Powered by Deep Web Technologies
Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tobacco Industry Involvement in Colorado  

E-Print Network (OSTI)

Accessed May 25, 2004) Industry Summary. 1992 (est. ).11 May 2004) Tobacco Industry Involvement in Colorado Pageor (800) LUNG-USA. Tobacco Industry Involvement in Colorado

Landman, BA, Anne; Bialick, Peter



Appendix V Public Involvement Plan  

NLE Websites -- All DOE Office Websites (Extended Search)

V V Public Involvement Plan Revision No.: 6 February 2008 Federal Facility Agreement and Consent Order (FFACO) FFACO, Appendix V February 2008 i FFACO Public Involvement Plan U.S. Department of Energy National Nuclear Security Administration Nevada Site Office Las Vegas, Nevada U.S. Department of Defense Defense Threat Reduction Agency Detachment 1, Nevada Operations Mercury, Nevada U.S. Department of Energy Office of Legacy Management Grand Junction, Colorado FFACO, Appendix V February 2008 ii Preface The Public Involvement Plan serves two purposes: it provides a broad public involvement strategy, and fulfills requirements contained in the Federal Facility Agreement and Consent Order (FFACO) relating to public awareness and participation. Under the FFACO, agreed to by


Public Involvment Plan - Rifle, Colorado  

Office of Legacy Management (LM)

4-TAR 4-TAR MAC-GWRIF 7.1 UMTRA Ground Water Project Public Involvement Plan for the Environmental Assessment of Ground Water Compliance at the New and Old Rifle, Colorado, Uranium Mill Tailings Sites May 1999 Prepared by U.S. Department of Energy Grand Junction Office Grand Junction, Colorado Work performed under DOE Contract No. DE-AC13-96GJ87335 Public Involvement Plan for the Rifle UMTRA Sites Page 2 Introduction This Public Involvement Plan is tiered to the Uranium Mill Tailings Remedial Action (UMTRA) Ground Water Project Public Participation Plan dated October 1997. This Public Involvement Plan applies to both the Old and New Rifle, Colorado, UMTRA Project sites and details the activities that have been or will be carried out to meet the public participation requirements of the


Community Involvement Fund | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Community Involvement Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Community Involvement Fund Overview The success of EM's legacy waste cleanup mission depends largely on the support of informed and engaged stakeholders. Cleanup activities have the potential to affect the health of the public, the environment, and the future of the communities that either host or are located near EM sites. Therefore, it is critical that EM receive public input from local citizens and community organizations prior to making cleanup decisions. In December 2010, EM partnered with the New Mexico Community Foundation


Rate Adjustments and Public Involvement  

NLE Websites -- All DOE Office Websites (Extended Search)

Rate Adjustments and Public Involvement Documents Rate Adjustments and Public Involvement Documents CRSP Transmission 9/16/2013 WAPA-161 FRN, CRSP transmission and ancillary services rates extension Letter announcing two-year extension to CRSP transmission and ancillary services rates Letter announcing revised CRSP transmission rates for FY 2014 Accompanying calculation table for FY 2014 CRSP transmission rate letter Letter announcing revised CRSP transmission rates for FY 2013 Letter announcing revised CRSP transmission rates for FY 2012 Letter announcing revised CRSP transmission rates for FY 2011 Letter announcing revised CRSP transmission rates for FY 2010 SLCA/IP 9/16/2013 WAPA-161 FRN, SLCA/IP firm power rate extension Letter announcing two-year extension to SLCA/IP firm power rate SLCA/IP Tentative Rate Adjustment Schedule


FOIASI - Special Inquiry Review of Allegations Involving  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOIASI - Special Inquiry Review of Allegations Involving FOIASI - Special Inquiry Review of Allegations Involving PotentialMisconduct by a Senior Office of Environmental Management Official FOIASI - Special Inquiry Review of Allegations Involving PotentialMisconduct by a Senior Office of Environmental Management Official In September 2009, the Office of Inspector General (OIG) received multiple allegations concerning improprieties by a senior official with the Office of Environmental Management. The allegations involved potential violations of political activity restrictions, lack of impartiality in performing official duties, misuse of position, and other related misconduct. Specific allegations concerned: 1. Orchestrating a $9 million American Recovery and Reinvestment Act of 2009 (Recovery Act) payment to certain Historically



Science Conference Proceedings (OSTI)

This Community Involvement Plan has been prepared by the Brookhaven National Laboratory's Community Involvement Office with the input of the community, Laboratory employees and representatives of the U.S. Department of Energy. The process to develop the plan began with the formation of a focus group consisting of representatives from: the community at large; special interest groups within the community; the business community; Laboratory retirees; senior and line management from the Laboratory; and the U.S. Department of Energy. The focus group reviewed an initial outline developed by the Office of Community involvement, held in-depth roundtable discussions of community involvement needs, and created a draft plan based on their discussions. A workshop was held to present the draft Community Involvement Plan to a wider audience for their input and insights on how Brookhaven should involve the community in decision making. This workshop was advertised in local newspapers and within the Laboratory. It was attended by community members, special interest group representatives, Laboratory employees and managers, U.S. Department of Energy-Brookhaven Group management, and members of the Laboratory's Community Advisory Council. The results of the workshop discussions are incorporated in this plan.




Decontamination Dressdown at a Transportation Accident Involving  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Decontamination Dressdown at a Transportation Accident Involving Decontamination Dressdown at a Transportation Accident Involving Radioactive Material Decontamination Dressdown at a Transportation Accident Involving Radioactive Material The purpose of this User's Guide is to provide instructors with an overview of the key points covered in the video. The Student Handout portion of this Guide is designed to assist the instructor in reviewing those points with students. The Student Handout should be distributed to students after the video is shown and the instructor should use the Guide to facilitate a discussion on how the decontamination dressdown process is implemented. During this discussion, the instructor can present various scenarios, each of which would discuss decontamination at the accident scene. The purpose of this discussion would be to cover how responders


Policy 1305 Cost Transfers Involving Sponsored Projects  

E-Print Network (OSTI)

Policy 1305 Cost Transfers Involving Sponsored Projects Responsible Office Office of Grant transfer of payroll and other direct costs associated with sponsored projects. Purpose of the Policy are responsible for ensuring that transfers of costs to sponsored projects which represent corrections of errors


Sandia National Laboratories: About Sandia: Community Involvement:  

NLE Websites -- All DOE Office Websites (Extended Search)

Community Involvement Community Involvement Contribution Programs Volunteer Programs Education Programs About Contribution Programs Shoes for Kids photo A tradition of employee giving Sandia National Laboratories employees and retirees are generous, contributing over $5.9 million a year through the United Way of Central New Mexico to non-profits in New Mexico, California, and the nation. Giving is a tradition at Sandia. In the 1960s, employees initiated the Shoes for Kids Program. Rather than giving each other gifts during the holidays, employees elected to contribute to a fund to provide new shoes to local elementary school children. The program has provided a new pair of shoes to over 500 Albuquerque-area children for over 50 years. Other annual programs benefiting local students include book and school supply drives.


Projecting Fatalities in Crashes involving Older Drivers  

NLE Websites -- All DOE Office Websites (Extended Search)

Crashes Crashes Projecting Fatalities in Crashes Involving Older Drivers Involving Older Drivers Oak Oak Ridge Ridge National Laboratory National Laboratory, USA USA Presented at Presented at the the 17th 17th World Congress of the International World Congress of the International Association Association for Accident and Traffic Medicine for Accident and Traffic Medicine May May 30, 30, 2000, 2000, Stockholm, Sweden Stockholm, Sweden ORNL ORNL P. P. Hu Hu D. D. Jones Jones T. T. Reuscher Reuscher R. R. Schmoyer Schmoyer T. T. Truett Truett General General Motors Motors Annette Annette Irwin Irwin U.S. U.S. DOTransportation DOTransportation Jesse Jesse Blatt Blatt Acknowledgements Acknowledgements Objective Objective This This research research is is funded funded by by a a Cooperative Cooperative Research


Abrupt structural transitions involving functionally optimal networks  

E-Print Network (OSTI)

We show analytically that abrupt structural transitions can arise in functionally optimal networks, driven by small changes in the level of transport congestion. Our findings are based on an exactly solvable model system which mimics a variety of biological and social networks. Our results offer an explanation as to why such diverse sets of network structures arise in Nature (e.g. fungi) under essentially the same environmental conditions. As a by-product of this work, we introduce a novel renormalization scheme involving `cost motifs' which describes analytically the average shortest path across multiple-ring-and-hub networks.

Jarrett, T C; Fricker, M; Johnson, N F; Jarrett, Timothy C.; Ashton, Douglas J.; Fricker, Mark; Johnson, Neil F.



Abrupt structural transitions involving functionally optimal networks  

E-Print Network (OSTI)

We show analytically that abrupt structural transitions can arise in functionally optimal networks, driven by small changes in the level of transport congestion. Our findings are based on an exactly solvable model system which mimics a variety of biological and social networks. Our results offer an explanation as to why such diverse sets of network structures arise in Nature (e.g. fungi) under essentially the same environmental conditions. As a by-product of this work, we introduce a novel renormalization scheme involving `cost motifs' which describes analytically the average shortest path across multiple-ring-and-hub networks.

Timothy C. Jarrett; Douglas J. Ashton; Mark Fricker; Neil F. Johnson



Buried Waste Integrated Demonstration stakeholder involvement model  

Science Conference Proceedings (OSTI)

The Buried Waste Integrated Demonstration (BWID) is a program funded by the US Department of Energy (DOE) Office of Technology Development. BWID supports the applied research, development, demonstration, and evaluation of a suite of advanced technologies that together form a comprehensive remediation system for the effective and efficient remediation of buried waste. Stakeholder participation in the DOE Environmental Management decision-making process is critical to remediation efforts. Appropriate mechanisms for communication with the public, private sector, regulators, elected officials, and others are being aggressively pursued by BWID to permit informed participation. This document summarizes public outreach efforts during FY-93 and presents a strategy for expanded stakeholder involvement during FY-94.

Kaupanger, R.M.; Kostelnik, K.M.; Milam, L.M.



Charge exchange processes involving iron ions  

DOE Green Energy (OSTI)

A review and evaluation is given of the experimental data which are available for charge exchange processes involving iron ions and neutral H, H/sub 2/ and He. Appropriate scaling laws are presented, and their accuracy estimated for these systems. A bibliography is given of available data sources, as well as of useful data compilations and review articles. A procedure is recommended for providing single approximate formulae to the fusion community to describe total cross sections for electron capture by partially-stripped Fe/sup q+/ ions in collisions with H, H/sub 2/ and He, based on the scaling relationships suggested by Janev and Hvelplund.

Phaneuf, R.A.



Tribal and stakeholder involvement in systems analysis  

SciTech Connect

Beginning in early 1995, U.S. Department of Energy began an experiment to link tribal and stakeholder representatives into technology assessment activities related to an Integrated Nonthermal Treatment System (INTS) study. The INTS study moved outside the framework of after-the-fact public involvement by providing the opportunity for technical and non-technical stakeholders alike to work together in the early predecision stages of the criteria development and assessment of options for innovative mixed waste treatment. The stakeholders gained an appreciation of the intense level of effort required to complete such an analysis. The engineers and scientists conducting the systems analyses had the opportunity (some for the first time) to learn more about tribal and stakeholder issues and how they might apply to the technical tasks related to technology assessment and selection.

McClure, L. [Lockheed Martin Idaho Technologies Company, Idaho Falls, ID (United States); Swartz, G. [Swartz and Associates, Boulder City, NV (United States); Cooley, C. [Department of Energy, Germantown, MD (United States)



Genomic Aspects of Research Involving Polyploid Plants  

Science Conference Proceedings (OSTI)

Almost all extant plant species have spontaneously doubled their genomes at least once in their evolutionary histories, resulting in polyploidy which provided a rich genomic resource for evolutionary processes. Moreover, superior polyploid clones have been created during the process of crop domestication. Polyploid plants generated by evolutionary processes and/or crop domestication have been the intentional or serendipitous focus of research dealing with the dynamics and consequences of genome evolution. One of the new trends in genomics research is to create synthetic polyploid plants which provide materials for studying the initial genomic changes/responses immediately after polyploid formation. Polyploid plants are also used in functional genomics research to study gene expression in a complex genomic background. In this review, we summarize the recent progress in genomics research involving ancient, young, and synthetic polyploid plants, with a focus on genome size evolution, genomics diversity, genomic rearrangement, genetic and epigenetic changes in duplicated genes, gene discovery, and comparative genomics. Implications on plant sciences including evolution, functional genomics, and plant breeding are presented. It is anticipated that polyploids will be a regular subject of genomics research in the foreseeable future as the rapid advances in DNA sequencing technology create unprecedented opportunities for discovering and monitoring genomic and transcriptomic changes in polyploid plants. The fast accumulation of knowledge on polyploid formation, maintenance, and divergence at whole-genome and subgenome levels will not only help plant biologists understand how plants have evolved and diversified, but also assist plant breeders in designing new strategies for crop improvement.

Yang, Xiaohan [ORNL; Ye, Chuyu [ORNL; Tschaplinski, Timothy J [ORNL; Wullschleger, Stan D [ORNL; Tuskan, Gerald A [ORNL



Public involvement in radioactive waste management decisions  

SciTech Connect

Current repository siting efforts focus on Yucca Mountain, Nevada, where DOE`s Office of Civilian Radioactive Waste Management (OCRWM) is conducting exploratory studies to determine if the site is suitable. The state of Nevada has resisted these efforts: it has denied permits, brought suit against DOE, and publicly denounced the federal government`s decision to study Yucca Mountain. The state`s opposition reflects public opinion in Nevada, and has considerably slowed DOE`s progress in studying the site. The Yucca Mountain controversy demonstrates the importance of understanding public attitudes and their potential influence as DOE develops a program to manage radioactive waste. The strength and nature of Nevada`s opposition -- its ability to thwart if not outright derail DOE`s activities -- indicate a need to develop alternative methods for making decisions that affect the public. This report analyzes public participation as a key component of this openness, one that provides a means of garnering acceptance of, or reducing public opposition to, DOE`s radioactive waste management activities, including facility siting and transportation. The first section, Public Perceptions: Attitudes, Trust, and Theory, reviews the risk-perception literature to identify how the public perceives the risks associated with radioactivity. DOE and the Public discusses DOE`s low level of credibility among the general public as the product, in part, of the department`s past actions. This section looks at the three components of the radioactive waste management program -- disposal, storage, and transportation -- and the different ways DOE has approached the problem of public confidence in each case. Midwestern Radioactive Waste Management Histories focuses on selected Midwestern facility-siting and transportation activities involving radioactive materials.




Factors Involved in Search Dog Training  

E-Print Network (OSTI)

Events of significant impact as recent as hurricane Ike yielded a consistent disturbing truth: we lack sufficient numbers of competent search dog [Canis familiaris] teams. This study was conceived to provide information in identifying factors involved in training competent search dogs. Obedience training methods, age training was initiated, previous handler canine training experience, and handler perception and emotional attachment to their search dog were examined through a sixty-six question survey. Achievement of a national certification was used as a measure of performance success. Association between factors and performance success was evaluated through Chi-Square testing. Surveys were announced through the National Search Dog Alliance (NSDA) and were available online; 177 were fully completed by respondents and used in the data analysis. Seventy-two percent of nationally certified canine team respondents preferred positive reinforcement methods. Several statistically significant associations were detected: (a) female handlers preferred positive reinforcement training methods [x^2 = 8.504, d.f.=1, P = 0.004], (b) as dogs matured use of active training equipment increased [x^2 = 54.043, d.f.= 2, P training each week had a higher proportion of national certifications [x^2 = 16.379, d.f. = 1, P less than 0.001]. The data also indicated a trend for handlers to have previous canine training experience equal to or greater than search dog training experience [x^2 = 118.36, d.f. = 9, P =0.05]. The results warrant further research on the effects of early training, the effects of training time investment, and the interaction between canine selection and handler understanding of canine learning theory.

Alexander, Michael B.



Building Technologies Office: Get Involved with Home Energy Score  

NLE Websites -- All DOE Office Websites (Extended Search)

Get Involved with Home Get Involved with Home Energy Score to someone by E-mail Share Building Technologies Office: Get Involved with Home Energy Score on Facebook Tweet about Building Technologies Office: Get Involved with Home Energy Score on Twitter Bookmark Building Technologies Office: Get Involved with Home Energy Score on Google Bookmark Building Technologies Office: Get Involved with Home Energy Score on Delicious Rank Building Technologies Office: Get Involved with Home Energy Score on Digg Find More places to share Building Technologies Office: Get Involved with Home Energy Score on AddThis.com... About Take Action to Save Energy Partner With DOE Activities Solar Decathlon Building America Home Energy Score Get Involved Partners Research & Background FAQs Home Performance with ENERGY STAR

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Emer Emer Emer Emer Emer Emergency Response to a T gency Response to a T gency Response to a T gency Response to a T gency Response to a Transportation ransportation ransportation ransportation ransportation Accident Involving Radioactive Material Accident Involving Radioactive Material Accident Involving Radioactive Material Accident Involving Radioactive Material Accident Involving Radioactive Material DISCLAIMER DISCLAIMER DISCLAIMER DISCLAIMER DISCLAIMER Viewing this video and completing the enclosed printed study material do not by themselves provide sufficient skills to safely engage in or perform duties related to emergency response to a transportation accident involving radioactive material. Meeting that goal is beyond the scope of this video and requires either additional


Building Technologies Program: How Do I Get Involved?  

NLE Websites -- All DOE Office Websites (Extended Search)

How Do I Get Involved? How Do I Get Involved? to someone by E-mail Share Building Technologies Program: How Do I Get Involved? on Facebook Tweet about Building Technologies Program: How Do I Get Involved? on Twitter Bookmark Building Technologies Program: How Do I Get Involved? on Google Bookmark Building Technologies Program: How Do I Get Involved? on Delicious Rank Building Technologies Program: How Do I Get Involved? on Digg Find More places to share Building Technologies Program: How Do I Get Involved? on AddThis.com... About Laws & Regulations ENERGY STAR® Testing & Verification EPACT 2005 Test Procedures Information Resources Notices & Rules Certification & Enforcement Schedule Setting Public Workshops & Hearings State Petitions Useful Links Guidance & FAQs


Cost Transfers Involving Sponsored Projects Directives and Procedures  

E-Print Network (OSTI)

Cost Transfers Involving Sponsored Projects Directives and Procedures Responsible Office: Office....................................................................................................................2 1.3 Cost Transfer.................................................................................................................2 2. Project Management

Watson, Craig A.


EIA Renewable Energy- Number of Companies Involved in Photovoltaic ...  

U.S. Energy Information Administration (EIA)

Renewable data table showing the number of companies involved with cell manufacturing, module/system design, prototype module and systems development, wholesale ...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Video User' s Guide Video User' s Guide DECONTAMINATION DRESSDOWN AT A TRANSPORTATION ACCIDENT INVOLVING RADIOACTIVE MATERIAL DISCLAIMER Viewing this video and completing the enclosed printed study material do not by themselves provide sufficient skills to safely engage in or perform duties related to emergency response to a transportation accident involving radioactive material. Meeting that goal is beyond


Public Involvement Opportunities for the DUF6 Conversion Facility EISs  

NLE Websites -- All DOE Office Websites (Extended Search)

Opportunities Opportunities Public Involvement Opportunities The public comment period for the Supplement Analysis for Disposal of Depleted Uranium Oxide Conversion Product Generated from DOE's Inventory of Depleted Uranium Hexafluoride is closed. Sorry! The public comment period for the Supplement Analysis for Disposal of Depleted Uranium Oxide Conversion Product Generated from DOE's Inventory of Depleted Uranium Hexafluoride is closed. The public comment form is no longer available. For information on other public involvement opportunities, please visit Public Involvement Opportunities. Ways to Provide Comments Comments may be submitted via the Public Comment Form on this Web site. Comments can also be mailed to: DU Disposal Supplement Analysis Comment Argonne National Laboratory


Microsoft Word - Number of Public Involvement Deliverables _2_.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Document Document Public Involvement Deliverables Number of Public Involvement Deliverables Completed In a Typical Fiscal Year * Nevada Site Office Manager Environmental Management Weekly Reports: 52 per year * DOE Headquarters Environmental Management Weekly Report: 52 per year * Fact sheets: 20 * Briefings: approximately 100 presentations per year, averaging 15 slides each * Drafting of articles for distribution/posting as EM News Flash alerts: 10-12 per year * Videos: 1 'full-length' production video (@ ~10 minutes or more): 2-3 feature production videos (@ ~2 minutes) and numerous (+150) video clips and raw video * Maintenance of the web-based Environmental Management Information System (EMIS) Public Involvement portion. Maintenance includes uploading briefings,


The human thalamus is crucially involved in executive control operations  

Science Conference Proceedings (OSTI)

The processing of executive control is thought to involve cortical as well as thalamic brain areas. However, the questions of how thalamic structures contribute to the control of behavior and how cortical versus thalamic processing is coordinated remain ...

Frank Marzinzik; Michael Wahl; Gerd-Helge Schneider; Andreas Kupsch; Gabriel Curio; Fabian Klostermann



DOE Involvement in Consensus Negotiations for Energy Conservation Standards  

NLE Websites -- All DOE Office Websites (Extended Search)

Involvement in Consensus Negotiations for Energy Conservation Involvement in Consensus Negotiations for Energy Conservation Standards DOE Involvement in Consensus Negotiations for Energy Conservation Standards DOE Involvement in Consensus Negotiations for Energy Conservation Standards. The Department of Energy is supportive of outside parties' negotiations efforts to reach consensus on energy conservation standards and test procedures that can be presented for consideration by the Department However, neither the Department nor any of its contractors can: offer advice or suggestion on any standard or test procedure under consideration by outside parties; take a position on any standard or test procedure under consideration by outside parties; negotiate with outside parties; or participate in any way in discussions among outside parties.


Medical Education Research Scholars Program 2013 / 2014 Inform -Involve -Enable  

E-Print Network (OSTI)

#12;Medical Education Research Scholars Program 2013 / 2014 Inform - Involve - Enable revised 6/04/13 1 Medical Education Research Scholars Program (MERSP) Application Cover Sheet Please click _______________________________ Date: ____________ Department Chair Signature: ______________________ Date: _____________ #12;Medical

Finley Jr., Russell L.


Public involvement plan for the Oak Ridge Reservation  

SciTech Connect

This Public Information Plan is a user`s guide for getting involved in US Department of Energy environmental decisions in Oak Ridge, Tennessee. It outlines the many ways the public can help DOE find solutions to its environmental challenges. The plan focuses on DOE`s Environmental Management public involvement activities. Environmental Management is composed of the following programs: environmental restoration, technology development and waste management.



OpenEI:Get Involved | Open Energy Information  

Open Energy Info (EERE)

OpenEI:Get Involved OpenEI:Get Involved Jump to: navigation, search How to GET INVOLVED WITH OpenEI Get involved with OpenEI Easy Ways You Can Get Involved Beginner.jpg Newbie Are you new to OpenEI, but not sure how to get started? That's ok! Its easy to get involved and contribute to OpenEI. Sign up for an account then start contributing wiki content Use social media to help share the word about OpenEI Join a local energy or technology interest group Scientist.jpg Content Developer Are you interested in adding, contributing, and editing content on OpenEI? Find out how to create and grow OpenEI's content and contribute. Create a New Page Upload Dataset - txt, zip, xml, csv, xls, xlsx, doc, docx, pdf, json, cbwfdb format Upload File - png, gif, jpg, jpeg, pdf, ppt, pptx format Join an OpenEI Project - OpenEI projects tackle specific challenges



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM The Department of Energy has on a variety of occasions engaged in transactions under which it bartered uranium to which it has title for goods or services . This guidance memorializes the results of analyses previously directed to individual proposed transactions . For the reasons discussed below, we conclude that the Atomic Energy Act of 1954' , as amended, (AEA), authorizes such barter transactions. Background : DOE Barter Transactions In a number of instances, DOE has engaged in transactions involving the barter of DOE-owned uranium2 in exchange for various products or services. For example, DOE entered into a transaction with the United States Enrichment Corporation (USEC), under which USEC would


Emergency Response to a Transportation Accident Involving Radioactive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Response to a Transportation Accident Involving Response to a Transportation Accident Involving Radioactive Material Emergency Response to a Transportation Accident Involving Radioactive Material The purpose of this User's Guide is to provide instructors with an overview of the key points covered in the video. The Student Handout portion of this Guide is designed to assist the instructor in reviewing those points with students. The Student Handout should be distributed to students after the video is shown and the instructor should use the Guide to facilitate a discussion on each response disciplines' activities or duties at the scene. During this discussion, the instructor can present response scenarios, each of which would have a different discipline arriving first at the accident scene. The purpose of this discussion


Get Involved with Home Energy Score | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Residential Buildings » Home Energy Score » Get Involved with Residential Buildings » Home Energy Score » Get Involved with Home Energy Score Get Involved with Home Energy Score The Department of Energy's (DOE) Home Energy Score helps homeowners understand the energy performance of their homes and how they compare to other homes nationwide. Energy professionals and organizations can use the Score to promote energy efficiency to homeowners and encourage investments in energy improvements. Information for Homeowners Information for Interested Organizations Information for Interested Assessors Highlights Home Energy Scoring Tool Updated Home Energy Scoring Tool v.2014 features improved calculation methodology, user interface and mobility on the 10-point scale. Visit the Research and Background webpage and DOE's Progress Alert to learn more.


Using dual decomposition for solving problems involving data uncertainty |  

NLE Websites -- All DOE Office Websites (Extended Search)

dual decomposition for solving problems involving data uncertainty dual decomposition for solving problems involving data uncertainty August 14, 2013 Tweet EmailPrint Many applications mdash; energy, routing, scheduling, and production planning, for example mdash; involve problems in which some or all of the data may not be known when decisions under uncertainty must be made. In such cases, approximations with stochastic mixed-integer programming models are often used. Two approaches have been suggested to address such problems: dual decomposition (DD) and branch-and-price (BP). Both approaches divide the problem into two or more subproblems, together with linear constraints that enforce agreement between solutions to the different problems through a series of iterations. Unfortunately, both approaches also suffer from lack


Hydro Stakeholder Collaboration and Public Involvement Planning Case Studies  

Science Conference Proceedings (OSTI)

This report describes nine utility case applications of the hydro stakeholder communications and public involvement tools presented in a recent EPRI report. The resulting experience can assist utilities in developing an effective public outreach program that will pay off in long-term public support for hydro relicensing and operations.



Involving Indigenous Peoples in Protected Area Management: Comparative Perspectives from  

E-Print Network (OSTI)

on the author's several years of field research experience in local community involve- ment in parks responsibility (IUCN/WWF 1999). These principles and guidelines state that indigenous people be recognized. Poverty; lack of education, access to health, and other government ser- vices; low level of infrastructure

Wilmers, Chris


Testing alternative models of individuals' social media involvement and satisfaction  

Science Conference Proceedings (OSTI)

This study extends the Technology Acceptance Model 3 (TAM 3) within the context of the rapidly evolving area of social media. Since social media requires the user's active participation and processing of information as well as the creation of user-generated ... Keywords: Involvement, Social media sites, Social media usage intention, TAM 3, Three alternative models, User satisfaction

Jeen-Su Lim, Abdulrahman Al-Aali, John H. Heinrichs, Kee-Sook Lim



Case against private utility involvement in solar/insulation programs  

SciTech Connect

The arguments against private utility involvement are arranged under the following headings: excessive profit-taking, monopolization/favoritism, increased cost to consumers, homeowners would pay twice, the lack of accountability, the lack of commitment to solar by utilities, solar/political/ethical considerations, solar/conservation technologies are inherently decentralized, and the other alternatives. (MHR)

Bossong, K.


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Feature - Argonne involved with proposed Green Fuels Depot in Naperville  

NLE Websites -- All DOE Office Websites (Extended Search)

involved in Naperville's proposed Green Fuels Depot involved in Naperville's proposed Green Fuels Depot Naperville's proposed Green Fuels Depot The proposed Green Fuels Depot would produce renewable fuels for Naperville's vehicle fleet. Using grass clippings to power next-generation vehicles - now that's green transportation. This is one of the ideas being considered at Naperville's newly proposed Green Fuels Depot. The project, which will require $4 million in funding to get started, would bring together Argonne National Laboratory, the city of Naperville, Packer Engineering and the College of DuPage for an innovative plan to produce renewable energy. "It's a golden opportunity for Argonne to be associated with one of our neighboring communities in promoting new technologies that we have pioneered here at the laboratory," said Glenn Keller, manager of vehicle


Human Operational Errors Involving Control, Relay, and Auxiliary Equipment  

Science Conference Proceedings (OSTI)

This report describes the objectives, information gathering and analysis, and findings of a research effort related to human operational errors involving control, relay, and auxiliary equipment. This research is conducted by the Switching Safety and Reliability Project of EPRI8217s Substations Program. The project consists of three separate studies: 8226 an analysis of relay-related incidents attributed to human errors, 8226 a compilation of work practices when planning and performing work on relays, an...



State Traffic Safety Information - Fatal Crashes Involving Speeding :  

NLE Websites -- All DOE Office Websites (Extended Search)

Illinois (2007-2009) Illinois (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving Speeding : Illinois (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


State Traffic Safety Information - Fatal Crashes Involving a Large Truck :  

NLE Websites -- All DOE Office Websites (Extended Search)

Hawaii (2007-2009) Hawaii (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving a Large Truck : Hawaii (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


State Traffic Safety Information - Fatal Crashes Involving a Large Truck :  

NLE Websites -- All DOE Office Websites (Extended Search)

Delaware (2007-2009) Delaware (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving a Large Truck : Delaware (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness


State Traffic Safety Information - Fatal Crashes Involving Speeding :  

NLE Websites -- All DOE Office Websites (Extended Search)

Hawaii (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving Speeding : Hawaii (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


State Traffic Safety Information - Fatal Crashes Involving a Large Truck :  

NLE Websites -- All DOE Office Websites (Extended Search)

District of Columbia (2007-2009) District of Columbia (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving a Large Truck : District of Columbia (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility


State Traffic Safety Information - Fatal Crashes Involving Speeding : Iowa  

NLE Websites -- All DOE Office Websites (Extended Search)

Iowa Iowa (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving Speeding : Iowa (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


Overview of the 2012 IECC and DOE's Involvement  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ENERGY CODES ENERGY CODES energycodes.gov BUILDING ENERGY CODES Overview of the 2012 IECC and DOE's Involvement Pam Cole Building Energy Codes Program Pacific Northwest National Laboratory BUILDING ENERGY CODES energycodes.gov * 1980's through 2006 - Minimum codes were truly minimal - DOE pushed for marginal improvements (1% to 3% per cycle) - DOE proposed (successfully) a major rewrite of the IECC in 2004 (became the 2006 IECC)-emphasis was format, not stringency * 2009 to Present..... - Things are getting more serious The World of Codes BUILDING ENERGY CODES energycodes.gov * Summary of changes - ~30% better than 2006 IECC - Major changes * Consolidated with IRC energy chapter (actually a change to the IRC, not the IECC) * Mandatory whole-house pressure test * More stringent duct leakage test


State Traffic Safety Information - Fatal Crashes Involving a Large Truck :  

NLE Websites -- All DOE Office Websites (Extended Search)

Indiana (2007-2009) Indiana (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving a Large Truck : Indiana (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness


State Traffic Safety Information - Fatal Crashes Involving a Large Truck :  

NLE Websites -- All DOE Office Websites (Extended Search)

Idaho (2007-2009) Idaho (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving a Large Truck : Idaho (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


Accurate Numerical Simulations Of Chemical Phenomena Involved in Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Visualization of the spin density from the excess electron cluster. Robert Visualization of the spin density from the excess electron cluster. Robert Harrison Accurate Numerical Simulations Of Chemical Phenomena Involved in Energy Production and Storage with MADNESS and MPQC PI Name: Robert Harrison PI Email: harrisonrj@ornl.gov Institution: ORNL Allocation Program: ESP Allocation Hours at ALCF: 150 Million Year: 2010 to 2013 Research Domain: Chemistry Researchers propose to focus on the problems of catalysis and heavy element chemistry for fuel reprocessing-both of which are of immediate interest to the Department of Energy (DOE), are representative of a very broad class of problems in chemistry, and demand the enormous computational resources anticipated from the next generation of leadership computing facilities. Also common to both is the need for accurate electronic structure


State Traffic Safety Information - Fatal Crashes Involving Speeding :  

NLE Websites -- All DOE Office Websites (Extended Search)

Kansas (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving Speeding : Kansas (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


State Traffic Safety Information - Fatal Crashes Involving Speeding : Maine  

NLE Websites -- All DOE Office Websites (Extended Search)

Maine Maine (2007-2009) Research Menu Data/Tools Apps Resources Let's Talk Research Alpha You are here Data.gov » Communities » Research » Data State Traffic Safety Information - Fatal Crashes Involving Speeding : Maine (2007-2009) Dataset Summary Description The State Traffic Safety Information (STSI) portal is part of the larger Fatality Analysis Reporting System (FARS) Encyclopedia. STSI provides state-by-state traffic safety profiles, including: crash data, lives saved/savable, legislation, economic costs, grant funding, alcohol related crash data, performance measures, and geographic maps of crash data. Tags {geospatial,fatality,crash,data,safety,roadway,vehicle,human,person} Dataset Ratings Overall 0 No votes yet Data Utility 0 No votes yet Usefulness 0 No votes yet


An analysis of factors contributing to train-involved crashes  

E-Print Network (OSTI)

A railroad-highway grade crossing is a unique intersection in that two different modes of transportation (trains and vehicles) use the same physical space. Many factors can contribute to collisions between trains and vehicles at these crossings. Crashes involving trains and vehicles are a significant safety problem in Texas each year. This research attempts to identify and analyze contributing factors to train-involved accidents in Texas. Three years of accident data (1328 total accidents) were analyzed for the contributing factors. The contributing factors were classified into four categories: railroad factors, environmental factors, roadway factors, and driver/passenger factors. The accident data was analyzed using one and two-way classification tables. The frequency distributions for the accidents included in this study were compared to the corresponding frequency distributions for national or statewide accidents using a Chi-Square statistical test. Finally, research hypotheses were formulated based on a literature review of driver behavior and previous accident studies and then tested using population proportion tests. The results of the identification of contributing factors showed that tried to beat train, impaired driver, stuck, stalled, or stopped on tracks, driving around gates, and driver inattention were the five most frequent primary contributing factors. The Chi-Square comparison of frequency distributions for accidents included in this study showed that the protection type, time of day, light conditions, driver race and sex, accident severity, location type, and roadway class were statistically different compared to the corresponding national and statewide frequency distributions. The analysis of the research hypotheses showed that hypotheses 3, 8, and 10 were supported according to the population proportion testing.

Cooner, Scott Allen



Personnel involved in nuclear standards development: 1980 directory  

Science Conference Proceedings (OSTI)

The development of nuclear standards is an active and necessary endeavor that is concerned with the safe, orderly, and economic development of nuclear potential. There are almost 4100 people from the teachnical community who are presently involved either in writing nuclear standards, including codes, or in the management and processing roles necessary for their approval and promulgation. This document identifies the current participation of each individual as member, chairman, cochairman (vice-chairman), or secretary of about 700 standards development committees and groups. The standards committees and groups are identified with the organizations that are responsible for the preparation, review, and maintenance of the standards and that provide support through supervisory committees and headquarters staff. This directory includes four major sections: personnel, employers, committees, and a Key-Word-in-Context (KWIC) Index of committee titles. It can also be used to identify the participation of employers as well as to recognize the contributions of individuals to the often interdisciplinary activity of standards development.

Carr, S.J. (ed.)



The character of resonant charge exchange involving highly excited atoms  

SciTech Connect

We study the process of resonant charge exchange involving excited helium atoms with the principal quantum number n = 5 colliding with the helium ion in the ground state in the collision energy range from thermal up to 10 eV. This information may be important for the analysis of planet atmospheres containing helium, in particular, for Jupiter's atmosphere, but our basic interest is the transition from the quantum to classical description of this process, where, due to large cross sections, evaluations of the cross sections are possible. For the chosen process, quantum theory allows determining the cross section as a result of a tunnel electron transition, while classical theory accounts for over-barrier electron transitions. The classical theory additionally requires effective transitions between states with close energies. The analysis of these transitions for helium with n = 5 shows that electron momenta and their projections are mixed for a part of the states, while for other states, the mixing is absent. A simple criterion to separate such states is given. In addition, the main contribution to the cross section of resonant charge exchange follows from tunnel electron transitions. As a result, the quantum theory is better for calculating the cross sections of resonant charge exchange than the classical one and also allows finding the partial cross sections of resonant charge exchange, while the classical approach gives the cross section of resonant charge exchange in a simple manner with the accuracy of 20%.

Kosarim, A. V.; Smirnov, B. M., E-mail: bmsmirnov@gmail.com [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation); Capitelli, M. [University of Bari, Department of Chemistry (Italy); Laricchiuta, A. [IMIP CNR, Sezione Territoriale di Bari (Italy)



Surface interactions involved in flashover with high density electronegative gases.  

Science Conference Proceedings (OSTI)

This report examines the interactions involved with flashover along a surface in high density electronegative gases. The focus is on fast ionization processes rather than the later time ionic drift or thermalization of the discharge. A kinetic simulation of the gas and surface is used to examine electron multiplication and includes gas collision, excitation and ionization, and attachment processes, gas photoionization and surface photoemission processes, as well as surface attachment. These rates are then used in a 1.5D fluid ionization wave (streamer) model to study streamer propagation with and without the surface in air and in SF6. The 1.5D model therefore includes rates for all these processes. To get a better estimate for the behavior of the radius we have studied radial expansion of the streamer in air and in SF6. The focus of the modeling is on voltage and field level changes (with and without a surface) rather than secondary effects, such as, velocities or changes in discharge path. An experiment has been set up to carry out measurements of threshold voltages, streamer velocities, and other discharge characteristics. This setup includes both electrical and photographic diagnostics (streak and framing cameras). We have observed little change in critical field levels (where avalanche multiplication sets in) in the gas alone versus with the surface. Comparisons between model calculations and experimental measurements are in agreement with this. We have examined streamer sustaining fields (field which maintains ionization wave propagation) in the gas and on the surface. Agreement of the gas levels with available literature is good and agreement between experiment and calculation is good also. Model calculations do not indicate much difference between the gas alone versus the surface levels. Experiments have identified differences in velocity between streamers on the surface and in the gas alone (the surface values being larger).

Hodge, Keith Conquest; Warne, Larry Kevin; Jorgenson, Roy Eberhardt; Wallace, Zachariah Red; Lehr, Jane Marie



[The first steps of chlorophyll synthesis: RNA involvement and regulation  

DOE Green Energy (OSTI)

Glu-tRNA[sup Glu] is synthesized from glutamate and tRNA[sup Glu] by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA[sup Glu] has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA[sup Glu]. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA [yields] ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA[sup Glu] by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA[sup Glu] with a point mutation in the T[Psi]C-loop. The altered tRNA supports protein but not ALA synthesis.

Soell, D.



An external dose reconstruction involving a radiological dispersal device  

E-Print Network (OSTI)

Recent events have underscored the need for the United States government to provide streamlined emergency response procedures and subsequent dose estimations for personnel responding to incidents involving radioactive material. Indeed, the National Council on Radiation Protection and Measurements Report No. 138 (NCRP 2001) indicates that exposures received by first responders will be important for a number of reasons, including planning for the appropriate use of key personnel in an extended emergency situation. In response, the Department of Homeland Security has published Protective Action Guides (DHS 2006) to help minimize these exposures and associated risks. This research attempts to provide some additional radiological exposure knowledge so that an Incident Commander, with limited or no information, can make more informed decisions about evacuation, sheltering-in-place, relocation of the public, turn-back levels, defining radiation hazard boundaries, and in-field radiological dose assessments of the radiation workers, responders, and members of the public. A method to provide such insight begins with providing a model that describes the physics of radiation interactions, radiation source and geometry, collection of field measurements, and interpretation of the collected data. A Monte Carlo simulation of the model is performed so that calculated results can be compared to measured values. The results of this investigation indicate that measured organ absorbed doses inside a tissue equivalent phantom compared favorably to the derived organ absorbed doses measured by the Panasonic thermoluminescence dosimeters and with Monte Carlo â??Nâ?? Particle modeled results. Additionally, a Victoreen 450P pressurized ion chamber measured the integrated dose and these results compared well with the Panasonic right lateral TLD. This comparison indicates that the Victoreen 450P ionization chamber could potentially serve as an estimator of real-time effective dose and organ absorbed dose, if energy and angular dependence corrections could be taken into account. Finally, the data obtained in this investigation indicate that the MCNP model provided a reasonable method to determine organ absorbed dose and effective dose of a simulated Radiological Dispersal Device in an Inferior-Superior geometry with Na99mTcO4 as the source of radioactive material.

Hearnsberger, David Wayne


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Low-Level Plutonium Sample Involved in NIST-Boulder Lab ...  

Science Conference Proceedings (OSTI)

Low-Level Plutonium Sample Involved in NIST-Boulder Lab Incident. For Immediate Release: June 10, 2008. ...



The involvement of Pseudomonas putida in basidiome initiation of the cultivated mushroom Agaricus bisporus.  

E-Print Network (OSTI)

??The involvement of pseudomonads In the process of basidiome initiation of the cultivated mushroom Agaricus bisporus was investigated. Pseudomonads used throughout the study were identified (more)

Rainey, Paul Barton



Can I obtain a list of companies involved in the natural gas ...  

U.S. Energy Information Administration (EIA)

Can I obtain a list of companies involved in the natural gas industry, such as utilities, pipeline companies, and storage operators? Yes. EIA collects and publishes a ...



E-Print Network (OSTI)

??The present research investigates the cognitive and perceptual mechanisms involved in mania-proneness. Building on the work of Depue and colleagues (Depue & Iacono, 1989; Depue (more)

Mercer, Kimberly



Black Seminole involvement and leadership during the Second Seminole War, 1835 1842.  

E-Print Network (OSTI)

?? This thesis examines the involvement, leadership, and impact of the Black Seminoles during the Second Seminole War. In Florida, free Blacks, runaway slaves, and (more)

Dixon, Anthony E.



Why the CHI Community Should be Involved in Standards: Stories from Three CHI Participants  

Science Conference Proceedings (OSTI)

In this article, the three authors tell their stories about involvement in standards that are relevant to the computer human interaction community(CHI). Their reasoning for being involved is given and readers are also given information about different organizations that develop standards relevant to CHI.

Lund, Arnie; Scholtz, Jean; Bevan, Nigel



Dosimetric and Clinical Outcomes of Involved-Field Intensity-Modulated Radiotherapy After Chemotherapy for Early-Stage Hodgkin's Lymphoma With Mediastinal Involvement  

Science Conference Proceedings (OSTI)

Purpose: To evaluate the dosimetric and clinical outcomes of involved-field intensity-modulated radiotherapy (IF-IMRT) for patients with early-stage Hodgkin's lymphoma (HL) with mediastinal involvement. Methods and Materials: Fifty-two patients with early-stage HL that involved the mediastinum were reviewed. Eight patients had Stage I disease, and 44 patients had Stage II disease. Twenty-three patients (44%) presented with a bulky mediastinum, whereas 42 patients (81%) had involvement of both the mediastinum and either cervical or axillary nodes. All patients received combination chemotherapy followed by IF-IMRT. The prescribed radiation dose was 30-40 Gy. The dose-volume histograms of the target volume and critical normal structures were evaluated. Results: The median mean dose to the primary involved regions (planning target volume, PTV1) and boost area (PTV2) was 37.5 Gy and 42.1 Gy, respectively. Only 0.4% and 1.3% of the PTV1 and 0.1% and 0.5% of the PTV2 received less than 90% and 95% of the prescribed dose, indicating excellent PTV coverage. The median mean lung dose and V20 to the lungs were 13.8 Gy and 25.9%, respectively. The 3-year overall survival, local control, and progression-free survival rates were 100%, 97.9%, and 96%, respectively. No Grade 4 or 5 acute or late toxicities were reported. Conclusions: Despite the large target volume, IF-IMRT gave excellent dose coverage and a favorable prognosis, with mild toxicity in patients with early-stage mediastinal HL.

