Powered by Deep Web Technologies
Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Blank Layout  

Science Conference Proceedings (OSTI)

Table 4   Scrap allowance for blanking...t Edge of stock to blank Between blanks in row Thickness of stock, t Edge of stock to blank Between blanks in row mm in. mm in. mm in. mm in. mm in. mm in. Metals in general Up to 0.53 Up to 0.021 1.27 0.050 1.27 0.050 Up to 1.12 Up to 0.044 1.27 0.050 1.27 0.050 Standard strip stock 0.56??1.40...

2

THIS PAGE INTENTIONALLY LEFT BLANK  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

THIS PAGE INTENTIONALLY LEFT BLANK THIS PAGE INTENTIONALLY LEFT BLANK i U.S. DEPARTMENT OF ENERGY CRITICAL MATERIALS STRATEGY DECEMBER 2011 ii THIS PAGE INTENTIONALLY LEFT BLANK iii TABLE OF CONTENTS FOREWORD ........................................................................................................................................................... 1 ACKNOWLEDGEMENTS .......................................................................................................................................... 2 EXECUTIVE SUMMARY ........................................................................................................................................... 3 CHAPTER 1. INTRODUCTION .................................................................................................................................. 8

3

Cal Poly Architecture Report  

NLE Websites -- All DOE Office Websites (Extended Search)

a F - I1L - . > m E It. Simplicity and sufficiency were guiding design principles for the Solar CalPoly project. From the project's inception, the students' design proposals for...

4

Blanking Tools and Work Rolls  

Science Conference Proceedings (OSTI)

...is then turned over, allowing the punch to fall out, and the punch is then used to cut out the slug remaining from indenting, thus forming the doughnut-shaped blank....

5

blank  

NLE Websites -- All DOE Office Websites (Extended Search)

were identified www.epa.govcpgproducts.htm DUNS : https:www.bpn.govCCRSearchSearch.aspx EPEAT rating: www.epeat.net GSA: www.GSA.gov Use back of this form to document...

6

This page is intentionally left blank.  

U.S. Energy Information Administration (EIA)

U.S. Energy Information Administration/Electric Power Monthly June 2012 1 Executive Summary This page is intentionally left blank.

7

Inspection of lithographic mask blanks for defects  

DOE Patents (OSTI)

A visible light method for detecting sub-100 nm size defects on mask blanks used for lithography. By using optical heterodyne techniques, detection of the scattered light can be significantly enhanced as compared to standard intensity detection methods. The invention is useful in the inspection of super-polished surfaces for isolated surface defects or particulate contamination and in the inspection of lithographic mask or reticle blanks for surface defects or bulk defects or for surface particulate contamination.

Sommargren, Gary E. (Santa Cruz, CA)

2001-01-01T23:59:59.000Z

8

Cal  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CALIFORNIA CALIFORNIA BERKELEY · DAVIS · IRVINE · LDS ANGELES · RIVERSIDE · SAN DIEGO · SAN FRANCISCO SANTA BARBARA · SANTA CRUZ OFFICE OF THE PRESIDENT 300 Lakeside Drive Oakland, California 94612-3550 SENIOR VICE PRESIDENT- BUSINESS AND FINANCE May 8, 1998 U. S. Department of Energy Office of General Counsel, GC-52 1000 Independence Avenue, S. W. Washington, DC 20585 RE: Price Anderson Act Extension Comments Recently I learned of interpretations of the University's comments submitted on January 30, 1998, that I think bear some clarification. One of our comments suggested an alternative for DOE if the civil fine exemption were to be eliminated. That comment was not an endorsement for eliminating the exemption; rather it is a means for partially mitigating the adverse consequences to the production of science were

9

CalEnergy Generation | Open Energy Information  

Open Energy Info (EERE)

steam-producing facilities in the United States and the Philippines. Worldwide, CalEnergy Generation focuses on growth through acquisition and fuel source diversification....

10

CalCars | Open Energy Information  

Open Energy Info (EERE)

engineers, environmentalists and consumers promoting 100+MPG plug-in hybrid electric vehicles (PHEVs). References CalCars1 LinkedIn Connections CrunchBase Profile No...

11

) Leave Blank (NARA Use Only) I  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

for Records Disposition Authority 1 for Records Disposition Authority 1 ) Leave Blank (NARA Use Only) I (See lnstruct~ons on reverse) To: National Archives and Records Administration (NIR) Washington, DC 20408 1 From (Agency or establishment) Department of Energy 2. Major Subdivision Idaho Operations Office 3. Minor Subdivis~on I 4 Name of Person with whom to confer / 5 Tele~hone (include area code) l ~ o b Number N / - '13v-08-/ Date Rece~ved /J /07 I Notification to Agency In accordance with the provisions of 44 U.S.C. 3303a, the disposition request. in- cluding amendments, is approved except for items that may be marked "disposition not approved" or "withdrawn" in column 10. 1 ~ a t e / Archivist of the United States I I hereby certify that I am authorized to act for this agency in matters pertaining to the disposition of its records and that the records proposed

12

CalEnergy Generation | Open Energy Information  

Open Energy Info (EERE)

CalEnergy Generation CalEnergy Generation Jump to: navigation, search Logo: CalEnergy Generation Name CalEnergy Generation Place Calipatria, California Sector Geothermal energy Year founded 1971 Website http://www.calenergy.com/ Coordinates 33.1255957°, -115.5141538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":33.1255957,"lon":-115.5141538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

13

CalCOFI Data Management, White Paper  

E-Print Network (OSTI)

CalCOFI Data Management White Paper Karen I. Stocks 1 anddiscussions of this white paper and in part by the immediatesame timeframe as this white paper has been developed, there

Stocks, Karen I; Baker, Karen S

2005-01-01T23:59:59.000Z

14

CalStar Products | Open Energy Information  

Open Energy Info (EERE)

CalStar Products CalStar Products Jump to: navigation, search Name CalStar Products Place Newark, California Zip 94560 Product California-based environmentally friendly brick and paving stone manufacturer. Coordinates 44.690435°, -71.951685° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.690435,"lon":-71.951685,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

15

CalCEF Clean Energy Fund | Open Energy Information  

Open Energy Info (EERE)

94103 Product US-based fund manager to CalCEF clean energy funds focusing on the clean energy and related technologies market. References CalCEF Clean Energy Fund1 LinkedIn...

16

Blank side of cover. BIOLOGICAL AND CHEMICAL SURVEY  

E-Print Network (OSTI)

#12;Blank side of cover. #12;BIOLOGICAL AND CHEMICAL SURVEY OF THE LOWER PAGO RIVER, ESTUARY, NEAR: Background and center insert aerial photos of southern sector of Pago Bay showing river, estuary, channel.S. Department of the Interior Geological Survey, Topographic Map of Guam). . . . . . . . . . . . . 2 2

Schupp, Peter

17

Laser calibration system of TileCal in ATLAS detector  

E-Print Network (OSTI)

This talk presents the Laser calibration system of TileCal. After a brief introduction putting a stress on the importance of TileCal calibration and the monitoring of its stability, some example of response stability measurements obtained using the laser system are commented.

Giangiobbe, V; The ATLAS collaboration

2011-01-01T23:59:59.000Z

18

Cal Flint Floral Greenhouse Low Temperature Geothermal Facility | Open  

Open Energy Info (EERE)

Cal Flint Floral Greenhouse Low Temperature Geothermal Facility Cal Flint Floral Greenhouse Low Temperature Geothermal Facility Jump to: navigation, search Name Cal Flint Floral Greenhouse Low Temperature Geothermal Facility Facility Cal Flint Floral Sector Geothermal energy Type Greenhouse Location Buhl, Idaho Coordinates 42.5990714°, -114.7594946° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

19

CalRENEW-1 Solar Power Plant | Open Energy Information  

Open Energy Info (EERE)

CalRENEW-1 Solar Power Plant CalRENEW-1 Solar Power Plant Jump to: navigation, search Name CalRENEW-1 Solar Power Plant Facility CalRENEW-1 Sector Solar Facility Type Photovoltaic Developer Cleantech America Location Fresno County, California Coordinates 36.9858984°, -119.2320784° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.9858984,"lon":-119.2320784,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

20

Cal Climate Action Partnership: Reducing Greenhouse Gas Emissions...  

NLE Websites -- All DOE Office Websites (Extended Search)

Cal Climate Action Partnership: Reducing Greenhouse Gas Emissions at UC Berkeley Speaker(s): Fahmida Ahmed Date: January 11, 2007 - 12:00pm Location: 90-3122 Seminar HostPoint of...

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Cal Tech's Program in Meteorology: 19331948  

Science Conference Proceedings (OSTI)

The California Institute of Technology (Cal Tech) established a course of study in meteorology in 1933. It was intimately tied to the upsurge of activity in commercial and military aviation that occurred in the period between the world wars. The ...

J. M. Lewis

1994-01-01T23:59:59.000Z

22

This page intentionally left blank. California Solar Initiative, CPUC Staff Progress Report, April 2008 2  

E-Print Network (OSTI)

#12;This page intentionally left blank. California Solar Initiative, CPUC Staff Progress Report................................................................................................................ 5 2. Go Solar California! Overview............................................................................................... 8 2.1 California Solar Initiative Program History

23

Design and analysis of recycled content sign blanks  

E-Print Network (OSTI)

This report documents a study of the feasibility of using sign blanks constructed of reclaimed materials instead of conventional high-grade plywood and aluminum. This study presents the engineering techniques necessary for judicious use of recycled materials in roadside sign applications. Various types of recycled materials were solicited from commercial manufacturers and subjected to an array of laboratory tests and numerical simulations. Materials that were received were manufactured from a variety of materials including high density polyethylene (HDPE), polycarbonate, polyvinyl chloride, and calcium carbonate. This study encompasses analysis, performance, and properties of tested materials. A total of seven recycled materials were tested in flexure, uni-axial tension, creep, free vibration, and exposure to ultraviolet radiation. Corollaries of this study are development of performance-based specifications and a new design procedure for sign blanks. A preliminary design procedure is developed for two-pole supported and tee-pole supported sign substrates. The procedure is based on simple mechanics of materials bending formulae for a variety of deflection criteria. Design environmental loads are determined using ASCE 7-95 Minimum Design Loadsfor Buildings and Other Structures. A design example for a two-pole sign is performed for one of the recycled materials collected during the study. Adequacy of the preliminary design is checked using a finite element model of the structure in conjunction with a set of performance-based specifications. In addition, a combined laboratory and numerical procedure for duplicating wind induced vibrations is developed using a frequency domain-based method. Numerical simulation of a wind loading is carried out using two dynamic wind events. The response of several locations on the sign are recorded and converted to the frequency domain using fast Fourier transform. Simultaneously, a full-scale laboratory model is constructed and an electromechanical actuator is connected to the supporting structure. The laboratory structure is struck at the actuator connection with the same impact hammer used to analyze the field model. From a complex frequency response function an actuator time history is produced that elicits a structural response at a particular node that closely approximates the response obtained by finite element analysis. This procedure is capable of modeling dynamic response in the substrate to nearly any dynamic wind event, including impulse events caused by large highway vehicles. A brief listing of estimated cost for some of the recycled materials that were tested in the laboratory is included for quantities varying by order of magnitude from 1,000 to 1,000,000 sheets.

Harrison, Ben Frank

1996-01-01T23:59:59.000Z

24

DOE Solar Decathlon: News Blog » U of So Cal  

NLE Websites -- All DOE Office Websites (Extended Search)

U of So Cal U of So Cal Below you will find Solar Decathlon news from the U of So Cal archive, sorted by date. European Teams Top Architecture and Communications Contests Friday, October 11, 2013 By Solar Decathlon Czech Technical University took first place in the highly competitive Architecture Contest and Vienna University of Technology received top honors in the Communications Contest this morning at the U.S. Department of Energy Solar Decathlon 2013. A jury of professional architects determined the Architecture Contest winners by assessing each house's architectural elements, environmental compatibility and occupant comfort, design inspiration, and construction specifications. Photo of the interior of AIR House. The interior of Czech Technical University's AIR House, which won first

25

Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Natural Gas Rate Natural Gas Rate Reduction - SoCalGas to someone by E-mail Share Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas on Facebook Tweet about Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas on Twitter Bookmark Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas on Google Bookmark Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas on Delicious Rank Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas on Digg Find More places to share Alternative Fuels Data Center: Natural Gas Rate Reduction - SoCalGas on AddThis.com... More in this section... Federal State Advanced Search All Laws & Incentives Sorted by Type Natural Gas Rate Reduction - SoCalGas Southern California Gas Company (SoCalGas) offers natural gas at discounted

26

Cal Poly Department of Mathematics Puzzle of the Week  

E-Print Network (OSTI)

Cal Poly Department of Mathematics Puzzle of the Week April 2-8, 2010 1000 light bulbs flips the switch on every 3rd light, and so on. After person 1000 finishes how many bulbs are switched a submission. Solution: There are 31 light bulbs left on. Note that light bulb N will have its switch flipped

Sze, Lawrence

27

Cal-Nev-Ari, Nevada: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cal-Nev-Ari, Nevada: Energy Resources Cal-Nev-Ari, Nevada: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 35.3055496°, -114.8835866° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.3055496,"lon":-114.8835866,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

28

DOE Solar Decathlon: News Blog » U of So Cal  

NLE Websites -- All DOE Office Websites (Extended Search)

'U of So Cal' 'U of So Cal' European Teams Top Architecture and Communications Contests Friday, October 11, 2013 By Solar Decathlon Czech Technical University took first place in the highly competitive Architecture Contest and Vienna University of Technology received top honors in the Communications Contest this morning at the U.S. Department of Energy Solar Decathlon 2013. A jury of professional architects determined the Architecture Contest winners by assessing each house's architectural elements, environmental compatibility and occupant comfort, design inspiration, and construction specifications. Photo of the interior of AIR House. The interior of Czech Technical University's AIR House, which won first place in the U.S. Department of Energy Solar Decathlon 2013 Architecture

29

CalCEF Clean Energy Angel Fund | Open Energy Information  

Open Energy Info (EERE)

Angel Fund Angel Fund Jump to: navigation, search Logo: CalCEF Clean Energy Angel Fund Name CalCEF Clean Energy Angel Fund Address 5 Third Street, Suite 1125 Place San Francisco, California Zip 94103 Region Bay Area Product Seed Stage Venture Capital Firm Number of employees 1-10 Year founded 2007 Website http://www.calcefangelfund.com Coordinates 37.7876002°, -122.4033947° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7876002,"lon":-122.4033947,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

30

Learning by Doing, Cal Poly San Luis Obispo. Thesis on Quantum ...  

Science Conference Proceedings (OSTI)

Some projects include fabrication of a photovoltaic cell and construction of a solar water heater. Outside of campus labs, Logan has also been a leader in Cal

31

Estudo do comportamento mecnico de misturas de fosfogesso e cal para utilizao na construo rodoviria.  

E-Print Network (OSTI)

??Este trabalho tem como objetivo estudar, a partir de ensaios de laboratrio, o comportamento mecnico de misturas de fosfogesso e cal destinadas construes de (more)

Shirley Minnell Ferreira de Oliveira

2005-01-01T23:59:59.000Z

32

Award Recipient of the ENERGY STAR Challenge for Industry CalPortland...  

NLE Websites -- All DOE Office Websites (Extended Search)

with energy efficiency in mind by installing mechanical conveying systems instead of high energy intensity pneumatic systems. During times of economic slowdown, CalPortland's...

33

CalCEF Angel Network | Open Energy Information  

Open Energy Info (EERE)

Network Network Jump to: navigation, search Name CalCEF Angel Network Address 5 Third Street, Suite 1125 Place San Francisco, California Zip 94103 Region Bay Area Number of employees 1-10 Year founded 2007 Website http://www.calcefangelnetwork. Coordinates 37.7876002°, -122.4033947° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7876002,"lon":-122.4033947,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

34

On Bill Financing: SDG&E/SoCalGas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 San Diego Gas and Electric Co. and Southern California Gas Company. All copyright and trademark rights reserved. 2 San Diego Gas and Electric Co. and Southern California Gas Company. All copyright and trademark rights reserved. On Bill Financing: SDG&E / SoCalGas Frank Spasaro May 6, 2011 US - China Energy Efficiency Forum OVERVIEW of SDG&E / Southern California Gas * Covers most of the southern parts of California: * 24, 000 square miles * Over 24 million residents * 1.4 million electric meters * 6.65 million gas meters (850k + 5.8 million) California's Energy Action Plan II * In 2005, the CPUC and CEC'S EAP II declared: "[The} goal is for California's energy to be adequate, affordable, technologically advanced, and environmentally sound...[C]ost effective

35

Science Education Master Teacher UCI Cal Teach Science and Mathematics Program  

E-Print Network (OSTI)

Science Education Master Teacher UCI Cal Teach Science and Mathematics Program Program Description The UCI Cal Teach Science and Mathematics Program is a new undergraduate teacher preparation program for aspiring middle school and high school math and science teachers. Its curriculum is modeled after

Loudon, Catherine

36

TileCal Remote Monitoring Station at the University of Chicago (draft v0.1)  

E-Print Network (OSTI)

that is available on the TileCal ATLAS Control Room (ACR) station, with additional offline analysis capability (see problems observed with the monitoring software, in diagnos- tic plots, or in reconstructed data. The load imposed on the TileCal ACR machine by the remote moni- toring station must be small and should

37

ANALYSIS OF FUEL ELEMENT CORE BLANKS FOR ARGONNE LOW POWER REACTOR BY GAMMA COUNTING  

SciTech Connect

A technique based on a determinaiion of the differential counting rate exhibited by the 184-kev gamma radiation associated with the decay of U/sup 235/ was developed for the determination of the U/sup 235/ content in Argonne Low Power Reactor fuel element core blanks. The Argonne Low Power Reactor core blanks were an aluminum-highly enriched uranium alloy containing 17.5 weight per cent uranium (approximately 4 g U/sup 235/) having the following dimensions: length, 6.875 inches, width, 3.31 inches, and thickness, 0.200 inch. The gamma- ray spectrum emitied by uranium is rather complex. Using a scintillation spectrometer and scanning the spectrum, the energy is found to be concentrated primarily in two regions, at 184 and 90 kev. The 184-kev gamma rays result primarily from the decay of U/sup 235/ The gammas in the 90-kev region result from the U/sup 235/ decay and daughter products of U/sup 238/ and U/sup 235/. Using a pulse-height analyzer, it is possibie to select the desired radiation emitted from the source and determine the counting rate for a given source. In this work the 184-kev gamma radiation was counted to determine the amount of U/ sup 235/ present in the individual core blanks. (auth)

McGonnagle, W.J.; Perry, R.B.

1959-12-01T23:59:59.000Z

38

Numerical simulation is vital to analyse complex chemi-cal or physical processes. The Institute for Numerical  

E-Print Network (OSTI)

to decontami- nate environmental chromate focus on reducing it to a trivalent form. However, chemi- cal methods

Bartels, Soeren

39

INTENTIONALLY BLANK  

Science Conference Proceedings (OSTI)

... CO2 gas analyzer and a home built absorption ... spectroscopic ellipsometer with a heating element ... Fluidity at Oil-Water Interfaces Pascal Garczynski ...

2012-12-17T23:59:59.000Z

40

INTENTIONALLY BLANK  

Science Conference Proceedings (OSTI)

... Thrill Dragster making Cedar Point home of the ... conditions (control, oil, corexit, and oil plus corexit ... for commercial production, is by heating a SiC ...

2011-12-08T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

On Bill Financing: SDG&E/SoCalGas  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2011年5月5-6日|劳伦斯伯克利国家实验室,伯克利市,加州 2011年5月5-6日|劳伦斯伯克利国家实验室,伯克利市,加州 通过电费帐单的分期偿还计划: 圣地亚哥天然气和电气公司 /南加州天然气公司 Frank Spasaro 2011年5月5-6日|劳伦斯伯克利国家实验室,伯克利市,加州 第二届中美能效论坛 简介圣地亚哥天然气和电气公司(SDG&E) /南加州天然气公司 (SoCalGas) * 业务范围涵盖南加州大部份地区: * 24, 000 平方英里 * 超过2400万居民 * 安装140万个电表 * 安装665万个气表 (85万个+ 580万个) 2011年5月5-6日|劳伦斯伯克利国家实验室,伯克利市,加州

42

Secretary Chu Named Cal Alumnus of the Year | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Secretary Chu Named Cal Alumnus of the Year Secretary Chu Named Cal Alumnus of the Year Secretary Chu Named Cal Alumnus of the Year April 21, 2011 - 6:39pm Addthis John Schueler John Schueler Former New Media Specialist, Office of Public Affairs Earlier this month, the Cal Alumni Association (CAA) honored Secretary Steven Chu by naming him their 2011 Alumnus of the Year. The CAA cited Secretary Chu's "ground-breaking contributions to the fields of biophysics and atomic physics, commitment to addressing climate change, and transformative leadership in energy research and policy" as key factors in their selection. Secretary Chu, who was awarded his PhD from Berkeley in 1976, has often cited his education as the foundation for his success. "The idea was given to me that you can teach yourself anything you really want to learn.

43

The Cal Poly Sustainable Power for Electrical Resources (SuPER) Project  

NLE Websites -- All DOE Office Websites (Extended Search)

The Cal Poly Sustainable Power for Electrical Resources (SuPER) Project The Cal Poly Sustainable Power for Electrical Resources (SuPER) Project Speaker(s): James Harris Date: August 16, 2007 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Anita Estner The Cal Poly sustainable power for electrical resources (SuPER) project has completed two years of development for a low-cost source of electrical power for the 2 billion people who do not have access. The overall goal of the Cal Poly SuPER system is to provide sustainable electrical power for a household unit over a 20-year life cycle for a total cost of $500. A prototype has been developed, and consists of a solar photovoltaic module source with battery storage, a standard DC output voltage, and a computer/digital control and status subsystem. The design is documented

44

DGRC AskCal: natural language question answering for energy time series  

Science Conference Proceedings (OSTI)

Even quite sophisticated users can experience difficulty navigating large collections of data to locate the answers to their queries. We describe AskCal, a system that employs natural language processing, an ontology, a query planner, and various feedback ...

Andrew Philpot; Jose Luis Ambite; Eduard Hovy

2002-05-01T23:59:59.000Z

45

The Impact of California's Cal-Learn Demonstration Project, Final Report  

E-Print Network (OSTI)

57 Percent of Months Teen on AFDC Since Turning Selected763; if she was eligible for AFDC and new to the Cal-Learnor out of state, or left AFDC are excluded from the study. A

Mauldon, Jane; Malvin, Jan; Stiles, Jon; Nicosia, Nancy; Seto, Eva Y.

2000-01-01T23:59:59.000Z

46

Assessing Barriers to Employment Among CalWORKs Recipients in San Joaquin County - Final Report  

E-Print Network (OSTI)

with Dependent Children (AFDC) with Temporary Assistance foraided adults than did the AFDC program, but also establishesCalWORKs replaced the states AFDC program, called Greater

Speiglman, Richard; Norris, Jean C.

2005-01-01T23:59:59.000Z

47

A study of defects on EUV mask using blank inspection, patterned mask inspection, and wafer inspection  

SciTech Connect

The availability of defect-free masks remains one of the key challenges for inserting extreme ultraviolet lithography (EUVL) into high volume manufacturing. yet link data is available for understanding native defects on real masks. In this paper, a full-field EUV mask is fabricated to investigate the printability of various defects on the mask. The printability of defects and identification of their source from mask fabrication to handling were studied using wafer inspection. The printable blank defect density excluding particles and patterns is 0.63 cm{sup 2}. Mask inspection is shown to have better sensitivity than wafer inspection. The sensitivity of wafer inspection must be improved using through-focus analysis and a different wafer stack.

Huh, S.; Ren, L.; Chan, D.; Wurm, S.; Goldberg, K. A.; Mochi, I.; Nakajima, T.; Kishimoto, M.; Ahn, B.; Kang, I.; Park, J.-O.; Cho, K.; Han, S.-I.; Laursen, T.

2010-03-12T23:59:59.000Z

48

SoCalGas - Residential Energy Efficiency Loan Program | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Loan Program Loan Program SoCalGas - Residential Energy Efficiency Loan Program < Back Eligibility Residential Savings Category Home Weatherization Commercial Weatherization Sealing Your Home Heating & Cooling Commercial Heating & Cooling Cooling Ventilation Insulation Design & Remodeling Appliances & Electronics Water Heating Windows, Doors, & Skylights Program Info State California Program Type Utility Loan Program Rebate Amount $2,500 - $20,000 Provider Southern California Gas Company The Southern California Gas Company (SoCalGas) offers The Home Energy Upgrade Financing (HEUF) program to its residential customers interested in making energy efficient improvements to their homes. Customers can qualify for loans ranging from $2,500 to $20,000 to purchase and install

49

ChemiCal engineering The Department of Chemical Engineering's Graduate Program  

E-Print Network (OSTI)

ChemiCal engineering researCh The Department of Chemical Engineering's Graduate Program at Texas, and Rheology · Computational Methods in Chemical Engineering · Process Control and Optimization graduate. Master of Science in Chemical Engineering A written thesis and a minimum of 24 hours of graduate

Gelfond, Michael

50

California Elder Economic Security Initiative (Cal-EESI) How the Elder Index is Used  

E-Print Network (OSTI)

California Elder Economic Security Initiative (Cal-EESI) How the Elder Index is Used The Elder they need to be economically stable. California Policymakers and other legislative partners use the Elder Dignity Act of 2009 (AB 324, Beall) passed in the California State Legislature with bipartisan support

Dhir, Vijay

51

Implementation of California's Cal-Learn Demonstration Project, A Process Evaluation: Program Planning and Implementation From June 1993 Through June 1996  

E-Print Network (OSTI)

Cal-Learn Case Management Program Training packet, Augusttraining program for its new case managers on AFLP case management

Cunniff, James; Dillon, Nara; Hirshberg, Diane; Medlin, Carol; Malvin, Janet

1997-01-01T23:59:59.000Z

52

Geomagnetic field intensity changes in Sweden between 9000 and 450 cal BP: extending the record of barchaeomagnetic jerksQ by  

E-Print Network (OSTI)

Geomagnetic field intensity changes in Sweden between 9000 and 450 cal BP: extending the record in geomagnetic field intensity occurred at ~8400, ~6400, 3900 and 2800 cal BP. The maximum field intensity at 2800 cal BP was associated with the most rapid change in the direction of the geomagnetic vector. While

Sandgren, Per

53

SoCalGas - Non-Residential On-Bill Financing Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

On-Bill Financing Program On-Bill Financing Program SoCalGas - Non-Residential On-Bill Financing Program < Back Eligibility Agricultural Commercial Fed. Government Industrial Institutional Local Government Multi-Family Residential Nonprofit Schools State Government Tribal Government Savings Category Other Program Info State California Program Type Utility Loan Program Rebate Amount General Minimum Loan Amount: $5,000/meter minimum Non-Institutional Customers: up to $100,000/meter with 5 year max payback Taxpayer Funded Institutions: up to $250,000/meter with 10 year max payback State of California: up to $1,000,000 with 10 year max payback Provider Southern California Gas Company The SoCalGas On-Bill Financing (OBF) program offers qualified business customers 0% financing from $5,000 to $100,000 per meter for qualifying

54

SoCalGas - Residential Energy Efficiency Rebate Programs | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rebate Programs Rebate Programs SoCalGas - Residential Energy Efficiency Rebate Programs < Back Eligibility Residential Savings Category Home Weatherization Commercial Weatherization Appliances & Electronics Heating & Cooling Commercial Heating & Cooling Heating Water Heating Program Info Start Date 1/1/2010 Expiration Date 12/31/2012 State California Program Type Utility Rebate Program Rebate Amount Clothes Washer: $35 Dishwasher: $30 Storage Water Heater: $30 or $75 (.62 EF) Gas Furnace: $200 Attic and Wall Insulation: $0.15/sq. ft. Tankless Water Heater: $300 or $400 Provider Southern California Gas Company The Southern California Gas Company (SoCalGas) Home Energy Efficiency Rebate Program offers cash rebates on qualifying energy-efficiency upgrades or improvements made to single family homes, multi-family apartments, or

55

The Cost Escalation of Rail Projects: Using Previous Experience to Re-Evaluate the CalSpeed Estimates  

E-Print Network (OSTI)

RevisedCapital Cost Estimates, LowEstimate GRAPEVINE: 5.0%CalSpeed:RevisedCapital Cost Estimates, LowEstimate CENTRALRevisedCapital Cost Estimates, High Estimate CENTRAL

Leavitt, Dan; Ennis, Sean; McGovern, Pat

1993-01-01T23:59:59.000Z

56

The Influence of Blank-Width Ratio on Stress Field during Heavy Axial Forgings Manufacturing with Horizontal V-Shaped Anvils  

Science Conference Proceedings (OSTI)

The forging method with horizontal V-shaped anvils (HVA) is effective in the control of inner stress states, metal tissue, etc. FEM numerical simulation is conducted for the HVA forging method, given the blank-width ratio 0.5, 1.0 and 1.2, respectively, ... Keywords: horizontal V-shaped anvil, anvil-width ratio, blank-width ratio, axial forging, stress field

Li Li; Wang Qian; Yu Suoqing; Ni Liyong

2010-01-01T23:59:59.000Z

57

Transfer of Air Force technical procurement bid set data to small businesses, using CALS and EDI: Test report  

Science Conference Proceedings (OSTI)

This report documents a test transfer of three Air Force technical procurement bid sets to one large and twelve small businesses, using the Department of Defense (DoD) Continuous Acquisition and Life-cycle Support (CALS) and ANSI ASC X12 Electronic Data Interchange (EDI) standards. The main goal of the test was to evaluate the effectiveness of using CALS technical data within the context of the DoD`s EDI-based standard approach to electronic commerce in procurement, with particular emphasis on receipt and use of the data by small contractors. Air Force procurement data was provided by the Sacramento Air Logistics Center at McClellan Air Force Base; the manufacturing participants were selected from among McClellan`s ``Blue Ribbon`` contractors, located throughout the US. The test was sponsored by the Air Force CALS Test Network, headquartered at Wright-Patterson Air Force Base. The test successfully demonstrated the technical feasibility of including CALS MIL-R-28002 (Raster) engineering data in an EDI Specification/Technical Information transaction set (ANSI ASC X12 841) when issuing electronic requests for quotation to small businesses. In many cases, the data was complete enough for the contractor participant to feel comfortable generating a quote. Lessons learned from the test are being fed back to the CALS and EDI standards organizations, and to future implementors of CALS-EDI based acquisition or contracting systems, which require the transfer of technical information, such as engineering data, manufacturing process data, quality test data, and other product or process data, in the form of a CALS or other digital datafile.

