while the second layer of 61 larger scintillators provides the timing resolution necessary to form a coincidence with the corresponding nuclear interaction triggered by the tagged photon. The definitions of overlap channels in the first counter plane and of geometric correlation between the two planes are determined using digitized time information from the individual counters. Auxiliary beamline devices are briefly described, and performance results to date under real operating conditions are presented. The entire photon-tagging system has met or exceeded its design goals.

Daniel I. Sober; Hall Crannell; Alberto Longhi; Scott Matthews; James T. O'Brien; Barry L. Berman; William Briscoe; Philip L. Cole; James Connelly; W.R. Dodge; Luc Y. Murphy; S.A. Phillips; Michael Dugger; David Lawrence; Barry G. Ritchie; Elton Smith; J.M. Lambert; Eric P.M. Anciant; Gerad Audit; Thierry Auger; Claude Marchand; Michael Klusman; James Napolitano; M.A. Khandaker; Carlos Salgado; Adam Sarty

2000-02-01T23:59:59.000Z

405

Stress induced phase transition in Gd2O3 films by ion beam assisted reactive electron beam-physical vapor deposition (EB-PVD)  

Science Journals Connector (OSTI)

Abstract The structural evolution of thick polycrystalline gadolinium oxide (Gd2O3) films deposited by reactive electron beam-physical vapor deposition (EB-PVD) is investigated. High deposition rates (> 5 Å/s) lead to the growth of mixed phase films which are of the cubic phase near the film/substrate interface before forming monoclinic phase as distance from the interface increases. By decreasing the deposition rate to phase. The growth of the thermodynamically stable cubic phase under these conditions is attributed to both higher surface mobility of the adatoms during growth and to increased tensile stress within the film. Ion beam assisted deposition (IBAD) was then performed to introduce compressive stress into the film resulting in the formation of the monoclinic phase. Wafer curvature, X-ray diffraction, confocal Raman spectroscopy, and scanning electron microscopy are utilized to characterize the film and present evidence for the existence of a stress-induced phase transition in the Gd2O3 films.

Daniel A. Grave; Michael P. Schmitt; Joshua A. Robinson; Douglas E. Wolfe

2014-01-01T23:59:59.000Z

406

Bulk ion acceleration and particle heating during magnetic reconnection in a laboratory plasma  

SciTech Connect

Bulk ion acceleration and particle heating during magnetic reconnection are studied in the collisionless plasma of the Magnetic Reconnection Experiment (MRX). The plasma is in the two-fluid regime, where the motion of the ions is decoupled from that of the electrons within the ion diffusion region. The reconnection process studied here is quasi-symmetric since plasma parameters such as the magnitude of the reconnecting magnetic field, the plasma density, and temperature are compatible on each side of the current sheet. Our experimental data show that the in-plane (Hall) electric field plays a key role in ion heating and acceleration. The electrostatic potential that produces the in-plane electric field is established by electrons that are accelerated near the electron diffusion region. The in-plane profile of this electrostatic potential shows a “well” structure along the direction normal to the reconnection current sheet. This well becomes deeper and wider downstream as its boundary expands along the separatrices where the in-plane electric field is strongest. Since the in-plane electric field is 3–4 times larger than the out-of-plane reconnection electric field, it is the primary source of energy for the unmagnetized ions. With regard to ion acceleration, the Hall electric field causes ions near separatrices to be ballistically accelerated toward the outflow direction. Ion heating occurs as the accelerated ions travel into the high pressure downstream region. This downstream ion heating cannot be explained by classical, unmagnetized transport theory; instead, we conclude that ions are heated by re-magnetization of ions in the reconnection exhaust and collisions. Two-dimensional (2-D) simulations with the global geometry similar to MRX demonstrate downstream ion thermalization by the above mechanisms. Electrons are also significantly heated during reconnection. The electron temperature sharply increases across the separatrices and peaks just outside of the electron diffusion region. Unlike ions, electrons acquire energy mostly from the reconnection electric field, and the energy gain is localized near the X-point. However, the increase in the electron bulk flow energy remains negligible. These observations support the assertion that efficient electron heating mechanisms exist around the electron diffusion region and that the heat generated there is quickly transported along the magnetic field due to the high parallel thermal conductivity of electrons. Classical Ohmic dissipation based on the perpendicular Spitzer resistivity is too small to balance the measured heat flux, indicating the presence of anomalous electron heating.

Yoo, Jongsoo; Yamada, Masaaki; Ji, Hantao; Jara-Almonte, Jonathan; Myers, Clayton E. [Center for Magnetic Self-Organization, Princeton Plasma Physics Laboratory, Princeton, New Jersey 08543 (United States)] [Center for Magnetic Self-Organization, Princeton Plasma Physics Laboratory, Princeton, New Jersey 08543 (United States)

2014-05-15T23:59:59.000Z

407

OPERATION STATUS OF HIGH INTENSITY ION BEAMS AT GANIL F. Chautard, G. Sncal, GANIL, Caen, France  

E-Print Network (OSTI)

. · A high-energy experiment. · An auxiliary experiments sharing the CSS2 beam · Additionally, the cyclotron, Venice, Italy 54 Circular Accelerators in2p3-00396700,version1-29Jul2010 Author manuscript, published

Paris-Sud XI, Université de

408

Critical issues for high-brightness heavy-ion beams -- prioritized  

E-Print Network (OSTI)

towards ultra-high vacuum (UHV) technology with hard sealsD-end diagnostics tank with a UHV version. However, we wouldmight be possible with new UHV beam tubes if they could be

2007-01-01T23:59:59.000Z

409

Neutron Scattering Science User Office, neutronusers@ornl.gov or (865) 574-4600. Proposals for beam time at Oak Ridge National Laboratory's High Flux Isotope Reactor (HFIR)  

E-Print Network (OSTI)

Neutron Scattering Science User Office, neutronusers@ornl.gov or (865) 574-4600. Proposals for beam Wildgruber, wildgrubercu@ornl.gov. VISION CallforProposals neutrons.ornl.gov Neutron Scattering Science - Oak time at Oak Ridge National Laboratory's High Flux Isotope Reactor (HFIR) and Spallation Neutron Source

Pennycook, Steve

410

Ion-radical synergy in HfO{sub 2} etching studied with a XeF{sub 2}/Ar{sup +} beam setup  

SciTech Connect

To gain more insight into fundamental aspects of the etching behavior of Hf-based high-k materials in plasma etch reactors, HfO{sub 2} films were etched in a multiple-beam setup consisting of a low energy Ar{sup +} ion beam and a XeF{sub 2} radical beam. The etch rate and etch products were monitored by real-time ellipsometry and mass spectrometry, respectively. Although etching of HfO{sub 2} in XeF{sub 2}/Ar{sup +} chemistry is mainly a physical effect, an unambiguous proof of the ion-radical synergistic effect for the etching of HfO{sub 2} is presented. The etch yield for 400 eV Ar{sup +} ions at a substrate temperature of 300 deg. C was 0.3 atoms/ion for Ar{sup +} sputtering and increased to 2 atoms/ion when XeF{sub 2} was also supplied. The etch yield proved to follow the common square root of ion energy dependence both for pure sputtering and radical enhanced etching, with a threshold energy at room temperature of 69{+-}17 eV for Ar{sup +} ions and 54{+-}14 eV for Ar{sup +} ions with XeF{sub 2}.