Lu Ningning [Department of Radiation Oncology, Cancer Hospital, National Cancer Center, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China)] [Department of Radiation Oncology, Cancer Hospital, National Cancer Center, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Li Yexiong, E-mail: yexiong@yahoo.com [Department of Radiation Oncology, Cancer Hospital, National Cancer Center, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China); Wu Runye; Zhang Ximei; Wang Weihu; Jin Jing; Song Yongwen; Fang Hui; Ren Hua; Wang Shulian; Liu Yueping; Liu Xinfan; Chen Bo; Dai Jianrong; Yu Zihao [Department of Radiation Oncology, Cancer Hospital, National Cancer Center, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China)] [Department of Radiation Oncology, Cancer Hospital, National Cancer Center, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing (China)




SciTech Connect

Data are summarized on incidents that have been sustained by the AEC in the transport of radioactive materials from 1957 through 1981. In the period covered by this report there were 47 incidents reported. Twenty-nine did not result in the release of radioactive materials. Of the remaining 18 cases there was none that involved any serious radiological consequences or involved costly cleanup. Six of the incidents involved onsite movements of materials. The incidents are classified in accordance with the type of radiation release that occurred, mode of transport, and type of incident. Photographs are included for a number of the incidents. (C.H.)

Patterson, D.E.; DeFatta, V.P.




NLE Websites -- All DOE Office Websites (Extended Search)

GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM The Department of Energy has on a variety of occasions engaged in transactions under which it bartered uranium to which it has title for goods or services . This guidance memorializes the results of analyses previously directed to individual proposed transactions . For the reasons discussed below, we conclude that the Atomic Energy Act of 1954' , as amended, (AEA), authorizes such barter transactions. GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM More Documents & Publications Leasing of Department of Energy Property Before the Senate Energy and Natural Resources Subcommittee on Energy EIS-0468: Final Environmental Impact Statement


Federal involvement in: municipal wastewater treatment plant sludge energy recovery and conservation  

DOE Green Energy (OSTI)

The results are presented of a study concerning federal involvement in municipal wastewater treatment plant (MWWTP) sludge energy recovery and conservation. The objectives of the study were to: determine and report the major agency programs and related MWWTP sludge energy recovery and conservation projects; determine and summarize the coordination efforts between federal agencies involved in MWWTP sludge; and recommend future U.S. Energy Research and Development Administration (ERDA) involvement in MWWTP sludge energy recovery and conservation projects. Specific federal agencies designated for surveying include ERDA, EPA, USDA, Bureau of Mines, National Science Foundation, and National Commission on Water Quality. Past (post-1966), present, and planned federal involvement in MWWTP sludge energy recovery and conservation, research and development, demonstration, and study projects were considered.




The obligation nation : America's involvement in the affairs of the World  

E-Print Network (OSTI)

Does America have an obligation, whether through foreign aid, military involvement, or by spreading democracy, to change the world? This thesis answers these above questions in intimate detail through the moral framework ...

Francel, Leif (Leif G.)



CHSH type Bell inequalities involving a party with two or three local binary settings  

E-Print Network (OSTI)

We construct a simple algorithm to generate any CHSH type Bell inequality involving a party with two local binary measurements from two CHSH type inequalities without this party. The algorithm readily generalizes to situations, where the additional observer uses three measurement settings. There, each inequality involving the additional party is constructed from three inequalities with this party excluded. With this generalization at hand, we construct and analyze new symmetric inequalities for four observers and three experimental settings per observer.

Yu-Chun Wu; Piotr Badziag; Marek ?ukowski



Conflict-of-Interest/Non-Disclosure Certificate For Reviewers Involved in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conflict-of-Interest/Non-Disclosure Certificate For Reviewers Conflict-of-Interest/Non-Disclosure Certificate For Reviewers Involved in the Selection of Subcontractors for NEUP Research and Development Funds Conflict-of-Interest/Non-Disclosure Certificate For Reviewers Involved in the Selection of Subcontractors for NEUP Research and Development Funds The Department of Energy has a policy that individuals with a conflict of interest cannot participate in the technical review of procurement proposals. This certification must be completed by individuals prior to their participation in the pre-application and/or proposal review processes. 1. I will not participate in the review of any pre-application or proposal involving a particular matter that would have a direct and predictable effect on any person, company or organization with which I have a


The Community Environmental Monitoring Program: Reducing Public Perception of Risk through Stakeholder Involvement  

Science Conference Proceedings (OSTI)

The Community Environmental Monitoring Program (CEMP) has promoted stakeholder involvement, awareness, and understanding of radiological surveillance in communities surrounding the Nevada Test Site (NTS) since 1981. It involves stakeholders in the operation, data collection, and dissemination of information obtained from a network of 29 stations across a wide area of Nevada, Utah and California. It is sponsored by the U.S. Department of Energy, National Nuclear Security Administrations Nevada Site Office (NNSA/NSO) and administered by the Desert Research Institute (DRI) of the Nevada System of Higher Education. Integration of a near real-time communications system, a public web site, training workshops for involved stakeholders, and educational programs all help to alleviate public perception of risk of health effects from past activities conducted at the NTS.

William T. Hartwell



Proposed Tenaska Washington II Generation Project : Final Environmental Impact Statement. Volume 2: Public Involvement.  

SciTech Connect

In regard to the proposed Tenaska Washington II Generation Project, the goal of the Bonneville Power Administration`s (BPA) Environmental Impact Statement (EIS) public involvement process is to determine the issues to be examined and pertinent analyses to be conducted and to solicit comments on the content and quality of information presented in the Draft Environmental Impact Statement (DEIS). Comments and questions are solicited from the public and government agencies during the scoping process and during the comment period and public hearing on the DEIS, to find out what is of most concern to them. The end product of the public involvement process is the Comment Report which follows in part of this volume on Public Involvement.

United States. Bonneville Power Administration.



Utility/Industry Partnerships Involving Distributed Generation Technologies in Evolving Electricity Markets  

E-Print Network (OSTI)

Electricity markets in the United States are undergoing unprecedented structural changes as a result of the confluence of regulatory, competitive, and technological forces. This paper will introduce the role of distributed generation technologies in evolving electric markets and will review both current and emerging distributed generation technologies aimed at retail industrial, commercial and residential markets. This paper will draw upon several Electric Power Research Institutes (EPRI) and member utility case studies involving the assessment of distributed generation in premium power service, standby power and industrial cogeneration applications. In addition, EPRI products and services which can help evaluate energy service options involving distributed generation will also be briefly reviewed.

Rastler, D. M.



A Model of the Internal Feedback System Involved in Late Quaternary Climatic Variations  

Science Conference Proceedings (OSTI)

Because of the small net rates of energy flow involved in very long-term changes in ice mass (10?1 W m?2) it will be impossible to proceed in a purely deductive manner to develop a theory for these changes. An inductive approach will be necessary-...

Barry Saltzman; Alfonso Sutera



Simulation study of an FES-Involved control strategy for lower limb rehabilitation robot  

Science Conference Proceedings (OSTI)

This paper proposes a functional electrical stimulation (FES)-involved control strategy for self-made exoskeleton lower limb rehabilitation robot for the training purpose of paraplegic patients caused by spinal cord injury (SCI) or stroke. Two muscles ... Keywords: FES, muscle model, rehabilitation robot, torque control

Yixiong Chen; Jin Hu; Feng Zhang; Zengguang Hou



WORLD MEDICAL ASSOCIATION DECLARATION OF HELSINKI Ethical Principles for Medical Research Involving Human Subjects  

E-Print Network (OSTI)

1 WORLD MEDICAL ASSOCIATION DECLARATION OF HELSINKI Ethical Principles for Medical Research, October 2008 A. INTRODUCTION 1. The World Medical Association (WMA) has developed the Declaration of Helsinki as a statement of ethical principles for medical research involving human subjects, including

Pfeifer, Holger


On the theory of energy distributions of products of molecular beam reactions involving transient complexes*  

E-Print Network (OSTI)

On the theory of energy distributions of products of molecular beam reactions involving transient October 1974) Theoretical energy distributions of reaction products in molecular beam systems for the energy distributions of the products when 1 > j and j > l. I. INTRODUCTION In recent years illuminating

Marcus, Rudolph A.

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Chemical Spills In the event of a spill involving hazardous chemicals  

E-Print Network (OSTI)

Chemical Spills In the event of a spill involving hazardous chemicals: 1. Keep a safe distance from. From a safe distance, try to gather as much information on the spilled chemical as possible. If the chemical name can be found, look up its MSDS and determine the PPE required. If the chemical is very

de Lijser, Peter


Water Resource Management and Hydropower: Guidebook for Collaboration and Public Involvement  

Science Conference Proceedings (OSTI)

This Guidebook provides processes and tools to help hydropower operators develop improved communications and "early and often" involvement with stakeholders. These processes can help identify and activate public support for hydro and ultimately avoid unnecessary loss of hydro generation and other limitations on hydro during relicensing.



Parabolic equation solution of seismo-acoustics problems involving variations in bathymetry and sediment thickness  

E-Print Network (OSTI)

Parabolic equation solution of seismo-acoustics problems involving variations in bathymetry September 2007; accepted 27 September 2007 Recent improvements in the parabolic equation method are combined to extend this approach to a larger class of seismo-acoustics problems. The variable rotated parabolic


Emergency Action Plan For incidents involving hazardous materials, fires, explosions, or natural gas  

E-Print Network (OSTI)

-492-6025. For Non-Emergency Fire and Natural Gas Questions call the CU Fire Marshall @ 303-492-4042. AdditionalEmergency Action Plan For incidents involving hazardous materials, fires, explosions, or natural gas leaks, the following actions should be taken: 1) Life Safety First 2) Evacuate Immediate Area 3

Colorado at Boulder, University of


The Savannah River Site's liquid radioactive waste operations involves the man  

NLE Websites -- All DOE Office Websites (Extended Search)

Site's liquid radioactive waste operations involves the management of space in the Site's Site's liquid radioactive waste operations involves the management of space in the Site's 49 underground waste tanks, including the removal of waste materials. Once water is removed from the waste tanks, two materials remain: salt and sludge waste. Removing salt waste, which fills approximately 90 percent of the tank space in the SRS tank farms, is a major step toward closing the Site's waste tanks that currently contain approximately 38 million gallons of waste. Due to the limited amount of tank space available in new-style tanks, some salt waste must be dispositioned in the interim to ensure sufficient tank space for continued sludge washing and to support the initial start-up and salt processing operations at the Salt Waste Processing Facility (SWPF).


The Department of Energy (DOE) is actively involved in leading the  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(DOE) is actively involved in leading the (DOE) is actively involved in leading the development of advanced applications and tools to more effectively operate the electricity delivery system by enabling advanced analysis, visualization, monitoring and alarming, and decision support capabilities for grid operators. These applications use-and greatly increase the value of-data coming from high-resolution electrical measuring devices known as phasor measurement units (PMUs), whose deployment is being facilitated by the North American SynchroPhasor Initiative. The advanced applications research and development activities of DOE and its industry partners are a key component of the success of American Recovery and Reinvestment Act (ARRA) programs. By the time the ARRA projects are completed in 2014, several of these applications are expected to be fully


Report on electrocutions, electric shock, and electric burn injuries involving consumer products. final report  

SciTech Connect

This report provides direction to a project to reduce the number of electrocution, electric shock and electric burn injuries. The first section uses CPSC data to rank the consumer products involved in these accidents on the basis of frequency, severity, and number of products in use. It also analyzes demographic and accident characteristics. The second section contains a technical review of accidents occurring in eight product groups: Portable Power Tools; Welders, Battery Chargers and Inverters; Personal Hygiene Products; Entertainment Products; Lawn and Garden Tools; Installed Stoves, Ranges and Cook Tops; Refrigerators and Freezers; and Fans. This section also includes a review of the relevant Underwriters Laboratories (UL) standards and suggestions for potential action to reduce the accidents involving these eight product groups.

Not Available



Mitigation of Human Operational Errors Involving Control, Relay, and Auxiliary Equipment  

Science Conference Proceedings (OSTI)

This report describes the objectives and current status of a research effort related to human operational errors involving control, relay, and auxiliary equipment. This research is conducted by the Switching Safety and Reliability Project of EPRI's Substations Program. The report describes the data collection process for three ongoing studies on the above-named subject, and preliminary findings based on data collected from participating utilities by the end of November 2005. The project is expected to be...



Parametric completely generalized mixed implicit quasi-variational inclusions involving h-maximal monotone mappings  

Science Conference Proceedings (OSTI)

A new class of parametric completely generalized mixed implicit quasi-variational inclusions involving h-maximal monotone mappings is introduced. By applying resolvent operator technique of h-maximal monotone mapping and the property of fixed point set ... Keywords: 47H05, 47J20, 47J25, 49J40, 49J53, Parametric completely generalized mixed implicit quasi-variational inclusion, Resolvent operator, Sensitivity analysis, h-maximal monotone mapping

Xie Ping Ding



Stakeholder involvement and public outreach at two Department of Energy sites  

Science Conference Proceedings (OSTI)

Outreach efforts at two U.S. Department of Energy sites (i.e., the Hanford Site in southeastern Washington and Pantex Plant in the Texas panhandle) have involved a broad spectrum of communications media, including technical presentations and articles, information brochures and fact sheets, video productions; interactive exhibits; presentations at civic and other public meetings; and proactive interactions with the news media, regulators and concerned citizens. In addition, representatives of local communities operate offsite environmental monitoring stations and Native Americans are involved in studying cultural resources, fisheries, and other issues at Hanford, and a program to obtain environmental samples from neighbors property is underway at Pantex. All major environmental programs (e.g., the reconstruction of past radiological doses to offsite human populations at Hanford) are conducted with open public participation, the Pantex Plant has opened an Information office in Amarillo, Texas, and both sites now have Citizen`s Advisory Boards. This presentation describes Hanford and Pantex public outreach and involvement efforts, our successes and failures, and the lessons learned.

Gray, R.H. [Battelle Pantex, Amarillo, TX (United States)



A review of two recent occurrences at the Advanced Test Reactor involving subcontractor activities  

Science Conference Proceedings (OSTI)

This report documents the results of a brief, unofficial investigation into two incidents at the Idaho National Engineering and Environmental Laboratory (INEEL) Advanced Test Reactor (ATR) facility, reported on October 25 and 31, 1997. The first event was an unanticipated breach of confinement. The second involved reactor operation with an inoperable seismic scram subsystem, violating the reactor`s Technical Specifications. These two incidents have been found to be unrelated. A third event that occurred on December 16, 1996, is also discussed because of its similarities to the first event listed above. Both of these incidents were unanticipated breaches of confinement, and both involved the work of construction subcontractor personnel. The cause for the subcontractor related occurrences is a work control process that fails to effectively interface with LMITCO management. ATR Construction Project managers work sufficient close with construction subcontractor personnel to understand planned day-to-day activities. They also have sufficient training and understanding of reactor operations to ensure adherence to applicable administrative requirements. However, they may not be sufficiently involved in the work authorization and control process to bridge an apparent communications gap between subcontractor employees and Facility Operations/functional support personnel for work inside the reactor facility. The cause for the inoperable seismic scram switch (resulting from a disconnected lead) is still under investigation. It does not appear to be subcontractor related.

Dahlke, H.J.; Jensen, N.C.; Vail, J.A.



Using best available scientific information in assessing the involvement of energy industries at Superfund sites  

SciTech Connect

The US Congress is currently reauthorizing the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA or Superfund). Enacted in 1980, CERCLA has been criticized for its costly and time-consuming requirements, unfairness, need for better scientific information, and lack of progress in reducing health and environmental risks. This paper describes the development of a database of energy-industry involvement at Superfund sites, using the best available scientific information. It illustrates the difficulties in reporting, compiling, and assessing data as currently managed under CERCLA. It also presents analytical results, indicating the number of sites at which there has been energy-industry involvement (roughly one-fourth to one-third of all Superfund sites), and for these sites, the numbers of energy companies that are potentially responsible parties (about 500 individual companies), the estimated cleanup costs (an average of $18 million per site), and the volumetric shares of hazardous waste contributed by energy companies (up to one-third of the volume at sites with energy-industry involvement). Such results provide a basis for evaluating impacts of Superfund changes on energy companies.

Elcock, D.; Puder, M.



ABSTRACT: The Community Environmental Monitoring Program: Reducing Public Perception of Risk Through Stakeholder Involvement  

Science Conference Proceedings (OSTI)

Between 1951 and 1992, 928 nuclear tests were conducted at the Nevada Test Site (NTS), including 100 atmospheric and 828 underground tests. Initial public reaction to the tests was largely supportive, but by the late 1950s this began to change, largely as a result of fear of the potential for adverse health effects to be caused by exposure to ionizing radiation resulting from the tests. The nuclear power plant accident at Three Mile Island in 1979 served to heighten these fears, as well as foster a general distrust of the federal agencies involved and low public confidence in monitoring results. Modeled after a similar program that involved the public in monitoring activities around the Three Mile Island nuclear power plant, the Community Environmental Monitoring Program (CEMP) has promoted stakeholder involvement, awareness, and understanding of radiological surveillance in communities surrounding the NTS since 1981. It involves stakeholders in the operation, data collection, and dissemination of information obtained from a network of 29 stations across a wide area of Nevada, Utah, and California. It is sponsored by the U.S. Department of Energy, National Nuclear Security Administration Nevada Site Office (NNSA/NSO) and administered by the Desert Research Institute (DRI) of the Nevada System of Higher Education. Since assuming administration of the program in 2000, DRI has accomplished significant enhancements to the network's data collection and transmission capabilities. A robust datalogging and communications system allows for the near real-time transmission of data to a platform maintained by DRI's Western Regional Climate Center, where the data are uploaded and displayed on a publicly accessible web site (http://cemp.dri.edu/). Additionally, the CEMP can serve as part of an emergency response network in the event of an unplanned radiological release from the NTS, and also provides an excellent platform for testing new environmental sensor technologies. Finally, the CEMP provides training workshops for involved stakeholders, and educational programs, which help to alleviate public perception of risk of health effects from past activities conducted at the NTS.

T. Hartwell



US Department of Energy Oak Ridge Operations Environmental Management Public Involvement Plan for the Oak Ridge Reservation  

SciTech Connect

This document was prepared in accordance with CERCLA requirements for writing community relations plans. It includes information on how the DOE Oak Ridge Operations Office prepares and executes Environmental Management Community relations activities. It is divided into three sections: the public involvement plan, public involvement in Oak Ridge, and public involvement in 1995. Four appendices are also included: environmental management in Oak Ridge; community and regional overview; key laws, agreements, and policy; and principal contacts.



LOFAR-UK White Paper: A Science case for UK involvement in LOFAR  

E-Print Network (OSTI)

LOFAR, the Low-Frequency Array, is a next-generation software-driven radio telescope operating between 30 and 240MHz, currently under construction by ASTRON in the Netherlands. This low frequency radio band is one of the few largely unexplored regions of the electromagnetic spectrum. The sensitivity and angular resolution offered by LOFAR will be two to three orders of magnitude better than existing telescopes, and as such it will open up this new window on the Universe. LOFAR will impact on a broad range of astrophysics, from cosmology to solar system studies. There is growing European involvement in LOFAR, driven by the need to add stations far from the main core in order to improve angular resolution. LOFAR-UK is a project aimed at cementing UK participation in LOFAR via the operation of four stations within the UK. LOFAR-UK ground stations will allow LOFAR observations to reach sub-arcsecond scales at the highest frequencies, and as a result will also improve the (confusion-limited) sensitivity limit of the telescope for deep surveys. LOFAR-UK will achieve involvement for UK astronomers in a world-leading science facility operating in the immediate future. It will allow the UK to build up important scientific and technical expertise in `next generation' radio astronomy in preparation for the Square Kilometre Array (SKA), and will play an important role in broadening the UK community that has an interest in radio astronomy. This White Paper outlines the strategic importance to the UK astronomy community of gaining involvement in the LOFAR project, the scientific interests of UK researchers in using the telescope, and the technical challenges that will need to be overcome [abridged].

P. N. Best; the LOFAR-UK Consortium



Report on a workshop on transportation-accident scenarios involving spent fuel  

SciTech Connect

Much confusion and skepticism resulted from the scenarios for transportation accidents involving spent fuel that have been presented in environmental impact statements because the supporting assumptions and conclusions from the scenarios did not always appear to be consistent. As a result, the Transportation Technology Center gathered a group whose participants were experts in disciplines related to the transport of spent fuel to consider the scenarios. The group made a number of recommendations about scenario development and about areas in need of further study. This report documents the discussions held and the recommendations and conclusions of the group.

Wilmot, E.L.; McClure, J.D.; Luna, R.E.



The community environmental monitoring program: a model for stakeholder involvement in environmental monitoring  

Science Conference Proceedings (OSTI)

Since 1981, the Community Environmental Monitoring Program (CEMP) has involved stakeholders directly in its daily operation and data collection, as well as in dissemination of information on radiological surveillance in communities surrounding the Nevada Test Site (NTS), the primary location where the United States (US) conducted nuclear testing until 1992. The CEMP is funded by the US Department of Energy's National Nuclear Security Administration, and is administered by the Desert Research Institute (DRI) of the Nevada System of Higher Education. The CEMP provides training workshops for stakeholders involved in the program, and educational outreach to address public concerns about health risk and environmental impacts from past and ongoing NTS activities. The network includes 29 monitoring stations located across an approximately 160,000 km{sup 2} area of Nevada, Utah and California in the southwestern US. The principal radiological instruments are pressurized ion chambers for measuring gamma radiation, and particulate air samplers, primarily for alpha/beta detection. Stations also employ a full suite of meteorological instruments, allowing for improved interpretation of the effects of meteorological events on background radiation levels. Station sensors are wired to state-of-the-art data-loggers that are capable of several weeks of on-site data storage, and that work in tandem with a communications system that integrates DSL and wireless internet, land line and cellular phone, and satellite technologies for data transfer. Data are managed through a platform maintained by the Western Regional Climate Center (WRCC) that DRI operates for the U.S. National Oceanic and Atmospheric Administration. The WRCC platform allows for near real-time upload and display of current monitoring information in tabular and graphical formats on a public web site. Archival data for each station are also available on-line, providing the ability to perform trending analyses or calculate site-specific exposure rates. This configuration also allows for remote programming and troubleshooting of sensors. Involvement of stakeholders in the monitoring process provides a number of benefits, including increased public confidence in monitoring results, as well as decreasing costs by more than 50 percent from when the program was managed entirely by U.S. federal employees. Additionally, the CEMP provides an ideal platform for testing new environmental sensors. (authors)

Hartwell, William T. [Division of Earth and Ecosystem Sciences, Desert Research Institute, Las Vegas, Nevada (United States); Shafer, David S. [Division of Hydrological Sciences, Desert Research Institute, Las Vegas, Nevada (United States)



Structural Snapshots of Tankyrase, a Protein Involved in a Rare Genetic  

NLE Websites -- All DOE Office Websites (Extended Search)

The Road to Ultrahigh-Resolution X-ray Spectrometers The Road to Ultrahigh-Resolution X-ray Spectrometers How Atoms Behave: Characteristics of Microstructural Avalanches Iodate Refuses to Intimidate Creating the Heart of a Planet in the Heart of a Gem How a Powerful Antibody Neutralizes HIV Science Highlights Archives: 2013 | 2012 | 2011 | 2010 2009 | 2008 | 2007 | 2006 2005 | 2004 | 2003 | 2002 2001 | 2000 | 1998 | Subscribe to APS Science Highlights rss feed Structural Snapshots of Tankyrase, a Protein Involved in a Rare Genetic Disorder and Potential Cancer Target DECEMBER 15, 2011 Bookmark and Share Tankyrase binding motifs derived from various Tankyrase substrates employ a common mode for Tankyrase binding. A discovery made with the help of x-rays from the Advanced Photon Source (APS) at Argonne National Laboratory provides researchers with a greater


The value of adding regional to local stakeholder involvement in evaluating the acceptability of innovative technologies  

SciTech Connect

Technology is urgently needed to clean up contamination by volatile organic compounds at United States Department of Energy (DOE) sites. In many cases, however, existing technology is too slow, inefficient, or expensive. The record of technology development is, in some cases, similarly disappointing. Remediation technologies developed at great expense and evaluated piecemeal over long periods have not been deployed because, in the end, the public judged them ineffective or unacceptable. The need for successful methods of remediation is too great and resources too limited to continue with ineffective technology evaluation. In order to make good decisions about which technologies to deploy, remedial project managers need to know stakeholders` requirements for the performance of proposed technologies. Expanding stakeholder involvement regionally identifies the concerns of a broad range of stakeholders at and DOE sites throughout the West -- issues that must be taken into account if technologies are to be accepted for wide deployment.

Peterson, T.S.; McCabe, G. [Pacific Northwest Lab., Richland, WA (United States); Niesen, K.; Serie, P. [Environmental Issues Management, Inc., Seattle, WA (United States)



Involvement of calcium-sensing receptor in ischemia/reperfusion-induced apoptosis in rat cardiomyocytes  

Science Conference Proceedings (OSTI)

The calcium-sensing receptor (CaR) is a seven-transmembrane G-protein coupled receptor, which activates intracellular effectors, for example, it causes inositol phosphate (IP) accumulation to increase the release of intracellular calcium. Although intracellular calcium overload has been implicated in the cardiac ischemia/reperfusion (I/R)-induced apoptosis, the role of CaR in the induction of apoptosis has not been fully understood. This study tested the hypothesis that CaR is involved in I/R cardiomyocyte apoptosis by increasing [Ca{sup 2+}]{sub i}. The isolated rat hearts were subjected to 40-min ischemia followed by 2 h of reperfusion, meanwhile GdCl{sub 3} was added to reperfusion solution. The expression of CaR increased at the exposure to GdCl{sub 3} during I/R. By laser confocal microscopy, it was observed that the intracellular calcium was significantly increased and exhibited a collapsed {delta}{psi} {sub m}, as monitored by 5,5',6,6'-tetrachloro-1,1',3,3'- tetraethylbenzimidazolcarbocyanine iodide (JC-1) during reperfusion with GdCl{sub 3}. Furthermore, the number of apoptotic cells was significantly increased as shown by TUNEL assay. Typical apoptotic cells were observed with transmission electron microscopy in I/R with GdCl{sub 3} but not in the control group. The expression of cytosolic cytochrome c and activated caspase-9 and caspase-3 was significantly increased whereas the expression of mitochondrial cytochrome c significantly decreased in I/R with GdCl{sub 3} in comparison to the control. In conclusion, these results suggest that CaR is involved in the induction of cardiomyocyte apoptosis during ischemia/reperfusion through activation of cytochrome c-caspase-3 signaling pathway.

Zhang Weihua [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Fu Songbin [Department of Genetics, Harbin Medical University, Harbin 150086 (China); Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150086 (China); Lu Fanghao [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China)]. E-mail: lufanghao1973@yahoo.com.cn; Wu Bo [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Gong Dongmei [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Pan, Zhen-wei [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Lv Yanjie [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Zhao Yajun [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Li Quanfeng [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Wang Rui [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China); Department of Biology, Lakehead University, Thunder Bay, Ont., P7B5E1 (Canada); Yang Baofeng [Department of Pharmacology, Harbin Medical University, Harbin 150086 (China); Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150086 (China); Xu Changqing [Department of Pathophysiology, Harbin Medical University, Harbin 150086 (China) and Bio-pharmaceutical Key Laboratory of Heilongjiang Province, Harbin 150086 (China)]. E-mail: xucq@163.com


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Application of Dissolution Dynamic Nuclear Polarization to the Characterization of Reactions Involving Large Molecules  

E-Print Network (OSTI)

Nuclear magnetic resonance (NMR) spectroscopy is one of the most important analytical tools for organic and biological chemistry. It provides not only detailed information on the structure of small molecules and macromolecules, but also on molecular interactions. Because of the inherent low sensitivity of NMR, a long signal averaging time or a high spin concentration is often required. A variety of methods have been explored to improve the sensitivity of NMR. Especially, large signal gains can be obtained by hyperpolarization of the nuclear spins. NMR signals of hyperpolarized samples are enhanced by several orders of magnitude. Dissolution Dynamic Nuclear Polarization (D-DNP) is a versatile technique capable of polarizing many different nuclei in the solid state, and subsequently providing a hyperpolarized liquid sample following a dissolution step. The resulting signal enhancement has made it possible to obtain detailed information in research fields as varied as metabolic imaging or enzyme catalysis. This dissertation aims to extend the applicability of D-DNP into new areas of chemistry, which involve the characterization of interactions and reactions involving large molecules. In a first project, fluorine hyperpolarization is exploited to investigate protein-ligand interactions. The enhancement of 19F signal allows for the detection of submicromolar concentrations of fluorinated ligands in the strong-, intermediate-, and weak-binding regimes. Several NMR parameters are utilized to observe ligand binding to the macromolecule, and to determine dissociation constants. In a second project, competitive binding of ligands to the same binding pocket on a protein is investigated. Here, polarization flows from a first ligand hyperpolarized on protons to the protein, and then to the second ligand. The buildup in function of time of the signals due to this relayed nuclear Overhauser effect contains structural information on the binding epitope. In a third project, the aim is to directly detect a larger molecule, a polymer, which has been synthesized starting from hyperpolarized monomers. Using DNP, single scan observation of 13C, a common nucleus with large chemical shift dispersion, is possible. Time resolved 13C NMR spectroscopy in combination with kinetic models permits the description of polymerization reaction of the living anionic polymerization of styrene. In summary, several approaches have been investigated for utilizing a large hyperpolarization initially produced on small molecules, for the benefit of characterizing properties of macromolecules. These developments extend the capabilities of D-DNP and demonstrate the potential for leading to new applications in fields as diverse as drug discovery and polymer science.

Lee, Youngbok



Pancreatic Neuroendocrine Tumors With Involved Surgical Margins: Prognostic Factors and the Role of Adjuvant Radiotherapy  

SciTech Connect

Purpose: Pancreatic neuroendocrine tumors (pNET) are rare neoplasms associated with poor outcomes without resection, and involved surgical margins are associated with a worse prognosis. The role of adjuvant radiotherapy (RT) in these patients has not been characterized. Methods and Materials: We retrospectively evaluated 46 consecutive patients with positive or close (<1 mm) margins after pNET resection, treated from 1983 to 2010, 16 of whom received adjuvant RT. Median RT dose was 50.4 Gy in 1.8-Gy fractions; half the patients received concurrent chemotherapy with 5-fluorouracil or capecitabine. No patients received adjuvant chemotherapy. Cox multivariate analysis (MVA) was used to analyze factors associated with overall survival (OS). Results: Median age at diagnosis was 56 years, and 52% of patients were female. Median tumor size was 38 mm, 57% of patients were node-positive, and 11% had a resected solitary liver metastasis. Patients who received RT were more likely to have larger tumors (median, 54 mm vs. 30 mm, respectively, p = 0.002) and node positivity (81% vs. 33%, respectively, p = 0.002) than those not receiving RT. Median follow-up was 39 months. Actuarial 5-year OS was 62% (95% confidence interval [CI], 41%-77%). In the group that did not receive RT, 3 patients (10%) experienced local recurrence (LR) and 5 patients (18%) developed new distant metastases, while in the RT group, 1 patient (6%) experienced LR and 5 patients (38%) developed distant metastases. Of all recurrences, 29% were LR. On MVA, male gender (adjusted hazard ratio [AHR] = 3.81; 95% CI, 1.21-11.92; p = 0.02) and increasing tumor size (AHR = 1.02; 95% CI, 1.01-1.04; p = 0.007) were associated with decreased OS. Conclusions: Long-term survival is common among patients with involved-margin pNET. Despite significantly worse pathologic features among patients receiving adjuvant RT, rates of LR between groups were similar, suggesting that RT might aid local control, and merits further evaluation.

Arvold, Nils D. [Harvard Radiation Oncology Program, Harvard Medical School, Boston, MA (United States); Willett, Christopher G. [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Fernandez-del Castillo, Carlos [Department of Surgery, Massachusetts General Hospital, Boston, MA (United States); Ryan, David P. [Department of Medicine, Massachusetts General Hospital, Boston, MA (United States); Ferrone, Cristina R. [Department of Surgery, Massachusetts General Hospital, Boston, MA (United States); Clark, Jeffrey W.; Blaszkowsky, Lawrence S. [Department of Medicine, Massachusetts General Hospital, Boston, MA (United States); Deshpande, Vikram [Department of Pathology, Massachusetts General Hospital, Boston, MA (United States); Niemierko, Andrzej [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States); Allen, Jill N.; Kwak, Eunice L.; Wadlow, Raymond C.; Zhu, Andrew X. [Department of Medicine, Massachusetts General Hospital, Boston, MA (United States); Warshaw, Andrew L. [Department of Surgery, Massachusetts General Hospital, Boston, MA (United States); Hong, Theodore S., E-mail: Tshong1@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Boston, MA (United States)



Risk of Developing Cardiovascular Disease After Involved Node Radiotherapy Versus Mantle Field for Hodgkin Lymphoma  

SciTech Connect

Purpose: Hodgkin lymphoma (HL) survivors are known to have increased cardiac mortality and morbidity. The risk of developing cardiovascular disease after involved node radiotherapy (INRT) is currently unresolved, inasmuch as present clinical data are derived from patients treated with the outdated mantle field (MF) technique. Methods and Materials: We included all adolescents and young adults with supradiaphragmatic, clinical Stage I-II HL treated at our institution from 2006 to 2010 (29 patients). All patients were treated with chemotherapy and INRT to 30 to 36 Gy. We then simulated a MF plan for each patient with a prescribed dose of 36 Gy. A logistic dose-response curve for the 25-year absolute excess risk of cardiovascular disease was derived and applied to each patient using the individual dose-volume histograms. Results: The mean doses to the heart, four heart valves, and coronary arteries were significantly lower for INRT than for MF treatment. However, the range in doses with INRT treatment was substantial, and for a subgroup of patients, with lymphoma below the fourth thoracic vertebrae, we estimated a 25-year absolute excess risk of any cardiac event of as much as 5.1%. Conclusions: Our study demonstrates a potential for individualizing treatment by selecting the patients for whom INRT provides sufficient cardiac protection for current technology; and a subgroup of patients, who still receive high cardiac doses, who would benefit from more advanced radiation technique.

Maraldo, Maja V., E-mail: dra.maraldo@gmail.com [Department of Radiation Oncology, Rigshospitalet, Copenhagen (Denmark); Brodin, Nils Patrik; Vogelius, Ivan R.; Aznar, Marianne C.; Munck af Rosenschoeld, Per; Petersen, Peter M. [Department of Radiation Oncology, Rigshospitalet, Copenhagen (Denmark); Specht, Lena [Department of Radiation Oncology, Rigshospitalet, Copenhagen (Denmark); Faculty of Health Sciences, University of Copenhagen, Copenhagen (Denmark)



From public participation to stakeholder involvement: The rocky road to more inclusiveness  

Science Conference Proceedings (OSTI)

Surviving always at the edge of extinction, public participation in environmental decision making has an uncertain and problematic history. From its emergence from the urban planning and delivery system efforts of the 1960s to many siting and non-siting uses today, it remains a battleground, with few successes and many failures. While some compelling structural, organizational and cultural explanations for this state of affairs exist, the author offers a further one--a too-limited definition and vision of public participation. One then can argue for a more inclusive process such as stakeholder involvement (SI) to enable a more viable approach to decision making. One can argue that the narrow conceptualization offered in the term public participation (PP) is partly responsible for the meager results of decades of efforts by earnest practitioners. Because of the limited, unique, and self-selected publics that respond to the major PP mechanisms such as public hearings, PP has become largely the province of organized activist groups and is largely accepted as such by most parties, including PP professionals. The author reviews the roles of Congress, federal agencies/proponents, local governments, activist groups and PP professionals in creating the current limited PP processes. She discusses trends and prospects for moving to broader based, more inclusive SI approaches. The emerging SI approach presents major methodological and organizational challenges, but offers the promise of outcomes more likely to be legitimated and potentially more lasting.

Peelle, E.



TopBP1 associates with NBS1 and is involved in homologous recombination repair  

SciTech Connect

TopBP1 is involved in DNA replication and DNA damage checkpoint. Recent studies have demonstrated that TopBP1 is a direct positive effecter of ATR. However, it is not known how TopBP1 recognizes damaged DNA. Here, we show that TopBP1 formed nuclear foci after exposure to ionizing radiation, but such TopBP1 foci were abolished in Nijmegen breakage syndrome cells. We also show that TopBP1 physically associated with NBS1 in vivo. These results suggested that NBS1 might regulate TopBP1 recruitment to the sites of DNA damage. TopBP1-depleted cells showed hypersensitivity to Mitomycin C and ionizing radiation, an increased frequency of sister-chromatid exchange level, and a reduced frequency of DNA double-strand break induced homologous recombination repair. Together, these results suggested that TopBP1 might be a mediator of DNA damage signaling from NBS1 to ATR and promote homologous recombination repair.

Morishima, Ken-ichi [Department of Radiation Biology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Sakamoto, Shuichi; Kobayashi, Junya [Department of Genome Dynamics, Radiation Biology Center, Kyoto University, Kyoto 606-8501 (Japan); Izumi, Hideki; Suda, Tetsuji; Matsumoto, Yoshiyuki [Department of Radiation Biology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan); Tauchi, Hiroshi [Department of Environmental Sciences, Ibaraki University, Mito, Ibaraki 310-8512 (Japan); Ide, Hiroshi [Department of Mathematical and Life Sciences, Graduate School of Science, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8562 (Japan); Komatsu, Kenshi [Department of Genome Dynamics, Radiation Biology Center, Kyoto University, Kyoto 606-8501 (Japan); Matsuura, Shinya [Department of Radiation Biology, Research Institute for Radiation Biology and Medicine, Hiroshima University, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8553 (Japan)], E-mail: shinya@hiroshima-u.ac.jp



Endovascular Treatment of Infrarenal Abdominal Aortic Lesions With or Without Common Iliac Artery Involvement  

SciTech Connect

To evaluate the results of stent placement for obstructive atherosclerotic aortic disease with or without involvement of the common iliac artery. Forty patients had self-expanding stents primarily or after balloon dilatation in the abdominal aorta between January 2005 and May 2011. All patients had trouble walking. Follow-up examinations were performed with clinical visits; these included color Doppler ultrasonography and computed tomographic angiography. Technical, clinical, and hemodynamic success was achieved in all patients. None of the patients underwent reintervention during the follow-up period, which ranged from 3 months to 6 years (median 24 months). Nine complications occurred in six patients. Of the nine complications, four were distal thromboembolisms, which were successfully treated with catheter-directed thrombolysis or anticoagulation therapy. Endovascular treatment of the obstructive aortic disease using self-expanding stents was safe and effective, with high technical success and long-term patency. Thromboembolic complications were high even though direct stenting was considered protective for thromboembolism formation. Particularly for infrarenal aortic stenosis, it can be recommended as the first-line treatment option for patients with obstructive atherosclerotic aortic disease.

Oender, Hakan, E-mail: drhakanonder@hotmail.com [Dicle University Medical Faculty, Department of Radiology (Turkey)] [Dicle University Medical Faculty, Department of Radiology (Turkey); Oguzkurt, Levent [Baskent University Medical Faculty, Department of Radiology (Turkey)] [Baskent University Medical Faculty, Department of Radiology (Turkey); Guer, Serkan [Sifa University Medical Faculty, Department of Radiology (Turkey)] [Sifa University Medical Faculty, Department of Radiology (Turkey); Tekbas, Gueven [Dicle University Medical Faculty, Department of Radiology (Turkey)] [Dicle University Medical Faculty, Department of Radiology (Turkey); Guerel, Kamil [Abant Izzet Baysal University Medical Faculty, Department of Radiology (Turkey)] [Abant Izzet Baysal University Medical Faculty, Department of Radiology (Turkey); Coskun, Isa [Baskent University Medical Faculty, Department of Cardiovascular Surgery (Turkey)] [Baskent University Medical Faculty, Department of Cardiovascular Surgery (Turkey); Oezkan, Ugur [Baskent University Medical Faculty, Department of Radiology (Turkey)] [Baskent University Medical Faculty, Department of Radiology (Turkey)



Phase 1 involvement for potential stakeholders of the VOC-Arid Integrated Demonstration  

SciTech Connect

This report describes Phase I of a three-phased study to support evaluation of new cleanup technologies for federal facilities. It directly supports the Volatile Organic Compounds (VOC)-Arid Site Integrated Demonstration (VOC-Arid ID) being conducted at the Hanford Site. The purpose of the activity is to develop and demonstrate new technologies for cleaning up carbon tetrachloride and other VOCs in soils and groundwater. The institutional assessment task of the VOC-Arid ID, which is being performed by Battelle Seattle Research Center, is assessing regulatory and public acceptability of new technologies. Phase I focuses on gathering Hanford stakeholder input on how to evaluate technologies. Phase II will involve stakeholders applying the technology evaluation criteria to actual demonstration technologies. In Phase III, the task will evaluate stakeholder acceptability of innovative technologies at other DOE candidate sites. Only if a technology performs effectively during demonstration, and is accepted by the regulatory community and the public, can it be recommended for deployment. Phase I consisted of a series of stakeholder interviews and two stakeholder workshops, both designed to receive input about the criteria to be used to evaluate innovative technologies.

McCabe, G.H. [Battelle Seattle Research Center, WA (United States)



LOFAR-UK White Paper: A Science case for UK involvement in LOFAR  

E-Print Network (OSTI)

LOFAR, the Low-Frequency Array, is a next-generation software-driven radio telescope operating between 30 and 240MHz, currently under construction by ASTRON in the Netherlands. This low frequency radio band is one of the few largely unexplored regions of the electromagnetic spectrum. The sensitivity and angular resolution offered by LOFAR will be two to three orders of magnitude better than existing telescopes, and as such it will open up this new window on the Universe. LOFAR will impact on a broad range of astrophysics, from cosmology to solar system studies. There is growing European involvement in LOFAR, driven by the need to add stations far from the main core in order to improve angular resolution. LOFAR-UK is a project aimed at cementing UK participation in LOFAR via the operation of four stations within the UK. LOFAR-UK ground stations will allow LOFAR observations to reach sub-arcsecond scales at the highest frequencies, and as a result will also improve the (confusion-limited) sensitivity limit of t...