NONE

1994-08-15T23:59:59.000Z

58

Transfer of Air Force technical procurement bid set data to small businesses, using CALS and EDI. Summary report. Revision 1  

Science Conference Proceedings (OSTI)

This report provides a summary of the Air Force CALS Test Network (AFCTN) Test Report Transfer of Air Force Technical Procurement Bid Set Data to Small Businesses, Using CALS and EDI (AFCTN Test Report 94-034, UCRL-ID-118619). It represents a synthesis of the results, conclusions, and recommendations, as well as a more concise presentation of the issues and strategies as viewed from AFCTN`s perspective. This report documents a test transfer of three Air Force technical procurement bid sets to one large and twelve small businesses, using the Department of Defense (DoD) Continuous Acquisition and Life-cycle Support (CALS) and ANSI ASC X12 Electronic Data Interchange (EDI) standards. The main goal of the test was to evaluate the effectiveness of using CALS technical data within the context of the DoD`s EDI-based standard approach to electronic commerce in procurement, with particular emphasis on receipt and use of the data by small contractors. Air Force procurement data was provided by the Sacramento Air Logistics Center at McClellan Air Force Base; the manufacturing participants were selected from among McClellan`s {open_quote}Blue Ribbon{close_quote} contractors, located throughout the United States. The test was sponsored by the Air Force CALS Test Network, headquartered at Wright-Patterson Air Force Base. The test successfully demonstrated the technical feasibility of including CALS MIL-R-28002 (Raster) engineering data in an EDI Specification/Technical Information transaction set (ANSI ASC X12 841) when issuing electronic requests for quotation to small businesses. In many cases, the data was complete enough for the contractor participant to feel comfortable generating a quote.

NONE

1995-01-10T23:59:59.000Z

59

SoCalGas - New Construction Advanced Homes Incentives | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

New Construction Advanced Homes Incentives New Construction Advanced Homes Incentives SoCalGas - New Construction Advanced Homes Incentives < Back Eligibility Construction Installer/Contractor Residential Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Solar Buying & Making Electricity Maximum Rebate Base incentives increase until building is 45% above code. Program Info Expiration Date 12/15/2013 State California Program Type Utility Rebate Program Rebate Amount Baseline Advanced Home Incentives: $75-$225/kW, $0.43-$1.29/kWh, $1.72-$5.14/Therm (15%-45% above code) California ENERGY STAR Marketing Support: CAHP provides marketing material valued at up to 10% of baseline project incentive On-site Photovoltaics: Additional $1,000 per single-family unit and $200

60

SoCalGas - Custom Non-Residential Energy Efficiency Program | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Custom Non-Residential Energy Efficiency Program Custom Non-Residential Energy Efficiency Program SoCalGas - Custom Non-Residential Energy Efficiency Program < Back Eligibility Agricultural Commercial Industrial Savings Category Other Heating & Cooling Commercial Heating & Cooling Heating Appliances & Electronics Home Weatherization Construction Commercial Weatherization Design & Remodeling Manufacturing Water Heating Maximum Rebate Energy Efficiency Calculated Incentive Program: $1,000,000/project and $2,000,000/premise/year Savings By Design Program: $500,000/year Program Info Funding Source Public Purpose Goods Surcharge Start Date 1/1/2010 Expiration Date 12/31/2012 State California Program Type Utility Rebate Program Rebate Amount $1/therm saved annually or 50% of the project cost (excluding taxes and

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

SoCalGas - Non-Residential Energy Efficiency Rebate Programs | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Efficiency Rebate Programs Energy Efficiency Rebate Programs SoCalGas - Non-Residential Energy Efficiency Rebate Programs < Back Eligibility Agricultural Commercial Industrial Savings Category Other Heating & Cooling Commercial Heating & Cooling Heating Appliances & Electronics Home Weatherization Construction Commercial Weatherization Design & Remodeling Manufacturing Water Heating Maximum Rebate Energy Efficiency Rebates for Businesses: $200,000/customer/year; $50,000 for greenhouse curtains, $25,000 for boilers and water heaters Savings By Design Program: $150,000/year Program Info Start Date 1/1/2010 Expiration Date 12/31/2012 State California Program Type Utility Rebate Program Rebate Amount Business Energy Efficiency Program: $1/therm saved annually or 50% of cost Furnaces: Varies

62

SoCalGas - Multi-Family Residential Rebate Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Multi-Family Residential Rebate Program Multi-Family Residential Rebate Program SoCalGas - Multi-Family Residential Rebate Program < Back Eligibility Multi-Family Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Appliances & Electronics Construction Water Heating Program Info State California Program Type Utility Rebate Program Rebate Amount Dishwashers: $30 Insulation: 25% Natural Gas Storage Water Heaters: $30 Tankless Water Heaters: $300 Central Furnaces: $200 Central System Water Heaters: $500 Central System Boilers: $1,500 Central Demand Hot Water Controllers: $700 or $1400 Provider Southern California Gas Company Southern California Gas Company provides incentives to encourage the owners and managers of multi-family residential buildings to increase their energy

63

UNITED STATES DEPAR~FIENT OF THE INTERIOR GE O U X I CAL S URVEY  

Office of Legacy Management (LM)

DEPAR~FIENT OF THE INTERIOR DEPAR~FIENT OF THE INTERIOR GE O U X I CAL S URVEY F e d e r a l C e n t e r , D e n v e r , C o l o r a d o 80225 CHEMICAL AllD RADIOCHEMICAL ANALYSES OF WATER FROM STREAMS, RESERVOIRS, WELLS, AND SPRINGS I N THE R U L I S O N PROJECT AREA, GARFIELD AND MESA COUNTIES, COLORADO P r e p a r e d under C o n t r a c t A T ( 2 9 - 2 ) - 4 7 4 for the N e v a d a O p e r a t i o n s O f f i c e U . S . A t o m i c E n e r g y C o m m i s s i o n DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. CONTENTS Page I n t r o d u c t i o n . . . . ,. . . . . . . . . . . . . . . . . . . . . . . 1 . . . . . . . . . . . . . . . . . . . . Methods of study and d a t a . 3 3 Samples of s u r f a c e w a t e r s . . . . . . . . . .. . . . . . . . . 8 . . . . . . . . . . . Samples of w e l l s , s p r i n g s and c i s t e r n s . S e l e c t e d r e f e r e n c e s . . . . . . . . . . . . . . . . . . . . . . . . . .

64

Interfacial microstructure in a B{sub 4}C/Al composite fabricated by pressureless infiltration.  

SciTech Connect

In this work, B{sub 4}C particulate-reinforced Al composite was fabricated by a pressureless infiltration technique, and its interfacial microstructure was studied in detail by X-ray diffraction as well as by scanning and transmission electron microscopy. The B{sub 4}C phase was unstable in Al melt during the infiltration process, forming AlB{sub 10}-type AlB{sub 24}C{sub 4} or Al{sub 2.1}B{sub 51}C{sub 8} as a major reactant phase. The Al matrix was large grains (over 10 {micro}m), which had no definite orientation relationships (ORs) with the randomly orientated B{sub 4}C or its reactant particles, except for possible nucleation sites with {l_brace}011{r_brace}{sub B{sub 4}C} almost parallel to {l_brace}111{r_brace}{sub Al} at a deviation angle of 1.5 deg. Both B{sub 4}C-Al and reactant-Al interfaces are semicoherent and free of other phases. A comparison was made with the SiC/Al composite fabricated similarly by the pressureless infiltration. It was suggested that the lack of ORs between the Al matrix and reinforced particles, except for possible nucleation sites, is the common feature of the composites prepared by the infiltration method.

Luo, Z.; Song, Y.; Zhang, S.; Miller, D. J. (Materials Science Division); (Teaxas A& M Univ.); (Beijing Inst. Aeronautical Mater.)

2012-01-01T23:59:59.000Z

65

Award Recipient of the ENERGY STAR Challenge for Industry CalPortland New Westminster C4I Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

New Westminster Cement Terminal CalPortland Company 20 Capilano Way New Westminster, British Columbia V3L 5H2 The CalPortland Company New Westminster Cement Terminal opened for business in 1999. The terminal is located in New Westminster, BC and serves the surrounding markets including Vancouver. The terminal consists of two 600 ton storage silos, both pneumatic and mechanical conveying, and one truck loadout scale. The facility has space for 9 railcars, 6 gravity and 3 pneumatic railcars. The standard operating procedures were reviewed and new processes were put into place to minimize run time and maximize operating efficiencies. Additionally, the railcar fleet was rearranged to include more gravity than pneumatic railcars. Through excellent energy management practices the New

66

NETL: News Release - Cal State to Explore Use of Marine Algae To "Soak Up"  

NLE Websites -- All DOE Office Websites (Extended Search)

December 11, 2000 December 11, 2000 Cal State to Explore Use of Marine Algae To "Soak Up" Carbon Dioxide DOE's Carbon Sequestration Program Continues to Grow SAN MARCOS, CA - One possibility for reducing the buildup of gases in the atmosphere that can cause global warming may be to create algae ponds that can soak up the carbon dioxide released from power plants. MORE INFO DOE's Carbon Sequestration Program To explore this concept, the Department of Energy will add a project proposed by California State University, San Marcos, CA, to its carbon sequestration research program. The department will provide slightly more than $200,000 for the 1-year exploratory effort, while the university will contribute nearly $100,000. Cal State researchers will investigate the use of coccolithophorids -

67

Page intentionally blank. ACKNOWLEDGMENTS  

E-Print Network (OSTI)

this context, our critical infrastructure and key resources (CIKR) may be directly exposed to the event themselves or indirectly exposed as a result of the dependencies and interde- pendencies among CIKR. Within the CIKR protection mission area, national priorities must include preventing catastrophic loss of life

Kemner, Ken

68

Back Covers [blanks  

Science Conference Proceedings (OSTI)

The Large Hadron Collider (LHC) at CERN, the European Organization for Nuclear Research, needs to produce unprecedented volumes of data when it starts operation in 2007. To provide for its computational needs, the LHC computing grid (LCG) should be deployed ...

2005-07-01T23:59:59.000Z

69

Front Inside Cover [blank  

Science Conference Proceedings (OSTI)

The Large Hadron Collider (LHC) at CERN, the European Organization for Nuclear Research, needs to produce unprecedented volumes of data when it starts operation in 2007. To provide for its computational needs, the LHC computing grid (LCG) should be deployed ...

2005-07-01T23:59:59.000Z

70

Blank Starting Slide  

NLE Websites -- All DOE Office Websites (Extended Search)

May 2004 - 4.56 million - 526 calendar days Denison Rewind Original Schedule - Start Unit 1 November 2004 Complete Unit 1 May 2005 - Start Unit 2 September 2005 - Complete...

71

CalHypso: An ArcGIS extension to calculate hypsometric curves and their statistical moments. Applications to drainage basin analysis in SE Spain  

Science Conference Proceedings (OSTI)

We present the GIS extension CalHypso to automatically extract multiple hypsometric curves from digital elevation models (DEM). This extension is programmed in Visual Basic 6 and uses the ArcObjects architecture of ArcGIS. It employs a new and easy methodology ... Keywords: Active tectonics, Betic Cordillera, GIS extension, Hypsometric curve, Sierra Nevada

J. V. Prez-Pea; J. M. Azan; A. Azor

2009-06-01T23:59:59.000Z

72

The mixing state of carbonaceous aerosol particles in northern and southern California measured during CARES and CalNex 2010  

Science Conference Proceedings (OSTI)

Carbonaceous aerosols impact climate directly by scattering and absorbing radiation, and hence play a major, although highly uncertain, role in global radiative forcing. Commonly, ambient carbonaceous aerosols are internally mixed with secondary species such as nitrate, sulfate, and ammonium, which influence their climate impacts through optical properties, hygroscopicity, and atmospheric lifetime. Aircraft-aerosol time-of-flight mass spectrometry (A-ATOFMS), which measures single-particle mixing state, was used to determine the fraction of organic and soot aerosols that were internally mixed and the variability of their mixing state in California during the Carbonaceous Aerosol and Radiative Effects Study (CARES) and the Research at the Nexus of Air Quality and Climate Change (CalNex) field campaigns in the late spring and early summer of 2010. Nearly 88% of all A-ATOFMS measured particles (100-1000 nm in diameter) were internally mixed with secondary species, with 96% and 75% of particles internally mixed with nitrate and/or sulfate in southern and northern California, respectively. Even though atmospheric particle composition in both regions was primarily influenced by urban sources, the mixing state was found to vary greatly, with nitrate and soot being the dominant species in southern California, and sulfate and organic carbon in northern California. Furthermore, mixing state varied temporally in northern California, with soot becoming the prevalent particle type towards the end of the study as regional pollution levels increased. The results from these studies demonstrate that the majority of ambient carbonaceous particles are internally mixed and are heavily influenced by secondary species that are most predominant in each region. Based on these findings, considerations of regionally dominant sources and secondary species, as well as temporal variations of aerosol physical and optical properties, will be required to obtain more accurate predictions of the climate impacts of aerosol in California.

Cahill, John F.; Suski, Kaitlyn; Seinfeld, John H.; Zaveri, Rahul A.; Prather, Kimberly A.

2012-11-21T23:59:59.000Z

73

iBlank Portrait Template  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Suite 600, 1901 North Moore Street Suite 600, 1901 North Moore Street Arlington, VA 22209-1728 Phone: (703) 522-0086 | Fax: (703) 522-0548 Email: hpbamail@hpba.org Web Site: www.hpba.org HPBA Comments NOPR on Energy Conservation Standards for Direct Heating Equipment Docket No. EERE-2011-BT-STD-0047 RIN 1904-AC56 October 14, 2011 The Hearth, Patio & Barbecue Association (HPBA) provides these comments in response to the Department of Energy (DOE) Notice of Proposed Rulemaking entitled "Energy Conservation Program: Energy Conservation Standards for Direct Heating Equipment," published at 76 Fed. Reg. 43941 (July 22, 2011) (the NOPR). HPBA is the North American industry association for 2500 member manufacturers, retailers, and distributors of hearth products. The vast majority of these entities are small businesses

74

This page intentionally left blank. .  

Science Conference Proceedings (OSTI)

... the most reliable reservoirs to help curb emissions of greenhouse gases, and thus constitutes a major breakthrough in carbon sequestration efforts. ...

2010-07-27T23:59:59.000Z

75

Welding Methods for Tailored Blanks  

Science Conference Proceedings (OSTI)

...methods both with and without filler wire by Toyota since 1986. Filler wire is used for applications that have an exposed weld in the finished product, such as body side frames. Filler wire welds are ground flush to improve surface appearance after welding. Welds that do not require a flush surface...

76

iBlank Portrait Template  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Safety & Health Review Comm'n, 642 F.3d 234, 238 (D.C. Cir. 2011). 27 Natural Resources Def. Council, Inc. v. EPA, 489 F.3d 1364, 1371 (D.C. Cir. 2007). 28 NRDC v. Abraham, 355...

77

Cal Poly Initiates R-407C Chiller Replacement: Commercial Cooling Update--Case Study in Southern California Edison Territory, Issue 4, June 1996  

Science Conference Proceedings (OSTI)

Southern California Edison and EPRI have teamed with students at California State Polytechnic University in Pomona (Cal Poly) to evaluate the performance of what is thought to be the first chiller in the United States using R-407C, a promising replacement for HCFC-22. Once optimized, the 160-ton screw chiller should reduce annual energy use by 44% compared to the 24-year old, 204-ton CFC-11 unit it replaces, while providing a 6.7 year payback. Researchers are currently focusing on testing--which began in...

1996-07-02T23:59:59.000Z

78

This page intentionally left blank. ACKNOWLEDGMENTS ........................................................................................................ xi  

E-Print Network (OSTI)

the EPA's Emissions & Generation Resource Integrated Database (eGRID) non-baseload sub-regional grid. 17 The EPA's Emissions & Generation Resource Integrated Database (eGRID) provides data on power plant of the purchased electricity (using EPA eGRID regional emissions factors), and (2) an adjusted estimate

Argonne National Laboratory

79

Widget:TargetBlank | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search This widget opens external links in a new browser tab. Parameters include: link - external href link to open in new tab title - link title...

80

Fine-Blanking Tooling and Lubrication  

Science Conference Proceedings (OSTI)

Table 13   Properties of the commonly used tool coatings...thickness, μm Coefficient of friction Maximum usage temperature, °C Corrosion resistance TiN Golden-yellow 24 1??4 0.4 to ~0.6 600 Good TiAlN Black-violet 33 1??4 0.4 to ~0.45 800 Good CrN Chrome white 18 1??4 0.5 to ~0.6 700 Excellent TiCN Blue-gray 36 1??4 0.25 to ~0.4 400 Good Source: Ref 6...

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Electronic Methods Potentially Secure for Sending Blank ...  

Science Conference Proceedings (OSTI)

... discusses how postal mail and four electronic transmission options (telephone ... as cryptography and back up communications lines, depending on ...

2011-08-10T23:59:59.000Z

82

2010 CalNex WHOI RV Atlantis  

E-Print Network (OSTI)

Univ VA PMEL SW ESRL Pump Instrumentation on Main Deck PSD Cloud liquid water path (microwave Basin Emissions, Transport and Transformation · Emissions · Harbor · Ship · Oil refineries · Marine boundary layer structure and dynamics #12;Oakland Oil Refineries San Francisco Bay, Oakland Harbor

83

So Cal Survey 2005 Technical Paper  

E-Print Network (OSTI)

a fuel efficient, low emission, hybrid car, which uses botha fuel efficient, low emission, hybrid car, which uses both

Haselhoff, Kim; Ong, Paul M.

2005-01-01T23:59:59.000Z

84

CalCharge Prepares for Launch  

NLE Websites -- All DOE Office Websites (Extended Search)

is home to more than 95 battery and electrochemical storage (energy storage) companies, ranging from startups to global corporations focused on the technologies and...

85

This page is intentionally blank Table of Contents  

E-Print Network (OSTI)

Neutralization, Transportation, Treatment, 7 and Discharge into the Delaware River Section 1. Review of VX. Review of Transportation 15 Toxicology and Transportation Review 15 Section 3. Review of Treatment) a review of the feasibility of the phosphonate treatment proposal by DuPont and 3) future issues

86

THIS PAGE INTENTIONALLY LEFT BLANK - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Annual Electric Generator Report, asks respondents to ... March 19801982: FERC, Form FPC-5, "Electric Utility Company Monthly Statement." 1983: ...

87

The Memory of My Parents This Page is Blank.  

E-Print Network (OSTI)

is confirmed by a PEMEX (Petroleos Mexicanos) well that encountered over 3000 m of halite in the Minas Viejas

de Weck, Olivier L.

88

Aluminum Tailor-welded Blanks for High Volume Automotive ...  

Science Conference Proceedings (OSTI)

High Strength Aluminum Brazing Sheets for Condenser Fins of Automotive Heat Exchangers High Temperature Creep Characterization of A380 Cast...

89

[Page Intentionally Left Blank] Life Cycle Greenhouse Gas Emissions from  

E-Print Network (OSTI)

is implemented in the plant. Keywords: Energy, Biofuels, Alternative fuels, Diesel, Fisher ­ Tropsch is performed using absorption in ethanolamines and PSA. Once the syngas is prepared the Fischer - Tropsch) technologies based on Fischer-Tropsch synthesis (Wilhelm et al., 2001) Fischer-Tropsch liquids can be refined

Reuter, Martin

90

TRADOC Pam 525-2-1 (This page intentionally blank.)  

E-Print Network (OSTI)

disciplines: All-source intelligence, counterintelligence (CI), human intelligence (HUMINT), geospatial function of the Army. Intelligence operations are the variety of intelligence and counterintelligence tasks intelligence discipline targets. (4) Required Army policies (authorizations and restrictions) will be specified

US Army Corps of Engineers

91

Site Office Safety System Oversight Staffing Plan - Blank  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Site Office Safety System Oversight Staffing Plan" Site Office Safety System Oversight Staffing Plan" "Date" "ACTIVITIES","Days for Activity in each Fiscal Year",,,,,,"Notes" ,"FY09","FY10","FY11","FY12","FY13","FY14" "Program Tasks" "Total Task Days",0,0,0,0,0,0,"Number of days required for activities that need to be completed regardless of number of staff" "Individual Tasks" "Qualification Training" "Continuing Training" "Collateral Duties" "Administrative" "Leave, Holidays" "Total Individual Days",0,0,0,0,0,0,"Number of days required for activities that need to be completed by each individual"

92

THIS PAGE INTENTIONALLY LEFT BLANK - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Report, for plants with generating capacity exceeding 10 megawatts, and FERC, Form FPC-12C, Industrial Electric Generating Capacity, for all other ...

93

Meteorological Model Evaluation for CalNex 2010  

Science Conference Proceedings (OSTI)

The performance of mesoscale meteorological models is evaluated for the coastal zone and Los Angeles area of Southern California, and for the San Joaquin Valley. Several configurations of the Weather Research and Forecasting Model (WRF) with ...

Wayne M. Angevine; Lee Eddington; Kevin Durkee; Chris Fairall; Laura Bianco; Jerome Brioude

2012-12-01T23:59:59.000Z

94

VA-s--- ' At&LYTlCAL DATA SHEET  

Office of Legacy Management (LM)

the fire. b&,, Ro All wore Comfo type respirators and extinguished the fire from oil PH an upwind position. Sample No. Hour Sample Description Be Th (R ( T 1 Q 331 1400 I...

95

Zipcar at Cal Poly Fast, Convenient, Affordable and environmentally friendly.  

E-Print Network (OSTI)

Prius and Scion XB) These Zipcars are located on the south end of the parking lot near the Library bus stop. A-1 Parking Lot ­ (Toyota Prius and Scion XB) These cars are located on the south east end

Sze, Lawrence

96

Summary notation: Atomic Ref. Data Elec. Struct. Cal.  

Science Conference Proceedings (OSTI)

... For example, the fully qualified path name of the data file for neutral uranium treated in the RLDA approximation will be: ...

97

Los Angeles County CalWORKs Transportation Needs Assessment  

E-Print Network (OSTI)

cars. Also, the rate of car ownership and usage increases ascar. Also, the rate of car ownership and usage increases asaccess to a household car, transit usage increases with the

Ong, Paul M.; Houston, Douglas; Horton, John; Shaw, Linda L.

2001-01-01T23:59:59.000Z

98

LEXSTAT CAL. CODE. CIV. PROC. 1085 DEERING'S CALIFORNIA CODES ANNOTATED  

E-Print Network (OSTI)

) and egg or rice noodles. Garnish with chopped green onions. Freezing cabbage is not recommended because

Kammen, Daniel M.

99

CalWORKs: an evaluation of participation reporting tools.  

E-Print Network (OSTI)

??Welfare reform and the subsequent reauthorization made a number of changes to the federalp rogram, emphasized work participationfo r recipients and establisheda minimum state participation (more)

Pitt, Gayle

2010-01-01T23:59:59.000Z

100

Los Angeles County CalWORKs Transportation Needs Assessment  

E-Print Network (OSTI)

Atlanta TANF multi sites AFDC/TANF - multi sites Results1999) Raphael and Rice (1999) Danziger and Corcoran LA AFDCCA AFDC CA AFDC CA AFDC US AFDC/TANF Michigan TANF Role of

Ong, Paul M.; Houston, Douglas; Horton, John; Shaw, Linda L.

2001-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Atomic total energies: Atomic Ref.Data Elec Struc Cal  

Science Conference Proceedings (OSTI)

... These tables contain the atomic total energies and orbital eigenvalues, for the ground electronic configuration of the elements H ... Definition of format ...

102

Atomic total energies: Atomic Ref. Data Elec. Struc. Cal.  

Science Conference Proceedings (OSTI)

... These tables contain the atomic total energies and orbital eigenvalues, for the ground electronic configuration of the elements H ... Definition of format ...