Gevers, P. M.; Beijerinck, H. C. W.; Sanden, M. C. M. van de; Kessels, W. M. M. [Department of Applied Physics, Eindhoven University of Technology, P.O. Box 513, 5600 MB Eindhoven (Netherlands)

2008-04-15T23:59:59.000Z

411

Beam quality corrections for parallel-plate ion chambers in electron reference dosimetry  

Science Journals Connector (OSTI)

Current dosimetry protocols (AAPM, IAEA, IPEM, DIN) recommend parallel-plate ionization chambers for dose measurements in clinical electron beams. This study presents detailed Monte Carlo simulations of beam quality correction factors for four different types of parallel-plate chambers: NACP-02, Markus, Advanced Markus and Roos. These chambers differ in constructive details which should have notable impact on the resulting perturbation corrections, hence on the beam quality corrections. The results reveal deviations to the recommended beam quality corrections given in the IAEA TRS-398 protocol in the range of 0%–2% depending on energy and chamber type. For well-guarded chambers, these deviations could be traced back to a non-unity and energy-dependent wall perturbation correction. In the case of the guardless Markus chamber, a nearly energy-independent beam quality correction is resulting as the effects of wall and cavity perturbation compensate each other. For this chamber, the deviations to the recommended values are the largest and may exceed 2%. From calculations of type-B uncertainties including effects due to uncertainties of the underlying cross-sectional data as well as uncertainties due to the chamber material composition and chamber geometry, the overall uncertainty of calculated beam quality correction factors was estimated to be

K Zink; J Wulff

2012-01-01T23:59:59.000Z

412

MONO1001 : A source for singly charged ions applied to the production of multicharged fullerene beams  

E-Print Network (OSTI)

(from pure C60 and C70 powder) will be shown and the influence of several source parameters (HF-power, support gas, gas pressure, ...) will be discussed specifying the conditions necessary for an optimum ion

Boyer, Edmond

413

Visualization of Trajectories of Electron Beams Emitted by an Ion Source with Closed Electron Drift  

E-Print Network (OSTI)

that this additional electron source is not able to provideare a source of additional electrons that partiallyEmitted by an Ion Source with Closed Electron Drift Ivan V.

Bordenjuk, Ian V.; Institue of Physics, National Academy of Sciences of Ukraine

2008-01-01T23:59:59.000Z

414

Ultramicroscopy 103 (2005) 6781 Conventional and back-side focused ion beam milling  

E-Print Network (OSTI)

prepared using the more conventional `trench' FIB geometry. The use of carbon coating to remove specimen is used, then the local intensity and spacing of the interference fringes that form in the overlap region as it provides direct access to the electrostatic potential in the specimen (projected in the electron beam

Dunin-Borkowski, Rafal E.

415

Recent Performance of the SNS H- ion source and low-energy beam transport system  

SciTech Connect

Recent measurements of the H beam current show that SNS is injecting about 55 mA into the RFQ compared to 45 mA in 2010. Since 2010, the H beam exiting the RFQ dropped from 40 mA to 34 mA, which is sufficient for 1 MW of beam power. To minimize the impact of the RFQ degradation, the service cycle of the best performing source was extended to 6 weeks. The only degradation is fluctuations in the electron dump voltage towards the end of some service cycles, a problem that is being investigated. Very recently, the RFQ was retuned, which partly restored its transmission. In addition, the electrostatic low-energy beam transport system was reengineered to double its heat sinking and equipped with a thermocouple that monitors the temperature of the ground electrode between the two Einzel lenses. The recorded data show that emissions from the source at high voltage dominate the heat load. Emissions from the partly Cs-covered first lens cause the temperature to peak several hours after starting up. On rare occasions, the temperature can also peak due to corona discharges between the center ground electrode and one of the lenses.

Stockli, Martin P [ORNL] [ORNL; Ewald, Kerry D [ORNL] [ORNL; Han, Baoxi [ORNL] [ORNL; Murray Jr, S N [ORNL] [ORNL; Pennisi, Terry R [ORNL] [ORNL; Piller, Chip [ORNL] [ORNL; Santana, Manuel [ORNL] [ORNL; Tang, Johnny Y [ORNL] [ORNL; Welton, Robert F [ORNL] [ORNL

2014-01-01T23:59:59.000Z

416

SHyPIE A NEW SOURCE FOR ON LINE PRODUCTION OF MULTICHARGED RADIOACTIVE CONDENSABLE ION BEAMS  

E-Print Network (OSTI)

Chouaib Doukkali, Faculte des Sciences, 24000 El ladida Morocco In order to define the future intensity and reliability of the on line radioactive beams for the SPIRAL project, an intense activity of research, with energies up to 95.A MeV and intensities up to 6 1012 particles/s for the lightest elements. The primary

Paris-Sud XI, Université de

417

PERMANENT MAGNETS UNDER IRRADIATION AND RADIOACTIVE ALKALI ION BEAM DEVELOPMENT FOR SPIRAL 1  

E-Print Network (OSTI)

produced by nuclear reactions are released from the high temperature target (2000°C), effuse through a cold transfer tube up to a multi-charged ECR ion source. After extraction from the ECRIS at low energy ( 34 q of high-energy fragmentation as well as the ISOL methods for exploring the structure of nuclei far from

Boyer, Edmond

418

Multi-dimensional collective effects in high-current relativistic beams relevant to High Density Laboratory Plasmas  