Best, P N



Prognostic Value of Prevertebral Space Involvement in Nasopharyngeal Carcinoma Based on Intensity-Modulated Radiotherapy  

Science Conference Proceedings (OSTI)

Purpose: To investigate the prognostic significance of prevertebral space involvement (PSI) in patients with nasopharyngeal carcinoma (NPC) treated with intensity-modulated radiotherapy (IMRT). Methods and Materials: A retrospective review of data from 506 biopsy-proven, nonmetastatic NPCs was performed. Patients underwent magnetic resonance imaging examinations and received IMRT as their primary treatment. Results: In this series, 161 NPC patients (31.8%) had PSI. Parapharyngeal space (p < 0.001), skull base (p < 0.001), and paranasal sinuses (p = 0.009) were associated with PSI after multivariate analysis. The 4-year overall survival (OS), local relapse-free survival (LRFS), distant metastasis-free survival (DMFS) for NPC patients with and without PSI was 69.1% and 89.2% (p < 0.0001), 83.9% and 96.4% (p < 0.0001), and 71.6% and 89.6% (p < 0.0001), respectively. Multivariate analysis identified PSI as an independent negative prognostic factor for both OS (HR = 1.478-4.380; p = 0.001) and DMFS (HR = 1.389-4.174; p = 0.002). Patients with PSI had similar survival rates in OS and DMFS (p = 0.241 and p = 0.493, respectively) to that of T4 disease, while the differences between PSI and T3 disease in both OS and DMFS were distinctly significant (p = 0.029 and p = 0.029, respectively). Conclusions: For NPC patients treated with IMRT, PSI was found to be an independent prognostic factor for both OS and DMFS. It seems reasonable that PSI should be classified as a T4 disease on the basis of the current American Joint Committee on Cancer staging classification criteria.

Zhou Guanqun; Mao YanPing; Chen Lei; Li Wenfei [State Key Laboratory of Oncology in Southern China, Guangzhou, Guangdong (China); Department of Radiation Oncology, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Liu Lizhi [State Key Laboratory of Oncology in Southern China, Guangzhou, Guangdong (China); Imaging Diagnosis and Interventional Center, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Sun Ying; Chen Yong [State Key Laboratory of Oncology in Southern China, Guangzhou, Guangdong (China); Department of Radiation Oncology, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Tian Li [State Key Laboratory of Oncology in Southern China, Guangzhou, Guangdong (China); Imaging Diagnosis and Interventional Center, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); Lin Aihua [Department of Medical Statistics and Epidemiology, School of Public Health, Sun Yat-sen University, Guangzhou, Guangdong (China); Li Li [State Key Laboratory of Oncology in Southern China, Guangzhou, Guangdong (China); Imaging Diagnosis and Interventional Center, Cancer Center, Sun Yat-sen University, Guangzhou, Guangdong (China); and others



Issues Involving The OSI Concept of Operation For Noble Gas Radionuclide Detection  

Science Conference Proceedings (OSTI)

The development of a technically sound protocol for detecting the subsurface release of noble gas radionuclides is critical to the successful operation of an on site inspection (OSI) under the CTBT and has broad ramifications for all aspects of the OSI regime including the setting of specifications for both sampling and analysis equipment used during an OSI. With NA-24 support, we are investigating a variety of issues and concerns that have significant bearing on policy development and technical guidance regarding the detection of noble gases and the creation of a technically justifiable OSI concept of operation. The work at LLNL focuses on optimizing the ability to capture radioactive noble gases subject to the constraints of possible OSI scenarios. This focus results from recognizing the difficulty of detecting gas releases in geologic environments - a lesson we learned previously from the LLNL Non-Proliferation Experiment (NPE). Evaluation of a number of important noble gas detection issues, potentially affecting OSI policy, has awaited the US re-engagement with the OSI technical community. Thus, there have been numerous issues to address during the past 18 months. Most of our evaluations of a sampling or transport issue necessarily involve computer simulations. This is partly due to the lack of OSI-relevant field data, such as that provided by the NPE, and partly a result of the ability of LLNL computer-based models to test a range of geologic and atmospheric scenarios far beyond what could ever be studied in the field making this approach very highly cost effective. We review some highlights of the transport and sampling issues we have investigated during the past year. We complete the discussion of these issues with a description of a preliminary design for subsurface sampling that is intended to be a practical solution to most if not all the challenges addressed here.

Carrigan, C R; Sun, Y



[The first steps of chlorophyll synthesis: RNA involvement and regulation]. Progress report, January 1990--June 1992  

DOE Green Energy (OSTI)

Glu-tRNA{sup Glu} is synthesized from glutamate and tRNA{sup Glu} by glutamyl-tRNA synthetase (GluRS). Recent work has demonstrated that Glu-tRNA{sup Glu} has dual functions and is a precursor for protein and 5-aminolevulinate (ALA) synthesis. Current data does not provide compelling evidence for the notion that GluRS is regulated by chlorophyll precursors or in concert with the other enzymes of ALA synthesis. We have redefined the C5-pathway as a two-step route to ALA starting with Glu-tRNA{sup Glu}. Only two enzymes, Glu-tRNA reductase (GluTR) and GSA-2,1-amino-mutase (GSA-AM), are specifically involved in ALA synthesis. We have purified these enzymatic activities from Chlamydomonas and demonstrated that the two purified proteins in the presence of their cofactors NADPH and pyridoxal phosphate are sufficient for the in vitro Glu-tRNA {yields} ALA conversion. We have cloned the genes encoding GluTR. The sequences of the GluTR proteins deduced from these genes share highly conserved regions with those of bacterial origin. We havealso cloned and analyzed the gene encoding GSA-AM from Arabidopsis. As in Salmonella typhimurium, there are indications of the existence of an additional pathway for ALA formation in E. coli. To shed light on the recognition of the single tRNA{sup Glu} by the chloroplast enzymes GluTR, GluRS we characterized a chlorophyll-deficient mutant of Euglena having tRNA{sup Glu} with a point mutation in the T{Psi}C-loop. The altered tRNA supports protein but not ALA synthesis.

Soell, D.



Metal Catalyzed Formation of Aliphatic Polycarbonates Involving Oxetanes and Carbon Dioxide as Monomers  

E-Print Network (OSTI)

Biodegradable aliphatic polycarbonates are important components of non-toxic thermoplastic elastomers, which have a variety of medical applications. Industrially, aliphatic polycarbonates derived from six-membered cyclic carbonates such as trimethylene carbonate (TMC or 1,3-dioxan-2-one) are produced via ring-opening polymerization (ROP) processes in the presence of a tin catalyst. It is worth mentioning that TMC is readily obtained by transesterification of 1,3-propanediol with various reagents including phosgene and its derivatives. Therefore, it has been of great interest to investigate greener routes for the production of this important class of polymers. Toward this goal, the synthesis of aliphatic polycarbonates via the metal catalyzed alternative coupling of oxetanes and carbon dioxide represents an attractive alternative. The use of an abundant, inexpensive, non-toxic, and biorenewable resource, carbon dioxide, makes this method very valuable. Furthermore, in this reaction, the sixmembered cyclic carbonate byproduct, TMC, can also be ring-opened and transformed into the same polycarbonate. For over a decade, the Darensbourg research group has successfully utilized metal salen complexes as catalysts for the epoxide/CO2 copolymerization process. Hence, this dissertation focuses on the examination of these complexes as catalysts for the oxetane/CO2 copolymerization reaction and the further elucidation of its mechanism. Chromium(III) salen derivatives in the presence of an azide ion initiator were determined to be very effective catalysts for the coupling of oxetanes and carbon dioxide providing polycarbonates with minimal amounts of ether linkages. Kinetic and mechanistic investigations performed on this process suggested that copolymer formation proceeded by two routes. These are the direct enchainment of oxetane and CO2, and the intermediacy of trimethylene carbonate, which was observed as a minor product of the coupling reaction. Anion initiators which are good leaving groups, e.g. bromide and iodide, are effective at affording TMC, and hence, more polycarbonate can be formed by the ROP of preformed trimethylene carbonate. Research efforts at tuning the selectivity of the oxetane/CO2 coupling process for TMC and/or polycarbonate produced from the homopolymerization of preformed TMC have been performed using cobalt(II) salen derivatives along with anion initiators. Lastly, investigations of this process involving 3-methoxy-methyl-3-methyloxetane will be presented.

Moncada, Adriana I.



Does Transmission of Light through a Window Involve Physics at the Planck Scale? 1 Problem  

E-Print Network (OSTI)

While it would be generally considered that transmission of light through a glass window does not involve physics at the Planck length scale (sec. 26 of [1]), LP = hG/c3 ? 1.6 10 ?35 m, (1) a recent suggestion by Bekenstein [2, 3] is that it does. 1 The comment is that when a single photon of momentum p and energy E = pc enters a transparent block of mass M and index of refraction n, which block is initially at rest, the momentum of the photon 2 is reduced to p/ngroup ? p/n, and the momentum of the block is temporarily increased to P ? p(1?1/n) forthetimeinterval?t = ngroupL/c ? nL/c, where L is the length of the block, c is the speed of light in vacuum, and ngroup = c/vg = cdk/d? = d(?n)/d? = n + ?dn/d? ? n for glass. During this time interval the center of mass of the block 3 moves along the direction of the photon by a distance ?x = v?t = P ?t/M = (1 ? 1/n)pnL/Mc =(n ? 1)EL/Mc 2. For example, if n ? 1.5, E ? 2eV ? 3.2 10 ?19 J, L =0.01 m and M =0.1 kg,then?x ? 1.6 10 ?36 m ? 0.1LP. This indicates that the Planck scale is in some way relevant to transmission of light through a window. The argument is then that if space is grainy on the Planck scale (as suggested by Wheeler [6]), such a tiny displacement would be impossible, and the single photon would not be transmitted, but would be reflected. Hence, if the transmission coefficient of the window is smaller for a single photon than for a pulse, this could be evidence that space is grainy on the Planck scale. Can this be so? 2

Kirk T. Mcdonald



An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links  

E-Print Network (OSTI)

An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell to cancer, and NF-kB appears to play a causa- tive role, but the mechanisms are poorly understood. We show activation triggers an inflammatory response mediated by NF-kB that directly activates Lin28 transcription



E-Print Network (OSTI)

is a promoter-trap vector. Promoter-trapping cereus is ubiquitous in soil and on plant roots (Stabb involves Elite@ flow cytometer/cell sorter Section 2.6 after subculturing and at stationary phase. At each-colored transmitted light image. The apparent fusions for visualizing single cells in soil and on plantvariation

Baillie, David


Possible involvement of AMP-activated protein kinase in obesity resistance induced by respiratory uncoupling in white fat  

E-Print Network (OSTI)

Possible involvement of AMP-activated protein kinase in obesity resistance induced by respiratory case by downregulating peroxisome proliferator-activated receptor c (PPARc; [23]). The role of AMPK Department of Biologically Active Compounds, Institute of Physiology, Academy of Sciences of the Czech

Miksik, Ivan


Kinetics and dynamics of oxidation reactions involving an adsorbed CO species on bulk and supported platinum and copper-oxide  

DOE Green Energy (OSTI)

The proposed research is an integrated experimental and modeling study of oxidation reactions involving CO as a key player -- be it a reactant, adsorbed intermediate, and/or partial oxidation product -- in the catalytic sequence and chemistry. The reaction systems of interest in the project include CO, formaldehyde, and methanol oxidation by O{sub 2} and CO oxidation by NO, on both Pt and copper oxide catalysts. These reactions are of importance in automobile exhaust catalysis. There is a paucity of rate data in the literature for these important environmental control reactions. The goal of this research is to better understand the catalytic chemistry and kinetics of oxidations reactions involving CO as an adsorbed intermediate. Successfully meeting this goal requires an integration of basic kinetic measurements, in situ catalyst surface monitoring, kinetic modeling, and nonlinear mathematical tools.

Harold, M.P.



www.mdpi.com/journal/ijms Mechanisms Involved in the Pro-Apoptotic Effect of Melatonin in Cancer Cells  

E-Print Network (OSTI)

Abstract: It is well established that melatonin exerts antitumoral effects in many cancer types, mostly decreasing cell proliferation at low concentrations. On the other hand, induction of apoptosis by melatonin has been described in the last few years in some particular cancer types. The cytotoxic effect occurs after its administration at high concentrations, and the molecular pathways involved have been only partially determined. Moreover, a synergistic effect has been found in several cancer types when it is administered in combination with chemotherapeutic agents. In the present review, we will summarize published work on the pro-apoptotic effect of melatonin in cancer cells and the reported mechanisms involved in such action. We will also construct a hypothesis on how different cell signaling pathways may relate each other on account for such effect.

Carmen Rodriguez; Vanesa Martn; Federico Herrera; Guillermo Garca-santos; Jezabel Rodriguez-blanco; Sara Casado-zapico; Ana Mara Snchez-snchez; Santos Surez; Noelia Puente-moncada; Mara Jos Antua; Isaac Antoln



Human Factors Engineering Training Course for Utilities Involved in New Nuclear Power Plant Designs, Construction, and Operation  

Science Conference Proceedings (OSTI)

This report provides training materials for a three-day course in human factors engineering (HFE). The course was developed for utility personnel involved in new nuclear power plant (NPP) design and is also useful for vendors and other stakeholders. The primary focus of the HFE training is the main control room and its human-system interfaces (HSIs). However, it also addresses other operator work locations such as the remote shutdown station, local control stations, and emergency response facilities. In ...



Investigation of an Electromagnetic Interference (EMI) Problem Involving Light-Emitting Diode Streetlights and an Amateur Radio Tran sceiver  

Science Conference Proceedings (OSTI)

Any type of electronic device is susceptible to energy from the electromagnetic environment. This technical update describes an investigation of electromagnetic interference (EMI) problems associated with amateur radio, distribution hardware, and streetlights at a customer's home in Camden, Tennessee. Because light-emitting diode (LED) streetlights were deemed the direct cause of the EMI problem, an investigational plan involving a two-level effort was customized to fit the situation. First, field observ...


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Three Human Factors Engineering Training Courses for Utilities Involved in New Nuclear Power Plant Designs, Construction and Operati on  

Science Conference Proceedings (OSTI)

This product provides an assembled package of three Electric Power Research Institute (EPRI) developed human factors engineering (HFE) training courses to support a range of needs. The training materials for these courses were developed for utility personnel involved in new nuclear power plant (NPP) design, construction and operation. The training material is also useful for vendors and other stakeholders. The primary focus of the HFE training courses is the main control room and its human-system interfa...




Science Conference Proceedings (OSTI)

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials. Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities. Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex. Changes to the FFCA site treatment plans as a result of proposals in the Department's Accelerating Cleanup: Paths to Closure plan and contractor integration analysis. Interstate waste and materials shipments. Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the period from April 1, 2001 through June 30, 2001, under the NGA grant.

Ethan W. Brown




SciTech Connect

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials; Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities; Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex; Changes to the FFCA site treatment plans as a result of proposals in the Department's Accelerating Cleanup: Paths to Closure plan and contractor integration analysis; Interstate waste and materials shipments; and Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the quarter from May 1, 1999, through July 30, 1999, under the NGA grant. The work accomplished by the NGA project team during the past four months can be categorized as follows: maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, external regulation of DOE; and continued to facilitate interactions between the states and DOE to develop a foundation for an ongoing substantive relationship between the Governors of key states and Secretary Richardson.

Ann M. Beauchesne




Science Conference Proceedings (OSTI)

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials; Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities; Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex; Changes to the FFCA site treatment plans as a result of proposals in the Department's Accelerating Cleanup: Paths to Closure plan and contractor integration analysis; Interstate waste and materials shipments; and Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the quarter from February 1, 1999, through April 30, 1999, under the NGA grant. The work accomplished by the NGA project team during the past four months can be categorized as follows: maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, external regulation of DOE; and EM Integration activities; and continued to serve as a liaison between the NGA FFCA Task Force states and the Department.

Ann M. Beauchesne




SciTech Connect

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials. Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities. Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex. Changes to the FFCA site treatment plans as a result of proposals in DOE's Accelerating Cleanup: Paths to Closure strategy and contractor integration analysis. Interstate waste and materials shipments. Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the quarter from December 31, 1997 through April 30, 1998 under the NGA project. The work accomplished by the NGA project team during the past four months can be categorized as follows: maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; and provided ongoing support to state-DOE interactions in preparation for the March 30-31, 1998 NGA Federal Facilities Compliance Task Force Meeting with DOE. maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, DOE's Environmental Management Budget, and DOE's proposed Intersite Discussions.





SciTech Connect

Through the National Governors Association (NGA) project ``Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials; Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities; Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex; Changes to the FFCA site treatment plans as a result of proposals in the Department's Accelerating Cleanup: Paths to Closure plan and contractor integration analysis; Interstate waste and materials shipments; and Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the period from October 1, 1999 through January 31, 2000, under the NGA grant. The work accomplished by the NGA project team during the past three months can be categorized as follows: maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; convened and facilitated the October 6--8 NGA FFCA Task Force Meeting in Oak Ridge, Tennessee; maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, external regulation of DOE; and continued to facilitate interactions between the states and DOE to develop a foundation for an ongoing substantive relationship between the Governors of key states and the Department.

Ann M. Beauchesne




Science Conference Proceedings (OSTI)

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials. Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities. Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex. Changes to the FFCA site treatment plans as a result of proposals in DOE's Accelerating Cleanup: Paths to Closure strategy and contractor integration analysis. Interstate waste and materials shipments. Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the quarter from April 30, 1998 through June 30, 1998 under the NGA project. The work accomplished by the NGA project team during the past four months can be categorized as follows: maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; and provided ongoing support to state-DOE interactions. maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, DOE's Environmental Management Budget, and DOE's proposed Intersite Discussions.





Science Conference Proceedings (OSTI)

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: (1) Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials; (2) Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities; (3) Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex; (4) Changes to the FFCA site treatment plans as a result of proposals in the Department's Accelerating Cleanup: Paths to Closure plan and contractor integration analysis; (5) Interstate waste and materials shipments; and (6) Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the quarter from October 1, 1998 through January 31, 1999, under the NGA grant. The work accomplished by the NGA project team during the past four months can be categorized as follows: (1) maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; (2) maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, external regulation of DOE; and EM Integration activities; and (3) continued to serve as a liaison between the NGA FFCA Task Force states and the Department.

Ann M. Beauchesne




SciTech Connect

Through the National Governors' Association (NGA) project ''Critical Issues Related to Radioactive Waste and Materials Disposition Involving DOE Facilities'' NGA brings together Governors' policy advisors, state regulators, and DOE officials to examine critical issues related to the cleanup and operation of DOE nuclear weapons and research facilities. Topics explored through this project include: (1) Decisions involving disposal of mixed, low-level, and transuranic (TRU) waste and disposition of nuclear materials; (2) Decisions involving DOE budget requests and their effect on environmental cleanup and compliance at DOE facilities; (3) Strategies to treat mixed, low-level, and transuranic (TRU) waste and their effect on individual sites in the complex; (4) Changes to the FFCA site treatment plans as a result of proposals in the Department's Accelerating Cleanup: Paths to Closure plan and contractor integration analysis; (5) Interstate waste and materials shipments; and (6) Reforms to existing RCRA and CERCLA regulations/guidance to address regulatory overlap and risks posed by DOE wastes. The overarching theme of this project is to help the Department improve coordination of its major program decisions with Governors' offices and state regulators and to ensure such decisions reflect input from these key state officials and stakeholders. This report summarizes activities conducted during the quarter from June 1, 1998 through September 30, 1998, under the NGA grant. The work accomplished by the NGA project team during the past four months can be categorized as follows: (1) maintained open communication with DOE on a variety of activities and issues within the DOE environmental management complex; (2) maintained communication with NGA Federal Facilities Compliance Task Force members regarding DOE efforts to formulate a configuration for mixed low-level waste and low-level treatment and disposal, external regulation of DOE; and EM Integration activities; and (3) continued to serve as a liaison between the NGA FFCA Task Force states and the Department.

Ann B. Beauchesne



Involvement of Certification Agencies  

Science Conference Proceedings (OSTI)

...are also used with other specific meanings, MIL-HDBK- 17 (qualification and certification) or a government


Appendix E: Public Involvement  

NLE Websites -- All DOE Office Websites (Extended Search)

List Tribal Historic Preservation Office Attn: Deanne Bahr Sac and Fox Nation of Missouri 1322 US Hwy 75 Powhattan, KS 66527 Tribal Historic Preservation Office Attn: Karen...



SciTech Connect

The existence of several new intermetallic compounds of the Sc/sub 2/B and ScB stoichiometries, where B is from group VIII or IB of the periodic table, is reported along with their structures and lattice parameters. The Sc/sub 2/B compounds include Sc/sub 2/Ni, Sc/sub 2/Pd, Sc/sub 2/Co, and Sc/sub 2/Au, while the ScB compounds are ScCo, ScNi, ScCu, ScRu, ScRh, ScPd, ScAg, ScIr, ScPt, and ScAu, all of the ordered bcc CsCl structure. The trends in a plot of lattice contractions of the ScB compounds are discussed. (D.L.C.)

Aldred, A.T.



The Crystal Structure and Mechanism of an Unusual Oxidoreductase, GilR, Involved in Gilvocarcin V Biosynthesis  

SciTech Connect

GilR is a recently identified oxidoreductase that catalyzes the terminal step of gilvocarcin V biosynthesis and is a unique enzyme that establishes the lactone core of the polyketide-derived gilvocarcin chromophore. Gilvocarcin-type compounds form a small distinct family of anticancer agents that are involved in both photo-activated DNA-alkylation and histone H3 cross-linking. High resolution crystal structures of apoGilR and GilR in complex with its substrate pregilvocarcin V reveals that GilR belongs to the small group of a relatively new type of the vanillyl-alcohol oxidase flavoprotein family characterized by bicovalently tethered cofactors. GilR was found as a dimer, with the bicovalently attached FAD cofactor mediated through His-65 and Cys-125. Subsequent mutagenesis and functional assays indicate that Tyr-445 may be involved in reaction catalysis and in mediating the covalent attachment of FAD, whereas Tyr-448 serves as an essential residue initiating the catalysis by swinging away from the active site to accommodate binding of the 6R-configured substrate and consequently abstracting the proton of the hydroxyl residue of the substrate hemiacetal 6-OH group. These studies lay the groundwork for future enzyme engineering to broaden the substrate specificity of this bottleneck enzyme of the gilvocarcin biosynthetic pathway for the development of novel anti-cancer therapeutics.

Noinaj, Nicholas; Bosserman, Mary A.; Schickli, M. Alexandra; Piszczek, Grzegorz; Kharel, Madan K.; Pahari, Pallab; Buchanan, Susan K.; Rohr, Jrgen (NIH); (Kentucky)



Co-relation of Variables Involved in the Occurrence of Crane Accidents in U.S. through Logit Modeling.  

E-Print Network (OSTI)

One of the primary reasons of the escalating rates of injuries and fatalities in the construction industry is the ever so complex, dynamic and continually changing nature of construction work. Use of cranes has become imperative to overcome technical challenges, which has lead to escalation of danger on a construction site. Data from OSHA show that crane accidents have increased rapidly from 2000 to 2004. By analyzing the characteristics of all the crane accident inspections, we can better understand the significance of the many variables involved in a crane accident. For this research, data were collected from the U.S. Department of Labor website via the OSHA database. The data encompass crane accident inspections for all the states. The data were divided into categories with respect to accident types, construction operations, degree of accident, fault, contributing factors, crane types, victims occupation, organs affected and load. Descriptive analysis was performed to compliment the previous studies, the only difference being that both fatal and non-fatal accidents have been considered. Multinomial regression has been applied to derive probability models and correlation between different accident types and the factors involved for each crane accident type. A log likelihood test as well as chi-square test was performed to validate the models. The results show that electrocution, crane tip over and crushed during assembly/disassembly have more probability of occurrence than other accident types. Load is not a significant factor for the crane accidents, and manual fault is more probable a cause for crane accident than is technical fault. Construction operations identified in the research were found to be significant for all the crane accident types. Mobile crawler crane, mobile truck crane and tower crane were found to be more susceptible. These probability models are limited as far as the inculcation of unforeseen variables in construction accidents are concerned. In fact, these models utilize the past to portray the future, and therefore significant change in the variables involved is required to be added to attain correct and expedient results.

Bains, Amrit Anoop Singh



DOE-STD-1055-93; DOE Standard Guideline to Good Practices For Maintenance Management Involvement at DOE Nuclear Facilities  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NOT MEASUREMENT NOT MEASUREMENT SENSITIVE SENSITIVE DOE-STD-1055-93 March 1993 DOE STANDARD GUIDELINE TO GOOD PRACTICES FOR MAINTENANCE MANAGEMENT INVOLVEMENT AT DOE NUCLEAR FACILITIES U.S. Department of Energy AREA MNTY Washington, D.C. 20585 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. This document has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office of Scientific and Technical Information, P.O. Box 62, Oak Ridge, TN 37831. Available to the public from the National Technical Information Service, U.S. Department of Commerce, 5285 Port Royal Rd., Springfield, VA 22161. Order No. DE93013953 DOE-STD-1055-93 FOREWORD The purpose of the Guideline to Good Practices for M


DOE Technical Standards List: Directory of DOE and Contractor Personnel Involved in Non-Government Standards Activities  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4-99 4-99 May 1999 Superseding DOE-TSL-4-98 May 1998 DOE TECHNICAL STANDARDS LIST DIRECTORY OF DOE AND CONTRACTOR PERSONNEL INVOLVED IN NON- GOVERNMENT STANDARDS ACTIVITIES U.S. Department of Energy AREA SDMP Washington, D.C. 20585 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. This document has been reproduced from the best available copy. Available to DOE and DOE contractors from ES&H Technical Information Services, U.S. Department of Energy, (800) 473-4375, fax: (301) 903-9823. Available to the public from the U.S. Department of Commerce, Technology Administration, National Technical Information Service, Springfield, VA 22161; (703) 605-6000. DOE-TSL-4-99 iii 1. GENERAL GUIDANCE 1.1 Purpose. Public Law (PL) 104-113 [15 USC 272(b), March 7, 1996], The


Defect processes involving oxygen-compensated sites in CaF/sub 2/ precipitates doped with lanthanides and actinides  

Science Conference Proceedings (OSTI)

Oxygen incorporation into calcium fluoride precipitates doped with lanthanides and actinides is investigated by use of the technique of site-selective spectroscopy. Fluorescence from erbium in specific fluoride- and oxygen-compensated sites is monitored as a function of the ignition temperature of the precipitate to study the conversion from fluoride to oxygen compensation. Another process, thermal annealing of a disordered precipitate to give a well-defined lattice, is also followed. Changes in both oxygen compensation formation and lattice annealing are found to occur upon the addition of other trivalent and monovalent ions. The results provide a better understanding of the solid-state chemistry involved in new methods of chemical analysis using rare-earth doped CaF/sub 2/ precipitates, and how certain interference effects can arise. Also included is a study of the temperature dependence of fluorescent sites in CaF/sub 2/:U/sup 6 +/.

Johnston, M.V.; Wright, J.C.



DOE Technical Standards List. Directory of DOE and contractor personnel involved in non-government standards activities  

Science Conference Proceedings (OSTI)

This is a periodic report on the level of agency participation in non-Government standards activities. This technical standards list is intended to assist US Department of Energy (DOE) management and other personnel involved in the DOE technical Standards Program by identifying those participating individuals. The body of this document contains a listing of DOE employees and DOE contractors who have submitted a Record of Non-Government Standards Activity. Additional names were added from rosters supplied by non-Government standards bodies. Appendices to this document are provided to list the information by parent employment organization, by non-Government standards activity, and by the proper names of the non-Government standards organizations and committees.




The potential of plug-in hybrid electric vehicles to reduce petroleum use issues involved in developing reliable estimates.  

DOE Green Energy (OSTI)

This paper delineates the various issues involved in developing reliable estimates of the petroleum use reduction that would result from the wide-spread introduction of plug-in hybrid electric vehicles (PHEVs). Travel day data from the 2001 National Household Travel Survey (NHTS) were analyzed to identify the share of vehicle miles of travel (VMT) that could be transferred to grid electricity. Various PHEV charge-depleting (CD) ranges were evaluated, and 100% CD mode and potential blended modes were analyzed. The NHTS data were also examined to evaluate the potential for PHEV battery charging multiple times a day. Data from the 2005 American Housing Survey (AHS) were analyzed to evaluate the availability of garages and carports for at-home charging of the PHEV battery. The AHS data were also reviewed by census region and household location within or outside metropolitan statistical areas. To illustrate the lag times involved, the historical new vehicle market share increases for the diesel power train in France (a highly successful case) and the emerging hybrid electric vehicles in the United States were examined. A new vehicle technology substitution model is applied to illustrate a historically plausible successful new PHEV market share expansion. The trends in U.S. light-duty vehicle sales and light-duty vehicle stock were evaluated to estimate the time required for hypothetical successful new PHEVs to achieve the ultimately attainable share of the existing vehicle stock. Only when such steps have been accomplished will the full oil savings potential for the nation be achieved.

Vyas, A. D.; Santini, D. J.; Johnson, L. R.; Energy Systems



Suppressed Expression of T-Box Transcription Factors is Involved in Senescence in Chronic Obstructive Pulmonary Disease  

Science Conference Proceedings (OSTI)

Chronic obstructive pulmonary disease (COPD) is a major global health problem. The etiology of COPD has been associated with apoptosis, oxidative stress, and inflammation. However, understanding of the molecular interactions that modulate COPD pathogenesis remains only partly resolved. We conducted an exploratory study on COPD etiology to identify the key molecular participants. We used information-theoretic algorithms including Context Likelihood of Relatedness (CLR), Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNE), and Inferelator. We captured direct functional associations among genes, given a compendium of gene expression profiles of human lung epithelial cells. A set of genes differentially expressed in COPD, as reported in a previous study were superposed with the resulting transcriptional regulatory networks. After factoring in the properties of the networks, an established COPD susceptibility locus and domain-domain interactions involving protein products of genes in the generated networks, several molecular candidates were predicted to be involved in the etiology of COPD. These include COL4A3, CFLAR, GULP1, PDCD1, CASP10, PAX3, BOK, HSPD1, PITX2, and PML. Furthermore, T-box (TBX) genes and cyclin-dependent kinase inhibitor 2A (CDKN2A), which are in a direct transcriptional regulatory relationship, emerged as preeminent participants in the etiology of COPD by means of senescence. Contrary to observations in neoplasms, our study reveals that the expression of genes and proteins in the lung samples from patients with COPD indicate an increased tendency towards cellular senescence. The expression of the anti-senescence mediators TBX transcription factors, chromatin modifiers histone deacetylases, and sirtuins was suppressed; while the expression of TBX-regulated cellular senescence markers such as CDKN2A, CDKN1A, and CAV1 was elevated in the peripheral lung tissue samples from patients with COPD. The critical balance between senescence and anti-senescence factors is disrupted towards senescence in COPD lungs.

Acquaah-Mensah, George; Malhotra, Deepti; Vulimiri, Madhulika; McDermott, Jason E.; Biswal, Shyam


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Phenotype fingerprinting suggests the involvement of single-genotype consortia in degradation of aromatic compounds by Rhodopseudomonas palustris  

Science Conference Proceedings (OSTI)

Understanding of cellular processes involved in the anaerobic degradation of complex organic compounds by microorganisms is crucial for development of innovative biotechnologies for bioethanol production and for efficient degradation of toxic organic compounds. In natural environment the degradation is usually accomplished by syntrophic consortia comprised of different bacterial species. Here we show that the metabolically versatile phototrophic bacterium Rhodopseudomonas palustris may form its own syntrophic consortia, when it grows anaerobically on p-coumarate or benzoate as a sole carbon source. In the study we reveal the consortia from a comparison of large-scale measurements of mRNA and protein expressions under p-coumarate and benzoate degrading conditions using a novel computational approach referred as phenotype fingerprinting. In this approach marker genes for known R. palustris phenotypes are employed to calculate their expression from the gene and protein expressions in each studied condition. Subpopulations of the consortia are inferred from the expression of phenotypes and known metabolic modes of the R. palustris growth. We find that p-coumarate degrading condition leads to at least three R. palustris subpopulations utilizing p-coumarate, benzoate, and CO2 and H2. Benzoate degrading condition also produces at least three subpopulations utilizing benzoate, CO2 and H2, and N2 and formate. Communication among syntrophs and inter-syntrophic dynamics in each consortium are indicated by up-regulation of transporters and genes involved in the curli formation and chemotaxis. The photoautotrphic subpopulation found in both consortia is characterized by activation of two cbb operons and the uptake hydrogenase system. A specificity of N2-fixing subpopulation in the benzoate degrading consortium is the preferential activation of the vanadium nitrogenase over the molybdenum nitrogenase. The N2-fixing subpopulation in the consortium is confirmed by consumption of dissolved nitrogen gas under the benzoate degrading conditions.

Karpinets, Tatiana V [ORNL; Pelletier, Dale A [ORNL; Pan, Chongle [ORNL; Uberbacher, Edward C [ORNL; Hettich, Robert {Bob} L [ORNL; Samatova, Nagiza F [ORNL



Involvement of a Membrane-Bound Class III Adenylate Cyclase in Regulation of Anaerobic Respiration in Shewanella oneidensis MR-1  

Science Conference Proceedings (OSTI)

Unlike other bacteria that use FNR to regulate anaerobic respiration, Shewanella oneidensis MR-1 uses the cyclic AMP receptor protein (CRP) for this purpose. Three putative genes, cyaA, cyaB, and cyaC, predicted to encode class I, class IV, and class III adenylate cyclases, respectively, have been identified in the genome sequence of this bacterium. Functional validation through complementation of an Escherichia coli cya mutant confirmed that these genes encode proteins with adenylate cyclase activities. Chromosomal deletion of either cyaA or cyaB did not affect anaerobic respiration with fumarate, dimethyl sulfoxide (DMSO), or Fe(III), whereas deletion of cyaC caused deficiencies in respiration with DMSO and Fe(III) and, to a lesser extent, with fumarate. A phenotype similar to that of a crp mutant, which lacks the ability to grow anaerobically with DMSO, fumarate, and Fe(III), was obtained when both cyaA and cyaC were deleted. Microarray analysis of gene expression in the crp and cyaC mutants revealed the involvement of both genes in the regulation of key respiratory pathways, such as DMSO, fumarate, and Fe(III) reduction. Additionally, several genes associated with plasmid replication, flagellum biosynthesis, and electron transport were differentially expressed in the cyaC mutant but not in the crp mutant. Our results indicated that CyaC plays a major role in regulating anaerobic respiration and may contribute to additional signaling pathways independent of CRP.

Charania, M.; Brockman, K. L.; Zhang, Y.; Banerjee, A.; Pinchuk, Grigoriy E.; Fredrickson, Jim K.; Beliaev, Alex S.; Saffarini, Daad



Involvement of a Membrane-Bound Class III Adenylate Cyclase in Regulation of Anaerobic Respiration in Shewanella oneidensis MR-1  

Science Conference Proceedings (OSTI)

Unlike other bacteria that use FNR to regulate anaerobic respiration, S. oneidensis MR-1 uses the cAMP receptor protein, CRP, for this purpose. Three putative genes, cyaA, cyaB, and cyaC, predicted to encode class I, class IV, and class III adenylate cyclases respectively, have been identified in the genome sequence of this bacterium. Functional validation through complementation of an E. coli cya mutant confirmed that these genes encode proteins with adenylate cyclase activities. Chromosomal deletion of either cyaA or cyaB did not affect anaerobic respiration with fumarate, DMSO, or Fe(III), whereas the deletion of cyaC caused deficiencies in respiration with DMSO and Fe(III), and to a lesser extent with fumarate. A phenotype similar to that of a crp mutant, which lacks the ability to grow anaerobically with DMSO, fumarate, and Fe(III), was obtained when both cyaA and cyaC were deleted. Microarray analysis of gene expression in the crp and the cyaC mutants revealed the involvement of both genes in the regulation of key respiratory pathways such as DMSO, fumarate, and Fe(III) reduction. Additionally, several genes associated with plasmid replication, flagella biosynthesis, and electron transport, were differentially expressed in the cyaC mutant, but not in the crp mutant. Our results indicated that CyaC plays a major role in regulating anaerobic respiration, and may contribute to additional signaling pathways independent of CRP.

Charania, M.; Brockman, K.; Zhang, Yang; Banerjee, A.; Pinchuk, Grigoriy; Fredrickson, Jim K.; Beliaev, Alex S.; Saffarini, Daad




E-Print Network (OSTI)

Document complet disponible sur OLIS dans son format d'origine Complete document available on OLIS in its original formatNEA/RWM/WPDD(2006)5 2 NEA/RWM/WPDD(2006)5 FOREWORD Set up by the Radioactive Waste Management Committee (RWMC), the WPDD brings together senior representatives of national organisations who have a broad overview of Decommissioning and Dismantling (D&D) issues through their work as regulators, implementers, R&D experts or policy makers. These include representatives from regulatory authorities, industrial decommissioners from the NEA Co-operative Programme on Exchange of Scientific and Technical Information on Nuclear Installation Decommissioning Projects (CPD), and cross-representation from the other NEA Committees. The EC is a member of the WPDD and the IAEA is participating as an observer. This broad participation provides good possibilities for the co-ordination efforts amongst activities in the international programmes. At its sixth meeting, in Paris, 14-16 November 2005, the WPDD held a topical session on the Stakeholder Involvement in Decommissioning Projects. The topical session was jointly planned and

Organisation Coopration; English Or. English; English Or. English



Ionic mechanisms involved in the release of /sup 3/H-norepinephrine from the cat superior cervical ganglion  

SciTech Connect

It has previously been reported that in the isolated cat superior cervical ganglion (SCG) labeled with tritiated norepinephrine (/sup 3/H-NE), the stimulation of the preganglionic trunk at 10 Hz as well as the exposure to 100 ..mu..M exogenous acetylcholine (ACh), produced a Ca/sup + +/-dependent release of /sup 3/H-NE. The present results show that a Ca/sup + +/-dependent release of /sup 3/H-NE was produced also by exposure to either 50 ..mu..M veratridine or 60 mM KCl. Tetrodotoxin (0.5 ..mu..M) abolished the release of /sup 3/H-NE induced by preganglionic stimulation, ACh and veratridine but did not modify the release evoked by KCl. The metabolic distribution of the radioactivity released by the different depolarizing stimuli showed that the /sup 3/H-NE was collected mainly unmetabolized. In the cat SCG neither the release of /sup 3/H-NE evoked by KCl nor the endogenous content of NE was modified by pretreatment with 6-OH-dopamine (6-OH-DA). On the other hand, this chemical sympathectomy depleted the endogenous content of NE in the cat nictitating membrane, whose nerve terminals arise from the SCG. The data presented suggest that the depolarization-coupled release of NE from the cat SCG involves structures that are different to nerve terminals and that contain Na/sup +/ channels as well as Ca/sup + +/.

Alder-Graschinsky, E.; Filinger, E.J.; Martinez, A.E.



Ionic mechanisms involved in the release of /sup 3/H-norepinephrine from the cat superior cervical ganglion  

SciTech Connect

It has previously been reported that in the isolated cat superior cervical ganglion (SCG) labeled with tritiated norepinephrine (/sup 3/H-NE), the stimulation of the preganglionic trunk at 10 Hz as well as the exposure to 100 ..mu..M exogenous acetylcholine (ACh), produced a Ca/sup + +/-dependent release of /sup 3/H-NE. The present results show that a Ca/sup + +/-dependent release of /sup 3/H-NE was produced also by exposure to either 50 ..mu..M veratridine or 60 mM KCl. Tetrodotoxin (0.5 ..mu..M) abolished the release of /sup 3/H-NE induced by preganglionic stimulation, ACh and veratridine but did not modify the release evoked by KCl. The metabolic distribution of the radioactivity released by the different depolarizing stimuli showed that the /sup 3/H-NE was collected mainly unmetabolized. In the cat SCG neither the release of /sup 3/H-NE evoked by KCl nor the endogenous content of NE was modified by pretreatment with 6-OH-dopamine (6-OH-DA). On the other hand, this chemical sympathectomy depleted the endogenous content of NE in the cat nictitating membrane, whose nerve terminals arise from the SCG. The data presented suggest that the depolarization-coupled release of NE from the cat SCG involves structure that are different to nerve terminals and that contain Na/sup +/ channels as well as Ca/sup + +/ channels.

Adler-Graschinsky, E.; Filinger, E.J.; Martinez, A.E.



The human actin-related protein hArp5: Nucleo-cytoplasmic shuttling and involvement in DNA repair  

Science Conference Proceedings (OSTI)

Certain actin-related proteins (Arps) of budding yeast are localized in the nucleus, and have essential roles as stoichiometric components of histone acetyltransferase (HAT) and chromatin remodeling complexes. On the other hand, identification of vertebrate nuclear Arps and their functional analyses are just beginning. We show that human Arp5 (hArp5) proteins are localized in the nucleus, and that arp5{delta} yeast cells are partially complemented by hArp5. Thus, hArp5 is a novel member of the nuclear Arps of vertebrates, which possess evolutionarily conserved functions from yeast to humans. We show here that hArp5 shuttles between the nucleus and the cytoplasm. Furthermore, after the induction of DNA double strand breaks (DSB), cell growth and the accumulation of phosphorylated histone H2AX ({gamma}-H2AX) are impaired by hArp5 depletion. Association of hArp5 with the hIno80 chromatin remodeling enzyme and decrease of chromatin-bound hIno80 by hArp5-depletion indicate that hArp5 may have a role in the recruitment of the hINO80 complex to chromatin. Overexpression of hArp5 and hIno80 enhanced {gamma}-H2AX accumulation. These observations suggest that hArp5 is involved in the process of DSB repair through the regulation of the chromatin remodelling machinery.

