National Library of Energy BETA

Sample records for internet protocol ip

  1. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  2. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  3. INTERNET PROTOCOL DARPA INTERNET PROGRAM

    E-Print Network [OSTI]

    McBrien, Peter

    RFC: 791 INTERNET PROTOCOL DARPA INTERNET PROGRAM PROTOCOL SPECIFICATION September 1981 prepared Way Marina del Rey, California 90291 #12;#12;September 1981 Internet Protocol TABLE OF CONTENTS ...................................................... 9 3. SPECIFICATION ................................................... 11 3.1 Internet Header Format

  4. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  5. Internet Security Protocols Lectures 7 and 8

    E-Print Network [OSTI]

    Sandhu, Ravi

    PROTOCOLS both IP AH and IP ESP can operate in transport mode · end-to-end tunnel mode · security-gateway to security-gateway transport mode and tunnel model can coexist #12;7© Ravi Sandhu 2000-2004 IP TUNNELING C A B D Public Internet Internal Network 2 Internal Network 1 Security Gateway Security Gateway 8© Ravi

  6. ACM SIGCOMM -1-Computer Communication Review The Design Philosophy of the DARPA Internet Protocols

    E-Print Network [OSTI]

    Ratnasamy, Sylvia

    of ISO protocols has also been colored by the history of the Internet suite, so an understandingACM SIGCOMM -1- Computer Communication Review The Design Philosophy of the DARPA Internet Protocols (DARPA) under Contract No. N00014-83-K-0125 Abstract The Internet protocol suite, TCP/IP, was first

  7. Internet Protocol version 6 Overview* Albert Cabellos-Aparicio, Jordi Domingo-Pascual

    E-Print Network [OSTI]

    Politècnica de Catalunya, Universitat

    Internet Protocol version 6 Overview* Albert Cabellos-Aparicio, Jordi Domingo-Pascual Departament d stands for "Internet Protocol" and it was designed during the `70s with the purpose of interconnecting heterogeneous network technologies. IP was a huge success, and made it possible to create today's Internet

  8. Internet Security Protocols Lectures 7 and 8

    E-Print Network [OSTI]

    Sandhu, Ravi

    operate in Ø transport mode · end-to-end Ø tunnel mode · security-gateway to security-gateway v transport Network 2 Internal Network 1 Security Gateway Security Gateway 8© Ravi Sandhu 2001 IP TUNNELING Source mode and tunnel model can coexist #12;7© Ravi Sandhu 2001 IP TUNNELING C A B D Public Internet Internal

  9. SX Internet , Gerard Parr

    E-Print Network [OSTI]

    Fu, Xiaoming

    SX Internet 1 , 1 , 1 , Gerard Parr 2 1. 361005 2. Ulster N.Ireland, BT52 1SA : SX Scenix SX TCP/IP Internet Java SX SX Internet : SX TCP/IP Java , The Imbedded Internet Internet solution for TCP/IP protocol and Java Virtual Machine with the SX Microprocessor. The application

  10. Privacy of encrypted Voice Over Internet Protocol 

    E-Print Network [OSTI]

    Lella, Tuneesh Kumar

    2008-10-10

    In this research, we present a investigative study on how timing-based traffic analysis attacks can be used for recovery of the speech from a Voice Over Internet Protocol (VOIP) conversation by taking advantage of the ...

  11. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  12. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  13. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  14. Design of a PSi header processor for the internet protocol 

    E-Print Network [OSTI]

    Bai, Jinxia

    1995-01-01

    bottleneck is the network transport component, i.e. the network I/O at the end system. To overcome this performance bottleneck, a standard data communication protocol, such as TCP/IP, could be implemented by using hardware to speedup the protocol throughput...

  15. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  16. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  17. Internet Security Protocols Prof. Ravi Sandhu

    E-Print Network [OSTI]

    Sandhu, Ravi

    SOCKETS LAYER (SSL) v layered on top of TCP v SSL versions 1.0, 2.0, 3.0, 3.1 v Netscape protocol v later algorithm � cipher spec · encryption algorithm · message digest algorithm � master secret · 48 byte shared secret � is resumable flag · can be used to initiate new connections 10© Ravi Sandhu 2001 SSL CONNECTION

  18. Internet Security Protocols Prof. Ravi Sandhu

    E-Print Network [OSTI]

    Sandhu, Ravi

    -2004 SECURE SOCKETS LAYER (SSL) layered on top of TCP SSL versions 1.0, 2.0, 3.0, 3.1 Netscape protocol later secret · 48 byte shared secret is resumable flag · can be used to initiate new connections 10© Ravi each keys generated from master secret, client/server random client_write_MAC_secret server_write_MAC_secret

  19. Part 1: Introduction What is the Internet, What is a protocol?

    E-Print Network [OSTI]

    Internet Backbones A Brief History of Computer Networking and the Internet Wireshark Lab 1 Part 2Part 1: Introduction What is the Internet, What is a protocol? The Network Edge, Core, and Access Electronic Mail in the Internet The Internet's Directory Service: DNS Socket Programming Python Programming

  20. A History of the Improvement of Internet Protocols Over Satellites Using ACTS \\Lambda

    E-Print Network [OSTI]

    Kruse, Hans

    A History of the Improvement of Internet Protocols Over Satellites Using ACTS \\Lambda Mark Allman of ACTS experiments on the efficacy of using standard Internet pro­ tocols over long­delay satellite­delay networks with non­zero bit­error rates on the performance of the suite of Internet protocols. In par

  1. A History of the Improvement of Internet Protocols Over Satellites Mark Allman

    E-Print Network [OSTI]

    Kruse, Hans

    A History of the Improvement of Internet Protocols Over Satellites Using ACTS Mark Allman NASA GRC on the efficacy of using standard Internet pro- tocols over long-delay satellite channels. These experi- ments-error rates on the performance of the suite of Internet protocols. In par- ticular, we have focused

  2. H-35 DOE-H-__ Compliance With Internet Protocol Version 6 (Ipv6...

    Broader source: Energy.gov (indexed) [DOE]

    H-35 DOE-H- Compliance With Internet Protocol Version 6 (Ipv6) In Acquiring Information Technology (July 2011) Prescription: Use as appropriate. Consider using in solicitations...

  3. Mobile Agent Based Advanced Service Architecture for H.323 Internet Protocol

    E-Print Network [OSTI]

    architecture addresses the full management life-cycle of advanced services, from open third party creationMobile Agent Based Advanced Service Architecture for H.323 Internet Protocol Telephony by Jingrong Advanced Service Architecture for H.323 Internet Protocol Telephony" submitted by Jingrong Tang, B

  4. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  5. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  6. US - Voice Over Internet Protocol Phone Service Providers Market Analysis

    E-Print Network [OSTI]

    Srinivasan, Vijaybabu

    2006-05-19

    .263 Bit stream in the Real-time Transport Protocol Vijaybabu Srinivasan Spring 2006 17 EMGT835 RTCP RTP Control protocol RTP Real-Time Transport H.323 Protocols... Total 100 Reputation/ Image: Evaluation Criteria: Reputation is the current sum total of the specific traits attributed to a company by people. A company?s reputation is produced by the memory impressions of its perceived actions over time. 13...

  7. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  8. Expansion of the internet protocol address space with "minor" disruption of current hardware or software 

    E-Print Network [OSTI]

    Wheatley, Philip Stephen

    1996-01-01

    Currently, the Internet suite of protocols uses a 32 bit network layer address and requires that each machine have a unique address. The problem: 32 bits only distinguishes 2 32 or 4,294,967,296 machines. Even with four billion addresses, experts...

  9. Architecture and Protocols for the Internet of Things: A Case Study Angelo P. Castellani, Nicola Bui, Paolo Casari, Michele Rossi, Zach Shelby, Michele Zorzi

    E-Print Network [OSTI]

    Rossi, Michele

    Architecture and Protocols for the Internet of Things: A Case Study Angelo P. Castellani, Nicola--In this paper, we describe a practical realization of an Internet-of-Things (IoT) architecture at the University 2.0 and the Internet of Things (IoT) [1] is shifting Web appli- cations and services concepts

  10. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  11. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  12. Unified Theory of Relativistic Identification of Information in a Systems Age: Proposed Convergence of Unique Identification with Syntax and Semantics through Internet Protocol version 6

    E-Print Network [OSTI]

    Datta, Shoumen

    2008-07-31

    This paper proposes to utilize internet protocol version six (IPv6) to uniquely identify not only things (objects) but also processes, relationships (syntax, semantics) and interfaces (sensors). Convergence of identification ...

  13. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  14. Effective Protocols for Mobile Communications and Networking

    SciTech Connect (OSTI)

    Espinoza, J.; Sholander, P.; Van Leeuwen, B,

    1998-12-01

    This report examines methods of mobile communications with an emphasis on mobile computing and wireless communications. Many of the advances in communications involve the use of Internet Protocol (IP), Asynchronous Transfer Mode (ATM), and ad hoc network protocols. However, many of the advances in these protocols have been focused on wired communications. Recently much focus has been directed at advancing communication technology in the area of mobile wireless networks. This report discusses various protocols used in mobile communications and proposes a number of extensions to existing protocols. A detailed discussion is also included on desirable protocol characteristics and evaluation criteria. In addition, the report includes a discussion on several network simulation tools that maybe used to evaluate network protocols.

  15. Inventing an Energy Internet: Concepts, Architectures and Protocols for Smart Energy Utilization

    ScienceCinema (OSTI)

    Tsoukalas, Lefteri [Purdue University, Purdue, Indiana, United States

    2010-01-08

    In recent years, the Internet is revolutionizing information availability much like the Power Grid revolutionized energy availability a century earlier. We will explore the differences and similarities of these two critical infrastructures and identify ways for convergence which may lead to an energy internet. Pricing signals, nodal forecasting, and short-term elasticities are key concepts in smart energy flows respecting the delicate equilibrium involved in generation-demand and aiming at higher efficiencies. We will discuss how intelligent forecasting approaches operating at multiple levels (including device or nodal levels) can ameliorate the challenges of power storage. In addition to higher efficiencies, an energy internet may achieve significant reliability and security improvements and offer greater flexibility and transparency in the overall energy-environmental relation.

  16. Inventing an Energy Internet: Concepts, Architectures, and Protocols for Smart Energy Utilization

    SciTech Connect (OSTI)

    Tsoukalas, Lefteri

    2009-04-29

    In recent years, the Internet is revolutionizing information availability much like the Power Grid revolutionized energy availability a century earlier. We will explore the differences and similarities of these two critical infrastructures and identify ways for convergence which may lead to an energy internet. Pricing signals, nodal forecasting, and short-term elasticities are key concepts in smart energy flows respecting the delicate equilibrium involved in generation-demand and aiming at higher efficiencies. We will discuss how intelligent forecasting approaches operating at multiple levels (including device or nodal levels) can ameliorate the challenges of power storage. In addition to higher efficiencies, an energy internet may achieve significant reliability and security improvements and offer greater flexibility and transparency in the overall energy-environmental relation.

  17. Inventing an Energy Internet: Concepts, Architectures and Protocols for Smart Energy Utilization

    SciTech Connect (OSTI)

    Tsoukalas, Lefteri

    2009-04-29

    In recent years, the Internet is revolutionizing information availability much like the Power Grid revolutionized energy availability a century earlier. We will explore the differences and similarities of these two critical infrastructures and identify ways for convergence which may lead to an energy internet. Pricing signals, nodal forecasting, and short-term elasticities are key concepts in smart energy flows respecting the delicate equilibrium involved in generation-demand and aiming at higher efficiencies. We will discuss how intelligent forecasting approaches operating at multiple levels (including device or nodal levels) can ameliorate the challenges of power storage. In addition to higher efficiencies, an energy internet may achieve significant reliability and security improvements and offer greater flexibility and transparency in the overall energy-environmental relation.

  18. 1. The Internet 1-1 Chapter 1: The Internet

    E-Print Network [OSTI]

    Brass, Stefan

    .htm · Gregory R. Gromov: The Roads and Crossroads of Internet History. http://www.internetvalley.com/intval1.html · Robert H'obbes' Zakon: Hobbes' Internet Timeline v5.1 http://info.isoc.org/guest/zakon/Internet/History of networks". · write one page about the history of the internet. · explain numeric IP addresses and port

  19. Sports over IP : dynamics and perspectives

    E-Print Network [OSTI]

    Blain, Emmanuel

    2010-01-01

    Technological advances are allowing the use of the Internet Protocol and the Internet infrastructure mainly built by cable and telecom operators for broadcasting purposes in the U.S. This disruption raises a business issue ...

  20. Effective Project Management Office Processes and Technology Transfer: Implementation of an Avaya Voice Over Internet Protocol Telephony System in Mexico

    E-Print Network [OSTI]

    Perez, Mary Louise

    2012-08-31

    Management Institute, Inc. (PMI) to implement Information Technology (IT) projects and to transfer technology know how knowledge to its subsidiary in Mexico. To answer this question, an assessment of Cisco and Avaya VoIP telephony systems was completed...

  1. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  2. 1 Internet Basics evolution of the web

    E-Print Network [OSTI]

    Verschelde, Jan

    Outline 1 Internet Basics evolution of the web IP addresses and URLs client/server and HTTP 2 and the internet L-18 23 February 2015 1 / 29 #12;networking and the internet markup languages 1 Internet Basics in browser 5 Summary + Assignments Intro to Computer Science (MCS 260) networking and the internet L-18 23

  3. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  4. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  5. Internet of Things Introduction to Internet ofThings (IoT)

    E-Print Network [OSTI]

    Roussos, George

    Internet of Things Peng Du #12;Content Introduction to Internet ofThings (IoT) Challenges IPv6 / 6LoWPAN ROLL #12;What is Internet of Things (IoT) Internet TCP/IP Things Criteria #12;Elements A brief idea what Internet ofThings is and why it is interesting to us Appreciated IPv6 is one

  6. Sun Microsystems -MIT Internet 0 Collaboration

    E-Print Network [OSTI]

    Sun Microsystems - MIT Internet 0 Collaboration Dr. Douglas W. Johnson Corporate Standards douglas.johnson@sun.com #12;Internet 0 MIT ­ Sun collaboration Desire to "network everything" #12;Internet design insight JXTA IP Layer Waves of the Internet Smart Dust MEMS Devices #12;Comments and Questions? douglas.johnson@sun

  7. Application Protocols o Multimedia

    E-Print Network [OSTI]

    Biagioni, Edoardo S.

    Application Protocols o Telnet o FTP o WWW o SMTP o NNTP o IRC 7 #12; IRC o Internet Relay Chat o similar to telnet o chat

  8. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  9. Internet e HTML Informatica -Facolt di Psicologia -Laurea magistrale

    E-Print Network [OSTI]

    Anselma, Luca

    1 Internet e HTML 1 Informatica - Facoltà di Psicologia - Laurea magistrale Ultima modifica: 9 ·Informatica - Facoltà di Psicologia - Laurea magistrale 2 Internet ·Informatica - Facoltà di Psicologia-mail ! Instant messanging ! Voice over IP ! Videogiochi multiplayer ! File sharing ! ... ·Informatica - Facoltà

  10. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  11. Internet Traffic Measurement Carey Williamson

    E-Print Network [OSTI]

    Williamson, Carey

    Internet Traffic Measurement Carey Williamson Department of Computer Science University of Calgary in the design, testing, and evaluation of Internet protocols and applications. The article begins with some background information on Internet traffic measurement, and then proceeds to discuss the "tools of the trade

  12. Embedded Internet Systems: Applications in Construction Proceedings IGLC '98

    E-Print Network [OSTI]

    Tommelein, Iris D.

    Embedded Internet Systems: Applications in Construction Proceedings IGLC '98 EMBEDDED INTERNET developments in Internet communications technology on site. In particular, the paper examines the role of a new Internet communication standard, TCP/IP 6, offers significant potential in terms of remote

  13. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  14. Internet Fish

    E-Print Network [OSTI]

    LaMacchia, Brian A.

    1996-08-01

    I have invented "Internet Fish," a novel class of resource-discovery tools designed to help users extract useful information from the Internet. Internet Fish (IFish) are semi-autonomous, persistent information brokers; ...

  15. Deniable Internet Key Exchange Andrew C. Yao

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Deniable Internet Key Exchange Andrew C. Yao Frances F. Yao Yunlei Zhao§ Bin Zhu¶ Abstract In this work, we develop a family of protocols for deniable Internet Key-Exchange (IKE) with the following of privacy protection (especially for E-commerce over Internet), this work is naturally of practical interest

  16. Internet Engineering Task Force Sally Floyd INTERNET DRAFT David Black

    E-Print Network [OSTI]

    Floyd, Sally

    such as intermediate routers. IPsec protocols support two operating modes, transport mode and tunnel mode. Explicit bits in the IP header for ECN experimentation conflicts with header processing at IPsec tunnel endpoints in a manner that makes ECN unusable in the presence of IPsec tunnels. This document considers

  17. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  18. Internet Traffic Matrices: A Primer Paul Tune and Matthew Roughan

    E-Print Network [OSTI]

    Roughan, Matthew

    Internet Traffic Matrices: A Primer Paul Tune and Matthew Roughan School of Mathematical Sciences of various services from the Internet has led to an exponential growth of Internet traffic in the last decade for testing routing protocols. We conclude the chapter by summarising open questions in Internet traffic

  19. Internet Rehab

    E-Print Network [OSTI]

    Hacker, Randi; Tsutsui, William

    2007-05-09

    Broadcast Transcript: This Postcard is a public service message to America's teen internet fans: be grateful you live here and not in China. A recent survey revealed that 14 percent of Chinese teens are considered in danger of becoming internet...

  20. Internet Sampler 

    E-Print Network [OSTI]

    2006-08-23

    stream_source_info GnatkipInternetCrossstitchsampler.pdf.txt stream_content_type text/plain stream_size 1594 Content-Encoding UTF-8 stream_name GnatkipInternetCrossstitchsampler.pdf.txt Content-Type text/plain; charset=UTF-8... Gnat (gnatkip) wrote, 2006-08-23 16:36:00 Art: Internet Sampler Title: Internet Sampler Media: Excel, Photoshop, Crosstitch.com Caption Maker, alphabet by Carrie's Creations, graphics from Windows, IE, and Firefox Notes: An illustration...

  1. Accepted for Presentation at the International Conference on Internet Computing, Las Vegas, Nevada, June 25-29, 2001 Intelligent Trading Networks: Peer-to-Peer Trading in

    E-Print Network [OSTI]

    McLaren, Bruce Martin

    's Enterprise Resource Planning (ERP) system using a customized protocol of XML documents. Keywords: E at the International Conference on Internet Computing, Las Vegas, Nevada, June 25-29, 2001 2 Internet Browser ERP B2B Exchange Internet Browser ERP Internet Browser ERP ERP Internet Browser ERP Internet Browser ERP Internet

  2. Dynamic, transparent Internet server replication using HYDRANET 

    E-Print Network [OSTI]

    Dillon, Geoffrey A.

    1998-01-01

    The exponential growth of the use of the Internet has hics. caused increasing stress on the networking infrastructure. Routers, servers and protocols are reaching their limits and need room to scale up their capacities to meet user demands. Client...

  3. Characteristics of Fragmented IP Traffic on Internet Links

    E-Print Network [OSTI]

    California at San Diego, University of

    in this paper with the work on model theoretic parchments [MTP98]. 2 Signatures For the purpose of this paper

  4. Broadcasting over Internet-Yatindra Nath Singh

    E-Print Network [OSTI]

    Singh Yatindra Nath

    Broadcasting over Internet- II Yatindra Nath Singh Electrical Engineering Department http://home.iitk.ac.in/~ynsingh Email: ynsingh@iitk.ac.in #12;06-12-07 ©2007 Y.N.Singh, IIT kanpur 2 PIM-SM (protocol independent;06-12-07 ©2007 Y.N.Singh, IIT kanpur 3 Independent of routing protocol Use unicast routing information base

  5. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  6. Internet 0

    E-Print Network [OSTI]

    Krikorian, Raffi Chant, 1978-

    2004-01-01

    The Internet is currently unsuitable for small devices because the assumptions behind its architecture for desktop and server computers do not scale down. Implementations and costs that apply to larger machines have a ...