103

CALS AMBASSADORS Normand Adams Applied Economic Management/Environmental Horticulture  

E-Print Network (OSTI)

Arjan Ahluwalia Environmental Science Angie Ameerally Food Science and Technology/Chemistry Le Mar Baliwag Food Science and Technology Romina Benitez Environmental Science Brooke Brown Biochemistry Maritza Castro Animal and Poultry Sciences Katie Elliott Horticulture Olivia Ellis Human Nutrition, Foods

Liskiewicz, Maciej

104

Timelike Killing Fields and Relativistic Statisti-cal Mechanics  

E-Print Network (OSTI)

-time, and this corresponds to a Newtonian gas subject to gravitational, tidal, and in some instances "centrifugal forces gas and compare it, for a class of spacetimes, to its Newtonian analog, derived both independently examples are given in Kerr spacetime. KEY WORDS: Statistical mechanics; Relativistic ideal gas; Killing

Klein, David

105

New Directions in Information Organisation: submission from Alan Poulter Filling in the blanks in RDA or remaining blank? The strange case of FRSAD  

E-Print Network (OSTI)

. This involves coverage of the two preceding reports, the Functional Requirements of Bibliographic Records (FRBR of a critical text. However, the Group 3 entities were only intended as place holders, to indicate a future to cover the full range of potential classes of entities. Having two distinct entities (`subject

Strathclyde, University of

106

Microsoft Word - s05822_LEHR_WorkPlan  

Office of Legacy Management (LM)

Reporting Limits Reporting Limits This page intentionally left blank U.S. Department of Energy LEHR Remedial Design/Remedial Action Work Plan November 2010 Doc. No. S05822-0.0 Page F-1 Table F-1. Reporting Limits for Monitoring Parameters, DOE LEHR Parameter Method Reference Laboratory Reporting Limit MDL Units Aluminum EPA 6020A CalScience Environmental Lab 10.5 50 µg/L Antimony EPA 6020A CalScience Environmental Lab 1 0.38 µg/L Arsenic EPA 6020A CalScience Environmental Lab 1 0.589 µg/L Barium EPA 6020A CalScience Environmental Lab 1 0.105 µg/L Beryllium EPA 6020A CalScience Environmental Lab 1 0.131 µg/L Cadmium EPA 6020A CalScience Environmental Lab 1 0.266 µg/L Chromium, total EPA 6020A CalScience Environmental Lab 1 0.618 µg/L Cobalt EPA 6020A CalScience Environmental Lab 1 0.14 µg/L

107

This page left blank intentionally Student Detox Conveyances Comparison by Year  

E-Print Network (OSTI)

. PHYSICS LIBRARY 4220 Chamberlin Hall 1150 University Avenue, 608­262­9500 physics.library.wisc.edu WENDT LIBRARY 215 N. Randall Avenue, 608­262­3493 wendt.library.wisc.edu This is the primary library for engi

Wisconsin at Madison, University of

108

DHS-NIST-ASTM Robot Test Methods (v2011.1) BLANK ...  

Science Conference Proceedings (OSTI)

... Page 30 Terrains: Sand (P) Terrains ... IDENTIFIER PAN TILT ZOOM (OPT/DIG) COLOR I/RB/W NO YES VAR NO YES VAR FIXED AUTO -TIGHT ...

2013-02-04T23:59:59.000Z

109

Finite Element Study of the Aluminum AA6111T4 Blanking Process ...  

Science Conference Proceedings (OSTI)

Symposium, 2nd World Congress on Integrated Computational Materials Engineering ... The angles are similar for the clearances of 43% and 60% respectively.

110

Senior Vice President Enclosure document8 This page intentionally left blankMacroeconomic Impacts of LNG  

E-Print Network (OSTI)

I am transmitting with this letter a clean copy of NERAs report on the macroeconomic impacts of LNG exports from the United States that was contracted for by the Department of Energy. Sincerely, W. David Montgomery

Www. Nera. Com; Dear Mr. Smith; Robert Baron; Nera Economic Consulting; Ha D. Tuladhar; Nera Economic Consulting

2012-01-01T23:59:59.000Z

111

MCO Customer Handbook PAGE LEFT INTENTIONALLY BLANK TO OUR CUSTOMERS: Acknowledgement MCO Customer Handbook  

E-Print Network (OSTI)

We hope the Mapping Customer Operations (MCO) Customer Assistance Handbook fits your needs as a handy reference tool to obtain the best possible support from DLA. We have made every effort to ensure the information contained is accurate and current; however we appreciate any and all corrections as well as your feedback. The MCO Customer Handbook is also available at our web site www.dscr.dla.mil/rmf. From there, follow the link to Customer Assistance Handbook. We would like to recognize the many contributors and supporters of this handbook, each of whom played an integral role in developing and maintaining this resource. We are grateful and hope their efforts provide you the best insight into the mapping supply chain process. Thank you!

unknown authors

2006-01-01T23:59:59.000Z

112

Simulating the Blanking of Preg Robbers in Gold Ores by Treating ...  

Science Conference Proceedings (OSTI)

Biosorption Characteristics of Pb(II) from Aqueous Solution onto Poplar Cotton Characterization of Aluminum Cathode Sheets Used for Zinc Electrowinning.

113

This page has been left blank. SPOKEN DOCUMENT RETRIEVAL FOR TREC-9 AT CAMBRIDGE UNIVERSITY  

E-Print Network (OSTI)

of the compiler writer searching for good heuristics. Finally, our results show that ESP branch prediction edge 14 Succ. Exit LE -- the edge getting to the successor is a loop exit edge, NLE -- not a loop exit of determining what heuristics to use. In particular, the search for successful heuristics requires a significant

Cambridge, University of

114

Radiological Habits Survey: Hunterston, 2007 This page has been intentionally left blank  

E-Print Network (OSTI)

..................................................................................................23 4.7 Internal exposure..... .................................................................15 Figure 2 The Hunterston terrestrial (outer ring) and direct radiation (inner ring) survey areas AQUATIC RADIATION PATHWAYS ...........................................................................21 4

115

Radiological Habits Survey: Torness, 2006 This page has been intentionally left blank  

E-Print Network (OSTI)

cover 25 5.3 Novel radiation pathways 25 5.4 Internal exposure 25 6. DIRECT RADIATION 27 6.1 Direct.5 Wildfowling 19 4.6 The use of seaweed as a fertiliser 19 4.7 Internal exposure 19 4.8 External exposure 22 4 ratios for use in dose assessments 13 4. AQUATIC RADIATION PATHWAYS 14 4.1 Aquatic survey area 14 4

116

Page intentionally left blank For her love, patience, strength, and support during  

E-Print Network (OSTI)

Netzwerkkomponenten (English Version)," Bundesamt für Energiewirtschaft Forschungsprogramm Elektrizität, 26 November

de Weck, Olivier L.

117

CO_CODE","PLT_CODE","YEAR","MONTH","BLANK1","BOM_DIST","ORIG...  

U.S. Energy Information Administration (EIA) Indexed Site

,5,0,279900,1026,0,0,235.5,,1 052053,2539,92,09,,,,,,02,36,,3,"NG",,5,0,121000,1026,0,0,241.1,,1 052053,2539,92,09,,,,,,02,36,,3,"NG",,5,0,176700,1026,0,0,238.1,,1...

118

CO_CODE","PLT_CODE","YEAR","MONTH","BLANK1","BOM_DIST","ORIG...  

U.S. Energy Information Administration (EIA) Indexed Site

227000,1041,0,0,267.7,,1 050154,1560,90,04,,,,,,05,24,,2,"FO6",,1,1,53000,149092,0.96,0,241.1,,1 050159,1470,90,04,,,,,,01,23,,2,"FO6",,1,0,18503,151289,0.69,0.6,386.9,,1...

119

CO_CODE","PLT_CODE","YEAR","MONTH","BLANK1","BOM_DIST","ORIG...  

U.S. Energy Information Administration (EIA) Indexed Site

7,13466,0.71,8.2,176.98,,1,133 051385,0892,91,03,,,,,,03,17,,3,"NG",,4,0,13467,1020,0,0,241.1,,1 051385,0892,91,03,,10,17,"S",,03,17,,1,"BIT",,1,0,16708,10458,3,11.1,155.63,,1,157...

120

Microsoft Word - FONSI_CalValleySolarRanch_Final For Silver Sig_8-2-11  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FINDING OF NO SIGNIFICANT IMPACT DEPARTMENT OF ENERGY LOAN GUARANTEE TO HIGH PLAINS RANCH II, LLC FOR THE CALIFORNIA VALLEY SOLAR RANCH PROJECT IN SAN LUIS OBISPO COUNTY, CALIFORNIA AGENCY: U.S. Department of Energy, Loan Programs Office ACTION: Finding of No Significant Impact SUMMARY: The U.S. Department of Energy (DOE) conducted an environmental assessment (EA) that analyzed the potential environmental impacts associated with the California Valley Solar Ranch (CVSR) project, a 250-megawatt (MW) gross output commercial solar photovoltaic (PV) power plant project proposed by High Plains Ranch II, LLC (HPR II) in southeastern San Luis Obispo County, California. The CVSR Project would include the construction, operation, maintenance, and

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Towards musical query-by-semantic-description using the CAL500 data set  

Science Conference Proceedings (OSTI)

Query-by-semantic-description (QBSD)is a natural paradigm for retrieving content from large databases of music. A major impediment to the development of good QBSD systems for music information retrieval has been the lack of a cleanly-labeled, publicly-available, ... Keywords: content-based music information retrieval, query-by-semantic-description, supervised multi-class classification

Douglas Turnbull; Luke Barrington; David Torres; Gert Lanckriet

2007-07-01T23:59:59.000Z

122

ESTUDO LABORATORIAL DE MISTURAS DE FOSFOGESSO, SOLO TROPICAL E CAL PARA FINS DE PAVIMENTAO.  

E-Print Network (OSTI)

??O fosfogesso, subproduto da fabricao do cido fosfrico, por ser um resduo que necessita da disponibilidade de grandes reas para ser estocado, tornou-se objeto de (more)

ROSELY COSTA RUFO

2009-01-01T23:59:59.000Z

123

Award Recipient of the ENERGY STAR Challenge for Industry CalPortland...  

NLE Websites -- All DOE Office Websites (Extended Search)

operating efficiencies. Additionally, the railcar fleet was rearranged to include more gravity than pneumatic railcars. Through excellent energy management practices the New...

124

Fume Hoods Standards and Practices Laboratory exhaust ventilation systems designed, constructed, maintained, and used at Cal  

E-Print Network (OSTI)

for capturing discharges from gas chromatographs, pipe nipples or the end of tubing. However, the effectiveness. National Fire Protection Association (NFPA) Handbook 45, Standard on Fire Protection for Laboratories Using

de Lijser, Peter

125

Leading the Way: A Profile in Successfuil Energy Management CalPortlan...  

NLE Websites -- All DOE Office Websites (Extended Search)

assessed its company-wide Energy Value Chain and expanded its program to improve energy management in all aspects of the company's operations and in those of its suppliers...

126

Argonne and CalBattery strike deal for silicon-graphene anode ...  

... which is part of a White House initiative to inspire and accelerate high-growth entrepreneurship. ...

127

The Cal Poly Sustainable Power for Electrical Resources (SuPER...  

NLE Websites -- All DOE Office Websites (Extended Search)

electrical resources (SuPER) project has completed two years of development for a low-cost source of electrical power for the 2 billion people who do not have access. The overall...

128

UNITED STATES DEPARTMEN'rOFTHt" INTERIOR GEOJ1)GlCAL SURVEY  

Office of Legacy Management (LM)

of te5tin and sampling Conditions (01ffecting testing and sampling. Hydraulic tc s t Lng of holt: Dee-II. . . * . . Well history * . * * * . * * * . . . . . . . Page 1 2 3 8 15...

129

CalWORKs Sanction Patterns in Four Counties: A Technical Analysis  

E-Print Network (OSTI)

with Dependent Children (AFDC) cash welfare program withGAIN Sanction of Mandatory AFDC-FG Registrant (OR WTW 1 st052 GAIN Sanction Both AFDC-U Parents (OR WTW 2 nd

Ong, Paul M.; Houston, Douglas

2005-01-01T23:59:59.000Z

130

Implementing CalWORKs Support Services: Child Care in Los Angeles County  

E-Print Network (OSTI)

with Dependent Children (AFDC), an entitlement programexempt care. Using data on AFDC recipients in California, Iaddress this need within the AFDC population. Unfortunately,

Ball Cuthbertson, Brenda

1999-01-01T23:59:59.000Z

131

CalWORKs Sanction Patterns in Four Counties: An Analysis of Administrative Data - Briefing Paper  

E-Print Network (OSTI)

Dependent Chil- dren (AFDC) cash welfare program devolvedspeakers (Table 1). Prior AFDC Receipt: Of those familieswho had received no AFDC benefits between 1993 and 1997, 18%

Ong, Paul M.; Houston, Douglas

2005-01-01T23:59:59.000Z

132

CalWORKS Sanction Policies in Four Counties: An Analysis for Administrative Data  

E-Print Network (OSTI)

Dependent Chil- dren (AFDC) cash welfare program devolvedspeakers (Table 1). Prior AFDC Receipt: Of those familieswho had received no AFDC benefits between 1993 and 1997, 18%

Paul M. Ong and Douglas Houston

2005-01-01T23:59:59.000Z

133

Argonne and CalBattery strike deal for silicon-graphene anode...  

NLE Websites -- All DOE Office Websites (Extended Search)

* February 25, 2013 Tweet EmailPrint LEMONT, Ill. - The U.S. Department of Energy's Argonne National Laboratory, located outside of Chicago, and California Lithium Battery, Inc....

134

AUTOMATIC SYNTHESIS OF TTA PROCESSOR NETWORKS FROM RVC-CAL DATAFLOW PROGRAMS  

E-Print Network (OSTI)

platforms that offer better processing performance, scalability and energy- efficiency. On the software side´en Computer Science and Engineering Laboratory Department of Electrical and Information Engineering FI-90014 has been demonstrated by synthesizing an MPEG-4 Simple Profile video decoder to an FPGA. The decoder

Paris-Sud XI, Université de

135

A major purpose of the Techni-= cal Information Center is to provide  

E-Print Network (OSTI)

of surface material (top 0.5 cm) out to distances of 190 m from SGZ. CJccta and fallout samples were~ cjecta, fallout, and sweep-IJp samples as arc present In the pre-shot, test.i)(-'d.lhc particle si-up data are compared with analyses of samples from the explosion test bed, fallout and e.jecta samples

136

-.. IJNDSAY CHFXtCAL COMFAKY IND'J?ZRIAL HYGIEFE SJRVEY PART1  

Office of Legacy Management (LM)

- Thoron Figure 10 APPENDIX E Job Analysis Sheets -3- i . . SCOPE This is a repcrt of.a survey performed during, the period Septcnber I.6 through 18, 1952 at the Lindsay Chemical...

137

California energy flow in 1978. [Comparison with Cal. , 1977 and US, 1978  

DOE Green Energy (OSTI)

In 1978 California's total energy use was very close to that of 1977. All forms of transportation consumed 40% of all energy used as contrasted to 26% for the nation as a whole for the same year. Compared to 1977, California's use of hydroelectric power increased three-fold as the direct result of the end of the 1976 to 1977 drought. Oil, gas, and electricity usage changed by small measure, +1.6%, -5.8% and +3.6%, respectively. Oil and gas freed by the increased hydroelectric potential was used by other end-use sectors in the state with transportation taking the largest share. Consumption in that sector increased by approximately 11%. A conspicuous change in 1978 was the new mix of crude oil sources. Domestic California production was essentially stable at 19% of the total; foreign imports chiefly from Indonesia fell 50%; interstate shipments chiefly from Alaskan North Slope more than doubled. Natural gas supply sources and uses were similar to those of 1977. Industrial use of natural gas appears to have fallen. There is some indication of fuel switching to fuel oils, relocation of industry to other states and conservation in response to escalated fuel prices. Coal continues to be an insignificant fuel in California. Geothermal contributed less than 2% to total transmitted electricity. The comparable figure for nuclear energy is 4% and for imported power from other states, 20%.

Briggs, C.; Borg, I.Y.

1980-08-01T23:59:59.000Z

138

Award Recipient of the ENERGY STAR Challenge for Industry CalPortland  

NLE Websites -- All DOE Office Websites (Extended Search)

5 th 1999 with three small silos and enough track to hold thirty-two 100 ton cement rail cars. The terminal now has 5 silos and 2 sets of loop track to hold 9600 tons of cement...

139

Page 1 of 2 SafetyNet #143 Cal/OSHA Inspections  

E-Print Network (OSTI)

President for Research v Chemical and Biological Safety Committee v Office of Research Safety Principal:________________________ #2 LOCATION:________________________ Date Inspector (print) Date Inspector (print) January January:________________________ Date Inspector (print) Date Inspector (print) January January February February March March April April

Schladow, S. Geoffrey

140

Microsoft Word - appendix i.doc  

Office of Legacy Management (LM)

I 2009 Program Directives This page intentionally left blank This page intentionally left blank This page intentionally left blank This page intentionally left blank This page...

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

www.netl.doe.gov This page intentionally left blankPrepared by: Research and Development Solutions LLC  

E-Print Network (OSTI)

This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference therein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or any agency thereof. The views and opinions of authors expressed therein do not necessarily state or reflect those of the United States Government

Jared Ciferno; James Murphy

2006-01-01T23:59:59.000Z

142

DOE Office of Environmental Policy and GuidanceThis page intentionally blankBackground and Purpose EXECUTIVE SUMMARY  

E-Print Network (OSTI)

Protection Program (DOE 1990a) and the reporting requirements of DOE Order 231.1, Environment, Safety and Health Reporting (DOE 1996). The purposes of ASERs are to characterize site environmental management performance; including data on effluent releases, environmental monitoring, and estimates of radiological doses to the public; confirm compliance with environmental standards and requirements; and describe significant programs and efforts. ASERs annually demonstrate compliance with the required public protection dose limits and other radiological emissions and monitoring requirements of DOE Order 5400.5, Radiation Protection of the Public and the Environment (DOE 1990b). ASERs also document the potential radiological and nonradiological impacts of DOE operations on the public and environment near each site. The purpose of this Summary Report is to provide a DOE-wide overview of the offsite radiological releases, and doses calculated based on those releases, resulting from operations at DOE sites. This report summarizes the radiological data from the 1990 through 1994 ASERs for 50 DOE sites, including sites from the Formerly Utilized Sites Remedial Action Program (FUSRAP), which were under DOE responsibility during the reporting period covered by this

unknown authors

1990-01-01T23:59:59.000Z

143

404-446-2560 | www.nerc.comThis Page is left Intentionally BlankNERCs Mission  

E-Print Network (OSTI)

The North American Electric Reliability Corporation (NERC) is an international regulatory authority established to evaluate reliability of the bulk power system in North America. NERC develops and enforces Reliability Standards; assesses adequacy annually via a ten?year forecast and winter and summer forecasts; monitors the bulk power system; and educates, trains, and certifies industry personnel. NERC is the electric reliability organization for North America, subject to oversight by the U.S. Federal Energy Regulatory Commission (FERC) and governmental authorities in Canada. 1 NERC assesses and reports on the reliability and adequacy of the North American bulk power system, which is divided into eight Regional areas, as shown on the map and table below. The users, owners, and operators of the bulk power system within these areas account for virtually all the electricity supplied in the U.S., Canada, and a portion of Baja California Norte, Mxico. NERC Regional Entities Note: The highlighted area between SPP RE and SERC denotes overlapping Regional area boundaries. For example, some load serving entities participate in one Region and their associated transmission owner/operators in another. FRCC Florida Reliability

North Tower

2011-01-01T23:59:59.000Z

144

Using gypsUm and Other CalCiUm amendments in sOUthwestern sOils  

E-Print Network (OSTI)

materials, waste products of phosphate fertilizer production (phosphogypsum) or from power plant stack

Sanderson, Mike

145

SpRiNg 2008 COLUMNSChEMiCAL AND BiOMOLECuLAr ENgiNEEriNg  

E-Print Network (OSTI)

Jiao Tong University in China. #12;COLUMNS spring 2008 4 facultyNEWS SENgErS TOurS EurOPE AS iAsses the stAtor. the stAtor slot flow field ContAins An outwArdly direCted disChArge Jet thAt forms when settings, and prepare them to teach. The team has also developed a one-day workshop for new science

Shapiro, Benjamin

146

Time Running Out: A Portrait of California Families Reaching the CalWORKs Time Limit in 2004, Detailed Research Findings  

E-Print Network (OSTI)

reported being sick or disabled, one-third knew that suchnot report being sick or disabled understood this to be theold age, disability, caring for a disabled family member, or

London, Rebecca A.; Mauldon, Jane G.

2006-01-01T23:59:59.000Z

147

Cal/EPA's 20 Years of Environmental Excellence Top accomplishments from its five boards, departments and offices  

E-Print Network (OSTI)

is spurring energy diversity, lower costs and less dependence on foreign oil. · Diesel Exhaust: For more than a decade ARB has steadily ­ and successfully ­ worked to clean up toxic diesel exhaust emissions with the goal of an 85 percent reduction by 2020. A combination of regulations and financial incentives have

148

J La State Med Soc VOL 162 September/October 2010 249 CliniCal Case of the Month  

E-Print Network (OSTI)

and discharged with a prescription for doxycycline for a presumed respiratory tract infection. The patient

149

CalTOX (registered trademark), A multimedia total exposure model spreadsheet user's guide. Version 4.0(Beta)  

E-Print Network (OSTI)

CR-3624, Sandia National Laboratories, Albuquerque, NM.Lawrence Berkeley National Laboratory report LBNL-47254. [for release in late Lawrence Berkeley National Laboratory

McKone, T.E.; Enoch, K.G.

2002-01-01T23:59:59.000Z

150

Implementation of California's Cal-Learn Demonstration Project, A Process Evaluation: Program Operation From July 1996 Through December 1997  

E-Print Network (OSTI)

AFDC..UnitIncludes all persons on an AFDC case for whom cashPaymentsLos Angeles County AFDC Bonus Payment of money to

Cunniff, James; Hirshberg, Diane; Malvin, Janet

1998-01-01T23:59:59.000Z

151

Annual Research, Scholarly and Creative Activities Cal State Fullerton's commitment to academic excellence is reflected in the scholarly  

E-Print Network (OSTI)

. Interestingly, we were just a keystroke away from inserting Saturday labs when we were forecasting enrollment. In addition, our undergraduate teaching load continues to climb rapidly as we train new chemistry Sports facilities. Her replacement is Natalie Potts. Manuel, electrical, mechanical, and technical super

de Lijser, Peter

152

Job-Retention and Advancement Services for CalWORKs Participants: Initial Survey of County Practices - Detailed Research Findings  

E-Print Network (OSTI)

management Participation in education and training Bonuses/incentives Mentoring programsmanagement model, the sites program designs generally fall into one of three categories: advancement through combining education, training, and

Anderson, Jacquelyn; Miller, Jennifer; Bos, Johannes M.

2002-01-01T23:59:59.000Z

153

The Cost Escalation of Rail Projects: Using Previous Experience to Re-Evaluate the CalSpeed Estimates  

E-Print Network (OSTI)

r RA/L ! TRACKWORK RAIL RELOCATION SUBTOTAL CONTINGENCYobtain federal support for rail projects, at the expense ofProjects-. -- - Light Rail Transit Projects" . Wash- :

Leavitt, Dan; Ennis, Sean; McGovern, Pat

1993-01-01T23:59:59.000Z

154

The Cost Escalation of Rail Projects: Using Previous Experience to Re-Evaluate the CalSpeed Estimates  

E-Print Network (OSTI)

Experience Previous Research on Rail Transit Cost Escalation8, 1989. Previous Research on Rail Transit Planning andFrench and Japanese rail systems, our research suggests that

Leavitt, Dan; Ennis, Sean; McGovern, Pat

1993-01-01T23:59:59.000Z

155

Hydropower computerized reconnaissance package version 2. 0. [HYDRO-CAL, PAPER-ECON, and HYDRO-ECON  

DOE Green Energy (OSTI)

The Hydropower Computerized Reconnaissance (HCR) Package is a computerized preliminary engineering and economic study package for small hydroelectric projects which consists of three programs developed at the Idaho National Engineering Laboratory. One engineering program evaluates the flow characteristics of a site and determines the energy generated for various turbine configurations and two economic programs provide two levels of economic studies depending upon the amount of site-specific information available. An Apple II computer is utilized to provide a quick-turnaround capability. The models and methods used in the HCR package are described, and information is provided on program application, sample run sessions, program outputs, and listings of the main programs.

Broadus, C.R.

1981-04-01T23:59:59.000Z

156

Evolution of Water Marketing in California: Formal vs. Informal Property Rights  

E-Print Network (OSTI)

Organization Units: Cal/EPA Agencywide Staff Directory. Organization Units: Cal/EPA Agencywide Staff Directory,

Bickett, Damian Blase

2011-01-01T23:59:59.000Z

157

Appendix A Annual Inspection Checklist, Maps, and Photographs  

Office of Legacy Management (LM)

This page intentionally left blank This page intentionally left blank This page intentionally left blank Annual Site Inspection 2011 Photos B-9 - Depression that was filled in...

158

Ministry of Water, Land and Air Protection Ecosystem Standards and Planning Biodiversity BranchThis page has been intentionally left blank ii Preface Preface  

E-Print Network (OSTI)

British Columbia is recognized globally for its exceptional wildlife, diversity of ecosystems, and rich natural resources. The Ministry of Water, Land and Air Protection (WLAP) works to maintain these valuable natural assets, which lie at the heart of many recreational and economic activities enjoyed by British Columbians in all regions of the province. The Ministry has responsibility for the protection and stewardship of British Columbias environment. To fulfil this responsibility, it develops policy and legislation, regulations, codes of practice, environmental contracts and covenants (legal agreements). It also monitors and reports on selected species and habitats, as well as acquires information on habitat and species health. It sets science- and results-based objectives and standards and provides best practices for activities that affect our environment. Together, clear goals and objectives, meaningful performance measures and science-based tools guide Ministry actions in improving environmental management. Regulatory frameworks allow headquarters and regional staff to

Instream Works

2004-01-01T23:59:59.000Z

159

Site Environmental Report for 2008, Volume II  

E-Print Network (OSTI)

Strawberry Sewer Gross beta Field Blank Hearst Sewer S.I.Date Field Blank Gross beta ENV-44 Field Blank Tritium ENV-Creek (UC) Gross beta Chicken Creek Field Blank N. Fork

Lackner, Regina

2009-01-01T23:59:59.000Z

160

Sexually Transmitted Disease Services in California's Medi-Cal Managed Care: Findings From a Baseline Survey of STD Care Delivery in 2002  

E-Print Network (OSTI)

Cancer Screening (Fecal Occult Blood Test) Past Two Years,Cancer Screening (Fecal Occult Blood Test) Past Two Years,Cancer Screening (Fecal Occult Blood Test) Past Two Years,

Pourat, Nadereh; Nihalani, Jas; Razack, Natasha; Neiman, Romni; al., et

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

LANL's vision is to be the premier na.onal security science laboratory. Building a sustainable global energy future is a cri.cal  

E-Print Network (OSTI)

Stellarator Confinement............................13 00034: Advanced Nuclear Fuel Examination and Testing Applications to Petascale Platforms........111 00016: Development of a Global Advanced Nuclear Fuel Rod Model

162

Site Environmental Report for 2007 Volume II  

E-Print Network (OSTI)

Strawberry Sewer Gross beta FIELD BLANK Hearst Sewer S.I.Creek (UC) Gross beta Chicken Creek FIELD BLANK N. ForkCollection Date ENV-75 FIELD BLANK Gross beta ENV-44 ENV-75

Lackner, Regina E

2008-01-01T23:59:59.000Z

163

Site Environmental Report for 2003, Volume 2  

E-Print Network (OSTI)

Split Blank A-69 Gross beta Field Blank ENV-75 Tritium FieldCreek (UC) Gross beta Chicken Creek Field Blank N. Forkbeta 69-Storm Drain Manhole Chicken Creek East Canyon Field

Pauer, Ron

2004-01-01T23:59:59.000Z

164

This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC5207NA27344 Blank template  

E-Print Network (OSTI)

here Title or division here Date 00, 2008 #12;Humankind challenges NIF-1208-15665.ppt 2Moses, FPA, LIFE, 12/03/08 #12;NIF-1208-15665.ppt Moses, FPA, LIFE, 12/03/08 3 Achieving ignition at the NIF can be a defining moment for the world's energy future #12;NIF-1208-15665.ppt Moses, FPA, LIFE, 12/03/08 4 A variety

165

Appendix B Landfill Inspection Forms and Survey Data  

Office of Legacy Management (LM)

Appendix B Landfill Inspection Forms and Survey Data This page intentionally left blank This page intentionally left blank Original Landfill January 2011 Monthly Inspection -...