Kitayama, Kumiko; Kamo, Mariko [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoba-ku, Sendai 981-8555 (Japan); Oma, Yukako [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoba-ku, Sendai 981-8555 (Japan); Department of Molecular and Cellular Genetics, UMR7156 CNRS-ULP, University of Strasbourg, 67084 Strasbourg cedex (France); Matsuda, Ryo [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoba-ku, Sendai 981-8555 (Japan); Uchida, Takafumi [Enzymology, Graduate School of Agricultural, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoba-ku, Sendai 981-8555 (Japan); Ikura, Tsuyoshi [Department of Biochemistry, Tohoku University Graduate School of Medicine, Seiryoumachi 2 2-1, Aoba-ku, Sendai 980-8575 (Japan); Tashiro, Satoshi [Department of Cellular Biology, Hiroshima University, Hiroshima 734-8553 (Japan); Ohyama, Takashi [Department of Biology, Faculty of Education and Integrated Arts and Sciences, Waseda University, 2-2 Wakamatsu-cho, Shinjuku-ku, Tokyo 162-8480 (Japan); Winsor, Barbara [Department of Molecular and Cellular Genetics, UMR7156 CNRS-ULP, University of Strasbourg, 67084 Strasbourg cedex (France); Harata, Masahiko [Laboratory of Molecular Biology, Graduate School of Agricultural Science, Tohoku University, Tsutsumidori-Amamiyamachi 1-1, Aoba-ku, Sendai 981-8555 (Japan)], E-mail: mharata@biochem.tohoku.ac.jp



African American Parent Involvement: An examination of the characteristics that determine the most successful school and parent relationships between lower socioeconomic, African American parents, and highly effective schools  

E-Print Network (OSTI)

94(1), 95 Columbia County School Title I Policy, (2007).Parent involvement in schools: An ecological approach.The Elementary School Journal, 91(3). Compton-Lilly, C. (

Williams, Marcheta Ganther



ANP inhibits TNF-?-induced endothelial MCP-1 expression involvement of p38 MAPK and MKP-1  

E-Print Network (OSTI)

Abstract: Atrial natriuretic peptide (ANP) has been shown to reduce tumor necrosis factor ? (TNF-?)-induced activation of endothelial cells via inhibition of p38 mitogen-activated protein kinase (MAPK) and nuclear factor (NF)-?B pathways. The aim of this study was to determine whether ANP is able to inhibit TNF-?-induced expression of monocyte chemoattractant protein-1 (MCP-1) in endothelial cells and to elucidate the mechanisms involved. Pretreatment of human umbilical vein endothelial cell with ANP significantly reduced TNF-?-induced expression of MCP-1 protein and mRNA. The effects of ANP were shown to be mediated via the guanylyl-cyclase (GC)-coupled A receptor. Activation of the other GC-coupled receptor (natriuretic peptide receptor-B) by the C-type natriuretic peptide as well as activation of soluble GC with S-nitroso-L-glutathione exerted similar effects as ANP, supporting a role for cyclic guanosine monophosphate in the signal transduction. Antisense experiments showed a requirement of MAPK phosphatase-1 (MKP-1) induction and therefore, inhibition of p38 MAPK in the ANPmediated inhibition of TNF-?-induced expression of MCP-1. To investigate a potential interplay between TNF-?-induced activation of p38 MAPK and NF-?B, the p38 MAPK inhibitor SB203580 and a dominant-negative p38 MAPK mutant were used. The results indicated that the blockade of p38 MAPK activity leads to an increased activation of NF-?B and therefore, suggest a counter-regulatory action of p38 MAPK and NF-?B. As antisense experiments revealed a pivotal role for MKP-1 induction and therefore, p38 MAPK inhibition in ANPmediated attenuation of MCP-1 expression, this action seems to be rather independent of NF-?B

Nina C. Weber; Signe B. Blumenthal; Thomas Hartung; Angelika M. Vollmar; Ra K. Kiemer



Experience, Adoption, and Technology: Exploring the Phenomenological Experiences of Faculty Involved in Online Teaching at One School of Public Health  

E-Print Network (OSTI)

This phenomenological study explored the experiences of public health faculty, who developed and taught online courses, at one particular school of public health from 2006 to 2009. The goal was to explore and document the experiences of faculty involved with this phenomenon. A criterion sample was used to identify and select participants. Five public health faculty participated in the study. Data were analyzed in two ways. Written narratives, observational field notes, and artifact data were analyzed using the inducted grounded analysis technique. Interview data were analyzed using the phenomenological data analysis method, Stevic-Colazzi Keen Method. Findings revealed that the experiences of public health faculty, who develop and teach online courses were similar to those in other subjects and were described as difficult, daunting, painful, and time consuming, leaving the public health faculty feeling frustrated and exhausted. While negative feelings described the experience pertaining to the development of online courses, the experience in the teaching phase was seen as positive, enjoyable, joyful, refreshing, and fun. These experiences were found to be contingent upon instructional and organizational support, availability and quality of resources and faculty development and training. Three overarching themes emerged from the study in relation to the experience. These themes included the rhetoric of fear, transformation, and support. The rhetoric of fear described the participants sense of being afraid or apprehensive toward developing and teaching online courses. Transformation described the transition participants made as they emerged as online instructors. Support described the structures needed to engage in the activities of developing and teaching online courses. The study also revealed five types of barriers to developing and teaching online courses at this particular school of public health. These barriers included psychological, organizational, technical, instructional, and time barriers. Benefits for developing and teaching online courses were identified. They included availability for students, access and penetration into global markets, instructional innovation, design innovation, and new methods of instructional delivery. This study provides data that can be used by institutions and faculty as they design and implement social, political, and technical infrastructures to support the activities of online teaching.

Kidd, Terry T.




E-Print Network (OSTI)

To obtain Commission approval on options for the U.S. Nuclear Regulatory Commissions (NRCs) involvement with the Navys remediation of the Hunters Point Naval Shipyard (HPS) site, and recommended actions to inform the U.S. Environmental Protection Agency (EPA), the Navy, and stakeholders about the Commissions decision regarding NRCs involvement. This paper does not address any new commitments. SUMMARY: In July 2007 the Navy requested that NRC clarify the potential for NRC involvement with the remediation of the HPS site in San Francisco, California. The Navy explained that resolving uncertainties about NRC jurisdiction and involvement is important because of the potential impact on the Navys ongoing remediation and expedited schedules needed to support the redevelopment plans of the City of San Francisco for the site. These redevelopment plans and schedules have high visibility and considerable support from elected Federal, State, and local officials. In response to the Navys request, the staff has evaluated three options for NRCs involvement at the HPS and related policy issues. The staff recommends the option of relying CONTACT:

R. W. Borchardt; Robert L. Johnson



Probability of mediastinal involvement in non-small-cell lung cancer: a statistical definition of the clinical target volume for 3-dimensional conformal radiotherapy?  

Science Conference Proceedings (OSTI)

Purpose: Conformal irradiation (3D-CRT) of non-small-cell lung carcinoma (NSCLC) is largely based on precise definition of the nodal clinical target volume (CTVn). A reduction of the number of nodal stations to be irradiated would facilitate tumor dose escalation. The aim of this study was to design a mathematical tool based on documented data to predict the risk of metastatic involvement for each nodal station. Methods and Materials: We reviewed the large surgical series published in the literature to identify the main pretreatment parameters that modify the risk of nodal invasion. The probability of involvement for the 17 nodal stations described by the American Thoracic Society (ATS) was computed from all these publications. Starting with the primary site of the tumor as the main characteristic, we built a probabilistic tree for each nodal station representing the risk distribution as a function of each tumor feature. Statistical analysis used the inversion of probability trees method described by Weinstein and Feinberg. Validation of the software based on 134 patients from two different populations was performed by receiver operator characteristic (ROC) curves and multivariate logistic regression. Results: Analysis of all of the various parameters of pretreatment staging relative to each level of the ATS map results in 20,000 different combinations. The first parameters included in the tree, depending on tumor site, were histologic classification, metastatic stage, nodal stage weighted as a function of the sensitivity and specificity of the diagnostic examination used (positron emission tomography scan, computed tomography scan), and tumor stage. Software is proposed to compute a predicted probability of involvement of each nodal station for any given clinical presentation. Double cross validation confirmed the methodology. A 10% cutoff point was calculated from ROC and logistic model giving the best prediction of mediastinal lymph node involvement. Conclusion: To more accurately define the CTVn in NSCLC three-dimensional conformal radiotherapy, we propose a software that evaluates the risk of mediastinal lymph node involvement from easily accessible individual pretreatment parameters.

Giraud, Philippe [Department of Radiation Oncology, Institut Curie, Paris (France) and Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)]. E-mail: philippe.giraud@curie.net; De Rycke, Yann [Department of Biostatistics, Institut Curie, Paris (France); Lavole, Armelle [Department of Radiation Oncology, Institut Curie, Paris (France); Department of Respiratory Medicine, Tenon Hospital, Paris (France); Milleron, Bernard [Department of Respiratory Medicine, Tenon Hospital, Paris (France); Cosset, Jean-Marc [Department of Radiation Oncology, Institut Curie, Paris (France); Rosenzweig, Kenneth E. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)



Human Factors Engineering for Managers: Computer-Based Training for Utilities Involved in New Nuclear Power Plant Designs, Construct ion and Operation - 2012  

Science Conference Proceedings (OSTI)

This product provides a computer-based training (CBT) course in human factors engineering (HFE) for managers. The training materials for this course were developed to provide a foundation in HFE for managers at utilities involved in new nuclear power plants (NPPs). This course will help managers who may be expected to manage the interactions with the vendor and U.S. Nuclear Regulatory Commission (USNRC) during new plant design certification, detailed design and implementation, and development of procedur...



Genetic evidence that Ras-like GTPases, Gtr1p, and Gtr2p, are involved in epigenetic control of gene expression in Saccharomyces cerevisiae  

Science Conference Proceedings (OSTI)

Gtr1p and Gtr2p of Saccharomyces cerevisiae are members of the Ras-like GTP binding family and interact genetically with Prp20p (yeast RCC1), which is a guanine nucleotide exchange factor for Gsp1p (yeast homolog of Ran, involved in nuclear export). Recently, Gtr1p and Gtr2p were suggested to be molecular switches in the rapamycin-sensitive TOR signaling pathway. Here, we show that Gtr1p and Gtr2p genetically interact with the chromatin remodeling factor Ino80p. Gtr2p interacted physically with both Rvb1p and Rvb2p. Consistent with these results, Gtr2p localized to chromatin and could activate transcription. Gtr1p and Gtr2p were found to be involved in chromatin silencing in the vicinity of telomeres. Gtr1p and Gtr2p were required to repress nitrogen catabolite-repressed genes, which are repressed by the TOR signaling pathway. We propose that Gtr1p and Gtr2p are involved in epigenetic control of gene expression in the TOR signaling pathway.

Sekiguchi, Takeshi [Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka 812-8582 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency, Nihonbashi, Tokyo 103-0027 (Japan)], E-mail: sekigu@molbiol.med.kyushu-u.ac.jp; Hayashi, Naoyuki [Department of Molecular Pathology, Cancer Research Institute, Kanazawa University, 13-1 Takara-machi, Kanazawa, Ishikawa 920-0934 (Japan); Wang, Yonggang [Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka 812-8582 (Japan); Kobayashi, Hideki [Department of Molecular Biology, Graduate School of Medical Science, Kyushu University, Maidashi 3-1-1, Higashi-ku, Fukuoka 812-8582 (Japan); Core Research for Evolutional Science and Technology (CREST), Japan Science and Technology Agency, Nihonbashi, Tokyo 103-0027 (Japan)



Tribal and public involvement in the U.S. Department of Energy Mixed Waste Focus Area -- First quarter status report for the period ending December 31, 1995  

SciTech Connect

The US Department of Energy (DOE) Mixed Waste Focus Area (MWFA) began operations in February 1995 to provide technologies for the design, construction, and operation of implementable mixed waste treatment systems as identified in DOE Site Treatment Plans of the Federal Facilities Compliance Act. Implementable mixed waste treatment systems means that they meet the MWFA success criteria and that potential barriers to implementing those treatment systems have been identified and eliminated through effective communications and meaningful involvement with regulators, stakeholders, and tribal governments. The Regulatory and External Liaison Product Area of the MWFA is responsible for ensuring that possible teaming arrangements are considered and integrated into the MWFA technology development and decision-making processes. The Tribal and Public Involvement Team of the MWFA Regulatory and External Liaison Product Area has initiated a variety of activities to facilitate tribal and stakeholder involvement within the MWFA. This document discusses the status of those activities as of the end of the first quarter of the 1996 fiscal year and describes applicable lessons learned and process improvements.

Owens, K.J.



Defining the Risk of Involvement for Each Neck Nodal Level in Patients With Early T-Stage Node-Positive Oropharyngeal Carcinoma  

Science Conference Proceedings (OSTI)

Purpose: To assess the risk of ipsilateral subclinical neck nodal involvement for early T-stage/node-positive oropharyngeal squamous cell carcinoma. Methods and Materials: Patients undergoing multilevel upfront neck dissection (ND) at Johns Hopkins Hospital within the last 10 years for early clinical T-stage (cT1-2) node-positive (cN+) oropharyngeal squamous cell carcinoma were identified. Pathologic involvement of Levels IB-V was determined. For each nodal level, the negative predictive value of imaging results was computed by using sensitivity/specificity data for computed tomography (CT). This was used to calculate 1 - negative predictive value, or the risk that a negative level on CT harbors subclinical disease. Results: One hundred three patients met the criteria. Radical ND was performed in 14.6%; modified radical ND, in 70.9%; and selective ND, in 14.6%. Pathologic positivity rates were 9.5%, 91.3%, 40.8%, 18.0%, and 3.3% for Levels IB-V, respectively. Risks of subclinical disease despite negative CT imaging results were calculated as 3.1%, 76.3%, 17.5%, 6.3%, and 1.0% for Levels IB-V, respectively. Conclusions: Levels IB and V are at very low (<5%) risk of involvement, even with ipsilateral to pathologically proven neck disease; this can guide radiation planning. Levels II and III should be included in high-risk volumes regardless of imaging results, and Level IV should be included within the lowest risk volume.

Sanguineti, Giuseppe [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States)], E-mail: gsangui1@jhmi.edu; Califano, Joseph; Stafford, Edward [Department of Head and Neck Surgery, Johns Hopkins University, Baltimore, MD (United States); Fox, Jana [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Koch, Wayne; Tufano, Ralph [Department of Head and Neck Surgery, Johns Hopkins University, Baltimore, MD (United States); Sormani, Maria Pia [Biostatistics Unit, University of Genoa, Genoa (Italy); Forastiere, Arlene [Department of Oncology, Johns Hopkins University, Baltimore, MD (United States)



Who's Involved | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Thomas Energy Information Agency: Michele Simmons Office of Intelligence and Counterintelligence: Patrick Mahony Office of the Secretary: Danielle Dirickson Office of...


Tobacco Industry Involvement in Colorado  

E-Print Network (OSTI)

the Air May Keep Customers from Clearing the Restaurant.Nation's Restaurant News 2001 June 18:66. Intermountain RKH.157. Smyth Russell. Restaurant Owner Organizes Opposition to

Landman, BA, Anne; Bialick, Peter



Baldrige FAQs: Senior Leadership Involvement  

Science Conference Proceedings (OSTI)

... opportunity for your senior management to learn ... programs have tiered application or recognition systems. ... investment of time and energy could be ...



Tobacco Industry Involvement in Colorado  

E-Print Network (OSTI)

2004) Pre-Cammpaign Plan. Colorado Tax Initiative. (Sic).Cherry JR. Lorillard. Colorado - Montana - Oregon. 12 AprRS. Tobacco Institute. Colorado Tax Initiative. 29 Jan 1992.

Landman, BA, Anne; Bialick, Peter


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Cyber Incidents Involving Control Systems  

Science Conference Proceedings (OSTI)

The Analysis Function of the US-CERT Control Systems Security Center (CSSC) at the Idaho National Laboratory (INL) has prepared this report to document cyber security incidents for use by the CSSC. The description and analysis of incidents reported herein support three CSSC tasks: establishing a business case; increasing security awareness and private and corporate participation related to enhanced cyber security of control systems; and providing informational material to support model development and prioritize activities for CSSC. The stated mission of CSSC is to reduce vulnerability of critical infrastructure to cyber attack on control systems. As stated in the Incident Management Tool Requirements (August 2005) ''Vulnerability reduction is promoted by risk analysis that tracks actual risk, emphasizes high risk, determines risk reduction as a function of countermeasures, tracks increase of risk due to external influence, and measures success of the vulnerability reduction program''. Process control and Supervisory Control and Data Acquisition (SCADA) systems, with their reliance on proprietary networks and hardware, have long been considered immune to the network attacks that have wreaked so much havoc on corporate information systems. New research indicates this confidence is misplaced--the move to open standards such as Ethernet, Transmission Control Protocol/Internet Protocol, and Web technologies is allowing hackers to take advantage of the control industry's unawareness. Much of the available information about cyber incidents represents a characterization as opposed to an analysis of events. The lack of good analyses reflects an overall weakness in reporting requirements as well as the fact that to date there have been very few serious cyber attacks on control systems. Most companies prefer not to share cyber attack incident data because of potential financial repercussions. Uniform reporting requirements will do much to make this information available to Department of Homeland Security (DHS) and others who require it. This report summarizes the rise in frequency of cyber attacks, describes the perpetrators, and identifies the means of attack. This type of analysis, when used in conjunction with vulnerability analyses, can be used to support a proactive approach to prevent cyber attacks. CSSC will use this document to evolve a standardized approach to incident reporting and analysis. This document will be updated as needed to record additional event analyses and insights regarding incident reporting. This report represents 120 cyber security incidents documented in a number of sources, including: the British Columbia Institute of Technology (BCIT) Industrial Security Incident Database, the 2003 CSI/FBI Computer Crime and Security Survey, the KEMA, Inc., Database, Lawrence Livermore National Laboratory, the Energy Incident Database, the INL Cyber Incident Database, and other open-source data. The National Memorial Institute for the Prevention of Terrorism (MIPT) database was also interrogated but, interestingly, failed to yield any cyber attack incidents. The results of this evaluation indicate that historical evidence provides insight into control system related incidents or failures; however, that the limited available information provides little support to future risk estimates. The documented case history shows that activity has increased significantly since 1988. The majority of incidents come from the Internet by way of opportunistic viruses, Trojans, and worms, but a surprisingly large number are directed acts of sabotage. A substantial number of confirmed, unconfirmed, and potential events that directly or potentially impact control systems worldwide are also identified. Twelve selected cyber incidents are presented at the end of this report as examples of the documented case studies (see Appendix B).

Robert J. Turk



Talking about living and dying with the oldest old: public involvement in a study on end of life care in care homes.  

E-Print Network (OSTI)

required by many health care Goodman et al. BMC Palliative Care 2011, 10:20 http://www.biomedcentral.com/1472-684X/10/20 Page 2 of 7 facilities for researchers in the UK). They received an annual honorarium, study related expenses and financial support... to the study itself. This approach encouraged residents unfamiliar with a group discussion format to react to statements and to talk about the research openly, possibly because they were discussing their involvement with a third party. PIRg members were...

Goodman, Claire; Mathie, Elspeth; Cowe, Marion; Mendoza, Alex; Westwood, Daphne; Munday, Diane; Wilson, Patricia M; Crang, Clare; Froggatt, Katherine; Iliffe, Steve; Manthorpe, Jill; Gage, Heather; Barclay, Stephen



As you may kn&<' the~de&tment of &~er& (D&j 1s involved'in'a pronram  

Office of Legacy Management (LM)

As you may kn&<' the~de&tment of &~er& (D&j 1s involved'in'a pronram As you may kn&<' the~de&tment of &~er& (D&j 1s involved'in'a pronram '. to'chiiracterlze the radjologital cbndif~on of ,sites formerly used byythe . . . ., Manhattan Engineer Dlstrlct (NED) and/or Atomjc Energy Co$n~~lssiqq (AEC); in.. the development of 'nuclear energy.. As part..of this -programi' DOE is 1~ I+ preparing, ,a' series of. brJef~ summaries ,-of .the' history:. of' tho ,#D/AEC~ : : ..; 'i ..relatecl activities and 'Conditions at .thc. sneclfic. sites. The surnaaries~ are to 'document the activities 'frcmi the ~nitlation 'of a contract with' j.'., F:ED/AEC,-to the terminationof the firial.F1EO/AEC contract; The ,historical .: '_ ,,:~,st&naries aIs. briefly' describe the. currant .conditi,on of .each site.


Early Brain Response to Low-Dose Radiation Exposure Involves Molecular Networks and Pathways Associated with Cognitive Functions, Advanced Aging and Alzheimer's Disease  

SciTech Connect

Understanding the cognitive and behavioral consequences of brain exposures to low-dose ionizing radiation has broad relevance for health risks from medical radiation diagnostic procedures, radiotherapy, environmental nuclear contamination, as well as earth orbit and space missions. Analyses of transcriptome profiles of murine brain tissue after whole-body radiation showed that low-dose exposures (10 cGy) induced genes not affected by high dose (2 Gy), and low-dose genes were associated with unique pathways and functions. The low-dose response had two major components: pathways that are consistently seen across tissues, and pathways that were brain tissue specific. Low-dose genes clustered into a saturated network (p < 10{sup -53}) containing mostly down-regulated genes involving ion channels, long-term potentiation and depression, vascular damage, etc. We identified 9 neural signaling pathways that showed a high degree of concordance in their transcriptional response in mouse brain tissue after low-dose radiation, in the aging human brain (unirradiated), and in brain tissue from patients with Alzheimer's disease. Mice exposed to high-dose radiation did not show these effects and associations. Our findings indicate that the molecular response of the mouse brain within a few hours after low-dose irradiation involves the down-regulation of neural pathways associated with cognitive dysfunctions that are also down regulated in normal human aging and Alzheimer's disease.

Lowe, Xiu R; Bhattacharya, Sanchita; Marchetti, Francesco; Wyrobek, Andrew J.



Early Brain Response to Low-Dose Radiation Exposure Involves Molecular Networks and Pathways Associated with Cognitive Functions, Advanced Aging and Alzheimer's Disease  

SciTech Connect

Understanding the cognitive and behavioral consequences of brain exposures to low-dose ionizing radiation has broad relevance for health risks from medical radiation diagnostic procedures, radiotherapy, environmental nuclear contamination, as well as earth orbit and space missions. Analyses of transcriptome profiles of murine brain tissue after whole-body radiation showed that low-dose exposures (10 cGy) induced genes not affected by high dose (2 Gy), and low-dose genes were associated with unique pathways and functions. The low-dose response had two major components: pathways that are consistently seen across tissues, and pathways that were brain tissue specific. Low-dose genes clustered into a saturated network (p < 10{sup -53}) containing mostly down-regulated genes involving ion channels, long-term potentiation and depression, vascular damage, etc. We identified 9 neural signaling pathways that showed a high degree of concordance in their transcriptional response in mouse brain tissue after low-dose radiation, in the aging human brain (unirradiated), and in brain tissue from patients with Alzheimer's disease. Mice exposed to high-dose radiation did not show these effects and associations. Our findings indicate that the molecular response of the mouse brain within a few hours after low-dose irradiation involves the down-regulation of neural pathways associated with cognitive dysfunctions that are also down regulated in normal human aging and Alzheimer's disease.

Lowe, Xiu R; Bhattacharya, Sanchita; Marchetti, Francesco; Wyrobek, Andrew J.



Radiotherapy for Early Mediastinal Hodgkin Lymphoma According to the German Hodgkin Study Group (GHSG): The Roles of Intensity-Modulated Radiotherapy and Involved-Node Radiotherapy  

SciTech Connect

Purpose: Cure rates of early Hodgkin lymphoma (HL) are high, and avoidance of late complications and second malignancies have become increasingly important. This comparative treatment planning study analyzes to what extent target volume reduction to involved-node (IN) and intensity-modulated (IM) radiotherapy (RT), compared with involved-field (IF) and three-dimensional (3D) RT, can reduce doses to organs at risk (OAR). Methods and Materials: Based on 20 computed tomography (CT) datasets of patients with early unfavorable mediastinal HL, we created treatment plans for 3D-RT and IMRT for both the IF and IN according to the guidelines of the German Hodgkin Study Group (GHSG). As OAR, we defined heart, lung, breasts, and spinal cord. Dose-volume histograms (DVHs) were evaluated for planning target volumes (PTVs) and OAR. Results: Average IF-PTV and IN-PTV were 1705 cm{sup 3} and 1015 cm{sup 3}, respectively. Mean doses to the PTVs were almost identical for all plans. For IF-PTV/IN-PTV, conformity was better with IMRT and homogeneity was better with 3D-RT. Mean doses to the heart (17.94/9.19 Gy for 3D-RT and 13.76/7.42 Gy for IMRT) and spinal cord (23.93/13.78 Gy for 3D-RT and 19.16/11.55 Gy for IMRT) were reduced by IMRT, whereas mean doses to lung (10.62/8.57 Gy for 3D-RT and 12.77/9.64 Gy for IMRT) and breasts (left 4.37/3.42 Gy for 3D-RT and 6.04/4.59 Gy for IMRT, and right 2.30/1.63 Gy for 3D-RT and 5.37/3.53 Gy for IMRT) were increased. Volume exposed to high doses was smaller for IMRT, whereas volume exposed to low doses was smaller for 3D-RT. Pronounced benefits of IMRT were observed for patients with lymph nodes anterior to the heart. IN-RT achieved substantially better values than IF-RT for almost all OAR parameters, i.e., dose reduction of 20% to 50%, regardless of radiation technique. Conclusions: Reduction of target volume to IN most effectively improves OAR sparing, but is still considered investigational. For the time being, IMRT should be considered for large PTVs especially when the anterior mediastinum is involved.

Koeck, Julia, E-mail: Julia_Koeck@gmx.net [Department of Radiation Oncology, University Medical Center Mannheim, University of Heidelberg, Mannheim (Germany); Abo-Madyan, Yasser [Department of Radiation Oncology, University Medical Center Mannheim, University of Heidelberg, Mannheim (Germany); Department of Radiation Oncology, Faculty of Medicine, Cairo University, Cairo (Egypt); Lohr, Frank; Stieler, Florian [Department of Radiation Oncology, University Medical Center Mannheim, University of Heidelberg, Mannheim (Germany); Kriz, Jan; Mueller, Rolf-Peter [Department of Radiation Oncology, University of Cologne, Cologne (Germany); Wenz, Frederik [Department of Radiation Oncology, University Medical Center Mannheim, University of Heidelberg, Mannheim (Germany); Eich, Hans Theodor [Department of Radiation Oncology, University of Cologne, Cologne (Germany)



Derivation of the Blackbody Radiation Spectrum from a Natural Maximum-Entropy Principle Involving Casimir Energies and Zero-Point Radiation  

E-Print Network (OSTI)

By numerical calculation, the Planck spectrum with zero-point radiation is shown to satisfy a natural maximum-entropy principle whereas alternative choices of spectra do not. Specifically, if we consider a set of conducting-walled boxes, each with a partition placed at a different location in the box, so that across the collection of boxes the partitions are uniformly spaced across the volume, then the Planck spectrum correspond to that spectrum of random radiation (having constant energy kT per normal mode at low frequencies and zero-point energy (1/2)hw per normal mode at high frequencies) which gives maximum uniformity across the collection of boxes for the radiation energy per box. The analysis involves Casimir energies and zero-point radiation which do not usually appear in thermodynamic analyses. For simplicity, the analysis is presented for waves in one space dimension.

Timothy H. Boyer



Interference by 2,3,7,8-tetrachlorodibenzo-p-dioxin with cultured mouse submandibular gland branching morphogenesis involves reduced epidermal growth factor receptor signaling  

Science Conference Proceedings (OSTI)

Toxicity of 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) to mouse embryonic teeth, sharing features of early development with salivary glands in common, involves enhanced apoptosis and depends on the expression of epidermal growth factor (EGF) receptor. EGF receptor signaling, on the other hand, is essential for salivary gland branching morphogenesis. To see if TCDD impairs salivary gland morphogenesis and if the impairment is associated with EGF receptor signaling, we cultured mouse (NMRI) E13 submandibular glands with TCDD or TCDD in combination with EGF or fibronectin (FN), both previously found to enhance branching morphogenesis. Explants were examined stereomicroscopically and processed to paraffin sections. TCDD exposure impaired epithelial branching and cleft formation, resulting in enlarged buds. The glands were smaller than normal. EGF and FN alone concentration-dependently stimulated or inhibited branching morphogenesis but when co-administered with TCDD, failed to compensate for its effect. TCDD induced cytochrome P4501A1 expression in the glandular epithelium, indicating activation of the aryl hydrocarbon receptor. TCDD somewhat increased epithelial apoptosis as observed by terminal deoxynucleotidyl transferase (TdT)-mediated nick end-labeling method but the increase could not be correlated with morphological changes. The frequency of proliferating cells was not altered. Corresponding to the reduced cleft sites in TCDD-exposed explants, FN immunoreactivity in the epithelium was reduced. The results show that TCDD, comparably with EGF and FN at morphogenesis-inhibiting concentrations, impaired salivary gland branching morphogenesis in vitro. Together with the failure of EGF and FN at morphogenesis-stimulating concentrations to compensate for the effect of TCDD this implies that TCDD toxicity to developing salivary gland involves reduced EGF receptor signaling.

Kiukkonen, Anu [Department of Pedodontics and Orthodontics, Institute of Dentistry, University of Helsinki, Helsinki (Finland) and Department of Oral Pathology, Institute of Dentistry, University of Helsinki, Helsinki (Finland)]. E-mail: anummela@mappi.helsinki.fi; Sahlberg, Carin [Department of Pedodontics and Orthodontics, Institute of Dentistry, University of Helsinki, Helsinki (Finland); Partanen, Anna-Maija [Department of Pedodontics and Orthodontics, Institute of Dentistry, University of Helsinki, Helsinki (Finland); Alaluusua, Satu [Department of Pedodontics and Orthodontics, Institute of Dentistry, University of Helsinki, Helsinki (Finland); Department of Oral and Maxillofacial Diseases, Helsinki University Central Hospital, Helsinki (Finland); Pohjanvirta, Raimo [Academy of Finland, Helsinki (Finland); Department of Food and Environmental Hygiene, Faculty of Veterinary Medicine, University of Helsinki, Helsinki (Finland); Tuomisto, Jouko [Department of Environmental Health, National Public Health Institute, Kuopio (Finland); Lukinmaa, Pirjo-Liisa [Department of Oral Pathology, Institute of Dentistry, University of Helsinki, Helsinki (Finland); Department of Pathology, Helsinki University Central Hospital, Helsinki (Finland)



SRS Public Involvement in Waste Management Has Resulted in Effective Decisions Supported by the Public Including Disposal Changes and Top-to-Bottom Review Initiative Consensus  

Science Conference Proceedings (OSTI)

In the Savannah River Site's (SRS') Solid Waste Management Program, a key to success is the Public Involvement Program. The Solid Waste Division at SRS manages the site's transuranic, low-level, mixed, and hazardous wastes. All decisions associated with management of this waste are of interest to the public and successful program implementation would be impossible without a vigorous public involvement program. The SRS Solid Waste Division (SWD) and its Department of Energy (DOE) customer developed, implemented, and maintain a comprehensive public participation and communications program. It is staffed by public participation and technical specialists to ensure information is presented in a manner that is technically accurate while being tailored for understanding by people without a technical background. The program provides the public with accurate, complete, timely information and early meaningful participation opportunities. It also fulfills the public participation activities required by laws, regulations, DOE Orders, and negotiated agreements. The primary goal of the SWD Public Participation Program is to fulfill the objectives of the SWD and SRS Strategic Plans to ''build trust and communicate openly, honestly, and responsibly with employees, customers, stakeholders, and regulators,'' and to ''work to extend the support of external stakeholders for the pursuit of SRS and DOE Complex business goals.'' This paper focuses on the public participation program goals, the implementation through formal plans and objectives, targeted waste management programs and specific audiences, and specific effects of the program on waste management activities. A discussion of the DOE and contractor teaming along with how plans are carried out is also included.

Goldston, W. T.; Villasor, H. P.



Consolidative Involved-Node Proton Therapy for Stage IA-IIIB Mediastinal Hodgkin Lymphoma: Preliminary Dosimetric Outcomes From a Phase II Study  

SciTech Connect

Purpose: To compare the dose reduction to organs at risk (OARs) with proton therapy (PT) versus three-dimensional conformal radiotherapy (3D-CRT) and intensity-modulated radiotherapy (IMRT) in patients with mediastinal Hodgkin lymphoma (HL) enrolled on a Phase II study of involved-node radiotherapy (INRT). Methods and Materials: Between June 2009 and October 2010, 10 patients were enrolled on a University of Florida institutional review board-approved protocol for de novo 'classical' Stage IA-IIIB HL with mediastinal (bulky or nonbulky) involvement after chemotherapy. INRT was planned per European Organization for Research and Treatment of Cancer guidelines. Three separate optimized plans were developed for each patient: 3D-CRT, IMRT, and PT. The primary end point was a 50% reduction in the body V4 with PT compared with 3D-CRT or IMRT. Results: The median relative reduction with PT in the primary end point, body V4, was 51% compared with 3D-CRT (p = 0.0098) and 59% compared with IMRT (p = 0.0020), thus all patients were offered treatment with PT. PT provided the lowest mean dose to the heart, lungs, and breasts for all 10 patients compared with either 3D-CRT or IMRT. The median difference in the OAR mean dose reduction with PT compared with 3D-CRT were 10.4 Gy/CGE for heart; 5.5 Gy/CGE for lung; 0.9 Gy/CGE for breast; 8.3 Gy/CGE for esophagus; and 4.1 Gy/CGE for thyroid. The median differences for mean OAR dose reduction for PT compared with IMRT were 4.3 Gy/CGE for heart, 3.1 Gy/CGE for lung, 1.4 Gy/CGE for breast, 2.8 Gy/CGE for esophagus, and 2.7 Gy/CGE for thyroid. Conclusions: All 10 patients benefitted from dose reductions to OARs with PT compared with either 3D-CRT or IMRT. It is anticipated that these reductions in dose to OAR will translate into lower rates of late complications, but long-term follow-up on this Phase II INRT study is needed.

Hoppe, Bradford S., E-mail: bhoppe@floridaproton.org [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Flampouri, Stella; Su Zhong; Morris, Christopher G. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Latif, Naeem [University of Florida Hematology/Oncology, Jacksonville, FL (United States); Dang, Nam H.; Lynch, James [University of Florida Hematology/Oncology, Gainesville, FL (United States); Li Zuofeng; Mendenhall, Nancy P. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States)



Integrals involving triplets of Jacobi and Gegenbauer polynomials and some 3j-symbols of SO(n), SU(n) and Sp(4)  

E-Print Network (OSTI)

The coupling coefficients (3j-symbols) for the symmetric (most degenerate) irreducible representations of the orthogonal groups SO(n) in a canonical basis and different semicanonical (tree) bases [with SO(n) restricted to SO(n')\\times SO(n''), n'+n''=n] are expressed in terms of the integrals involving triplets of the Gegenbauer and the Jacobi polynomials. The derived usual triple-hypergeometric series (which do not reveal the apparent triangle conditions of the 3j-symbols) are rearranged (in contrast with math-ph/0201048) directly [without using their relation with the semistretched isofactors of the second kind for the complementary chain Sp(4)\\supset SU(2)\\times SU(2)] into formulas with more rich limits for summation intervals and obvious triangle conditions. The isofactors for the class-one representations of the orthogonal groups and for the class-two representations of the unitary groups (and, of course, the related integrals) turn into the double sums in the cases of the canonical SO(n)\\supset SO(n-1) or U(n)\\supset U(n-1) and semicanonical SO(n)\\supset SO(n-2)\\times SO(2) chains, as well as into the $_4F_3(1)$ series under more specific conditions. Expressions for the most general isofactors of SO(n) for coupling of the two symmetric irreps in the canonical basis are also derived.

S. Alisauskas



Thermal and combined thermal and radiolytic reactions involving nitrous oxide, hydrogen, nitrogen, and ammonia in contact with tank 241-SY-101 simulated waste  

DOE Green Energy (OSTI)

Work described in this report was conducted at Pacific Northwest National Laboratory (PNNL) for the Flammable Gas Safety Project, the purpose of which is to develop information needed to support Westinghouse Hanford Company (WHC) in their efforts to ensure the safe interim storage of wastes at the Hanford Site. Described in this report are the results of tests to evaluate the rates of thermal and combined thermal and radiolytic reactions involving flammable gases in the presence of Tank 241-SY-101 simulated waste. Flammable gases generated by the radiolysis of water and by the thermal and radiolytic decomposition of organic waste constituents may themselves participate in further reactions. Examples include the decomposition of nitrous oxide to yield nitrogen and oxygen, the reaction of nitrous oxide and hydrogen to produce nitrogen and water, and the reaction of nitrogen and hydrogen to produce ammonia. The composition of the gases trapped in bubbles in the wastes might therefore change continuously as a function of the time that the gas bubbles are retained.

Bryan, S.A.; Pederson, L.R.



A Regulatory Mechanism Involving TBP-1/Tat-Binding Protein 1 and Akt/PKB in the Control of Cell Proliferation  

E-Print Network (OSTI)

TBP-1 /Tat-Binding Protein 1 (also named Rpt-5, S6a or PSMC3) is a multifunctional protein, originally identified as a regulator of HIV-1-Tat mediated transcription. It is an AAA-ATPase component of the 19S regulative subunit of the proteasome and, as other members of this protein family, fulfils different cellular functions including proteolysis and transcriptional regulation. We and others reported that over expression of TBP-1 diminishes cell proliferation in different cellular contexts with mechanisms yet to be defined. Accordingly, we demonstrated that TBP-1 binds to and stabilizes the p14ARF oncosuppressor increasing its anti-oncogenic functions. However, TBP-1 restrains cell proliferation also in the absence of ARF, raising the question of what are the molecular pathways involved. Herein we demonstrate that stable knock-down of TBP-1 in human immortalized fibroblasts increases cell proliferation, migration and resistance to apoptosis induced by serum deprivation. We observe that TBP-1 silencing causes activation of the Akt/PKB kinase and that in turn TBP-1, itself, is a downstream target of Akt/PKB. Moreover, MDM2, a known Akt target, plays a major role in this regulation. Altogether, our data suggest the existence of a

Maria Sepe; Luisa Festa; Fabio Tolino; Luca Bellucci; Luca Sisto; Daniela Alfano; Pia Ragno; Viola Calabr; Vittorio De Franciscis; Girolama La Mantia; Ra Pollice



Losartan attenuates chronic cigarette smoke exposure-induced pulmonary arterial hypertension in rats: Possible involvement of angiotensin-converting enzyme-2  

Science Conference Proceedings (OSTI)

Chronic cigarette smoking induces pulmonary arterial hypertension (PAH) by largely unknown mechanisms. Renin-angiotensin system (RAS) is known to function in the development of PAH. Losartan, a specific angiotensin II receptor antagonist, is a well-known antihypertensive drug with a potential role in regulating angiotensin-converting enzyme-2 (ACE2), a recently found regulator of RAS. To determine the effect of losartan on smoke-induced PAH and its possible mechanism, rats were daily exposed to cigarette smoke for 6 months in the absence and in the presence of losartan. Elevated right ventricular systolic pressure (RVSP), thickened wall of pulmonary arteries with apparent medial hypertrophy along with increased angiotensin II (Ang II) and decreased ACE2 levels were observed in smoke-exposed-only rats. Losartan administration ameliorated pulmonary vascular remodeling, inhibited the smoke-induced RVSP and Ang II elevation and partially reversed the ACE2 decrease in rat lungs. In cultured primary pulmonary artery smooth muscle cells (PASMCs) from 3- and 6-month smoke-exposed rats, ACE2 levels were significantly lower than in those from the control rats. Moreover, PASMCs from 6-month exposed rats proliferated more rapidly than those from 3-month exposed or control rats, and cells grew even more rapidly in the presence of DX600, an ACE2 inhibitor. Consistent with the in vivo study, in vitro losartan pretreatment also inhibited cigarette smoke extract (CSE)-induced cell proliferation and ACE2 reduction in rat PASMCs. The results suggest that losartan may be therapeutically useful in the chronic smoking-induced pulmonary vascular remodeling and PAH and ACE2 may be involved as part of its mechanism. Our study might provide insight into the development of new therapeutic interventions for PAH smokers.

Han Suxia; He Guangming; Wang Tao; Chen Lei; Ning Yunye; Luo Feng; An Jin; Yang Ting; Dong Jiajia; Liao Zenglin; Xu Dan [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, and Department of Respiratory Medicine, West China Hospital of Sichuan University, Chengdu, Sichuan 610041 (China); Wen Fuqiang, E-mail: wenfuqiang.scu@gmail.co [Division of Pulmonary Diseases, State Key Laboratory of Biotherapy of China, and Department of Respiratory Medicine, West China Hospital of Sichuan University, Chengdu, Sichuan 610041 (China)



Impact of Cranial Irradiation Added to Intrathecal Conditioning in Hematopoietic Cell Transplantation in Adult Acute Myeloid Leukemia With Central Nervous System Involvement  

Science Conference Proceedings (OSTI)

Purpose: Neither the prognostic importance nor the appropriate management of central nervous system (CNS) involvement is known for patients with acute myeloid leukemia (AML) undergoing hematopoietic cell transplantation (HCT). We examined the impact of a CNS irradiation boost to standard intrathecal chemotherapy (ITC). Methods and Materials: From 1995 to 2005, a total of 648 adult AML patients received a myeloablative HCT: 577 patients were CNS negative (CNS-), and 71 were CNS positive (CNS+). Of the 71 CNS+ patients, 52 received intrathecal chemotherapy alone (CNS+ITC), and 19 received ITC plus an irradiation boost (CNS+RT). Results: The CNS-, CNS+ITC, and CNS+RT patients had 1- and 5-year relapse-free survivals (RFS) of 43% and 35%, 15% and 6%, and 37% and 32%, respectively. CNS+ITC patients had a statistically significant worse RFS compared with CNS- patients (hazard ratio [HR], 2.65; 95% confidence interval [CI], 2.0-3.6; p < 0.0001). CNS+RT patients had improved relapse free survival over that of CNS+ITC patients (HR, 0.45; 95% CI, 0.2-0.8; p = 0.01). The 1- and 5-year overall survivals (OS) of patients with CNS-, CNS+ITC, and CNS+RT, were 50% and 38%, 21% and 6%, and 53% and 42%, respectively. The survival of CNS+RT were significantly better than CNS+ITC patients (p = 0.004). After adjusting for known risk factors, CNS+RT patients had a trend toward lower relapse rates and reduced nonrelapse mortality. Conclusions: CNS+ AML is associated with a poor prognosis. The role of a cranial irradiation boost to intrathecal chemotherapy appears to mitigate the risk of CNS disease, and needs to be further investigated to define optimal treatment strategies.

Mayadev, Jyoti S. [Department of Radiation Oncology, University of Washington School of Medicine, Seattle, WA (United States); Department of Radiation Oncology University of California-Davis Medical Center, Davis, CA (United States); Douglas, James G., E-mail: drjay@u.washington.ed [Department of Radiation Oncology, University of Washington School of Medicine, Seattle, WA (United States); Department of Pediatrics, University of Washington School of Medicine, Seattle, WA (United States); Department of Neurological Surgery, University of Washington School of Medicine, Seattle, WA (United States); Storer, Barry E. [University of Washington School of Public Health, Seattle, WA (United States); Fred Hutchinson Cancer Research Center, Seattle, WA (United States); Appelbaum, Frederick R.; Storb, Rainer [Department of Medicine, University of Washington School of Medicine, Seattle, WA (United States); Fred Hutchinson Cancer Research Center, Seattle, WA (United States)



7/5/12 Higgs Boson Search Involving Texas A&M Physicists Reveals New Particle | Texas A&M University, Coll... 1/5www.science.tamu.edu/articles/911  

E-Print Network (OSTI)

7/5/12 Higgs Boson Search Involving Texas A&M Physicists Reveals New Particle | Texas A Texas A&M Physicists Reveals New Particle COLLEGE STATION -- Physicists at Texas A&M University Texas A&M physicists, postdoctoral researchers and graduate students based in College Station as well

Toback, David


Notice of Intent to prepare an Environmental Impact Statement for the Western Greenbrier Co-Production Demonstration Project, Rainelle, WV and Notice of Floodplain/Wetlands Involvement (6/3/03)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 11 Federal Register / Vol. 68, No. 106 / Tuesday, June 3, 2003 / Notices Dated: May 27, 2003. Judge Eric Andell, Deputy Under Secretary for Safe and Drug- Free Schools. [FR Doc. 03-13836 Filed 6-2-03; 8:45 am] BILLING CODE 4000-01-P DEPARTMENT OF ENERGY Notice of Intent To Prepare an Environmental Impact Statement for the Western Greenbrier Co-Production Demonstration Project, Rainelle, WV and Notice of Floodplain/Wetlands Involvement AGENCY: Department of Energy. ACTION: Notice of Intent to prepare an Environmental Impact Statement and Notice of Floodplain/Wetlands Involvement. SUMMARY: The U.S. Department of Energy (DOE) announces its intent to prepare an Environmental Impact Statement (EIS) pursuant to the National Environmental Policy Act (NEPA), the


DOE/EIS-0281-SA-02: Supplement Analysis for Site-Wide Environmental Impact Statement for Sandia National Laboratories/New Mexico Isentropic Compression and Flyer Plate Experiments Involving Plutonium at the Z and Saturn Accelorators (September 2002)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81-SA-02 81-SA-02 SUPPLEMENT ANALYSIS Site-Wide Environmental Impact Statement for Sandia National Laboratories/New Mexico Isentropic Compression and Flyer Plate Experiments Involving Plutonium at the Z and Saturn Accelerators September 2002 INTRODUCTION - PURPOSE OF SUPPLEMENT ANALYSIS This Supplement Analysis (SA) has been prepared to determine if the Site-Wide Environmental Impact Statement for Sandia National Laboratories/New Mexico (SWEIS), DOE/EIS-0281, adequately addresses the environmental effects of a proposal to conduct isentropic compression and flyer plate experiments involving plutonium at the Z and Saturn Accelerators, or if additional documentation under the National Environmental Policy Act (NEPA) is needed. The need for a SA to an existing


Kinetics and dynamics of oxidation reactions involving an adsorbed CO species on bulk and supported platinum and copper-oxide. First year annual report, January 1, 1991--December 31, 1991  

DOE Green Energy (OSTI)

The proposed research is an integrated experimental and modeling study of oxidation reactions involving CO as a key player -- be it a reactant, adsorbed intermediate, and/or partial oxidation product -- in the catalytic sequence and chemistry. The reaction systems of interest in the project include CO, formaldehyde, and methanol oxidation by O{sub 2} and CO oxidation by NO, on both Pt and copper oxide catalysts. These reactions are of importance in automobile exhaust catalysis. There is a paucity of rate data in the literature for these important environmental control reactions. The goal of this research is to better understand the catalytic chemistry and kinetics of oxidations reactions involving CO as an adsorbed intermediate. Successfully meeting this goal requires an integration of basic kinetic measurements, in situ catalyst surface monitoring, kinetic modeling, and nonlinear mathematical tools.