SciTech Connect

In summary, an analytical model describing the self-pinching of a relativistic charge-neutralized electron beam undergoing the collisionless Weibel instability in an overdense plasma has been developed. The model accurately predicts the final temperature and size of the self-focused filament. It is found that the final temperature is primarily defined by the total beam’s current, while the filament’s radius is shown to be smaller than the collisionless skin depth in the plasma and primarily determined by the beam’s initial size. The model also accurately predicts the repartitioning ratio of the initial energy of the beam’s forward motion into the magnetic field energy and the kinetic energy of the surrounding plasma. The density profile of the final filament is shown to be a superposition of the standard Bennett pinch profile and a wide halo surrounding the pinch, which contains a significant fraction of the beam’s electrons. PIC simulations confirm the key assumption of the analytic theory: the collisionless merger of multiple current filaments in the course of the Weibel Instability provides the mechanism for Maxwellization of the beam’s distribution function. Deviations from the Maxwell-Boltzmann distribution are explained by incomplete thermalization of the deeply trapped and halo electrons. It is conjectured that the simple expression derived here can be used for understanding collsionless shock acceleration and magnetic field amplification in astrophysical plasmas.

Shvets, Gennady

2014-05-09T23:59:59.000Z

419

Three-Dimensional Reconstruction and Microstructure Modeling of Porosity-Graded Cathode Using Focused Ion Beam and Homogenization Techniques  

SciTech Connect

In this study, microstructure of a porosity-graded lanthanum strontium manganite (LSM) cathode of solid oxide fuel cells (SOFCs) has been characterized using focused ion beam (FIB) and scanning electron microscopy(SEM) combined with image processing. Two-point correlation functions of the two-dimensional (2D) images taken along the direction of porosity gradient are used to reconstruct a three-dimensional (3D) microstructure. The effective elastic modulus of the two-phase porosity-graded cathode is predicted using strong contrast (SC) and composite inclusion (CI) homogenization techniques. The effectiveness of the two methods in predicting the effective elastic properties of the porositygraded LSM cathode is investigated in comparison with the results obtained from the finite element model (FEM).

Hamedani, Amani; Baniassadi, Majid; Sheidaei, A.; Pourboghrat, F.; Remond, Y.; Khaleel, Mohammad A.; Garmestani, Hamid

2014-02-28T23:59:59.000Z

420

Comparison of SOFC Cathode Microstructure Quantified using X-ray Nanotomography and Focused Ion Beam - Scanning Electron Microscopy  

SciTech Connect

X-ray nanotomography and focused ion beam scanning electron microscopy (FIB?SEM) have been applied to investigate the complex 3D microstructure of solid oxide fuel cell (SOFC) electrodes at spatial resolutions of 45 nm and below. The application of near edge differential absorption for x-ray nanotomography and energy selected backscatter detection for FIB–SEM enable elemental mapping within the microstructure. Using these methods, non?destructive 3D x-ray imaging and FIB–SEM serial sectioning have been applied to compare three?dimensional elemental mapping of the LSM, YSZ, and pore phases in the SOFC cathode microstructure. The microstructural characterization of an SOFC cathode is reported based on these measurements. The results presented demonstrate the viability of x-ray nanotomography as a quantitative characterization technique and provide key insights into the SOFC cathode microstructure.

Nelson, George J.; Harris, William H.; Lombardo, Jeffrey J.; Izzo, Jr., John R.; Chiu, W. K. S.; Tanasini, Pietro; cantoni, Marco; Van herle, Jan; Comninellis, Christos; Andrews, Joy C.; Liu, Yijin; Pianetta, Piero; Chu, Yong

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Radial space potential measurements in the central cell of the tandem mirror experiment with a heavy-ion-beam probe  

SciTech Connect

Spatial and temporal profiles of the space potential in the central-cell midplane of TMX have been obtained with a heavy-ion-beam probe. The absolute accuracy of measurements is +- 25 volts (with respect to the machine vacuum walls) with a resolution of approx. 2 volts. During moderate fueling with the gas boxes (i/sub gas/ approx. = 1200 Atom-Amperes D/sub 2/), the plasma potential is parabolic to at least 25 cm radius, with phi/sub e/ approx. = phi/sub max/(1-(r/32)/sup 2/) and 300 < phi/sub max/ <450 volts. With puffer-valve fueling, the space potential is relatively flat to at least 27 cm radius, with 250 < phi/sub e/ < 350 volts.

Hallock, G.A.

1983-04-11T23:59:59.000Z

422

Tunneling conductance studies in the ion-beam sputtered CoFe/Mg/MgO/NiFe magnetic tunnel junctions  

SciTech Connect

Magnetic tunnel junctions consisting of CoFe(10 nm)/Mg(1 nm)/MgO(3.5 nm)/NiFe(10 nm) are grown at room temperature using dual ion beam sputtering via in-situ shadow masking. The effective barrier thickness and average barrier height are estimated to be 3.5 nm (2.9 nm) and 0.69 eV (1.09 eV) at 290 K (70 K), respectively. The tunnel magnetoresistance value of 0.2 % and 2.3 % was observed at 290 K and 60 K, respectively. The temperature dependence of tunneling conductance revealed the presence of localized states present within the forbidden gap of the MgO barrier leading to finite inelastic spin independent tunneling contributions, which degrade the TMR value.

Singh, Braj Bhusan; Chaudhary, Sujeet [Thin Film Laboratory, Department of Physics, Indian Institute of Technology Delhi, New Delhi 110016 (India)

2013-06-03T23:59:59.000Z

423

TEM and x-ray investigation of single crystal-like zirconia films fabricated by dual ion beam deposition  

SciTech Connect

Single crystal-like yttria-stabilized zirconia (YSZ) thin films have been deposited on amorphous quartz, polycrystalline zirconia, single crystal Si, and Hastelloy substrates using dual ion beam deposition (IBAD). These films are highly crystallographically aligned both normal to and within the film plane. The films are deposited at low substrate temperatures (< 200 C), and the film orientation is substrate independent. 0--20 X-ray diffraction, X-ray rocking curves, X-ray pole figures and X-ray phi scans are used to evaluate the film structure. High resolution cross-sectional TEM is used to examine the evolution of crystallographic film alignment on an amorphous quartz substrate. The data suggest that the evolution of biaxial alignment is nucleation controlled under these conditions.

Ressler, K.G.; Sonnenberg, N.; Cima, M.J. [Massachusetts Inst. of Tech., Cambridge, MA (United States). Ceramics Processing Research Lab.