  7. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  8. Selections: Internet Voting with Over-the-Shoulder Coercion-Resistance

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Selections: Internet Voting with Over-the-Shoulder Coercion-Resistance Jeremy Clark and Urs cryptographic voting protocol that is end-to-end verifiable and suitable for Internet voting. After a one to Internet voting.1 Many nation-states are considering, piloting or using Internet voting in elections

  9. Internet Engineering Task Force (IETF) J. Chu Request for Comments: 6928 N. Dukkipati

    E-Print Network [OSTI]

    Cortes, Corinna

    Internet Engineering Task Force (IETF) J. Chu Request for Comments: 6928 N. Dukkipati Category group. Status of This Memo This document is not an Internet Standards Track specification an Experimental Protocol for the Internet community. This document is a product of the Internet Engineering Task

  10. Internet Engineering Task Force (IETF) M. Mathis Request for Comments: 6937 N. Dukkipati

    E-Print Network [OSTI]

    Cortes, Corinna

    Internet Engineering Task Force (IETF) M. Mathis Request for Comments: 6937 N. Dukkipati Category algorithm. Status of This Memo This document is not an Internet Standards Track specification an Experimental Protocol for the Internet community. This document is a product of the Internet Engineering Task

  11. Secure Wireless Payment Protocol School of Computer Science

    E-Print Network [OSTI]

    Kranakis, Evangelos

    Secure Wireless Payment Protocol Hong Wang School of Computer Science Carleton University 1125 Colonel By Drive, Ottawa, Canada Abstract With the convergence of wireless data communication and the Internet, more and more Internet services are now being used in the wireless area. Mobile payment protocols

  12. Adaptive best effort protocols for video delivery 

    E-Print Network [OSTI]

    Madhwaraj, Ashwin Raj

    1998-01-01

    data when transmitted over best-effort networks like the Internet. The protocols are end-to-end, and do not propose any modifications (like reservations) to the network infrastructure-hence, they can be used over the existing Internet. The design...

  13. The Department of Energys Implementation of Voice over Internet...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Implementation of Voice over Internet Protocol Telecommunications Networks DOEIG-0915 June 2014 U.S. Department of Energy Office of Inspector General Office of Audits and...

  14. Energy Internet

    Office of Energy Efficiency and Renewable Energy (EERE)

    Energy Internet is commercializing a software platform for decentralized scheduling of energy-producing or consuming assets on the electricity grid. This scalable system will revolutionize the control of distributed solar generation, electric vehicle charging, intelligent appliances and other smart grid technologies.

  15. Performance of Routing Protocols in HF Wireless Networks Eric E. Johnson*

    E-Print Network [OSTI]

    Johnson, Eric E.

    Balakrishnan* , and Zibin Tang* Klipsch School of Electrical and Computer Engineering New Mexico State and Routing Protocol (WARRP) and the Internet standard Optimized Link State Routing (OLSR) protocol (RFC-3626 in the Internet. The Optimized Link State Routing (OLSR) protocol (RFC-3626) [1] is an optimization

  16. 4. Wrzburger Workshop ,,IP Netzmanagement, IP Netzplanung und Optimierung"

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    Protocol (ICMP, ,,ping" and ,,traceroute" Funktionen) - Simple Network Management Protocol (SNMP) - DNSRessourcenmanagement Architektur R R R R R R S R R R S S QoS Architektur Harte und weiche QoS Garantien DiffServ Netz mit

  17. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  18. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  19. Beej's Guide to Network Programming Using Internet Sockets

    E-Print Network [OSTI]

    Mansour, Yishay

    to do cool Internet programming, but you don't have time to wade through a gob of structs trying structs­­Know these, or aliens will destroy the planet! Convert the Natives! #12; IP Addresses and How/O Multiplexing. Cool! More references Disclaimer and Call for Help What is a socket? You hear talk of "sockets

  20. Implementing the Interplanetary Internet

    E-Print Network [OSTI]

    Wood, Lloyd

    Implementing the Interplanetary Internet differing approaches Lloyd Wood Surrey Space Centre guest lecture Tuesday 17 February 2009. #12;22Interplanetary Internet ­ Lloyd Wood How did it all begin?How did Internet ­ Lloyd Wood VintVintVintVint sets up an Internet Society SIGsets up an Internet Society SIGsets

  1. Demystifying Internet traffic

    E-Print Network [OSTI]

    Vishwanath, Kashi Venkatesh

    2008-01-01

    Controlled Internet - Swing predictions1.2.2. From Internet-Scale Topology to Speci?c1.6 Figure 1.7 Early Internet topology: The Arpanet . .

  2. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  3. One-time pad booster for Internet

    E-Print Network [OSTI]

    Geraldo A. Barbosa

    2007-04-11

    One-time pad encrypted files can be sent through Internet channels using current Internet protocols. However, the need for renewing shared secret keys make this method unpractical. This work shows how users can use a fast physical random generator based on fluctuations of a light field and the Internet channel to directly boost key renewals. The transmitted signals are deterministic but carries imprinted noise that cannot be eliminated by the attacker. Thus, a one-time pad for Internet can be made practical. Security is achieved without third parties and not relying on the difficulty of factoring numbers in primes. An informational fragility to be avoided is discussed. Information-theoretic analysis is presented and bounds for secure operation are determined.

  4. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  5. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  6. Incentives and Internet Algorithms

    E-Print Network [OSTI]

    Feigenbaum, Joan

    Game Theory Internet Design #12;9 Game Theory and the Internet · Long history of work: ­ NetworkingIncentives and Internet Algorithms Joan Feigenbaum Yale University http://www.cs.yale.edu/~jf Scott with selfishness? · Internet Architecture: robust scalability ­ How to build large and robust systems? #12

  7. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  8. Interactions Among Ionospheric Propagation, HF Modems, and Data Protocols

    E-Print Network [OSTI]

    Johnson, Eric E.

    Mexico State University Abstract The well-known challenges in using the ionospheric skywave channel to Internet-style network- and ap- plication-layer protocols, which have been designed with reliable, high that will form the basis of reliable Internet operation via next-generation HF radio networks. Introduction

  9. ARQ PROTOCOL FEATURES FOR HF RADIO LINKS Eric E. Johnson

    E-Print Network [OSTI]

    Johnson, Eric E.

    ARQ PROTOCOL FEATURES FOR HF RADIO LINKS Eric E. Johnson New Mexico State University ABSTRACT The explosion of interest in using Internet-style applica- tions over wireless links prompts investigation links with Internet-style workloads. The investigation is focused on high-frequency radio links

  10. Georgia Tech Manufacturing Institute | 813 Ferst Drive, N.W. | Atlanta, GA 30332-0560 | (404) 894-9100 | www.manufacturing.gatech.edu Point of View: The Internet of Things for Manufacturing

    E-Print Network [OSTI]

    Das, Suman

    -9100 | www.manufacturing.gatech.edu Point of View: The Internet of Things for Manufacturing (IoTfM) By Introduction The Internet of Things is predicted to have a huge impact on the future of manu- facturing. According to the Industrial IP Advantage resource center, the Internet of Things has an estimated value

  11. NOVAS APLICAES MULTIMDIA NA INTERNET 2 V. Bastos, E.Bergamini#, L. Ceze, T.C.M.B. Carvalho, J. Figueiredo*, S.S. Furuie*,

    E-Print Network [OSTI]

    Ceze, Luis

    o desempenho da rede, verificado através de software de gerenciamento. Palavras Chave: Internet 2-acesso, todos com suporte a protocolos de roteamento IP, protocolos para IP multicast e #12;software agente SNMP possível devido ao uso de uma estação de gerenciamento, através da qual era possível avaliar a operação dos

  12. Internet Exchanges: Enabling Local Online Communities

    E-Print Network [OSTI]

    Mitchell, Keith

    Interconnect Principles Internet Exchange History Internet Exchange Models Internet Exchange Security Setting, Foundry #12;Internet Exchanges History #12;A decade+ of Internet Exchanges The London Internet ExchangeInternet Exchanges: Enabling Local Online Communities Keith Mitchell Chair, United Kingdom Network

  13. Voice and Data Network of Convergence and the Application of Voice over IP

    SciTech Connect (OSTI)

    Eldridge, J.M.

    2000-11-01

    This paper looks at emerging technologies for converging voice and data networks and telephony transport over a data network using Internet Protocols. Considered are the benefits and drivers for this convergence. The paper describes these new technologies, how they are being used, and their application to Sandia.

  14. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  15. Entanglement percolation on a quantum internet with scale-free and clustering characters

    SciTech Connect (OSTI)

    Wu Liang; Zhu Shiqun

    2011-11-15

    The applicability of entanglement percolation protocol to real Internet structure is investigated. If the current Internet can be used directly in the quantum regime, the protocol can provide a way to establish long-distance entanglement when the links are pure nonmaximally entangled states. This applicability is primarily due to the combination of scale-free degree distribution and a high level of clustering, both of which are widely observed in many natural and artificial networks including the current Internet. It suggests that the topology of real Internet may play an important role in entanglement establishment.

  16. The American Internet Voter

    E-Print Network [OSTI]

    Hall, Thad E.

    Since the creation of the Internet, there have been a seemingly never-ending number of books and analyses about the role of the Internet in Politics. Many of these books fail to keep in mind that the behavior of ...

  17. Internet Performance Measurement Collaborators

    E-Print Network [OSTI]

    Internet Performance Measurement Collaborators Cross Industry Working Team (XIWT) High Performance of the timestamp mechanism in the ANS Surveyor Probe device FY98 · GITS Internet Performance Measurement Toolkit in Internet performance measurement through improved statistical analysis of the data that is collected

  18. LAWYERSSHOULD KNOW THE INTERNET

    E-Print Network [OSTI]

    California at San Diego, University of

    TEN THINGS LAWYERSSHOULD KNOW ABOUT THE INTERNET The COMMONS Initiative: Cooperative Measurement http://www.caida.org/publications/papers/2008/10_things_Lawyers_Should_Know_About_The_Internet Adapted and Modeling of Open Networked Systems KIMBERLY CLAFFY CAIDA: Cooperative Association for Internet Data

  19. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  20. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  1. Long-Range Correlations and Memory in the Dynamics of Internet Interdomain Routing

    E-Print Network [OSTI]

    Kitsak, Maksim; Havlin, Shlomo; Krioukov, Dmitri

    2015-01-01

    Data transfer is one of the main functions of the Internet. The Internet consists of a large number of interconnected subnetworks or domains, known as Autonomous Systems. Due to privacy and other reasons the information about what route to use to reach devices within other Autonomous Systems is not readily available to any given Autonomous System. The Border Gateway Protocol is responsible for discovering and distributing this reachability information to all Autonomous Systems. Since the topology of the Internet is highly dynamic, all Autonomous Systems constantly exchange and update this reachability information in small chunks, known as routing control packets or Border Gateway Protocol updates. Motivated by scalability and predictability issues with the dynamics of these updates in the quickly growing Internet, we conduct a systematic time series analysis of Border Gateway Protocol update rates. We find that Border Gateway Protocol update time series are extremely volatile, exhibit long-term correlations a...

  2. Introduzione alla rete Internet Introduzione alla rete Internet

    E-Print Network [OSTI]

    Giaccone, Paolo

    Introduzione alla rete Internet Pag. 1 Introduzione alla rete Internet INTRODUZIONE ALLE RETI. Internet: nomenclatura · Host: calcolatore collegato a Internet ­ ogni host può essere client e/o server sotto-reti, sotto la stessa autorità amministrativa (ISP: Internet Service Provider) host 4 subnet 1

  3. Introduzione alla rete Internet Introduzione alla rete Internet

    E-Print Network [OSTI]

    Giaccone, Paolo

    Introduzione alla rete Internet Pag. 1 Introduzione alla rete Internet INTRODUZIONE ALLE RETI. Internet: nomenclatura · Host: calcolatore collegato a Internet ­ ogni host può essere client e/o server sotto-reti, sotto la stessa autorità amministrativa (ISP: Internet Service Provider) #12;Introduzione

  4. Introduzione alla rete Internet Introduzione alla rete Internet

    E-Print Network [OSTI]

    Giaccone, Paolo

    Introduzione alla rete Internet Pag. 1 Introduzione alla rete Internet INTRODUZIONE ALLE RETI, 559 Nathan Abbott Way, Stanford, California 94305, USA. #12;Introduzione alla rete Internet Pag. 2 Internet: nomenclatura · Host: calcolatore collegato a Internet ­ ogni host può essere client e/o server

  5. Master of Science Thesis Stockholm, Sweden 2008

    E-Print Network [OSTI]

    Maguire Jr., Gerald Q.

    A FCOA Foreign Agent Care of Address FSDs File System Drivers GFA Gateway Foreign Agent HA Home Agent HAL Internet Protocol version 6 IP-in-IP or IP-IN-IP IP in IP encapsulation (a method of tunneling) ipintr

  6. ELISA: European Linkage between Internet Integrated and Differentiated Services over ATM

    E-Print Network [OSTI]

    AG ()Dresden University of Technology, Department of Computer Science () Siemens AG () National-Fokus Abstract Nowadays we are witnessing the growth of Internet at an unprecedented rate. However, the current to network operators to integrate Internet protocols and the mature ATM QoS technology. This paper presents

  7. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  8. Using Internet nodes and routers onboard satellites W. Ivancic,

    E-Print Network [OSTI]

    Wood, Lloyd

    , California. Air Force Space Battlelab, Schriever Air Force Base, Colorado. ~ Universal Space Network, Inc) demonstration that took place at Vandenberg Air Force Base. VMOC is one of the US Office of the Secretary were commissioned and used, the onboard router acted as an Internet-Protocol compliant, space-based

  9. Editor: Charles Petrie petrie@stanford.edu 2 Published by the IEEE Computer Society 1089-7801/14/$31.00 2014 IEEE IEEE INTERNET COMPUTING

    E-Print Network [OSTI]

    Petrie, Charles

    -7801/14/$31.00 © 2014 IEEE IEEE INTERNET COMPUTING N o, I'm not trying to apply the term "Inter- net of Things function, and is carried out by the Internet Assigned Num- bers Authority (IANA). Ok, is this a thing for Internet protocols, some of which include things like MIME types and TCP port numbers. Most importantly

  10. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  11. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  12. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  13. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  14. Geography-based structural analysis of the Internet

    SciTech Connect (OSTI)

    Kasiviswanathan, Shiva; Eidenbenz, Stephan; Yan, Guanhua

    2010-01-01

    In this paper, we study some geographic aspects of the Internet. We base our analysis on a large set of geolocated IP hop-level session data (including about 300,000 backbone routers, 150 million end hosts, and 1 billion sessions) that we synthesized from a variety of different input sources such as US census data, computer usage statistics, Internet market share data, IP geolocation data sets, CAJDA's Skitter data set for backbone connectivity, and BGP routing tables. We use this model to perform a nationwide and statewide geographic analysis of the Internet. Our main observations are: (1) There is a dominant coast-to-coast pattern in the US Internet traffic. In fact, in many instances even if the end-devices are not near either coast, still the traffic between them takes a long detour through the coasts. (2) More than half of the Internet paths are inflated by 100% or more compared to their corresponding geometric straight-line distance. This circuitousness makes the average ratio between the routing distance and geometric distance big (around 10). (3) The weighted mean hop count is around 5, but the hop counts are very loosely correlated with the distances. The weighted mean AS count (number of ASes traversed) is around 3. (4) The AS size and the AS location number distributions are heavy-tailed and strongly correlated. Most of the ASes are medium sized and there is a wide variability in the geographic dispersion size (measured in terms of the convex hull area) of these ASes.

  15. Internet Optometry: Assessing the Broken Glasses in Internet Reachability

    E-Print Network [OSTI]

    Roughan, Matthew

    Internet Optometry: Assessing the Broken Glasses in Internet Reachability Randy Bush Olaf Maennel Matthew Roughan Steve Uhlig Internet Initiative Japan Loughborough University of Adelaide TU Berlin by today's Internet. Unfortunately, this does not imply that the com- munity has a deep understanding of it

  16. Internet optometry: assessing the broken glasses in Internet reachability

    E-Print Network [OSTI]

    Roughan, Matthew

    Internet optometry: assessing the broken glasses in Internet reachability Randy Bush Olaf Maennel of as the most basic service provided by today's Internet. Unfortunately, this does not imply that the community topological properties of the Internet. 1. INTRODUCTION It may be too obvious to mention, but the fundamental

  17. From the Internet of Computers to the Internet of Things

    E-Print Network [OSTI]

    From the Internet of Computers to the Internet of Things Friedemann Mattern and Christian building blocks of the "Internet of Things". In particu- lar, we consider RFID and other important with a discussion of social and governance issues that are likely to arise as the vision of the Internet of Things

  18. 1. The Internet 1-1 Chapter 1: The Internet

    E-Print Network [OSTI]

    Brass, Stefan

    1. The Internet 1-1 Chapter 1: The Internet References: · Rainer Klute: Das World Wide Web. Addison-Wesley, 1996, ISBN: 389319763X. · RRZN Hannover: Internet. Ein Einf¨uhrung in die Nutzung der Internet.psychologie.uni-bonn.de/sozial/staff/musch/history.htm · Gregory R. Gromov: The Roads and Crossroads of Internet History. http://www.internetvalley.com/intval1

  19. THE INTERNET TRAJECTORY AND TECHNOLOGY

    E-Print Network [OSTI]

    Natelson, Douglas

    THE INTERNET TRAJECTORY AND TECHNOLOGY Dr. Leonard KleinrockDistinguished Professor of Computer Science UCLA In this presentation we discuss the origins and trajectory of the Internet. The early work of the critical events in the growth of the Internet. We also describe our vision of where the Internet is heading

  20. Sustainable Internet Architecture PROJECT DESCRIPTION

    E-Print Network [OSTI]

    Kuzmanovic, Aleksandar

    Sustainable Internet Architecture PROJECT DESCRIPTION 1 Introduction The Internet currently plays of challenges. Numerous research studies on a new Internet architecture (e.g., [16, 37, 48, 54, 55]) have on both the new Internet architecture itself and the underlying problems that motivate it. We look

  1. Internet Polling Development Report 

    E-Print Network [OSTI]

    Klima, P.; Lockhart, D.; Haberl, J. S.

    2001-01-01

    This is the final report which documents the development of Internet-based data logger polling. The project consists of two main tasks: the development of automated polling procedures that can be launched remotely with no operator input...

  2. Internet Voting in Estonia

    E-Print Network [OSTI]

    Trechsel, Alexander H.

    Several countries have conducted Internet voting trials in binding public elections over the past decade, including Switzerland, the United Kingdom, and the United States. These trials have been conducted at the local and ...

  3. The Internet Protocol Journal Trends in Viruses and Worms

    E-Print Network [OSTI]

    Chen, Thomas M.

    University he modern computer virus was conceived and demonstrated by Fred Cohen in 1983. Like biological viruses, computer viruses reproduce by attaching to a normal program or document and taking over control it easier for malicious programs to travel between computers by themselves. Recent virus and worm outbreaks

  4. Weaving Measurements Into Internet Protocols and Services Research Statement

    E-Print Network [OSTI]

    Plaisted, David A.

    be fully realized only if the number of monitors needed for completely monitoring a target network and then place monitors at the smallest set of nodes that can collectively monitor a complete target network

  5. Analysis of an internet voting protocol Kristian Gjsteen

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    essentially consists of a short sequence of options (a party list followed by selection of candidates, at most about a hundred options in total) chosen from a small set of possible options (at most a few thousand elections. There are no write-ins. There are significant functional constraints on any real-world voting

  6. Protocol for House Parties

    Broader source: Energy.gov [DOE]

    Protocol for House Parties, from the Tool Kit Framework: Small Town University Energy Program (STEP).