166

Process of making electrolyte structure for molten carbonate fuel cells  

DOE Patents (OSTI)

An electrolyte structure is produced by forming matrix material powder into a blank at room temperature and impregnating the resulting matrix blank with molten electrolyte.

Arendt, R.H.; Curran, M.J.

1980-08-05T23:59:59.000Z

167

Process of making electrolyte structure for molten carbonate fuel cells  

DOE Patents (OSTI)

An electrolyte structure is produced by forming matrix material powder into a blank at room temperature and impregnating the resulting matrix blank with molten electrolyte.

Arendt, Ronald H. (Schenectady, NY); Curran, Matthew J. (Schenectady, NY)

1980-01-01T23:59:59.000Z

168

Microsoft Word - RIN 12044476 DVP  

Office of Legacy Management (LM)

Monticello Mill Tailings Site Operable Unit III Post-Record of Decision Monitoring Plan (August 2004). Equipment Blank Assessment Equipment blanks are prepared and analyzed to...

169

Microsoft Word - Reuse Strategy Revision 3.doc  

Office of Legacy Management (LM)

August 2009 LMSS02944 This page intentionally left blank LMSS02944 Office of Legacy Management Real Property Reuse Strategy August 2009 This page intentionally left blank...

170

"Eat more foods that grow on plants and less that are processed in plants."  

E-Print Network (OSTI)

Calorie Fat Less Portion Calorie Fat Baked Chicken Breast 6oz 200 Cal 4gm Deep-Fried Chicken 6 oz 440 Cal 267 Cal 24gm 1% Low-Fat Milk 8oz 95 Cal 2gm Whole Milk 8oz 139 Cal 8gm Plain Non-Fat Yogurt 8oz 126

Hardy, Christopher R.

171

???????????? ??????????? "????????????" ????????? ?????  

E-Print Network (OSTI)

??????????? "????????????" ????????? ????? ???????? ? Facebook vesti.kz/fragment/23455/+ @vestikz" target="_blank" rel="nofollow">???????? ? ??????? ???????? ????????? ???????? mail.ru ???????? ?????? ???????? ? ???? ??????????? ???????...

Anon.

2009-08-25T23:59:59.000Z

172

An Empirical Assessment of the Competitiveness of the New England Electricity Market  

E-Print Network (OSTI)

May - December 99 Cal PJM New England Density ResidualMay - December 1999) Cal NE PJM (p-MC)/p Residual Demand/Demand May - December 00 PJM NE Cal Density Residual Demand/

Bushnell, Jim; Saravia, Celeste

2002-01-01T23:59:59.000Z

173

President's Message May 2012  

E-Print Network (OSTI)

Take a look at Cal AAEMs facebook and twitter page: http://our Cal AAEM Twitter and Facebook pages. However, you dont

Mills, Trevor

2012-01-01T23:59:59.000Z

174

6. Impact of smoke and moisture on shortwave radia7ve hea7ng profile Dynamical and Radia7ve Influences of Smoke Transport on the Southeast Atlan7c Atmospheric Ver7cal Structure  

E-Print Network (OSTI)

Office, United Kingdom Email: aadebiyi@rsmas.miami.edu 1. Introduc7on Seasonal of Miami, Rosens=el School of Marine & Atmospheric Science, Miami, FL; 2UK Met over the southeast Atlan:c ocean, with the peak in aerosol loading occurring

Zuidema, Paquita

175

Southern California Leading EconomicSouthern California Leading EconomicSouthern California Leading EconomicSouthern California Leading Economic IndicatorIndicatorIndicatorIndicator August 2011 Institute for Economic and Environmental Studies (IEES), Cal  

E-Print Network (OSTI)

Southern California Leading EconomicSouthern California Leading EconomicSouthern California Leading EconomicSouthern California Leading Economic IndicatorIndicatorIndicatorIndicator August 2011 © Institute for Economic and Environmental Studies (IEES), California State University Fullerton Adrian R. Fleissig, Ph

de Lijser, Peter

176

Southern California Leading Economic IndicatorSouthern California Leading Economic IndicatorSouthern California Leading Economic IndicatorSouthern California Leading Economic Indicator May 2010 Institute for Economic and Environmental Studies (IEES), Cal  

E-Print Network (OSTI)

Southern California Leading Economic IndicatorSouthern California Leading Economic IndicatorSouthern California Leading Economic IndicatorSouthern California Leading Economic Indicator May 2010 © Institute for Economic and Environmental Studies (IEES), California State University Fullerton Adrian R. Fleissig, Ph

de Lijser, Peter

177

Southern California Leading EconomicSouthern California Leading EconomicSouthern California Leading EconomicSouthern California Leading Economic IndicatorIndicatorIndicatorIndicator August 2012 Institute for Economic and Environmental Studies (IEES), Cal  

E-Print Network (OSTI)

Southern California Leading EconomicSouthern California Leading EconomicSouthern California Leading EconomicSouthern California Leading Economic IndicatorIndicatorIndicatorIndicator August 2012 © Institute for Economic and Environmental Studies (IEES), California State University Fullerton Adrian R. Fleissig, Ph

de Lijser, Peter

178

Rhenium Complexes and Clusters Supported on c-Al2O3: Effects of Rhenium Oxidation State and Rhenium Cluster Size on Catalytic Activity for n-butane Hydrogenolysis  

SciTech Connect

Supported metals prepared from H{sub 3}Re{sub 3}(CO){sub 12} on {gamma}-Al{sub 2}O{sub 3} were treated under conditions that led to various rhenium structures on the support and were tested as catalysts for n-butane conversion in the presence of H{sub 2} in a flow reactor at 533 K and 1 atm. After use, two samples were characterized by X-ray absorption edge positions of approximately 5.6 eV (relative to rhenium metal), indicating that the rhenium was cationic and essentially in the same average oxidation state in each. But the Re-Re coordination numbers found by extended X-ray absorption fine structure spectroscopy (2.2 and 5.1) show that the clusters in the two samples were significantly different in average nuclearity despite their indistinguishable rhenium oxidation states. Spectra of a third sample after catalysis indicate approximately Re{sub 3} clusters, on average, and an edge position of 4.5 eV. Thus, two samples contained clusters approximated as Re{sub 3} (on the basis of the Re-Re coordination number), on average, with different average rhenium oxidation states. The data allow resolution of the effects of rhenium oxidation state and cluster size, both of which affect the catalytic activity; larger clusters and a greater degree of reduction lead to increased activity.

Lobo Lapidus, R.; Gates, B

2009-01-01T23:59:59.000Z

179

Extremal Properties of Bases for Representations of Semisimple Lie Algebras  

Science Conference Proceedings (OSTI)

Let \\cal L be a complex semisimple Lie algebra with specified Chevalley generators. Let V be a finite dimensional representation of \\cal L with weight basis \\cal B. The supporting graph P of \\cal ... Keywords: irreducible representations, semisimple Lie algebras, supporting graphs

Robert G. Donnelly

2003-05-01T23:59:59.000Z

180

Spring 2013 Chair's Message 2  

E-Print Network (OSTI)

multimeter in analog electronics and electri- cal troubleshooting. The Agilent hardware also includes

Hochberg, Michael

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

BY BILL LONDON Building bridges. That summarizes David Lemak's  

E-Print Network (OSTI)

of underutilized dry biomass. Via anaerobic digestion and electri- cal generation of the collected biogas

Collins, Gary S.

182

A Rough Road Leads To The Stars  

NLE Websites -- All DOE Office Websites (Extended Search)

and forged to produce the ALSRC body blank (Figure 4). To allow stock for the handle attachments and other bosses to be machined from the blank, it was necessary to forge the...

183

Site Environmental Report for 2005 Volume I and Volume II  

E-Print Network (OSTI)

Analyte Gross beta Location* Chicken Creek Field Blank S.I.Canyon Field Blank N. Fork Strawberry Creek Gross beta 69-beta Location* Chicken Creek East Canyon S.I. Conventional Field

Ruggieri, Michael

2006-01-01T23:59:59.000Z

184

m271  

National Nuclear Security Administration (NNSA)

M271 Attachment 1 SECTION J APPENDIX C Special Bank Account Agreement Intentionally left blank for Internet posting purposes....

185

ICME Applications: Non-Ferrous  

Science Conference Proceedings (OSTI)

Jul 8, 2013 ... 2nd World Congress on Integrated Computational Materials Engineering: ICME .... The burr size increases with blanking clearances.

186

Director's Update, VCAT, October 2011  

Science Conference Proceedings (OSTI)

... Chairman and CEO Edison International ... Rebecca Blank, Undersecretary for Economic Affairs, is currently the acting Secretary ... Standards policy ...

2012-12-29T23:59:59.000Z

187

Materials Processing Fundamentals  

Science Conference Proceedings (OSTI)

Hydraulic Simulation of Fluid Flow in Beam Blank Continuous Casting Mold with Double Nozzles ... Thermochemical Stability of Blue Ceramic Powders.

188

double-sided arc welding of az31b magnesium alloy sheet  

Science Conference Proceedings (OSTI)

Jul 20, 2012... tailor-welded blanks for forming automotive structural components. ... initial investigations suggest that visually acceptable symmetrical welds...

189

SIM Time and Frequency Working Group  

Science Conference Proceedings (OSTI)

... National Web Clocks (outside SIM). China; Germany; Italy; Japan; Malaysia; Singapore; Taiwan. CMC Related Files. Blank CMC form (Excel File). ...

190

IEEE P1622 Standards Development Strategy  

Science Conference Proceedings (OSTI)

... the NIST Event Management Automation Protocol ... standard for electronic blank ballot distribution). ... interoperability among voting devices in general. ...

2012-03-01T23:59:59.000Z

191

Topological gauge theories from supersymmetric quantum mechanics on spaces of connections  

E-Print Network (OSTI)

We rederive the recently introduced $N=2$ topological gauge theories, representing the Euler characteristic of moduli spaces ${\\cal M}$ of connections, from supersymmetric quantum mechanics on the infinite dimensional spaces ${\\cal A}/{\\cal G}$ of gauge orbits. To that end we discuss variants of ordinary supersymmetric quantum mechanics which have meaningful extensions to infinite-dimensional target spaces and introduce supersymmetric quantum mechanics actions modelling the Riemannian geometry of submersions and embeddings, relevant to the projections ${\\cal A}\\rightarrow {\\cal A}/{\\cal G}$ and inclusions ${\\cal M}\\subset{\\cal A}/{\\cal G}$ respectively. We explain the relation between Donaldson theory and the gauge theory of flat connections in $3d$ and illustrate the general construction by other $2d$ and $4d$ examples.

M Blau; G Thompson

1991-12-20T23:59:59.000Z

192

Environmental Energy Technologies Division News  

NLE Websites -- All DOE Office Websites (Extended Search)

(Berkeley Lab) has worked with CalCEF and other key partners to launch CalCharge-a public-private partnership designed to accelerate the development, commercialization, and...

193

High Speed Trains for California (Volume II: Detailed Segment Descriptions, Cost Estimates, and Travel Time Calculations)  

E-Print Network (OSTI)

~ o~ CalSpeed:Capital Cost Estimates OAKLAND-RICHMOND (SP r/minutes). CalSpeed:Capital Cost Estimates HERCULES-FAIRFIELDCalSpeed:Capital Cost Estimates GRAPEVINE:5.0% ALTERNATIVE

Hall, Peter; Leavitt, Dan; Vaca, Erin

1992-01-01T23:59:59.000Z

194

Oligopoly Equilibria in Electricity Contract Markets  

E-Print Network (OSTI)

Market California New England PJM n b k c Table 2: Two Stagemarket. Cal. 99 New Eng. 99 PJM 99 Cal. 00 New Eng. 99 Price2004) covers only 1999 in PJM. For each hour t, I represent

Bushnell, James

2005-01-01T23:59:59.000Z

195

http://cmb.ornl.gov Center for Molecular Biophysics  

E-Print Network (OSTI)

into ethanol in a fermenta- tion/distillation process, purely chemi- cal routes do not rely on expensive. if the chemi- cal is suitable, it attaches onto the protein and produces a desirable effect in the cell

196

Search For New Physics at BABAR  

E-Print Network (OSTI)

Using a full BABAR data sample of 426 $fb^{-1}$, we present improved measurements of the ratio ${\\cal{R}}(D^{(*)}) = {\\cal{B}} (\\bar{B} \\to D^{(*)}\\tau^{-}\\bar{\

Godang, Romulus

2013-01-01T23:59:59.000Z

197

Estimation of fracture porosity in an unsaturated fractured welded tuff using gas tracer testing  

E-Print Network (OSTI)

are .pres or .pres_cal for pressure data files and .rtdor .rtd_cal for temperature data files. The files withC. Subroutines PRESSUREDATA and RTD are called upon next to

Freifeld, Barry

2001-01-01T23:59:59.000Z

198

Synthesis of quantized feedback control software for discrete time linear hybrid systems  

Science Conference Proceedings (OSTI)

We present an algorithm that given a Discrete Time Linear Hybrid System${\\cal H}$ returns a correct-by-construction software implementation K for a (near time optimal) robust quantized feedback controller for ${\\cal H}$ along with ...

Federico Mari; Igor Melatti; Ivano Salvo; Enrico Tronci

2010-07-01T23:59:59.000Z

199

Standards Activities of Organizations in the United States  

Science Conference Proceedings (OSTI)

... of voluntary national techni- cal standards for advanced television. ... standards issues that are considered by international standards organizations. ...

2011-07-22T23:59:59.000Z

200

Geophys. J. Int. (2012) 189, 143160 doi: 10.1111/j.1365-246X.2012.05378.x GJIGeodynamicsandtectonics  

E-Print Network (OSTI)

Miltenberg first recruited him. Martin enrolled in the Col lege planning to major in politi cal science

Cowie, Patience

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

SHORT REVIEW Genetics, development and evolution of adaptive  

E-Print Network (OSTI)

Miltenberg first recruited him. Martin enrolled in the Col lege planning to major in politi cal science

Hoekstra, Hopi E.

202

A technology that squeezes electromagnetic waves  

E-Print Network (OSTI)

of microscopes, the efficiency of light-emitting diodes (LEDs) and the sensitivity of chemi- cal and biological

Heaton, Thomas H.

203

Please turn over and complete the remainder of the form. Camp Titan of Associated Students, CSUF, Inc. Titan Student Union Room 269  

E-Print Network (OSTI)

_________________ ___ ____________ _________________ ___ ____________ _________________ ___ ____________ _________________ ___ ____________ _________________ ___ ____________ _________________ ___ ____________ Total monthly income from all sources AFDC Number MediCal Number Foster Care Case Number Referral Agency

de Lijser, Peter

204

IF YOU ARE INTERESTED OR NEED MORE INFORMATION  

E-Print Network (OSTI)

(s) of income that your family receives: Welfare (Cal WORKS/AFDC/TANF) Social Security Retirement Veterans

de Lijser, Peter

205

Advanced Integrated Systems Technology Development  

E-Print Network (OSTI)

refrigeration, and fire protection systems. Figure 2.1.2-1: CalSTRS Headquarters, Sacramento, CA (Mechanical design

2013-01-01T23:59:59.000Z

206

CHAOSALLTHEWAYDOWN --PRE-SHOW TO COLLAPSE  

E-Print Network (OSTI)

versions of the Theater of Pattern Formation, for Burning Man 2005 and CalArts CREAIT Festival 2006, were

Crutchfield, Jim

207

The Development Effects of High-Speed Rail Stations and Implications for California  

E-Print Network (OSTI)

CALIFORNIA Rail System The CalSpeed research group at theresearch and development, and Figure California High- Speed Rail

Sands, Brian D.

1993-01-01T23:59:59.000Z

208

Cerenkov's Effect and Neutrino Oscillations in Loop Quantum Gravity  

E-Print Network (OSTI)

Bounds on the scale parameter {\\cal L} arising in loop quantum gravity theory are derived in the framework of Cerenkov's effect and neutrino oscillations. Assuming that {\\cal L} is an universal constant, we infer {\\cal L}> 10^{-18}eV^{-1}, a bound compatible with ones inferred in different physical context.

G. Lambiase

2003-01-16T23:59:59.000Z

209

The Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Challenge Challenge CalPortland is a major building materials and construction solutions provider to the western United States and Canada. In 2003, CalPortland's management team was focused on performing plant expansions and developing its business. In the process, CalPortland discovered that further monitoring of energy performance and utility costs was needed along with increased accountability for energy use. CalPortland's management team sought to improve energy efficiency and incorporate accountability into its energy management approach. Building an Energy Program To begin managing its energy performance, CalPortland enlisted the expertise of a senior engineer to create an effective corporate-wide

210

INL Executable Plan  

NLE Websites -- All DOE Office Websites (Extended Search)

ID-11383 ID-11383 Revision 2 INL FY 2011 Site Sustainability Plan with the FY 2010 Annual Report December 2010 (This Page Intentionally Left Blank) DOE/ID-11383 Revision 2 INL FY 2011 Site Sustainability Plan with the FY 2010 Annual Report December 2010 Prepared for the U.S. Department of Energy DOE Idaho Operations Office (This Page Intentionally Left Blank) (This Page Intentionally Left Blank) (This Page Intentionally Left Blank) (This Page Intentionally Left Blank) INL FY 2011 Site Sustainability Plan with the FY 2010 Annual Report DOE/ID-11383 Revision 2 December 2010 Approved By: ~~~/ Jeffrey~USseau Fa~ 7 Dlte President and General Manager , - Bechtel BWXT Idaho, LLC Advanced Mixed Waste Treatment Project (This Page Intentionally Left Blank)

211

Microsoft Word - S08400_2012_MVP_5yrRev.doc  

Office of Legacy Management (LM)

Fourth Five-Year Review Report Fourth Five-Year Review Report For Monticello Radioactively Contaminated Properties Superfund Site San Juan County Monticello, Utah June 2012 LMS/MNT/S08400 This page intentionally left blank June 18, 2012 This page intentionally left blank This page intentionally left blank U.S. Department of Energy Fourth Five-Year Review Report for MVP June 2012 Doc. No. S08400 Page i Contents Abbreviations ................................................................................................................................. iii Executive Summary .........................................................................................................................v 1.0 Introduction ..........................................................................................................................1

212

Seal for fluid forming tools  

SciTech Connect

An electro-hydraulic forming tool for forming a sheet metal blank in a one-sided die has first and second rigid rings that engage opposite sides of a sheet metal blank. The rigid rings are contained within slots on a die portion and a hydraulic force applicator portion of the forming tool. The seals are either resiliently biased by an elastomeric member or inherently resiliently biased into contact with the blank.

Golovashchenko, Sergey Fedorovich (Beverly Hills, MI); Bonnen, John Joseph Francis (Milford, MI)

2012-03-20T23:59:59.000Z

213

CRITICALITY SAFETY QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Criticality Criticality Safety Qualification Standard Reference Guide APRIL 2011 This page is intentionally blank. Table of Contents i FIGURES ...................................................................................................................................... iii PURPOSE ...................................................................................................................................... 1 SCOPE ........................................................................................................................................... 1 PREFACE ...................................................................................................................................... 1 ACKNOWLEDGEMENTS ......................................................................................................... 2

214

Government Operation  

Science Conference Proceedings (OSTI)

Use Cases from NBD(NIST Big Data) Requirements WG V1.0. http://bigdatawg. nist.gov/home.php. Contents. Blank Template. Government Operation ...

2013-09-07T23:59:59.000Z

215

Microsoft Word - S06584StSoil.doc  

Office of Legacy Management (LM)

Appendix C University of Arizona Letter This page intentionally left blank December 17, 2009 Memo to: Jody Waugh Regarding: Uranium in Former Evaporation Pond Area at Monument...

216

TGDC Applications Working Group  

Science Conference Proceedings (OSTI)

... The draft document we have out now (IEEE P1622 Use Case for Electronic Blank Ballot Distribution) is in the IEEE's boiler plate formatsome of ...

2011-05-12T23:59:59.000Z

217

Microsoft Word - S09273_ProgPlan.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy, Office of Legacy Management Formerly Utilized Sites Remedial Action Program Program Plan January 2013 LMSS09273 This page intentionally left blank LMSS09273 U.S....

218

ANNUAL ACCOMPLISHMENT PLAN UPDATE FOR DISABLED VETERANS  

National Nuclear Security Administration (NNSA)

Affirmative Action Program FY 2011 Annual Report October 2011 U.S. Department of Energy National Nuclear Security Administration 2 This page intentionally left blank FY 2011 NNSA...

219

SECTION J, APPENDIX B - PEP  

National Nuclear Security Administration (NNSA)

SECTION J APPENDIX B PERFORMANCE EVALUATION PLAN Replaced by Mods 002, 016, 020, 029 Intentionally left blank for Internet posting purposes. Section J, Appendix B, Page 1...

220

Contract DE-AC04-94AL85000 Modification M461  

National Nuclear Security Administration (NNSA)

M461 Attachment 1 SECTION J APPENDIX C Special Bank Account Agreement (Updated Mod M271, M461) Intentionally left blank for Internet posting purposes....

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Contract DE-AC04-94AL85000 Modification M497  

National Nuclear Security Administration (NNSA)

97 Attachment 1 SECTION J APPENDIX C Special Bank Account Agreement (Updated Mod M271, M461, M497) Intentionally left blank for Internet posting purposes....

222

Microsoft Word - Vol II.docx  

Office of Legacy Management (LM)

of Energy Revision 7 Final This page intentionally left blank Emergency Contact Legacy Management 24-hour Monitored Security Telephone Number (877) 695-5322 This page...

223

The Rheology of Cementitious Materials  

Science Conference Proceedings (OSTI)

... in this field and for fruitful discussions and comments, in particular, at Sika Technology, Dr. Norman Blank, Dr. Irene Schober, and Dr. Urs Mder; at ...

2005-02-18T23:59:59.000Z

224

FAQs for Survey Forms 914 - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

If there are no operated properties in an area, leave the cell blank for that area. What units should I use to report the production volumes?

225

Thermochemical Stability of Blue Ceramic Powders  

Science Conference Proceedings (OSTI)

Abstract Scope, This paper presents the thermo-chemical stability of diverse ... Hydraulic Simulation of Fluid Flow in Beam Blank Continuous Casting Mold with

226

Microsoft Word - NO1113_Dewatering report.doc  

Office of Legacy Management (LM)

Hydrologic Assessment of Dewatering for Installation of the Belcher Road Water Transmission Line This page intentionally left blank U.S. Department of Energy Dewatering Evaluation...

227

Microsoft Word - Vol II_ATT B_PCCIP_081009.doc  

Office of Legacy Management (LM)

Plan This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-4.0-Final Attachment...

228

Microsoft Word - Vol II_Att C.doc  

Office of Legacy Management (LM)

Plan This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-4.0-Final Attachment...

229

Microsoft Word - Vol II_Att E.doc  

Office of Legacy Management (LM)

Plan This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-4.0-Final Attachment...

230

Microsoft Word - 11063890 DVP  

Office of Legacy Management (LM)

Water Sampling at the Riverton, Wyoming, Processing Site September 2011 LMSRVTS00611 This page intentionally left blank U.S. Department of Energy DVP-June 2011, Riverton,...

231

Microsoft Word - 13045222 DVP 26-aug-13.docx  

Office of Legacy Management (LM)

and June 2013 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing Site July 2013 LMSGUPS00713 This page intentionally left blank U.S. Department of...

232

Microsoft Word - S07503_NaturitaGWSW  

Office of Legacy Management (LM)

Groundwater and Surface Water Monitoring Evaluation Report for the Naturita, Colorado, Processing Site April 2011 LMSNAPS07503 This page intentionally left blank LMSNAPS07503...

233

Microsoft Word - 10083304 10093365 DVP  

Office of Legacy Management (LM)

and September 2010 Groundwater and Surface Water Sampling at the Slick Rock, Colorado, Processing Sites January 2011 LMSSRKS00810 This page intentionally left blank U.S....

234

Appendix C  

Science Conference Proceedings (OSTI)

... THIS PAGE INTENTIONALLY LEFT BLANK ... the length of a side of an acre of ground. ... custom, 42 gallons comprise a barrel of crude oil or petroleum ...

2012-11-15T23:59:59.000Z

235

DOE specification: Flooded-type lead-acid storage batteries  

DOE Green Energy (OSTI)

This document contains a ``fill-in-the-blanks`` guide specification for procurement of flooded-type lead-acid storage batteries, for uninterruptible power supply applications.

NONE

1996-08-01T23:59:59.000Z

236

NIST.gov - Computer Security Division - Computer Security ...  

Science Conference Proceedings (OSTI)

... link to document, the document will open in a blank browser window and this ... USB Flash Drive Security - (Office of Government Ethics), 05/04/06. ...

237

Microsoft Word - S04516_2008 GW Rpt.doc  

Office of Legacy Management (LM)

Appendix G OU III Groundwater Model-Predicted Uranium Concentrations This page intentionally left blank Page G-1 Table G-1. Uranium Concentration Variation: Background Locations...

238

General User Information  

NLE Websites -- All DOE Office Websites (Extended Search)

Instructions Instructions for using the online proposal system, with tips and troubleshooting advice. Blank Proposal Forms Two samples, one for macromolecular crystallography...

239

Microsoft Word - S06596_GW.doc  

Office of Legacy Management (LM)

Appendix I 2010 Program Directives This page intentionally left blank Page I-1 Page I-2 Page I-3 Page I-4...

240

Form WAMRF-008  

Science Conference Proceedings (OSTI)

... entry fields are blank when opened, preventing loss of old ... 49, Files on network drives cannot be ... 10, Power Source: Power Source Reference Level ...

2013-08-08T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

2008 Geothermal Technologies Market Report  

NLE Websites -- All DOE Office Websites (Extended Search)

JULY 2009 2008 GEOTHERMAL TECHNOLOGIES MARKET REPORT Energy Efficiency & Renewable Energy (This page intentionally left blank) TOC Table of Contents Executive Summary . . . . . . ....

242

Cost and Performance Baseline for Fossil Energy Plants; Volume...  