1996-12-31T23:59:59.000Z

424

INITIAL EXPERIMENTAL STUDIES OF ELECTRON ACCUMULATION IN A HEAVY-ION BEAM*  

E-Print Network (OSTI)

in a future power plant driver. On PSR, electrons are observable for surprisingly long times, but still only1,2 , L. Prost1,3 , A. Sakumi4 , P.A. Seidl1,3 , J.-L. Vay1,3 1 Virtual National Laboratory

Furman, Miguel

425

Mega-electron-volt ion beam induced anisotropic plasmon resonance of silver nanocrystals in glass  

E-Print Network (OSTI)

, 3508 TA Utrecht, The Netherlands B. J. Kooi Department of Applied Physics, Materials Science Center. Watson Laboratory of Applied Physics, California Institute of Technology, Pasadena, California 91125 A. M. Vredenberg Department of Atomic and Interface Physics, Debye Institute, Utrecht University, P.O. Box 80000

Polman, Albert

426

The universe in the laboratory - Nuclear astrophysics opportunity at the facility for antiproton and ion research  

SciTech Connect

In the next years the Facility for Antiproton and Ion Research FAIR will be constructed at the GSI Helmholtzze-ntrum für Schwerionenforschung in Darmstadt, Germany. This new accelerator complex will allow for unprecedented and pathbreaking research in hadronic, nuclear, and atomic physics as well as in applied sciences. This manuscript will discuss some of these research opportunities, with a focus on supernova dynamics and nucleosynthesis.

Langanke, K. [GSI Helmholtzzentrum für Schwerionenforschung, Technische Universität Darmstadt, Frankfurt Institute of Advanced Studies, D-64291 Darmstadt (Germany)

2014-05-09T23:59:59.000Z

427

Development of gas cluster ion beam surface treatments for reducing field emission and breakdown in RF cavities  

SciTech Connect

Sub-micron-scale surface roughness and contamination cause field emission that can lead to high voltage breakdown of electrodes, and these are limiting factors in the development of high gradient RF technology. We are studying various Gas Cluster Ion Beam (GCIB) treatments to smooth, clean, etch and/or chemically alter electrode surfaces to allow higher fields and accelerating gradients, and to reduce the time and cost of conditioning high voltage electrodes. For this paper, we have processed Nb, Stainless Steel, and Ti electrode materials using beams of Ar, O2, or NF3 +O2 clusters with accelerating potentials up to 35 kV. Using a Scanning Field Emission Microscope (SFEM), we have repeatedly seen a dramatic reduction in the number of field emission sites on Nb coupons treated with GCIB. Smoothing effects on Stainless steel and Ti substrates have been evaluated using AFM imaging and show that 200-nm wide polishing scratch marks are greatly attenuated. A 150-mm diameter GCIB treated stainless steel electrode has now shown virtually no DC field emission current at gradients over 20 MV/m.

D.R. Swenson; E. Degenkolb; A.T. Wu; Z. Insepov

2006-11-01T23:59:59.000Z

428

Smoothing metallic glasses without introducing crystallization by gas cluster ion beam  

Science Journals Connector (OSTI)

We show that 30?keV Ar cluster ion bombardment of Ni 52.5Nb10Zr15Ti15Pt7.5 metallic glass (MG) can remove surface mountain-like features and reduce the root mean square surface roughness from 12?nm to 0.7?nm. X-ray diffraction analysis reveals no crystallization after cluster ion irradiation. Molecular dynamics simulations show that although damage cascades lead to local melting the subsequent quenching rate is a few orders of magnitude higher than the critical cooling rate for MG formation thus the melted zone retains its amorphous nature down to room temperature. These findings can be applied to obtain ultra-smooth MGs without introducing crystallization.

Lin Shao; Di Chen; Michael Myers; Jing Wang; Buddhi Tilakaratne; Wei-Kan Chu; Guoqiang Xie; Arezoo Zare; Don A. Lucca

2013-01-01T23:59:59.000Z

429

Production of Liquid Cluster Ions by Nozzle Beam Source with and without He Gas  

SciTech Connect

We developed a new type of cluster ion source which could produce various kinds of liquid clusters such as water, methanol, ethanol and octane clusters. When the vapor pressure was larger than one atm, the water and ethanol clusters could be produced by an adiabatic expansion phenomenon without adding He gas. The peak size of the cluster ions increased with the increase of the vapor pressures. When the source temperature was at room temperature, the water and ethanol clusters were also produced by adding He gas. In another case of producing liquid clusters such as methanol and octane clusters, He gas was added to mix up with vapors of liquid materials. When the He gas pressure was larger than a few atms, the methanol and octane clusters were produced at a vapor pressure of two atm. The peak size increased with increase of the vapor pressure as well as the He gas pressure.

Takaoka, G. H.; Ryuto, H.; Okada, T.; Sugiyama, K. [Photonics and Electronics Science and Engineering Center, Kyoto University, Nishikyo, Kyoto 615-8510 (Japan)

2008-11-03T23:59:59.000Z

430

The role of carbon in ion beam nano-patterning of silicon  

SciTech Connect

We report a comparative study of nano-pattern formations on a carbon film and a smooth Si(100) surface following inert and chemically active ion bombardment. For the case of carbon film, patterns could be formed both by inert (Ar{sup +}) and self (C{sup +}) ion bombardment with the former producing ripples at relatively lower fluence. In contrast, bombardment by inert Ar{sup +} failed to form the nano patterns on Si surface, while bombardment by the same energy C{sup +} generated the ripples. Thus, impurity induced chemical effect seems to be crucial rather than the Bradley-Harper or Carter-Vishnyakov effects for destabilizing the surface for ripple formation.

Bhattacharjee, S. [Variable Energy Cyclotron Center, I/AF, Bidhannagar, Kolkata 700064 (India) [Variable Energy Cyclotron Center, I/AF, Bidhannagar, Kolkata 700064 (India); UGC-DAE Consortium for Scientific Research, III/LB-8, Saltlake, Kolkata 700098 (India); Karmakar, P.; Naik, V.; Chakrabarti, A. [Variable Energy Cyclotron Center, I/AF, Bidhannagar, Kolkata 700064 (India)] [Variable Energy Cyclotron Center, I/AF, Bidhannagar, Kolkata 700064 (India); Sinha, A. K. [UGC-DAE Consortium for Scientific Research, III/LB-8, Saltlake, Kolkata 700098 (India)] [UGC-DAE Consortium for Scientific Research, III/LB-8, Saltlake, Kolkata 700098 (India)

2013-10-28T23:59:59.000Z

431

Smoothing metallic glasses without introducing crystallization by gas cluster ion beam  

SciTech Connect

We show that 30 keV Ar cluster ion bombardment of Ni{sub 52.5}Nb{sub 10}Zr{sub 15}Ti{sub 15}Pt{sub 7.5} metallic glass (MG) can remove surface mountain-like features and reduce the root mean square surface roughness from 12 nm to 0.7 nm. X-ray diffraction analysis reveals no crystallization after cluster ion irradiation. Molecular dynamics simulations show that, although damage cascades lead to local melting, the subsequent quenching rate is a few orders of magnitude higher than the critical cooling rate for MG formation, thus the melted zone retains its amorphous nature down to room temperature. These findings can be applied to obtain ultra-smooth MGs without introducing crystallization.