  7. Cost Analysis of NEMO Protocol Entities Md. Shohrab Hossain, Mohammed Atiquzzaman, William Ivancic

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    Cost Analysis of NEMO Protocol Entities Md. Shohrab Hossain, Mohammed Atiquzzaman, William Ivancic to ensure connectivity of the mobile nodes with the Internet. However, there has been no comprehensive cost analysis of mobility protocol entities that considers all possible costs. In this paper, we have developed

  8. On the Security of the Tor Authentication Protocol

    E-Print Network [OSTI]

    Goldberg, Ian

    On the Security of the Tor Authentication Protocol Ian Goldberg David R. Cheriton School@cs.uwaterloo.ca Abstract. Tor is a popular anonymous Internet communication sys- tem, used by an estimated 250,000 users to anonymously exchange over five terabytes of data per day. The security of Tor depends on properly

  9. Analysing the PGM Protocol with UPPAAL Batrice Brard Patricia Bouyer

    E-Print Network [OSTI]

    Doyen, Laurent

    the probability of negative acknowledgements (NAK) implosion and the load of the network due to retransmissions of lost packets. This protocol was presented to the Internet Engineering Task Force as an open reference, which turns out not to be always verified but to depend on the values of several parameters that we

  10. Use of Internet panels to conduct surveys

    E-Print Network [OSTI]

    Hays, RD; Liu, H; Kapteyn, A

    2015-01-01

    surveys. Journal of Medical Internet Research, 15, e260.of RDD telephone surveys and internet surveys conducted withtelephone interviewing versus the Internet: Comparing sample

  11. Internet Performance to Africa

    SciTech Connect (OSTI)

    Cottrell, L

    2003-10-01

    We report the first results ever for real-time Internet performance to Africa using the PingER methodology. Multiple monitoring hosts were used to enable comparisons with performance from different parts of the world. From these preliminary measurements, we have found that Internet packet losses to some African sites in recent months range from very poor to bad (> 12%), some getting better, others are holding steady or getting worse. This, together with the average monthly Round Trip Times, imply end-to-end maximum TCP throughputs that are order of magnitudes different between countries in the region. Africa is shown to be far from the Internet performance in industrialized nations due to the poor infrastructure in place today. These monitoring efforts can provide valuable information to analyze the relative rates of future improvement and today they help us to quantify the digital divide and can provide quantitative information to policy makers.

  12. Noise Secured Internet

    E-Print Network [OSTI]

    Geraldo A. Barbosa

    2006-02-28

    This work shows how a secure Internet can be implemented through a fast key distribution system that uses physical noise to protect the transmitted information. Starting from a shared random sequence $K_0$ between two (or more) users, longsequences $R$ of random bits can be shared. The signals sent over the Internet are deterministic but have a built-in Nature-made uncertainty that protects the shared sequences. After privacy amplification the shared $R$ random bits --encrypted by noise-- are subsequently utilized in one-time-pad data ciphering.

  13. ENERGY EFFICIENCY TECHNOLOGY ROADMAP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    IP v.6 - Internet protocol version 6 Emergence of component level standards addressing energy use optimization Networking communication data compression speed bandwidth...

  14. User innovation in Internet businesses

    E-Print Network [OSTI]

    Park, Jin Suk, S.M. Massachusetts Institute of Technology

    2007-01-01

    This paper examines the concept of user innovation, how this concept has been applied to internet businesses, and behaviors and motivation of the users who have participated in user innovative activities for internet ...

  15. THE RIMINI PROTOCOL Oil Depletion Protocol

    E-Print Network [OSTI]

    Keeling, Stephen L.

    1 THE RIMINI PROTOCOL an Oil Depletion Protocol ~ Heading Off Economic Chaos and Political Conflict During the Second Half of the Age of Oil As proposed at the 2003 Pio Manzu Conference Soaring oil prices have drawn attention to the issue of the relative supply and demand for crude oil

  16. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  17. Future Internet Research, Services

    E-Print Network [OSTI]

    Sztrik, János

    -financed by the European Social Fund. National Development Agency www.ujszechenyiterv.gov.hu 06 40 638 638 Foreword research and development projects were granted, and many young colleagues were involved into the work;3 Future Internet Research, Services and Technology The project is supported by the European Union and co

  18. Internet Institute University of Oxford

    E-Print Network [OSTI]

    The Oxford Internet Institute University of Oxford #12;A significant proportion of social, economic Science Internet Economics Connectivity, Inclusion and InequalityEducation, Wellbeing and Digital Life Digital Knowledge and Culture #12;The Oxford Internet Institute It's an incredibly exciting time

  19. Geometrie im Internet Wolfgang Rath

    E-Print Network [OSTI]

    Havlicek, Hans

    Geometrie im Internet Wolfgang Rath Institut für Geometrie, TU Wien rath@geometrie.tuwien.ac.at http://www.geometrie.tuwien.ac.at/rath Version 1999-11-15 #12;Geometrie im Internet - Wolfgang Rath......................................................................................... 5 1.1 SCHNELLER EINSTIEG INS INTERNET

  20. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  1. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  2. Webinar: Hydrogen Refueling Protocols

    Broader source: Energy.gov [DOE]

    Video recording and text version of the webinar titled, Hydrogen Refueling Protocols, originally presented on February 22, 2013.

  3. Application Protocol Reference Architecture Application Protocol Reference Architecture

    E-Print Network [OSTI]

    van Sinderen, Marten

    Application Protocol Reference Architecture 165 Chapter 7 Application Protocol Reference Architecture This chapter proposes an alternative reference architecture for application protocols. The proposed reference architecture consists of the set of possible architectures for application protocols

  4. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  5. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  6. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  7. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  8. INTERNET USE POLICY Updated 8/2011

    E-Print Network [OSTI]

    INTERNET USE POLICY Updated 8/2011 Access to Internet Sites The Library offers access to the Internet as an integral part of its other information resources. In keeping with the principles of free unfiltered Internet access and does not limit patron access to information on the Internet based solely

  9. routing, Internet, BGP Internet Expansion, Refinement and Churn

    E-Print Network [OSTI]

    California at San Diego, University of

    routing, Internet, BGP Internet Expansion, Refinement and Churn ANDRE BROIDO, EVI NEMETH, KC CLAFFY measures reflect contributions of opposite sign, and that true measure of variation, or churn, is the sum a standalone prefix to a root prefix) are instances of routing system churn. One advantage of using our notion

  10. routing, Internet, BGP Internet Expansion, Refinement and Churn

    E-Print Network [OSTI]

    California at San Diego, University of

    routing, Internet, BGP Internet Expansion, Refinement and Churn ANDRE BROIDO, EVI NEMETH, KC CLAFFY contributions of opposite sign, and that true measure of variation, or churn, is the sum of their absolute a standalone prefix to a root prefix) are instances of routing system churn. One advantage of using our notion

  11. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  12. Energy-Efficient Transmission for Multimedia Streams in Last-hop Wireless Internet

    E-Print Network [OSTI]

    Energy-Efficient Transmission for Multimedia Streams in Last-hop Wireless Internet Invited Paper characteristics that can be leveraged to design energy-efficient loss recovery mechanisms. Given their loss, we first present an analysis of an energy-efficient MAC-layer protocol, called Fast Transmit MAC

  13. Creating Sustainable Regulation of the Open Internet

    E-Print Network [OSTI]

    Hantover, Lixian

    2013-01-01

    in the midst of a rapid Internet sea change. Every day, newfor any new regulation of the Internet is sustainability: toL.J. 1. 49 2 The Pew Internet and American Life project

  14. Opportunities and Inaudibilities: Asian American Internet Musicians

    E-Print Network [OSTI]

    Regullano, Eileen

    2015-01-01

    60–73. Spooner, Tom. “Asian-Americans and the Internet. ”Pew Research Center’s Internet & American Life Project.americans-and-the-internet/. Timothy DeLaGhetto Dog Joke. ,

  15. INTEGRATED RIVER QUALITY MANAGEMENT USING INTERNET TECHNOLOGIES

    E-Print Network [OSTI]

    INTEGRATED RIVER QUALITY MANAGEMENT USING INTERNET TECHNOLOGIES P. Cianchi*, S. Marsili such a computing architecture can be implemented using current internet technologies. Based on the "intelligent a normal web browser. KEYWORDS River water quality, Environmental management, Internet computing, Systems

  16. Distributed Internet Security and Measurement

    E-Print Network [OSTI]

    New Mexico, University of

    , New Mexico May, 2009 #12;Distributed Internet Security and Measurement by Josh Karlin B.A., Computer#12;Distributed Internet Security and Measurement by Josh Karlin B.A., Computer Science for the Degree of Doctor of Philosophy Computer Science The University of New Mexico Albuquerque, New Mexico May

  17. Mashups--Web Web Internet

    E-Print Network [OSTI]

    Mashups-- Web Web 1. Web Internet mashup Wikipedia Mashup web api web Web Internet Mashup public APIs, XML/RSS/Atom feeds, web services, HTML Mashup Web 2.0 Web 2.0 Mashup Web Web Web api eBay, Amazon, Google and Yahoos APIs Mashups Web Mashup Mashup 2. Mashup [2] Mashup

  18. Internet Usage Mining Using Random Forests

    E-Print Network [OSTI]

    Liu, Xuening

    2013-01-01

    Los Angeles Internet Usage Mining Using Random Forests Aof the Thesis Internet Usage Mining Using Random Forests bydata emerges, data mining is finally in the spotlight. This

  19. Introduction to Internetworking Introduction to Internetworking

    E-Print Network [OSTI]

    n Tuesday . 7:00 Introduction to Internetworking elliot . 8:10 The Internet Protocol (IP) ­ elliot:00 Hardware elliot . 8:00 Internet Engineering jhawk . 9:00 Technical Internet Tools ­ elliot . 9:30 IP to Internetworking A Model n ISO­OSI Networking Model n History n The Model . Application Layer . Presentation Layer

  20. A Handy Internet Politics Measurement Note Internet Politcs Measurement Measurement and analysis on the Internet politics through

    E-Print Network [OSTI]

    Kuzmanovic, Aleksandar

    on the Internet politics through case studies on (i) well-known but failed technical ideas in history, (iiA Handy Internet Politics Measurement Note Internet Politcs Measurement ­ Measurement and analysis Difficulity to Enforce Cyberlaws and Related Regulations (Japan, Germany, US)............4 Internet Addiction

  1. Wumpus Protocol Analysis

    E-Print Network [OSTI]

    White, Barbara Y.

    The goal of this research was to assist in the creation of a new, improved Wumpus advisor by taking protocols of ten people learning to play Wumpus with a human coach. It was hoped that by observing these subjects learn ...

  2. A practical approach to the interGroup protocols

    SciTech Connect (OSTI)

    Berket, Karlo [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Agarwal, Deborah A. [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States); Chevassut, Olivier [Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States)

    2001-11-12

    Existing reliable ordered group communication protocols have been developed for local-area networks and do not, in general, scale well to large numbers of nodes and wide-area networks. The InterGroup suite of protocols is a scalable group communication system that introduces an unusual approach to handling group membership, and supports a receiver-oriented selection of service. The protocols are intended for a wide-area network, with a large number of nodes, that has highly variable delays and a high message loss rate, such as the Internet. The levels of the message delivery service range from unreliable unordered to reliable timestamp ordered. We also present a secure group layer that builds on InterGroup to provide SSL-like security for groups.

  3. Creating the Internet of Your Things

    E-Print Network [OSTI]

    Chaudhuri, Surajit

    Creating the Internet of Your Things Barb Edson General Manager Microsoft Corp. Executive Summary. The Internet of Things, also known as IoT, is one such trend. The Internet of Things provides vast opportunities, but it can also pose a challenge to enterprises. The Internet of Things has kept plenty

  4. Internet Mathematical Olympiads Alexander Domoshnitsky, Dr.

    E-Print Network [OSTI]

    Spagnolo, Filippo

    146 Internet Mathematical Olympiads Alexander Domoshnitsky, Dr. Professor of Mathematics, DeanD on Education, Ariel University Center, Ariel, Israel romany@ariel.ac.il Abstract Modern Internet technologies the Internet. Simple Internet technologies supply audio and video connection between participants

  5. TRACK Internet Service 3.1 Introduction

    E-Print Network [OSTI]

    Froude, Lizzie

    Chapter 3 TRACK Internet Service 3.1 Introduction In chapter 1 the idea of a TRACK Internet Service single computer may be infeasible. An Internet Service has been developed to address these issues of data storage and computer CPU. The Internet Service has been used to help with the large amount of data

  6. Lightweight Message Authentication for the Internet of

    E-Print Network [OSTI]

    Maguire Jr., Gerald Q.

    Lightweight Message Authentication for the Internet of Things RIKARD HÖGLUND KTH ROYAL INSTITUTE for the Internet of Things Rikard Höglund 2014-11-24 Master's Thesis Examiner and academic adviser Professor Gerald capable of connecting to the Internet has grown enormously. The Internet of Things describes a scenario

  7. Confessions of an Internet alautun, Maya glyph

    E-Print Network [OSTI]

    Mills, David L.

    the perspective of the Internet program managers, I was the internet greasemonkey. I built things and tested themConfessions of an Internet Timekeeper alautun, Maya glyph David L. Mills University of Delaware http://www.eecis.udel.edu/~mills mailto:mills@udel.edu 14-Feb-07 1 #12;On the Internet cultural

  8. Java Programming MSc. Internet Security

    E-Print Network [OSTI]

    Hill, Gary

    Java Programming MSc. Internet Security - 1 - Table of content Introduction Appendices............................................................................. 70 #12;Java and accompanying application using Java 3D coding. The developed application, in a Java 3D environment, will form

  9. Oral Tradition and the Internet

    E-Print Network [OSTI]

    Foley, John Miles

    2010-12-10

    Although the proposition may at first seem counterintuitive, humankind’s oldest and newest technologies of communication are fundamentally homologous. To put it succinctly, oral tradition (OT) and Internet technology (IT) share the core dynamic...

  10. An Overview of Internet biosurveillance

    SciTech Connect (OSTI)

    Hartley, David M.; Nelson, Noele P.; Arthur, Ray; Barboza, P.; Collier, Nigel; Lightfoot, Nigel; Linge, J. P.; van der Goot, E.; Mawudeku, A.; Madoff, Lawrence; Vaillant, L.; Walters, Ronald A.; Yangarber, Roman; Mantero, Jas; Corley, Courtney D.; Brownstein, John S.

    2013-06-21

    Internet biosurveillance utilizes unstructured data from diverse Web-based sources to provide early warning and situational awareness of public health threats. The scope of source coverage ranges from local based media in the vernacular to international media in widely read languages. Internet biosurveillance is a timely modality available to government and public health officials, health care workers, and the public and private sector, serving as a real-time complementary approach to traditional indicator-based public health disease surveillance methods. Internet biosurveillance also supports the broader activity of epidemic intelligence. This review covers the current state of the field of Internet biosurveillance and provides a perspective on the future of the field.

  11. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  12. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  13. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  14. Indoor experiments of self-organization and localization protocols for hybrid networks

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    to constitute a wireless testbed and to test any protocol for ad hoc or hybrid networks. I. INTRODUCTION Mobile. Because a source can be not in the radio range of the destination, intermediary nodes must relay on how to provide an efficient hybrid network, connected to the Internet, and test in one scenario

  15. Analysing the PGM Protocol with UPPAAL ? Batrice Brard 1 , Patricia Bouyer 2 , and Antoine Petit 1

    E-Print Network [OSTI]

    Doyen, Laurent

    , designed to minimize both the probability of negative acknowledgements (NAK) implosion and the loading of the network due to retransmissions of lost packets. This protocol was presented to the Internet Engineering but to depend of the values of several parameters that we underscore. 1 Introduction Since the introduction

  16. Une analyse du protocole PGM avec UPPAAL 1 Batrice Brard ---Patricia Bouyer ---Antoine Petit

    E-Print Network [OSTI]

    Doyen, Laurent

    , designed to minimize both the probability of negative acknowledgements (NAK) implosion and the loading of the network due to retransmissions of lost packets. This protocol was presented to the Internet Engineering but to depend of the values of several parameters that we underscore. MOTS­CLÉS : Vérification, model

  17. Analysing the PGM Protocol with UPPAAL Batrice Brard Patricia Bouyer y Antoine Petit

    E-Print Network [OSTI]

    Doyen, Laurent

    the probability of negative acknowledgements (NAK) implosion and the load of the network due to retransmissions of lost packets. This protocol was presented to the Internet Engineering Task Force as an open reference, which turns out not to be always veri#28;ed but to depend on the values of several parameters that we

  18. Scheduling and Queue Management for Multi-class Traffic in Access Router of Mobility Protocol

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    communicate with the Access Router (AR) through wireless channels for sending data packets and signalingScheduling and Queue Management for Multi-class Traffic in Access Router of Mobility Protocol Md communicating over Internet. Due to such high data traffic, the access routers are often overloaded with packets

  19. fragility). A key research problem is distinguishing among laws, protocols, and historical accidents.

    E-Print Network [OSTI]

    Lee, H.C. Paul

    fragility). A key research problem is distinguishing among laws, protocols, and historical frequency and voltag- es of delivered power, oil refineries have 10,000 such control loops, and Internet, terabytes of data, and a billion-dollar price tag. 55. Systems Biology Workbench (www.cds.caltech.edu/ sbw

  20. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  1. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  2. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  3. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  4. V-149: Microsoft Internet Explorer Object Access Bug Lets Remote...

    Broader source: Energy.gov (indexed) [DOE]

    Microsoft Internet Explorer Object Access Bug Lets Remote Users Execute Arbitrary Code PLATFORM: Internet Explorer 8 ABSTRACT: A vulnerability was reported in Microsoft Internet...

  5. Internet Data Analysis for the Undergraduate Statistics Curriculum

    E-Print Network [OSTI]

    Juana Sanchez; Yan He

    2011-01-01

    Haythornthwaite edts. (2002). The Internet in Everyday Life.Where Mathematics meets the Internet. Notices of the AMS,Internet Data Analysis for the Undergraduate Statitics

  6. U-262: Microsoft Internet Explorer Flaw Lets Remote Users Execute...

    Broader source: Energy.gov (indexed) [DOE]

    Microsoft Internet Explorer Flaw Lets Remote Users Execute Arbitrary Code PLATFORM: Internet Explorer 6, 7, 8, 9 ABSTRACT: A vulnerability was reported in Microsoft Internet...

  7. Technology and Education: Computers, Software, and the Internet

    E-Print Network [OSTI]

    Fairlie, Robert

    2015-01-01

    the Racial Divide on the Internet." Science 17 April: 390-Bureau. 2012. Computer and Internet Access in the United2012, Table 1. Reported Internet Usage for Individuals 3

  8. Because Meaning: Language Change through Iconicity in Internet Speak

    E-Print Network [OSTI]

    Rehn, Anneliise

    2015-01-01

    Change through Iconicity in Internet Speak Anneliise Rehn ?speakers, especially on the internet, the possibilities forusage by people on the internet of sentences like The apple

  9. The Spatiality of Power in Internet Control and Cyberwar

    E-Print Network [OSTI]

    Ashraf, Cameran Hooshang

    2015-01-01

    throughout the Internet's history and alongside politicalpresents a brief history of the Internet to bring these twobriefly discuss the history of the Internet so as to bring

  10. IP Concatenation: The Method for Enhancement of IPsec Performance

    E-Print Network [OSTI]

    Yeom, Heon Young

    of the public telecommunication infrastructure, maintaining privacy through the use of tunneling protocols of hosts, between a pair of IPsec gateways, or between a IPsec gateway and a host (IPsec gateway is the term to refer to a gateway that implements IPsec protocols). IPsec has some advantages

  11. Evolving Custom Communication Protocols

    E-Print Network [OSTI]

    Fernandez, Thomas

    Evolving Custom Communication Protocols by Wes Faler of Part-Time Scientists for 28C3, Berlin One-at-time simulation #12;Easy as 1...2...3... Parameter sweep int driver_movesPerTransaction[] = { 1, 20 }; int driver_wheelTicksPerCommand[] = { 512, 4096 }; int driver_commandsPerPacket[] = { 1, 25

  12. Information requested in Protocol No

    Broader source: Energy.gov (indexed) [DOE]

    "Behind the meter" smart grid technologies will be developed by appliance manufacturers, building- automation suppliers, aggregators, Internet software developers, and other...