Harold, M.P.



Regional Nodal Involvement and Patterns of Spread Along In-Transit Pathways in Children With Rhabdomyosarcoma of the Extremity: A Report From the Children's Oncology Group;Rhabdomyosarcoma; Regional failure; In-transit nodes; Radiotherapy; Extremity  

SciTech Connect

Purpose: To evaluate the incidence and prognostic factors for regional failure, with attention to the in-transit pathways of spread, in children with nonmetastatic rhabdomyosarcoma of the extremity. Methods and Materials: The Intergroup rhabdomyosarcoma studies III, IV-Pilot, and IV enrolled 226 children with rhabdomyosarcoma of the extremity. Failure at the in-transit (epitrochlear/brachial and popliteal) and proximal (axillary/infraclavicular and inguinal/femoral) lymph nodes was evaluated. The median follow-up for the surviving patients was 10.4 years. Results: Of the 226 children, 55 (24%) had clinical or pathologic evidence of either in-transit and/or proximal lymph node involvement at diagnosis. The actuarial 5-year risk of regional failure was 12%. The prognostic factors for poor regional control were female gender and lymph node involvement at diagnosis. In the 116 patients with a distal extremity primary tumor, 5% had in-transit lymph node involvement at diagnosis. The estimated 5-year incidences of in-transit and proximal nodal failure was 12% and 8%, respectively. The in-transit failure rate was 0% for patients who underwent radiotherapy and/or underwent lymph node sampling of the in-transit nodal site but was 15% for those who did not (p = .07). However, the 5-year event-free survival rate did not differ between these two groups (64% vs. 55%, respectively, p = .47). Conclusion: The high incidence of regional involvement necessitates aggressive identification and treatment of regional lymph nodes in patients with rhabdomyosarcoma of the extremity. In patients with distal extremity tumors, in-transit failures were as common as failures in more proximal regional sites. Patients who underwent complete lymph node staging with appropriate radiotherapy to the in-transit nodal site, if indicated, were at a slightly lower risk of in-transit failure.

La, Trang H. [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Wolden, Suzanne L. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Rodeberg, David A. [Department of Surgery, University of Pittsburg School of Medicine, Pittsburg, PA (United States); Hawkins, Douglas S. [Division of Hematology/Oncology, University of Washington School of Medicine, Seattle, WA (United States); Brown, Kenneth L. [Department of Orthopedics, British Columbia Children's Hospital, Vancouver, BC (Canada); Anderson, James R. [Department of Biostatistics, College of Public Health, University of Nebraska Medical Center, Omaha, NE (United States); Donaldson, Sarah S., E-mail: sarah2@stanford.edu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States)


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The role of the school social worker in family involvement as identified by family specialists and parents in selected title I schools in North East Independent School District in San Antonio, Texas  

E-Print Network (OSTI)

This study examined the influence of social workers placed at the elementary school level, who work with low-socioeconomic families. The intent of the study was to examine the role of the social worker, at identified Title I elementary schools, on parent involvement. Research Question 1 asked, "What influence do the family specialists have in family involvement as reported by parents and family specialists at the identified Title I elementary schools in the North East ISD, in San Antonio, Texas?" The results of this study strongly support that the family specialist on the campus did have a positive influence on parents getting involved at their child's school. Research Question 2 asked, "What selected variables influence parental involvement as reported by parents and family specialists, who are participants of the Parent Academy at the selected Title I elementary schools in the North East ISD, in San Antonio, Texas?" The results of this study strongly supported that the variables of open communication between home and school and the school being inviting to parents are positive factors in getting parents involved. Research Question 3 asked, "What influence do community agencies have in assisting with the needs of families, as reported on the end-of-year summary sheets by the family specialists at the selected Title I elementary schools in the North East ISD, in San Antonio, Texas?" The results of this study showed that data procedures were inconsistent among the family specialists in the North East ISD. Data concerning the use of social service agencies was incomplete. No standard procedures are in place for tracking services provided to families. Research Question 4 asked, "What influence do parents have on determining the classes set forth for the Parent Academy, as reported by the parents and family specialists who are participants of the Parent Academy at the selected Title I elementary campuses in the North East ISD in San Antonio, Texas?" The results of this study strongly suggested that both parents and family specialists feel the parents have a voice in choosing the classes provided for them by the family specialists.

Canada, Gloria Lou



The role of the school social worker in family involvement as identified by family specialists and parents in selected title 1 schools in north east independent school district in san antonio, texas  

E-Print Network (OSTI)

This study examined the influence of social workers placed at the elementary school level, who work with low-socioeconomic families. The intent of the study was to examine the role of the social worker, at identified Title I elementary schools, on parent involvement. Research Question 1 asked, What influence do the family specialists have in family involvement as reported by parents and family specialists at the identified Title I elementary schools in the North East ISD, in San Antonio, Texas? The results of this study strongly support that the family specialist on the campus did have a positive influence on parents getting involved at their childs school. Research Question 2 asked, What selected variables influence parental involvement as reported by parents and family specialists, who are participants of the Parent Academy at the selected Title I elementary schools in the North East ISD, in San Antonio, Texas? The results of this study strongly supported that the variables of open communication between home and school and the school being inviting to parents are positive factors in getting parents involved. Research Question 3 asked, What influence do community agencies have in assisting with the needs of families, as reported on the end-of-year summary sheets by the family specialists at the selected Title I elementary schools in the North East ISD, in San Antonio, Texas? The results of this study showed that data procedures were inconsistent among the family specialists in the North East ISD. Data concerning the use of social service agencies was incomplete. No standard procedures are in place for tracking services provided to families. Research Question 4 asked, What influence do parents have on determining the classes set forth for the Parent Academy, as reported by the parents and family specialists who are participants of the Parent Academy at the selected Title I elementary campuses in the North East ISD in San Antonio, Texas? The results of this study strongly suggested that both parents and family specialists feel the parents have a voice in choosing the classes provided for them by the family specialists.

Canada, Gloria Lou



Sandia National Laboratories: About Sandia: Community Involvement:  

NLE Websites -- All DOE Office Websites (Extended Search)

Science Night Science Night Family Science Night Family Science Night provides an evening of hands-on science activities held at local elementary schools in the Albuquerque, NM and Livermore, CA communities. Students and parents work together to conduct simple inquiry-based science activities. Sandia provides all materials and instructions (English and Spanish). For schools outside of our communities, we offer the following resources to help you host your own Family Science Night. Class Materials and Activities Activities (English and Spanish) (PDF) Activities to try at home (MS Word) Videos Watch a video of our Family Science Night. Contacts Albuquerque, NM Laurie Bergemann (505) 284-5204 ljberge@sandia.gov Livermore, CA Stephanie Beasly (925) 294-4992 sbeasly@sandia.gov Family Science Night


Generating Referring Expressions that Involve Gradable Properties  

Science Conference Proceedings (OSTI)

This article examines the role of gradable properties in referring expressions from the perspective of natural language generation. First, we propose a simple semantic analysis of vague descriptions (i.e., referring expressions that contain gradable ...

Kees van Deemter



Sandia National Laboratories: About Sandia: Community Involvement...  

NLE Websites -- All DOE Office Websites (Extended Search)

CroSSlinks Science Volunteers The CroSSlinks program, sponsored by Sandia and Lockheed Martin, links the science community with schools to improve science education for Albuquerque...


On Equilibrium Problems Involving Strongly Pseudomonotone ...  

E-Print Network (OSTI)

xi where ng is the number of all generating units, that is p(x) = a0 ? 2 ng. ? i=1 xi = p(?), where a0 > 0 is a constant (in general is large). Then the profit made by...


Sandia National Laboratories: About Sandia: Community Involvement:  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE Regional Science Bowls DOE Regional Science Bowls 2013 New Mexico High School Regional Winners 2013 New Mexico High School Regional Winners You are invited to compete in the high school (9th-12th grades) or middle school (6th-8th grades) 2013 Regional Science Bowl competitions scheduled for New Mexico. The Science Bowl is a Jeopardy-like event for high school and middle school students who have a strong interest and academic ability in mathematics and science. The Science Bowl competition is in the form of a round robin in the morning and double elimination after lunch. Teams consist of four students and one optional alternative team member. The National Science Bowl rules, brochure, information, resources, including sample questions, forms for coaches, students, etc., are located online.


Simultaneous Equation Systems Involving Binary Choice Variables  

E-Print Network (OSTI)

of car and ownership train andbus usage,respectively. The#aBUS USAGE,ANDCAROWNERSHIP (source:DutchMobility Panel) CARowned,1 = 1 + cars owned). T, Train-usage (0= no usage, 1 =

van Wissen, Leo J.; Golob, Thomas F.



Number of Interactions Involved in Software Failures ...  

Science Conference Proceedings (OSTI)

... Table 2. Number of variables in avionics software branches. Vars, Count, Pct, Cumulative. 1, 5691, 74.1%, 74.1%. 2, 1509, 19.6%, 93.7%. ...


Decom project involves new tools, communication  

Science Conference Proceedings (OSTI)

This article is the May 1996 Power highlights. Included within this section are discussions of the following: (1) Ft. St. Vrain and Yankee Rowe decommissioning, (2) Stuck fuel assembly during refueling operations at PVNGS-2, (3) Restart schedules for Salem-1 & -2 and Indian Point-3, and (4) Reactor vessel annealing demonstration at Marble Hill.




Environmental science and ecology involve studies  

E-Print Network (OSTI)

in nuclear- waste technology (D.W. Shoesmith) and reactor safety (J.C. Wren), the Ivey Chair in Ecosystem reconstruction. Environmental research also includes the study of nuclear waste containment and disposal, nuclear reactor safety, new green solvent alternatives in chemi- cal reactions, photochemical destruction

Christensen, Dan


Sandia National Laboratories: About Sandia: Community Involvement...  

NLE Websites -- All DOE Office Websites (Extended Search)

Math Night provides an evening of hands-on math activities held at local elementary schools. Students and parents work together on fun math games and activities. Sandia provides...


Sandia National Laboratories: About Sandia: Community Involvement...  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia National Laboratories recognizes high school students annually at the awards banquet. The Thunderbird Awards reward young people who, through hard work and determination,...


Low Dose Radiation Program: Links - Public Involvement  

NLE Websites -- All DOE Office Websites (Extended Search)

Risk Communication, More Than Facts and Feelings IAEA Bulletin The United Nations and Chernobyl U.S. Federal Emergency Management Agency, FACT Sheet - Nuclear Blast Return to...


Accurate Numerical Simulations Of Chemical Phenomena Involved...  

NLE Websites -- All DOE Office Websites (Extended Search)

Robert Harrison PI Email: harrisonrj@ornl.gov Institution: ORNL Allocation Program: ESP Allocation Hours at ALCF: 150 Million Year: 2010 to 2013 Research Domain: Chemistry...


Department of Energy Idaho - Public Involvement Opportunity  

NLE Websites -- All DOE Office Websites (Extended Search)

load the latest free Adobe Reader. Current Documents for Review and Public Comment: Idaho-Related National Environmental Policy Act (NEPA) Documents Undergoing Comment Periods:...


Proximal Point Methods for Functions Involving Lojasiewicz ...  

E-Print Network (OSTI)

Note that PU x0 exists and is unique because U is a nonempty closed convex set. We denote ... Setting x = PU x0 in (4.17) we obtain d(PU x0,xk) ? d(PU x0,x0).


Convex optimization problems involving finite autocorrelation ...  

E-Print Network (OSTI)

minimax fit to the data shown with a dashed line. 3.3 FIR magnitude .... This maps the interval ...... Linear programming design of digital data transmission filters.


Lag Relationships Involving Tropical Sea Surface Temperatures  

Science Conference Proceedings (OSTI)

A long historical record (100 years) of monthly sea surface temperature anomalies from the Comprehensive OceanAtmosphere Data Set was used to examined the lag relationships between different locations in the global Tropics. Application of ...

John R. Lanzante



Subsea well control involves special considerations  

Science Conference Proceedings (OSTI)

Due to the increased length of kill and choke lines, greater care must be taken in subsea operations to establish the parameters employed to kill an underbalanced well. This study provides a straightforward, step-by-step approach for round-the-clock preparedness when well control equipment is located on the seafloor.

Fulton, D.K.


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Subsea well control involves special considerations  

Science Conference Proceedings (OSTI)

Due to the increased length of kill and choke lines, greater care must be taken in subsea operations to establish the parameters employed to kill an underbalanced well. This article provides a straightforward, step-by-step approach for round-the-clock preparedness when well control equipment is located on the seafloor.

Fulton, D.K.



Sandia National Laboratories: About Sandia: Community Involvement  

NLE Websites -- All DOE Office Websites (Extended Search)

of scientists and engineers. Whether we are engaging children in the fascination of science, serving on a Board of Directors, volunteering at a food bank, or giving money -...


Community Involvement | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

Appalachian Science & Engineering Fair St. Jude Childrens Research Hospital Tennessee Science Bowl Tennessee Stage Company Tennessee State Museum Tennessee State Society United...


Gallai Theorems Involving Domination Parameters - CECM  

E-Print Network (OSTI)

May 3, 2002 ... Oneonta, NY 13820 stevensg@hartwick.edu. M. Gairing. Dept. of Math. and Comp. Sci. University of Paderborn. D-33102 Paderborn, Germany.


Sandia National Laboratories: About Sandia: Community Involvement:  

NLE Websites -- All DOE Office Websites (Extended Search)

Education Programs Education Programs Contribution Programs Volunteer Programs Education Programs CroSSlinks Science Volunteers DOE Regional Science Bowls Family Math Night Family Science Night National Board Certification Science, Technology, Engineering, and Math Programs Thunderbird Awards About Education Programs Inspiring the next generation of scientists and engineers Nitrogen photo Sandia National Laboratories provides innovative, science-based, systems-engineering solutions to our nation's most challenging national security problems. The declining numbers of American students who pursue science and engineering degrees is a national concern. Encouraging students to pursue science, technology, engineering, and math (STEM) careers is the goal of our K-12 education programs. Student in lab coat



E-Print Network (OSTI)

, April 18, 1979. While there are legitimate ethical concerns whenever vulnerable populations are studied of which are intended to be submitted later to, or held for inspection by, the Food and Drug Administration

Sibille, Etienne


Notice of Availability of the Draft Environmental Assessment and Wetland Involvement for the Transformation of Facilities and Infrastructure for the Non-Nuclear Production Activities Conducted at the National Nuclear Security Administration's Kansas City  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

690 Federal Register 690 Federal Register / Vol. 72, No. 236 / Monday, December 10, 2007 / Notices indicated. The application also will be available for inspection at the offices of the Board of Governors. Interested persons may express their views in writing on the standards enumerated in the BHC Act (12 U.S.C. 1842(c)). If the proposal also involves the acquisition of a nonbanking company, the review also includes whether the acquisition of the nonbanking company complies with the standards in section 4 of the BHC Act (12 U.S.C. 1843). Unless otherwise noted, nonbanking activities will be conducted throughout the United States. Additional information on all bank holding companies may be obtained from the National Information Center website at www.ffiec.gov/nic/. Unless otherwise noted, comments


Theoretical study of intermolecular energy transfer involving electronically excited molecules: He(/sup 1/S) + H/sub 2/(B /sup 1/. sigma. /sub u//sup +/). [Solution for coupled channel equations  

DOE Green Energy (OSTI)

To further understanding of gas phase collision dynamics involving electronically-excited molecules, a fully quantum mechanical study of He + H/sub 2/(B /sup 1/..sigma../sub u//sup +/) was undertaken. Iterative natural orbital configuration interaction (CI) calculations were performed to obtain the interaction potential between He and H/sub 2/(B /sup 1/..sigma../sub u//sup +/). The potential energy surface (PES) is highly anisotropic and has a van der Waals well of about 0.03 eV for C/sub 2v/ approach. Avoided PES crossings occur with He + H/sub 2/(E,F /sup 1/..sigma../sub g//sup +/) and with He + H/sub 2/(X /sup 1/..sigma../sub g//sup +/) and cause a local maximum and a deep minimum in the He + H/sub 2/(B /sup 1/..sigma../sub u//sup +/) PES, respectively. The crossing with He + H/sub 2/(X /sup 1/..sigma../sub g//sup +/) provides a mechanism for fluorescence quenching. The computed CI energies were combined with previous multi-reference double excitation CI calculations and fit with analytic functions for convenience in scattering calculations. Accurate dipole polarizabilities and quadrupole moment of H/sub 2/(B /sup 1/..sigma../sub u//sup +/) were computed for use in the multipole expansion, which is the analytic form of the long-range PES. 129 refs., 28 figs., 35 tabs.

Grimes, R.M.



Follicle-stimulating hormone receptor-mediated uptake of sup 45 Ca sup 2+ by proteoliposomes and cultured rat sertoli cells: Evidence for involvement of voltage-activated and voltage-independent calcium channels  

Science Conference Proceedings (OSTI)

We have previously reported incorporation into liposomes of Triton X-100-solubilized FSH receptor-G-protein complexes derived from purified bovine calf testis membranes. In the present study we have used this model system to show that FSH induces flux of 45Ca2+ into such proteoliposomes in a hormone-specific concentration-dependent manner. FSH, inactivated by boiling, had no stimulatory effect on 45Ca2+ flux, nor did isolated alpha- or beta-subunits of FSH. Addition of GTP (or its analogs 5'-guanylylimidodiphosphate and guanosine-5'-O-(3-thiotriphosphate)) or sodium fluoride (in the presence or absence of GTP or its analogs) failed to induce 45Ca2+ flux into proteoliposomes, suggesting that the uptake of 45Ca2+ was receptor, and not G-protein, related. Voltage-independent (ruthenium red and gadolinium chloride) and voltage-activated (methyoxyverapamil and nifedipine) calcium channel-blocking agents reduced FSH-stimulated 45Ca2+ flux into proteoliposomes to control levels. FSH also induced uptake of 45Ca2+ by cultured rat Sertoli cells. Ruthenium red and gadolinium chloride had no effect on basal levels of 45Ca2+ uptake or estradiol secretion by cultured rat Sertoli cells, nor did methoxyverapamil or nifedipine. All four calcium channel blockers, however, were able to reduce FSH-induced 45Ca2+ uptake to basal levels and FSH-stimulated conversion of androstenedione to estradiol by up to 50%, indicating an involvement of Ca2+ in FSH-stimulated steroidogenesis. Our results suggest that the well documented changes in intracellular calcium levels consequent to FSH binding may be due, at least in part, to an influx of calcium through FSH receptor-regulated calcium channels.

Grasso, P.; Reichert, L.E. Jr. (Albany Medical College, NY (USA))



Sandia National Laboratories: About Sandia: Community Involvement: National  

NLE Websites -- All DOE Office Websites (Extended Search)

National Board Certification National Board Certification Sandia National Laboratories and Lockheed Martin recognize the importance of quality teaching and promote the professional development of math and science teachers in New Mexico. A National Research Council (NRC) of the National Academies report affirms many of the positive findings of other research into the affects of National Board Certification. According to the rigorous and comprehensive report, the National Board for Professional Teach Standards (NBPTS) have had a positive impact on student achievement, teacher retention, and professional development. Certifications are available in mathematics (Early Adolescence, Adolescence and Young Adulthood) and science (Early Adolescence, Adolescence and Young Adulthood). Candidates are strongly encouraged to attend the Pre-Candidate


Opportunities for utility involvement with solar domestic hot water  

SciTech Connect

Solar water heating is one of a number of options that can be considered under utility demand-side management (DSM) programs. Utilities perceive a range of potential benefits for solar water heating in terms of customer service, energy conservation, load management, environmental enhancement, and public relations. The solar industry may benefit from utility marketing efforts, economies of scale, added credibility, financing options, and long-term maintenance arrangements. This paper covers three topics: (1) the energy and demand impacts of solar water heating on utility load profiles based on the results of four studies in the literature, (2) the results of workshops sponsored by the National Renewable Energy Laboratory (NREL) to identify key issues faced by utilities in considering residential solar water heating as a DSM option, (3) several current or planned utility programs to promote solar water heating. 7 refs.

Carlisle, N.; Christensen, C. [National Renewable Energy Lab., Golden, CO (United States); Barrett, L. [Barrett Consulting Associates, Inc., Colorado Springs, CO (United States)



On "Sub-Threshold" Reactions Involving Nuclear Fission  

E-Print Network (OSTI)

We analyze reactions of several types that are naively below threshold but can proceed because of the release of binding energy from nuclear fission and occasionally the formation of Coulombic bound states. These reactions include (i) photofission with pion production and (ii) charged current neutrino-nucleus reactions that lead to fission and/or formation of a Coulomb bound state of a $\\mu^-$ with the nucleus of a fission fragment. We comment on the possible experimental observation of these reactions.

M. Goldhaber; R. Shrock



Fission involves a new state of nuclear matter  

E-Print Network (OSTI)

The rearrangement step of nuclear fission occurs within 0.17 yoctosecond, in a new state of nuclear matter characterized by the formation of closed shells of nucleons. The determination of its lifetime is now based on the prompt neutron emission law. The width of isotopic distributions measures the uncertainty in the neutron number of the fragments. Magic mass numbers, 82 and 126, play a major role in the mass distributions. Arguments are presented in favour of an all-neutron state. The boson field responsible for the new collective interaction has to be searched for.

C. Ythier; S. Hachem; G. Mouze



Public Involvement Opportunities for the DUF6 Conversion Facility...  

NLE Websites -- All DOE Office Websites (Extended Search)

Public Comment Form The public comment period for the Supplement Analysis for Disposal of Depleted Uranium Oxide Conversion Product Generated from DOE's Inventory of Depleted...



Science Conference Proceedings (OSTI)

Two and three magnetic flux ropes are created and studied in a well-diagnosed laboratory experiment. The twisted helical bundles of field lines rotate and collide with each other over time. In the two rope case, reverse current layers indicative of reconnection are observed. Using a high spatial and temporal resolution three-dimensional volume data set in both cases, quasi-separatrix layers (QSLs) are identified in the magnetic field. Originally developed in the context of solar magnetic reconnection, QSLs are thought to be preferred sites for reconnection. This is verified in these studies. In the case of three flux ropes there are multiple QSLs, which come and go in time. The divergence of the field lines within the QSLs and the field line motion is presented. In all cases, it is observed that the reconnection is patchy in space and bursty in time. Although it occurs at localized positions it is the result of the nonlocal behavior of the flux ropes.

Gekelman, W.; Van Compernolle, B. [Department of Physics and Astronomy, University of California, Los Angeles, CA 90095 (United States); Lawrence, E. [Princeton Plasma Physics Laboratory, Princeton, NJ (United States)



Low Dose Radiation Program: Links - Current Issues Involving...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Ionizing Radiation A-Bombs Atomicarchive.com Hiroshima Peace site History of the Atomic Bomb & The Manhattan Project The Atomic Testing Museum The Race to Build the Atomic...


ERDA safety practices involving disposal of contaminated real property  

SciTech Connect

A general discussion of the specific procedures for excess disposal outlined in the Property Management Handbook, ERDAM 5301 is given. (LK)

Loop, E.K.



The growing trend of government involvement in IT security  

Science Conference Proceedings (OSTI)

In today's society, information security has come to the forefront of discussion, especially as terrorism, illegal corporate activities, and cyber crime incidents are increasing. The government is now taking on a larger role in determining standards ... Keywords: awareness training, information security

Christin Moore



Argonne National Laboratory has been actively involved in the development  

E-Print Network (OSTI)

Lithium-air Battery 8 Argonne's Lithium-ion Battery Research Produces New Materials and Technology'S RESOURCESTOWORK FORYOU Lithium-ion Battery Research page 8 Minister of Science and Technology Visits Argonne page Agency, the Tesla Roadster can travel 244 miles on a single charge of its lithium- ion battery pack

Kemner, Ken


Involvement of extracellular matrix constituents in breast cancer  

SciTech Connect

It has recently been established that the extracellular matrix is required for normal functional differentiation of mammary epithelia not only in culture, but also in vivo. The mechanisms by which extracellular matrix affects differentiation, as well as the nature of extracellular matrix constituents which have major impacts on mammary gland function, have only now begun to be dissected. The intricate variety of extracellular matrix-mediated events and the remarkable degree of plasticity of extracellular matrix structure and composition at virtually all times during ontogeny, make such studies difficult. Similarly, during carcinogenesis, the extracellular matrix undergoes gross alterations, the consequences of which are not yet precisely understood. Nevertheless, an increasing amount of data suggests that the extracellular matrix and extracellular matrix-receptors might participate in the control of most, if not all, of the successive stages of breast tumors, from appearance to progression and metastasis.

Lochter, Andre; Bissell, Mina J


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Optimization Online - Two-Stage Stochastic Programming Involving ...  

E-Print Network (OSTI)

Mar 17, 2010 ... In particular, we consider the problem of determining the response ... of uncertainty in demand and the damage level of the disaster network.


FAQ 30-Have there been accidents involving uranium hexafluoride...  

NLE Websites -- All DOE Office Websites (Extended Search)

UF6 was released, which reacted with steam from the process and created HF and uranyl fluoride. This accident resulted in two deaths from HF inhalation and three individuals...


Statistical methods for genetic association analysis involving complex longitudinal data  

E-Print Network (OSTI)

and Time to Event Analysis 171 AnalysisLongitudinal and Time to Event Analysis As noted, missingand survival (time to event) analysis 62 . This joint model

Salem, Rany Mansour



A primal-dual splitting method for convex optimization involving ...  

E-Print Network (OSTI)

Dec 16, 2011 ... and the variables may live in very high-dimensional spaces. The first-order prox- ... In this work, we propose a new proximal splitting method for the generic template ..... obtained along this line of research remain to be studied.



SciTech Connect

Integrated Gasification Combined Cycle (IGCC) system using coal gasification is an important approach for future energy options. This work focuses on understading the system operation and optimizing it in the presence of uncertain operating conditions using ASPEN Plus and CAPE-OPEN compliant stochastic simulation and multiobjective optimization capabilities developed by Vishwamitra Research Institute. The feasible operating surface for the IGCC system is generated and deterministic multiobjective optimization is performed. Since the feasible operating space is highly non-convex, heuristics based techniques that do not require gradient information are used to generate the Pareto surface. Accurate CFD models are simultaneously developed for the gasifier and chemical looping combustion system to characterize and quantify the process uncertainty in the ASPEN model.

Juan M. Salazar; Urmila M. Diwekar; Stephen E. Zitney



Top Management Involvement in the Adoption of Energy Efficiency Projects  

E-Print Network (OSTI)

Adoption: The Case of Energy- Efficiency Audits. Resource695. Expert Group on Energy Efficiency. 2007. Realizing theDiscount Rates and Energy Efficiency. Contemporary Economic

Blass, Vered; Corbett, Charles J.; Delmas, Magali A; Muthulingam, Suresh



REPRODUCTIONRESEARCH Signal transduction mechanisms involved in in vitro ram sperm  

E-Print Network (OSTI)

process of capacitation (Yanagimachi 1994). First described by Austin (1951, 1952) and Chang (1951, 1955 and ranges from 1­2 h in sheep and rat to 10­12 h in ferret (Austin 1970). The physiological, biochemical- cally, capacitation media contain energy substrates (e.g. pyruvate, lactate and glucose), a cholesterol

Zaragoza, Universidad de


Radiation-induced responses involved in intercellular signaling...  

NLE Websites -- All DOE Office Websites (Extended Search)

blood lymphocytes irradiated ex vivo and in vivo from patients undergoing total body irradiation, as well as in studies employing mouse models. In addition to genes with roles in...


Analysis of Crack Development Involving a Pressure Vessel in a ...  

Science Conference Proceedings (OSTI)

The vessel is part of a by-product refining system comprising a synthetic natural gas production plant. The vessel processes a mixture of chemical species,...


Internet Paradox A Social Technology That Reduces Social Involvement  

E-Print Network (OSTI)

122 48 W 1860 + 392 049035 XNP TRONA 35 46 N 117 23 W 1695 + 393 049043 XNP TRUCKEE RS 39 20 N 120 11

Kiesler, Sara


Projecting Fatalities in Crashes Involving Older Drivers, 2000...  

NLE Websites -- All DOE Office Websites (Extended Search)

ALS Activity Limitation Status AMA American Medical Association AoA Administration on Aging BEA Bureau of Economic Analysis BLS Bureau of Labor Statistics CODES Crash Outcome...


Review of ARAC's involvement in the Titan II missile accident  

SciTech Connect

The Atmospheric Release Advisory Capability (ARAC) response to the Titan II accident near Damascus, Arkansas on 19 September 1980 entailed 12 personnel for periods ranging from 2 to 12 hours. The first call was a NEST Standby alert at 0415L (PCT), followed by a request for dispersal calculations at 0615L, personnel callout at 0630L, crude estimates of plausible source term scenarios at 0845-0900L, first model calculations at 1130L and final model calculations at 1500L. While several new firsts were recorded for ARAC, demonstrating expanded capabilities for NEST-type responses, time lines were very long, essential information was very scant to non-existent, and useful communication of final calculations to the accident site impossible. A detailed chronology is found in Appendix A and a list of acronyms and abbreviations is contained in Appendix B.

Sullivan, T.J.



Projecting Fatalities in Crashes Involving Older Drivers, 2000-2025  

Science Conference Proceedings (OSTI)

As part of this research effort, we developed a new methodology for projecting elderly traffic crash fatalities. This methodology separates exposure to crashes from crash risk per se, and further divides exposure into two components, the number of miles driven and the likelihood of being a driver. This component structure permits conceptually different determinants of traffic fatalities to be projected separately and has thorough motivation in behavioral theory. It also permits finer targeting of particular aspects of projections that need improvement and closer linking of projections to possible policy instruments for influencing them.

Hu, P.S.



Case for utility involvement in solar-domestic water heating  

SciTech Connect

Credibility of system performance over an extended period of time is still a major concern for prospective buyers of solar-collector systems. Although Congress has enacted solar legislation with the intention of assisting homeowners in the adoption of solar energy, it apparently did not consider which organizational entities could best address the concerns of the consumer and accelerate the adoption of solar energy for domestic hot water heating. This article points out that legislation which does not encourage full participation by utilities in the marketing of solar energy has produced very low adoption rates compared to the size of the solar market potential. It also describes some of the empirical results of one utility company's efforts with a large-scale solar demonstration program, and presents some findings for the investor-owned utility industry to consider before Congress takes additional legislative action in this area. 11 references, 2 figures, 2 tables.

Smackey, B.M.



Issues involved with non-characterized control of methanotrophic bacteria  

SciTech Connect

Methane-utilizing bacteria, methanotrophs, have application as biocatalysts in the commodity chemical production, waste treatment and environmental remediation industries. Methanotrophs have the ability to oxidize many chemical compounds into more desired products, such as the production of propylene oxide. Methanotrophs can also degrade toxic compounds such as trichloroethylene. However, there are many physical, chemical and biological problems associated with the continuous oxidation of chemicals. These include, low mass transfer of methane, oxygen and propylene; toxicity of substrates and degradation products, and competition between the growth substrate, i.e., methane and chemical feed stock, e.g., propylene for the biocatalyst. To supervise methanotrophic bioprocesses, an intelligent control system must accommodate any biological limitations, e.g., toxicity, and mitigate the impact of the physical and chemical limitations, e.g., mass transfer of methane and the solubility of propylene. The intelligent control system must have the capability to assess the current conditions and metabolic state of the bacteria; recognize and diagnose instrument faults; and select and maintain sets of parameters that will result in high production and growth.

Stoner, D.L.; Tolle, C.R.; Noah, K.S.; Davis, D.A.; Miller, K.S.; Fife, D.J.



Modeling complex contacts involving deformable objects for haptic interaction.  

E-Print Network (OSTI)

??Haptic interaction allows a human user to touch and feel objects in virtual or remote environments with the tactile feedback as if he/she is handling (more)

Luo, Qi


Tiling Proofs of Recent Sum Identities Involving Pell Numbers  

E-Print Network (OSTI)

in a white square. That is, X = Ad and Y = Bw where A has length 2n - 1 and B has length 2n. Here (X, Y sum identities, which are highlighted at the conclusion of this paper. In order to provide of tilings of a board of length n using white squares, black squares, and gray dominoes. Thus, for example, p

Benjamin, Arthur T.


Tiling Proofs of Recent Sum Identities Involving Pell Numbers  

E-Print Network (OSTI)

in a white square. That is, X = Ad and Y = Bw where A has length 2n - 1 and B has length 2n. Here (X, Y of this paper. In order to provide combinatorial arguments for the identities above, we will consider is simple: pn counts the number of tilings of a board of length n using white squares, black squares

Sellers, James A.


Hippocampal involvement in processing of indistinct visual motion stimuli  

Science Conference Proceedings (OSTI)

Perception of known patterns results from the interaction of current sensory input with existing internal representations. It is unclear how perceptual and mnemonic processes interact when visual input is dynamic and structured such that it does not ...

Eva M. Fraedrich; Virginia L. Flanagin; Jeng-Ren Duann; Thomas Brandt; Stefan Glasauer



Variational stability of optimal control problems involving subdifferential operators  

Science Conference Proceedings (OSTI)

This paper is concerned with the problem of minimizing an integral functional with control-nonconvex integrand over the class of solutions of a control system in a Hilbert space subject to a control constraint given by a phase-dependent multivalued map with closed nonconvex values. The integrand, the subdifferential operators, the perturbation term, the initial conditions and the control constraint all depend on a parameter. Along with this problem, the paper considers the problem of minimizing an integral functional with control-convexified integrand over the class of solutions of the original system, but now subject to a convexified control constraint. By a solution of a control system we mean a 'trajectory-control' pair. For each value of the parameter, the convexified problem is shown to have a solution, which is the limit of a minimizing sequence of the original problem, and the minimal value of the functional with the convexified integrand is a continuous function of the parameter. This property is commonly referred to as the variational stability of a minimization problem. An example of a control parabolic system with hysteresis and diffusion effects is considered. Bibliography: 24 titles.

Tolstonogov, Aleksandr A [Institute of System Dynamics and Control Theory, Siberian Branch of the Russian Academy of Sciences, Irkutsk (Russian Federation)


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

planned financial, contractual, organizational, or other interests relating to the performance of the statement of work. For contractual interests, such statement must include...


Mutation assays involving blood cells that metabolize toxic substances  

DOE Patents (OSTI)

The present invention pertains to a line of human blood cells which have high levels of oxidative activity (such as oxygenase, oxidase, peroxidase, and hydroxylase activity). Such cells grow in suspension culture, and are useful to determine the mutagenicity of xenobiotic substances that are metabolized into toxic or mutagenic substances. The invention also includes mutation assays using these cells, and other cells with similar characteristics. 3 figs.

Crespi, C.L.; Thilly, W.G.



Truck-Involved Crashes and Traffic Levels on Urban Freeways  

E-Print Network (OSTI)

Highway Safety, University of Kentucky working paper.was conducted at the University of Kentucky in an effort to

Golob, Thomas F.; Regan, Amelia C.




NLE Websites -- All DOE Office Websites (Extended Search)

The power system and the communication system both determine performance of the smart grid. IEEE STANDARD 1547 RESEARCH * Shortcomings of IEEE 1547 Continued - With the large...


Structural Studies of Proteins Involved in Diseases of Protein Deposition and a Protein Involved in Nitrogenase Assembly  

E-Print Network (OSTI)

genetic map of the major nif gene cluster from Azotobactergenetic map of the major nif gene cluster from Azotobacterby a previously sequenced nif (nitrogen fixation) gene [12-

Phillips, Aaron Hale



Inorganic lead (Pb)- and mercury (Hg)-induced neuronal cell death involves cytoskeletal reorganization  

E-Print Network (OSTI)

Inorganic lead and mercury are widely spread xenobiotic neurotoxicants threatening public health. The exposure to inorganic lead and mercury results in adverse effects of poisoning including IQ deficit and peripheral neuropathy. Additionally, inorganic neurotoxicants have even more serious impact on earlier stages of embryonic development. This study was therefore initiated in order to determine the cytotoxic effects of lead and mercury in earlier developmental stages of chick embryo. Administration of inorganic lead and mercury into the chick embryo resulted in the prolonged accumulation of inorganics in the neonatal brain, with detrimental cytotoxicity on neuronal cells. Subsequent studies demonstrated that exposure of chick embryo to inorganic lead and mercury resulted in the reorganization of cytoskeletal proteins in the neonatal brain. These results therefore suggest that inorganics-mediated cytoskeletal reorganization of the structural proteins, resulting in neurocytotoxicity, is one of the underlying mechanisms by which inorganics transfer deleterious effects on central nervous system.

Woo-sung Choi; Su-jin Kim; Jin Suk Kim



Computational structure of a performance assessment involving stochastic and subjective uncertainty  

Science Conference Proceedings (OSTI)

A recent performance assessment for the Waste Isolation Pilot Plant (WIPP), which is being developed by the U.S. Department of Energy for the geologic disposal of transuranic waste, is used to illustrate the computational structure of a large analysis ...

Jon C. Helton



Codebook for Network Data on Individuals Involved with Terrorism and Counterterrorism  

E-Print Network (OSTI)

, has criticized the use of defamation laws by authorities to silence criticism in Albania, Azerbaijan://www.echr.coe.int/ECHR/EN/Header/Case- Law/Decisions+and+judgments/HUDOC+database/:. 82 Fatullayev vs. Azerbaijan (2010), http://www.icj.org/img/CASE_OF_FATULLAYEV_v_AZERBAIJAN


Myotactin, a novel hypodermal protein involved in musclecell adhesion in Caenorhabditis elegans  

E-Print Network (OSTI)

Abstract. In C. elegans, assembly of hypodermal hemidesmosome-like structures called fibrous organelles is temporally and spatially coordinated with the assembly of the muscle contractile apparatus, suggesting that signals are exchanged between these cell types to position fibrous organelles correctly. Myotactin, a protein recognized by monoclonal antibody MH46, is a candidate for such a signaling molecule. The antigen, although expressed by hypodermis, first reflects the pattern of muscle elements and only later reflects the pattern of fibrous organelles. Confocal microscopy shows that in adult worms myotactin and fibrous organelles show coincident localization. Further, cell ablation studies show the bodywall muscle cells are necessary for normal myotactin distribution.

Michelle Coutu Hresko; Lawrence A. Schriefer; Paresh Shrimankar; Robert H. Waterston



Localization and activation of CaMKII delta isoforms and their involvement in heart failure  

E-Print Network (OSTI)

hypertrophy and heart failure ..CaMKII mediated hypertrophy and heart failure .. I.F.II.C. Preparation of heart tissue extract and cell lysate

Mishra, Shikha



Lessons learned from occurrences involving procedures at Los Alamos National Laboratory in 1994  

Science Conference Proceedings (OSTI)

This study used the Department of Energy (DOE) Occurrence Reporting and Processing System (ORPS) data to investigate occurrences reported during one year at Los Alamos National Laboratory (LANL). ORPS provides a centralized database and computerized support for the Collection, distribution, updating, analysis, and validation of information in occurrence reports about abnormal events related to facility operation. Human factors causes for occurrences are not always defined in ORPS. Content analysis of narrative data revealed that 33% of all LANL 1994 adverse operational events have human factors causes related to procedures. Procedure-caused occurrences that resulted in injury to workers, damage to facilities or equipment, or a near-miss are analyzed.

Frostenson, C.K.



Phototropin involvement in the expression of genes encoding chlorophyll and carotenoid biosynthesis enzymes and LHC  

E-Print Network (OSTI)

oxygen protection. Several journal articles and conference proceedings provide design details regarding of the cabling and fault-detection circuitry. Power scavenging concepts may also be considered for low photolithography combined with hydrofluoric acid wet chemical etching, chlorine-based plasma etching or CFB4


Survey of considerations involved in introducing CANDU reactors into the United States  

SciTech Connect

The important issues that must be considered in a decision to utilize CANDU reactors in the U.S. are identified in this report. Economic considerations, including both power costs and fuel utilization, are discussed for the near and longer term. Safety and licensing considerations are reviewed for CANDU-PHW reactors in general. The important issues, now and in the future, associated with power generation costs are the capital costs of CANDUs and the factors that impact capital cost comparisons. Fuel utilization advantages for the CANDU depend upon assumptions regarding fuel recycle at present, but the primary issue in the longer term is the utilization of the thorium cycle in the CANDU. Certain safety features of the CANDU are identified as intrinsic to the concept and these features must be examined more fully regarding licensability in the U.S.

Till, C E; Bohn, E M; Chang, Y I; van Erp, J B



Investigations of the Fundamental Surface Reactions Involved in the Sorption and Desorption of Radionuclides  

SciTech Connect

Models for describing solution- and surface-phase reactions have been used for 30 years, but only recently applicable to complex surfaces. Duff et al., using micro-XANES, found that Pu was concentrated on Mn-oxide and smectite phases of zeolitic tuff, providing an evaluation of contaminant speciation on surfaces for modeling. Experiments at Los Alamos demonstrated that actinides display varying surface residence time distributions, probably reflective of mineral surface heterogeneity. We propose to investigate the sorption/desorption behavior of radionuclides from mineral surfaces, as effected by microorganisms, employing isolates from Nevada Test Site deep alluvium as a model system. Characterizations will include surface area, particle size distribution, x-ray diffraction (XRD), microprobe analysis, extractions, and microbiology. Surface interactions will be assessed by electron spectroscopy (XPS), x-ray absorption fine structure spectroscopy (XAFS), X-ray emission spectroscopy, transmission electron microscopy (TEM) and Scanning electron microscopy (SEM). Desert Research Institute (DRI), University of Nevada, Reno (UNR), and University of Nevada, Las Vegas (UNLV) researchers will collaborate to enhance scientific infrastructure and the understanding of contaminant behavior on surfaces, with broader implications for the management of DOE sites.