Shao, Lin; Chen, Di; Myers, Michael; Wang, Jing [Department of Nuclear Engineering and Materials Science and Engineering Program, Texas A and M University, College Station, Texas 77843 (United States)] [Department of Nuclear Engineering and Materials Science and Engineering Program, Texas A and M University, College Station, Texas 77843 (United States); Tilakaratne, Buddhi; Wijesundera, Dharshana; Chu, Wei-Kan [Department of Physics and Texas Center for Superconductivity, University of Houston, Houston, Texas 77004 (United States)] [Department of Physics and Texas Center for Superconductivity, University of Houston, Houston, Texas 77004 (United States); Xie, Guoqiang [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan)] [Institute for Materials Research, Tohoku University, Sendai 980-8577 (Japan); Zare, Arezoo; Lucca, Don A. [School of Mechanical and Aerospace Engineering, Oklahoma State University, Stillwater, Oklahoma 74078 (United States)] [School of Mechanical and Aerospace Engineering, Oklahoma State University, Stillwater, Oklahoma 74078 (United States)

2013-03-11T23:59:59.000Z

432

Conformal growth of Mo/Si multilayers on grating substrates using collimated ion beam sputtering  

SciTech Connect

Deposition of multilayers on saw-tooth substrates is a key step in the fabrication of multilayer blazed gratings (MBG) for extreme ultraviolet and soft x-rays. Growth of the multilayers can be perturbed by shadowing effects caused by the highly corrugated surface of the substrates, which results in distortion of the multilayer stack structure and degradation of performance of MBGs. To minimize the shadowing effects we used an ionbeam sputtering machine with a highly collimated atomic flux to deposit Mo/Si multilayers on saw-tooth substrates. The sputtering conditions were optimized by finding a balance between smoothening and roughening processes in order to minimize degradation of the groove profile in the course of deposition and at the same time to keep the interfaces of a multilayer stack smooth enough for high efficiency. An optimal value of energy of 200 eV for sputtering Kr{sup +} ions was found by deposition of test multilayers on flat substrates at a range of ion energies. Two saw-tooth substrates were deposited at energies of 200 eV and 700 eV for the sputtering ions. It was found that reduction of the ion energy improved the blazing performance of the MBG and resulted in a 40% gain in the diffraction efficiency due to better replication of the groove profile by the multilayer. As a result of the optimization performed, an absolute diffraction efficiency of 28.8% was achieved for the 2nd blaze order of the MBG with a groove density of 7350 lines/mm at a wavelength of 13.5 nm. Details of the growth behavior of the multilayers on flat and saw-tooth substrates are discussed in terms of the Linear Continuous Model of film growth.

Gawlitza, Peter; Cambie, Rossana; Dhuey, Scott; Gullikson, Eric; Warwick, Tony; Braun, Stefan; Yashchuk, Valeriy; Padmore, Howard

2012-01-23T23:59:59.000Z

433

SAFETY ENGINEERING FOR THE RELATIVISTIC HEAVY ION COLLIDER AT THE BROOKHAVEN NATIONAL LABORATORY.  

SciTech Connect

THERE ARE ONLY A FEW OTHER HIGH ENERGY PARTICLE ACCELERATORS LIKE RHIC IN THE WORLD. THEREFORE, THE DESIGNERS OF THE MACHINE DO NOT ALWAYS HAVE CONSENSUS DESIGN STANDARDS AND REGULATORY GUIDANCE AVAILABLE TO ESTABLISH THE ENGINEERING PARAMETERS FOR SAFETY. SOME OF THE AREAS WHERE STANDARDS ARE NOT AVAILABLE RELATE TO THE CRYOGENIC SYSTEM, CONTAINMENT OF LARGE VOLUMES OF FLAMMABLE GAS IN FRAGILE VESSELS IN THE EXPERIMENTAL APPARATUS AND MITIGATION OF A DESIGN BASIS ACCIDENT WITH A STORED PARTICLE BEAM. UNIQUE BUT EQUIVALENT SAFETY ENGINEERING MUST BE DETERMINED. SPECIAL DESIGN CRITERIA FOR PROMPT RADIATION WERE DEVELOPED TO PROVIDE GUIDANCE FOR THE DESIGN OF RADIATION SHIELDING.

MUSOLINO,S.V.

1999-11-14T23:59:59.000Z

434

Sub-50 nm high aspect-ratio silicon pillars, ridges, and trenches fabricated using ultrahigh resolution electron beam lithography and reactive ion  

E-Print Network (OSTI)

-ethoxyethanol and methanol. Cr, 50 nm thick, was then deposited via electron beam evaporation at a rate of 0.1 n of Cl,, SiCl,, and He gases were tested. Chlorine was used because it has been shown to produce vertical sidewalls4 due to the ion assisted etching mecha- nism," but has the drawback of producing trenches

435

Traverse Focusing of Intense Charged Particle Beams with Chromatic Effects for Heavy Ion Fusion  

SciTech Connect

A fi nal focusing scheme designed to minimize chromatic effects is discussed. The Neutralized Drift Compression Experiment-II (NDCX-II) will apply a velocity tilt for longitudinal bunch compression, and a fi nal focusing solenoid (FFS) for transverse bunch compression. In the beam frame, neutralized drift compression causes a suffi#14;ciently large spread in axial momentum, pz , resulting in chromatic effects to the fi nal focal spot during transverse bunch compression. Placing a weaker solenoid upstream of a stronger fi nal focusing solenoid (FFS) mitigates chromatic effects and improves transverse focusing by a factor of approximately 2-4 for appropriate NDCX-II parameters.