  13. House Simulation Protocols Report | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    House Simulation Protocols Report House Simulation Protocols Report Report cover Building America's House Simulation Protocols report is designed to assist researchers in tracking...

  14. Superior Energy Performance Certification Protocol

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Superior Energy Performance cm Certification Protocol December 7, 2012 D R A F T f o r R E V I E W Superior Energy Performance cm Certification Protocol 1 December 7, 2012 2012...

  15. Sustaining the Internet with hyperbolic mapping

    E-Print Network [OSTI]

    Boguna, Marian; Krioukov, Dmitri

    2010-01-01

    The Internet infrastructure is severely stressed. Rapidly growing overhead associated with the primary function of the Internet---routing information packets between any two computers in the world---causes concerns among Internet experts that the existing Internet routing architecture may not sustain even another decade; parts of the Internet have started sinking into black holes already. Here we present a method to map the Internet to a hyperbolic space. Guided with the constructed map, which we release with this paper, Internet routing exhibits scaling properties close to theoretically best possible, thus resolving serious scaling limitations that the Internet faces today. Besides this immediate practical viability, our network mapping method can provide a different perspective on the community structure in complex networks.

  16. The Internet: an introduction for lawyers 

    E-Print Network [OSTI]

    Terrett, Andrew; Monaghan, Iain

    Given the intense media coverage that the Internet has attracted over the past few years, one might reasonably argue that the Internet needs no introduction. It has successfully permeated into our everyday lives in a ...

  17. Telecooperation: Concept, Applications and Need from the Internet

    E-Print Network [OSTI]

    Zimmer, Uwe

    Telecooperation: Concept, Applications and Need from the Internet Maki Habib GMD­Japan Research is Internet World Wide Web). Internet Web represent suitable infrastructure technologies that facilitate virtual presence electronic communications between entities, human populations and machines. Internet Web

  18. The Evolution of International Internet Telephony

    E-Print Network [OSTI]

    McGarty, Terrence

    International Internet Telephony has been evolving since its introduction in 1996. In 1996, the typical player was

  19. Clean Power for the Internet 

    E-Print Network [OSTI]

    Brown, E.; Elliott, R. N.; Shipley, A.

    2002-01-01

    with the backup support of diesel generators belching pollution into the sky. The extent of these impacts is unknown. The change in market dynamics in the year 2001 resulted in a slower growth rate in data centers, as it did with the rest of the Internet industry...

  20. Marketing wood Products on the Internet: IHLA, 1998 Marketing Wood Products on the Internet

    E-Print Network [OSTI]

    Marketing wood Products on the Internet: IHLA, 1998 Marketing Wood Products on the Internet IHLA Fall Regional Meetings - 1998 Bob Smith "When history is written, the creation of the Internet may in the past few years than the Internet. Every major newspaper, magazine, and television station have covered

  1. Internet Engineering Task Force J. Espi Internet-Draft R. Atkinson

    E-Print Network [OSTI]

    Atkinson, Robert C

    Internet Engineering Task Force J. Espi Internet-Draft R. Atkinson Intended status: Standards Track improving the overall performance of the handover process. Status of this Memo This Internet-Draft is submitted to IETF in full conformance with the provisions of BCP 78 and BCP 79. Internet-Drafts are working

  2. 2006 Vol. 2 ( 63 ) pp. 27-32 Future Internet and the evolutio of the Internet

    E-Print Network [OSTI]

    Moon, Sue B.

    2006 Vol. 2 ( 63 ) pp. 27-32 Future Internet and the evolutio of the Internet (sbmoon, , , . . " " . . ( ) In the past 30 years, the Internet has been a success beyond the early designers' wildest dreams, and now. The Internet has been incrementally accommodating diverse services not foreseen at the time of ARPANET

  3. Internet 3.0: Ten Problems with Current Internet Architecture and Solutions for the Next Generation

    E-Print Network [OSTI]

    Jain, Raj

    Internet 3.0: Ten Problems with Current Internet Architecture and Solutions for the Next Generation Louis Saint Louis, MO 63130 jain@cse.wustl.edu Abstract-- The basic ideas of the Internet architecture switching. Is this the way we would design the Internet if we were to start it now? This paper is an attempt

  4. Internet Mathematics Vol. 6, No. 1: 12 Open Letter to the Internet

    E-Print Network [OSTI]

    Bonato, Anthony

    Internet Mathematics Vol. 6, No. 1: 1­2 Open Letter to the Internet Mathematics Community Anthony Bonato and Fan Chung Graham Editors-in-Chief The World Wide Web and Internet have evolved rapidly, and generative network models are just a few of the active research areas surrounding the web and Internet

  5. Time for a "Greener" Internet Mario Baldi

    E-Print Network [OSTI]

    Baldi, Mario

    -growing energy (electricity). Since a lot of the Internet traffic growth comes from predictable services (such as video) there is a huge potential for decreasing future Internet energy requirements by synchronizing complexity, speedup. I. INTRODUCTION HE Internet has been growing steadily for several years

  6. Global Internet Measurement Infrastructure Paul Barford

    E-Print Network [OSTI]

    Barford, Paul

    Global Internet Measurement Infrastructure Paul Barford Computer Science Department University@cs.wisc.edu Abstract Over the past ten years, measurements of Internet behavior have been made for a range of applications: from research focused on understanding Internet behavior in the form of invariant characteristics

  7. The internet and the popularization of mathematics

    E-Print Network [OSTI]

    Ghys, Étienne

    The internet and the popularization of mathematics ´Etienne Ghys Abstract. In this paper activity with the general public. I would like to focus on the internet as a powerful tool to achieve of mathematics, Internet. 1. Introduction Even though the International Congress of Mathematicians has been

  8. POLICIES & PROCEDURES Legal Disclaimers for CSUN Internet

    E-Print Network [OSTI]

    Cohen, Randy W.

    POLICIES & PROCEDURES Legal Disclaimers for CSUN Internet Sites/Terms and Conditions of Use Policy on California State University, Northridge Internet sites. POLICY/PROCEDURES: The following legal disclaimers and Conditions of Use CSUN Internet Sites Endorsements General Liability Limitation of Liability Disclaimer

  9. IEEE Communications Magazine May 2001108 Internet Accounting

    E-Print Network [OSTI]

    Pras, Aiko

    IEEE Communications Magazine · May 2001108 Internet Accounting 0163-6804/01/$10.00 © 2001 IEEE ABSTRACT This article provides an introduction to Internet accounting and discusses the status of related work within the IETF and IRTF, as well as certain research projects. Internet accounting is different

  10. Internet Fish Brian A. LaMacchia

    E-Print Network [OSTI]

    LaMacchia, Brian A.

    Internet Fish by Brian A. LaMacchia Artificial Intelligence Laboratory and Department of Electrical Fish,'' a novel class of resource­discovery tools designed to help users extract useful information from the Internet. Internet Fish (IFish) are semi­autonomous, persistent information brokers; users

  11. Geo-Engineering through Internet Informatics (GEMINI)

    SciTech Connect (OSTI)

    Doveton, John H.; Watney, W. Lynn

    2003-03-06

    The program, for development and methodologies, was a 3-year interdisciplinary effort to develop an interactive, integrated Internet Website named GEMINI (Geo-Engineering Modeling through Internet Informatics) that would build real-time geo-engineering reservoir models for the Internet using the latest technology in Web applications.

  12. Towards an Evolvable Internet Architecture Sylvia Ratnasamy

    E-Print Network [OSTI]

    Ratnasamy, Sylvia

    , but our optimism about Internet evolution proved to be unfounded. The unfortunate history of IPv6, IntTowards an Evolvable Internet Architecture Sylvia Ratnasamy Intel Research, Berkeley sylvia@riverbed.com ABSTRACT There is widespread agreement on the need for architectural change in the Internet, but very few

  13. Internet video streaming using 3-D SPIHT 

    E-Print Network [OSTI]

    Jiang, Jianhong

    2001-01-01

    Internet video streaming is a new way of distributing video over the Internet. It is an important component of Internet multimedia. Due to the increasing demand of multimedia on the World Wide Web, it has experienced explosive growth in the last...

  14. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  15. Service Oriented Middleware for the Internet of Things: A Perspective

    E-Print Network [OSTI]

    Teixeira, Thiago

    Service Oriented Middleware for the Internet of Things: A Perspective (Invited Paper) Thiago. The Internet of Things plays a central role in the foreseen shift of the Internet to the Future Internet that the Internet of Things will cooperate with the Internet of Services to provide users with services

  16. User Empowerment in the Internet of Things

    E-Print Network [OSTI]

    Munjin, Dejan

    2011-01-01

    This paper focuses on the characteristics of two big triggers that facilitated wide user adoption of the Internet: Web 2.0 and online social networks. We detect brakes for reproduction of these events in Internet of things. To support our hypothesis we first compare the difference between the ways of use of the Internet with the future scenarios of Internet of things. We detect barriers that could slow down apparition of this kind of social events during user adoption of Internet of Things and we propose a conceptual framework to solve these problems.

  17. Packet Drop Avoidance for High-speed network transmission protocol

    SciTech Connect (OSTI)

    Jin, Guojun

    2004-05-01

    As network bandwidth continues to grow and longer paths are used to exchange large scientific data between storage systems and GRID computation, it has become increasingly obvious that there is a need to deploy a packet drop avoidance mechanism into network transmission protocols. Current end-to-end congestion avoidance mechanisms used in Transmission Control Protocol (TCP) have worked well on low bandwidth delay product networks, but with newer high-bandwidth delay networks they have shown to be inefficient and prone to unstable. This is largely due to increased network bandwidth coupled with changes in internet traffic patterns. These changes come from a variety of new network applications that are being developed to take advantage of the increased network bandwidth. This paper will examine the end-to-end congestion avoidance mechanism and perform a step-by-step analysis of its theory. In addition we will propose an alternative approach developed as part of a new network transmission protocol. Our alternative protocol uses a packet drop avoidance (PDA) mechanism built on top of the maximum burst size (MBS) theory combined with a real-time available bandwidth algorithm.

  18. Vorlesung Telematik Higher Layer Protocols

    E-Print Network [OSTI]

    Fu, Xiaoming

    of sophistication Simple bridges just forward packets smart bridges start looking like routers · A Router is used segment data data data Slide 8 #12;Bridges, Routers and Gateways · A Bridge is used to connect multiple! Slide 9 #12;Bridges, routers and gateways Ethernet A Ethernet B Bridge IP Router Small company Gateway

  19. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  20. Thesis Research Protocol November 2013 1 Thesis Research Protocol

    E-Print Network [OSTI]

    van Vliet, Lucas J.

    Thesis Research Protocol November 2013 1 Thesis Research Protocol November 2013 Thesis Research Project The master's programme Industrial Ecology is completed by the Thesis Research Project (TRP Ecology. The Thesis Research Project is composed of two modules: a Thesis Preparation Module (6 EC

  1. Sex GENOTYPING PROTOCOL PCR PROTOCOL NAME: Sex1

    E-Print Network [OSTI]

    Shoubridge, Eric

    Sex GENOTYPING PROTOCOL GENE NAME: PCR PROTOCOL NAME: Sex1 PCR REAGENTS: 10X NEB THERMOPOL PCR) PRIMERS: Sex1 Forward (20uM Standard Working Concentration) Sex1 Reverse (20uM Standard Working CONDITIONS: Sex (or Sex1) 95 C for 3 min 95 C for 30 sec 60 C for 1 min 35 cycles

  2. Constructing Personal Network on the Internet Kenichi Kourai

    E-Print Network [OSTI]

    Chiba, Shigeru

    net- work resources like communication channels, network settings like IP routing, and gateway.112.40.128/26 IP ­2­ #12;IP DHCP NFS NIS 3 VPN VPN IP 1 3.1 ID VPN 80 CGI CGI 3.2 ­3­ #12;gateway remote network SSL SSL 2 SSL SSL SSL 2 2 SSL 2 1 SSL 3 decrypt encrypt decryptencrypt filtering gateway client server

  3. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  4. Internet/Networking Overview Notes for CSC 580

    E-Print Network [OSTI]

    Tate, Steve

    /Networking Overview Slide 4 Some Internet History · ARPA (Advanced Research Projects Agency) experiment to test ideas: The web and privatization Internet/Networking Overview Slide 5 Some Web History · 1990: Tim Berners1 Internet/Networking Overview Notes for CSC 580 Internet/Networking Overview Slide 2 Internet

  5. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  6. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  7. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  8. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  9. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  10. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  11. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  12. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  13. Chance constrained optimization for targeted Internet advertising$ Antoine Deza a

    E-Print Network [OSTI]

    Deza, Antoine

    Chance constrained optimization for targeted Internet advertising$ Antoine Deza a , Kai Huang b online 6 January 2015 Keywords: Internet advertising Chance constrained programming Sample approximation for the fulfillment of guaranteed display Internet advertising campaigns. The proposed formulation for the allocation

  14. Protecting Copyrights at the "Backbone" Level of the Internet

    E-Print Network [OSTI]

    Schleimer, Jospeh D.

    2008-01-01

    256 9 Jonathan Zittrain, Internet Points of Control, 44 B.C.Tools and Technology of Internet Filtering, in ACCESSAND POLICY OF GLOBAL INTERNET FILTERING 57, 65 11 17 U.S.C.

  15. Internet Kiosks in Rural India: What Influences Success?#

    E-Print Network [OSTI]

    Kendall, Jake; Singh, Nirvikar

    2007-01-01

    subject to learning effects. Internet Kiosks in Rural India:Science, 46, 4, 548-62. Internet Kiosks in Rural India: Whataccessed September 27, 2004. Internet Kiosks in Rural India:

  16. The Internet and E-commerce Development in Mexico

    E-Print Network [OSTI]

    Kenney, Martin; Curry, James; Contreras, Oscar

    2001-01-01

    La influencia de internet en México y su impacto directo en1999a. “Cuentas Internet de Mexico,” IDC-Select, http://Historia del Internet en México,” Network Information

  17. Misinformation on the Internet?: A Study of Vaccine Safety Beliefs

    E-Print Network [OSTI]

    Doty, Colin

    2015-01-01

    Wide Web. Journal of Medical Internet Research, 7(2). doi:beliefs specifically on the Internet (Atlani-Duault et al. ,of health information on the internet. Working draft, white

  18. The Spatiality of Power in Internet Control and Cyberwar

    E-Print Network [OSTI]

    Ashraf, Cameran Hooshang

    2015-01-01

    2007). Terrorist use of the Internet: The real story. DTICWong, F. (2010). A taxonomy of Internet censorship and anti-Tools and technology of Internet filtering. In R. Deibert,

  19. APPLICATIONS OF THE INTERNET IN THE TRANSPORTATION INDUSTRY

    E-Print Network [OSTI]

    . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . J-3 History of the InternetAPPLICATIONS OF THE INTERNET IN THE TRANSPORTATION INDUSTRY by Jennifer Messick Professional The Internet is becoming an extremely popular resource in America and the transportation engineering profession

  20. IBM Internet Security Systems Threat Insight Monthly

    E-Print Network [OSTI]

    of cryptography as it relates to the computer security industry. We will look at some of the underlying technologyIBM Internet Security Systems X-Force ® Threat Insight Monthly www.iss.netwww.iss.net September . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 Contents www.iss.netwww.iss.net IBM Internet Security Systems X-Force ® Threat Insight Monthly

  1. POLICIES & PROCEDURES Legal Disclaimers for CSUN Internet

    E-Print Network [OSTI]

    Cohen, Randy W.

    /data lines. e. Limitation of Liability: This disclaimer of liability applies to any general, special and Conditions of Use CSUN Internet Sites Endorsements General Liability Limitation of Liability Disclaimer, or organizations. d. General Liability: The materials on CSUN's Internet site are provided "as is" and without

  2. Study of Proposed Internet Congestion Control Algorithms*

    E-Print Network [OSTI]

    Study of Proposed Internet Congestion Control Algorithms* Kevin L. Mills, NIST (joint work with D Y Algorithms ­ Mills et al. Innovations in Measurement Science More information @ http;Study of Proposed Internet Congestion Control Algorithms ­ Mills et al. OutlineOutline Technical

  3. Towards implementing the Mobile Transient Internet Architecture

    E-Print Network [OSTI]

    Albuquerque, New Mexico December, 2006 #12;Towards implementing the Mobile Transient Internet ArchitectureTowards implementing the Mobile Transient Internet Architecture by Joud Said Khoury B.E., Lebanese of Master of Science Electrical Engineering The University of New Mexico Albuquerque, New Mexico December

  4. The Linux Command Line Second Internet Edition

    E-Print Network [OSTI]

    Dahl, David B.

    The Linux Command Line Second Internet Edition William E. Shotts, Jr. A LinuxCommand.org Book #12 this book in elec- tronic formats for most popular e-readers: http://nostarch.com/tlcl.htm Release History Version Date Description 13.07 July 6, 2013 Second Internet Edition. 09.12 December 14, 2009 First

  5. Privacy Preservation Technologies in Internet of Things

    E-Print Network [OSTI]

    Sen, Jaydip

    2010-01-01

    Since the beginning of the Internet thirty years ago, we have witnessed a number of changes in the application of communication technologies. Today, the Internet can be described to a large extent as a ubiquitous infrastructure that is always accessible. After the era of connecting places and connecting people, the Internet of the future will also connect things. The idea behind the resulting Internet of Things is to seamlessly gather and use information about objects of the real world during their entire lifecycle. In this paper, we consider different approaches to technological protection of user data privacy in the world of Internet of Things. In particular,we consider what kind of security problems are being faced and what level of protection can be provided by applying approaches based on secure multi-party computations.

  6. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  7. Within a Stone's Throw: Proximal Geolocation of Internet Users via Covert Wireless Signaling

    SciTech Connect (OSTI)

    Paul, Nathanael R; Shue, Craig; Taylor, Curtis

    2013-01-01

    While Internet users may often believe they have anonymity online, a culmination of technologies and recent research may allow an adversary to precisely locate an online user s geophysical location. In many cases, such as peer-to-peer applications, an adversary can easily use a target s IP address to quickly obtain the general geographical location of the target. Recent research has scoped this general area to a 690m (0.43 mile) radius circle. In this work, we show how an adversary can exploit Internet communication for geophysical location by embedding covert signals in communication with a target on a remote wireless local area network. We evaluated the approach in two common real-world settings: a residential neighborhood and an apartment building. In the neighborhood case, we used a single-blind trial in which an observer located a target network to within three houses in less than 40 minutes. Directional antennas may have allowed even more precise geolocation. This approach had only a 0.38% false positive rate, despite 24,000 observed unrelated packets and many unrelated networks. This low rate allowed the observer to exclude false locations and continue searching for the target. Our results enable law enforcement or copyright holders to quickly locate online Internet users without requiring time-consuming subpoenas to Internet Service Providers. Other privacy use cases include rapidly locating individuals based on their online speech or interests. We hope to raise awareness of these issues and to spur discussion on privacy and geolocating techniques.