NLE Websites -- All DOE Office Websites (Extended Search)

This page intentionally left blank NETL Viewpoint Background The goal of Fossil Energy Research, Development, and Demonstration (RD&D) is to ensure the availability...

243

IRP Budget Spreadsheet | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

IRP Budget Spreadsheet IRP Budget Spreadsheet Blank budget spreadsheet for the Intergrated Research Project. IRPBudgetspreadsheet021711.xls More Documents & Publications IRC...

244

Download Notes  

Science Conference Proceedings (OSTI)

... New pixel statistics printout - tab delimited for export ... Widgets -> K Ratio -> Load from .fini file' Lower left 'Info' button ... Edit -> Blank Image' - right size if ...

245

Overview  

Science Conference Proceedings (OSTI)

Overview. A, B, C. 1, Validation, Tab, Note. 2, Codes and other facets must have definitions. FacetBlankDefs, Fixed and added ...

2013-07-08T23:59:59.000Z

246

Laser Lithography: Heidelberg DWL-66FS  

Science Conference Proceedings (OSTI)

... High resolution pattern generator for low volume mask ... photomask blanks as well as direct patterning of ... gov Address: 100 Bureau Drive, Stop 6201 ...

2013-04-20T23:59:59.000Z

247

NanoFab Tool: Heidelberg DWL-66FS  

Science Conference Proceedings (OSTI)

... High resolution pattern generator for low volume mask ... photomask blanks as well as direct patterning of ... US1 Address: 100 Bureau Drive, Stop 6201 ...

2013-05-12T23:59:59.000Z

249

Upgraded Software Makes ID Verification Testing Easier  

Science Conference Proceedings (OSTI)

... The test data objects produced by the PIV Data Generator conform to ... onto blank PIV cards to create customized cards for testing the conformance ...

2013-07-08T23:59:59.000Z

250

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

box. The "Existing April 2010 Report Information" box will be blank. * Check the "Terms and Conditions" box and enter your FRPIN. * Click "Update Link." Further guidance on...

251

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The "Existing (previous quarter) Report Information" box will be blank. * Check the "Terms and Conditions" box and enter your FRPIN. * Click "Update Link." Further guidance on...

252

Manual  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

intentionally left blank. ii | Independent Oversight Effective procurement programs are essential elements of nuclear safety programs at U. S. Department of Energy (DOE) nuclear...

253

untitled  

Office of Legacy Management (LM)

2 Delineation Point Photos This page intentionally left blank U.S. Department of Energy Fernald Preserve, Ohio, Wetland Mitigation Monitoring Report Appendix B-2, Delineation Point...

254

Microsoft Word - S00404_CAN LTSP.doc  

Office of Legacy Management (LM)

Surveillance Plan for the U.S. Department of Energy Canonsburg Uranium Mill Tailings Disposal Site Canonsburg, Pennsylvania LMSCANS00404-0.0 This page intentionally left blank...

255

Office  

NLE Websites -- All DOE Office Websites (Extended Search)

Fossil Energy Project Portfolio Hydrogen Turbine Program 2013 U.S. DEPARTMENT OF ENERGY HYDROGEN TURBINE PROGRAM | 2013 PROJECT PORTFOLIO 2 THIS PAGE INTENTIONALLY LEFT BLANK...

256

Microsoft Word - S04328_ISMS  

Office of Legacy Management (LM)

PRINTED This page intentionally left blank UNCONTROLLED IF PRINTED LMSPOLS04328-1.2 Legacy Management Support Contractor Integrated Safety Management System Description with...

257

Microsoft Word - U0192600_January 2004.doc  

Office of Legacy Management (LM)

This page intentionally left blank Document Number U0192600 Contents DOEOffice of Legacy Management Tuba City Semi-Annual Performance Evaluation January 2004 Page iii Contents...

258

Microsoft Word - 08101897 DVP.doc  

Office of Legacy Management (LM)

blank Page 55 Control Number NA DATE: December 8, 2008 TO: Dick Johnson FROM: Jeff Price SUBJECT: Trip Report Site: Bluewater, New Mexico Dates of Sampling Event: November...

259

Microsoft Word - 09102641_DVP.doc  

Office of Legacy Management (LM)

blank Page 73 Control Number NA DATE: November 13, 2009 TO: Dick Johnson FROM: Jeff Price SUBJECT: Trip Report Site: Bluewater, New Mexico Dates of Sampling Event: November...

260

Microsoft Word - RIN 07040836 DocProd.doc  

Office of Legacy Management (LM)

page intentionally left blank page intentionally left blank U.S. Department of Energy DVPMay 2007, Gunnison, Colorado, Processing Site August 2007 RIN 07040836 Page iii Contents Sampling Event Summary ...............................................................................................................1 Gunnison, Colorado, Processing Site Sample Location Map ..........................................................3

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Microsoft Word - FY13TYSP- KCP Document w comments incorporated with CIF section -2012 07 09 Draft.doc  

National Nuclear Security Administration (NNSA)

- - - This page intentionally blank. - - - FY 2013 - FY 2037 Kansas City Plant Twenty Five Year Site Plan Prepared by Honeywell Federal Manufacturing & Technologies July, 2012 _______________________________________ Mark L. Holecek Manager National Nuclear Security Administration Kansas City Site Office _______________________________________ Christopher C. Gentile President Honeywell Federal Manufacturing & Technologies - - - This page intentionally blank. - - - Table of Contents Section Page - 5 - POINTS OF CONTACT ............................................................................................................................................. 7 PREFACE .................................................................................................................................................................... 9

262

NPS-PH-07-001 POSTGRADUATE  

E-Print Network (OSTI)

-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response of Research #12;THIS PAGE INTENTIONALLY LEFT BLANK #12;i REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704, Paperwork Reduction Project (0704-0188) Washington DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE

263

NAVAL POSTGRADUATE SCHOOL Monterey, California  

E-Print Network (OSTI)

PAGE INTENTIONALLY LEFT BLANK #12;i REPORT DOCUMENTATION PAGE Form Approved OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including, Paperwork Reduction Project (0704-0188) Washington DC 20503. 1. AGENCY USE ONLY (Leave blank) 2. REPORT DATE

264

DRAFT 11/09/2010 PLEASE DO NOT CITE OR QUOTE Indoor Air Quality (IAQ)  

E-Print Network (OSTI)

://www.epa.gov/iaq/pubs/ozonegen.html This cell is intentionally blank. Identify evidence of mice, squirrels and other rodents; termites are replaced, add a heat trap to the hot water line of new set-up. ·· If replacing combustion equipment as part CPSC Document #466 This cell is intentionally blank. VENTED APPLIANCES (continued) UNVENTED APPLIANCES

265

Microsoft Word - N01747_Bldg 100 SAR.doc  

Office of Legacy Management (LM)

Building 100 Area Site Assessment Report August 2012 LMS/PIN/N01747 This page intentionally left blank LMS/PIN/N01747 Pinellas County, Florida, Site Building 100 Area Site Assessment Report August 2012 This page intentionally left blank U.S. Department of Energy Building 100 Area Site Assessment Report August 2012 Doc. No. N01747 Page i Contents Abbreviations ................................................................................................................................. iii

266

11 CMS Exec Sum_update_1221.indd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

he 2011 Criti cal Materials Strategy examines the role he 2011 Criti cal Materials Strategy examines the role of rare earth metals and other materials in the clean energy economy. It is an update of the 2010 Criti cal Materials Strategy, which highlighted the importance of certain criti cal materials to wind turbines, electric vehicles, photovoltaic thin fi lms and energy-effi cient lighti ng. The 2011 Criti cal Materials Strategy includes updated criti cality assessments, market analyses and technology analyses to identi fy criti cal materials challenges. It was prepared by the U.S. Department of Energy (DOE) based on data collected and research performed during 2011. The report's main highlights are the following: * Several clean energy technologies-including wind turbines, electric vehicles, photovoltaic thin fi

267

Method for forming a liquid cooled airfoil for a gas turbine  

SciTech Connect

A method for forming a liquid cooled airfoil for a gas turbine is disclosed. A plurality of holes are formed at spaced locations in an oversized airfoil blank. A pre-formed composite liquid coolant tube is bonded into each of the holes. The composite tube includes an inner member formed of an anti-corrosive material and an outer member formed of a material exhibiting a high degree of thermal conductivity. After the coolant tubes have been bonded to the airfoil blank, the airfoil blank is machined to a desired shape, such that a portion of the outer member of each of the composite tubes is contiguous with the outer surface of the machined airfoil blank. Finally, an external skin is bonded to the exposed outer surface of both the machined airfoil blank and the composite tubes.

Grondahl, Clayton M. (Clifton Park, NY); Willmott, Leo C. (Ballston Spa, NY); Muth, Myron C. (Amsterdam, NY)

1981-01-01T23:59:59.000Z

268

International Energy Statistics - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Annual Monthly/Quarterly. Consumption | Annual Monthly/Quarterly. ... Crude Oil Distillation Capacity (Thousand Barrels Per Cal Day) Loading ... Units Conversion ...

269

Amino acid biosignatures : implications for the detection of extinct or extant microbial communities on Mars  

E-Print Network (OSTI)

Space Agency gas chromatography mass spectrometry gamma-amino-n-butyric acid water hydrochloric acid isobutylamine isopropylamine NASA/CalTech Jet Propulsion

Aubrey, Andrew D.

2008-01-01T23:59:59.000Z

270

Amino Acid Biosignatures - Implications for the Detection of Extinct or Extant Microbial Communities on Mars  

E-Print Network (OSTI)

Space Agency gas chromatography mass spectrometry gamma-amino-n-butyric acid water hydrochloric acid isobutylamine isopropylamine NASA/CalTech Jet Propulsion

Aubrey, Andrew D

2008-01-01T23:59:59.000Z

271

Extended nuclear plant outages raise Southern California ...  

U.S. Energy Information Administration (EIA)

Although SoCal Citygate spot natural gas prices have increased slightly ... higher wholesale power prices in Southern California more likely are attributable to ...

272

NICE 2013 Workshop DRAFT Agenda - September 17-19 ...  

Science Conference Proceedings (OSTI)

... Dr. Dan Manson (CalPolyPomona) TRK2 B: The Open Cyber Challenge Platform Dr. Victor Fay-Wolfe (URI) TRK3 Cyber Intelligence Workforce ...

2013-07-31T23:59:59.000Z

273

NICE 2013 Workshop Agenda  

Science Conference Proceedings (OSTI)

... Dr. Dan Manson (CalPolyPomona) TRK2 B: The Open Cyber Challenge Platform Dr. Victor Fay-Wolfe (URI) TRK3 Cyber Intelligence Workforce ...

2013-08-09T23:59:59.000Z

274

Butllet de la Societat Catalana de Matemtiques Vol. 15, nm. 2, 2000. Pg. 716  

E-Print Network (OSTI)

deformacions del que estic fent. Al vespre, me'n vaig a casa amb la meva família, sopo, faig el que cal fer per

Aguadé, Jaume

275

Mechanisms of Nickel Sorption on Pyrophyllite: Macroscopic and Microscopic Approaches  

E-Print Network (OSTI)

and illite, shows little deviation from the ideal chemi- cal formula [Al2Si4Oio(OH)2] of 2:1 clay minerals

Sparks, Donald L.

276

A measurement of the branching fraction B(tau$^{+}$ --> h$^{-}$ $\\pi$sup(0) $\  

E-Print Network (OSTI)

Using data from the CLEO II detector at CESR, we measure {\\cal B}(\\tau^\\pm\\rightarrow h^\\pm\\pi^0\

Artuso, M; He, D; Horwitz, N; Kennett, R; Mountain, R; Moneti, G C; Muheim, F; Mukhin, Y; Playfer, S; Rozen, Y; Stone, S; Thulasidas, M; Vasseur, G; Xing, X; Zhu, G; Bartelt, J; Csorna, S E; Egyed, Z; Jain, V; Kinoshita, K; Barish, B; Chadha, M; Chan, S; Cowen, D F; Eigen, G; Miller, J S; O'Grady, C; Urheim, J; Weinstein, A J; Acosta, D; Athanas, M; Masek, G; Paar, H P; Sivertz, M; Gronberg, J; Kutschke, R; Menary, S; Morrison, R J; Nakanishi, S; Nelson, H N; Nelson, T K; Qiao, C; Richman, J D; Ryd, A; Tajima, H; Sperka, D; Witherell, M S; Procario, M; Balest, R; Cho, K; Daoudi, M; Ford, W T; Johnson, D R; Lingel, K; Lohner, M; Rankin, P; Smith, J G; Alexander, J P; Bebek, C; Berkelman, K; Bloom, K; Browder, T E; Cassel, D G; Cho, H A; Coffman, D M; Crowcroft, D S; Drell, P S; Ehrlich, R; Gaidarev, P; Galik, R S; Garca-Sciveres, M; Geiser, B; Gittelman, B; Gray, S W; Hartill, D L; Heltsley, B K; Jones, C D; Jones, S L; Kandaswamy, J; Katayama, N; Kim, P C; Kreinick, D L; Ludwig, G S; Masui, J; Mevissen, J; Mistry, N B; Ng, C R; Nordberg, E; Patterson, J R; Peterson, D; Riley, D; Salman, S; Sapper, M; Wrthwein, F; Avery, P; Freyberger, A; Rodrguez, J; Stephens, R; Yang, S; Yelton, J; Cinabro, D; Henderson, S; Liu, T; Saulnier, M; Wilson, R; Yamamoto, H; Bergfeld, T; Eisenstein, B I; Gollin, G; Ong, B; Palmer, M; Selen, M; Thaler, J J; Edwards, K W; Ogg, M; Spaan, B; Bellerive, A; Britton, D I; Hyatt, E R F; MacFarlane, D B; Patel, P M; Sadoff, A J; Ammar, R; Ball, S; Baringer, P; Bean, A; Besson, D; Coppage, D; Copty, N; Davis, R; Hancock, N; Kelly, M; Kotov, S; Kravchenko, I; Kwak, N; Lam, H; Kubota, Y; Lattery, M; Momayezi, M; Nelson, J K; Patton, S; Perticone, D; Poling, R; Savinov, V; Schrenk, S; Wang, R; Alam, M S; Kim, I J; Nemati, B; O'Neill, J J; Severini, H; Sun, C R; Zoeller, M M; Crawford, G; Daubenmier, C M; Fulton, R; Fujino, D; Gan, K K; Honscheid, K; Kagan, H; Kass, R; Lee, J; Malchow, R; Skovpen, Y; Sung, M; White, C; Butler, F; Fu, X; Kalbfleisch, G; Ross, W R; Skubic, P L; Wood, M; Fast, J; McIlwain, R L; Miao, T; Miller, D H; Modesitt, M; Payne, D; Shibata, E I; Shipsey, I P J; Wang, P N; Battle, M; Ernst, J; Gibbons, L; Kwon, Y; Roberts, S; Thorndike, E H; Wang, C H; Dominick, J; Lambrecht, M; Sanghera, S; Shelkov, V; Skwarnicki, T; Stroynowski, R; Volobuev, I P; Wei, G; Zadorozhny, P

1994-01-01T23:59:59.000Z

277

The Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

in all aspects of the company's operations and in those of its suppliers and customers. To encourage others to learn the benefits of energy efficiency, CalPortland...

278

Conditions on Electric Power Generation  

NLE Websites -- All DOE Office Websites (Extended Search)

and California (CAL). We pay special attention to interdependencies among hydropower and thermal power plant operations because hydropower plants may provide up to 40% of the WECC...

279

Environmental Energy Technologies Division News  

NLE Websites -- All DOE Office Websites (Extended Search)

Through Improved User Interfaces 3 Berkeley Lab Helps the City of Oakland Meet Energy Costs 4 Thermal Distribution Systems in Large Commercial Buildings 5 Cal-Arch: A...

280

ANA?LISIS BIOLO?GICO PESQUERO DE LA PESQUERI?A CON RED AGALLERA DE DERIVA EN LA PENI?NSULA DE BAJA CALIFORNIA DURANTE EL PERIODO 1999-2008  

E-Print Network (OSTI)

finfish, Pacific sardine, Pacific herring, Pacific mackerel,hagfish, Pacificc herring, and recreational. CalCOFI Rep. ,kelp, Pacific sardine, Pacific herring, Pacific mackerel,

Olvera, Miguel A. E.

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Role of Chemistry in 718-Type Alloys Allvac718Plus Alloy ...  

Science Conference Proceedings (OSTI)

Keywords: 718, 718Plus, Chemistry, MeChaniCal Properties, Thermal StaBility, Waspaloy. Abstract. The role of important alloying elements in 718Ytype alloys (...

282

MSID Publications  

Science Conference Proceedings (OSTI)

... CAD/CAM, CAE, CAE systems, CALS, CAM, CAM-I, case histories, case-based design, Certification, CGI, cgi.tcl, characterization metrology, CIM ...

283

VOLUME 2, ISSUE 10 - NETL-RUA November enews.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

role as CAL, Dr. Yoon represents Virginia Tech, serving as a liaison to industry partner URS and the NETL Focus Area Leads (FALs). His responsibilities include helping to...

284

Opportunities for Open Automated Demand Response in Wastewater Treatment Facilities in California - Phase II Report. San Luis Rey Wastewater Treatment Plant Case Study  

E-Print Network (OSTI)

2007). A byproduct of anaerobic digestion is biogas whichthe byproduct of the anaerobic digestion of solids removedgas produced from anaerobic digestion at no cost. CalPower,

Thompson, Lisa

2010-01-01T23:59:59.000Z

285

Characterization of an Apically Derived Epithelial Membrane Glycoprotein from Bovine Milk, Which Is  

E-Print Network (OSTI)

~ ............ RR--MQND~FU~D Cal RRL~TNSERYI N V N R R G ~ Dro ---QER .................. QNNWQK 811 825 826 840 Sar

Mather, Ian

286

blue pages confidential University of Waterloo  

E-Print Network (OSTI)

66 74 Chemlcal 158 125 133 127 131 133 Civil 91 97 122 101 103 101 Electr~cal 119 205 215 205 214 210

Waterloo, University of

287

LINE CONDUCTED DISTURBANCES ORIGINS AND ...  

Science Conference Proceedings (OSTI)

... 1980. pp. 351-367. Greenwood. A.. Electr~cal Transients in Power Systems, Wiley Inter- sclence. New York. London. 1971. ...

2013-05-17T23:59:59.000Z

288

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

289

ARM - Field Campaign - Aerosol IOP  

NLE Websites -- All DOE Office Websites (Extended Search)

was also deployed and worked well. New surface and airborne instruments (Cal Tech and DRI) to measure Cloud Condensation Nuclei were also deployed. Several times during the IOP,...

290

Restoring Sight to the Blind - Industrial Partnerships Office  

CalTech California Institute of Technology. The artificial retina can function for years inside the harsh biological environment of the eye.

291

1663_Issue19indd.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

capable of analyzing and transmitting sensor data, to an energy harvesting element on a wind turbine blade. Mechani- cal energy from the natural vibration of the blade is...

292

Regions for Select Spot Prices  

U.S. Energy Information Administration (EIA)

Houston: Houston Ship Channel: Houston Zone (SNL index) Southwest: El Paso San Juan: Palo Verde (SNL index) Southern California (CA) SoCal Border: SP-15 (CAISO)

293

1 Introduction  

E-Print Network (OSTI)

cal/bilevel structures, stochastic programming with applications to electricity spot market. 1Department of Mathematics, Wayne State University, Detroit, MI 48202...

294

View / Download - TMS  

Science Conference Proceedings (OSTI)

Mar 11, 2012 ... ments in engineering and technologi- cal sciences as well as . . . remarkable contributions to China's engineering and technology development...

295

February 13, 2012 Dear Parent and Guardian,  

E-Print Network (OSTI)

to attend camp must be from a low-income family, a foster child, an AFDC child, or receiving Medi-Cal. 3

de Lijser, Peter

296

The Relationship Between Pharmaceutical Companies and Physicians  

E-Print Network (OSTI)

10.Pharmaceutical Companies Gifts to Doctors Scrutinized byand require that the companies publicly disclose payments toelusive pharmaceuti- cal companies. Perhaps, in the end, it

Aggarwal, Khushbu

2010-01-01T23:59:59.000Z

297

Diagnosing Unilateral Market Power in Electricity Reserves Market  

E-Print Network (OSTI)

Cal- ifornia Power Exchange Energy Markets: Prepared for theCalifornias Wholesale Energy Market, 2001, Department ofpower in the states energy markets (Hildebrandt [2001];

Knittel, Christopher R; Metaxoglou, Konstantinos

2008-01-01T23:59:59.000Z

298

Browse wiki | Open Energy Information  

Open Energy Info (EERE)

Company + , US-based fund manager to CalCEF clean energy funds focusing on the clean energy and related technologies market. + , San Francisco + , California + Place San...

299

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

cal-exclusion-determination Download Reimbursements to Licensees of Active Uranium and Thorium Processing Sites, Fiscal Year 2009 and 2010 Status Report Reimbursements to Licensees...

300

Measurements of Charged Current Lepton Universality and $|V_{us}|$ using Tau Lepton Decays to $e^- \\bar{\  

E-Print Network (OSTI)

Using 467 $fb^{-1}$ of $e^+e^-$ annihilation data collected with the BaBar detector, we measure $\\frac{{\\cal{B}}(\\tau^- \\to \\mu^- \\bar{\

Aubert, B

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

How Green is Your Property Portfolio? The Environmental Performance of Commercial Real Estate  

E-Print Network (OSTI)

procurement policies. TIAA-CREF has developed similarinvestors, such as CalPERS and TIAA-CREF in the U.S. , Hesta

Kok, Nils; Bauer, Rob; Eichholtz, Piet; Quigley, John M.

2010-01-01T23:59:59.000Z

302

ARE Update Volume 10, Number 3  

E-Print Network (OSTI)

Price Differentials Constant SoCal-border Opal Malin-Chicago Citygate4. Chicago Citygate 5. Henry Hub tial price equilibrium.

Uria, Rocio; Williams, Jeffrey; Hardesty, Shermain; Nataraj, Shanthi

2007-01-01T23:59:59.000Z

303

View / Download  

Science Conference Proceedings (OSTI)

sor of Materials and Metallurgi- cal Engineering at South Dakota. School of Mines and Technology. He will guide the professional activities of TMS concerned...

304

Carbon Capital: The Political Ecology of Carbon Forestry and Development in Chiapas, Mexico  

E-Print Network (OSTI)

and Teaching of Economics, Mexico. AMBIO. 2008. Scolel Teeds. X. Solano & A. Cal. Mexico City: Camara de Diputadosmodern Chiapas. Univ of New Mexico Pr. Birchfield, V. (1999)

Osborne, Tracey Muttoo

2010-01-01T23:59:59.000Z

305

Biomass from Cyanobacteria:Opportunities for the Proposed Algae Biotechnology and Biofuels  

E-Print Network (OSTI)

Using CO2 & Algae to Treat Wastewater and Produce Biofuel Feedstock Tryg Lundquist Cal Poly State ­ Biofuel feedstock · CO2 addition may: ­ Improve nutrient uptake ­ Accelerate treatment ­ Decrease algae of the Industry and Growth · Algae's Role in WW Treatment · CO2's New Role · Research at Cal Poly · Future Work

Tullos, Desiree

306

A multimodal virtual anatomy e-learning tool for medical education  

Science Conference Proceedings (OSTI)

Computer-aided learning (CAL) has great potential in facilitating learning. In medical education, several approaches using CAL have been used. In this paper, we present a novel software platform which we designed to provide a virtual learning environment ... Keywords: 3D graphics, direct volume rendering, medical educationd, virtual learning environment

Jianfeng Lu; Li Li; Goh Poh Sun

2010-08-01T23:59:59.000Z

307

Branching laws for polynomial endomorphisms in CAR algebra for fermions, uniformly hyperfinite algebras and Cuntz algebras  

E-Print Network (OSTI)

Previously, we have shown that the CAR algebra for fermions is embedded in the Cuntz algebra ${\\cal O}_{2}$ in such a way that the generators are expressed in terms of polynomials in the canonical generators of the latter, and it coincides with the U(1)-fixed point subalgebra ${\\cal A}\\equiv {\\cal O}_{2}^{U(1)}$ of ${\\cal O}_{2}$ for the canonical gauge action. Based on this embedding formula, some properties of ${\\cal A}$ are studied in detail by restricting those of ${\\cal O}_{2}$. Various endomorphisms of ${\\cal O}_{2}$, which are defined by polynomials in the canonical generators, are explicitly constructed, and transcribed into those of ${\\cal A}$. Especially, we investigate branching laws for a certain family of such endomorphisms with respect to four important representations, i.e., the Fock representation, the infinite wedge representation and their duals. These endomorphisms are completely classified by their branching laws. As an application, we show that the reinterpretation of the Fock vacuum as the Dirac vacuum is described in representation theory through a mixture of fermions.

Mitsuo Abe; Katsunori Kawamura

2006-06-20T23:59:59.000Z

308

PERGAMON Carbon 38 (2000) 17671774 High temperature hydrogen sulfide adsorption on activated  

E-Print Network (OSTI)

.e. an activation energy is required for chemi- cal adsorption to occur and once that energy is supplied and gas-phase regeneration experiments were [1] Cal MP, Strickler BW, Lizzio AA. High temperature hydro, PA: US Department of Energy/Federal removal requirement set at one of the DOE's IGCC plants. Energy

Cal, Mark P.

309

Appendix G Supporting Documentation  

Office of Legacy Management (LM)

Supporting Documentation Supporting Documentation for Focused Feasibility Study This page intentionally left blank Contents Section Ground Water Models for Alternatives 3 and 4 ........................................................................ G .O Human Health Risk Assessment Calculations ........................................................................... G2.0 Cost Analysis ........................................................................................................................... G3.0 This page intentionally left blank Section G1.0 Ground Water Models for Alternatives 3 and 4 This page intentionally left blank D o c o l ~ ~ e n t Nurt~her Q0029500 Appendix G MMTS OU 111 Feasibility Study Ground Water Modeling for Alternative 3: PRB Treatment Objective

310

Microsoft Word - S03649_MAY_LTSP_Apr08.doc  

Office of Legacy Management (LM)

page intentionally left blank page intentionally left blank DOE-LM/1605-2008 Office of Legacy Management Long-Term Surveillance Plan for the Maybell (UMTRCA Title I) Disposal Site Moffat County, Colorado April 2008 Work Performed by S.M. Stoller Corporation under DOE Contract No. DE-AM01-07LM00060 for the U.S. Department of Energy Office of Legacy Management, Grand Junction, Colorado This page intentionally left blank U.S. Department of Energy LTSP-Maybell, Colorado, Disposal Site

311

Method for making devices having intermetallic structures and intermetallic devices made thereby  

DOE Patents (OSTI)

A method and system for making a monolithic intermetallic structure are presented. The structure is made from lamina blanks which comprise multiple layers of metals which are patternable, or intermetallic lamina blanks that are patternable. Lamina blanks are patterned, stacked and registered, and processed to form a monolithic intermetallic structure. The advantages of a patterned monolithic intermetallic structure include physical characteristics such as melting temperature, thermal conductivity, and corrosion resistance. Applications are broad, and include among others, use as a microreactor, heat recycling device, and apparatus for producing superheated steam. Monolithic intermetallic structures may contain one or more catalysts within the internal features.

Paul, Brian Kevin (Oregon State University, Corvallis, OR); Wilson, Rick D.; Alman, David E.