James M. Mitrani, Igor D. Kaganovich, Ronald C. Davidson

2013-01-28T23:59:59.000Z

436

Assessment of Potential for Ion Driven Fast Ignition  

E-Print Network (OSTI)

mm radius ion beams Fast Ignition (laser or fast ion pulse)deg half cone angle Fast Ignition (laser or fast ion pulse)ion beam pulses for fast ignition, laser generated ion beams

2005-01-01T23:59:59.000Z

437

Sandia National Laboratories: Research: Facilities: Technology Deployment  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Sciences Experimental Facilities (ESEF) Engineering Sciences Experimental Facilities (ESEF) Technology Deployment Centers Advanced Power Sources Laboratory Engineering Sciences Experimental Facilities (ESEF) Trisonic Wind Tunnel Hypersonic Wind Tunnel High Altitude Chamber Explosive Components Facility Ion Beam Laboratory Materials Science and Engineering Center Pulsed Power and Systems Validation Facility Radiation Detection Materials Characterization Laboratory Shock Thermodynamic Applied Research Facility (STAR) Weapon and Force Protection Center Design, Evaluation and Test Technology Facility Research Engineering Sciences Experimental Facilities (ESEF) The ESEF complex contains several independent laboratories for experiments and advanced diagnostics in the fields of thermodynamics, heat transfer,

438

Ion source  

DOE Patents (OSTI)

A magnetic filter for an ion source reduces the production of undesired ion species and improves the ion beam quality. High-energy ionizing electrons are confined by the magnetic filter to an ion source region, where the high-energy electrons ionize gas molecules. One embodiment of the magnetic filter uses permanent magnets oriented to establish a magnetic field transverse to the direction of travel of ions from the ion source region to the ion extraction region. In another embodiment, low energy 16 eV electrons are injected into the ion source to dissociate gas molecules and undesired ion species into desired ion species.

Leung, Ka-Ngo (Hercules, CA); Ehlers, Kenneth W. (Alamo, CA)

1984-01-01T23:59:59.000Z

439

Second-Use Li-Ion Batteries to Aid Automotive and Utility Industries (Fact Sheet), NREL Highlights in Research & Development, NREL (National Renewable Energy Laboratory)  

NLE Websites -- All DOE Office Websites (Extended Search)

Repurposing lithium-ion batteries at the end of useful life Repurposing lithium-ion batteries at the end of useful life in electric drive vehicles could eliminate owners' disposal concerns and offer low-cost energy storage for certain applications. Increasing the number of plug-in electric drive vehicles (PEVs) is one major strategy for reduc- ing the nation's oil imports and greenhouse gas emissions. However, the high up-front cost and end-of-service disposal concerns of their lithium-ion (Li-ion) batteries could impede the proliferation of such vehicles. Re-using Li-ion batteries after their useful automotive life has been proposed as a way to remedy both matters. In response, the National Renewable Energy Laboratory (NREL) and its partners are conducting research to identify, assess, and verify profitable

440

Design of a compact, permanent magnet electron cyclotron resonance ion source for proton and H{sub 2}{sup +} beam production  

SciTech Connect

A 2.45 GHz microwave ion source was developed at China Institute of Atomic Energy (CIAE) for proton beam production of over 60 mA [B.-Q. Cui, Y.-W. Bao, L.-Q. Li, W.-S. Jiang, and R.-W. Wang, Proceedings of the High Current Electron Cyclotron Resonance (ECR) Ion Source for Proton Accelerator, APAC-2001, 2001 (unpublished)]. For various proton beam applications, another 2.45 GHz microwave ion source with a compact structure is designed and will be built at CIAE as well for high current proton beam production. It is also considered to be used for the test of H{sub 2}{sup +} beam, which could be injected into the central region model cyclotron at CIAE, and accelerated to 5 MeV before extraction by stripping. The required ECR magnetic field is supplied by all the permanent magnets rather than electrical solenoids and six poles. The magnetic field distribution provided by this permanent magnets configuration is a large and uniformly volume of ECR zone, with central magnetic field of a magnitude of {approx}875 Gs[T. Taylor and J. S. C. Wills, Nucl. Instrum. Methods Phys. Res. A 309, 37 (1991)]. The field adjustment at the extraction end can be implemented by moving the position of the magnet blocks. The results of plasma, coupling with 2.45 GHz microwave in the ECR zone inside the ion source are simulated by particle-in-cell code to optimize the density by adjusting the magnetic field distribution. The design configuration of the ion source will be summarized in the paper.

Jia Xianlu; Zhang Tianjue; Wang Chuan; Zheng Xia; Yin Zhiguo; Zhong Junqing; Wu Longcheng; Qin Jiuchang [China Institute of Atomic Energy, P.O. Box 275(3), Beijing 102413 (China); Luo Shan [The 6th Department, Communication Command Academy, Wuhan 430010 (China)

2010-02-15T23:59:59.000Z

Note: This page contains sample records for the topic "ion beam laboratory" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Spectroscopy at the high-energy electron beam ion trap (Super EBIT)  

SciTech Connect

The following progress report presents some of the x-ray measurements performed during the last year on the Livermore SuperEBIT facility. The measurements include: direct observation of the spontaneous emission of the hyperfine transition in ground state hydrogenlike holmium, {sup 165}Ho{sup 66{plus}}; measurements of the n {equals} 2 {r_arrow} 2 transition energies in neonlike thorium, Th{sup 80{plus}}, through lithiumlike thorium, Th{sup 87{plus}}, testing the predictions of quantum electrodynamical contributions in high-Z ions up to the 0.4{percent} level; measurements of the isotope shift of the n= 2 {r_arrow} 2 transition energies between lithiumlike through carbonize uranium, {sup 233}U{sup 89{plus}...86{plus}} and {sup 238}U{sup 89{plus}...86{plus}}, inferring the variation of the mean- square nuclear charge radius; and high-resolution measurements of the K{alpha} radiation of heliumlike xenon, Xe{sup 52 {plus}}, using a transmission-type crystal spectrometer, resolving for the first time the ls2p{sup 3}P{sub 1} {r_arrow} 1S{sup 2} {sup 1}S{sub 0} and ls2s{sup 3}S{sub 1} {r_arrow} 1S{sup 2} {sup 1}S{sub 0} transitions individually. 41 refs., 9 figs., 1 tab.

Widmann, K.; Beiersdorfer, P.; Crespo Lopez-Urrutia, J.R.