  8. COP 6930 Advanced Internet Engineering Prerequisites: graduate status and basic knowledge of Internet and Web systems and

    E-Print Network [OSTI]

    Furht, Borko

    COP 6930 ­ Advanced Internet Engineering Prerequisites: graduate status and basic knowledge of Internet and Web systems and programming. For undergraduate students: permission of instructor. Course Description: Students will get familiar with current Internet and Web technologies and application trends

  9. Start your career with a company that recognizes and rewards top graduates! At Honeywell, our people are driven by a desire to contribute, be challenged and grow. Our

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    and commercial Internet TCP/IP protocols), realtime operating systems, multicore processors, and modeling/verification human centered systems advanced graphics and displays electric power highintegrity controls aircraft, communication networks, operating systems and middleware, system modeling, and application development

  10. ROBUSTNESS OF SPEECH QUALITY METRICS TO BACKGROUND NOISE AND NETWORK DEGRADATIONS: COMPARING VISQOL, PESQ AND POLQA

    E-Print Network [OSTI]

    Cortes, Corinna

    , PESQ AND POLQA Andrew Hines, Jan Skoglund, Anil Kokaram and Naomi Harte Sigmedia, Trinity College the popularity and usage of voice over internet protocol (VoIP) for video conferencing. The content is delivered

  11. Control of real-time multimedia applications in best-effort networks 

    E-Print Network [OSTI]

    Ye, Dan

    2009-05-15

    The increasing demand for real-time multimedia applications and the lack of quality of service (QoS) support in public best-effort or Internet Protocol (IP) networks has prompted many researchers to propose improvements ...

  12. Unraveling Internet identities : accountability & anonymity at the application layer

    E-Print Network [OSTI]

    Wolff, Josephine Charlotte Paulina

    2012-01-01

    Both anonymity and accountability play crucial roles in sustaining the Internet's functionality, however there is a common misconception that increasing the anonymity of Internet identities necessitates diminishing their ...

  13. DOE Site Facility Management Contracts Internet Posting | Department...

    Energy Savers [EERE]

    DOE Site Facility Management Contracts Internet Posting DOE Site Facility Management Contracts Internet Posting PDF icon DOE NNSA Site Facility Management Contracts - November...

  14. Estudo sobre armazenagem eficiente de tabela de rotas em Network Processors

    E-Print Network [OSTI]

    Hexsel, Roberto A

    protocolo IP fornece um conjunto de regras para que as m´aquinas possam se comunicar usando endere¸cos definidos conforme o Internet Protocol. Quando algu´em deseja conectar suas m´aquinas `a Internet, deve con¸camento de suas m´aquinas e dessa forma elas podem ser endere¸cadas na Internet. Um Sistema Aut

  15. Satellite Transport Protocol (STP): An SSCOPbased Transport Protocol for Datagram Satellite Networks

    E-Print Network [OSTI]

    California at Berkeley, University of

    1 Satellite Transport Protocol (STP): An SSCOP­based Transport Protocol for Datagram Satellite Networks Thomas R. Henderson * and Randy H. Katz University of California at Berkeley {tomh­based protocol, the Service Specific Connection Oriented Protocol (SSCOP), for use as a transport protocol

  16. Modulate Internet Radio Into FM Using GNU Radio

    E-Print Network [OSTI]

    Yu, Chansu

    1 Modulate Internet Radio Into FM Using GNU Radio By: Elie Salameh Outline. · Fm in gnu radio · Audio Streams in Internet Radio · Gnu & Audio Files · Sox command · Playlist ".pls" · Recording internet radio #12;2 Project description · Using gnu radio to modulate internet radio into fm. · Using usrp

  17. Internet growth: Myth and reality, use and abuse Andrew Odlyzko

    E-Print Network [OSTI]

    Odlyzko, Andrew M.

    Internet growth: Myth and reality, use and abuse Andrew Odlyzko AT&T Labs - Research amo@research.att.com http://www.research.att.com/ amo Abstract Actual Internet traffic growth rates of 100 percent per year to Internet growth claim astronomical rates of increase; the usual phrase is that "Internet traffic

  18. Internet Explorer 11 meldet: ,,Ihr Browser wird nicht untersttzt"

    E-Print Network [OSTI]

    Potsdam, Universität

    Internet Explorer 11 meldet: ,,Ihr Browser wird nicht unterstützt" Keine Sorge, Internet Explorer". Bedienungsanleitung Mail.UP Seite 1 von 2 Internet Explorer 11 Universität Potsdam | ZEIK #12;Sie erhalten ein Pop nun sofort sichtbar und Sie können sich anmelden. Bedienungsanleitung Mail.UP Seite 2 von 2 Internet

  19. Internet Clean-Slate Design: What and Why? Anja Feldmann

    E-Print Network [OSTI]

    Schmid, Stefan

    Internet Clean-Slate Design: What and Why? Anja Feldmann Deutsche Telekom Laboratories / TU Berlin's Internet without rethinking the fundamental assumptions and design decisions underlying its current of the Internet's architecture. In this paper we first give an overview of the challenges that a future Internet

  20. Internet Evolution and the Role of Software Engineering

    E-Print Network [OSTI]

    Greenberg, Albert

    Internet Evolution and the Role of Software Engineering Pamela Zave AT&T Laboratories.att.com/TILDEpamela Abstract. The classic Internet architecture is a victim of its own suc- cess. Having succeeded so well on the many deficiencies of the current Internet and the possible paths toward a better future Internet

  1. Experiences in Implementing a Java Collaborative IDE over the Internet

    E-Print Network [OSTI]

    Chen, Sheng-Wei

    1 Experiences in Implementing a Java Collaborative IDE over the Internet CHIEN-MIN WANG, SHUN of issues related to event broadcasting in a Java collaborative computing environment over the Internet. We technologies, communication over the Internet has become commonplace and collaboration via the Internet has

  2. Wits Internet Week 2015 | July 7-10 Morning seminar

    E-Print Network [OSTI]

    Wagner, Stephan

    Wits Internet Week 2015 | July 7-10 Morning seminar: "Approaching 25 years of the Internet studies academic) 09h05 ­ 09h30 Keynote address: The Internet arrives in South Africa: Memory of the earlyISPA) 09h30 ­ 09h50 A timeline of the history of the Internet in South Africa: Fast or slow? Luci Abrahams

  3. The Internet and past and future communications revolutions

    E-Print Network [OSTI]

    Odlyzko, Andrew M.

    The Internet and past and future communications revolutions Andrew Odlyzko School of Mathematics version, September 28, 2009 Predicting the evolution of the Internet is an error-prone business issue of Internet Computing. The authors were all Internet luminaries with sterling records. Yet

  4. ,,INTERNET-KLINIK" Neue Medien in der Psychotherapie

    E-Print Network [OSTI]

    Manstein, Dietmar J.

    ,,INTERNET-KLINIK" Neue Medien in der Psychotherapie Martina de Zwaan Klinik für Psychosomatik und Psychotherapie #12;Internet = Alltagsmedium 78% der Erwachsenen in Deutschland verwenden das Internet Klinik für · E-Mental Health: Nutzung von Informations- und Kommunikationstechnologien (IKT; Computer, Internet

  5. Internet Business Opportunities in the Forest Products Industry

    E-Print Network [OSTI]

    Internet Business Opportunities in the Forest Products Industry Richard Vlosky, Ph.D. Professor Resources Louisiana State University January 2003 #12;The Internet: Evolution? Revolution! #12;What am I% Movement toward a more global marketplace 22% Proliferation of the Internet 21% #12;Internet Growth

  6. September 1996 A Modest Proposal for The Immodest Internet

    E-Print Network [OSTI]

    Peha, Jon M.

    September 1996 A Modest Proposal for The Immodest Internet Jon M. Peha Carnegie Mellon University Decency Act, congress's attempt to keep "indecent" material on the Internet away from minors no clearer evidence of the danger of pornography on the Internet to our young than the fact that Internet

  7. Cheleby: A Subnet-level Internet Topology Mapping System

    E-Print Network [OSTI]

    Gunes, Mehmet Hadi

    transcontinental backbone providers [1]. Additionally, the Internet evolves with the interplay between cooperation

  8. Get started with the Internet of Things in

    E-Print Network [OSTI]

    Chaudhuri, Surajit

    Get started with the Internet of Things in your organization Introducing Microsoft Azure Internet the Internet of Things (IoT). When you see definitions and hype about IoT, it's easy to feel overwhelmed. When on the flexible and scalable Microsoft Cloud Platform. With Microsoft Azure Internet of Things services, you can

  9. The Internet of Things for Efficient Internal and

    E-Print Network [OSTI]

    The Internet of Things for Efficient Internal and External Medical Logistics The Internet of Things to create an instant database The Internet of Things for Efficient Internal and External Medical Logistics Internet of People Concept "Blue Sky" Thinking? IoT Technologies RFID Issues RFID - supplemented with 2D

  10. Finding order in a contentious Internet

    E-Print Network [OSTI]

    Sowell, Jesse H., II (Jesse Horton)

    2015-01-01

    This inquiry started with the simple question, "Who manages the Internet infrastructure and how?" Since, this question evolved into an evaluation of the routing system and the institutions that manage it. This institutional ...

  11. Industrial Dojo Program Fosters Industrial Internet Development...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dojo,' Contributes to Open Source to Foster Continued Development of the Industrial Internet Click to email this to a friend (Opens in new window) Share on Facebook (Opens in new...

  12. 0% 10% 20% 30% 40% Internet (11)

    E-Print Network [OSTI]

    Doyle, Robert

    32% 20.5% 14.5% 3% 3% 15% 9% 3% 0% 10% 20% 30% 40% Other (0) Internet (11) Applied Directly NY Oswego County DSS Caseworker Mexico NY Teach For America Teacher Houston TX Hospitality and Food

  13. Ricci Curvature of the Internet Topology

    E-Print Network [OSTI]

    Ni, Chien-Chun; Gao, Jie; Gu, Xianfeng David; Saucan, Emil

    2015-01-01

    Analysis of Internet topologies has shown that the Internet topology has negative curvature, measured by Gromov's "thin triangle condition", which is tightly related to core congestion and route reliability. In this work we analyze the discrete Ricci curvature of the Internet, defined by Ollivier, Lin, etc. Ricci curvature measures whether local distances diverge or converge. It is a more local measure which allows us to understand the distribution of curvatures in the network. We show by various Internet data sets that the distribution of Ricci cuvature is spread out, suggesting the network topology to be non-homogenous. We also show that the Ricci curvature has interesting connections to both local measures such as node degree and clustering coefficient, global measures such as betweenness centrality and network connectivity, as well as auxilary attributes such as geographical distances. These observations add to the richness of geometric structures in complex network theory.

  14. 0% 10% 20% 30% 40% Internet (22)

    E-Print Network [OSTI]

    Doyle, Robert

    4% 13% 16% 36% 4% 4% 15% 1% 7% 0% 10% 20% 30% 40% Other (6) Internet (22) Applied Directly York NY Art History employer position title location state Corning, Inc Marketing Communications

  15. The Greedy, the Naive, and the Optimal Multicast Routing: from Theory to Internet Protocols

    E-Print Network [OSTI]

    Faloutsos, Michalis

    of optimism can do. My father, Nickos, was of course an accomplish in this business. Academically speaking, I to thank Petros, for putting up with me the last 28 years, for his unlimited hacking abilities

  16. Accepted to International Journal of Internet Protocol Technology (Accepted Sep 24, 2009)

    E-Print Network [OSTI]

    California at Los Angeles, University of

    , Los Angeles, CA 90095 Abstract High volume, high speed, and heterogeneous inbound and outbound data format are characteristics of RFID-based Automatic Identification Data Capture infrastructure. Due. A "store and forward" and rule-based subscription integration methodology to streamline RFID data

  17. U-062: Pidgin SILC (Secure Internet Live Conferencing) Protocol Denial of Service Vulnerability

    Broader source: Energy.gov [DOE]

    An attacker can exploit these issues by constructing and submitting a specially crafted SILC message. Successful exploits will cause the affected application to crash.

  18. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  19. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  20. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  1. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  2. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  3. 9/10/2002 Internet/Grid Computing -Fall 2002 1 What is Performance for Internet/Grid Computation?

    E-Print Network [OSTI]

    Browne, James C.

    9/10/2002 Internet/Grid Computing - Fall 2002 1 What is Performance for Internet/Grid Computation? Goals for Internet/Grid Computation? Do things you cannot otherwise do because of: Lack of Capacity Large scale computations Cost SETI Scale/Scope of communication Internet searches All of the above #12

  4. Study of Proposed Internet Congestion ControlStudy of Proposed Internet Congestion Control Kevin L. Mills, NIST

    E-Print Network [OSTI]

    Study of Proposed Internet Congestion ControlStudy of Proposed Internet Congestion Control, 2010 image generated with http://www.wordle.net/ #12;Study of Proposed Internet Congestion Control of Proposed Internet Congestion Control Algorithms ­ Mills et al. Wh h i lt t I t t ti t l l ith ? Standard

  5. ON BUILDING AN INTERNET GATEWAY FOR INTERNET TELEPHONY Cheng-Yue Chang and Ming-Syan Chen

    E-Print Network [OSTI]

    Hung, Shih-Hao

    ON BUILDING AN INTERNET GATEWAY FOR INTERNET TELEPHONY Cheng-Yue Chang and Ming-Syan Chen@arbor.ee.ntu.edu.tw; mschen@cc.ee.ntu.edu.tw ABSTRACT In recent years, the Internet has emerged as an important collaborative, it is very important to construct a PSTN/Internet gateway for further experiments and devel- opments

  6. Create the Internet of Your Things The Internet of Things (IoT) is here today, and it begins

    E-Print Network [OSTI]

    Chaudhuri, Surajit

    Create the Internet of Your Things The Internet of Things (IoT) is here today, and it begins you create the Internet of Your Things, beginning with what matters most to your business. Using if you qualify for a Quick Start consultation. Transform Your Business With the Internet of Your Things

  7. Expressive Analytical Model for Routing Protocols infor Routing Protocols in

    E-Print Network [OSTI]

    Julien, Christine

    Taesoo Jun Angela Dalton Sh h k B dShreeshankar Bodas Christine Julien Sriram Vishwanath TR-UTEDGE-2007 in Mobile Ad Hoc Networks Taesoo Jun, Angela Dalton, Shreeshankar Bodas, Christine Julien, and Sriram, sriram}@ece.utexas.edu Abstract--Many routing protocols exist for mobile ad hoc networks. To select

  8. Reviews and approves OG protocol Publishes New protocols, Revisions,

    E-Print Network [OSTI]

    Kay, Mark A.

    CIRB reviews/approves Study-Specific Worksheet; notifies researcher & local IRB of acceptance Confirms- Specific Worksheet Worksheet Acceptance (site accepted) New protocols Revisions Renewals DSMB rpts Local local site closure to Researcher and to local IRB Oncology Group (OG) Scientific review at CTEP takes

  9. Steamboat-Springs:Internet:Internet Applications:Outlook Express 4.5 Folder:Outlook Express Temp:final-masanori.doc 1

    E-Print Network [OSTI]

    Fischer, Gerhard

    Steamboat-Springs:Internet:Internet Applications:Outlook Express 4.5 Folder:Outlook Express Temp for Collaborative, Evolutionary Design____________11 #12;Steamboat-Springs:Internet:Internet Applications

  10. Internet Use and Political Engagement: The Role of E-Campaigning as a Pathway to Online Political Participation

    E-Print Network [OSTI]

    Cantijoch, Marta; Cutts , David; Gibson, Rachel

    2013-01-01

    Information Poverty, and the Internet. Cambridge: Cambridgeparticipations and the internet: assessing effects, causalthe Representativeness of Internet Political Participation’,

  11. Library Protocol Safety and Security

    E-Print Network [OSTI]

    Oxford, University of

    Library Protocol Safety and Security · The library is open only to members of Brasenose; strangers are not to be admitted. · Eating, drinking (with the exception of water) and smoking are strictly forbidden. · Library the library. · Lampshades must not be tilted or have notes, postcards etc attached to them; any such items

  12. * Correspondence to: L. Wood, Centre for Communication Systems Research (CCSR), University of Surrey, Guildford, Surrey GU2 5XH, U.K.

    E-Print Network [OSTI]

    Dabbous, Walid

    networks; Internet Protocol (IP); routing; tunnelling; multi-protocol label switching (MPLS); Border Gateway Protocol (BGP); quality of service (QoS); multicast 1. INTRODUCTION Satellite-based networking has is a true network; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS

  13. Microsoft Word - MR_Contingency_Protocol_EM_FINAL.docx | Department...

    Energy Savers [EERE]

    Microsoft Word - MRContingencyProtocolEMFINAL.docx Microsoft Word - MRContingencyProtocolEMFINAL.docx Microsoft Word - MRContingencyProtocolEMFINAL.docx More Documents...

  14. Office of Environment, Safety and Health Assessments Protocol...

    Energy Savers [EERE]

    April 2015 (Revision 1) - PROTOCOL - EA-30-02 Office of Environment, Safety and Health Assessments Protocol for Required Reading, April 2015 (Revision 1) - PROTOCOL -...

  15. Internet Daters’ Body Type Preferences: Race–Ethnic and Gender Differences

    E-Print Network [OSTI]

    Glasser, Carol L.; Robnett, Belinda; Feliciano, Cynthia

    2009-01-01

    Washington D.C. : Pew Internet and American Life Project.formation on the internet: What's the big attraction? Theselection among men in internet “personal” ads. Journal of

  16. Internet as Teenager In Higher Education: Rapid Growth, Transformation, Uncertain but Bright Future

    E-Print Network [OSTI]

    Matkin, Gary

    2007-01-01

    religious beliefs, the Internet is challenging higherimportant contribution of the Internet to education to datePaper Series Gary Matkin, INTERNET AS TEENAGER IN HIGHER

  17. The Internet and Virtual Civil Society: The New Frontier of Social Capital

    E-Print Network [OSTI]

    Kittilson, Miki Caul; Dalton, Russell J.

    2008-01-01

    The Social Ties of Internet Users. Dalton, Russell. 2007.Polat, Rbia. 2005. The Internet and Political Participation.Nonrecursive models of internet use and community engagement

  18. Internet as Teenager In Higher Education: Rapid Growth, Transformation, Uncertain but Bright Future

    E-Print Network [OSTI]

    Matkin, Gary

    2007-01-01

    that the history of the application of Internet technologythis new Internet technology. The Lessons of History aboutthis history. I conclude with an assertion that the Internet

  19. The Use of the Internet as a Source for Environmental History

    E-Print Network [OSTI]

    Sedrez, Lise F.

    1998-01-01

    issues on the Internet is significant, environmental historythe fact that the Internet now has a history that is worthof the Internet as a Source for Environmental History Lise

  20. Crossover transition in the Fluctuation of Internet

    E-Print Network [OSTI]

    Qian, Jiang-Hai; Han, Ding-Ding; Ma, Yu-Gang

    2015-01-01

    Gibrat's law predicts that the standard deviation of the growth rate of a node's degree is constant. On the other hand, the preferential attachment(PA) indicates that such standard deviation decreases with initial degree as a power law of exponent $-0.5$. While both models have been applied to Internet modeling, this inconsistency requires the verification of their validation. Therefore we empirically study the fluctuation of Internet of three different time intervals(daily, monthly and yearly). We find a crossover transition from PA model to Gibrat's law, which has never been reported. Specifically Gibrat-law starts from small degree region and extends gradually with the increase of the observed period. We determine the validated periods for both models and find that the correlation between internal links has large contribution to the emergence of Gibrat law. These findings indicate neither PA nor Gibrat law is applicable to the actual Internet, which requires a more complete model theory.