2004-01-06T23:59:59.000Z

312

Adjustable extender for instrument module  

DOE Patents (OSTI)

A blank extender module used to mount an instrument module in front of its console for repair or test purposes has been equipped with a rotatable mount and means for locking the mount at various angles of rotation for easy accessibility. The rotatable mount includes a horizontal conduit supported by bearings within the blank module. The conduit is spring-biased in a retracted position within the blank module and in this position a small gear mounted on the conduit periphery is locked by a fixed pawl. The conduit and instrument mount can be pulled into an extended position with the gear clearing the pawl to permit rotation and adjustment of the instrument.

Sevec, J.B.; Stein, A.D.

1975-11-01T23:59:59.000Z

313

Microsoft Word - S08399_2012 MMTS 5yrRev.doc  

Office of Legacy Management (LM)

Five-Year Review Report Five-Year Review Report Fourth Five-Year Review Report For Monticello Mill Tailings (USDOE) Site, San Juan County, Monticello, Utah June 2012 LMS/MNT/S08399 This page intentionally left blank June 18, 2012 This page intentionally left blank This page intentionally left blank U.S. Department of Energy Fourth Five-Year Review for MMTS June 2012 Doc. No. S08399 Page i Contents Abbreviations ................................................................................................................................. iii Executive Summary ........................................................................................................................ v 1.0 Introduction ......................................................................................................................... 1

314

DOE Solar Decathlon: California Polytechnic State University: Benchmarking  

NLE Websites -- All DOE Office Websites (Extended Search)

Cal Poly solar-powered house on the National Mall for Solar Decathlon 2005. Cal Poly solar-powered house on the National Mall for Solar Decathlon 2005. Enlarge image The exterior of Cal Poly's house features a large deck and overhang that shades the south-facing windows and doors. (Credit: Chris Gunn/U.S. Department of Energy Solar Decathlon) Who: California Polytechnic State University What: Solar Cal Poly Where: California Polytechnic State University 1 Grand Ave. San Luis Obispo, CA 93407 Map This House Public tours: Contact the Cal Poly Renewable Energy Club at 224-805-7999 for tour information. Solar Decathlon 2005 California Polytechnic State University: Benchmarking Solar Performance The solar-powered house designed by California Polytechnic State University returned to San Luis Obispo after placing third overall in the U.S. Department of Energy Solar Decathlon 2005. It was reconstructed on campus

315

A New Look on the Electromagnetic Duality. Suggestions and Developments  

E-Print Network (OSTI)

In this paper a new look on the electro-magnetic duality is presented and appropriately exploited. The duality analysis in the nonrelativistic and relativistic formulations is shown to lead to the idea the mathematical model field to be a differential form valued in the 2-dimensional vector space ${\\cal R}^2$. A full ${\\cal R}^2$ covariance is achieved through introducing explicitly the canonical complex structure ${\\cal I}$ of ${\\cal R}^2$ in the nonrelativistic equations. The connection of the relativistic Hodge * with ${\\cal I}$ is shown and a complete coordinate free relativistic form of the equations and the conservative quantities is obtained. The duality symmetry is interpreted as invariance of the conservative quantities and conservation equations.

Donev, S

2000-01-01T23:59:59.000Z

316

A New Look on the Electromagnetic Duality. Suggestions and Developments  

E-Print Network (OSTI)

In this paper a new look on the electro-magnetic duality is presented and appropriately exploited. The duality analysis in the nonrelativistic and relativistic formulations is shown to lead to the idea the mathematical model field to be a differential form valued in the 2-dimensional vector space ${\\cal R}^2$. A full ${\\cal R}^2$ covariance is achieved through introducing explicitly the canonical complex structure ${\\cal I}$ of ${\\cal R}^2$ in the nonrelativistic equations. The connection of the relativistic Hodge * with ${\\cal I}$ is shown and a complete coordinate free relativistic form of the equations and the conservative quantities is obtained. The duality symmetry is interpreted as invariance of the conservative quantities and conservation equations.

Stoil Donev

2000-06-27T23:59:59.000Z

317

GENERAL TECHNICAL BASE QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

General General Technical Base Qualification Standard Reference Guide MARCH 2012 This page is intentionally blank. Table of Contents i FIGURES ...................................................................................................................................... iii TABLES ........................................................................................................................................ iii ACRONYMS ................................................................................................................................ iv PURPOSE ...................................................................................................................................... 1 SCOPE ........................................................................................................................................... 1

318

NUCLEAR SAFETY SPECIALIST QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nuclear Nuclear Safety Specialist Qualification Standard Reference Guide AUGUST 2008 This page is intentionally blank. i Table of Contents LIST OF FIGURES ..................................................................................................................... iv LIST OF TABLES ........................................................................................................................ v ACRONYMS ................................................................................................................................ vi PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

319

SAFETY SOFTWARE QUALITY ASSURANCE QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Safety Software Safety Software Quality Assurance Qualification Standard Reference Guide MARCH 2011 This page intentionally left blank Table of Contents i LIST OF FIGURES ...................................................................................................................... ii LIST OF TABLES ........................................................................................................................ ii ACRONYMS ................................................................................................................................ iii PURPOSE ...................................................................................................................................... 1 PREFACE ...................................................................................................................................... 1

320

Fire Protection Engineering Qualification Standard Reference Guide  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fire Protection Fire Protection Engineering Qualification Standard Reference Guide SEPTEMBER 2009 This page is intentionally blank. Table of Contents i ACRONYMS ................................................................................................................................. ii PURPOSE.......................................................................................................................................1 SCOPE ............................................................................................................................................1 PREFACE.......................................................................................................................................1 TECHNICAL COMPETENCIES................................................................................................3

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

WASTE MANAGEMENT QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Qualification Standard Qualification Standard Reference Guide August 2010 Waste Management This page is intentionally blank. Table of Contents iii LIST OF FIGURES ..................................................................................................................... iv LIST OF TABLES ........................................................................................................................ v ACRONYMS ................................................................................................................................ vi PURPOSE ...................................................................................................................................... 1 SCOPE ........................................................................................................................................... 1

322

Well-To-Wheels Energy and Greenhouse Gas Analysis of Plug-In Hybrid Electric Vehicles  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

ii This page intentionally left blank. iii CONTENTS ACKNOWLEDGMENTS ........................................................................................................ xi NOTATION .............................................................................................................................. xiii EXECUTIVE SUMMARY ...................................................................................................... 1 ES.1 CD Operation of Gasoline PHEVs and BEVs ......................................................... 2 ES.1.1 Petroleum Displacement ............................................................................. 2 ES.1.2 GHG Emissions .......................................................................................... 3

323

Microsoft Word - July 2008 PMCDP Module CHRIS ESS Tutorial.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Program Program ESS Tutorial July 2008 This page intentionally left blank. Project Management Career Development Program ESS Tutorial Table of Contents Revision: July 2008 Table of Contents Introduction................................................................................................................................................1 * PMCDP Participants .....................................................................................................................1 * PMCDP Certification....................................................................................................................1 * Equivalency for a Competency .....................................................................................................2

324

SAFEGUARDS & SECURITY GENERAL TECHNICAL BASE QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

&Security General Technical Base Qualification Standard Reference Guide JANUARY 2010 This page is intentionally blank. Table of Contents i LIST OF FIGURES ..................................................................................................................... iv LIST OF TABLES ....................................................................................................................... iv ACRONYMS ................................................................................................................................. v PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

325

OCCUPATIONAL SAFETY QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Qualification Standard Qualification Standard Reference Guide JULY 2011 Occupational Safety This page is intentionally blank. Table of Contents i FIGURES ...................................................................................................................................... iii TABLES ........................................................................................................................................ iv ACRONYMS ................................................................................................................................. v PURPOSE ...................................................................................................................................... 1 SCOPE ........................................................................................................................................... 1

326

INDUSTRIAL HYGIENE QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial Industrial Hygiene Qualification Standard Reference Guide DECEMBER 2009 This page is intentionally blank. Table of Contents i LIST OF FIGURES ...................................................................................................................... ii LIST OF TABLES ........................................................................................................................ ii ACRONYMS ................................................................................................................................ iv PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

327

ELECTRICAL SYSTEMS AND SAFETY OVERSIGHT QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electrical Electrical Systems and Safety Oversight Qualification Standard Reference Guide DECEMBER 2009 This page is intentionally blank. Table of Contents i. i LIST OF FIGURES ..................................................................................................................... vi LIST OF TABLES ..................................................................................................................... viii ACRONYMS ................................................................................................................................ ix PURPOSE ...................................................................................................................................... 1 SCOPE ........................................................................................................................................... 1

328

NNSA PACKAGE CERTIFICATION ENGINEER QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NNSA Package NNSA Package Certification Engineer Qualification Standard Reference Guide FEBRUARY 2010 This page is intentionally blank. i Table of Contents LIST OF FIGURES ...................................................................................................................... ii LIST OF TABLES ........................................................................................................................ ii ACRONYMS ................................................................................................................................ iii PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

329

CONSTRUCTION MANAGEMENT QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Construction Construction Management Qualification Standard Reference Guide August 2009 This page is intentionally blank. Table of Contents i LIST OF FIGURES ..................................................................................................................... iv LIST OF TABLES ........................................................................................................................ v ACRONYMS ................................................................................................................................ vi PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

330

Microsoft Word - Vol I.doc  

Office of Legacy Management (LM)

January 2013 January 2013 LMS/FER/S03496-6.0 Revision 6.0 Final This page intentionally left blank LMS/FER/S03496-6.0 Comprehensive Legacy Management and Institutional Controls Plan Volumes I and II Fernald Preserve Fernald, Ohio January 2013 Revision 6 Final This page intentionally left blank Volume I Legacy Management Plan January 2013 U.S. Department of Energy Revision 6 Final This page intentionally left blank Emergency Contact Legacy Management 24-hour Monitored Security Telephone Number (877) 695-5322 This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-6.0-Final Volume I-Legacy Management Plan January 2013 Page i Contents

331

RADIATION PROTECTION QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Radiation Radiation Protection Qualification Standard Reference Guide MARCH 2009 ii This page intentionally left blank iii Table of Contents LIST OF FIGURES ..................................................................................................................... iv LIST OF TABLES ....................................................................................................................... iv ACRONYMS, ABBREVIATIONS and SYMBOLS ................................................................. v PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

332

AVIATION SAFETY OFFICER QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Safety Safety Officer Qualification Standard Reference Guide MARCH 2010 i This page is intentionally blank. Table of Contents ii LIST OF FIGURES ..................................................................................................................... iii LIST OF TABLES ....................................................................................................................... iii ACRONYMS ............................................................................................................................... iv PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

333

TRANSPORTATION AND TRAFFIC MANAGEMENT QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Transportation Transportation & Traffic Management Qualification Standard Reference Guide APRIL 2010 This page is intentionally blank. i LIST OF FIGURES ...................................................................................................................... ii LIST OF TABLES ........................................................................................................................ ii ACRONYMS ................................................................................................................................ iv PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

334

TECHNICAL TRAINING QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Technical Technical Training Qualification Standard Reference Guide December 2009 This page is intentionally blank. Table of Contents i LIST OF FIGURES ...................................................................................................................... ii LIST OF TABLES ........................................................................................................................ ii ACRONYMS ................................................................................................................................ iii PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

335

WEAPONS QUALITY ASSURANCE QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Weapon Weapon Quality Assurance Qualification Standard Reference Guide AUGUST 2009 This page is intentionally blank. Table of Contents i LIST OF FIGURES ...................................................................................................................... ii LIST OF TABLES ........................................................................................................................ ii ACRONYMS ................................................................................................................................ iv PURPOSE...................................................................................................................................... 1 SCOPE ...........................................................................................................................................

336

SAFEGUARDS AND SECURITY QUALIFICATION STANDARD REFERENCE GUIDE  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and Security Qualification Standard Reference Guide OCTOBER 2010 This page is intentionally blank. Table of Contents i LIST OF TABLES ........................................................................................................................ v ACRONYMS ................................................................................................................................ vi PURPOSE ...................................................................................................................................... 1 SCOPE ........................................................................................................................................... 1 PREFACE ...................................................................................................................................... 1

337

Nuclear & Particle Physics Directorate  

NLE Websites -- All DOE Office Websites (Extended Search)

High Energy Physics Review, 22-23 April 2004 Click on an agenda item below to access a PDF version of the speaker's slides. NOTE: If your browser displays a blank page for any...

338

California Beach Health: Evaluation of Grunion as an Indicator Species  

E-Print Network (OSTI)

Non-Tidal Rhythms. Author: Martin, K. L. M. Date: 2007 Bookharm grunion eggs? Authors: K. Martin, T. Speer-Blank, R.M. H. Horn, and K. L. M. Martin. Date: 2006 Bok Name: L.

Martin, Karen

2008-01-01T23:59:59.000Z

339

Part B - Requirements & Funding Information PART B - Requirements...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

authorities) B.3. Part B Identifier If this is a new IA, then leave this blank. After STRIPES creates the IA identifier number, the number will appear in Part A Section A.3....

340

Part B - Requirements & Funding Information PART B - Requirements...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

authorities B.3. Part B Identifier If this is a new IA, then leave this blank. After STRIPES creates the IA identifier number, the number will appear in Part A Section A.3....

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Hay harvesting services respond to market trends  

E-Print Network (OSTI)

services respond to market trends by Steven Blank, Karenyears, there has been a trend in California from harvesting1,300 pounds or more. This trend is influencing how hay-

Blank, Steven; Klonsky, Karen; Fuller, Kate

2009-01-01T23:59:59.000Z

342

Microsoft Word - 2010Aser_Appx_C  

Office of Legacy Management (LM)

Supplemental Air Information This page intentionally left blank U.S. Department of Energy Fernald Preserve 2010 Site Environmental Report May 2011 Doc. No. S07409 Page C-i...

343

Contract DE-AC04-94AL85000 Modification M508  

National Nuclear Security Administration (NNSA)

Modification M508 Attachment 1 SECTION J APPENDIX C Special Bank Account Agreement (Updated Mod M271, M461, M497, M508) Intentionally left blank for Internet posting purposes....

344

Contract DE-AC04-94AL85000  

National Nuclear Security Administration (NNSA)

Modification M508 Attachment 1 SECTION J APPENDIX C Special Bank Account Agreement (Updated Mod M271, M461, M497, M508) Intentionally left blank for Internet posting purposes...

345

COMPREHENSIVE LEGACY MANAGEMENT  

Office of Legacy Management (LM)

Revision 7.0 Final This page intentionally left blank LMSFERS03496-7.0 Comprehensive Legacy Management and Institutional Controls Plan Volumes I and II Fernald Preserve Fernald,...

346

Microsoft Word - Vol II_Att D.docx  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-7.0-Final Attachment D-Integrated...

347

Overview  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-7.0-Final Attachment E-Community...

348

Microsoft Word - Vol II_Att A_OMMP.docx  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-7.0-Final Attachment A-Operations and...

349

Materials Transportation Testing & Analysis at Sandia National...  

NLE Websites -- All DOE Office Websites (Extended Search)

Send Your Comments andor Questions (Fill in blank fields and click on "Submit" to send) Send To: Transportation Risk & Packaging Your Name: Your E-mail Address: Topic of Interest:...

350

A Certificate-Based Approach to Marketing Green Power and Constructing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Certificate-Based Approach to Marketing Green Power and Constructing New Wind Energy Facilities Preprint May 2002 * NRELCP-620-32430 E. Blank Community Energy, Inc. L. Bird and B....

351

Microsoft Word - 10063150 DVP.doc  

Office of Legacy Management (LM)

Site October 2010 LMSGRNS00610 This page intentionally left blank U.S. Department of Energy DVP-June 2010, Green River, Utah October 2010 RIN 10063150 Page i Contents Sampling...

352

Nuclear & Particle Physics Directorate  

NLE Websites -- All DOE Office Websites (Extended Search)

Agenda: 29-30 September 2003 Note: If your browser displays a blank page after clicking on any of the below items, copy the file to your computer and load it into Acrobat from...

353

Microsoft Word - RIN 09072474_DVP.doc  

Office of Legacy Management (LM)

Water Sampling at the Tuba City, Arizona, Disposal Site December 2009 LMSTUBS00809 This page intentionally left blank U.S. Department of Energy DVP-August 2009, Tuba City,...

354

Microsoft Word - RIN 10022849 DVP.doc  

Office of Legacy Management (LM)

0 Water Sampling at the Grand Junction, Colorado, Office Site May 2010 LMSGJOS00210 This page intentionally left blank U.S. Department of Energy DVP-February 2010, Grand...

355

Microsoft Word - RIN 10073213 DVP  

Office of Legacy Management (LM)

Water Sampling at the Tuba City, Arizona, Disposal Site January 2011 LMSTUBS00710 This page intentionally left blank U.S. Department of Energy DVP-July 2010, Tuba City, Arizona...

356

DOE specification: Valve-regulated type lead-acid storage batteries  

DOE Green Energy (OSTI)

This document contains a ``fill-in-the-blanks`` guide specification for procurement of sealed valve-regulated type lead-acid storage batteries, for uninterruptible power supply applications.

NONE

1996-08-01T23:59:59.000Z

357

Microsoft Word - S07121_CY2010 Annual Rpt  

Office of Legacy Management (LM)

Site Calendar Year 2010 April 2011 This page intentionally left blank U.S. Department of Energy Rocky Flats Annual Report of Site Surveillance and Maintenance Activities-CY 2010...

358

: BioEnergy Science Center  

NLE Websites -- All DOE Office Websites (Extended Search)

Standard Cylinder Type Engine Can you see how biofuel would work in current engines? Please use these parts to label the blank parts of your engine picture. The Crankshaft is at...

359

Microsoft Word - Appendix B - Example Contact Record.docx  

Office of Legacy Management (LM)

Example Contact Record This page intentionally left blank U.S. Department of Energy Rocky Flats Site Operations Guide July 2013 Doc. No. S03037-6.0 Page B-1 Rocky Flats Site...

360

Southeastern Colorado Survey of Critical Biological Resources  

E-Print Network (OSTI)

biostimulation through adding manure was used to reclaim the oily sludge-contaminated soil. Materials and methods automated plate reader. All wells were blanked to the control well A1. For the BIOLOG data, average well

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Microsoft Word - N01058_LTSM Plan.doc  

Office of Legacy Management (LM)

for the Pinellas Site November 2012 This page intentionally left blank U.S. Department of Energy Long-Term Surveillance and Maintenance Plan for the Pinellas Site November 2012...

362

DISCLAIMER  

Office of Legacy Management (LM)

page intentionally left blank Dwument Number U 0 0 6 5 3 0 1 Site Idormation o De Chelly Production WeU - Former Sowce lea Road - Fence Geologic Units 300 600 Feet Alluvialand...

363

California Solar Initiative California Public Utilities Commission  

E-Print Network (OSTI)

California Solar Initiative California Public Utilities Commission Staff Progress Report January 2008 #12;California Solar Initiative, CPUC Staff Progress Report, January 2008 This page intentionally left blank. #12;California Solar Initiative, CPUC Staff Progress Report, January 2008 Table of Contents

364

Method and apparatus for inspecting reflection masks for defects  

SciTech Connect

An at-wavelength system for extreme ultraviolet lithography mask blank defect detection is provided. When a focused beam of wavelength 13 nm is incident on a defective region of a mask blank, three possible phenomena can occur. The defect will induce an intensity reduction in the specularly reflected beam, scatter incoming photons into an off-specular direction, and change the amplitude and phase of the electric field at the surface which can be monitored through the change in the photoemission current. The magnitude of these changes will depend on the incident beam size, and the nature, extent and size of the defect. Inspection of the mask blank is performed by scanning the mask blank with 13 nm light focused to a spot a few .mu.m in diameter, while measuring the reflected beam intensity (bright field detection), the scattered beam intensity (dark-field detection) and/or the change in the photoemission current.

Bokor, Jeffrey (Oakland, CA); Lin, Yun (Berkeley, CA)

2003-04-29T23:59:59.000Z

365

Subroutine LENCH  

Science Conference Proceedings (OSTI)

... and finds out how long the c "actual" string is (ie not including padded blanks on the right). ... str(ilench:ilench).ne.tab !Look for trailing tabs as well ...

366

Statistical Deformation Control  

Science Conference Proceedings (OSTI)

...Four of the six inputs of a forming system (material, lubricant, tooling, and press) can be tracked using the SPC techniques described previously. Typical measurements could include: Material thickness, coil/blank dimensions, and properties Lubricant composition, viscosity, and application...

367

Slide11 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

of researcher "R.L. AAMODT". Input your TERM in the "SEARCH FOR" blank (put multiple terms and phrases in "double quotes"). Then select ENTER. You may choose also to "SORT...

368

Reply to comment | OSTI, US Dept of Energy, Office of Scientific...  

Office of Scientific and Technical Information (OSTI)

of researcher "R.L. AAMODT". Input your TERM in the "SEARCH FOR" blank (put multiple terms and phrases in "double quotes"). Then select ENTER. You may choose also to "SORT...

369

How do I find journal articles? InfoRhode Tutorial 1 Slide 1  

E-Print Network (OSTI)

search terms into the blanks, consider whether you need to limit your search Make sure you enter a Boolean style search, for example, transportation, or the results are too general, try narrowing the search by adding an additional term

Rhode Island, University of

370

DOE - Safety of Radioactive Material Transportation  

NLE Websites -- All DOE Office Websites (Extended Search)

Comments & Questions Send Your Comments andor Questions (Fill in blank fields and click on "Submit" to send) Send To: Webmaster Your Name: Your E-mail Address: Affiliation: Type...

371

Microsoft Word - RIN 12114945 DVP  

Office of Legacy Management (LM)

2012, Bluewater, New Mexico U.S. Department of Energy RIN 12114945 February 2013 Page ii This page intentionally left blank U.S. Department of Energy DVP-November 2012,...

372

Microsoft Word - U0199700_August 2004.doc  

Office of Legacy Management (LM)

Corporation under DOE Contract No. DE-AC01-02GJ79491 for the U.S. Department of Energy, Grand Junction, Colorado This page intentionally left blank Document Number U0199700...

373

Microsoft Word - S08569_2011VMR  

Office of Legacy Management (LM)

Site Update for 2011 April 2012 This page intentionally left blank U.S. Department of Energy VMR for the Riverton, Wyoming, Processing Site, Update for 2011 April 2012 Doc. No....

374

Microsoft Word - Appendix-B.docx  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy Fernald Preserve 2012 Site Environmental Report May 2013 Doc. No. S09665 Page B-i Contents Abbreviations...

375

Rocky Flats, Colorado, Site Quarterly Report of Site Surveillance  

Office of Legacy Management (LM)

Calendar Year 2013 October 2013 This page intentionally left blank U.S. Department of Energy Rocky Flats Site Quarterly Report of Site Surveillance and Maintenance Activities-2nd...

376

Microsoft Word - S04877_AnnInspRpt2008.doc  

Office of Legacy Management (LM)

Properties Sites December 2008 This page intentionally left blank U.S. Department of Energy 2008 Annual Inspection-Monticello, Utah December 2008 Doc. No. S487700 Page i Contents...

377

Microsoft Word - S06297_LTSP  

Office of Legacy Management (LM)

Durango, Colorado January 2011 This page intentionally left blank U.S. Department of Energy LTSP-Durango Disposal Site, Durango, Colorado January 2011 Doc. No. S06297-0.0 Page i...

378

Promoting Renewable Energy in a Market Environment  

NLE Websites -- All DOE Office Websites (Extended Search)

Promoting Renewable Energy in a Market Environment: A Community-Based Approach for Aggregating Green Demand Rudd Mayer Eric Blank Randy Udall John Nielsen Land and Water Fund of...

379

Microsoft Word - Vol II_Att D.doc  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-4.0-Final Attachment D-Integrated...

380

Microsoft Word - Vol 1-091009.doc  

Office of Legacy Management (LM)

Revision 4.0 Final This page intentionally left blank LMSFERS03496-4.0 Comprehensive Legacy Management and Institutional Controls Plan Volumes I and II Fernald Preserve Fernald,...

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Microsoft Word - Vol II-091009.doc  

Office of Legacy Management (LM)

695-5322 This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-4.0-Final Volume...

382

Microsoft Word - Vol II_Att A_OMMP_081009.doc  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-4.0-Final Attachment A-Operations and...

383

Original Paper Development and prevalidation of a method for ...  

Science Conference Proceedings (OSTI)

mental conditions were established. This method was ... for phenol monitoring in pharmaceutical preparations as well as other ... conditions and performance characteristics, as well as ..... the blank values are the principal generator of random.

384

Performance of the upgraded LTP-II at the ALS Optical Metrology Laboratory  

E-Print Network (OSTI)

project developed by the ALS Scientific Support Group,Beamline 4.0.1: www-als.lbl.gov/als/techspecs/ bl4.0.1.html.GLIDCOP Grating Blank for ALS Beamline 10.0.1, LSBL-842 (

Kirschman, Jonathan L.; Advanced Light Source

2008-01-01T23:59:59.000Z

385

Microsoft Word - s05822_LEHR_WorkPlan  

Office of Legacy Management (LM)

Management Plan November 2010 This page intentionally left blank U.S. Department of Energy LEHR Remedial DesignRemedial Action Work Plan November 2010 Doc. No. S05822-0.0 Page...

386

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ffing-analysis-instructions-blank-sheet-and-example-sheet Article The History of the Light Bulb From incandescent bulbs to fluorescents to LEDs, we're exploring the long history of...

387

Microsoft Word - S03307_2007 report.doc  

Office of Legacy Management (LM)

Management U.S. Department of Energy This page intentionally left blank DOE-LM1519-2006 Annual Ground Water Report April 2006 through March 2007 Tuba City, Arizona, Disposal...

388

Microsoft Word - ANL 2005 ESH - Volume II -FINAL FORMATTED...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

87 ii This page intentionally left blank. iii Acronyms AGHC Alpha-Gamma Hot Cell AGHCF Alpha-Gamma Hot Cell Facility ALARA As Low As Reasonably Achievable ANL...

389

Microsoft Word - 11033655 DVP.doc  

Office of Legacy Management (LM)

left blank Page 53 Control Number NA DATE: April 5, 2010 TO: Rick Findlay FROM: Jeff Price SUBJECT: Trip Report (LTHMP Sampling) Site: Shoal, Nevada Dates of Sampling Event:...

390

Microsoft Word - 11053763 DVP  

Office of Legacy Management (LM)

left blank Page 45 Control Number NA DATE: May 26, 2011 TO: Rick Findlay FROM: Jeff Price SUBJECT: Trip Report (LTHMP Sampling) Site: Central Nevada Test Area (CNTA) Dates of...

391

Microsoft Word - S05827_WCR_Final.doc  

Office of Legacy Management (LM)

Comments This page intentionally left blank U.S. Department of Energy Well Completion Report for CAU 443 CNTA December 2009 Doc. No. S05827 Page G-1 Well Completion Report for CAU...