1996-07-10T23:59:59.000Z

442

Patient-specific QA and delivery verification of scanned ion beam at NIRS-HIMAC  

SciTech Connect

Purpose: To evaluate a patient-specific QA program and system for constancy checking of a scanning delivery system developed at the National Institute of Radiological Sciences.Methods: For the patient-specific QA, all the planned beams are recalculated on a water phantom with treatment planning software (TPS). The recalculated dose distributions are compared with the measured distributions using a 2D ionization chamber array at several depths, and evaluated using gamma index analysis with criteria of 3% and 3 mm and a pass rate of 90%. For the constancy check, the authors developed the multiwire proportional chamber (MWPC), which can record the delivered 2D fluence images in a slice-by-slice manner. During irradiation for dosimetric QA with the 2D ionization chamber array and an accordion-type water phantom, the 2D fluence images are recorded using the MWPC in the delivery system. These recorded images are then compared to those taken in the treatment session to check the constancy check. This analysis also employs gamma index analysis using the same criteria as in the patient-specific QA. These patient-specific QA and constancy check evaluations were performed using the data of 122 patients.Results: In the patient-specific QA, the measured dose distributions agreed well with those calculated by the TPS, and the QA criteria were satisfied in all measurements. The additional check of the fluence comparison ensured the constancy of the delivered field during each treatment irradiation.Conclusions: The authors established a patient-specific QA program and additional check of delivery constancy in every treatment session. Fluence comparison is a strong tool for constancy checking of the delivery system.

Furukawa, Takuji; Inaniwa, Taku; Hara, Yousuke; Mizushima, Kota; Shirai, Toshiyuki; Noda, Koji [Medical Physics Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan)] [Medical Physics Research Group, Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, 4-9-1 Anagawa, Inage-ku, Chiba 263-8555 (Japan)

2013-12-15T23:59:59.000Z

443

Microstructural development in PWA-1480 electron beam welds: An atom probe field ion microscopy study  

SciTech Connect

The microstructure development in PWA-1480 superalloy electron beam weld (Ni-11.0 at. % Al-11.5% Cr-1.9% Ti-5.1% Co-4.0% Ta-1.3% W) was characterized. Optical microscopy revealed a branched dendritic structure in the weld metal. Transmission electron microscopy of these welds, in the as-welded condition, showed fine cuboidal (0.05--0.5 {mu}m) L1{sub 2}-ordered {gamma}{prime} precipitates within the y grains. The average volume percentage of {gamma}{prime} precipitates was found to be {approx}5%. Atom probe analyses revealed that the composition of {gamma} matrix was Ni-4.6 at. % Al-25.5% Cr-0.4% Ti-9.4% Co-0.8% Ta-2.9% W and that of {gamma}{prime} precipitates was Ni-17.3 at. % Al-2.6% Cr-2.4% Ti-3.0% Co-7.4% Ta-1.3% W. These compositions were compared with the previous APFIM analyses of commercial PWA-1480 single crystals that had received conventional heat treatments. Small differences were found in the chromium and aluminum levels and these may be due to the nonequilibrium nature of phase transformations that occur during weld cooling. No solute segregation was detected at the {gamma}-{gamma}{prime}interface. The APFIM results were also compared with the thermodynamic calculations of alloying element partitioning between {gamma} and {gamma}{prime} using the ThermoCalc{trademark} software.

David, S.A.; Miller, M.K. [Oak Ridge National Lab., TN (United States); Babu, S.S. [The Pennsylvania State Univ., State College, PA (United States)

1995-12-31T23:59:59.000Z

444

Ion  

NLE Websites -- All DOE Office Websites (Extended Search)

field pinch R. N. Dexter, D. W. Kerst, T. W. Lovell, S. C. Prager, and J. C. Sprott, Fusion Technol. 19, 131 1991 are presented using two beam-based diagnostics: Charge...

445

Ion  

NLE Websites -- All DOE Office Websites (Extended Search)

calibration The absolute calibration is performed with an integrating sphere (Optronics Laboratories model 455-8-1) whose spectral radiance is precisely known. The grating...

446

Enforcement Letter, Oak Ridge National Laboratory LLC- May 13, 2009 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oak Ridge National Laboratory LLC- May 13, 2009 Oak Ridge National Laboratory LLC- May 13, 2009 Enforcement Letter, Oak Ridge National Laboratory LLC- May 13, 2009 May 13, 2009 Enforcement Letter issued to UT-Battelle, LLC related to a Radioactive Material Release at the Holifield Radioactive Ion Beam Facility at Oak Ridge National Laboratory The Department of Energy's Office of Enforcement within the Office of Health, Safety and Security has conducted an evaluation of the deficiencies described in Noncompliance Tracking System (NTS) report NTS-ORO--ORNL-X10PHYSICS-2008-000 1, Operational Emergency at Building 6000, Holifield Radioactive Ion Beam Facility. Our evaluation included a review of the Oak Ridge National Laboratory (ORNL) Management Investigation Team Report dated November 19, 2008, the associated corrective action plan,

447

Enforcement Letter, Oak Ridge National Laboratory LLC- May 13, 2009 |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Enforcement Letter, Oak Ridge National Laboratory LLC- May 13, 2009 Enforcement Letter, Oak Ridge National Laboratory LLC- May 13, 2009 Enforcement Letter, Oak Ridge National Laboratory LLC- May 13, 2009 May 13, 2009 Enforcement Letter issued to UT-Battelle, LLC related to a Radioactive Material Release at the Holifield Radioactive Ion Beam Facility at Oak Ridge National Laboratory The Department of Energy's Office of Enforcement within the Office of Health, Safety and Security has conducted an evaluation of the deficiencies described in Noncompliance Tracking System (NTS) report NTS-ORO--ORNL-X10PHYSICS-2008-000 1, Operational Emergency at Building 6000, Holifield Radioactive Ion Beam Facility. Our evaluation included a review of the Oak Ridge National Laboratory (ORNL) Management Investigation Team Report dated November 19, 2008, the associated corrective action plan,

448

Three-dimensional pore networks and transport properties of a shale gas formation determined from focused ion beam serial imaging  

Science Journals Connector (OSTI)