Czerwinski, Ken; Heske, Clemens; Moser, Duane; Misra, Mnoranjan; McMillion, Glen



Phase-Changing Ionic Liquids: CO2 Capture with Ionic Liquids Involving Phase Change  

Science Conference Proceedings (OSTI)

IMPACCT Project: Notre Dame is developing a new CO2 capture process that uses special ionic liquids (ILs) to remove CO2 from the gas exhaust of coal-fired power plants. ILs are salts that are normally liquid at room temperature, but Notre Dame has discovered a new class of ILs that are solid at room temperature and change to liquid when they bind to CO2. Upon heating, the CO2 is released for storage, and the ILs re-solidify and donate some of the heat generated in the process to facilitate further CO2 release. These new ILs can reduce the energy required to capture CO2 from the exhaust stream of a coal-fired power plant when compared to state-ofthe- art technology.




Compliance Summary and Community Involvement 2-1 2. Compliance Summary and Community  

E-Print Network (OSTI)

. The Transuranic Waste Processing Center (TWPC) and Isotek return all government material, equipment, and property or damaged (nonradioactive items or materials received at the TWPC can be returned or recycled even

Pennycook, Steve


Compliance Summary and Community Involvement 2-1 2. Compliance Summary and Community  

E-Print Network (OSTI)

) determined to have been misdelivered or damaged (nonradioactive items or materials received at TWPC can

Pennycook, Steve


Physical processes involved in strip electrode welding using the method of slatted splicing  

Science Conference Proceedings (OSTI)

Physical processes that take place in a strip electrode during welding using the slatted splicing technique are considered. Flowing of the welding current in the electrode is shown to be the key process which determines electrode heating and melting. Technological receipts are proposed that allow obtaining high-quality welds by the method of slatted splicing.

Bushma, V. O. [Moscow State Technological University 'Stankin' (Russian Federation)



The Modification of Joint Size-Charge Distribution in Rain. Part II: Computations Involving Partial Coalescence  

Science Conference Proceedings (OSTI)

Raindrop collisional breakup is included in a model of joint size-charge distribution development. Consistent with experimental observations the model includes a finite filament (joining separating drops) that upon rupture produces charged ...

S. G. Bradley; C. D. Stow



Genes involved in long-chain alkene biosynthesis in Micrococcus luteus  

E-Print Network (OSTI)

appealing targets for advanced cellulosic biofuels, as theyfavorable targets for advanced cellulosic biofuels, as they

Beller, Harry R.


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

Nitryl Chloride Chlorine Nitrate emission from molecular chlorine resonance series excited byused in this work. Chlorine nitrate (ClON0 ) plays a major

Nelson, Herbert Hoffman



PUCK: an automated prompting system for smart environments: toward achieving automated prompting--challenges involved  

Science Conference Proceedings (OSTI)

The growth in popularity of smart environments has been quite steep in the last decade and so has the demand for smart health assistance systems. A smart home-based prompting system can enhance these technologies to deliver in-home interventions to users ... Keywords: Automated prompting, Imbalanced class distribution, Machine learning, Prompting systems, Smart environments

Barnan Das; Diane J. Cook; Maureen Schmitter-Edgecombe; Adriana M. Seelye



Corporate involvement in disaster response and recovery : an analysis of the Gujarat Earthquake  

E-Print Network (OSTI)

Disaster vulnerability is a serious issue in developing countries where globalization, development patterns, poverty and environmental degradation are placing more people at risk to natural disasters. Recent appeals for ...

Sayegh, Tracy, 1976-




SciTech Connect

Pertinert details of the incidents are given. Some are illustrated with photographs or diagrams. (M.H.R.)

Hayes, D.F.



Involvement of recombination in x-ray mutagenesis of human cells  

SciTech Connect

Closely related human lymphoblastoid cell lines derived from WI-L2 differ greatly in their responses to X-irradiation. Compared with TK6 (ATCC CRL 8015), WI-L2-NS (ATCC CRL 8155) has an enhanced X-ray survival. The induction of mutation by X-rays is also markedly different. The hemizygous hprt locus is slightly more mutable in WI-L2-NS than in TK6, and the dose response fits best to a linear-quadratic curve rather than the linear fit of TK6X-ray induced mutation at the autosomal tk locus in heterozygotes derived from WI-L2-NS is 20-50 fold higher than in heterozygotes derived from TK6. A larger proportion of WI-L2-NS mutants had lost heterozygosity compared with mutants of TK6. , Fluorescence in situ hybridization indicated that loss of heterozygosity was due almost uniformly to deletion of an allele in mutants of TK6, and to recombination or gene conversion in mutants of WI-L2-NS. These results indicate that recombinational repair contributes to both cell survival and mutation following exposure to ionizing radiation.

Amundson, S.A. (Los Alamos National Lab., NM (United States)); Xia, F.; Liber, H.L. (Harvard School of Public Health, Boston, MA (United States))



Involvement of recombination in x-ray mutagenesis of human cells  

SciTech Connect

Closely related human lymphoblastoid cell lines derived from WI-L2 differ greatly in their responses to X-irradiation. Compared with TK6 (ATCC CRL 8015), WI-L2-NS (ATCC CRL 8155) has an enhanced X-ray survival. The induction of mutation by X-rays is also markedly different. The hemizygous hprt locus is slightly more mutable in WI-L2-NS than in TK6, and the dose response fits best to a linear-quadratic curve rather than the linear fit of TK6X-ray induced mutation at the autosomal tk locus in heterozygotes derived from WI-L2-NS is 20-50 fold higher than in heterozygotes derived from TK6. A larger proportion of WI-L2-NS mutants had lost heterozygosity compared with mutants of TK6. , Fluorescence in situ hybridization indicated that loss of heterozygosity was due almost uniformly to deletion of an allele in mutants of TK6, and to recombination or gene conversion in mutants of WI-L2-NS. These results indicate that recombinational repair contributes to both cell survival and mutation following exposure to ionizing radiation.

Amundson, S.A. [Los Alamos National Lab., NM (United States); Xia, F.; Liber, H.L. [Harvard School of Public Health, Boston, MA (United States)



Agent-based analysis of patterns in crowd behaviour involving contagion of mental states  

Science Conference Proceedings (OSTI)

In this paper an agent-based analysis is made of patterns in crowd behaviour, in particular to simulate a real-life incident that took place on May 4, 2010 in Amsterdam. As a basis, an existing agent-based model is used for contagion of emotions, beliefs ... Keywords: belief, contagion, crowd behaviour, emotion, intention

Tibor Bosse; Mark Hoogendoorn; Michel C. A. Klein; Jan Treur; C. Natalie Van Der Wal



Involvement of DNA polymerase beta in repairing oxidative damages induced by antitumor drug adriamycin  

SciTech Connect

Adriamycin (ADM) is a widely used antineoplastic drug. However, the increasing cellular resistance has become a serious limitation to ADM clinical application. The most important mechanism related to ADM-induced cell death is oxidative DNA damage mediated by reactive oxygen species (ROS). Base excision repair (BER) is a major pathway in the repair of DNA single strand break (SSB) and oxidized base. In this study, we firstly applied the murine embryo fibroblasts wild-type (pol {beta} +/+) and homozygous pol {beta} null cell (pol {beta} -/-) as a model to investigate ADM DNA-damaging effects and the molecular basis underlying these effects. Here, cellular sensitivity to ADM was examined using colorimetric assay and colony forming assay. ADM-induced cellular ROS level and the alteration of superoxide dismutase (SOD) activity were measured by commercial kits. Further, DNA strand break, chromosomal damage and gene mutation were assessed by comet assay, micronucleus test and hprt gene mutation assay, respectively. The results showed that pol {beta} -/- cells were more sensitive to ADM compared with pol {beta} +/+ cells and more severe SSB and chromosomal damage as well as higher hprt gene mutation frequency were observed in pol {beta} -/- cells. ROS level in pol {beta} -/- cells increased along with decreased activity of SOD. These results demonstrated that pol {beta} deficiency could enable ROS accumulation with SOD activity decrease, further elevate oxidative DNA damage, and subsequently result in SSB, chromosome cleavage as well as gene mutation, which may be partly responsible for the cytotoxicity of ADM and the hypersensitivity of pol {beta} -/- cells to ADM. These findings suggested that pol {beta} is vital for repairing oxidative damage induced by ADM.

Liu Shukun; Wu Mei [Department of Environmental Health, Sichuan University, West China School of Public Health, Chengdu (China); Zhang Zunzhen, E-mail: zhangzunzhen@163.co [Department of Environmental Health, Sichuan University, West China School of Public Health, Chengdu (China)



The involvement of the primate frontal cortex-basal ganglia system in arbitrary visuomotor association learning  

E-Print Network (OSTI)

It is the goal of this thesis to examine the frontal cortex-basal ganglia system during arbitrary visuomotor association learning, the forming of arbitrary links between visual stimuli and motor responses (e.g. red means ...

Machon, Michelle S



Department of Energy interest and involvement in nuclear plant license renewal activities  

SciTech Connect

Recognizing the importance of nuclear license renewal to the nation's energy strategy, the Department of Energy (DOE) initiated a plant lifetime improvement program during 1985 to determine the feasibility of the license renewal option for US nuclear plants. Initial activities of the DOE program focused on determining whether there were technical and economic obstacles that might preclude or limit the successful implementation of the license renewal option. To make this determination, DOE cosponsored with the Electric Power Research Institute (EPRI) pilot-plant efforts by Virginia Electric Power and Northern States Power. Both pilot-plant efforts concluded that life extension is technically and economically feasible. In parallel with the pilot-plant activities, DOE performed national economic studies that demonstrated the economic desirability of life extension. Having demonstrated the feasibility of life extension, DOE, in conjunction with EPRI, selected two lead plants to demonstrate the license renewal process. These lead plants are Yankee Atomic's Yankee Rowe facility and Northern States Power's Monticello facility. DOE also initiated activities to develop the technical and regulatory bases to support the license renewal process in the United States. DOE has recently identified nuclear plant license renewal to be an important element of its National Energy Strategy. This paper summarizes the significant results, conclusions, and ongoing activities of the DOE effort. 18 refs.

Bustard, L.D. (Sandia National Labs., Albuquerque, NM (USA)); Harrison, D.L. (USDOE Assistant Secretary for Nuclear Energy, Washington, DC (USA). Office of LWR Safety and Technology)



Tabulation of thermodynamic data for chemical reactions involving 58 elements common to radioactive waste package systems  

DOE Green Energy (OSTI)

The rate of release and migration of radionuclides from a nuclear waste repository to the biosphere is dependent on chemical interactions between groundwater, the geologic host rock, and the radioactive waste package. For the purpose of this report, the waste package includes the wasteform, canister, overpack, and repository backfill. Chemical processes of interest include sorption (ion exchange), dissolution, complexation, and precipitation. Thermochemical data for complexation and precipitation calculations for 58 elements common to the radioactive waste package are presented. Standard free energies of formation of free ions, complexes, and solids are listed. Common logarithms of equilibrium constants (log K's) for speciation and precipitation reactions are listed. Unless noted otherwise, all data are for 298.15/sup 0/K and one atmosphere.

Benson, L.V.; Teague, L.S.



The use of intelligence information to identify the foreign interests of entities involved with DOE programs  

SciTech Connect

This report investigates whether DOE activities could benefit from greater and more consistent access to intelligence information on selected entities with foreign interests. It does not cover dual-use and munition commodities. The investigation determined what information was available from the national intelligence community and law enforcement agencies that would have prevented DOE contracts with selected entities if the information had been available and regulations regarding contracts with selected entities had been enforced.

Not Available




E-Print Network (OSTI)

). The quadrangle contains the Cypress- Plateau coal mine along with the Gordon Creek coal bed methane (CBM) field been conducted in this quadrangle has been proprietary work for the Cypress-Plateau coal mine). Figure 8. Wattis Coal seam located near the old Cyprus Plateau mine. This seam is 1.2 m thick

Seamons, Kent E.


Involvement of RNA binding proteins AUF1 in mammary gland differentiation  

Science Conference Proceedings (OSTI)

The expression of many genes, such as {beta}-casein, c-myc, and cyclin D1, is altered by lactogenic hormone stimulation during mammary epithelial cell differentiation. Here, we demonstrate that post-transcriptional regulation plays an important role to establish gene expression required to initiate milk production as well as transcriptional control. AUF1 protein, a member of the AU-rich element (ARE)-binding protein family, plays a role in ARE-mRNA turnover by regulating mRNA stability and/or translational control. Cytoplasmic localization of AUF1 protein is critically linked to function. We show that as the mammary gland differentiates, AUF1 protein moves from the cytoplasm to the nucleus. Moreover, in mammary gland epithelial cells (HC11), stimulation by lactogenic hormone decreased cytoplasmic and increased nuclear AUF1 levels. Direct binding of AUF1 protein was observed on c-myc mRNA, but not {beta}-casein or cyclin D1 mRNA. AUF1 downregulation in HC11 cells increased the expression of {beta}-casein mRNA and decreased the expression of c-myc mRNA by lactogenic hormone. Conversely, overexpression of AUF1 inhibited these effects of lactogenic hormone stimulation in HC11 cells. These results suggest that AUF1 participates in mammary gland differentiation processes under the control of lactogenic hormone signals.

Nagaoka, Kentaro [Laboratory of Animal Breeding, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)]. E-mail: akenaga@mail.ecc.u-tokyo.ac.jp; Tanaka, Tetsuya [Laboratory of Animal Breeding, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Imakawa, Kazuhiko [Laboratory of Animal Breeding, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan); Sakai, Senkiti [Laboratory of Animal Breeding, Graduate School of Agricultural and Life Sciences, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-8657 (Japan)



Two-Stage Stochastic Programming Involving CVaR with an ...  

E-Print Network (OSTI)

In particular, we consider the problem of determining the response facility ... of the relief supplies at each facility in the presence of uncertainty in demand and the .... problem (Schultz and Tiedemann, 2006), energy optimization problems ...... that the unit penalty cost pck for each commodity k is ? times the purchase price.


A Solanum lycopersicum catechol-O-methyltransferase involved in synthesis of the flavor molecule guaiacol  

E-Print Network (OSTI)

such as liquid smoke (Guillen et al., 1995; Serra Bonvehi´ and Ventura Coll, 1998; Kumaz- awa and Masuda, 2002­819. Guillen, M.D., Manzanos, M.J. and Zabala, L. (1995) Study of a commercial liquid smoke flavoring by means

Klee, Harry J.


Experiments Involving Correlations Between CdTe Solar Cell Fabrication History and Intrinsic Device Stability  

DOE Green Energy (OSTI)

An orthogonal full-factorial design was used to study the effect of CdS and CdTe layer thickness, oxygen ambient during vapor CdCl2 (VCC) and the use of nitric-phosphoric (NP) acid as a pre-contact etch on the initial and stressed performance of CdS/CdTe small-area devices. The best initial device efficiency (using thinner CdS, thicker CdTe, no oxygen during VCC, and NP etch) also showed poor stability. Increasing the CdS thickness significantly improved stability with only a slight decrease in resulting initial performance. All devices used a thin margin of CdTe around the perimeter of the backcontact that was shown to significantly reduce catastrophic degradation and improve overall test statistics. The latter degradation is modeled by the formation of a weak-diode/low shunt resistance localized near the edge of finished devices. This shunting is believed to occur through the CdS/CdTe interface, rather than along the device edge, and is exacerbated by thinner CdS films.

Albin, D.; McMahon, T.; Berniard, T.; Pankow, J.; Demtsu, S.; Noufi, R.



FAQ 29-What are the risks from accidents involving depleted uranium...  

NLE Websites -- All DOE Office Websites (Extended Search)

The most immediate hazard after a release would be from inhalation of hydrogen fluoride (HF), a highly corrosive gas formed when UF6 reacts with moisture in air. Exposure to...


Uniqueness of solutions for elliptic systems and fourth order equations involving a parameter  

E-Print Network (OSTI)

We examine the equation \\[\\Delta^2 u = \\lambda f(u) \\qquad \\Omega, \\] with either Navier or Dirichlet boundary conditions. We show some uniqueness results under certain constraints on the parameter $ \\lambda$. We obtain similar results for the sytem {equation*} \\{{array}{rrl} -\\Delta u &=& \\lambda f(v) \\qquad \\Omega, -\\Delta v &=& \\gamma g(u) \\qquad \\Omega, u&=& v = 0 \\qquad \\partial Omega. {array}. {equation*}

Cowan, Craig



New symbiotic associations involving Syllidae (Annelida: Polychaeta), with taxonomic and biological remarks on  

E-Print Network (OSTI)

is the cosmopolitan species Haplosyllis spongicola (GrÏbe). It is a typical example of a polyxenous relationship among the `cosmopolitan' character of the species based on the infestation character- istics of the sponge

Martin, Daniel

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Getting to Dialogue: Parent/Teacher Communication in a School-Based Involvement Group.  

E-Print Network (OSTI)

??Many within the field of educational systems design believe that in order for the ideal system to exist, where all stakeholders benefit, the users of (more)

Savoy, Michael



Functional characterization and expression of molluscan detoxification enzymes and transporters involved in dietary allelochemical resistance  

E-Print Network (OSTI)

Understanding how organisms deal with potentially toxic or fitness-reducing allelochemicals is important for understanding patterns of predation and herbivory in the marine environment. The ability of marine consumers to ...

Whalen, Kristen Elizabeth



www.mdpi.com/journal/ijerph Extensive Internet InvolvementAddiction or Emerging Lifestyle?  

E-Print Network (OSTI)

Abstract: In the discussions for the future DSM-5, the Substance-Related Disorders Work Group has been addressing addiction-like behavioral disorders such as Internet addiction to possibly be considered as potential additions for the diagnostic system. Most research aiming to specify and define the concept of Internet addiction (or: Excessive/Compulsive/Problematic Internet UsePIU), takes its point of departure in conventional terminology for addiction, based in established DSM indicators. Still, it is obvious that the divide between characteristics of addiction and dimensions of new lifestyles built on technological progress is problematic and far from unambiguous. Some of these research areas are developing from the neurobiological doctrine of addiction as not being tied to specific substances. The concept of behavioral addictions, based on biological mechanisms such as the reward systems of the brain, has been launched. The problems connected to this development are in this study discussed and reflected with data from a Swedish survey on Internet use (n = 1,147). Most Swedes (85%) do use the Internet to some degree. The prevalence of excessive use parallels other similar countries. Respondents in our study spend (mean value) 9.8 hours per week online at home, only

Karin Helmersson Bergmark; Anders Bergmark; Olle Findahl



An investigation of the issues involved in creating a bank of exam questions  

E-Print Network (OSTI)

at the University's Computer Lab: having experimented with putting the famous coffee webcam online in the early 1990s, the Department looked round for other material to put onto the web and decided that their small collection of past exam papers could find a home... with papers whose exam code has changed, creating an XML document with the complete structure of the University and all exams, testing for bugs and security loopholes, and optimising for speed. In addition to this, the past papers themselves need...

Truscott, Harriet



Overview of Scientific Issues Involved in Selection of Polymers for PV Applications: Preprint  

DOE Green Energy (OSTI)

Encapsulant materials used in photovoltaic (PV) modules serve multiple purposes. They physically hold components in place, provide electrical insulation, reduce moisture ingress, optically couple superstrate materials (e.g., glass) to PV cells, protect components from mechanical stress by mechanically de-coupling components via strain relief, and protect materials from corrosion. To do this, encapsulants must adhere well to all surfaces, remain compliant, and transmit light after exposure to temperature, humidity, and UV radiation histories. Here, a brief review of some of the polymeric materials under consideration for PV applications is provided, with an explanation of some of their advantages and disadvantages.

Kempe, M.



Involvement of fatty acid pathways and cortical interaction of the pronuclear complex in Caenorhabditis elegansembryonic polarity  

E-Print Network (OSTI)

-32 animals at the permissive temperature. Progeny were immediately mated to unc-32(e189) / qC1 males to maintain emb- 8(hc69) and pod-1(ye11) in the heterozygous state over the balancer chromosome qC1. Verification of this emb- 8(hc69) pod-1(ye11...

Rappleye, Chad A; Tagawa, Akiko; Le Bot, Nathalie; Ahringer, Julie; Aroian, Raffi V



Experimentation Involving Controversial Scientific and Technological Issues: Weather Modification as a Case Illustration  

Science Conference Proceedings (OSTI)

The development of weather modification requires resolution of a number of scientific questions. To resolve them necessitates field experiments that frequently extend over many years and cost millions of dollars. These projects usually are highly ...

Stanley A. Changnon; W. Henry Lambright



Introduction In recent years, many of the genes that are involved in early  

E-Print Network (OSTI)

). Factors required for outgrowth of the limb have also been identified (Lewandoski et al., 2000; Min et al

Capecchi, Mario R.


Involvement of the Rab27 binding protein Slac2c/MyRIP in insulin exocytosis  

E-Print Network (OSTI)

Rab27a is a GTPase associated with insulin-containing secretory granules of pancreatic ?-cells. Selective reduction of Rab27a expression by RNA interference did not alter granule distribution and basal secretion but impaired exocytosis triggered by insulin secretagogues. Screening for potential effectors of the GTPase revealed that the Rab27a-binding protein Slac2c/MyRIP is associated with secretory granules of ?-cells. Attenuation of Slac2c/MyRIP expression by RNA interference did not modify basal secretion but severely impaired hormone release in response to secretagogues. Although ?-cells express Myosin-Va, a potential partner of Slac2c/MyRIP, no functional link between the two proteins could be demonstrated. In fact, overexpression of the Myosin-Va binding domain of Slac2c/MyRIP did not affect granule localization and hormone exocytosis. In contrast, overexpression of the actin-binding domain of Slac2c/MyRIP led to a potent inhibition of exocytosis without detectable alteration in granule distribution. This effect was prevented by point mutations that abolish actin binding. Taken together our data suggest that Rab27a and Slac2c/MyRIP are part of a complex mediating the interaction of secretory granules with cortical actin cytoskeleton and participate to the regulation of the final steps of insulin exocytosis.

Laurent Waselle; Mitsunori Fukuda; Mariella Iezzi; Aziz El-amraoui; Christine Petit; Romano Regazzi



Laser-driven deflection arrangements and methods involving charged particle beams  

DOE Patents (OSTI)

Systems, methods, devices and apparatus are implemented for producing controllable charged particle beams. In one implementation, an apparatus provides a deflection force to a charged particle beam. A source produces an electromagnetic wave. A structure, that is substantially transparent to the electromagnetic wave, includes a physical structure having a repeating pattern with a period L and a tilted angle .alpha., relative to a direction of travel of the charged particle beam, the pattern affects the force of the electromagnetic wave upon the charged particle beam. A direction device introduces the electromagnetic wave to the structure to provide a phase-synchronous deflection force to the charged particle beam.

Plettner, Tomas (San Ramon, CA); Byer, Robert L. (Stanford, CA)



Involvement of right STS in audio-visual integration for affective speech  

E-Print Network (OSTI)

with the observation of supra-additive increases in power for the ambiguous emotion condition, that account does not entirely reconcile with the observation of no significant supra-additive increases in theta power in STS during the unambiguous emotion condition... congruency across sensory modalities enhances or modulates supra-additive responses in STG and surrounding temporal regions, although the present study alone does not permit one to draw definitive conclusions about the role of supra-additive increases...

Hagan, Cindy



DOE O 442.2, Differing Professional Opinions for Technical Issues Involving Environment, Safety and Health  

Directives, Delegations, and Requirements

The Order establishes the DOE Differing Professional Opinion process for employees to raise technical concerns related to environment, safety, and health which ...



Coupled-Channel Evaluations of Cross Sections for Scattering Involving Particle-Unstable Resonances  

Science Conference Proceedings (OSTI)

How does the scattering cross section change when the colliding bound-state fragments are allowed particle-emitting resonances? This question is explored in the framework of a multichannel algebraic scattering method of determining nucleon-nucleus cross sections at low energies. Two cases are examined, the first being a gedanken investigation in which n+{sup 12}C scattering is studied with the target states assigned artificial widths. The second is a study of neutron scattering from {sup 8}Be, a nucleus that is particle unstable. Resonance character of the target states markedly varies evaluated cross sections from those obtained assuming stability in the target spectrum.

Fraser, P.; Amos, K. [School of Physics, University of Melbourne, Victoria 3010 (Australia); Canton, L.; Pisent, G. [Istituto Nazionale di Fisica Nucleare, Sezione di Padova, I-35131 (Italy); Karataglidis, S. [Department of Physics and Electronics, Rhodes University, Grahamstown 6140 (South Africa); Svenne, J. P. [Department of Physics and Astronomy, University of Manitoba, Winnipeg, Manitoba, R3T 2N2 (Canada); Knijff, D. van der [Advanced Research Computing, Information Division, University of Melbourne, Victoria 3010 (Australia)



Collaboratives for Wildlife-Wind Turbine Interaction Research: Fostering Multistakeholder Involvement (Poster)  

DOE Green Energy (OSTI)

This poster highlights the various wildlife-wind collaboratives (specific to wildlife-wind turbine interaction research) that currently exist. Examples of collaboratives are included along with contact information, objectives, benefits, and ways to advance the knowledge base.

Sinclair, K.



Native American fishery issues: Hanford involvement in evaluation of the Zone 6 fishery  

DOE Green Energy (OSTI)

Native American fishers are concerned about the deteriorating quality of salmon and other fish caught from the Columbia River. They fear salmon are not healthy and that eating the fish could Jeopardize the health of Native Americans. In 1991, the Pacific Northwest Laboratory (PNL). with the assistance of the Yakima Indian Nation (YIN). monitored the salmon and steelhead fishery in the lower Columbia River (Zone 6 fishery). PNL biologists set up a hot-line'' for Native American fishers to call if they caught fish they suspected were diseased or contaminated. Fish reported to the hot-line were examined by a fish disease pathologist. Additionally. PNL and YIN staff reviewed water-quality data of the lower Columbia River. Water-quality data collected from 1949 through 1990. Results are described.

Abernethy, C.S.; Neitzel, D.A. (Pacific Northwest Lab., Richland, WA (United States)); Strom, G. (Yakima Indian Nation, Toppenish, WA (United States))



A model of hyphal tip growth involving microtubule-based transport  

E-Print Network (OSTI)

We propose a simple model for mass transport within a fungal hypha and its subsequent growth. Inspired by the role of microtubule-transported vesicles, we embody the internal dynamics of mass inside a hypha with mutually excluding particles progressing stochastically along a growing one-dimensional lattice. The connection between long range transport of materials for growth, and the resulting extension of the hyphal tip has not previously been addressed in the modelling literature. We derive and analyse mean-field equations for the model and present a phase diagram of its steady state behaviour, which we compare to simulations. We discuss our results in the context of the filamentous fungus, Neurospora crassa.

K. E. P. Sugden; M. R. Evans; W. C. K. Poon; N. D. Read



Physical Simulation of an Embedded Surface Mesh Involving Deformation and Fracture  

E-Print Network (OSTI)

Simulating virtual objects which can deform or break apart within their environments is now common in state-of-the-art virtual simulations such as video games or surgery simulations. Real-time performance requires a physical model which provides an approximation to the true solution for fast computations but at the same time provides enough believability of the simulation to the user. Recent research in object deformation and fracture has revolved around embedding portions of the simulation for graphical display inside a much simpler physical domain which is invisible to the user. Embedding complex geometry in a simpler domain allows for very complex effects to occur in a much more robust and computationally efficient manner. This thesis explores a novel method to efficiently embed a high-resolution surface mesh inside a coarse tetrahedral physical mesh for the purposes of interactive simulation and display. A technique to display interior regions as solid geometry without explicitly re-meshing the graphical mesh during fracture has been explored and developed. Keeping the graphical mesh static in memory during simulation allows the geometry to be off-loaded to the GPU while shaders can be utilized to only display portions of the geometry which are locally contained within the physical mesh. Recent advances in GPU technology have also been exploited in order to provide an increase in visual fidelity and help achieve the illusion that the virtual object itself is breaking apart in a physically plausible manner.

Clack, Billy



Issues Associated with IAEA Involvement in Assured Nuclear Fuel Supply Arrangements  

SciTech Connect

Assured nuclear fuel supply has been discussed at various times as a mechanism to help limit expansion of enrichment and reprocessing (E&R) capability beyond current technology holders. Given the events in the last few years in North Korea and Iran, concern over weapons capabilities gained from acquisition of E&R capabilities has heightened and brought assured nuclear fuel supply (AFS) again to the international agenda. Successful AFS programs can be valuable contributions to strengthening the nonproliferation regime and helping to build public support for expanding nuclear energy.

Kessler, Carol E.; Mathews, Carrie E.



Minority student involvement in computational science research at Texas Southern University  

Science Conference Proceedings (OSTI)

There is an extreme shortage of minority students entering STEM fields in general, and computational science in particular. Therefore, a large segment of the national population has potential for contributions to science and research, but this potential ... Keywords: HBCU, HPC, computational science, high-performance computing, minorities in science education

M. Farrukh Khan; Daniel Vrinceanu; Kiran Chillakamarri; C. J. Tymczak



The rice OsGAE1 is a novel gibberellin-regulated gene and involved ...  

Science Conference Proceedings (OSTI)

genomic DNA was isolated from 1-week-old seedlings grown on MS ... restriction mapping and sequencing. .... (residues 52190) with a repeated sequence of.

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LANL gets young women involved in math and science at 31st Expanding...  

NLE Websites -- All DOE Office Websites (Extended Search)

Environment Feature Stories Public Reading Room: Environmental Documents, Reports LANL Home Phonebook Calendar Video Newsroom News Releases News Releases - 2010 ...


Power-law distributions in events involving nuclear and radiological materials  

E-Print Network (OSTI)

Nuclear and radiological events are large-impact, hard-to-predict rare events, whose associated probability is exceedingly low. They can exert monumental impacts and lead to grave environmental and economic consequences. ...

Chow, Jijun



Hydrogenolysis Of 5-Carbon Sugars, Sugar Alcohols And Compositions For Reactions Involving Hydrogen  

DOE Patents (OSTI)

Methods and compositions for reactions of hydrogen over a Re-containing catalyst with compositions containing a 5-carbon sugar, sugar alcohol, or lactic acid are described. It has been surprisingly discovered that reaction with hydrogen over a Re-containing multimetallic catalyst resulted in superior conversion and selectivity to desired products such as propylene glycol. A process for the synthesis of PG from lactate or lactic acid is also described.

Werpy, Todd A. (West Richland, WA); Frye, Jr., John G. (Richland, WA); Zacher, Alan H. (Kennewick, WA); Miller, Dennis J. (Okemos, MI)



Native American fishery issues: Hanford involvement in evaluation of the Zone 6 fishery  

SciTech Connect

Native American fishers are concerned about the deteriorating quality of salmon and other fish caught from the Columbia River. They fear salmon are not healthy and that eating the fish could Jeopardize the health of Native Americans. In 1991, the Pacific Northwest Laboratory (PNL). with the assistance of the Yakima Indian Nation (YIN). monitored the salmon and steelhead fishery in the lower Columbia River (Zone 6 fishery). PNL biologists set up a hot-line'' for Native American fishers to call if they caught fish they suspected were diseased or contaminated. Fish reported to the hot-line were examined by a fish disease pathologist. Additionally. PNL and YIN staff reviewed water-quality data of the lower Columbia River. Water-quality data collected from 1949 through 1990. Results are described.

Abernethy, C.S.; Neitzel, D.A. (Pacific Northwest Lab., Richland, WA (United States)); Strom, G. (Yakima Indian Nation, Toppenish, WA (United States))



Critical time course of right frontoparietal involvement in mental number space  

Science Conference Proceedings (OSTI)

Neuropsychological, neurophysiological, and neuroimaging studies suggest that right frontoparietal circuits may be necessary for the processing of mental number space, also known as the mental number line MNL. Here we sought to specify the critical time ...

Elena Rusconi; Martynas Dervinis; Frederick Verbruggen; Christopher D. Chambers



Braze Process Optimization Involving Conventional Metal/Ceramic Brazing with 50Au-50Cu Alloy  

DOE Green Energy (OSTI)

Numerous process variables can influence the robustness of conventional metal/ceramic brazing processes. Experience with brazing of hermetic vacuum components has identified the following parameters as influencing the outcome of hydrogen furnace brazed Kovar{trademark} to metallized alumina braze joints: (a) Mo-Mn metallization thickness, sinter fire temperature and porosity (b) Nil plate purity, thickness, and sinter firing conditions (c) peak process temperature, time above liquidus and (d) braze alloy washer thickness. ASTM F19 tensile buttons are being used to investigate the above parameters. The F19 geometry permits determination of both joint hermeticity and tensile strength. This presentation will focus on important lessons learned from the tensile button study: (A) the position of the Kovar{trademark} interlayer can influence the joint tensile strength achieved--namely, off-center interlayers can lead to residual stress development in the ceramic and degrade tensile strength values. Finite element analysis has been used to demonstrate the expected magnitude in strength degradation as a function of misalignment. (B) Time above liquidus (TAL) and peak temperature can influence the strength and alloying level of the resulting braze joint. Excessive TAL or peak temperatures can lead to overbraze conditions where all of the Ni plate is dissolved. (C) Metallize sinter fire processes can influence the morphology and strength obtained from the braze joints.




Impacts of Forecaster Involvement on Convective Storm Initiation and Evolution Nowcasting  

Science Conference Proceedings (OSTI)

A forecaster-interactive capability was added to an automated convective storm nowcasting system [Auto-Nowcaster (ANC)] to allow forecasters to enhance the performance of 1-h nowcasts of convective storm initiation and evolution produced every 6 ...

Rita D. Roberts; Amanda R. S. Anderson; Eric Nelson; Barbara G. Brown; James W. Wilson; Matthew Pocernich; Thomas Saxen



The graduate program involves 23 full-, part-time, or active emeritus  

E-Print Network (OSTI)

: overview Bulk geochemical parameters are given in Table 1. High TOC rocks with petroleum source potential Masirah Bay formations. 6. Source rock geochemistry 6.1. Bulk carbon isotopic composition Bulk d13 C, typical of petroleum source rocks deposited under anoxic, or euxinic, condi- tions (Curiale et al., 1985

Peterson, Blake R.


GRADUATE STUDY IN GEOLOGY The graduate program involves 26 full-, part-  

E-Print Network (OSTI)

.G., Summons R.E. and Sweet I.P., 1986. Hydrocarbon shows and petroleum source rocks in sediments as old as 1. Petroleum source rocks of the Amadeus Basin. In: Geological and geophysical studies in the Amadeus Basin.D. and Francis D.A., 1993. Geochemistry of oils and source rocks of the East Coast Basin and implications

Peterson, Blake R.


Directory of DOE and contractor personnel involved in non-government standards activities  

SciTech Connect

This document contains a listing of DOE employees and DOE contractors who have submitted form DOE F 1300.2, Record of Non-Government Standards Activity. Additional names were added from rosters supplied by non-Government standards bodies.




Thermal Sciences The thermal sciences area involves the study of energy conversion and transmission, power  

E-Print Network (OSTI)

, power generation, the flow of liquids and gases, and the transfer of thermal energy (heat) by means, Thermodynamics, a sophomore spring course. This is followed by ME 608, Fluid Dynamics in the fall of the junior - Analytical Fluid Dynamics ME 709 - Computational Fluids Dynamics ME 712 - Waves in Fluids #12;

Chini, Gregory P.


NJITMAGA-HARDCOPY Some of those involved in the public policy debate may have  

E-Print Network (OSTI)

fuels used to generate electricity. Under the old regulatory model, these costs would have been directly or functionally transfer ownership of their electric generating plants. Utilities still deliver elec- tricity. The savings stem from reducing the impact of fuel cost increases and efficiency improvements at electric

Bieber, Michael


Improving tide-gauge data processing: A method involving tidal frequencies and inverted barometer effect  

Science Conference Proceedings (OSTI)

Sea level measured at tide-gauge stations is affected by undesired events such as spikes, gaps, steps and time shifts. The presence of these instrumental failures seriously decreases the quality of each analysis done using the record. Furthermore, they ... Keywords: Data processing, Inverted barometer effect, Ocean tides, Sea-level changes, Tide-gauge observations

E. Gil; C. de Toro



Risks From Severe Accidents Involving Steam Generator Tube Leaks or Ruptures  

Science Conference Proceedings (OSTI)

The various types of corrosion observed in PWR steam generator tubes prompted the nuclear industry to initiate a program of Steam Generator Degradation Specific Management (SGDSM). This program's objective is to develop a cost-effective means to maintain plant safety while improving steam generator reliability. Critical to this program is an assessment of the impact of steam generator tube leakage or rupture during severe accidents. This study determined the contributions of these types of severe acciden...



On the Cover: One route to harvesting the energy of the sun involves learning to mimic  

E-Print Network (OSTI)

.1% of the world's electricity, and solar fuel from modern (sustainable) biomass provided less than 1 Defect-tolerant and Self-repairing Solar Conversion Systems ................. 145 Solar Thermochemical and development RC reaction center TCO transparent conducting oxide TMS theoretical modeling and simulation TPV

Wu, Zhigang


Ionizing radiation induces IL-6-production by human fibroblasts involving activation of nuclear factor-. kappa. B  

Science Conference Proceedings (OSTI)

The authors report that human lung fibroblasts respond to X-ray treatment with release of interleukin (IL) -6. Synthesis of IL-6 upon ionizing radiation is preceded by an increase of IL-6 transcript levels resulting from transcriptional activation of the IL-6 gene. Analysis of deleted fragments of the IL-6 promoter revealed that transcriptional induction of the IL-6 promoter is due to enhanced binding activity of the transcription factor NF-kB. Although AP-1 does not participate in the rapid induction of the IL-6 promoter its binding activity is also enhanced upon XRT. In contrast to binding kinetics observed with NF-kB, AP-1 binding upon XRT. In contrast to binding kinetics observed with NF-kB- and the AP-1 recognition sequence, conferred inducibility by XRT to a heterologous promoter, with reporter gene activity being maximal 24 hours or 48 hours upon XRT, respectively. Sequential activation of two distinct transcription factors might thus contribute to synchronize transcriptional activation of different genes participating in the X-ray response.

Brach, M.A.; Gruss, H.J.; Kaisho, Tsuneyasu; Asano, Yoshinobu; Vos, Sven de; Mertelsmann, R.; Hirano, Toshio; Herrmann, F. (Univ. of Freiburg (Germany) Osaka Univ. (Japan))



Active black holes: Relevant plasma structures, regimes and processes involving all phase space  

E-Print Network (OSTI)

The presented theory is motivated by the growing body of experimental information on the characteristics, connected with relevant spectral, time, and space resolutions, of the radiation emission from objects considered as ...

Coppi, Bruno


An Evolutionary Genomic Approach to Identify Genes Involved in Human Birth Timing  

E-Print Network (OSTI)

Coordination of fetal maturation with birth timing is essential for mammalian reproduction. In humans, preterm birth is a disorder of profound global health significance. The signals initiating parturition in humans have ...

Plunkett, Jevon



E-Print Network (OSTI)

Laser Energy Measurements When using the Phase-R as the photolysis source, pulse energy measurements were obtained with a Gentec system.

Nelson, Herbert Hoffman



A system theoretic safety analysis of U.S. Coast Guard aviation mishap involving CG-6505  

E-Print Network (OSTI)

During a 22-month period, between 2008 and 2010, the U.S. Coast Guard experienced seven Class-A aviation mishaps resulting in the loss of 14 Coast Guard aviators and seven Coast Guard aircraft. This represents the highest ...

Hickey, Jon (Jon Patrick)


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Molybdenum Triamidoamine Systems. Reactions Involving Dihydrogen Relevant to Catalytic Reduction of Dinitrogen  

E-Print Network (OSTI)

[HIPTN[subscript 3]N]Mo(N[subscript 2]) (MoN[subscript 2]) ([HIPTN[subscript 3]N][superscript 3?] = [(HIPTNCH2CH2)3N]3? where HIPT = 3,5-(2,4,6-i-Pr[subscript 3]C[subscript 6]H[subscript 2])[subscript 2]C[subscript ...

Hetterscheid, Dennis G. H.


Higher order symmetric duality in nondifferentiable multi-objective programming problems involving generalized cone convex functions  

Science Conference Proceedings (OSTI)

A pair of Mond-Weir type multi-objective higher order symmetric dual programs over arbitrary cones is formulated. Weak, strong and converse duality theorems are established under higher order K-F-convexity assumptions. Our results generalize several ... Keywords: Cone constraints, Duality theorems, Efficiency, K-F- convexity, Multi-objective programming

Ravi P. Agarwal; Izhar Ahmad; Anurag Jayswal



Atmospheric Aerosols Aging Involving Organic Compounds and Impacts on Particle Properties  

E-Print Network (OSTI)

In the first part of this dissertation, we study the aging of soot, a representative type of primary aerosols, in the presence of OH-initiated oxidation products of toluene. Monodisperse soot particles are introduced into an environmental chamber where toluene is oxidized by OH radicals. The variations in soot particle properties are simultaneously monitored, including particle size, mass, organic mass faction, hygroscopicity, and optical properties. The changes in particle properties are found to be largely governed by the thickness of the organic coating that is closely related to reaction time and initial reactant concentrations. Derived from particle size and mass, the effective density increases while dynamic shape factor decreases as the organic coating grows, suggesting a compaction of the soot morphology. As the organic coating grows, the particles become more hygroscopic and have enhanced light scattering and absorption. The second part discusses the potential reactions between amines and some aerosol constituents and alteration of aerosol properties. The reactions between alkylamines and ammonium sulfate/bisulfate have been studied using a low-pressure fast flow reactor coupled to a mass spectrometer at 293 K. Alkylamines react with ammonium sulfate/bisulfate to form alkylaminium sulfates, suggesting the existence of alkylaminium salts in particle phase. We have extended our study to characterize the physicochemical properties of alkylaminium sulfates. The hygroscopicity, thermostability, and density of five representative alkylaminium sulfates have been measured by an integrated aerosol analytical system. All alkylaminium sulfate aerosols show monotonic size growth when exposed to increasing relative humidity. Mixing ammonium sulfate with alkylaminium sulfates lowers the deliquescence point corresponding to ammonium sulfate. Alkylaminium sulfates are thermally comparable to or more stable than ammonium sulfate. The densities of alkylaminium sulfate particles are lower than that of ammonium sulfate. Our results suggest that the organic compounds can effectively alter the composition and properties of atmospheric aerosols, considerably influencing the impacts of aerosols on air quality, climate forcing, and human health.

Qiu, Chong




SciTech Connect

Recent growth in the development of hydrogen infrastructure has led to more requests for code officials to approve hydrogen-related projects and facilities. To help expedite the review and approval process, significant efforts have been made to educate code officials on permitting hydrogen vehicle fueling stations and facilities using stationary fuel cells (e.g., backup power for telephone cell tower sites). Despite these efforts, project delays continue because of several factors, including the limited experience of code officials with these types of facilities, submittals that lack the required information (including failure to adequately address local requirements), and submission of poor quality documents. The purpose of this paper is to help project proponents overcome these potential roadblocks and obtain timely approval for a project. A case study of an actual stationary application permitting request is provided to illustrate the value of addressing these issues.

Kallman, Richard A.; Barilo, Nick F.; Murphy, W. F.



Games, Risks, and Analytics: Several Illustrative Cases Involving National Security and Management Situations  

Science Conference Proceedings (OSTI)

This paper presents and compares four models of games and risk analyses designed to support strategic and policy decisions, three focusing on national security issues and one on project management. They share a common core of probability, linked decisions ... Keywords: analytics, counterterrorism, failure probability, game analysis, national security, nuclear proliferation, practice, principal--agent model, risk analysis

M. Elisabeth Pat-Cornell



Overview of ASTM D03 Involvement with Hydrogen Fuel Purity Specificati...  

NLE Websites -- All DOE Office Websites (Extended Search)

Breath of H2 Standardization Other ASTM Committees: * Committee D05 on Coal and Coke * Committee D14 on Adhesives * Committee D16 on Aromatic Hydrocarbons and Related...