392

CX-007971: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Add Blanks in Central Hood Exhaust (CHEX) System Ductwork Between FLT-17 and FLT-18 CX(s) Applied: B2.3 Date: 02/06/2012 Location(s): South Carolina Offices(s): Savannah River Operations Office

393

Fernald Preserve, Fernald, Ohio Comprehensive Legacy  

Office of Legacy Management (LM)

September 2013 September 2013 LMS/FER/S03496-7.0 Revision 7.0 Draft This page intentionally left blank LMS/FER/S03496-7.0 Comprehensive Legacy Management and Institutional Controls Plan Volumes I and II Fernald Preserve Fernald, Ohio September 2013 Revision 7 Draft This page intentionally left blank Volume I Legacy Management Plan January 2013September 2013 U.S. Department of Energy Revision 67 FinalDraft This page intentionally left blank Emergency Contact Legacy Management 24-hour Monitored Security Telephone Number (877) 695-5322 This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-7.0-Draft Volume I-Legacy Management Plan

394

Microsoft Word - Appendix H - Emergency Response Plan for Dams...  

Office of Legacy Management (LM)

H Emergency Response Plan for the Rocky Flats Site Dams This page intentionally left blank LMSRFSS04533-3.0 Rocky Flats, Colorado, Site Emergency Response Plan for the Rocky...

395

Medical Messages  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Messages Index Prepared for the Department of Energy Office of Transportation and Emergency Management 02B00215-08.p65 This page intentionally left blank table of contents...

396

Microsoft Word - S0130700_Mar 2008Rev June 2008.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

This page intentionally left blank U.S. Department of Energy LTSP for the Falls City, Texas, Disposal Site March 2008 Doc. No. S0130700 Page A-3 LTSP for the Falls City, Texas,...

397

Microsoft Word - S0130700_Mar 2008Rev June 2008.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

This page intentionally left blank U.S. Department of Energy LTSP for the Falls City, Texas, Disposal Site March 2008 Doc. No. S0130700 Page D-3 LTSP for the Falls City, Texas,...

398

Microsoft Word - 11033683 DVP  

Office of Legacy Management (LM)

Sampling at the Falls City, Texas, Disposal Site June 2011 LMSFCTS00411 This page intentionally left blank U.S. Department of Energy DVP-April 2011, Falls City, Texas June 2011...

399

Microsoft Word - S0130700_Mar 2008Rev June 2008.doc  

Office of Legacy Management (LM)

This page intentionally left blank U.S. Department of Energy LTSP for the Falls City, Texas, Disposal Site March 2008 Doc. No. S0130700 Page E-3 LTSP for the Falls City, Texas,...

400

Microsoft Word - S08833_BMR.docx  

Office of Legacy Management (LM)

Amchitka Island, Alaska, Amchitka Island, Alaska, Biological Monitoring Report 2011 Sampling Results September 2013 LMS/AMC/S08833 This page intentionally left blank LMS/AMC/S08833 Amchitka Island, Alaska Biological Monitoring Report 2011 Sampling Results September 2013 This page intentionally left blank U.S. Department of Energy Amchitka Island, Alaska, Biological Monitoring Report, 2011 Sampling Results September 2013 Doc. No. S08833 Page i Contents Abbreviations ...................................................................................................................................v Executive Summary ...................................................................................................................... vii

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Microsoft Word - S08005_VMR  

Office of Legacy Management (LM)

Verification Monitoring Verification Monitoring Report for the Gunnison, Colorado, Processing Site December 2011 LMS/GUP/S08005 This page intentionally left blank LMS/GUP/S08005 2011 Verification Monitoring Report for the Gunnison, Colorado, Processing Site December 2011 This page intentionally left blank U.S. Department of Energy 2011 Verification Monitoring Report-Gunnison, Colorado, Processing Site December 2011 Doc. No. S08005 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Overview ................................................................................................................................1 2.0 Site Conditions .......................................................................................................................3

402

Microsoft Word - Appendix-D.docx  

Office of Legacy Management (LM)

This page intentionally left blank This page intentionally left blank U.S. Department of Energy Fernald Preserve 2012 Site Environmental Report May 2013 Doc. No. S09665 Page D-i Contents Abbreviations ............................................................................................................................ D-iii Measurement Abbreviations ..................................................................................................... D-iv References .................................................................................................................................. D-v D.1.0 Ecological Restoration Monitoring ................................................................................ D-1 D.2.0 Wetland Functional Phase Monitoring .......................................................................... D-1

403

Microsoft Word - S07535_2010_GW_Mon  

Office of Legacy Management (LM)

Phase I Groundwater Monitoring Phase I Groundwater Monitoring Report Calendar Year 2010 March 2011 LMS/MND/S07535 This page intentionally left blank LMS/MND/S07535 Mound Site Phase I Groundwater Monitoring Report Calendar Year 2010 March 2011 This page intentionally left blank U.S. Department of Energy Mound Site Phase I Groundwater Monitoring Report-CY 2010 March 2011 Doc. No. S07535 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Introduction ............................................................................................................................1 1.1 Purpose .........................................................................................................................1

404

Microsoft Word - Appendix I - Additional Field Implementation Detail for Selected Monitoring.docx  

Office of Legacy Management (LM)

I I Additional Field Implementation Detail for Selected Monitoring Objectives This page intentionally left blank LMS/RFS/S08202-1.0 Rocky Flats Site, Colorado Additional Field Implementation Detail for Selected Monitoring Objectives July 2013 This page intentionally left blank U.S. Department of Energy Additional Field Implementation Detail for Selected Monitoring Objectives July 2013 Doc. No. S08202-1.0 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Introduction ............................................................................................................................1 2.0 Investigative Monitoring ........................................................................................................2

405

LMS-WEL-S09552_AIR.cdr  

Office of Legacy Management (LM)

Inspection Report for Inspection Report for the Weldon Spring, Missouri, Site January 2013 LMS/WEL/S09552 ENERGY Legacy Management U.S. DEPARTMENT OF This page intentionally left blank 2012 Annual Inspection Report for the Weldon Spring, Missouri, Site This page intentionally left blank U.S. Department of Energy 2012 Annual Inspection - Weldon Spring, Missouri January 2013 Page i Contents Executive Summary .........................................................................................................................1 1.0 Introduction ............................................................................................................................2

406

ARROW-PAK Report  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of ARROW-PAK of ARROW-PAK Container August 2007 External Technical Review of ARROW-PAK Container This Page Intentionally Left Blank External Technical Review of ARROW-PAK Container External Technical Review of ARROW-PAK Container This Page Intentionally Left Blank External Technical Review of ARROW-PAK Container - i - CONTENTS ACRONYMS...................................................................................................................................v EXECUTIVE SUMMARY .......................................................................................................... vii 1.0 INTRODUCTION/BACKGROUND .............................................................................. 1-1 1.1 SAFE AND COMPLIANT CH-TRU WASTE SHIPPING

407

111114 - G-TM-G-00001 - SRS EMS Description Manual - R7.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Management System G-TM-G-00001 Management System G-TM-G-00001 Description Manual Rev. 7 i ENVIRONMENTAL MANAGEMENT SYSTEM DESCRIPTION MANUAL Environmental Management System G-TM-G-00001 Description Manual Rev. 7 ii This page intentionally left blank Environmental Management System G-TM-G-00001 Description Manual Rev. 7 iv This page intentionally left blank Environmental Management System G-TM-G-00001 Description Manual Rev. 7

408

Microsoft Word - S04388_EMSPrograms  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Programs Manual Programs Manual January 2012 LMS/POL/S04388-3.0 This page intentionally left blank LMS/POL/S04388-3.0 Environmental Management System Programs Manual This page intentionally left blank U.S. Department of Energy EMS Programs Manual Doc. No. S04388-3.0 Page i Contents Abbreviations ...................................................................................................................................v Executive Summary ...................................................................................................................... vii 1.0 Energy Efficiency and Greenhouse Gases⎯EMS Program #1 .............................................1 1.1 Purpose .........................................................................................................................1

409

Microsoft Word - S09244_VMR  

Office of Legacy Management (LM)

2 Verification Monitoring 2 Verification Monitoring Report for the Gunnison, Colorado, Processing Site September 2012 LMS/GUP/S09244 This page intentionally left blank LMS/GUP/S09244 2012 Verification Monitoring Report for the Gunnison, Colorado, Processing Site September 2012 This page intentionally left blank U.S. Department of Energy 2012 Verification Monitoring Report-Gunnison, Colorado, Processing Site September 2012 Doc. No. S09244 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Overview ................................................................................................................................1

410

Microsoft Word - S02885_2012 CIP Mound Site  

Office of Legacy Management (LM)

Mound Site Mound Site Community Involvement Plan January 2012 LMS/MND/S02885 This page intentionally left blank LMS/MND/S02885 Office of Legacy Management Mound Site Community Involvement Plan January 2012 This page intentionally left blank U.S. Department of Energy Mound Community Involvement Plan January 2012 Doc. No. S02885 Page i Contents Abbreviations .................................................................................................................................. ii 1.0 Introduction ............................................................................................................................1 2.0 Site Description and Background ...........................................................................................1

411

Appendix E Supporting Information for Ground Water Modeling  

Office of Legacy Management (LM)

Supporting Information for Ground Water Modeling Supporting Information for Ground Water Modeling This page intentionally left blank Contents Section Geologic Map of Site Area ........................................................................................................ E1.O Stream Flow Measurements ...................................................................................................... E2.0 Estimates of Ground Water Flow .............................................................................................. E3.0 .......................................... MODFLOW Flow Budget Analysis for OU 1 1 1 Model Subregions E4.0 ............................................................................ Burro Canyon Aquifer Ground Water Model E5.0 This page intentionally left blank

412

Microsoft Word - S07202_VMR  

Office of Legacy Management (LM)

10 10 February 2011 LMS/RVT/S07202 This page intentionally left blank LMS/RVT/S07202 Verification Monitoring Report for the Riverton, Wyoming, Processing Site Update for 2010 February 2011 This page intentionally left blank U.S. Department of Energy Riverton, Wyoming, Verification Monitoring Report February 2011 Doc. No. S07202 Page i Contents 1.0 Introduction ............................................................................................................................1 2.0 Site Conditions .......................................................................................................................3 2.1 Hydrogeology ...............................................................................................................3

413

Microsoft Word - S05094_VMR.doc  

Office of Legacy Management (LM)

08 08 May 2009 LMS/RVT/S05094 This page intentionally left blank LMS/RVT/S05094 Verification Monitoring Report for the Riverton, Wyoming, Processing Site Update for 2008 May 2009 This page intentionally left blank U.S. Department of Energy Riverton, Wyoming, Verification Monitoring Report May 2009 Doc. No. S05094 Page i Contents 1.0 Introduction ........................................................................................................................1-1 2.0 Site Conditions ...................................................................................................................2-1 2.1 Hydrogeology ...........................................................................................................2-1

414

Microsoft Word - S09923_2012_VMR.docx  

Office of Legacy Management (LM)

Slick Rock, Colorado, Slick Rock, Colorado, Processing Sites April 2013 LMS/SRE-SRW/S09923 This page intentionally left blank LMS/SRE-SRW/S09923 Verification Monitoring Report for the Slick Rock, Colorado, Processing Sites April 2013 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report-Slick Rock, Colorado April 2013 Doc. No. S09923 Page i Contents Abbreviations ................................................................................................................................. iii Executive Summary .........................................................................................................................v 1.0 Introduction ............................................................................................................................1

415

Microsoft Word - Vol II.docx  

Office of Legacy Management (LM)

January 2013 January 2013 U.S. Department of Energy Revision 6 Final This page intentionally left blank Emergency Contact Legacy Management 24-hour Monitored Security Telephone Number (877) 695-5322 This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-6.0-Final Volume II-Institutional Controls Plan January 2013 Page i Contents Acronyms and Abbreviations ........................................................................................................ iii Executive Summary .........................................................................................................................v 1.0 Introduction ........................................................................................................................1-1

416

Microsoft Word - S06182_GCAP.doc  

Office of Legacy Management (LM)

Groundwater Compliance Action Groundwater Compliance Action Plan for the Lakeview, Oregon, Processing Site June 2010 LMS/LKP/S06182 This page intentionally left blank LMS/LKP/S06182 Groundwater Compliance Action Plan for the Lakeview, Oregon, Processing Site June 2010 This page intentionally left blank U.S. Department of Energy Groundwater Compliance Action Plan for the Lakeview, Oregon, Processing Site June 2010 Doc. No.S06182 Page i Contents Abbreviations................................................................................................................................. iii

417

Microsoft Word - Vol II_Att D.doc  

Office of Legacy Management (LM)

This page intentionally left blank This page intentionally left blank U.S. Department of Energy Comprehensive Legacy Management and Institutional Controls Plan Doc. No. S03496-6.0-Final Attachment D-Integrated Environmental Monitoring Plan January 2013 Page i Contents Acronyms and Abbreviations ......................................................................................................... v 1.0 Introduction ..................................................................................................................... 1-1 1.1 Background ............................................................................................................. 1-1 1.2 Program Objectives and Scope ............................................................................... 1-2

418

Microsoft Word - S07834_2011 Ann Rpt_ag comment revs  

Office of Legacy Management (LM)

10 Through March 2011 10 Through March 2011 for the Shiprock, New Mexico, Site January 2012 LMS/SHP/S07834 This page intentionally left blank LMS/SHP/S07834 Annual Performance Report April 2010 Through March 2011 for the Shiprock, New Mexico, Site January 2012 This page intentionally left blank U.S. Department of Energy Annual Performance Report, Shiprock, New Mexico January 2012 Doc. No. S07834 Page i Contents Abbreviations ...................................................................................................................................v Executive Summary ...................................................................................................................... vii 1.0 Introduction ............................................................................................................................1

419

Microsoft Word - S07225_SSP  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 2012 February 2012 LMS/S07225 This page intentionally left blank LMS/S07225 Site Sustainability Plan Office of Legacy Management February 2012 _______________________________________________________ David W. Geiser, Director, Office of Legacy Management david.geiser@hq.doe.gov 2012.02.10 11:37:12 -05'00' This page intentionally left blank U.S. Department of Energy Site Sustainability Plan February 2012 Doc. No. S07225 Page i Contents List of Abbreviations ..................................................................................................................... iii I. Executive Summary ...............................................................................................................1

420

Microsoft Word - S09347_VMR  

Office of Legacy Management (LM)

Durango, Colorado, Durango, Colorado, Processing Site December 2012 LMS/DUP/S09347 This page intentionally left blank LMS/DUP/S09347 Verification Monitoring Report for the Durango, Colorado, Processing Site December 2012 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report for the Durango, Colorado, Processing Site December 2012 Doc. No. S09347 Page i Contents Abbreviations ................................................................................................................................. iii

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Microsoft Word - S06692_VMR.doc  

Office of Legacy Management (LM)

Gunnison, Colorado, Processing Site September 2010 LMS/GUP/S06692 This page intentionally left blank LMS/GUP/S06692 2010 Verification Monitoring Report for the Gunnison, Colorado, Processing Site September 2010 This page intentionally left blank U.S. Department of Energy 2010 Verification Monitoring Report-Gunnison, Colorado, Processing Site September 2010 Doc. No. S06692 Page i Contents Abbreviations................................................................................................................................. iii 1.0 Overview................................................................................................................................ 1 2.0 Site Conditions.......................................................................................................................

422

Microsoft Word - N01673_B100 AA final draft  

Office of Legacy Management (LM)

Draft Building 100 Area Draft Building 100 Area Plume Management Alternatives Analysis March 2012 LMS/PIN/N01673 This page intentionally left blank LMS/PIN/N01673 Pinellas County, Florida, Site Environmental Restoration Project Draft Building 100 Area Plume Management Alternatives Analysis March 2012 This page intentionally left blank U.S. Department of Energy Draft Building 100 Area Plume Management Alternatives Analysis March 2012 Doc. No. N01673 Page i Contents Abbreviations ................................................................................................................................. iv Executive Summary .........................................................................................................................v

423

Microsoft Word - S07963_MND 5yr  

Office of Legacy Management (LM)

Third Five-Year Review for the Third Five-Year Review for the Mound, Ohio, Site Miamisburg, Ohio September 2011 LMS/MND/S07963 This page intentionally left blank This page intentionally left blank U.S. Department of Energy Mound, Ohio, Third Five-Year Review September 2011 Doc. No. S07963 Page i Contents Abbreviations ................................................................................................................................ vii Executive Summary ....................................................................................................................... ix Five-Year Review Summary Form ................................................................................................ xi 1.0 Introduction ............................................................................................................................1

424

Microsoft Word - S09629_Flushing2013  

Office of Legacy Management (LM)

Alternate Water Supply System Alternate Water Supply System Flushing Plan Riverton, Wyoming, Processing Site January 2013 LMS/RVT/S09629 This page intentionally left blank LMS/RVT/S09629 Alternate Water Supply System Flushing Plan Riverton, Wyoming, Processing Site January 2013 This page intentionally left blank U.S. Department of Energy AWSS Flushing Plan, Riverton, Wyoming, Processing Site January 2013 Doc. No. S09629 Page i Contents Abbreviations .................................................................................................................................. ii 1.0 Introduction ............................................................................................................................1 2.0 Background ............................................................................................................................1

425

Microsoft Word - S05527_VMR 2009.DOC  

Office of Legacy Management (LM)

Report for the Gunnison, Colorado, Processing Site August 2009 LMS/GUP/S05527 This page intentionally left blank LMS/GUP/S05527 2009 Verification Monitoring Report for the Gunnison, Colorado, Processing Site August 2009 This page intentionally left blank U.S. Department of Energy 2009 Verification Monitoring Report-Gunnison, Colorado, Processing Site August 2009 Doc. No. S05527 Page i Contents Abbreviations................................................................................................................................. iii 1.0 Introduction............................................................................................................................ 1 2.0 Site Conditions.......................................................................................................................

426

Microsoft Word - S05428_VMR.doc  

Office of Legacy Management (LM)

2008 and 2009 Update July 2010 LMS/SRE-SRW/S05428 This page intentionally left blank LMS/SRE-SRW/S05428 Verification Monitoring Report for the Slick Rock, Colorado, Processing Sites 2008 and 2009 Update July 2010 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report-Slick Rock, Colorado, 2008 and 2009 Update July 2010 Doc. No. S05428 Page i Contents Abbreviations................................................................................................................................. iii 1.0 Introduction ............................................................................................................................1 1.1 Purpose of Report .........................................................................................................

427

Microsoft Word - S07699_VMR  

Office of Legacy Management (LM)

June 2011 LMS/SRE-SRW/S07699 This page intentionally left blank LMS/SRE-SRW/S07699 Verification Monitoring Report for the Slick Rock, Colorado, Processing Sites June 2011 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report-Slick Rock, Colorado June 2011 Doc. No. S07699 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Introduction ............................................................................................................................1 1.1 Purpose of Report .........................................................................................................1

428

Microsoft Word - S07361_OUIII Biomonitoring Rpt  

Office of Legacy Management (LM)

Biomonitoring Program Status Biomonitoring Program Status and Analytical Update March 2011 LMS/MNT/S07361 This page intentionally left blank LMS/MNT/S07361 Monticello Mill Tailings Site Operable Unit III Biomonitoring Program Status and Analytical Update March 2011 This page intentionally left blank U.S. Department of Energy MMTS OU III Biomonitoring Program Status and Analytical Update March 2011 Doc. No. S07361 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Introduction ............................................................................................................................1 1.1 Overview .......................................................................................................................1

429

Microsoft Word - S05773_2009 VerifMonRpt.doc  

Office of Legacy Management (LM)

September 2009 September 2009 LMS/DUP/S05773 This page intentionally left blank LMS/DUP/S05773 Office of Legacy Management Verification Monitoring Report for the Durango, Colorado, Processing Site September 2009 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report-Durango, Colorado, Processing Site September 2009 Doc. No. S05773 Page i Contents Abbreviations................................................................................................................................. iii 1.0 Introduction............................................................................................................................ 1 2.0 Site Conditions.......................................................................................................................

430

Microsoft Word - S06909_Durango 2010 VMR  

Office of Legacy Management (LM)

Processing Site September 2010 LMS/DUP/S06909 This page intentionally left blank LMS/DUP/S06909 Office of Legacy Management Verification Monitoring Report for the Durango, Colorado, Processing Site September 2010 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report for the Durango, Colorado, Processing Site September 2010 Doc. No. S06909 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Introduction ............................................................................................................................ 1 1.1 Compliance Strategy ..................................................................................................... 1

431

Site Sustainability Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy U.S. Department of Energy Office of Legacy Management December 2013 LMS/S07225 This page intentionally left blank This page intentionally left blank U.S. Department of Energy Site Sustainability Plan December 2013 Doc. No. S07225 Page i Contents Abbreviations ................................................................................................................................. iii I. Executive Summary ...............................................................................................................1 II. Performance Review and Plan Narrative ...............................................................................9 1 GHG Reduction and Comprehensive GHG Inventory ...........................................................9

432

Improving the fidelity of deletion  

Science Conference Proceedings (OSTI)

In this work we study the quantum deletion machine with two transformers, and show that the deletion machine with a single transformer performs better than the deletion machine with more than two transformers. We also observe that the fidelity of deletion depends on the blank state used in the deleter, and so for different blank states the fidelity is different. Further, we study the Pati-Braunsein deleter with transformer.

Adhikari, Satyabrata; Choudhury, B. S. [Department of Mathematics, Bengal Engineering and Science University, Howrah-711103, West Bengal (India)

2006-05-15T23:59:59.000Z

433

Microsoft Word - S04674_2008VMR.doc  

Office of Legacy Management (LM)

for the Durango, Colorado, Processing Site September 2008 LMS/DUP/S04674 This page intentionally left blank LMS/DUP/S04674 Office of Legacy Management Verification Monitoring Report for the Durango, Colorado, Processing Site September 2008 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report-Durango, Colorado, Processing Site September 2008 Doc. No. S0467400 Page iii Contents Acronyms and Abbreviations ......................................................................................................... v 1.0 Introduction............................................................................................................................ 1 2.0 Site Conditions.......................................................................................................................

434

Microsoft Word - S08837_2011 VMR  

Office of Legacy Management (LM)

Slick Rock, Colorado, Processing Sites May 2012 LMS/SRE-SRW/S08837 This page intentionally left blank LMS/SRE-SRW/S08837 Verification Monitoring Report for the Slick Rock, Colorado, Processing Sites May 2012 This page intentionally left blank U.S. Department of Energy Verification Monitoring Report-Slick Rock, Colorado May 2012 Doc. No. S08837 Page i Contents Abbreviations ................................................................................................................................. iii Executive Summary .........................................................................................................................v 1.0 Introduction ............................................................................................................................1

435

Microsoft Word - 08071744_DocProd.doc  

Office of Legacy Management (LM)

Shirley Basin South, Wyoming Shirley Basin South, Wyoming Disposal Site January 2009 LMS/SBS/S00808 This page intentionally left blank This page intentionally left blank U.S. Department of Energy DVP-August 2008, Shirley Basin South, Wyoming, Disposal Site January 2009 RIN 08071744 Page i Contents Sampling Event Summary ...............................................................................................................1 Shirley Basin South, Wyoming, Disposal Site Sample Location Map ............................................2 Data Assessment Summary..............................................................................................................3 Water Sampling Field Activities Verification Checklist .............................................................5

436

Microsoft Word - S06093_VMR.doc  

Office of Legacy Management (LM)

09 09 April 2010 LMS/RVT/S06093 This page intentionally left blank LMS/RVT/S06093 Verification Monitoring Report for the Riverton, Wyoming, Processing Site Update for 2009 April 2010 This page intentionally left blank U.S. Department of Energy Riverton, Wyoming, Verification Monitoring Report April 2010 Doc. No. S06093 Page i Contents 1.0 Introduction ........................................................................................................................1-1 2.0 Site Conditions ...................................................................................................................2-1 2.1 Hydrogeology ...........................................................................................................2-1

437

Microsoft Word - S07304_OLF Data Summ_Eval  

Office of Legacy Management (LM)

Original Landfill Data Summary Original Landfill Data Summary and Evaluation Report December 2010 LMS/RFS/S07304 This page intentionally left blank LMS/RFS/S07304 Rocky Flats, Colorado, Site Original Landfill Data Summary and Evaluation Report December 2010 This page intentionally left blank U.S. Department of Energy RFS Original Landfill Data Summary and Evaluation Report December 2010 Doc. No. 07304 Page i Contents Abbreviations ................................................................................................................................. iii 1.0 Introduction ............................................................................................................................1 2.0 Sampling Summary ................................................................................................................1

438

Microsoft Word - S08999_Apr11-Mar12.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Groundwater Report Groundwater Report April 2011 Through March 2012 Tuba City, Arizona, Disposal Site July 2012 LMS/TUB/S08999 This page intentionally left blank LMS/TUB/S08999 Annual Groundwater Report April 2011 Through March 2012 Tuba City, Arizona, Disposal Site July 2012 This page intentionally left blank U.S. Department of Energy Tuba City Annual Groundwater Report-April 2011 through March 2012 July 2012 Doc. No. S08999 Page i Contents Abbreviations ................................................................................................................................. iv

439

AN EXPERIMENTAL STUDY OF RETINAL BURNS: PART I. THE IRRADIANCE THRESHOLDS FOR CHORIO-RETINAL LESIONS. PART II. ENTOPTIC SCATTER AS A FUNCTION OF WAVE LENGTH  

SciTech Connect

Using a high intensity light source to produce chorioretinal lesions in the eyes of rabbits, cats, and guinea pigs, the authors determined, at different levels of retinal irradiance, the exposure time which produced an ophthalmoscopically visible lesion. It was found that, at irradiance levels greater than 2 cal/cm/sup 2/sec, a radiant exposure of 1.0 cal/cm/sup 2/ produced a threshold lesion. At irradiance levels less than 0.7 cal/cm/sup 2//sec, lesions could not be produced at any exposure time through ten seconds. Histological data on the nature of the legions and course of healing are presented and discussed. (auth)

Demott, D.W.; Davis, T.P.

1959-05-11T23:59:59.000Z

440

Teleportation of arbitrary $n$-qudit state with multipartite entanglement  

E-Print Network (OSTI)

We propose a protocol ${\\cal D}_n$ for faithfully teleporting an arbitrary $n$-qudit state with the tensor product state (TPS) of $n$ generalized Bell states (GBSs) as the quantum channel. We also put forward explicit protocol ${\\cal D}'_n$ and ${\\cal D}''_n$ for faithfully teleporting an arbitrary $n$-qudit state with two classes of $2n$-qudit GESs as the quantum channel, where the GESs are a kind of genuine entangled states we construct and can not be reducible to the TPS of $n$ GBSs.

Zhan-jun Zhang

2006-11-30T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

CX-009557: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

57: Categorical Exclusion Determination 57: Categorical Exclusion Determination CX-009557: Categorical Exclusion Determination Recycling of Nutrients and Water in Algal Biofuels Production CX(s) Applied: A9, B3.6 Date: 12/10/2012 Location(s): California Offices(s): Golden Field Office The U.S. DOE is proposing to provide federal funding to the Cal Poly Corporation (CPC) to support California Polytechnic State University (Cal Poly) to conduct research, development and demonstration activities to advance efficient recycling of waste and nutrients in algal biofuels production. CPC is a separate, nonprofit corporation, that supports the educational mission of Cal Poly and provides post-award fiscal and administrative support with projects sponsored on Cal Poly's behalf. CX-009557.pdf More Documents & Publications

442

California | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SoCalGas - Multi-Family Residential Rebate Program SoCalGas - Multi-Family Residential Rebate Program Southern California Gas Company provides incentives to encourage the owners and managers of multi-family residential buildings to increase their energy efficiency. The program offers rebates for the installation of qualified energy-efficient products in apartment dwelling units and in the common areas of apartment and condominium complexes, and common areas of mobile home parks. Equipment must meet the efficiency standards provided on the web site.Contact Southern California Gas Company for additional information. October 16, 2013 SoCalGas - Custom Non-Residential Energy Efficiency Program Southern California Gas Company (SoCalGas) offers non-residential customers incentive programs to encourage energy efficiency. More information about

443

Black Hole Mergers Manuela Campanelli  

E-Print Network (OSTI)

Black Hole Mergers Manuela Campanelli Center for Computa6 Department of Physics Duke University Feb 15-17, 2012 #12;Black Holes Antennae galaxies, op6cal, HST · In General Rela6vity (GR), Black Holes (BHs

Wolpert, Robert L

444

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

cal-exclusion-determination Download CX-000960: Categorical Exclusion Determination Green Bank of Kentucky, Energy Efficient Revolving Loan Fund CX(s) Applied: A9, B1.4, B5.1 Date:...