Three-dimensional pore network reconstructions of mudstone properties are made using dual focused ion beam-scanning electron microscopy (FIB-SEM). Samples of Jurassic Haynesville Formation mudstone are examined with FIB-SEM and image analysis to determine pore properties, topology, and tortuosity. Resolvable pore morphologies (>~10 nm) include large slit-like pores between clay aggregates and smaller pores in strain shadows surrounding larger clastic grains. Mercury injection capillary pressure (MICP) data suggest a dominant 1-10 nm or less size of pores barely resolvable by FIB-SEM imaging. Computational fluid dynamics modelling is used to calculate single phase permeability of the larger pore networks on the order of a few nanodarcys (which compare favourably with core-scale permeability tests). This suggests a pore hierarchy wherein permeability may be limited by connected networks of inter-aggregate pores larger than about 20 nm, while MICP results reflect smaller connected networks of pores residing in the clay matrix. [Received: May 12, 2011; Accepted: September 14, 2011

Thomas A. Dewers; Jason Heath; Russ Ewy; Luca Duranti

2012-01-01T23:59:59.000Z

449

Much simplified ion-beam assisted deposition-TiN template for high-performance coated conductors  

SciTech Connect

A much simplified template, i.e., two nonsuperconducting layers between the superconducting YBa{sub 2}Cu{sub 3}O{sub 7-{delta}} (YBCO) and the polycrystalline metal substrate, has been developed for high-performance coated conductors by using biaxially aligned TiN as a seed layer. A combination of a thin TiN ({approx}10 nm by ion-beam assisted deposition) layer and an epitaxial buffer LaMnO{sub 3} layer ({approx}120 nm) allows us to grow epitaxial YBCO films with values of full width at half-maximum around 3.5 deg. and 1.7 deg. for the {phi}-scan of (103) and rocking curve of (005) YBCO, respectively. The YBCO films grown on electropolished polycrystalline Hastelloy using this two-layer template exhibited a superconducting transition temperature of 89.5 K, a critical current density of 1.2 MA/cm{sup 2} at 75.5 K, and an {alpha} value (proportional factor of critical current density J{sub c}{approx}H{sup -}{alpha}) of around 0.33, indicating a high density of pinning centers and an absence of weak links.

Xiong, J. [Division of Materials Physics and Applications, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); State Key Lab of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Matias, V.; Zhai, J. Y.; Maiorov, B.; Trugman, D.; Jia, Q. X. [Division of Materials Physics and Applications, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Wang, H. [Department of Electrical and Computer Engineering, Texas A and M University, College Station, Texas 77843-3128 (United States); Tao, B. W.; Li, Y. R. [State Key Lab of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

2010-10-15T23:59:59.000Z

450

A new method of measuring the poloidal magnetic and radial electric fields in a tokamak using a laser-accelerated ion-beam trace probe  

SciTech Connect

Both the poloidal magnetic field (B{sub p}) and radial electric field (E{sub r}) are significant in magnetic confinement devices. In this paper, a new method was proposed to diagnose both B{sub p} and E{sub r} at the same time, which was named Laser-accelerated Ion-beam Trace Probe (LITP). This method based on the laser-accelerated ion beam, which has three properties: large energy spread, short pulse lengths, and multiple charge states. LITP can provide the 1D profiles, or 2D images of both B{sub p} and E{sub r}. In this paper, we present the basic principle and some preliminary theoretical results.

Yang, X. Y.; Chen, Y. H.; Lin, C.; Wang, X. G.; Xiao, C. J., E-mail: cjxiao@pku.edu.cn [State Key Labaratory of Nuclear Physics and Technology, School of Physics, Peking University, Beijing 100871 (China); Wang, L. [Institute of Physics, Chinese Academy of Sciences, P.O. Box 603, Beijing 100190 (China); Xu, M. [Center for Fusion Science of Southwestern Institute of Physics, P.O. Box 432, Chengdu 610041 (China)

2014-11-15T23:59:59.000Z

451

Laser beam control and diagnostic systems for the copper-pumped dye laser system at Lawrence Livermore National Laboratory  

SciTech Connect

The laser system described in the previous paper is used for experiments in which success requires tight tolerances on beam position, direction, and wavefront. Indeed, the optimum performance of the laser itself depends on careful delivery of copper laser light to the dye amplifiers, precise propagation of dye laser beams through restricted amplifier apertures, and accurate monitoring of laser power at key locations. This paper describes the alignment systems, wavefront correction systems, and laser diagnostics systems which ensure that the control requirements of both the laser and associated experiments are met. Because laser isotope separation processes utilize more than one wavelength, these systems monitor and control multiple wavelengths simultaneously.

Bliss, E.S.; Peterson, R.L.; Salmon, J.T.; Thomas, R.A.

1992-11-01T23:59:59.000Z

452

A dynamic focusing x-ray monochromator for a wiggler beam line at the SRS of the SERC Daresbury Laboratory  

SciTech Connect

A Si(220) double-crystal monochromator for the energy range 10--30 keV is presented. It will be used for EXAFS as well as powder diffraction measurements. To determine the requirements for this monochromator we looked, apart from mean considerations, at the requirements dictated by EXAFS in transmission mode. For good data analyses the proper shape, amplitude, and location at the energy axis of each wiggle is required. Moreover it is essential to separate the wiggles from background and noise. For the latter a high flux through the sample is desirable, which can be achieved by horizontal focusing of the beam. For that we have chosen to bend the second crystal sagitally. The sagittal bending radius is adjustable between 50 and 0.8 m, because for different energies different sagittal radii are necessary to focus the beam on the sample. The mean meridional radius of the second crystal is fixed at 130 m, which is an optimization for 20 keV. The meridional radius of the first crystal can be tuned between 100 and 500 m. When this radius is set to 130 m the energy resolution is calculated to be 6, 3, and 35 eV for 10, 20, and 30 keV (for perfectly bent crystals). By changing the meridional radius of the first crystal, future users of this monochromator can make the trade off between resolution and intensity. Movement of the monochromator exit beam, during a scan, will occur due to the monochromator geometry, but is reduced as much as possible by using an asymmetrically cut second crystal, with an asymmetry angle of 2.5{degree}. The average exit beam movement of the monochromator for a 1-keV scan is 20 {mu}m. For 40% of the energy range (10--30 keV) the exit beam position remains within 10 {mu}m. For the second crystal no translation stage is used.

De Bruijn, D.; Van Zuylen, P. (TNO Institute of Applied Physics, P.O. Box 155, 2600 AD Delft (Netherlands)); Kruizinga, G. (Netherlands Organization for Scientific Research (NWO), P.O. Box 93138, 2509 AC Den Haag (Netherlands) State University of Utrecht, Sorbonnelaan 16, 3508 TB Utrecht (Netherlands))

1992-01-01T23:59:59.000Z