  1. Protocol Testing: Review of Methods and Relevance

    E-Print Network [OSTI]

    von Bochmann, Gregor

    Protocol Testing: Review of Methods and Relevance for Software Testing G. v. Bochmann and Alexandre Juin 1994 #12; Protocol Testing: Review of Methods and Relevance for Software Testing Gregor v the existing hardware and software testing methods would be adequate for the testing of communication protocols

  2. Protocol Testing: Review of Methods and Relevance

    E-Print Network [OSTI]

    von Bochmann, Gregor

    Protocol Testing: Review of Methods and Relevance for Software Testing G. v. Bochmann and AlexandreZal Juin 1994 #12;Protocol Testing: Review of Methods and Relevance for Software Testing Gregor v. Bochmann and software testing methods would be adequate for the testing of communication protocols. The purpose

  3. The Pulse Protocol: Energy Efficient Infrastructure Access

    E-Print Network [OSTI]

    Awerbuch, Baruch

    The Pulse Protocol: Energy Efficient Infrastructure Access Baruch Awerbuch, David Holmer, herb}@cs.jhu.edu Abstract-- We present the Pulse protocol which is designed for multi-hop wireless. The Pulse protocol utilizes a periodic flood initiated at the network gateways which provides both routing

  4. TEC Working Group Topic Groups Archives Protocols

    Broader source: Energy.gov [DOE]

    The Transportation Protocols Topic Group serves as an important vehicle for DOE senior managers to assess and incorporate stakeholder input into the protocols process. The Topic Group was formed to review a series of transportation protocols developed in response to a request for DOE to be more consistent in its approach to transportation.

  5. Performances de protocoles transactionnels en environnement mobile

    E-Print Network [OSTI]

    Serrano Alvarado, Patricia

    indices de performance quantitatifs, et étudie ceux-ci sur quatre protocoles (2PC, UCM, CO2PC et TCOT that are studied on four protocols (2PC, UCM, CO2PC et TCOT). Three of them are specifics propositions for mobile revisited to propose adapted transaction models and proper- ties. Proposed algorithms and protocols try

  6. SCADA Protocol Anomaly Detection Utilizing Compression (SPADUC) 2013

    SciTech Connect (OSTI)

    Gordon Rueff; Lyle Roybal; Denis Vollmer

    2013-01-01

    There is a significant need to protect the nation’s energy infrastructures from malicious actors using cyber methods. Supervisory, Control, and Data Acquisition (SCADA) systems may be vulnerable due to the insufficient security implemented during the design and deployment of these control systems. This is particularly true in older legacy SCADA systems that are still commonly in use. The purpose of INL’s research on the SCADA Protocol Anomaly Detection Utilizing Compression (SPADUC) project was to determine if and how data compression techniques could be used to identify and protect SCADA systems from cyber attacks. Initially, the concept was centered on how to train a compression algorithm to recognize normal control system traffic versus hostile network traffic. Because large portions of the TCP/IP message traffic (called packets) are repetitive, the concept of using compression techniques to differentiate “non-normal” traffic was proposed. In this manner, malicious SCADA traffic could be identified at the packet level prior to completing its payload. Previous research has shown that SCADA network traffic has traits desirable for compression analysis. This work investigated three different approaches to identify malicious SCADA network traffic using compression techniques. The preliminary analyses and results presented herein are clearly able to differentiate normal from malicious network traffic at the packet level at a very high confidence level for the conditions tested. Additionally, the master dictionary approach used in this research appears to initially provide a meaningful way to categorize and compare packets within a communication channel.

  7. Chapter 14: Chiller Evaluation Protocol

    SciTech Connect (OSTI)

    Tiessen, A.

    2014-09-01

    This protocol defines a chiller measure as a project that directly impacts equipment within the boundary of a chiller plant. A chiller plant encompasses a chiller--or multiple chillers--and associated auxiliary equipment. This protocol primarily covers electric-driven chillers and chiller plants. It does not include thermal energy storage and absorption chillers fired by natural gas or steam, although a similar methodology may be applicable to these chilled water system components. Chillers provide mechanical cooling for commercial, institutional, multiunit residential, and industrial facilities. Cooling may be required for facility heating, ventilation, and air conditioning systems or for process cooling loads (e.g., data centers, manufacturing process cooling). The vapor compression cycle, or refrigeration cycle, cools water in the chilled water loop by absorbing heat and rejecting it to either a condensing water loop (water cooled chillers) or to the ambient air (air-cooled chillers).

  8. Memory cost of quantum protocols

    E-Print Network [OSTI]

    Alessandro Bisio; Giacomo Mauro D'Ariano; Paolo Perinotti; Michal Sedlak

    2011-12-16

    In this paper we consider the problem of minimizing the ancillary systems required to realize an arbitrary strategy of a quantum protocol, with the assistance of classical memory. For this purpose we introduce the notion of memory cost of a strategy, which measures the resources required in terms of ancillary dimension. We provide a condition for the cost to be equal to a given value, and we use this result to evaluate the cost in some special cases. As an example we show that any covariant protocol for the cloning of a unitary transformation requires at most one ancillary qubit. We also prove that the memory cost has to be determined globally, and cannot be calculated by optimizing the resources independently at each step of the strategy.

  9. Building America House Simulation Protocols

    SciTech Connect (OSTI)

    Hendron, Robert; Engebrecht, Cheryn

    2010-09-01

    The House Simulation Protocol document was developed to track and manage progress toward Building America's multi-year, average whole-building energy reduction research goals for new construction and existing homes, using a consistent analytical reference point. This report summarizes the guidelines for developing and reporting these analytical results in a consistent and meaningful manner for all home energy uses using standard operating conditions.

  10. Multiple protocol fluorometer and method

    DOE Patents [OSTI]

    Kolber, Zbigniew S. (Shoreham, NY); Falkowski, Paul G. (Stony Brook, NY)

    2000-09-19

    A multiple protocol fluorometer measures photosynthetic parameters of phytoplankton and higher plants using actively stimulated fluorescence protocols. The measured parameters include spectrally-resolved functional and optical absorption cross sections of PSII, extent of energy transfer between reaction centers of PSII, F.sub.0 (minimal), F.sub.m (maximal) and F.sub.v (variable) components of PSII fluorescence, photochemical and non-photochemical quenching, size of the plastoquinone (PQ) pool, and the kinetics of electron transport between Q.sub.a and PQ pool and between PQ pool and PSI. The multiple protocol fluorometer, in one embodiment, is equipped with an excitation source having a controlled spectral output range between 420 nm and 555 nm and capable of generating flashlets having a duration of 0.125-32 .mu.s, an interval between 0.5 .mu.s and 2 seconds, and peak optical power of up to 2 W/cm.sup.2. The excitation source is also capable of generating, simultaneous with the flashlets, a controlled continuous, background illumination.

  11. Survey and Taxonomy of IP Address Lookup Algorithms Miguel . Ruiz-Snchez,2 3

    E-Print Network [OSTI]

    Dabbous, Walid

    Sophia Antipolis France. 3Universidad Autónoma Metropolitana Iztapalapa Campus Mexico City. 4Institut Eurécom Sophia Antipolis France. Abstract Due to the rapid growth of traffic in the Internet, backbone of the Internet has stressed its routing system. While the data rates of links have kept pace with the increasing

  12. Analysing ZigBee Key Establishment Protocols

    E-Print Network [OSTI]

    Yüksel, Ender

    2012-01-01

    In this report, we present our approach for protocol analysis together with a real example where we find an important flow in a contemporary wireless sensor network security protocol. We start by modelling protocols using a specific process algebraic formalism called LySa process calculus. We then apply an analysis based on a special program analysis technique called control flow analysis. We apply this technique to the ZigBee-2007 End-to-End Application Key Establishment Protocol and with the help of the analysis discover an unknown flaw. Finally we suggest a fix for the protocol, and verify that the fix works by using the same technique.

  13. Reduce, Reuse, Recycle: An Approach to Building Large Internet Caches

    E-Print Network [OSTI]

    Rabinovich, Michael "Misha"

    Reduce, Reuse, Recycle: An Approach to Building Large Internet Caches Syam Gadde Dept. of Computer, a distributed Internet object cache targeted to the needs of the organizations that aggregate the end users

  14. Navigating Internet Neighborhoods: Reputation, Its Impact on Security, and

    E-Print Network [OSTI]

    Bernstein, Joseph B.

    Navigating Internet Neighborhoods: Reputation, Its Impact on Security, and How to Crowd Conclusion Threats to Internet security and availability From unintentional to intentional, random of Mexico Liu (Michigan) Network Reputation November 6, 2013 6 / 52 #12;Intro Motivation Security investment

  15. An Inter-Cloud Architecture for Future Internet Infrastructures

    E-Print Network [OSTI]

    Petrakis, Euripides G.M.

    An Inter-Cloud Architecture for Future Internet Infrastructures STELIOS SOTIRIADIS, Technical, Technical University of Crete, Greece Iaan latest years, the concept of interconnecting clouds to allow of cloud resources from Internet users. An efficient common management between different clouds

  16. Analyzing the effect of routing protocols on media access control protocols in radio networks

    SciTech Connect (OSTI)

    Barrett, C. L. (Christopher L.); Drozda, M. (Martin); Marathe, A. (Achla); Marathe, M. V. (Madhav V.)

    2002-01-01

    We study the effect of routing protocols on the performance of media access control (MAC) protocols in wireless radio networks. Three well known MAC protocols: 802.11, CSMA, and MACA are considered. Similarly three recently proposed routing protocols: AODV, DSR and LAR scheme 1 are considered. The experimental analysis was carried out using GloMoSim: a tool for simulating wireless networks. The main focus of our experiments was to study how the routing protocols affect the performance of the MAC protocols when the underlying network and traffic parameters are varied. The performance of the protocols was measured w.r.t. five important parameters: (i) number of received packets, (ii) average latency of each packet, (iii) throughput (iv) long term fairness and (v) number of control packets at the MAC layer level. Our results show that combinations of routing and MAC protocols yield varying performance under varying network topology and traffic situations. The result has an important implication; no combination of routing protocol and MAC protocol is the best over all situations. Also, the performance analysis of protocols at a given level in the protocol stack needs to be studied not locally in isolation but as a part of the complete protocol stack. A novel aspect of our work is the use of statistical technique, ANOVA (Analysis of Variance) to characterize the effect of routing protocols on MAC protocols. This technique is of independent interest and can be utilized in several other simulation and empirical studies.

  17. Rseaux & Internet -9 Octobre 2015 -Laurent Lefevre -1 Merci nos sponsors

    E-Print Network [OSTI]

    van Tiggelen, Bart

    Réseaux & Internet - 9 Octobre 2015 - Laurent Lefevre - 1 #12;Merci à nos sponsors Réseaux & Internet - 9 Octobre 2015 - Laurent Lefevre - 2 Et aux organisateurs.... #12;Réseaux & Internet - 9 Octobre 2015 - Laurent Lefevre - 3 #12;Réseaux & Internet - 9 Octobre 2015

  18. Peering, Transit, Interconnection: Internet Access in Central Europe

    E-Print Network [OSTI]

    McGarty, Terrence P.

    2002-07-22

    This paper presents a review of the alternatives for Internet access in Central Europe and the evolution of the

  19. The Spatiality of Power in Internet Control and Cyberwar

    E-Print Network [OSTI]

    Ashraf, Cameran Hooshang

    2015-01-01

    state actors on various “dark net” black markets (Bradbury,E. (2012). The net delusion: The dark side of Internet

  20. Language of the Internet NAOMI S. BARON

    E-Print Network [OSTI]

    Carlini, David

    processing to facilitate working on the Internet and the World Wide Web (1.3) Section 2 Linguistic Issues for Communicating via the Web 1 As with so many aspects of the computing world, the nature of the language of this chapter. #12;2 summarize the types of Web coding systems (4.1) present an overview of Web markup languages

  1. INTERNET AND FREE ACCESS TO SCHOLARLY PUBLICATIONS

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 INTERNET AND FREE ACCESS TO SCHOLARLY PUBLICATIONS Jean-Philippe Rennard Grenoble Graduate School of this evolution and presents the path toward a new economic model of scholarly publications. "If I have seen., Encyclopaedia of E-Commerce, E-Government and Mobile Commerce, IGR, 2006. Abstract: The mean price of scholarly

  2. Unconstrained Endpoint Profiling (Googling the Internet)

    E-Print Network [OSTI]

    Kuzmanovic, Aleksandar

    Evanston, IL, USA ionut@northwestern.edu Supranamaya Ranjan Narus Inc. Mountain View, CA, USA soups Inc. Mountain View, CA, USA anucci@narus.com ABSTRACT Understanding Internet access trends at a global for profit or commercial advantage and that copies bear this notice and the full citation on the first page

  3. Trinocular: Understanding Internet Reliability Through Adaptive Probing

    E-Print Network [OSTI]

    Heidemann, John

    and human factors cause Internet outages--from big events like Hurricane Sandy in 2012 and the Egyptian, increasing In- ternet "background radiation" by less than 0.7%. Trinocular is also predictable and precise accuracy. We validate our approach using controlled experiments, use Trinocular to analyze two days

  4. Using Google Earth for Internet GIS 

    E-Print Network [OSTI]

    Henry, Andrew

    2009-11-26

    The goal of this research is to investigate the potential of using Google Earth for Internet GIS applications. The study specifically examines the use of vector and attribute data and the potential of displaying and processing this data in new ways...

  5. PROPORTIONAL DIFFERENTIATED SERVICES FOR THE INTERNET

    E-Print Network [OSTI]

    Dovrolis, Constantinos

    PROPORTIONAL DIFFERENTIATED SERVICES FOR THE INTERNET by Konstantinos Dovrolis #12; PROPORTIONAL ­ MADISON 2000 #12; i To my family M ffae'šo& , Kff'øj, Ašš fflø ff, T ffoeo& #12; ii PROPORTIONAL develop the Proportional Differentiated Services (PDS) architecture. In PDS, the differentiation between

  6. Greening of the Internet Maruti Gupta

    E-Print Network [OSTI]

    Shihada, Basem

    of energy consumption of networking devices in the In- ternet, motivated by data collected by the U of saving energy is huge, particularly in the developing world where energy is a precious resource whose Internet deployment and access in the developing world where energy is very scarce. Table 1 [14] summarizes

  7. NESHAP Subpart W Activities An Internet Webinar

    E-Print Network [OSTI]

    sources regulated under Rad-NESHAP, including radon emissions from operation uranium mill tailings (NESHAPEPA'S NESHAP Subpart W Activities An Internet Webinar Reid J. Rosnick Environmental Protection the presentation, we'll try to answer as many questions as possible, time permitting #12;3 Overview What is NESHAP

  8. LITERATURE SEARCH TUTORIAL Open Internet Browser

    E-Print Network [OSTI]

    Dratz, Edward A.

    ://www.ncbi.nlm.nih.gov/entrez/query.fcgi · To search PubMed--fill in search box enter search terms, or enter author name, or journal titles--see instructions written below search box. To obtain detailed instructions on how to enter items, click on blueLITERATURE SEARCH TUTORIAL · Open Internet Browser · Go to http

  9. 0% 10% 20% 30% 40% Internet (9)

    E-Print Network [OSTI]

    Doyle, Robert

    8.0% 14% 9% 38.5% 1.5% 17% 6% 6% 0% 10% 20% 30% 40% Other (5) Internet (9) Applied Directly of Sales and Marketing Los Angeles CA Universal Pictures Production Assistant Astoria NY History of Art

  10. The Internet and HTML Jen Golbeck

    E-Print Network [OSTI]

    Golbeck, Jennifer

    rules · There are billions of web pages that are valid HTML but not valid XHTML - Thus, HTML will keep's Tutorial · Your first HTML page · Uploading your page to the Web server via FTP #12;15 HTML Basics · Tags1 The Internet and HTML Jen Golbeck College of Information Studies University of Maryland #12

  11. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  12. Women in Computing Professions: Will the Internet Make a Difference?

    E-Print Network [OSTI]

    Galpin, Vashti

    Women in Computing Professions: Will the Internet Make a Difference? Position Papers for an OII Profession: Will the Internet Make a Difference? Forum and its related discussion paper (to be posted at www, Internet technologies and IT professions. The background in Turkey Turkey has a population of around 68

  13. CARPOOL: Extending Free Internet Access over DTN in Urban Environments

    E-Print Network [OSTI]

    Tsaoussidis, Vassilis

    - tolerant access to the Internet for everyone, and (iii) has energy- efficient design that delegates allCARPOOL: Extending Free Internet Access over DTN in Urban Environments Ioannis Komnios and Vassilis-tolerant Internet access to all. Targeting an urban scenario, where means of public transport, such as buses

  14. New Mexico Tech Skeen Library Internet Use Policy

    E-Print Network [OSTI]

    Borchers, Brian

    New Mexico Tech Skeen Library Internet Use Policy Library users are encouraged to use the Internet - Internet resources are provided primarily for New Mexico Tech students, faculty and staff. Community users of New Mexico law prohibiting the display of sexually explicit matters in an establishment frequented

  15. CASE/CM Services Supporting InternetBased Software Engineering

    E-Print Network [OSTI]

    Biuk-Aghai, Robert P.

    CASE/CM Services Supporting Internet­Based Software Engineering Robert P. Biuk­Aghai Faculty of geographically dis­ tributed software engineers cooperating and com­ municating over the Internet. In the future of Internet­based Computer­Aided Software Engineering (CASE) and Configuration Manage­ ment (CM) environments

  16. October 16 2012 Considerations and Recommendations Concerning Internet Research and

    E-Print Network [OSTI]

    Biederman, Irving

    , but there are other issues to address: basic categorizations of types of Internet research; types of data; data the Internet affects individuals and their behaviors · Others (emerging and cross-platform types of researchPage 1 October 16 2012 Draft Considerations and Recommendations Concerning Internet Research

  17. Current Internet Technology and Statistics | Blessing or Curse? Jurgen Symanzik

    E-Print Network [OSTI]

    Symanzik, Jürgen

    Current Internet Technology and Statistics | Blessing or Curse? Jurgen Symanzik George Mason overview on the history of the Internet and some of its main features. In the second part, we introduce exist- ingInternet technology that e ects todays education and research in Statistics. Examples

  18. Potential Internet Applications in Forest Products Exporting and

    E-Print Network [OSTI]

    Potential Internet Applications in Forest Products Exporting and International Trade Olivian T Laboratory Louisiana State University Agricultural Center #12;Research Objectives · Provide Internet usage with implementing the Internet as a business tool · Document the use of foreign languages on wood products exporter

  19. A Guide to Finding Protein Information on the Internet

    E-Print Network [OSTI]

    Hill, Chris

    A Guide to Finding Protein Information on the Internet Alexander Simon Hill Lab University of Utah exist for collecting, analyzing, and synthesizing biological information on the Internet. However. The search process is complicated by characteristics of the Internet such as its rapid rate of growth

  20. The Internet rules of engagement: then and now Leonard Kleinrock

    E-Print Network [OSTI]

    Kleinrock, Leonard

    The Internet rules of engagement: then and now Leonard Kleinrock Computer Science Department carefully established the Rules of Engagement for the Internet in its earliest days around the time of its that the Internet has had upon society been influenced by the Rules of Engagement and in what ways do they need

  1. Internet Topology Research Redux Walter Willinger Matthew Roughan

    E-Print Network [OSTI]

    Roughan, Matthew

    Internet Topology Research Redux Walter Willinger Matthew Roughan AT&T Labs-Research University facets of Internet connectivity . . . . . . . . . . . . . . . . . . 2 1.2 Many interested parties with different objectives . . . . . . . . . . . . . 3 1.3 More than a decade of Internet topology research

  2. Fair Internet traffic integration: network flow models and analysis

    E-Print Network [OSTI]

    Kelly, Frank

    Fair Internet traffic integration: network flow models and analysis Peter Key, Laurent Massoulié the integration of two types of Internet traffic, elastic file transfers and streaming traffic. Previous studies have concentrated on just one type of traffic, such as the flow level models of Internet congestion

  3. Fontenot, UNO and Vlosky, LSU "Exploratory Study of Internet

    E-Print Network [OSTI]

    Fontenot, UNO and Vlosky, LSU "Exploratory Study of Internet Buyer-Seller Relationships" Renée J and Vlosky, LSU Purpose of Research x Explore how the Internet modifies the way that companies do business specifically with regards to changes in buyer-seller relationships. x Define basic elements of Internet

  4. CONGESTION CONTROL FOR MULTIMEDIA APPLICATIONS IN THE WIRELESS INTERNET

    E-Print Network [OSTI]

    Rakocevic, Veselin

    1 CONGESTION CONTROL FOR MULTIMEDIA APPLICATIONS IN THE WIRELESS INTERNET Veselin Rakocevic School applications require a fresh approach to congestion control in the Internet. Currently, congestion control to the ongoing discussion about the Internet congestion control by providing a parallel analysis of these two

  5. Current Internet Technology and Statistics ---Blessing or Curse? Jurgen Symanzik

    E-Print Network [OSTI]

    Symanzik, Jürgen

    Current Internet Technology and Statistics --- Blessing or Curse? J¨urgen Symanzik George Mason a general overview on the history of the Internet and some of its main features. In the second part, we introduce exist­ ing Internet technology that effects todays education and research in Statistics. Examples

  6. Internet pricing and the history of communications Andrew Odlyzko

    E-Print Network [OSTI]

    Odlyzko, Andrew M.