Abstract--This paper addresses the problem of controlling wind energy conversion systems (WECS) which involve  

E-Print Network (OSTI)

Abstract-- This paper addresses the problem of controlling wind energy conversion systems (WECS-inverter. The goal of control is to maximize wind energy extraction and this needs letting the wind turbine rotor wind energy extraction) only for one wind speed value depending on the considered value of turbine

Paris-Sud XI, Université de


Most cross-sex killings involve the killing of a spouse (Daly & Wilson, 1999). With occasional exceptions, men far out-  

E-Print Network (OSTI)

Triangle Todd K. Shackelford Department of Psychology Florida Atlantic University David M. Buss Department of Psychology University of Texas at Austin Viviana A. Weekes-Shackelford Department of Psychology Florida not explained by existing theories of homicide. Requests for reprints should be sent to Todd K. Shackelford

Pillow, Jonathan


Using Software Development Standards to Analyse Accidents Involving Electrical, Electronic or Programmable Electronic Systems: The Blade Mill Case Study  

E-Print Network (OSTI)

Johnson,C.W. Bowell,M. In C.J. Hayhurst, C.M.Holloway and B. Strauch (eds), Proceedings of the 2nd Workshop on the Investigation and Reporting of Incidents and Accidents, Published as NASA Technical Report NASA/CP-2003-212642 pp 111-128

Johnson, C.W.


A Comparative Review of Hydrologic Issues Involved in Geologic Storage of CO2 and Injection Disposal of Liquid Waste  

E-Print Network (OSTI)

pp. 112, 2005. DOE, Carbon sequestration research andNational Conference on Carbon Sequestration, National Energyverification of geologic carbon sequestration, Geophys. Res.

Tsang, C.-F.



A Comparative Review of Hydrologic Issues Involved in Geologic Storage of CO2 and Injection Disposal of Liquid Waste  

E-Print Network (OSTI)

of new fractures (hydraulic fracturing), which reduce thefor fault slip and hydraulic fracturing for two differentmay also allow for hydraulic fracturing at the bottom of the

Tsang, C.-F.



Permeability reduction mechanisms involved in in-situ gelation of a polyacrylamide/chromium (VI)/thiourea system  

SciTech Connect

In this paper an investigation of the in-situ gelation of a polyacrylamide/chromium(VI)/thiourea system under flow conditions in unconsolidated sandpacks is presented. High flow resistance was observed in a localized section of the sandpacks that was consistent with deep-bed filtration mechanisms. A method to measure the size of aggregates in gel solution is also presented. Results from this method showed that the gel aggregates grow with reaction time and distance traveled through the sandpack, supporting the conclusion that filtration is a dominant factor in the in-situ gelation process under flow conditions.

McCool, C.S.; Green, D.W.; Willhits, G.P. (University of Kansas, KS (US))



Trust and multi-agent systems: applying the "diffuse, default model" of trust to experiments involving artificial agents  

Science Conference Proceedings (OSTI)

We argue that the notion of trust, as it figures in an ethical context, can be illuminated by examining research in artificial intelligence on multi-agent systems in which commitment and trust are modeled. We begin with an analysis of a philosophical ... Keywords: Artificial agents, Default trust, Diffuse trust, Multi-agent systems, Trust

Jeff Buechner; Herman T. Tavani



Notice of Intent to Prepare an Environmental Impact Statement and Notice of Floodplain and Wetlands Involvement; NRG Energy, Inc.  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

109 109 Federal Register / Vol. 63, No. 206 / Monday, October 26, 1998 / Notices internet address Pat Sherrill@ed.gov, or should be faxed to 202-708-9346. FOR FURTHER INFORMATION CONTACT: Patrick J. Sherrill (202) 708-8196. Individuals who use a telecommunications device for the deaf (TDD) may call the Federal Information Relay Service (FIRS) at 1-800-877-8339 between 8 a.m. and 8 p.m., Eastern time, Monday through Friday. SUPPLEMENTARY INFORMATION: Section 3506 of the Paperwork Reduction Act of 1995 (44 U.S.C. Chapter 35) requires that the Office of Management and Budget (OMB) provide interested Federal agencies and the public an early opportunity to comment on information collection requests. OMB may amend or waive the requirement for public consultation to the extent that public


Studies involving high temperature desulfurization/regeneration reactions of metal oxides for fuel cell development. Final report  

DOE Green Energy (OSTI)

Research conducted at Giner, Inc. during 1981 to 1983 under the present contract has been a continuation of the investigation of a high temperature regenerable desulfurization process capable of reducing the sulfur content in coal gases from 200 ppM to 1 ppM. The overall objective has been the integration of a coal gasifier with a molten carbonate fuel cell, which requires that the sulfur content be below 1 ppM. Commercially available low temperature processes incur an excessive energy penalty. Results obtained with packed-bed and fluidized bed reactors have demonstrated that a CuO/ZnO mixed oxide sorbent is regenerable and capable of lowering the sulfur content (as H/sub 2/S and COS) from 200 ppM in simulated hot coal-derived gases to below 1 ppM level at 600 to 650/sup 0/C. Four potential sorbents (copper, tungsten oxide, vanadium oxide and zinc oxide) were initially selected for experimental use in hot regenerable desulfurization in the temperature range 500 to 650/sup 0/C. Based on engineering considerations, such as desulfurization capacity in per weight or volume of sorbents, a coprecipitated CuO/ZnO was selected for further study. A structural reorganization mechanism, unique to mixed oxides, was identified: the creation of relatively fine crystallites of the sulfided components (Cu/sub 2/S and ZnS) to counteract the loss of surface area due to sintering during regeneration. Studies with 9 to 26% water vapor in simulated coal gases show that sulfur levels below 1 ppM can be achieved in the temperature range of 500/sup 0/ to 650/sup 0/C. The ability of CuO/ZnO to remove COS, CS/sub 2/ and CH/sub 3/SH at these conditions has been demonstrated in this study. Also a previously proposed pore-plugging model was further developed with good success for data treatment of both packed bed and fluidized-bed reactors. 96 references, 42 figures, 21 tables.

Jalan, V.



Comparison of approaches for simulating reactive solute transport involving organic degradation reactions by multiple terminal electron acceptors  

Science Conference Proceedings (OSTI)

Reactive solute transport models are useful tools for analyzing complex geochemical behavior resulting from biodegradation of organic compounds by multiple terminal electron acceptors (TEAPs). The usual approach of simulating the reactions of multiple ... Keywords: biogeochemistry, groundwater, hydrogen, monod kinetics, thermodynamics

Gary P. Curtis




E-Print Network (OSTI)

Background paper of the conference on The Caucasus and Black Sea region: European Neighbourhood Policy (ENP) and beyond

Nona Mikhelidze; Istituto Affari Internazionali Iai; Nona Mikhelidze



Summary Report of a Peer Involvement Workshop on the Development of an Exposure Factors Handbook for the Aging  

E-Print Network (OSTI)

DC 20460 DISCLAIMER This document has been reviewed in accordance with U.S. Environmental Protection Agency policy and approved for publication. Mention of trade names or commercial products does not constitute endorsement or recommendation for use.

unknown authors



Oroxylin A induced apoptosis of human hepatocellular carcinoma cell line HepG2 was involved in its antitumor activity  

SciTech Connect

We previously reported that wogonin, a flavonoid compound, was a potent apoptosis inducer of human hepatoma SMMC-7721 cells and murine sarcoma S180 cells. In the present study, the effect of oroxylin A, one wogonin structurally related flavonoid isolated from Scutellariae radix, on human hepatocellular carcinoma cell line HepG2 was examined and molecular mechanisms were also investigated. Oroxylin A inhibited HepG2 cell proliferation in a concentration- and time-dependent manner measured by MTT-assay. Treatment with an apoptosis-inducing concentration of oroxylin A caused typical morphological changes and apoptotic blebbing in HepG2 cells. DNA fragmentation assay was used to examine later apoptosis induced by oroxylin A. FACScan analysis revealed a dramatic increase in the number of apoptotic and G{sub 2}/M phase arrest cells after oroxylin A treatment. The pro-apoptotic activity of oroxylin A was attributed to its ability to modulate the concerted expression of Bcl-2, Bax, and pro-caspase-3 proteins. The expression of Bcl-2 protein and pro-caspase-3 protein was dramatically decreased after treatment with oroxylin A. These results demonstrated that oroxylin A could effectively induce programmed cell death and suggested that it could be a promising antitumor drug.

Hu Yang [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); Yang Yong [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); You Qidong [Department of Medicinal Chemistry, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China)]. E-mail: qdyou@cpu.edu.cn; Liu Wei [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); Gu Hongyan [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); Zhao Li [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); Zhang Kun [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); Wang Wei [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China); Wang Xiaotang [Department of Chemistry and Biochemistry, Florida International University, 11200 SW 8th Street, Miami, FL 33199 (United States); Guo Qinglong [Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang, Nanjing 210009 (China)]. E-mail: qinglongguo@hotmail.com



A Comparative Review of Hydrologic Issues Involved in Geologic Storage of CO2 and Injection Disposal of Liquid Waste  

E-Print Network (OSTI)

loss in class I waste injection wells, in: Apps J.A. andR.F. , An overview of injection well history in the Unitedmeasures for Class I injection wells, in Apps J.A. and Tsang

Tsang, C.-F.


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TERC Research in the Chilean Patagonia TERC is involved in a collaborative research effort with the EULA Center of the  

E-Print Network (OSTI)

a Research Proposal for Inclusion in the 1998 Smolt Monitoring Program Proposal Reviewed: Comparative of similar numbers of juvenile salmon as a basis for management of the hydroelectric system is advisable hatcheries most distant from the hydroelectric system in the 1997 study, Pahsimeroi and Mc

Schladow, S. Geoffrey


Making recreational space: citizen involvement in outdoor recreation and park establishment in British Columbia, 1900-2000.  

E-Print Network (OSTI)

??Studies of outdoor recreation and the social construction of wilderness have shown how urban consumption of wilderness areas dispossessed rural residents from traditional land uses. (more)

Clayton, Jenny



A Comparative Review of Hydrologic Issues Involved in Geologic Storage of CO2 and Injection Disposal of Liquid Waste  

Science Conference Proceedings (OSTI)

The paper presents a comparison of hydrologic issues and technical approaches used in deep-well injection and disposal of liquid wastes, and those issues and approaches associated with injection and storage of CO{sub 2} in deep brine formations. These comparisons have been discussed in nine areas: (1) Injection well integrity; (2) Abandoned well problems; (3) Buoyancy effects; (4) Multiphase flow effects; (5) Heterogeneity and flow channeling; (6) Multilayer isolation effects; (7) Caprock effectiveness and hydrogeomechanics; (8) Site characterization and monitoring; and (9) Effects of CO{sub 2} storage on groundwater resources There are considerable similarities, as well as significant differences. Scientifically and technically, these two fields can learn much from each other. The discussions presented in this paper should help to focus on the key scientific issues facing deep injection of fluids. A substantial but by no means exhaustive reference list has been provided for further studies into the subject.

Tsang, C.-F.; Birkholzer, J.; Rutqvist, J.



Understanding Key Players and Factors Involved in the Implementation of Physical Activity Push Strategies into Organizational Settings  

E-Print Network (OSTI)

evolution of an organizational heart health assessment. Am Jbuilding a legacy of health organizational wellness program.in employee health and organizational productivity outcomes

Hopkins, Jammie Mack



Genome-wide assessment of the carriers involved in the cellular uptake of drugs: a model system in yeast.  

E-Print Network (OSTI)

by amplifying their molecular barcodes and hybridizing them to a TAG4 oligonucleotide microarray. Resistant strains will account for an increasing proportion of the total pool in drug-treated compared to untreated conditions, because they are able to outcompete... , therefore, requires knowledge of the interactions between transpor- ters (including genetic variants) and their substrates (pri- marily drugs, nutrients, and endogenous metabolites). Allelic variation data based on the knowledge of these car- riers will feed...

Lanthaler, Karin; Bilsland, Elizabeth; Dobson, Paul D; Moss, Harry J; Pir, Pinar; Kell, Douglas B; Oliver, Stephen G



Mechanisms Involved in the Amplification of the 11-yr Solar Cycle Signal in the Tropical Pacific Ocean  

Science Conference Proceedings (OSTI)

It is debated whether the response of the tropical Pacific Ocean to the 11-yr solar cycle forcing resembles a La Nia or El Niolike signal. To address this issue, ensemble simulations employing an atmospheric general circulation model with and ...

Stergios Misios; Hauke Schmidt



Potential health risks from postulated accidents involving the Pu-238 RTG (radioisotope thermoelectric generator) on the Ulysses solar exploration mission  

DOE Green Energy (OSTI)

Potential radiation impacts from launch of the Ulysses solar exploration experiment were evaluated using eight postulated accident scenarios. Lifetime individual dose estimates rarely exceeded 1 mrem. Most of the potential health effects would come from inhalation exposures immediately after an accident, rather than from ingestion of contaminated food or water, or from inhalation of resuspended plutonium from contaminated ground. For local Florida accidents (that is, during the first minute after launch), an average source term accident was estimated to cause a total added cancer risk of up to 0.2 deaths. For accidents at later times after launch, a worldwide cancer risk of up to three cases was calculated (with a four in a million probability). Upper bound estimates were calculated to be about 10 times higher. 83 refs.

Goldman, M. (California Univ., Davis, CA (USA)); Nelson, R.C. (EG and G Idaho, Inc., Idaho Falls, ID (USA)); Bollinger, L. (Air Force Inspection and Safety Center, Kirtland AFB, NM (USA)); Hoover, M.D. (Lovelace Biomedical and Environmental Research Inst., Albuquerque, NM (USA). Inhalation Toxicology Research Inst.); Templeton, W. (Pacific Northwest Lab., Richland, WA (USA)); Anspaugh, L. (Lawren



Chromatin condensation in terminally differentiating mouse erythroblasts does not involve special architectural proteins but depends on histone deacetylation  

SciTech Connect

Terminal erythroid differentiation in vertebrates is characterized by progressive heterochromatin formation, chromatin condensation and, in mammals, culminates in nuclear extrusion. To date, although mechanisms regulating avian erythroid chromatin condensation have been identified, little is known regarding this process during mammalian erythropoiesis. To elucidate the molecular basis for mammalian erythroblast chromatin condensation, we used Friend virus-infected murine spleen erythroblasts that undergo terminal differentiation in vitro. Chromatin isolated from early and late stage erythroblasts had similar levels of linker and core histones, only a slight difference in nucleosome repeats, and no significant accumulation of known developmentally-regulated architectural chromatin proteins. However, histone H3(K9) dimethylation markedly increased while histone H4(K12) acetylation dramatically decreased and became segregated from the histone methylation as chromatin condensed. One histone deacetylase, HDAC5, was significantly upregulated during the terminal stages of Friend virus-infected erythroblast differentiation. Treatment with histone deacetylase inhibitor, trichostatin A, blocked both chromatin condensation and nuclear extrusion. Based on our data, we propose a model for a unique mechanism in which extensive histone deacetylation at pericentromeric heterochromatin mediates heterochromatin condensation in vertebrate erythroblasts that would otherwise be mediated by developmentally-regulated architectural proteins in nucleated blood cells.

Popova, Evgenya Y.; Krauss, Sharon Wald; Short, Sarah A.; Lee, Gloria; Villalobos, Jonathan; Etzell, Joan; Koury, Mark J.; Ney, Paul A.; Chasis, Joel Anne; Grigoryev, Sergei A.



H[sub 2]S in EOR--1: Gas processing for CO[sub 2] EOR involves sulfur removal  

SciTech Connect

A design study for a new West Texas gas processing plant for a CO[sub 2] EOR project provides for installation of H[sub 2]S removal processes to be delayed for 3 years after completion of the plant. During this delay, a more precise produced gas composition will be obtained so that the process equipment for removing H[sub 2]S can be properly selected and sized to handle the gas stream that at the peak will reach about 30 MMscfd. The new plant's processing components include inlet separation, sulfur removal and recovery, compression, dehydration, and NGL recovery. The new plant will be capable of processing CO[sub 2]-contaminated associated gas, recovering valuable propane-plus NGLs,a nd producing a miscible CO[sub 2] for reinjection. The first in a series of two articles details the process and configuration options. The concluding part will discuss in greater detail the sulfur recovery alternatives.

Johnson, J.E. (Pritchard Corp., Overland Park, KS (United States)); Tzap, S.J.; Kelley, R.E. (Raytheon Engineers and Constructors, Denver, CO (United States)); Laczko, L.P. (OXY USA Inc., Midland, TX (United States))



Undergraduate Research Involvement Program At The Fu Foundation School of Engineering and Applied Science at Columbia University,  

E-Print Network (OSTI)

- ments of radar backscatter and passive microwave emissions. In the Amundsen Sea, the Oden cruise between for sequester- ing CO2 emitted from new power cycles, including integrated gasification com- bined cycle (IGCC. His current research focuses on spaceborne imagery to understand the turbulent, dynamic plasma


Distribution of energy in bimolecular chemiluminescent reactions involving hydrogen atoms. Progress report, May 1, 1976--April 30, 1977. [Experimental apparatus  

DOE Green Energy (OSTI)

New spectroscopic observations of the production of photons throughout the visible region from the collision of approximately 5 eV H atoms with a Li/Li/sub 2/ crossed beam are described. The present state and future plans for the photon-detection experiments are discussed. Theoretical and non-beam spectroscopic work related to the Li/sub 2/H system is also noted.

Stwalley, W.C.



A Tabulation of Thermodynamic Data for Chemical Reactions Involving 58 Elements Common to Radioactive Waste Package Systems  

E-Print Network (OSTI)

and critique of the thermodynamic properties of rock-formingD. , 1977. Compilation of thermodynamic data on naturallysolubility and thermodynamic properties of hydroxy -

Benson, L.V.



Modeling the interactions between poly(n-vinylpyrrolidone) and gas hydrates: factors involved in suppressing and accelerating hydrate growth  

Science Conference Proceedings (OSTI)

Gas hydrates represent both a bane and a potential boon to the oil and gas industry, and considerable research into hydrate formation has been undertaken. We have recently developed a multi-threaded version of a Monte Carlo crystal growth algorithm and ... Keywords: Monte Carlo simulations, PVP, gas hydrates, parallel computing

Brent Wathen; Peter Kwan; Zongchao Jia; Virginia K. Walker



Program Mission Campaigns are multi-year, multi-functional efforts involving, to varying degrees, every site in the nuclear  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . 101,112 82,031 84,205 2,174 2.7% NNSA Service Center General Atomics,960 3,000 40 1.4% Subtotal, NNSA Service Center . . . . . . . . . . . . 69,132 58,055 64,498 6,443 11 Subprogram. The lifetime work will aid NNSA in assessing the need, timing, and capacity for a large capacity


Tuesday, February 19, 2013 | Spring 2013: Issue 4 Looking to get involved? Want to make a difference?  

E-Print Network (OSTI)

holds a free screening of Laura Cunningham's "Frack You!" VINES Board Meeting TechWorks! Prototype a free screening of Laura Cunningham's "Frack You!" February 20th Decker Health Sciences Building Rm 201 Contact: Erik H. Jensen (607)7290100 ejensen@wskg.org Website: WSKG "Frack You!" is an hour long comedy

Suzuki, Masatsugu


Tuesday, September 4, 2012 | Fall 2012: Volume 3, Issue 1 Looking to get involved? Want to make a difference?  

E-Print Network (OSTI)

Intern Citizen Action of New York seeks Intern to work as Anti-Fracking Organizer Vestal Residents as Anti-Fracking Organizer 435 State St Binghamton Contact: Isaac Silberman-Gorn (607) 723-0110 i.silbermangorn@gmail.com Website: citizenactionny.org/ Citizen Action of New York is seeking an intern to work as an Anti-Fracking

Suzuki, Masatsugu


Tuesday, September 11, 2012 | Fall 2012: Volume 3, Issue 2 Looking to get involved? Want to make a difference?  

E-Print Network (OSTI)

/ Theater Assistant Intern Citizen Action of New York seeks Intern to work as Anti-Fracking Organizer as Anti-Fracking Organizer 435 State St Contact: Isaac Silberman-Gorn (607) 723-0110 i.silbermangorn@gmail.com Website: Citizen Action of NY Citizen Action of New York is seeking an intern to work as an Anti-Fracking

Suzuki, Masatsugu


Tuesday, November 15, 2011 | Fall 2011: Volume 2, Issue 15 Looking to get involved? Want to make a difference?  

E-Print Network (OSTI)

Human Rights Fair The Last Mountain: Film Screening and Community Issues Forum Fracking? Christmas Department, Sigma Alpha Lambda, and the Student Environmental Awareness Club. RSVP online. Fracking@oilslady.com Renee Vogelsang renee@frackaction.com Website: Speak Out Against Fracking A coalition of groups opposed

Suzuki, Masatsugu


Non-LTE Balmer line formation in late-type spectra: Effects of atomic processes involving hydrogen atoms  

E-Print Network (OSTI)

(*** abridged ***) Context: The wings of Balmer lines are often used as effective temperature diagnostics for late-type stars under the assumption they form in local thermodynamic equilibrium. Aims: Our goal is to investigate the non-LTE formation of Balmer lines in late-type stellar atmospheres, to establish if the assumption of LTE is justified. Furthermore, we aim to determine which collision processes are important for the problem; in particular, the role of collision processes with hydrogen atoms is investigated. Method: A model hydrogen atom for non-LTE calculations has been constructed accounting for various collision processes using the best available data from the literature. The processes included are inelastic collisions with electrons and hydrogen atoms, mutual neutralisation and Penning ionisation. Non-LTE calculations are performed, and the relative importance of the collision processes is investigated. Results: Our calculations show electron collisions alone are not sufficient to establish LTE for the formation of Balmer line wings. The role of inelastic collisions with neutral hydrogen is unclear. The available data for these processes is of questionable quality, and different prescriptions for the rate coefficents give significantly different results for the Balmer line wings. Conclusions: Improved calculations or experimental data are needed for excitation and, particularly, ionisation of hydrogen atoms in low-lying states by hydrogen atom impact at near threshold energies. Until such data are available, the assumption of LTE for the formation of Balmer line wings in late-type stars is questionable.

P. S. Barklem



Synthetic Strategies Toward Tetrahydrofurans Involving Double Diastereoselective Nucleophile-Promoted Aldol-Lactonizations and Subsequent Applications to Bioactive Natural Products  

E-Print Network (OSTI)

Novel synthetic strategies towards the formation of tetrahydrofurans and their subsequent application to bioactive natural products have been explored. More specifically, a method for invoking double-diastereoselectivity in the formation of tetrahydrofuran-fused ?-lactones through nucleophile-catalyzed aldol-lactonization (NCAL) has been developed. By employing a chiral catalyst, such as OTMS-quinidine or OTMS-quinine, coupled with a chiral aldehyde acid substrate, we have been able to successfully override the inherent substrate stereochemical bias to access either diastereomeric product as the major adduct. This new methodology is being applied to construction of the tetrahydrofuran fragment of the cytotoxic agent, haterumalide NA.

Arendt, Kevin M.


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Gas generation and migration studies involving recently generated /sup 238/Pu-contaminated waste for the TRU Waste Sampling Program  

DOE Green Energy (OSTI)

This study is part of the multicontractor TRU Waste Sampling Program. Radiolytically generated gases were vented through a filtering device to determine its effectiveness in maintaining hydrogen concentrations within acceptably safe levels. In the second part of the study measurements were made to determine the ability of these gases, particularly hydrogen, to migrate through a sealed rigid polyethylene drum liner. Void volumes in these drums were found to be generally in excess of 90%. The carbon composite filter was found to satisfactorily vent hydrogen up to moderately high levels of alpha activity in the waste substrate. The sealed 90-mil liner was found to inhibit, but not prevent, the migration of hydrogen and other radiolytically generated gases.

Zerwekh, A.; Warren, J.L.



Uncertainty and sensitivity analysis of a fire-induced accident scenario involving binary variables and mechanistic codes  

E-Print Network (OSTI)

In response to the transition by the United States Nuclear Regulatory Commission (NRC) to a risk-informed, performance-based fire protection rulemaking standard, Fire Probabilistic Risk Assessment (PRA) methods have been ...

Minton, Mark A. (Mark Aaron)



Nuclear substructure reorganization during late stage erythropoiesis is selective and does not involve caspase cleavage of major nuclear substructural proteins  

E-Print Network (OSTI)

Stratton, Inc. 3. Campbell F. Nuclear elimination from theA electron micoscopic study of nuclear elimination from theD. Comparative study of nuclear expulsion from the late

Krauss, Sharon Wald; Lo, Annie J.; Short, Sarah A.; Koury, Mark J.; Mohandas, Narla; Chasis, Joel Anne



DOE technical standards list: Directory of DOE and contractor personnel involved in non-government standards activities  

SciTech Connect

The body of this document contains a listing of DOE employees and DOE contractors who have submitted form DOE F 1300.2, Record of Non-Government Standards Activity, which is attached to the end of this document. Additional names were added from rosters supplied by non-Government standards bodies. The committees or governing bodies in which the person participates is listed after each name. An asterisk preceding the committee notation indicates that the person has identified himself or herself as the DOE representative on that committee. Appendices to this document are also provided to sort the information by the parent employment organization, by non-Government standards activity, and by the proper names of the non-Government standards organizations and committees. DOE employees and contractors listed in this technical standards list are those recorded as of May 1, 1999.




DOE technical standards list: Directory of DOE and contractor personnel involved in non-government standards activities  

SciTech Connect

The body of this document contains a listing of DOE employees and DOE contractors who have submitted form DOE F 1300.2, Record of Non-Government Standards Activity, which is attached to the end of this document and to DOE Order 1300.2A. Additional names were added from rosters supplied by non-Government standards bodies. The committees or governing bodies in which the person participates is listed after each name. An asterisk preceding the committee notation indicates that the person has identified himself or herself as the DOE representative on that committee. Appendices to this document are also provided to sort the information by the parent employment organization, by non-Government standards activity, and by the proper names of the non-Government standards organizations and committees. DOE employees and contractors listed in this TSL are those recorded as of July 1, 1996.




Cloning and characterization of KNR4, a yeast gene involved in (1,3)-{beta}-glucan synthesis  

Science Conference Proceedings (OSTI)

K9 killer toxin from Hansenula mrakii was used to select a number of resistant mutants from Saccharomyces cerevisiae. Preliminary biochemical and genetic studies showed that some of them acquired structural defects in the cell wall. One of these mutants, the knr4-1 mutant, displays a number of cell wall defects, including osmotic sensitivity; sensitivity to cercosporamide, a known antifungal agent; and resistance to Zymolyase, a (1,3)-{beta}-glucanase. We report here the isolation and analysis of the KNR4 gene. DNA sequence analysis revealed an uninterrupted open reading frame which contains five potential start codons. The longest coding template encodes a protein of 505 amino acids with a calculated molecular mass of 57,044 Da. A data base search revealed 100% identity with a nuclear protein, SMI1p. Disruption of the KNR4 locus does not result in cell death; however, it leads to reduced levels of both (1,3)-{beta}-glucan synthase activity and (1,3)-p-glucan content in the cell wall. The gene was mapped to the right arm of chromosome VII. 70 refs., 8 figs., 1 tab.

Hong, Zhi; Mann, P.; Brown, N.H. [Schering-Plough Research Inst., Kenilworth, NJ (United States)] [and others



Induction of nuclear factor kB after low-dose ionizing radiation involves a reactive oxygen intermediate signaling pathway  

Science Conference Proceedings (OSTI)

Reactive oxygen intermediates (ROIs) have been found to be the messengers in the activation of the kB transcription regulator in mitogen- or cytokine-stimulated cells, operating in conjunction with or independently of various other mechanisms; these include Ca{sup ++}-dependent and PKC-dependent cytoplasmic signaling pathways. We have recently reported that low-dose ionizing radiation induces NF-kB in human lymphoblastoid 244B cells. Since ionizing radiation generates free radicals in cells, we have investigated whether the ROIs generated by ionizing radiation induce NF-kB activity, and also whether they do so by a similar mechanism as in cells treated with PMA or H{sub 2}O{sub 2}. The results not only confirm a previous observation from our laboratory that low-dose ionizing radiation (0.1-2.0 Gy) activates kB transcription factor transiently with a maximal induction at 0.5 Gy exposure, but also demonstrate mechanistically that the activation of NF-kB by low-dose ionizing radiation can be inhibited considerably by the antioxidant N-acetyl-L-cysteine, indicating that at least the major part of the activation process is mediated by ROIs. These findings support the idea that ROIs can regulate the kB elements which in turn can serve as response elements for oxidant stress. 37 refs., 4 figs., 1 tab.

Mohan, N.; Meltz, M.L. [Univ. of Texas Health Science Center, San Antonio, TX (United States)



Hydrotreating studies involving NiMo/silica-doped hydrous titanium oxide (HTO:Si)-coated alumina catalysts  

SciTech Connect

For hydrotreating a petroleum-derived liquid feed at 400 C, LHSV = 2. 5 g/g{sub cat}/h, and 1500 psig hydrogen (H) pressure, both HDS and HDN activities were roughly equivalent for a name/TO:Si-coated Amocat catalyst and a commercial alumina-supported name catalyst (Amocat 1C). Superior HDN performance was exhibited by the name/TO: Si-coated Amocat catalyst at low H pressure (500 psig) and after H pressure cycling (1500-500-1500 psig) relative to Amocat 1C. Consistent with previous results obtained on a coal-derived liquid feed, the HDS/HDN results with the petroleum-derived liquid showed that the performance of the name/TO:Si-coated Amocat catalyst on an active metals weight basis exceeded the performance of Amocat 1C at all test conditions. The name/TO:Si-coated Amocat catalyst also showed potentially increased hydrogenation activity, increased resistance to deactivation, and increased yields of lower boiling point distillate fractions, although further work is needed.

Gardner, T.J.; Miller, J.E.; McLaughlin, L.I.; Trudell, D.E.



Early Peroxisome proliferator-activated receptor gamma regulated genes involved in expansion of pancreatic beta cell mass  

E-Print Network (OSTI)

.5 0 Syber-Green Target gene Primer sequences 5-3 MVK Forward TCCAGCAAGGGACGATGTC Reverse CTTGGTGTTGGTGAGCAGGAT FADS3 Forward AG AGCACCACCTCTTCCCCACGA Reverse CCCCAGCAGGGGGTGAGGAT FADS2 Forward GCGAGTGGCAGCCCCTTGAG Reverse... of peripheral insulin resistance [11]. In fact, animals with lack of PPARg had blunted the phy- siological expansion of b-cell mass in response to high- fat feeding. There are important differences between the mechan- isms controlling the increase of b-cell mass...

Vivas, Yurena; Martinez-Garcia, Cristina; Izquierdo, Adriana; Garcia-Garcia, Francisco; Callejas, Sergio; Velasco, Ismael; Campbell, Mark; Ros, Manuel; Dopazo, Ana; Dopazo, Joaquin; Vidal-Puig, Antonio; Medina-Gomez, Gema



Two versatile cofactors, flavin adenine dinucleotide and non-heme iron, involved in DNA repair and natural product halogenation  

E-Print Network (OSTI)

Cofactors assist enzymes with a variety of complex chemistries. Two versatile cofactors, flavin adenine dinucleotide (FAD) and non-heme iron, together with molecular oxygen as an oxidizing agent, perform a wide array of ...

Wong, Cintyu



Chromatin condensation in terminally differentiating mouse erythroblasts does not involve special architectural proteins but depends on histone deacetylation  

E-Print Network (OSTI)

P.T. (2004) To the 30-nm chromatin fiber and beyond. BiochimC.D. ( 2005) RNA meets chromatin. Genes Dev, 19, 1635-1655.proteins induce large-scale chromatin reorganization during

Popova, Evgenya Y.



Involvement of histone H1 in the organization of the nucleosome and of the salt-dependent superstructures of chromatin  

E-Print Network (OSTI)

We describe the results of a systematic study, using electron microscopy, of the effects of ionic strength on the morphology of chromatin and of H1-depleted chromatin. With increasing ionic strength, chromatin folds up progressively from a filament of nucleosomes at- 1 mM monovalent salt through some intermediate higher-order helical structures (Thoma, F., and T. Koller, 1977, Cell 12:101-107) with a fairly constant pitch but increasing numbers of nucleosomes per turn, until finally at 60 mM (or else in-0.3 mM Mg") a thick fiber of 250 A diameter is formed, corresponding to a structurally well-organized but not perfectly regular superhelix or solenoid of pitch-I 10 A as described by Finch and Klug (1976, Proc. Natl. Acad. Sci. U. S. A. 73:1897-1901). The numbers of nucleosomes per turn of the helical structures agree well with those which can be calculated from the light-scattering data of Campbell et al. (1978, Nucleic Acids Res. 5:1571-1580). H 1-depleted chromatin also condenses with increasing ionic strength but not so densely as chromatin and not into a definite structure with a well-defined fiber

F Thoma; Th Koller; A. Klug



Human Factors Engineering (HFE) Computer Based Training Module for Utilities Involved in Implementing Digital Instrumentation and Control Systems  

Science Conference Proceedings (OSTI)

This product provides a brief computer-based training (CBT) module on human factors engineering (HFE) that was developed explicitly to be included in training materials on digital instrumentation and control (I&C) issues for new nuclear power plants (NPPs). This module is intended for engineers, technicians and project managers responsible for design, implementation, testing, operation and maintenance of digital I&C systems in NPPs. The primary focus of the HFE training is the main control room and its h...



''Talk To Me!'' - Lessons Learned In Communicating Risks To Tenants And Others Involved In The Department Of Energy's Reindustrialization Program  

SciTech Connect

Communicating risk information is more difficult than assessing it. The latter relies on data, formulas, theorems and mathematical relationships that, with some effort, can be logically explained to another person; it's objective. Communicating risks, however, is subjective and relies on personalities, perceptions and predisposition, as well as emotions. Most notably the emotion is fear--fear of the unknown, fear of the message, the messenger, or the impact of the information on something of value to the person asking the questions. The Department of Energy's Oak Ridge Operations Office is engaged in a Reindustrialization program to lease (and most recently, to transfer) formerly used facilities to private sector entities. The facilities are located at the East Tennessee Technology Park, originally a gaseous diffusion plant operated to enrich uranium for World War II efforts and later for use as fuel in civilian nuclear reactors.

Cusick, Lesley T.; Golden, Karen M.



Developed by Jeff Spencer and others from the Yakama Nation involved with the Subbasin Planning Effort Developed from EDT data  

E-Print Network (OSTI)

Natural Confinement field surveys, aerial video interpretation that was used in conjunction with GIS without TFW survey data, subsamples from a variety of reaches were collected and aerial video was utilized (primarily confinement); field work, topographic map interpretation and aerial video interpretation; SSHIAP


The manufacture of nylon involves the use of cyclohexane, whose successful production is strongly dependent on the  

E-Print Network (OSTI)

developed for each combina- tion of gas and reactor in the form of Eq. (1). (1) where 0, i, ii, 1, 2, 3, 1 oxidation reactor." Industrial and Engg. Chemistry, Process Design and Development (v13), pp317-323. Berezin of Standards (NIST), Lockheed Martin, DaimlerChrysler Rail Systems NA (Adtranz NA), the Ben Franklin Technology

Smith, Alice E.


Endothelial Cells Stimulate T Cell NFAT Nuclear Translocation in the Presence of Cyclosporin A: Involvement of the  

E-Print Network (OSTI)

of T cell resistance to these drugs (1, 2). T cell activation requires an Ag-specific signal mediated via mobilization and protein kinase C (PKC) activation, leading to cytokine production and cell proliferation). The activity of NFAT proteins is regulated by their phosphor- ylation state, which is controlled

Hughes, Christopher C. W.


A Novel Family of Yeast Chaperons Involved in the Distribution of V-ATPase and Other Membrane Proteins*  

E-Print Network (OSTI)

designed, built and tested. Melt water from inner part of ice core section was pumped to an ICP.3.1 Pumps and introduction system 50 3.3.2 Separation column and stationary phases 51 3.3.3 Detectors 52 3

Nelson, Nathan


Chronic heart rate reduction with ivabradine improves systolic function of the reperfused heart through a dual mechanism involving a direct  

E-Print Network (OSTI)

Chronic heart rate reduction with ivabradine improves systolic function of the reperfused heart.berdeaux@inserm.fr inserm-00500900,version1-12Jul2010 Author manuscript, published in "European heart journal 2010 function and calcium handling to chronic heart rate reduction with ivabradine in the reperfused heart

Paris-Sud XI, Université de


Notice of Intent To Prepare an Environmental Impact Statement and To Conduct Public Scoping Meetings and Notice of Floodplain and Wetlands Involvement; Public Service Company of New Mexico  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

73 73 Federal Register / Vol. 64, No. 29 / Friday, February 12, 1999 / Notices Dated: February 8, 1999. William E. Burrow, Acting Leader, Information Management Group, Office of the Chief Information Officer. Office of Educational Research and Improvement Type of Review: New. Title: Research on Charter School Finances. Frequency: On occasion. Affected Public: Not-for-profit institutions; State, local or Tribal Gov't, SEAs or LEAs. Reporting and Recordkeeping Hour Burden: Responses: 693. Burden Hours: 671. Abstract: This two-year study explores how state and district policies, as well as charter school practices, affect charter schools' cost-effectiveness and quality. Funding equity and adequacy are assessed. This study proposes to inform policymakers at the federal, state, and local level of the precise

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DIY FLOATING FLOOR CHECKLIST The information below is general in nature and will only give you a basic guide to the process involved.  

E-Print Network (OSTI)

DIY FLOATING FLOOR CHECKLIST The information below is general in nature and will only give you Takeextracarewhenusingpowertools Formoredetailedtipshavealookatour: · General safety tips http://news.domain.com.au/domain/ diy/diy

Peters, Richard



E-Print Network (OSTI)

??The ability to compute rarefied, ionized hypersonic flows is becoming more important as missions such as Earth reentry, landing high mass payloads on Mars, and (more)

Liechty, Derek Shane



Include in Column B cost of all composition produced by plant. Include in Column C cost of all operations not involving printing (Col. A)  

E-Print Network (OSTI)

occupied (whether Government-owned or rented), utilities, etc. (14.5 cents per month per square foot. Amount spent for rental of equipment Total cost (Use col.A total from this line to compute cost per 1 units produced in plant this fiscal quarter Total units produced in plant this fiscal year Cost per 1

US Army Corps of Engineers


eat-5 and unc-7 represent a multigene family in Caenorhabditis elegans involved in cell-cell coupling. J. Cell Biol. 134, 537548. Abstract Article  

E-Print Network (OSTI)

Abstract. The Drosophila melanogaster genes Passover and l(1)ogre and the Caenorhabditis elegans gene unc-7 define a gene family whose function is not known. We have isolated and characterized the C. elegans gene eat-5, which is required for synchronized pharyngeal muscle contractions, and find that it is a new member of this family. Simultaneous electrical and video recordings reveal that in eat-5 mutants, action potentials of muscles in the anterior and posterior pharynx are unsynchronized. Injection of carboxyfluorescein into muscles of the posterior pharynx demonstrates that all pharyngeal muscles are dye-coupled in wild-type animals; in eat-5 mutants, however, muscles of the anterior pharynx are no longer dye-coupled to posterior pharyngeal muscles. We show that a gene fusion of eat-5 to the green fluo-

Todd A. Starich; Raymond Y. N. Lee; Cristin Panzareua; Leon Avery; Jocelyn E. Shaw



SO2907, A Putative TonB-dependent Receptor, Is Involved in Dissimilatory Iron Reduction by Shewanella oneidensis Strain MR-1  

Science Conference Proceedings (OSTI)

Shewanella oneidensis strain MR-1 utilizes soluble and insoluble ferric ions as terminal electron acceptors during anaerobic respiration. The components of respiratory metabolism are localized in the membrane fractions which include the outer membrane and cytoplasmic membrane. Many of the biological components that interact with the various iron forms are proposed to be localized in these membrane fractions. To identify the iron-binding proteins acting either as an iron transporter or as a terminal iron reductase, we used metal-catalyzed oxidation reactions. This system catalyzed the oxidation of amino acids in close proximity to the iron binding site. The carbonyl groups formed from this oxidation can then be labeled with fluoresceinamine (FLNH2). The peptide harboring the FLNH2 can then be proteolytically digested, purified by HPLC and then identified by MALDI-TOF tandem MS. A predominant peptide was identified to be part of SO2907 that encodes a putative TonB-dependent receptor. Compared to wild type (wt), the so2097 gene deletion (?SO2907) mutant has impaired ability to reduce soluble Fe(III), but retains the same ability to respire oxygen or fumarate as the wt. The ?SO2907 mutant was also impacted in reduction of insoluble iron. Iron binding assays using isothermal titration calorimetry and fluorescence tryptophan quenching demonstrated that a truncated form of heterologous-expressed SO2907 that contains the Fe(III) binding site, is capable of binding soluble Fe(III) forms with Kd of approximate 50 ?M. To the best of our knowledge, this is the first report of the physiological role of SO2907 in Fe(III) reduction by MR-1.

Qian, Yufeng; Shi, Liang; Tien, Ming



Summary: [n this paper many of the factors involved in the application of optimisation theory to the design of communication systemsare discussed. As m  

E-Print Network (OSTI)

an historical background. -- . *Department of Electrical Engineering, University of hTmvcastle, h" s w.. t "electric" technology is the subject of many articles and books (see, for example, references 1 and 2 is to achievo an acceptable compromise betlvccn information flo~v, error rate, capital equipment cost

Moore, John Barratt


Use of a virtual environment to solve real world problems The research involves a project for homeland security within the Modeling and Simulation  

E-Print Network (OSTI)

and Simulation Group has worked diligently to duplicate virtual nuclear facilities and power plants across certain components are attacked by terrorists. Certain components of a nuclear facility or power plant at the Oak Ridge National Laboratory. Using the Unreal Engine, nuclear facilities and other real-world plants


Comparison of the efficiency of a thermo-chemical process to that of a fuel cell process when both involve the same chemical reaction  

E-Print Network (OSTI)

This work assesses if a plausible theoretical thermo-chemical scheme can be conceived of, that is capable of extracting work from chemical reactants which can be compared with work produced by a fuel cell, when both processes are supplied with the same reactants. A theoretical process is developed to convert heat liberated from a chemical reaction to work. The hypothetical process is carried over a series of isothermal chemical reactor - heat engine combinations. Conducting the chemical reaction and work extraction over a series of temperature steps minimizes irreversibilities that result from the chemical reaction and heat transfer. Results obtained from the numerical calculations on the scheme confirm that when a large number of reactors-engine combinations are used, irreversibility of the proposed hypothetical reactor-engine combination can be reduced to zero. It is concluded from the results, that the theoretical model is as efficient as a fuel cell when both have the same chemical reaction under identical conditions. The effect of inert gas chemistry on the process has also been observed. It is determined from the results that the chemistry of the inert gas does not affect the proposed process. It is determined from results of a parametric study on the composition of inert gas, that the reduction of inert gas does not significantly improve the efficiency of the proposed process.

Bulusu, Seshu Periah



Polygenic Resistance In The Highly DDT-resistant 91-R Strain Of Drosophila Melanogaster Involves Decreased Penetration, Increased Metabolism And Direct Excretion Of DDT.  