445

Switchgrass is a promising, high-yielding crop for California biofuel  

E-Print Network (OSTI)

greenhouse-gas flux for bioenergy crop- ping systems. EcolMediterranean region. Biomass Bioenergy [CalClim] Californiafor biofuel systems. Biomass Bioenergy 30:198206. Heaton E,

2011-01-01T23:59:59.000Z

446

Failure by fracture and fatigue in "NANO" and "BIO" materials  

E-Print Network (OSTI)

AND FATIGUE IN NANO AND BIO MATERIALS R. O. Ritchie, 1,3and Fatigue in Nano and Bio Materials R. O. Ritchie 1 ,structures and biologi- cal/bio-implantable materials, so-

Ritchie, R.O.; Muhlstein, C.L.; Nalla, R.K.

2003-01-01T23:59:59.000Z

447

Evaluating Flake Assemblage and Stone Tool Distributions at a Large Western Stemmed Tradition Site Near Yucca Mountain, Nevada  

E-Print Network (OSTI)

Tradition Site Near Yucca Mountain, Nevada G R E G O R Y M .Institute near Yucca Mountain, Nevada, have revealed anlevel at the top of Yucca Mountain. Vegetation is typi- cal

Haynes, Gregory M

1996-01-01T23:59:59.000Z

448

Measurement of the branching fraction for $D^{+} K^{-}\\pi^{+}\\pi^{+}$  

E-Print Network (OSTI)

Using the CLEO-II detector at CESR we have measured the ratio of branching fractions, {\\cal B}(D^+\\rightarrow K^- \\pi^+ \\pi^+)/{\\cal B}(D^0 \\rightarrow K^-\\pi^+) = 2.35 \\pm 0.16 \\pm 0.16. Our recent measurement of {\\cal B}(D^0 \\rightarrow K^-\\pi^+) then gives {\\cal B}(D^+\\rightarrow K^- \\pi^+ \\pi^+) = (9.3 \\pm 0.6 \\pm 0.8)\\%. hardcopies with figures can be obtained by writing to to: Pam Morehouse preprint secretary Newman Lab Cornell University Ithaca, NY 14853 or by sending mail to: preprints@lns62.lns.cornell.edu A postscript version is available through World-Wide-Web.

Balest, R; Cho, K; Daoudi, M; Ford, W T; Johnson, D R; Lingel, K; Lohner, M; Rankin, P; Smith, J G; Alexander, J P; Bebek, C; Berkelman, K; Bloom, K; Browder, T E; Cassel, D G; Cho, H A; Coffman, D M; Drell, P S; Ehrlich, R; Gaiderev, P; Garca-Sciveres, M; Geiser, B; Gittelman, B; Gray, S W; Hartill, D L; Heltsley, B K; Jones, C D; Jones, S L; Kandaswamy, J; Katayama, N; Kim, P C; Kreinick, D L; Ludwig, G S; Masui, J; Mevissen, J; Mistry, N B; Ng, C R; Nordberg, E; Patterson, J R; Peterson, D; Riley, D; Salman, S; Sapper, M; Wrthwein, F; Avery, P; Freyberger, A; Rodrguez, J; Stephens, R; Yang, S; Yelton, J; Cinabro, D; Henderson, S; Liu, T; Saulnier, M; Wilson, R; Yamamoto, H; Bergfeld, T; Eisenstein, B I; Gollin, G; Ong, B; Palmer, M; Selen, M; Thaler, J J; Sadoff, A J; Ammar, R; Ball, S; Baringer, P; Bean, A; Besson, D; Coppage, D; Copty, N; Davis, R; Hancock, N; Kelly, M; Kwak, N; Lam, H; Kubota, Y; Lattery, M; Nelson, J K; Patton, S; Perticone, D; Poling, R A; Savinov, V; Schrenk, S; Wang, R; Alam, M S; Kim, I J; Nemati, B; O'Neill, J J; Severini, H; Sun, C R; Zoeller, M M; Crawford, G; Daubenmier, C M; Fulton, R; Fujino, D; Gan, K K; Honscheid, K; Kagan, H; Kass, R; Lee, J; Malchow, R; Skovpen, Y; Sung, M; White, C; Butler, F; Fu, X; Kalbfleisch, G; Ross, W R; Skubic, P L; Snow, J; Wang, P L; Wood, M; Brown, D N; Fast, J; McIlwain, R L; Miao, T; Miller, D H; Modesitt, M; Payne, D; Shibata, E I; Shipsey, I P J; Wang, P N; Battle, M; Ernst, J; Kwon, Y; Roberts, S; Thorndike, E H; Wang, C H; Dominick, J; Lambrecht, M; Sanghera, S; Shelkov, V; Skwarnicki, T; Stroynowski, R; Volobuev, I P; Wei, G; Zadorozhny, P; Artuso, M; Goldberg, M; He, D; Horwitz, N; Kennett, R; Mountain, R; Moneti, G C; Muheim, F; Mukhin, Y; Playfer, S; Rozen, Y; Stone, S; Thulasidas, M; Vasseur, G; Zhu, G; Bartelt, J; Csorna, S E; Egyed, Z; Jain, V; Kinoshita, K; Edwards, K W; Ogg, M; Britton, D I; Hyatt, E R F; MacFarlane, D B; Patel, P M; Akerib, D S; Barish, B; Chadha, M; Chan, S; Cowen, D F; Eigen, G; Miller, J S; O'Grady, C; Urheim, J; Weinstein, A J; Acosta, D; Athanas, M; Masek, G; Paar, H P; Gronberg, J; Kutschke, R; Menary, S; Morrison, R J; Nakanishi, S; Nelson, H N; Nelson, T K; Qiao, C; Richman, J D; Ryd, A; Tajima, H; Sperka, D; Witherell, M S; Procario, M

1994-01-01T23:59:59.000Z

449

onnectionsCConnections The ELECTRICAL and COMPUTER ENGINEERING Alumni Newsletter  

E-Print Network (OSTI)

the wall" creativity might take plasma research even further toward technologies that will change the way applications for years. Kushner's path to plasma research was, admittedly, indirect. He earned his PhD from Cal

Beresnev, Igor

450

NATIONAL ACADEMY OF SCIENCES . HEINZ A. LOWENSTAM  

E-Print Network (OSTI)

, he was the first to blend biologi- cal and paleontological analyses to unravel the ecological as smelters, and steel mills. There were coal mines and iron foundries. The air was so poor that our plants

Kirschvink, Joseph L.

451

An approach for evaluating the market effects of energy efficiency programs  

E-Print Network (OSTI)

planning for 2009-2011 energy efficiency and beyond, OctoberCal- ifornia long-term energy efficiency strategic plan. San2000 summer study on energy efficiency in buildings, 6.179-

Vine, Edward; Prahl, Ralph; Meyers, Steve; Turiel, Isaac

2010-01-01T23:59:59.000Z

452

Measurement of theta13 with reactor neutrinos  

E-Print Network (OSTI)

at the Diablo Canyon nuclear power plant in California.erent distances from a nuclear power plant, a future reactorthe Diablo Canyon nuclear power plant in Cal- ifornia, and

Heeger, Karsten M.; Freedman, Stuart J.; Kadel, Richard W.; Luk, Kam-Biu

2004-01-01T23:59:59.000Z

453

VACTERL (vertebral anomalies, anal atresia or imperforate anus, cardiac anomalies, tracheoesophageal fistula, renal and limb defect) spectrum presenting with portal hypertension: a case report  

E-Print Network (OSTI)

like to thank the Radiology Department, St James' Hospital, Leeds, UK for providing the images of the scans. We would also like to thank the Clini- cal Science Library, Macclesfield District Hospital for providing the journals. Author Details 1...

Bhurtel, Dilli RAJ; Losa, Ignatius

2010-05-05T23:59:59.000Z

454

ARE Update Volume 8, Number 4  

E-Print Network (OSTI)

The magnitude of the cost estimate is typi- cal for speciesScott/Shasta which unit cost estimates were developed are:We developed aggregate cost estimates for common Water

2005-01-01T23:59:59.000Z

455

How ORISE is Making a Difference: Securing the Golden State from...  

NLE Websites -- All DOE Office Websites (Extended Search)

program in the country. These efforts led to the creation of several state-wide, joint disaster response plans and today, ORISE personnel work closely with CalOES staff by...

456

Appendix B: CArBon dioxide CApture teChnology SheetS  

NLE Websites -- All DOE Office Websites (Extended Search)

teChnology uPDate, may 2013 eleCtroChemiCal membrane for Carbon DioxiDe CaPture & Power generation primary project goals FuelCell Energy, Inc. (FCE) is developing an...

457

Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States  

E-Print Network (OSTI)

gas from PG&E. The electricity tariff has Time-Of-Use (TOU)month) Source: SCE TOU electricity tariff and SoCal naturalthe almost flat electricity tariff ($/kWh) and the seasonal

Stadler, Michael

2009-01-01T23:59:59.000Z

458

ALS Stars in New Video from California Academy of Sciences  

NLE Websites -- All DOE Office Websites (Extended Search)

ALS Stars in New Video from California Academy of Sciences ALS Stars in New Video from California Academy of Sciences Print Tuesday, 30 October 2012 13:51 cal academy of sciences...

459

Lexicon-based methods for sentiment analysis  

Science Conference Proceedings (OSTI)

We present a lexicon-based approach to extracting sentiment from text. The Semantic Orientation CALculator (SO-CAL) uses dictionaries of words annotated with their semantic orientation (polarity and strength), and incorporates intensification and negation. ...

Maite Taboada; Julian Brooke; Milan Tofiloski; Kimberly Voll; Manfred Stede

2011-06-01T23:59:59.000Z

460

Abstract: In this paper, we discuss the optics effects of the...  

NLE Websites -- All DOE Office Websites (Extended Search)

(x , y ) and canoni- cal (p x , p y ) momenta created by the non-zero transverse components of the magnetic vector potential of a lon- gitudinal field. Since the canonical...

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Thermodynamic Data for Biomass Conversion and Waste Incineration  

NLE Websites -- All DOE Office Websites (Extended Search)

l b l l q,(net) 4202 cal g i qv(net) 17580 J g- 83 JENEBE 15 Agricultural Residues CORN STOVER; solid; Material is considered biomass fuel and has proximate analysis values...

462

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

cal-exclusion-determination Download CX-006655: Categorical Exclusion Determination Coal Bed Methane Gas Separator CX(s) Applied: B3.7, B3.11 Date: 02242010 Location(s): Casper,...

463

Wireless Demand Response Controls for HVAC Systems  

E-Print Network (OSTI)

the contribution of air-conditioning. Figure 2: WirelessIntroduction Commercial air-conditioning is one of thethe Cal ISO is commercial air-conditioning. One of the most

Federspiel, Clifford

2010-01-01T23:59:59.000Z

464

CHEMICAL ENGINEERING Fall 2013-Winter 2014  

E-Print Network (OSTI)

ADVANCED CHEMICAL ENGINEERING Fall 2013-Winter 2014 Certificate Program CONTINUING AND PROFESSIONAL EDUCATIONCONTINUING AND PROFESSIONAL EDUCATION #12;About the Advanced Chemical Engineering Certificate Program The new Advanced Chemical Engineering Certificate Program offers professionals in chemi- cal engineering

California at Davis, University of

465

Darrie Ganzhorn: Director of Programs and Operations, Homeless Garden Project  

E-Print Network (OSTI)

a three-year job training program; this isnt: you stay herehow much of it was a training program. So when Cal-Worksdialogue between the training program and the sustainable

Reti, Irene H.

2010-01-01T23:59:59.000Z

466

Review of California and National Methods for Energy Performance Benchmarking of Commercial Buildings  

E-Print Network (OSTI)

Energy Star Ratings Using Building Occupancy CharacteristicsDefaults and Whole Building Energy Use Intensity andCalifornia CEUS Office Buildings (n=109) C-6 % of Cal-Arch

Matson, Nance E.; Piette, Mary Ann

2005-01-01T23:59:59.000Z

467

Pfizer, Inc.  

E-Print Network (OSTI)

Radioactive Materials Management Forum (Cal Rad Forum) to provide our views and background information on issues that we hope will be discussed at the Commission briefing on low-level radioactive waste scheduled for April 17 th. Cal Rad is an association of organizations, public and private, that use radioactive materials and generate low-level radioactive waste in the Southwestern Compact region. Our corporate and institutional membership covers the spectrum of organizations that use radioactive materials in research, medicine, power generation, and other industrial applications. Cal Rad was founded in 1983 to assist and promote governmental responses to the requirements of the Low-Level Radioactive Waste Policy Act that will assure access to safe disposal facilities, under regulations consistent with sound science, for all classes of low-level waste generated by organizations that use radioactive materials. Cal Rad conducts legislative, regulatory, and public information programs in

Keith E. Asmussen, Ph.D.; Gary Stimmell; Vilmarie Rodriguez; Ligand Pharmaceuticals; Philip D. Rutherford; Carol S. Marcus, Ph.D.; James M Woolfenden; Kathy C. Yhip; John Closs; William H. Cromwell; Thomas A. Gray; Thomas A. Gray; David Turner; Robert Carretta M. D; Roger Richter

2009-01-01T23:59:59.000Z

468

Climate impacts on the planktonic marine ecosystem in the Southern California current  

E-Print Network (OSTI)

shallower D 10NO3 than offshore stations. Fig 4.3. Seasonal66 CalCOFI stations are offshore group. Fig. 2.3. Hovmoller2.2), and right panels are offshore stations (Fig. 2.2). Red

Kim, Hey-Jin

2008-01-01T23:59:59.000Z

469

UNIVERSITE DE ROUEN Faculte des Sciences -Departement de Physique -CORIA -INSA  

E-Print Network (OSTI)

´ecoulements compressibles a ´et´e associ´e `a cette structure. Le mod`ele est bas´e sur un cal- cul dynamique

Paris-Sud XI, Université de

470

The State of Health Insurance in California: Findings from the 2007 California Health Interview Survey  

E-Print Network (OSTI)

beneficiaries who are not disabled, 26.4% report having nocoverage. Among apparently disabled Medi-Cal beneficiaries,those who qualify as disabled and have very high medical

Brown, Richard E.; Kronick, Richard; Kincheloe, Jennifer R.; Lavarreda, Shana Alex; Peckham, Erin

2009-01-01T23:59:59.000Z

471

SELF-POTENTIAL SURVEY AT THE CERRO PRIETO GEOTHERMAL FIELD, BAJA CALIFORNIA, MEXICO  

E-Print Network (OSTI)

Presented at the Geothermal Resources Council 1978 AnnualPrepared for the Division of Geothermal Energy of the U. S.of th'e dipole in km. Geothermal Field, Baja Cal ifornia,

Corwin, R.F.

2011-01-01T23:59:59.000Z

472

Did the Thermocline Deepen in the California Current after the 1976/77 Climate Regime Shift?  

Science Conference Proceedings (OSTI)

The 55-yr California Cooperative Oceanic Fisheries Investigations (CalCOFI) dataset in the southern California Current reveals a significant surface-intensified warming and stratification (buoyancy frequency) change across the 1976/77 climate ...

Hey-Jin Kim; Arthur J. Miller

2007-06-01T23:59:59.000Z

473

ieee transactions on ultrasonics, ferroelectrics, and frequency control, vol. 51, no. 2, february 2004 211 Characterizing Ultra-Thin Matching Layers of  

E-Print Network (OSTI)

the piezoelectric ceramic and the propagating medium. Epoxy resin, parylene, and composite materials have been widely used as matching layers in the medi- cal transducer industry for many years [1]. Recently, high

Cao, Wenwu

474

Collective artificial intelligence : simulated role-playing from crowdsourced data  

E-Print Network (OSTI)

Collective Artificial Intelligence (CAl) simulates human intelligence from data contributed by many humans, mined for inter-related patterns. This thesis applies CAI to social role-playing, introducing an end-to-end process ...

Orkin, Jeffrey David

2013-01-01T23:59:59.000Z

475

School of Engineering Rensselaer nurtures a "low walls" research culture that facilitates strong interactions among faculty  

E-Print Network (OSTI)

and theoretical fluid dynamics, aerodynamics, advanced propulsion, experimental gas dynamics, energy conversion computation, energy, nanotechnology, fluid mechanics, heat transfer, dynamics and vibrations, automation and high temperature structures, biochemi- cal sensing, thermal management, and energy generation

476

Economic Potential for Agriculture Water-Saving Using Alternative Irrigation Techniques  

E-Print Network (OSTI)

four percent of aggregate water intake in the approximation,or reused) to total intake water. The DWR data give a quiteIntake of \\~ater by CalHorn:a (million acre ~lantlfacttlring feet) Firms Water

Vaux, Henry James Jr.; Marsh, Albert W

1980-01-01T23:59:59.000Z

477

Micro-Planner Reference Manual  

E-Print Network (OSTI)

Micro-Planner is an implementation of a subset of Cal Hewitt's language, PLANNER by Gerald Jay Sussman, Terry Winograd, and Eugene Charniak on the AI group computer in LISP. Micro-Planner is now a publically accessible ...

Sussman, Gerald

1970-07-01T23:59:59.000Z

478

Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States  

E-Print Network (OSTI)

SOFC) .Viability PVPS R&D RT SCE SoCal SOFC tC TOU UL UPS VRB WACSolid-Oxide Fuel Cell (SOFC) SOFC is a promising technology

Stadler, Michael

2009-01-01T23:59:59.000Z

479

Effect of Heat and Electricity Storage and Reliability on Microgrid Viability: A Study of Commercial Buildings in California and New York States  

E-Print Network (OSTI)

SOFC)..Viability PVPS R&D RT SCE SoCal SOFC tC TOU UL UPS VRB WACSolid-Oxide Fuel Cell (SOFC) SOFC is a promising technology

Stadler, Michael

2009-01-01T23:59:59.000Z

480

Californias Immigrant Households and Public-Assistance Participation in the 1990s - Policy Brief  

E-Print Network (OSTI)

with Dependent Children (AFDC)/California Work Opportunitystate households participating in AFDC/ CalWORKs pro- grams.of noncitizen households received AFDC, compared to 4.5% of

2002-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "inticont cal blanks" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Working Against the Clock: The Implementation of Welfare Time Limits in California - Detailed Research Findings  

E-Print Network (OSTI)

experiencetoapreCalWORKsAFDCprogramwithasomewhatwithDependentChildren(AFDC)programwithTemporaryandadministration. TheAFDCprogramandthenewTANF

2006-01-01T23:59:59.000Z

482

A Consumer's Guide: Heat Your Water with the Sun (Brochure)  

NLE Websites -- All DOE Office Websites (Extended Search)

fuel, a solar water heater can be more economi- cal over the life of the system than heating water with electricity, fuel oil, propane, or even natural gas. That's because the...

483

The medical profession in the Roman Empire from Augustus to Justinian  

E-Print Network (OSTI)

Rid''1an of Cairo, Cairo 1937. Schulze SEG Segre,Tit.Cal. SEHHW SGDI SNG Sterrett EJ . Tabanelli TAM. Temkin, Kyk10li Thorndike , History. Thylander Underwood \\vui lleumier - xiii - : .Schulze, Zur Geschichte der lateinischen Eigennamen...

Nutton, Vivian

1970-05-28T23:59:59.000Z

484

Northwest Energy Efficiency Taskforce Executive Committee  

E-Print Network (OSTI)

#12;Northwest Energy Efficiency Taskforce Executive Committee Chairs Tom Karier, Washington Member, Northwest Energy Efficiency Alliance Bill Gaines, Director/Chief Executive Officer, Tacoma Public Utilities, Cowlitz County Public Utility District Cal Shirley, Vice President for Energy Efficiency Service, Puget

485

1970s | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

1940s | 1950s | 1960s | 1980s | 1990s | 2000s 1970: Atomic Energy Basics 1970: Cal. Computer Aids AEC Here News Article 1970: Composition Section 1970: 10 Millionth Published...

486

Studying Gamma Ray Bursts from a  

E-Print Network (OSTI)

Studying Gamma Ray Bursts from a new perspective! {... Unraveling some mysteries and adding new Radio Op0cal X-ray Short ( energy -ray photons... ... accompained by a considerable long las0ng emission

?umer, Slobodan

487

Droplet activation properties of organic aerosols observed at...  

NLE Websites -- All DOE Office Websites (Extended Search)

activation properties of organic aerosols observed at an urban site during CalNex-LA Fan Mei, 1,7 Patrick L. Hayes, 2,3 Amber Ortega, 2,3 Jonathan W. Taylor, 4 James D. Allan,...

488

A Mechanistically Based Model for High Temperature LCF of Ni ...  

Science Conference Proceedings (OSTI)

5. Oxidation was well-represented by parabolic kinetics and an activation energy of 9.6 k-cal/mol. 6. Based on metallographic observations and LCF test results.

489

All the four dimensional static, spherically symmetric solutions of abelian Kaluza-Klein theory  

E-Print Network (OSTI)

The explicit form for all the four dimensional, static, spherically symmetric solutions in (4+n)-d Abelian Kaluza-Klein (KK) theory is presented by performing two SO(1,1) boosts on the non-extreme U(1)_M \\times U(1)_E KK black hole (BH) and supplementing it by SO(n)/SO(n-2) transformations. The solutions are parameterized by the mass M, Taub-Nut charge a, n electric \\vec{\\cal Q} and n magnetic \\vec{\\cal P} charges. Non-extreme BH's (with zero Taub-NUT charge) have either the Reissner-Nordstr\\" om or Schwarzschild global space-time, nonzero entropy and temperature. Extreme (supersymmetric) BH's satisfy \\vec{\\cal P} \\cdot \\vec{\\cal Q} = 0 and have a null or naked singularity, with S [T_H] reaching the zero lower [finite or infinite upper] bound.

Cvetic, M; Cveti, Mirjam; Youm, Donam

1995-01-01T23:59:59.000Z

490

Addendum to "Supersymmetric dyonic black holes in Kaluza-Klein theory"  

E-Print Network (OSTI)

We complete the study of 4-dimensional (4-d), static, spherically symmetric, supersymmetric black holes (BH's) in Abelian (4+n)-d Kaluza-Klein theory, by showing that for such solutions n electric charges \\vec{\\cal Q} \\equiv (Q_1,...,Q_n) and n magnetic charges \\vec{\\cal P} \\equiv (P_1,...,P_n) are subject to the constraint \\vec{\\cal P}\\cdot \\vec{\\cal Q}=0. All such solutions can be obtained by performing the SO(n) rotations, which do not affect the 4-d space-time metric and the volume of the internal space, on the supersymmetric U(1)_M\\times U(1)_E BH's, {\\it i.e.}, supersymmetric BH's with a diagonal internal metric.

Cvetic, M; Cveti, Mirjam; Youm, Donam

1995-01-01T23:59:59.000Z

491

Effect of compaction conditions on the seismic compression of compacted fill soils  

E-Print Network (OSTI)

of Geotechnical Engineering, ASCE, Vol. 105, No. 7, pp. 839Geotechni- cal Engineering, ASCE, Vol. 116, No. 8, pp. 1231Geotechnical Engineering, ASCE, Vol. 121, No. 12, pp. 870

Whang, Daniel H; Stewart, Jonathan P; Bray, Jonathan D

2004-01-01T23:59:59.000Z

492

Underwater noise caused by snapping shrimp  

E-Print Network (OSTI)

E. 0. ~ulbert,,~~An Underwater Sound of Natural Qrigin,!! J.Sect ion, Feb. 3, 1943. UNDERWATER SOUN~SOF OLOG l CALOF CERTAl N Bl OLOGl CAL UNDERWATER SOUND ON 'THE EAST COAST

University of California, Division of War Research at the U.S. Navy Electronics Laboratory,

1946-01-01T23:59:59.000Z

493

Pharmaceutical crops have a mixed outlook in California  

E-Print Network (OSTI)

8:1825. Ellstrand NC. 2006. When crop transgenes wander inM, Van Acker R. 2005. Can crop transgenes be kept on aEconomics of Pharmaceuti- cal Crops: Potential Bene?ts and

Marvier, Michelle

2007-01-01T23:59:59.000Z

494

University of Southern Californias U.S. Department of Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

OF SO CAL POINTS APPROACH EQUALS EXCEEDS ECLIPSES 0-60% 61-80% 81-90% 91-100% A. LIVABILITY 1 Is the operation of the house's lighting, entertainment, and other controls intuitive?...

495

President's Message November 2011  

E-Print Network (OSTI)

in moving us forward with a Facebook page and has planned abe applied to the CAL/AAEM Facebook page to automaticallyof interacting with our chapter Facebook site and links with

Mills, Trevor

2011-01-01T23:59:59.000Z

496

DOE Solar Decathlon: Scores by Contest  

NLE Websites -- All DOE Office Websites (Extended Search)

Appliances Contest The current scores for the Appliances Contest of the U.S. Department of Energy Solar Decathlon are shown below. 1. U of So Cal 99.665 Appliances: 99.665 points...

497

EV I  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'VIRONMENTAL R EV I EW for CATEGORI CAL EXCLUSION I>ETE RM I NATION Rocky Mo unt a in Region, Wesle rn Area Power Adm inist ra tio n C heye nne Substa tion West Co nt rol Building...

498

Arsenic speciation in pyrite and secondary weathering phases, Mother Lode gold district, Tuolumne County, California  

E-Print Network (OSTI)

minerals; goe, goethite; jar, jarosite; gyp, gypsum; hem,zone e DP-038 X DP-057 X goe, gyp goe, gyp goe goe jar,gyp jar, gyp jar jar, gyp jar, gyp jar jar jar, cal jar, gyp

Savage, K.S.; Tingle, Tracy N.; O'Day, Peggy A.; Waychunas, Glenn A.; Bird, Dennis K.

2004-01-01T23:59:59.000Z

499

An Amulet for Trustworthy Wearable mHealth Jacob Sorber, Minho Shin, Ronald Peterson, Cory Cornelius, Shrirang Mare,  

E-Print Network (OSTI)

, and home-based tele-medicine devices can help caregivers and individuals themselves better monitor sensors, implanted medi- cal devices and home-based tele-medicine devices, can help care- givers

Myers, Lawrence C.

500

Fuel Quality Issues in Stationary Fuel Cell Systems  

NLE Websites -- All DOE Office Websites (Extended Search)

York: 1972. 55. Zicari, S. Removal of Hydrogen Sulfide from Biogas Using Cow-Manure Compost. Master of Science Thesis, Cornell University, N.Y., 2003. 56. Cal, M. P., Rood, M....