    Internet pricing and the history of communications Andrew Odlyzko AT&T Labs - Research amo, the telephone, and the Internet. In particular, the typical story for each service is that quality rises, prices. The historical analogies of this paper suggest that the Internet will evolve in a similar way, towards simplicity

  7. Internet Architecture: Lessons Learned and Looking Forward Geoffrey G. Xie

    E-Print Network [OSTI]

    Xie, Geoffrey

    Internet Architecture: Lessons Learned and Looking Forward Geoffrey G. Xie Department of Computer the architectural design of the Internet. The main objectives are: (i) highlight the design principles underlying the Internet architecture and explain their roles in the success of the network, and (ii) identify some

  8. Internet Packet Transport: Traffic Control and Network Engineering \\Lambda

    E-Print Network [OSTI]

    Kumar, Anurag

    Internet Packet Transport: Traffic Control and Network Engineering \\Lambda ANURAG KUMAR Dept. of Electrical Communication Engineering Indian Institute of Science Bangalore, 560 012 Abstract The Internet can of store­and­forward (also called elastic) traffic in the Internet. We first motivate the need for feedback

  9. Internet traffic growth: Sources and implications Andrew M. Odlyzko

    E-Print Network [OSTI]

    Odlyzko, Andrew M.

    Internet traffic growth: Sources and implications Andrew M. Odlyzko University of Minnesota, Minneapolis, MN, USA ABSTRACT The high tech bubble was inflated by myths of astronomical Internet traffic growth rates. Yet although these myths were false, Internet traffic was increasing very rapidly, close

  10. Internet Tomography Mark Coates Alfred Hero Robert Nowak Bin Yu

    E-Print Network [OSTI]

    Yu, Bin

    Internet Tomography Mark Coates Alfred Hero Robert Nowak Bin Yu January, 2002 ABSTRACT Today's Internet is a massive, distributed network which continues to explode in size as e- commerce and related activities grow. The heterogeneous and largely unregulated structure of the Internet renders tasks

  11. The CATI Project: Charging and Accounting Technology for the Internet

    E-Print Network [OSTI]

    Braun, Torsten

    The CATI Project: Charging and Accounting Technology for the Internet Burkhard Stiller1, Torsten The objectives of the CATI project (Charging and Accounting Technology for the Internet) include the design, implementation, and evaluation of charging and accounting mechanisms for Internet services and Virtual Private

  12. 5G Network Architecture and the Future Mobile Internet

    E-Print Network [OSTI]

    Garfunkel, Eric

    Vision Faster radio ~Gbps Low-latency wireless access ~ms Dynamic spectrum, multiple radio access Internet Architecture LTE w/FIA interface WiFi w/FIA interface Standard FIA Router FIA Distributed Control Internet Architecture (FIA) MobilityFirst Project Wireless Technology Trend "5G" Internet Technology Trend

  13. Environment Monitoring and Control of a Polyhouse Farm through Internet

    E-Print Network [OSTI]

    Khandekar, Sameer

    1 Environment Monitoring and Control of a Polyhouse Farm through Internet Yogesh R. Sonawane is the objective of the work presented in this paper. The objective is achieved through the use of internet based. Keywords: Monitoring and Control through internet, Polyhouse farm environment management. I. INTRODUCTION

  14. Toward Representative Internet Measurements Aditya Akella, Srinivasan Seshan

    E-Print Network [OSTI]

    Akella, Aditya

    and understand the structure and behavior of the Internet have a long history in the network research communityToward Representative Internet Measurements Aditya Akella, Srinivasan Seshan Dept. of Computer, and failure modes still is far from complete. Characterizing the operation of the current Internet

  15. Fighting the `Good' Internet War and George Danezis

    E-Print Network [OSTI]

    Danezis, George

    , is to suggest strategies and tactics to uncover them. 2 Waging War ­ History Lessons and Internet WarfareFighting the `Good' Internet War Dan Cvrcek and George Danezis 1 University of Cambridge, UK & Brno to counter Internet threats under the light of the classic strategy literature. The literature often

  16. CALL FOR PAPERS Workshop on Internet Programming Languages

    E-Print Network [OSTI]

    Läufer, Konstantin

    The Internet has long provided a global computing infrastructure but, for most of its history, there hasCALL FOR PAPERS Workshop on Internet Programming Languages in conjunction with the IEEE Computer the Internet. This workshop will provide a forum for the discussions of all aspects of computer languages

  17. Economic Issues Facing the Internet Hal R. Varian

    E-Print Network [OSTI]

    Varian, Hal R.

    ­spirited pattern of cooperation that have characterized the Internet's history would probably not have beenEconomic Issues Facing the Internet Hal R. Varian June 10, 1996 (Revised September 15, 1996 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 6 Summary 18 1 Introduction The peculiar economic situation of the Internet is due to the fact

  18. Triathlon of Lightweight Block Ciphers for the Internet of Things

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Triathlon of Lightweight Block Ciphers for the Internet of Things Daniel Dinu , Yann Le Corre to the question of how well these ciphers are suited to secure the Internet of Things (IoT). The benchmarking Introduction The Internet of Things (IoT) is a frequently-used term to describe the currently ongoing evolution

  19. Mobile Interaction with the Internet of Things Sven Siorpaes1

    E-Print Network [OSTI]

    Mobile Interaction with the Internet of Things Sven Siorpaes1 , Gregor Broll1 , Massimo Paolucci2 hand the Internet of Things provides a set of standards and methods to tag objects in the real world and an early prototype currently under development for mobile interactions with the Internet of Things. Hereby

  20. INTERNET AND E-COMMERCE PATENTS Bradley C. Wright

    E-Print Network [OSTI]

    Shamos, Michael I.

    the Internet want things faster, cheaper, and better. Waiting for a slow Web site to download overlyINTERNET AND E-COMMERCE PATENTS Bradley C. Wright The digital world is getting crowded. The number become pervasive, companies with an Internet presence have labored to distinguish their Web sites

  1. Holding Intruders Accountable on the Internet Stuart Staniford-Chen

    E-Print Network [OSTI]

    Yoo, S. J. Ben

    by many things, including greed, revenge, and peer pressure. 3, 4 As the Internet continues to growHolding Intruders Accountable on the Internet Stuart Staniford-Chen L. Todd Heberlein Department take advantage of the architecture of the Internet to hide their point of ori- gin, thus preserving

  2. TANGOW: Un Sistema de Enseanza Adaptativa a travs de Internet

    E-Print Network [OSTI]

    Carro, Rosa M.

    TANGOW: Un Sistema de Enseñanza Adaptativa a través de Internet Rosa María Carro, Estrella Pulido de cursos accesibles a través de Internet. Los cursos definidos con TANGOW se adaptan a los comienzos, tanto la red Internet como los servicios asociados a la World Wide Web han sido ampliamente

  3. TANGOW: Un Sistema de Enseanza Adaptativa a travs de Internet

    E-Print Network [OSTI]

    Carro, Rosa M.

    herramienta para desarrollar cursos adaptativos accesibles a través de Internet. Proceedings of the PrimerTANGOW: Un Sistema de Enseñanza Adaptativa a través de Internet Rosa María Carro, Estrella Pulido de cursos accesibles a través de Internet. Los cursos definidos con TANGOW se adaptan a los

  4. Guidelines for Internet Access to Journals This information provides publishers' Guidelines for Institutional Subscribers regarding Internet Access to Uni-

    E-Print Network [OSTI]

    Sprott, Julien Clinton

    Guidelines for Internet Access to Journals This information provides publishers' Guidelines for Institutional Subscribers regarding Internet Access to Uni- versity of Wisconsin Press Journal content. · INTERNET ACCESS is defined as the viewing and use of subscribed Journal content online via the World Wide

  5. Is BGP Update Storm a Sign of Trouble: Observing the Internet Control and Data Planes During Internet Worms

    E-Print Network [OSTI]

    Roughan, Matthew

    Is BGP Update Storm a Sign of Trouble: Observing the Internet Control and Data Planes During Internet Worms Matthew Roughan University of Adelaide matthew. roughan@ adelaide.edu.au Jun Li University, data plane, BGP, Internet worms, network measurement Abstract There are considerable reasons to wish

  6. Forest Products Marketing on the Internet "When history is written, the creation of the Internet may be ranked

    E-Print Network [OSTI]

    Forest Products Marketing on the Internet Bob Smith "When history is written, the creation of the Internet may be ranked alongside Johann Gutenberg's printing press and Marconi's radio as among the major attention in the past year than the Internet. Every major newspaper, magazine, and television station have

  7. INEEL AIR MODELING PROTOCOL ext

    SciTech Connect (OSTI)

    C. S. Staley; M. L. Abbott; P. D. Ritter

    2004-12-01

    Various laws stemming from the Clean Air Act of 1970 and the Clean Air Act amendments of 1990 require air emissions modeling. Modeling is used to ensure that air emissions from new projects and from modifications to existing facilities do not exceed certain standards. For radionuclides, any new airborne release must be modeled to show that downwind receptors do not receive exposures exceeding the dose limits and to determine the requirements for emissions monitoring. For criteria and toxic pollutants, emissions usually must first exceed threshold values before modeling of downwind concentrations is required. This document was prepared to provide guidance for performing environmental compliance-driven air modeling of emissions from Idaho National Engineering and Environmental Laboratory facilities. This document assumes that the user has experience in air modeling and dose and risk assessment. It is not intended to be a "cookbook," nor should all recommendations herein be construed as requirements. However, there are certain procedures that are required by law, and these are pointed out. It is also important to understand that air emissions modeling is a constantly evolving process. This document should, therefore, be reviewed periodically and revised as needed. The document is divided into two parts. Part A is the protocol for radiological assessments, and Part B is for nonradiological assessments. This document is an update of and supersedes document INEEL/INT-98-00236, Rev. 0, INEEL Air Modeling Protocol. This updated document incorporates changes in some of the rules, procedures, and air modeling codes that have occurred since the protocol was first published in 1998.

  8. A Low Cost Embedded System for Internet Based Power Measurement 

    E-Print Network [OSTI]

    Yeary, M.; Sweeney, J.; Culp, C.H; Swan, B.

    2003-01-01

    the Internet. Moreover, since our device uses a Java program for control, the data from several different sensors may be captured and calculations may be made before data is accessed by a central server on the Internet. As the Internet gains in prominence... web-server called a Tiny Internet Interface, which is a Java server (i.e. embedded system designed to run Java applications and interface between external hardware and a network). This device will be referred to as the Internet interface unit...

  9. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  10. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  11. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  12. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  13. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  14. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  15. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  16. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  17. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  18. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  19. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  20. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  1. Chapter 21: Residential Lighting Evaluation Protocol. Uniform...

    Office of Environmental Management (EM)

    Evaluation Protocol The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures Created as part of subcontract with period of...

  2. Chapter 16: Retrocommissioning Evaluation Protocol. The Uniform...

    Energy Savers [EERE]

    Evaluation Protocol The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures Created as part of subcontract with period of...

  3. Membrane and MEA Accelerated Stress Test Protocols

    Broader source: Energy.gov [DOE]

    This presentation on fuel cell membrane and MEA stress test protocols was given by T. Benjamin at the High Temperature Membrane Working Group Meeting in May 2007.

  4. Algorithms for Large-Scale Internet Measurements 

    E-Print Network [OSTI]

    Leonard, Derek Anthony

    2012-02-14

    using existing or inexpensive resources. We initially address distance estimation in the Internet, which is used by many distributed applications. We propose a new end-to-end measurement framework called Turbo King (T-King) that uses the existing DNS... infrastructure and, when compared to its predecessor King, obtains delay samples without bias in the presence of distant authoritative servers and forwarders, consumes half the bandwidth, and reduces the impact on caches at remote servers by several orders...

  5. Broadcasting over Internet Yatindra Nath Singh

    E-Print Network [OSTI]

    Singh Yatindra Nath

    Broadcasting over Internet Yatindra Nath Singh Electrical Engineering Department http://home.iitk.ac.in/~ynsingh Email: ynsingh@iitk.ac.in #12;06-12-07 ©2007 Y.N.Singh, IIT kanpur 2 Network structure Layered Application layer #12;06-12-07 ©2007 Y.N.Singh, IIT kanpur 3 #12;06-12-07 ©2007 Y.N.Singh, IIT kanpur 4

  6. Broadcasting over Internet-Yatindra Nath Singh

    E-Print Network [OSTI]

    Singh Yatindra Nath

    Broadcasting over Internet- III Yatindra Nath Singh Electrical Engineering Department http://home.iitk.ac.in/~ynsingh Email: ynsingh@iitk.ac.in #12;06-12-07 ©2007 Y.N.Singh, IIT kanpur 2 Basic architecture for IPTV system it to audio/video signal Audio video signal passed to TV #12;06-12-07 ©2007 Y.N.Singh, IIT kanpur 3 #12

  7. All information-theoretically secure key establishing protocols are quantum protocols

    E-Print Network [OSTI]

    Mario Stipcevic

    2005-03-26

    A theorem is proved which states that no classical key generating protocol could ever be provably secure. Consequently, candidates for provably secure protocols must rely on some quantum effect. Theorem relies on the fact that BB84 Quantum key distribution protocol has been proven secure.

  8. Security incidents on the Internet, 1989--1995

    SciTech Connect (OSTI)

    Howard, J.D.

    1995-12-31

    This paper presents an analysis of trends in Internet security based on an investigation of 4,299 Internet security-related incidents reported to the CERT{reg_sign} Coordination Center (CERT{reg_sign}/CC) from 1989 through 1995. Prior to this research, knowledge of actual Internet security incidents was limited and primarily anecdotal. This research: (1) developed a taxonomy to classify Internet attacks and incidents, (2) organized, classified, and analyzed CERT{reg_sign}/CC incident records, (3) summarized the relative frequency of the use of tools and vulnerabilities, success in achieving access, and results of attacks, (4) estimated total Internet incident activity, (5) developed recommendations for Internet users and suppliers, and (6) developed recommendations for future research. With the exception of denial-of-service attacks, security incidents were found to be increasing at a rate less than Internet growth. Estimates showed that most, if not all, severe incidents were reported to the CERT{reg_sign}/CC, and that more than one out of three above average incidents (in terms of duration and number of sites) were reported. Estimates also indicated that a typical Internet site was involved in, at most, around one incident (of any kind) per year, and a typical Internet host in, at most, around one incident in 45 years. The probability of unauthorized privileged access was around an order of magnitude less likely. As a result, simple and reasonable security precautions should be sufficient for most Internet users.

  9. Packet flow monitoring tool and method

    DOE Patents [OSTI]

    Thiede, David R [Richland, WA

    2009-07-14

    A system and method for converting packet streams into session summaries. Session summaries are a group of packets each having a common source and destination internet protocol (IP) address, and, if present in the packets, common ports. The system first captures packets from a transport layer of a network of computer systems, then decodes the packets captured to determine the destination IP address and the source IP address. The system then identifies packets having common destination IP addresses and source IP addresses, then writes the decoded packets to an allocated memory structure as session summaries in a queue.

  10. IEEE Wireless Communications August 200940 1536-1284/09/$25.00 2009 IEEE SERVICE-ORIENTED BROADBAND

    E-Print Network [OSTI]

    Zhang, Xi

    IEEE Wireless Communications · August 200940 1536-1284/09/$25.00 © 2009 IEEE Internet SERVICE-ORIENTED BROADBAND WIRELESS NETWORK ARCHITECTURE INTRODUCTION Recent years have witnessed the emergence of a variety of wireless services, such as videoconfer- encing, Internet Protocol (IP) TV, music down- loading, and online

  11. Improving the Security of Cryptographic Protocol Standards

    E-Print Network [OSTI]

    Basin, David

    for their implementation. This generality is enabled by standards and technical documents such as Request for CommentsImproving the Security of Cryptographic Protocol Standards David Basin Cas Cremers Kunihiko Miyazaki Sasa Radomirovic Dai Watanabe May 1, 2014 Keywords: Standards, Network Protocols, Security

  12. Symbolic Verification of Timed Asynchronous Hardware Protocols

    E-Print Network [OSTI]

    Stevens, Ken

    of system level verification by applying symbolic model checking techniques to help mitigate the state constraints into verification models to prove timed behavioral correctness of systems employing timed protocol to model timing in asynchronous hardware protocols ­ a novel mapping of tim- ing into the verification flow

  13. Protocols for Processes Munindar P. Singh

    E-Print Network [OSTI]

    Protocols for Processes Munindar P. Singh (Students: Amit K. Chopra, Nirmit V. Desai, Ashok U. Mallya) singh@ncsu.edu Department of Computer Science North Carolina State University http://www.csc.ncsu.edu/faculty/mpsingh/ c Munindar P. Singh, July 2004 ­ p.1/25 #12;Why Processes and Protocols? Heavy interest from

  14. Positron: Composing Commitment Protocols No Institute Given

    E-Print Network [OSTI]

    to a specific role). We evaluate our contributions by modeling well-known protocols in the insurance, manufactur with how they relate to one another. Such a description, even if supported by standards such as BPMN [20 exchanged by the business partners. In contrast, a commitment protocol emphasizes the social state

  15. Verifying authentication protocols with CSP Steve Schneider

    E-Print Network [OSTI]

    Doran, Simon J.

    Verifying authentication protocols with CSP Steve Schneider Department of Computer Science Royal of Communicating Sequential Processes (CSP). It is il- lustrated by an examination of the Needham-Schroeder public of authentication protocols, built on top of the gen- eral CSP semantic framework. This approach aims to combine

  16. Measuring Transport Protocol Potential for Energy Efficiency

    E-Print Network [OSTI]

    Tsaoussidis, Vassilis

    Measuring Transport Protocol Potential for Energy Efficiency S. Kontogiannis, L. Mamatas, I. Psaras. Several attempts have been made to measure the energy efficiency of trans- port protocols, (e.g. [10], [12-saving potential of transport pro- tocols. We focus on the system-related aspect of energy. Do we have to damage

  17. Network Upgrade for the SLC: Control System Modifications

    SciTech Connect (OSTI)

    Crane, M.; Mackenzie, R.; Sass, R.; Himel, T.; /SLAC

    2011-09-09

    Current communications between the SLAC Linear Collider control system central host and the SLCmicros is built upon the SLAC developed SLCNET communication hardware and protocols. We will describe how the Internet Suite of protocols (TCP/IP) are used to replace the SLCNET protocol interface. The major communication pathways and their individual requirements are described. A proxy server is used to reduce the number of total system TCP/IP connections. The SLCmicros were upgraded to use Ethernet and TCP/IP as well as SLCNET. Design choices and implementation experiences are addressed.