E-Print Network (OSTI)

??Resistance to dichlorodiphenyltrichloroethane (DDT) in the 91-R strain of Drosophila melanogaster is extremely high compared to the susceptible Canton-S strain (>1500 times). Oxidative detoxification is (more)

Strycharz, Joseph P



Distribution of energy in biomolecular chemiluminescent reactions involving hydrogen atoms. Progress report, May 1, 1976--April 30, 1976. [Summaries of research activities at Univ. of Iowa  

DOE Green Energy (OSTI)

Preliminary observations of photon and ion production from the collision of approximately 5-eV H atoms with Li and Li/sub 2/ and also with a Li-coated surface are described. The present state and future plans for the primary and secondary molecular beam apparatuses are discussed. Theoretical and non-beam spectroscopic work related to the Li/sub 2/H system is also noted.

Stwalley, W.C.



Charge-dipole acceleration of polar gas molecules towards charged nanoparticles: involvement in powerful charge-induced catalysis of heterophase chemical reactions and ball lightning phenomenon  

Science Conference Proceedings (OSTI)

In humid air, the substantial charge-dipole attraction and electrostatic acceleration of surrounding water vapour molecules towards charged combustible nanoparticles cause intense electrostatic hydration and preferential oxidation of these nanoparticles ...

Oleg Meshcheryakov



Estimating switching costs involved in changing mobile phone carriers in Japan: Evaluation of lock-in factors related to Japan's SIM card locks  

Science Conference Proceedings (OSTI)

This paper employs a web-based conjoint-type questionnaire to examine empirically user preference for a hypothetical Subscriber Identity Module (SIM) unlock situation in Japan's mobile phone market. This paper also analyzes carriers' other marketing ... Keywords: Discrete choice model, Mobile phone, Switching cost, Vertically integrated market

Akihiro Nakamura



Response of fission yeast to toxic cations involves cooperative action of the stress-activated protein kinase Spc1/Sty1 and the Hal4 protein kinase  

E-Print Network (OSTI)

1993. Experiments with Fission Yeast. A laboratory coursetranscriptional responses of fission yeast to environmentalWhitehall. 2002. Role of fission yeast Tup1-like repressors

Wang, L Y; Shimada, K; Morishita, M; Shiozaki, Kazuhiro



How Reliable are Parallel Disk Systems When Energy-Saving Schemes are Involved? Shu Yin, Xiaojun Ruan, Adam Manzanares, and Xiao Qin  

E-Print Network (OSTI)

failure rate from the disk's utilization, operating temperature as well as power-state transition of an individual disk is affected by power-state transitions and; therefore, the increase in failure rate as a function of power-state transition frequency has to be added to a baseline failure rate (see Eq. 3

Qin, Xiao


Obama's Second Chance on the Predominant Moral Issue of this Century President Obama, finally, took a get-involved get-tough approach to negotiations on health care  

E-Print Network (OSTI)

's future, fossil fuels will remain the cheapest energy and we will squeeze every drop from tar sands, oil shale, pristine lands, and offshore areas. An essential corollary to the rising carbon price is 100

Hansen, James E.


Structural Analysis of WbpE from Pseudomonas aeruginosa PAO1: A Nucleotide Sugar Aminotransferase Involved in O-antigen Assembly  

E-Print Network (OSTI)

In recent years, the opportunistic pathogen Pseudomonas aeruginosa has emerged as a major source of hospital-acquired infections. Effective treatment has proven increasingly difficult due to the spread of multidrug resistant ...

Larkin, Angelyn


One of the Largest Pieces of Processing Equipment Removed from Plutonium Finishing Plant- Worker involvement led to safe completion of high-hazard work  

Energy.gov (U.S. Department of Energy (DOE))

RICHLAND, WASH. U.S. Department of Energy (DOE) contractor CH2M HILL Plateau Remediation Company (CH2M HILL) announced today the successful removal of one of the largest, most complex pieces of equipment from the Plutonium Finishing Plant (PFP) at the Hanford Site in southeast Washington State.


On the Theory of Oxidation-Reduction Reactions Involving Electron Transfer. V. Comparison and Properties of Electrochemical and Chemical Rate Constants  

DOE R&D Accomplishments (OSTI)

Using a theory of electron transfers which takes cognizance of reorganization of the medium outside the inner coordination shell and of changes of bond lengths inside it, relations between electrochemical and related chemical rate constants are deduced and compared with the experimental data. A correlation is found, without the use of arbitrary parameters. Effects of weak complexes with added electrolytes are included under specified conditions. The deductions offer a way of coordinating a variety of data in the two fields, internally as well as with each those in another. For example, the rate of oxidation or reduction of a series of related reactants by one reagent is correlated with that of another and with that of the corresponding electrochemical oxidation-reduction reaction, under certain specified conditions. These correlations may also provide a test for distinguishing an electron from an atom transfer mechanism. (auth)

Marcus, R. A.



The Accurate Computer Simulation of Phase Equilibrium for Complex Fluid Mixtures. Application to Binaries Involving isobutene, methanol, MTBE, and n-butane  

E-Print Network (OSTI)

We have developed a new method, called the Reaction Gibbs Ensemble Monte Carlo (RGEMC) method for the computer simulation of the phase equilibria for multicomponent mixtures, given an intermolecular potential model for the constituent molecular species. The approach treats the phase equilibrium conditions as a special type of chemical reaction, and incorporates knowledge of the pure-substance vapor pressure data into the simulations. Unlike macroscopic thermodynamic-based approaches like the Wilson and the UNIFAC approximations, no experimental information concerning the mixtures is required. In addition to the PTxy phase equilibrium data, the volumetric properties of the mixture are calculated. We developed intermolecular potential models based on the OPLS potential models of Jorgensen, and used the RGEMC method to predict phase equilibrium data for the binary systems isobutene+MTBE and the binaries formed by methanol with isobutene, MTBE, and n-butane. The predictions are excellent, ...

Martin Lsal; William R. Smith; Ivo Nezbeda



Nuclear dynamics : from importin beta regulation of nuclear pore assembly to identification of novel vertebrate proteins involved in mRNA export  

E-Print Network (OSTI)

transcribed genes to the nuclear envelope. Nature 441, 770-of a pathway-specific nuclear import inhibitor. Nat Structof cytoplasmic nuclear protein import factor p97. J Cell

Phung, Quang


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear dynamics : from importin beta regulation of nuclear pore assembly to identification of novel vertebrate proteins involved in mRNA export.  

E-Print Network (OSTI)

??The cell nucleus contains the genetic materials of an organism and allows selective nucleocytoplasmic transport via the nuclear pores embedded in the nuclear membranes. In (more)

Phung, Quang



Porokeratosis palmaris et plantaris disseminata or a disseminated late-onset variant of porokeratotic eccrine ostial and dermal ductal nevus (PEODDN) with follicular involvement  

E-Print Network (OSTI)

chills, and headaches. Doxycycline 150 mg daily, Carmol 40,some improvement with doxycycline, particularly of herboth T3 and T4), doxycycline, Carmol 40, and tramadol. She

Hartman, Rachael; Rizzo, Carina; Patel, Rishi; Kamino, Hideko; Shupack, Jerome L



A Slowly Varying Model of the Quasi-biennial Oscillation Involving Effects of Transcience, Self-acceleration and Saturation of Equatorial Waves  

Science Conference Proceedings (OSTI)

A numerical simulation of the quasi-biennial oscillations (QBO) is presented using a sophisticated one-dimensional model operating under a slowly varying WKB assumption. The roles of wave transience, wave self-acceleration and wave saturation are ...

Hiroshi Tanaka; Nobuyuki Yoshizawa



From Jimmy Carter to George W. Bush: Presidential Policies and Involvement in the Debate over the Arctic National Wildlife Refuge, 1977-2009.  

E-Print Network (OSTI)

??The Arctic National Wildlife Refuge (ANWR), located in the Northeastern corner of Alaska, has for the last three decades been the focus of one of (more)

Eriksen, Gisle Holsb



The use of post detonation analysis of stable isotope ratios to determine the type and production process of the explosive involved  

SciTech Connect

The detonation of a series of explosives was performed in a controlled manner to collect the resulting, solid residue or {open_quotes}soot.{close_quotes} This residue was examined to determine the ratios of the stable carbon, hydrogen, and nitrogen isotopes. The goal of the experiment was to determine if these ratios could be used to indicate, from the post detonation residues, the type and origin of the detonated explosive. The ratios of the stated stable isotopes in the undetonated explosive were also determined. Despite some reservations in the quality of the data resulting from contamination by nonexplosive components, certain trends can be discerned. (1) Carbon isotopes allow aromatic explosives to be distinguished from nonaromatic explosives. This trend seems to carry through the detonation so that the distinction might be made after the fact. (2) The amination process for TATB can be detected through the hydrogen and, to some extent, the nitrogen isotope ratios. Unfortunately, the data are not sufficiently good to determine if this differential carries through the detonation. (3) The relative magnitude and sign of the nitrogen isotope ratio seems to carry through the detonation: some exchange with atmospheric nitrogen is probable. Even though this set of experiments must also be viewed as preliminary, there is a definite indication that certain qualitative characteristics of explosives can be detected after the detonation. This {open_quotes}signature{close_quotes} could have application to both intelligence and counter terrorism.

McGuire, R.R.; Velsko, C.A.; Lee, C.G.; Raber, E.



Possible involvement of caspase-6 and -7 but not caspase-3 in the regulation of hypoxia-induced apoptosis in tube-forming endothelial cells  

SciTech Connect

We recently reported that a broad-spectrum caspase inhibitor zVAD-fmk failed, while p38 inhibitor SB203580 succeeded, to prevent chromatin condensation and nuclear fragmentation induced by hypoxia in tube-forming HUVECs. In this study, we investigated the reasons for zVAD-fmk's inability to inhibit these morphological changes at the molecular level. The inhibitor effectively inhibited DNA ladder formation and activation of caspase-3 and -6, but it surprisingly failed to inhibit caspase-7 activation. On the other hand, SB203580 successfully inhibited all of these molecular events. When zLEHD-fmk, which specifically inhibits initiator caspase-9 upstream of caspase-3, was used, it inhibited caspase-3 activation but failed to inhibit caspase-6 and -7 activation. It also failed to inhibit hypoxia-induced chromatin condensation, nuclear fragmentation and DNA ladder formation. Taken together, our results indicate that, during hypoxia, caspase-7 is responsible for chromatin condensation and nuclear fragmentation while caspase-6 is responsible for DNA ladder formation.

Eguchi, Ryoji [Department of Thoracic Oncology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501 (Japan); Tone, Shigenobu [Department of Biochemistry, Kawasaki Medical School, 577 Matsushima, Kurashiki, Okayama 701-0192 (Japan); Suzuki, Akio [Laboratory of Cell and Molecular Biology of Aging, Department of Food and Nutritional Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka-city, Shizuoka 422-8526 (Japan); Fujimori, Yoshihiro [Cancer Center, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501 (Japan); Nakano, Takashi [Department of Thoracic Oncology, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya, Hyogo 663-8501 (Japan); Kaji, Kazuhiko [Laboratory of Cell and Molecular Biology of Aging, Department of Food and Nutritional Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka-city, Shizuoka 422-8526 (Japan); Ohta, Toshiro [Laboratory of Cell and Molecular Biology of Aging, Department of Food and Nutritional Sciences, Graduate School of Nutritional and Environmental Sciences, University of Shizuoka, 52-1 Yada, Suruga-ku, Shizuoka-city, Shizuoka 422-8526 (Japan)], E-mail: ohtat@u-shizuoka-ken.ac.jp



Crystal structure of the N-terminal region of human Ash2L shows a winged-helix motif involved in DNA binding  

Science Conference Proceedings (OSTI)

Ash2L is a core component of the MLL family histone methyltransferases and has an important role in regulating the methylation of histone H3 on lysine 4. Here, we report the crystal structure of the N-terminal domain of Ash2L and reveal a new function of Ash2L. The structure shows that Ash2L contains an atypical PHD finger that does not have histone tail-binding activity. Unexpectedly, the structure shows a previously unrecognized winged-helix motif that directly binds to DNA. The DNA-binding-deficient mutants of Ash2L reduced Ash2L localization to the HOX locus. Strikingly, a single mutation in Ash2L{sub WH} (K131A) breaks the chromatin domain boundary, suggesting that Ash2L also has a role in chromosome demarcation.

Chen, Yong; Wan, Bingbing; Wang, Kevin C.; Cao, Fang; Yang, Yuting; Protacio, Angeline; Dou, Yali; Chang, Howard Y.; Lei, Ming (Michigan-Med); (HHMI)



Theory of ultra dense matter and the dynamics of high energy interactions involving nuclei. Progress report, December 15, 1992--December 14, 1993  

SciTech Connect

Progress in the areas of pQCD radiative processes in dense matter, QCD transport theories to describe the evolution of nonequilibrium phenomena in dense matter, and the development and testing of phenomenological models of high-energy nuclear collisions is summarized. The evolution of the total energy density of quarks and gluons with minijet initial conditions at RHIC energy is shown for Au+Au.

Gyulassy, M.



A Phase I Study of Chemoradiotherapy With Use of Involved-Field Conformal Radiotherapy and Accelerated Hyperfractionation for Stage III Non-Small Cell Lung Cancer: WJTOG 3305  

Science Conference Proceedings (OSTI)

Purpose: A Phase I study to determine a recommended dose of thoracic radiotherapy using accelerated hyperfractionation for unresectable non-small-cell lung cancer was conducted. Methods and Materials: Patients with unresectable Stage III non-small-cell lung cancer were treated intravenously with carboplatin (area under the concentration curve 2) and paclitaxel (40 mg/m{sup 2}) on Days 1, 8, 15, and 22 with concurrent twice-daily thoracic radiotherapy (1.5 Gy per fraction) beginning on Day 1 followed by two cycles of consolidation chemotherapy using carboplatin (area under the concentration curve 5) and paclitaxel (200 mg/m{sup 2}). Total doses were 54 Gy in 36 fractions, 60 Gy in 40 fractions, 66 Gy in 44 fractions, and 72 Gy in 48 fractions at Levels 1 to 4. The dose-limiting toxicity, defined as Grade {>=}4 esophagitis and neutropenic fever and Grade {>=}3 other nonhematologic toxicities, was monitored for 90 days. Results: Of 26 patients enrolled, 22 patients were assessable for response and toxicity. When 4 patients entered Level 4, enrollment was closed to avoid severe late toxicities. Dose-limiting toxicities occurred in 3 patients. They were Grade 3 neuropathy at Level 1 and Level 3 and Grade 3 infection at Level 1. However, the maximum tolerated dose was not reached. The median survival time was 28.6 months for all patients. Conclusions: The maximum tolerated dose was not reached, although the dose of radiation was escalated to 72 Gy in 48 fractions. However, a dose of 66 Gy in 44 fractions was adopted for this study because late toxicity data were insufficient.

Tada, Takuhito, E-mail: tada@msic.med.osaka-cu.ac.jp [Department of Radiology, Osaka City University Graduate School of Medicine, Osaka (Japan); Department of Radiology, Izumi Municipal Hospital, Izumi (Japan); Chiba, Yasutaka [Department of Environmental Medicine and Behavioural Science, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Tsujino, Kayoko [Department of Radiation Oncology, Hyogo Cancer Center, Akashi (Japan); Fukuda, Haruyuki [Department of Radiology, Osaka Prefectural Medical Center for Respiratory and Allergic Diseases, Habikino (Japan); Nishimura, Yasumasa [Department of Radiation Oncology, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Kokubo, Masaki [Division of Radiation Oncology, Institute of Biomedical Research and Innovation, Kobe (Japan); Negoro, Shunichi [Department of Medical Oncology, Hyogo Cancer Center, Akashi (Japan); Kudoh, Shinzoh [Department of Respiratory Medicine, Osaka City University Graduate School of Medicine, Osaka (Japan); Fukuoka, Masahiro [Department of Medical Oncology, Izumi Municipal Hospital, Izumi (Japan); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Nakanishi, Yoichi [Research Institute for Disease of the Chest, Graduate School of Medical Science, Kyusyu University, Fukuoka (Japan)



Research Article Short Communication: Is Ethanol-Based Hand Sanitizer Involved in Acute Pancreatitis after Excessive Disinfection?An Evaluation with the Use of PBPK Model  

E-Print Network (OSTI)

Copyright 2012 Cline Huynh-Delerme et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. An occupational physician reported to the French Health Products Safety Agency (Afssaps) a case of adverse effect of acute pancreatitis (AP) in a teaching nurse, after multiple demonstrations with ethanol-based hand sanitizers (EBHSs) used in a classroom with defective mechanical ventilation. It was suggested by the occupational physician that the exposure to ethanol may have produced a significant blood ethanol concentration and subsequently the AP. In order to verify if the confinement situation due to defective mechanical ventilation could increase the systemic exposure to ethanol via inhalation route, a physiologically based pharmacokinetic (PBPK) modeling was used to predict ethanol blood levels. Under the worst case scenario, the simulation by PBPK modeling showed that the maximum blood ethanol concentration which can be predicted of 5.9 mg/l is of the same order of magnitude to endogenous ethanol concentration (mean = 1.1 mg/L; median = 0.4 mg/L; range = 035 mg/L) in nondrinker

Cline Huynh-delerme; Catherine Artigou; Laurent Bodin; Robert Tardif; Ginette Charest-tardif; Ccile Verdier; Nessryne Sater; Mostafa Ould-elhkim; Catherine Desmares



The construction industry is comprised of a wide range of businesses involved in engineering standards, building design, and the construction of various types of materials and  

E-Print Network (OSTI)

thermal characteristics of buildings for insulation purposes, and to determine heating, cooling in engineering standards, building design, and the construction of various types of materials and structures-related impacts, such as high winds and flooding, influence the choice of site construction, building techniques


"The original publication is available at www.springerlink.com". Potential involvement of adipocyte insulin-resistance in obesity-associated up-  

E-Print Network (OSTI)

glucose tolerance test); PPAR (peroxisome proliferator activating receptor); RIA (radio immuno assay); RT insulin-resistance in obesity-associated up- regulation of adipocyte lysophospholipase D. When compared to non-obese controls, ATX expression was significantly increased in db/db mice

Paris-Sud XI, Université de


Notice of Intent to Prepare a Programmatic Environmental Impact Statement, Amend Relevant Agency Land Use Plans, Conduct Public Scoping Meetings, and Notice of Floodplain and Wetlands Involvement (DOE/EIS-0386)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7 Federal Register 7 Federal Register / Vol. 70, No. 187 / Wednesday, September 28, 2005 / Notices SAFEGUARDS: Computerized records are maintained in a controlled area accessible only to authorized personnel. Entry to these areas is restricted to those personnel with a valid requirement and authorization to enter. Physical entry is restricted by the use of lock, guards, and administrative procedures. Access to any specific record is based on the need- to-know and the specific level of authorization granted to the user. Physical and electronic access is restricted to designated individuals having a need-to-know in the performance of official duties. Access to personal information is further restricted by the use of the Army Knowledge Online database (AKO) single sign-on and password


Notice of Intent to prepare a Supplemental Environmenal Impact Statement (SEIS), and conduct scoping meetings; Notice of Floodplain and Wetlands Involvement (DOE/EIS-0323-S1)(05/09/06)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

61 Federal Register 61 Federal Register / Vol. 71, No. 89 / Tuesday, May 9, 2006 / Notices link. Enter the docket number, excluding the last three digits, in the docket number field to access the document. For assistance, please contact FERC, Online Support at FERCOnlineSupport@ferc.gov or toll free at (866) 208-3676, or for TTY, contact (202) 502-8659. Docket Number Date received Presenter or requester Prohibited: 1. EL05-102-002 .............................................................................................. 4-24-06 Undisclosed. 1 Exempt: 1. CP95-35-000 ................................................................................................ 4-24-06 Carlos Reyes. 2. CP95-35-000 ................................................................................................


Notice of Intent to Prepare an Environmental Impact Statement and to Conduct Public Scoping Meetings, and Notice of Floodplain and Wetlands Involvement for Remediation of the Moab Uranium Mill Tailings Site in Grand County, UT (12/20/02)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

69 69 Federal Register / Vol. 67, No. 245 / Friday, December 20, 2002 / Notices reauthorization that would improve the framework in which the Federal Government promotes access to postsecondary education and ensures accountability of taxpayer funds? Invitation To Comment Interested persons are invited to submit comments and recommendations regarding the reauthorization of the Higher Education Act. All comments submitted in response to this notice will be available for public inspection, during and after the comment period at 1990 K Street, NW., 8th floor, Washington, DC, between the hours of 9 a.m. and 4 p.m., Monday through Friday of each week except Federal holidays. Electronic Access to This Document You may view this document, as well as all other Department of Education


Notice of Intent to prepare an Environmental Impact Statement and to Conduct Public Scoping Meetings and Notice of Floodplain and Wetlands Involvement; Baja California Power, Inc., and Sempra Energy Resources (DOE/EIS-0365) (10/3/03)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

96 96 Federal Register / Vol. 68, No. 210 / Thursday, October 30, 2003 / Notices and Budget and the Congress, whichever date occurs last. The matching program will continue for 18 months after the effective date and may be extended for an additional 12 months thereafter, if the conditions specified in 5 U.S.C. 552a(o)(2)(D) have been met. 6. Address for Receipt of Public Comments or Inquiries. Individuals wishing to comment on this matching program or obtain additional information about the program, including requesting a copy of the computer matching agreement between ED and VA, should contact Ms. Marya Dennis, Management and Program Analyst, U.S. Department of Education, 3111 Union Center Plaza, 830 First Street NE., Washington, DC 20202. Telephone: (202) 377-3385. If


Thermal and combined thermal and radiolytic reactions involving nitrous oxide, hydrogen, and nitrogen in the gas phase; comparison of gas generation rates in supernate and solid fractions of Tank 241-SY-101 simulated waste  

DOE Green Energy (OSTI)

This report summarizes progress made in evaluating me by which flammable gases are generated in Hanford double-shell tank wastes, based on the results of laboratory tests using simulated waste mixtures. Work described in this report. was conducted at Pacific Northwest Laboratory (PNL) for the Flammable Gas Safety Project, the purpose of which is to develop information needed to support Westinghouse Hanford Company (WHC) in their efforts to ensure the safe interim storage of wastes at the Hanford Site. This work is related to gas generation studies being performed at Georgia Institute of Technology (GIT), under subcontract to PNL, using simulated wastes, and to studies being performed at VMC using actual wastes.

Bryan, S.A.; Pederson, L.R.



Underwater wireless communications have witnessed major developments in recent years, especially in the last decade. While the first generation of applications involved just a single transmitter and receiver communicating at low bit-rates, nowadays un-  

E-Print Network (OSTI)

Underwater wireless communications have witnessed major developments in recent years, especially applications range from autonomous observation systems to cooperative missions between autonomous underwater layer for underwater networks. The underwater acoustic channel shows some unique characteristics

Stojanovic, Milica


Overexpression of the JmjC histone demethylase KDM5B in human carcinogenesis: involvement in the proliferation of cancer cells through the E2F/RB pathway  

E-Print Network (OSTI)

expression and cell growth. Results KDM5B expression is up-regulated in clinical cancer tissues We first examined expression levels of five jumonji his- tone demethylase genes included in JARID family, KDM5A (JARID1A), KDM5B (JARID1B), KDM5C (JAR- ID1C), KDM5...

Hayami, Shinya; Yoshimatsu, Masanori; Veerakumarasivam, Abhimanyu; Unoki, Motoko; Iwai, Yukiko; Tsunoda, Tatsuhiko; Field, Helen I; Kelly, John D; Neal, David E; Yamaue, Hiroki; Ponder, Bruce AJ; Nakamura, Yusuke; Hamamoto, Ryuji



''Talk To Me!'' - Lessons Learned In Communicating Risks To Tenants And Others Involved In The Department Of Energy's Reindustrialization Program  

SciTech Connect

Communicating risk information is more difficult than assessing it. The latter relies on data, formulas, theorems and mathematical relationships that, with some effort, can be logically explained to another person; it's objective. Communicating risks, however, is subjective and relies on personalities, perceptions and predisposition, as well as emotions. Most notably the emotion is fear--fear of the unknown, fear of the message, the messenger, or the impact of the information on something of value to the person asking the questions. The Department of Energy's Oak Ridge Operations Office is engaged in a Reindustrialization program to lease (and most recently, to transfer) formerly used facilities to private sector entities. The facilities are located at the East Tennessee Technology Park, originally a gaseous diffusion plant operated to enrich uranium for World War II efforts and later for use as fuel in civilian nuclear reactors.

Cusick, Lesley T.; Golden, Karen M.


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Modelling and optimisation of batch distillation involving esterification and hydrolysis reaction systems. Modelling and optimisation of conventional and unconventional batch distillation process: Application to esterification of methanol and ethanol using acetic acid and hydrolysis of methyl lactate system.  

E-Print Network (OSTI)

??Batch distillation with chemical reaction when takes place in the same unit is referred to as batch reactive distillation process. The combination reduces the capital (more)

Edreder, Elmahboub A.



Notice of Intent To Prepare an Environmental Impact Statement and To Conduct Public Scoping Meetings and Notice of Floodplain and Wetlands Involvement; Bangor Hydro-Electric Company (11/02/04)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

14 14 Federal Register / Vol. 69, No. 211 / Tuesday, November 2, 2004 / Notices and the Reporting and Dissemination Committees-will meet in open session. From 12 p.m. to 2 p.m., Board members will receive a briefing from State NAEP Coordinators on their NAEP roles and on the use of NAEP data. This will be followed by Board discussion on NAEP Reporting Guidelines led by the Chair of the Reporting and Dissemination Committee, John Stevens, after which the November 19 session of the Board meeting will adjourn. On November 20, the full Board will meet in open session from 9 a.m. to 12 p.m. At 9 a.m., the Board will discuss NAEP 12th Grade issues, led by Vice Chair, Sheila Ford. Board actions on policies and Committee reports are scheduled to take place between 10:45


Notice of Intent to Prepare a Supplemental Environmental Impact Statement and Conduct Public Scoping Meetings, and Notice of Floodplain and Wetlands Involvement (DOE/EIS-0385) (03/05/08)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

895 Federal Register 895 Federal Register / Vol. 73, No. 44 / Wednesday, March 5, 2008 / Notices The original programmatic consent was approved in June 2006 (published in the Federal Register June 13, 2006). A one-year extension was approved in January 2007 (published in the Federal Register January 23, 2007). If approved, the third extension, for three years, will extend to 2011. All transactions will be subject to U.S.-Euratom Agreement for Cooperation on Peaceful Uses of Nuclear Energy. In accordance with Section 131 of the Atomic Energy Act of 1954, as amended, we have determined that this subsequent arrangement will not be inimical to the common defense and security. This subsequent arrangement will take effect no sooner than 15 days after the date of publication of this notice.


Notice of Intent to prepare and Environmental Impact Statement and Notice of Floodplain and Wetlands Involvement for the Lyle Falls Fishway Project (DOE/EIS-0397) (06/26/06)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

329 Federal Register 329 Federal Register / Vol. 71, No. 122 / Monday, June 26, 2006 / Notices other technological collection techniques or other forms of information technology, e.g., permitting electronic submission of responses. Procurement Contracts, OMB Control No. 3038-0031-Extension The information collection consists of procurement activities relating to solicitation, amendments to solicitations, requests for quotations, construction contracts, awards of contracts, performance bonds, and payment information for individuals (vendors) or contracts engaged in providing supplies or services. The Commission estimates the burden of this collection of information as follows: ESTIMATED ANNUAL REPORTING BURDEN Annual number of respondents Frequency of response Total annual


Measurment of Depositing and Bombarding Species Involved in the Plasma Production of Amorphous Silicon and Silicon/Germanium Solar Cells: Annual Technical Report, 1 June 2002 - 31 May 2005  

DOE Green Energy (OSTI)

The objective of this study is to measure the molecular species that lead to the growth of hydrogenated amorphous silicon (a-Si:H) and microcrystalline silicon (..mu..c-Si) photovoltaic (PV) devices from RF discharges. Neutral radicals produce most of the film growth during this PV-device production, and, by implication, radicals primarily determine the device structure and electrical characteristics. The most important feature of the present experiment is thus the measurement of neutral-radical fluxes to the substrate. Additional depositing species that can influence film properties are positive ions and silicon-based particles produced by the discharge; we also measure these positive-ion species here. Some studies have already measured some of these radical and positive-ion species in silane and silane/argon discharges, but not for discharge conditions similar to those used to produce most photovoltaic devices. Our objective is to measure all of these species for conditions typically used for device production. In particular, we have studied 13.6 MHz-excited discharges in pure silane and silane/hydrogen vapors.

Gallagher, A.; Rozsa, K.; Horvath, P.; Kujundcik, D.



CERTS Microgrid Laboratory Test Bed  

E-Print Network (OSTI)

needed to operate microgrids consisting of generatingdemonstrations involving microgrids that involve one or moreimprovements offered by microgrids. KEYWORDS Field

Eto, Joe



CERTS Microgrid Laboratory Test Bed  

E-Print Network (OSTI)

needed to operate microgrids consisting of generatingdemonstrations involving microgrids that involve one or moreimprovements offered by microgrids. KEYWORDS Field




Financing Non-Residential Photovoltaic Projects: Options and Implications  

E-Print Network (OSTI)

energy projects involve large wind power projects with installed costsenergy projects involve large wind power projects with installed costs

Bolinger, Mark



NISTIR 7622 Draft, Piloting Supply Chain Risk Management ...  

Science Conference Proceedings (OSTI)

... for indications of security consciousness in their ... Manual review involves human review of design ... Penetration testing involves humans or computing ...



Session I - Programmaster.org  

Science Conference Proceedings (OSTI)

Oct 20, 2010 ... The Endless Challenges of Plutonium Processing and Metallurgy: Lisa ... Any work involving plutonium is complicated due to issues involving...


Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA  

NLE Websites -- All DOE Office Websites (Extended Search)

JLA Public Involvement to someone by E-mail JLA Public Involvement to someone by E-mail Share Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA Public Involvement on Facebook Tweet about Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA Public Involvement on Twitter Bookmark Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA Public Involvement on Google Bookmark Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA Public Involvement on Delicious Rank Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA Public Involvement on Digg Find More places to share Vehicle Technologies Office: Workplace Charging Challenge Partner: JLA Public Involvement on AddThis.com... Goals Research & Development Testing and Analysis


Los Alamos National Laboratory: Long-Term Environmental Stewardship...  

NLE Websites -- All DOE Office Websites (Extended Search)

Commitment to Public Involvement PreviousNext Commitment to Public Involvement Community Relations Plan Student tour of environmental sites Student tour of environmental sites...


A study of building procurement process as a potential tool to enhance safety practice in the construction industry.  

E-Print Network (OSTI)

??Building procurement involves many different parties and resources. It is very common that requires project participants involved to work within budget, on time and according (more)

Sulaiman, K



A National Vision of America's Transition to a Hydrogen Economy...  

NLE Websites -- All DOE Office Websites (Extended Search)

Involves thermal, electrolytic, and photolytic processes Delivery The distribution of hydrogen from production and storage sites Involves pipelines, trucks, barges, and fueling...


A Privilege Management System For A Secure Network  

Science Conference Proceedings (OSTI)

Modern research projects may involve dozens of geographically distributed collaborators who access distributed information, devices, and even communication channels. Business enterprises worldwide have developed strategies which involve collaboration ...

K. J. Maly



Preliminary Notice of Violation - High Flux Isotope Reactor,...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

work processes involving HFIR maintenance planning, implementation and post maintenance testing; (2) work processes involving REDC operations; (3) quality improvement and...


On the Piloted Ignition of Solid Fuels in Spacecraft Environments  

E-Print Network (OSTI)

importance of the heat transfer processes in the ignition ofa measure of the heat transfer processes involved. Aninsight on the heat and mass transfer processes involved in

Fereres-Rapoport, Sonya M.



Co-evolution in Epistemic Networks -- Reconstructing Social Complex Systems  

E-Print Network (OSTI)

present net- work models are node-based (agent-based), notbased models, where interactions involve n agents altogetherbased models, where events involve only two agents, it is

Roth, Camille



Performance Testing and Internal Probe Measurements of a High Specific Impulse Hall Thruster  

E-Print Network (OSTI)

, with appointments in electrical engineering and in the Institute for Plasma Research. He is actively involved


EnErgy IncEntIvEs: The Power behind The Power  

E-Print Network (OSTI)

of the transformational power of electricity led to government involvement in powerful public-private partnerships

Vertes, Akos

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Calendar No. [ReportNo. 109-1  

E-Print Network (OSTI)

sequestration program involving 6 public-private partnerships. 7 SEC. 957. COMPLEX WELL TECHNOLOGY TESTING FACIL


Interview: NRDC's Frances Beineclie  

E-Print Network (OSTI)

fracturing (fracing, pronounced "fracking") to enhance the recovery of oil and natural gas. This involves

Berkowitz, Alan R.


Electronics and Telecommunications Portal  

Science Conference Proceedings (OSTI)

... Quantum Electrical Measurements; Quantum Information and ... The working of countless electronic devices involves electric and magnetic ...



Student Employment Opportunities The Computing Center has jobs available for student employees  

E-Print Network (OSTI)

and hardware, troubleshooting problems, and assisting users. Other duties will involve special projects


Indoor sound criteria according to the American Society of Heating, Refrigerating and Air?Conditioning Engineers (ASHRAE)An introduction  

Science Conference Proceedings (OSTI)

ASHRAE TC?2.6 Sound and Vibration Controltechnical committee has been activity involved with development



Agreement between the Psychiatric Technicians Bargaining Unit 18, California Association of Psychiatric Technicians (CAPT) and the State of California, 2001-2003  

E-Print Network (OSTI)

System, OASDI, levies, garnishments, Federal and Statefile involving a wage garnishment order shall, upon request

Psychiatric Technicians Bargaining Unit 18, California Association of Psychiatric Technicians (CAPT)



Architectural Design and Support for Knowledge Sharing Across Heterogeneous MAST systems  

E-Print Network (OSTI)

disparate and somewhat esoteric sensor suites. Our technical approach involves the following major thrust



E-Print Network (OSTI)

contributions. The problem is that research is often viewed as an esoteric activity involving scientists who

District of Columbia, University of the



E-Print Network (OSTI)

industrial standpoint. Heat treatment scheme B involves an ice-hrine quench 00% salt solution, refrigeration

Thompson, L.D.



Strontium and cesium release mechanisms during unsaturated flow through waste-weathered Hanford sediments  

E-Print Network (OSTI)

methods, which involved optimization of specific parameters for ion exchange and mineral dissolution/

Chang, H.



Novel Regenerated Solvent Extraction Processes for the Recovery of Carboxylic Acids or Ammonia from Aqueous Solutions Part II. Recovery of Ammonia from Sour Waters  

E-Print Network (OSTI)

shale and The also involves large capital investments retorting IS operating costs. however, it production

Poole, L.J.



Pathways and Barriers to Genetic Testing and Screening: Molecular Genetics Meets the "High-risk Family"  

E-Print Network (OSTI)

of individual interview techniques involve assessments onfocus group interview is a well-established technique for

Duster, Troy; Beeson, Diane



0018-9162/02/$17.00 2002 IEEE64 Computer Get Ready for  

E-Print Network (OSTI)

and milestone plans, and product development strategies that involve requirements, designs, and architectural

Tappert, Charles


WellcomeNews IN THIS ISSUE...  

E-Print Network (OSTI)

companies or other organisations involved in product development. See www.wellcome.ac.uk/techtransfer

Newcastle upon Tyne, University of


Regulating the information gatekeepers  

Science Conference Proceedings (OSTI)

Concerns about biased manipulation of search results may require intervention involving government regulation.

Patrick Vogl; Michael Barrett



Cryogenic Technologies Project  

Science Conference Proceedings (OSTI)

... processes and products involving cryogenic technologies. ... Develop mathematical models for cryogenic ... Assist in development of bibliographic ...




E-Print Network (OSTI)

of the International Symposium on Phosphogypsum. The staff of the Soil Research Laboratory has been involved

Demers, Nora Egan



E-Print Network (OSTI)

of the International Symposium on Phosphogypsum. The staff of the Soil Research Laboratory has been involved

Amrhein, Valentin


NIST: Physical Measurement Laboratory - Research ...  

Science Conference Proceedings (OSTI)

... Fellowships: SURFing the Physical Measurement Laboratory ... Optical, Radiation, and Chemical Physics. ... involves PML's Quantum Physics Division. ...



Sandia National Laboratories: Working with Sandia: Staff ...  

Search; Menu; About. Leadership; President's Message; Social Media; Community Involvement; Contribution Programs; Volunteer Programs; Education Programs ...

Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2008-2010 Research Summary: Analysis of Demand Response Opportunities in California Industry  

E-Print Network (OSTI)

facilities These involved sub- metering the electricityon literature survey, sub-metering analysis, survey results

Goli, Sasank



Breakdown of Cell Wall Nanostructure in Dilute Acid Pretreated Sai Venkatesh Pingali,*,  

E-Print Network (OSTI)

Weave Composite ~ 1 dpa, HFIR irradiation ORNL / Kyoto U. A science-based program involving tailored


Some topics in thermodynamics and quantum mechanics  

E-Print Network (OSTI)

We sketch some connecting relations involving fractional and quantum calculi, fractal structure, thermodynamics, and quantum mechanics.

Robert Carroll



Special Focus SCIENCE CHINA Information Sciences  

E-Print Network (OSTI)

doi: ************** How commercial involvement affects open source projects: three case studies on issue reporting

Ma Xiujuan; Zhou Minghui; Riehle Dirk



9 July 1999 Z .Chemical Physics Letters 307 1999 527532  

E-Print Network (OSTI)

of the structures. Heats of formation were evaluated based on homodesmotic reactions involving disilane, trisilane

Swihart, Mark T.


Sixteenth International Conference on the physics of electronic and atomic collisions  

SciTech Connect

This report contains abstracts of papers on the following topics: photons, electron-atom collisions; electron-molecule collisions; electron-ion collisions; collisions involving exotic species; ion- atom collisions, ion-molecule or atom-molecule collisions; atom-atom collisions; ion-ion collisions; collisions involving rydberg atoms; field assisted collisions; collisions involving clusters and collisions involving condensed matter.

Dalgarno, A.; Freund, R.S.; Lubell, M.S.; Lucatorto, T.B. (eds.)




Science Conference Proceedings (OSTI)



Document Understanding Conferences - Introduction  

Science Conference Proceedings (OSTI)

... The agencies involved include DARPA, ARDA and NIST. Their programmes, for example DARPA's TIDES (Translingual ...



E-Print Network (OSTI)

, Canada. He has been with the Engineering Department of ALCATEL and PEMEX in projects involving digital

Geffner, Hector



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

access to B-20 and above. The project involves installing 2 new dispenser that can blend bio at the pump. The project involves installing 2 new dispenser that can blend bio at the...


Positive design  

Science Conference Proceedings (OSTI)

This article is focused on the changes needed in design to create positive solutions for all involved in design processes. It draws upon the rich discussion and discourse from a conference focused on positive design involving managers, designers, and ...

Jurgen Faust



Industry Professional | Open Energy Information  

Open Energy Info (EERE)

Industry Professional Jump to: navigation, search How to GET INVOLVED WITH OpenEI Get involved with OpenEI Programmer.jpg Industry Professional Do you have valuable information...


Dept. Computing Science Technical Report TR2002118 Supporting Early Intervention Programmes for special  

E-Print Network (OSTI)

, or in mainstream nurseries and schools. Many home­based therapy programmes involve parents or carers applying of autistic children is Applied Behaviour Analysis. This approach involves parents coordinating a home­based

Williamson, John


Dept. Computing Science Technical Report TR-2002-118 Supporting Early Intervention Programmes for special-  

E-Print Network (OSTI)

, or in mainstream nurseries and schools. Many home-based therapy programmes involve parents or carers applying of autistic children is Applied Behaviour Analysis. This approach involves parents coordinating a home-based

Williamson, John


Study of Mercury Transformation with Chlorinated Species under Homogeneous and Heterogeneous Conditions.  

E-Print Network (OSTI)

??Mercury (Hg) transformation under homogeneous (gas-phase oxidation reactions primarily involving chlorine species in flue gases) and heterogeneous (gas-surface oxidation reactions involving surface enhanced Hg oxidation (more)

Busireddy, Bhargavi



On-Demand Grid Application Tuning and Debugging with the NetLogger Activation Service  

Science Conference Proceedings (OSTI)

Typical Grid computing scenarios involve manydistributed hardware and software components. The morecomponents that are involved, the more likely it is that oneof them may fail. In order for Grid computing to succeed,there must be a simple mechanism to ...

Dan Gunter; Brian L. Tierney; Craig E. Tull; Vibha Virmani



An Overview of Residential Ventilation Activities in the Building America Program (Phase I)  

DOE Green Energy (OSTI)

This report provides an overview of issues involved in residential ventilation; provides an overview of the various ventilation strategies being evaluated by the five teams, or consortia, currently involved in the Building America Program; and identifies unresolved technical issues.

Barley, D.




E-Print Network (OSTI)

box diagram where charged Higgs fields are involved has alsoMaskawa model and the "Higgs" model. a(B 0 -S0) is thewhich involve the charged Higgs particles and contribute to

Shizuya, K.



Model studies of the structures, reactivities, and reaction mechanisms of metalloenzymes  

Science Conference Proceedings (OSTI)

Electronic structure theory, which in recent years has been actively and effectively applied to the modeling of chemical reactions involving transition-metal complexes, is now also being applied to the modeling of biological processes involving metalloenzymes. ...

K. Morokuma; D. G. Musaev; T. Vreven; H. Basch; M. Torrent; D. V. Khoroshun


Note: This page contains sample records for the topic "involvement involvement involvement" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The Challenge of Testing RFID Integrated Circuits  

Science Conference Proceedings (OSTI)

RFID integrated circuits often involve many of themost leading edge production technologies availabletoday. The complexities involved with integrating thesecomplexities into the backend and test environment areexceptionally challenging. To date, this ...

David Murfett



Technology discourses and sustainability: Fraught with disconnects  

Science Conference Proceedings (OSTI)

The public discourse on sustainable technology often involves a disconnect between political and engineering perspectives. This paper illustrates this disconnect in a case study of a technology discourse involving stakeholders in the biofuels ...

Peter Wiesner; William R. Tonti



Recognizing arguing subjectivity and argument tags  

Science Conference Proceedings (OSTI)

In this paper we investigate two distinct tasks. The first task involves detecting arguing subjectivity, a type of linguistic subjectivity on which relatively little work has yet to be done. The second task involves labeling instances of arguing subjectivity ...

Alexander Conrad; Janyce Wiebe; and Rebecca Hwa



DOE/EIS-0285; Bonneville Power Administration Transmission System...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Publications A-4 Scoping Feedback FYI A-5 A Public Involvement: Publications A-6 A-7 Scoping Feedback FYI A Public Involvement: Publications A-8 A-9 Scoping Feedback FYI...


Consequences of Reduced Versican Expression in Embryonic Chick Synovial Joint Development.  

E-Print Network (OSTI)

??The different mechanisms involved in vertebrate synovial joint development are activelybeing uncovered. A variety of studies have thus far discovered the involvement of several largemolecules (more)

Nagchowdhuri, Partha Sarathi



Consequences of Reduced Versican Expression in Embryonic Chick Synovial Joint Development.  

E-Print Network (OSTI)

??The different mechanisms involved in vertebrate synovial joint development are activelybeing uncovered. A variety of studies have thus far discovered the involvement of several largemolecules (more)

Nagchowdhuri, Partha Sarathi



NIST Workshop Gets a 'Grip' on Robotics Challenge  

Science Conference Proceedings (OSTI)

... next-generation automation, especially when their production mix involves ... reliability, ease of programming, reachability, energy consumption per ...