  18. Router-level community structure of the Internet Autonomous Systems

    E-Print Network [OSTI]

    Beiró, Mariano G; Alvarez-Hamelin, J Ignacio

    2015-01-01

    The Internet is composed of routing devices connected between them and organized into independent administrative entities: the Autonomous Systems. The existence of different types of Autonomous Systems (like large connectivity providers, Internet Service Providers or universities) together with geographical and economical constraints, turns the Internet into a complex modular and hierarchical network. This organization is reflected in many properties of the Internet topology, like its high degree of clustering and its robustness. In this work, we study the modular structure of the Internet router-level graph in order to assess to what extent the Autonomous Systems satisfy some of the known notions of community structure. We show that the modular structure of the Internet is much richer than what can be captured by the current community detection methods, which are severely affected by resolution limits and by the heterogeneity of the Autonomous Systems. Here we overcome this issue by using a multiresolution d...

  19. Internet of Things Exploring and Securing a Future

    E-Print Network [OSTI]

    Maguire Jr., Gerald Q.

    Internet of Things Exploring and Securing a Future Concept CRISTIAN BUDE and ANDREAS KERVEFORS OF TECHNOLOGY I N F O R M A T I O N A N D C O M M U N I C A T I O N T E C H N O L O G Y #12;Internet of Things) Department of Communication Systems SE-100 44 Stockholm, Sweden #12;Abstract | i Abstract Internet of Things

  20. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  1. Context-Aware Protocol Engines for  Ad Hoc Networks

    E-Print Network [OSTI]

    Garcia-Luna-Aceves, J.J.

    2009-01-01

    Context-Aware Protocol Engines for Ad Hoc Networks J. J.we call a context-aware protocol engine. With a CAPE, nodesthe context-aware protocol engine (CAPE) as an instantiation

  2. Adapting a delay-based protocol to heterogeneous environments 

    E-Print Network [OSTI]

    Kotla, Kiran

    2008-10-10

    We investigate the issues in making a delay-based protocol adaptive to heterogeneous environments. We assess and address the problems a delay-based protocol faces when competing with a loss-based protocol such as TCP. We ...

  3. An Alternative Quantization Protocol for the History Dependent Parrondo Game

    E-Print Network [OSTI]

    Faisal Shah Khan

    2008-06-09

    Earlier work on the quantization of the history dependent (HD) Parrondo game by Flitney, Ng, and Abbott led to the FNA protocol. We propose an alternative quantization protocol for this game which differs from the FNA protocol in various aspects.

  4. Office of Environment, Safety and Health Assessments Protocol...

    Broader source: Energy.gov (indexed) [DOE]

    April 2015 Office of Environment, Safety and Health Assessments Protocol for Site Leads, April 2015 (Revision 1) - PROTOCOL - EA-31-01 The purpose of this protocol is to establish...

  5. GE Scientist Stephan Biller Discusses the Industrial Internet...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Manufacturing Scientist Stephan Biller Discusses the Industrial Internet Click to email this to a friend (Opens in new window) Share on Facebook (Opens in new window) Click to...

  6. The regulation of internet interconnection : assessing network market power

    E-Print Network [OSTI]

    Maida, Elisabeth M. (Elisabeth Marigo)

    2013-01-01

    Interconnection agreements in the telecommunications industry have always been constrained by regulation. Internet interconnection has not received the same level of scrutiny. Recent debates regarding proposed mergers, ...

  7. Internet of Things | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenryInhibitingInteractive JobsEngagement |InternationalInternet of

  8. Internet Engineering Task Force IPTEL WG INTERNET-DRAFT Lennox/Schulzrinne

    E-Print Network [OSTI]

    Lennox, Jonathan

    -abstracts.txt" listing contained in the Internet-Drafts Shadow Directories on ftp.is.co.za (Africa), nic and deploy. This document describes an architecture for such a method, which we call a call processing examples 2 3 Architecture 4 3.1 Network components

  9. CrCration dation d''un siteun site Internet personnelInternet personnel

    E-Print Network [OSTI]

    Vellend, Mark

    page web est fait en grosse partie de code HTML,Une page web est fait en grosse partie de code HTML des fichiers du site Internet ·· ComposComposéé de fichiers .html (.htm, .de fichiers .html (.htm, HyperTextHyperText MarkupMarkup LanguageLanguage;; Si vous dSi vous déésirez en savoir plus sur le HTML

  10. CINEMA: Columbia InterNet Extensible Multimedia Architecture Kundan Singh, Wenyu Jiang, Jonathan Lennox, Sankaran Narayanan and Henning Schulzrinne

    E-Print Network [OSTI]

    CINEMA: Columbia InterNet Extensible Multimedia Architecture Kundan Singh, Wenyu Jiang, Jonathan and implementation of our Internet telephony system CINEMA (Columbia InterNet Extensible Multimedia Architecture

  11. Seamless Integration of Heterogeneous Devices and Access Control in Smart Homes

    E-Print Network [OSTI]

    the Internet as well as increasing penetration of wireless protocols such as ZigBee has raised attention semantic discovery of home devices at runtime by integrating several protocols including X10, Insteon, ZigBee] or Insteon [2], wireless communications (ZigBee [3], Z-Wave [4]), IP-based UPnP (Universal Plug-and-Play) [5

  12. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  13. Light Duty Fuel Cell Electric Vehicle Hydrogen Fueling Protocol...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Light Duty Fuel Cell Electric Vehicle Hydrogen Fueling Protocol Light Duty Fuel Cell Electric Vehicle Hydrogen Fueling Protocol Download the webinar slides from the U.S. Department...

  14. Secure SCADA Communication ProtocolPerformance Test Results ...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Secure SCADA Communication ProtocolPerformance Test Results Secure SCADA Communication ProtocolPerformance Test Results The Pacific Northwest National Laboratory (PNNL) was tasked...

  15. The Greenhouse Gas Protocol Initiative: GHG Emissions from Refrigerati...

    Open Energy Info (EERE)

    The Greenhouse Gas Protocol Initiative: GHG Emissions from Refrigeration and Air Conditioning Jump to: navigation, search Tool Summary LAUNCH TOOL Name: The Greenhouse Gas Protocol...

  16. High Performance Computing Data Center Metering Protocol | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    High Performance Computing Data Center Metering Protocol High Performance Computing Data Center Metering Protocol Guide details the methods for measurement in High Performance...

  17. NOAA Fisheries Protocols For Hydro-dynamic Dredge Surveys

    E-Print Network [OSTI]

    NOAA Fisheries Protocols For Hydro-dynamic Dredge Surveys: Surf Clams and Ocean Quahogs December 19..................................................................................................................................... 1 NOAA Fisheries Hydro-dynamic Clam Dredge Survey Protocols

  18. TEC Working Group Topic Groups Archives Protocols Meeting Summaries...

    Office of Environmental Management (EM)

    Working Group Topic Groups Archives Protocols Meeting Summaries Meeting Summaries Philadelphia TEC Meeting, Protocols Topic Group Summary - July 1999 Jacksonville TEC Meeting,...

  19. Development of an Accelerated Ash-Loading Protocol for Diesel...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    an Accelerated Ash-Loading Protocol for Diesel Particulate Filters Development of an Accelerated Ash-Loading Protocol for Diesel Particulate Filters Poster presentation at the 2007...

  20. Protocol for Enhanced Evaluations of Beyond Design Basis Events...

    Office of Environmental Management (EM)

    Protocol for Enhanced Evaluations of Beyond Design Basis Events Supporting Implementation of Operating Experience Report 2013-01 Protocol for Enhanced Evaluations of Beyond Design...

  1. Protocol for Addressing Induced Seismicity Associated with Enhanced...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Protocol for Addressing Induced Seismicity Associated with Enhanced Geothermal Systems (EGS) Protocol for Addressing Induced Seismicity Associated with Enhanced Geothermal Systems...

  2. Protocol for Addressing Induced Seismicity Associated with Enhanced...

    Energy Savers [EERE]

    Protocol for Addressing Induced Seismicity Associated with Enhanced Geothermal Systems Protocol for Addressing Induced Seismicity Associated with Enhanced Geothermal Systems This...

  3. The Development of Rapid Aging and Poisoning Protocols for Diesel...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Development of Rapid Aging and Poisoning Protocols for Diesel Aftertreatment Devices The Development of Rapid Aging and Poisoning Protocols for Diesel Aftertreatment Devices...

  4. Rapid Aging Protocols for Diesel Aftertreatment Devices: NOx...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Aging Protocols for Diesel Aftertreatment Devices: NOx Abatement Catalysts Rapid Aging Protocols for Diesel Aftertreatment Devices: NOx Abatement Catalysts Poster presentation at...

  5. Office of Environment, Safety and Health Assessments Protocol...

    Energy Savers [EERE]

    March 2015 (Revision 1) - PROTOCOL - EA-30-01 Office of Environment, Safety and Health Assessments Protocol for the Development and Maintenance of Criteria Review and...

  6. Optimizing local protocols implementing nonlocal quantum gates

    E-Print Network [OSTI]

    Scott M. Cohen

    2010-02-02

    We present a method of optimizing recently designed protocols for implementing an arbitrary nonlocal unitary gate acting on a bipartite system. These protocols use only local operations and classical communication with the assistance of entanglement, and are deterministic while also being "one-shot", in that they use only one copy of an entangled resource state. The optimization is in the sense of minimizing the amount of entanglement used, and it is often the case that less entanglement is needed than with an alternative protocol using two-way teleportation.

  7. Energy Assessment Protocol for Glass Furnaces 

    E-Print Network [OSTI]

    Plodinec, M. J.; Kauffman, B. M.; Norton, O. P.; Richards, C.; Connors, J.; Wishnick, D.

    2005-01-01

    of the protocol are implemented, resulting in cost savings of greater than $200,000 per year. PROJECT OVERVIEW The glass industry is a major energy consumer. Depending on the market sector, a glass furnace heated by oxy-fuel burners may use from 3..., the manufacturer of the burners used in the PPG furnace, brought extensive field experience to the team, as well as in-depth knowledge of burner performance. ENERGY ASSESSMENT PROTOCOL The project team developed the protocol based on DIAL, Eclipse and PPG...

  8. STANDARD OPERATING PROTOCOLS FOR DECOMMISSIONING

    SciTech Connect (OSTI)

    Foss, D. L.; Stevens, J. L.; Gerdeman, F. W.

    2002-02-25

    Decommissioning projects at Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) sites are conducted under project-specific decision documents, which involve extensive preparation time, public comment periods, and regulatory approvals. Often, the decision documents must be initiated at least one year before commencing the decommissioning project, and they are expensive and time consuming to prepare. The Rocky Flats Environmental Technology Site (RFETS) is a former nuclear weapons production plant at which hazardous substances and wastes were released or disposed during operations. As a result of the releases, RFETS was placed on the National Priorities List in 1989, and is conducting cleanup activities under a federal facilities compliance agreement. Working closely with interested stakeholders and state and federal regulatory agencies, RFETS has developed and implemented an improved process for obtaining the approvals. The key to streamlining the approval process has been the development of sitewide decision documents called Rocky Flats Cleanup Agreement Standard Operating Protocols or ''RSOPs.'' RSOPs have broad applicability, and could be used instead of project-specific documents. Although no two decommissioning projects are exactly the same and they may vary widely in contamination and other hazards, the basic steps taken for cleanup are usually similar. Because of this, using RSOPs is more efficient than preparing a separate project-specific decision documents for each cleanup action. Over the Rocky Flats cleanup life cycle, using RSOPs has the potential to: (1) Save over 5 million dollars and 6 months on the site closure schedule; (2) Eliminate preparing one hundred and twenty project-specific decision documents; and (3) Eliminate writing seventy-five closure description documents for hazardous waste unit closure and corrective actions.

  9. A SECURE TEXT MESSAGING PROTOCOL Gary Belvin

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    in conformity with the requirements for the degree of Master of Science in Security Informatics. Baltimore Key Agreement Protocol for SMS (KAPS) 12 3.1 Retransmission Validation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 18 3.9 Key Agreement

  10. The Kyoto Protocol and developing countries

    E-Print Network [OSTI]

    Babiker, Mustafa H.M.; Reilly, John M.; Jacoby, Henry D.

    Under the Kyoto Protocol, the world's wealthier countries assumed binding commitments to reduce greenhouse gas emissions. The agreement requires these countries to consider ways to minimize adverse effects on developing ...

  11. Verifying the Mascara Protocol | A rst step |

    E-Print Network [OSTI]

    Sidorova, Natalia

    Verifying the Mascara Protocol | A #12;rst step | Dragan Bosnacki Dennis Dams Susanne Graf Leszek list properties associated with the di#11;erent entities which we intend to verify or for which we

  12. An Algorithm for Evolving Protocol Constraints 

    E-Print Network [OSTI]

    Collins, Mark

    We present an investigation into the design of an evolutionary mechanism for multiagent protocol constraint optimisation. Starting with a review of common population based mechanisms we discuss the properties of the ...

  13. The Performance of Internet-based Business Models: Evidence from the Banking Industry

    E-Print Network [OSTI]

    DeYoung, Robert

    2005-01-01

    This study introduces a general intuitive framework for analyzing start-up firms with Internet-based business plans, and estimates the framework for Internet-only banks and thrifts in the U.S. Internet-only banks historically ...

  14. Let The People Know the Facts: Can Government Information Removed From the Internet Be Reclaimed?

    E-Print Network [OSTI]

    2006-01-01

    information to the Internet. A Brief History of the Freedomhistory establishes a mandate to post materials on the InternetInternet. 104 The language of the E-FOIA amendments and the legislative history

  15. From Control Society to Parliament of Things: Designing Object Relations with an Internet of Things

    E-Print Network [OSTI]

    Tuters, Marc

    2009-01-01

    Giving shape to the internet of things. Leonardo, Vol. 39(and Aibos in the Internet of Things, 2004. [7] J. Bleecker.Object Relations with an Internet of Things Marc Tuters

  16. Roadmap for Real World Internet applications Socioeconomic scenarios

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Roadmap for Real World Internet applications ­ Socioeconomic scenarios and design recommendations that is feasible to roadmap the dynamic deployment of Real World Internet applications. A multi- faceted scenarios. These scenarios are used as a roadmap for the system and architecture deployment. The application

  17. Transactions in GIS Dynamic Modelling and Visualization on the Internet

    E-Print Network [OSTI]

    Worboys, Mike

    1 Transactions in GIS Dynamic Modelling and Visualization on the Internet Bo Huang* and Michael F for GIS to incorporate dynamic analytic models. At the same time, there is a need to distribute results of dynamic GIS using the Internet. Therefore, this paper sets out to explore the implementation of dynamic

  18. Impact of Internet Usage in Saudi Arabia: A Social Perspective

    E-Print Network [OSTI]

    Sait, Sadiq M.

    Impact of Internet Usage in Saudi Arabia: A Social Perspective Sadiq M. Sait, KFUPM, Dhahran Arabia was introduced in the late 1990s. Being relatively new, its effects and impact on Saudi society and Society, Social Perspective, Internet Usage, Saudi Arabia INTRODUCTION Society and social systems can

  19. NIST STANDARD REFERENCE DATA (SRD) INTERNET SERVICE SUBSCRIPTION LICENSE

    E-Print Network [OSTI]

    NIST STANDARD REFERENCE DATA (SRD) INTERNET SERVICE SUBSCRIPTION LICENSE This document is a non-exclusive, non-transferrable, non-assignable and limited License Agreement (AGREEMENT) between the National ­ a person designated in the License to use the Internet Edition of a NIST Standard Reference Database under

  20. The Java Market: Transforming the Internet into a Metacomputer

    E-Print Network [OSTI]

    Amir, Yair

    The Java Market: Transforming the Internet into a Metacomputer Yair Amir 1 , Baruch Awerbuch running on a producer's machine. The Java Market modifies the submitted application. It transforms of the time. This paper presents the Java Market, a system that allows organizations and Internet users

  1. Radial structure of the Internet BY PETTER HOLME

    E-Print Network [OSTI]

    New Mexico, University of

    Radial structure of the Internet BY PETTER HOLME 1, *, JOSH KARLIN 1 AND STEPHANIE FORREST 1,2 1 Department of Computer Science, University of New Mexico, Albuquerque, NM 87131, USA 2 Santa Fe Institute, 1399 Hyde Park Road, Santa Fe, NM 87501, USA The structure of the Internet at the autonomous system (AS

  2. Implications of Security Enhancements and Interventions for Core Internet Infrastructure

    E-Print Network [OSTI]

    New Mexico, University of

    Implications of Security Enhancements and Interventions for Core Internet Infrastructure Sharon University of New Mexico First posted August 15, 2014. Last revised September 9, 2014. Abstract Security enhancements to the Internet are often implemented as hierarchical and centralizing structures grafted onto

  3. A Multilingual Usage Consultation Tool Based on Internet Searching

    E-Print Network [OSTI]

    Nakagawa, Hiroshi

    present a usage consultation tool, based on Internet searching, for language learners. When a user enters terms in dictionar- ies. Another way to search for information on usage is to use the KWIC (Key WordA Multilingual Usage Consultation Tool Based on Internet Searching -More than a search engine, less

  4. On Correlated Availability in Internet-Distributed Systems Derrick Kondo

    E-Print Network [OSTI]

    Kondo, Derrick

    On Correlated Availability in Internet-Distributed Systems Derrick Kondo INRIA, France dkondo measure and characterize the time dynamics of availability in a large-scale Internet- distributed system with over 110,000 hosts. Our char- acterization focuses on identifying patterns of corre- lated availability

  5. Internet and World Wide Web (WWW) EXEN 550, Management Information

    E-Print Network [OSTI]

    Kimbrough, Steven Orla

    Internet and World Wide Web (WWW) Lab: EXEN 550, Management Information Systems University's mode of addressing 2. Lynx---exploring the Web with a simple text­based browser \\Lambda File: internet on the Web---tools for finding things 5. Building your own Web page Throughout, we will emphasize basic

  6. Explorative study of African Americans and internet dating 

    E-Print Network [OSTI]

    Spates, Kamesha Sondranek

    2005-02-17

    -1 EXPLORATIVE STUDY OF AFRICAN AMERICANS AND INTERNET DATING A Thesis by KAMESHA SONDRANEK SPATES Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE December 2004 Major Subject: Sociology EXPLORATIVE STUDY OF AFRICAN AMERICANS AND INTERNET DATING A Thesis by KAMESHA SONDRANEK SPATES Submitted to Texas A...

  7. Smarter Cropping: Internet program helps farmers make decisions about crops 

    E-Print Network [OSTI]

    Wythe, Kathy

    2009-01-01

    Wythe tx H2O | pg. 26 Smarter Cropping Internet program helps farmers make decisions about crops Along the coastal plains of Texas, farmers and crop managers are using the Internet to make more informed decisions about growing cotton. This Web...

  8. e-Ireland: Europe's New Internet Hub Hrvoje Benko

    E-Print Network [OSTI]

    Benko, Hrvoje

    e-Ireland: Europe's New Internet Hub Hrvoje Benko In a few years' time, there will be no Internet Europe and Asian-Pacific countries experience intensive growth in 2002. (Forrester) The amazing thing. It appears that Ireland is just coming out of the "catching up" phase with the rest of Europe

  9. Field Monitoring Protocol: Heat Pump Water Heaters

    SciTech Connect (OSTI)

    "B. Sparn, L. Earle, D. Christensen, J. Maguire, and E. Wilson, C.E. Hancock

    2013-02-01

    This document provides a standard field monitoring protocol for evaluating the installed performance of Heat Pump Water Heaters in residential buildings. The report is organized to be consistent with the chronology of field test planning and execution. Research questions are identified first, followed by a discussion of analysis methods, and then the details of measuring the required information are laid out. A field validation of the protocol at a house near the NREL campus is included for reference.

  10. CIS 455: Internet and Web Systems Course Number & Title (A.1) CIS 455 Internet and Web Systems

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    CIS 455: Internet and Web Systems Course Number & Title (A.1) CIS 455 Internet and Web Systems and web systems: scalability, interoperability (of data and code), atomicity and consistency models-backed or PHP/JSP/Servlet-based web sites (for this, see CIS 330/550 or MKSE 212). Here, we will learn how

  11. Geographic Trough Filling for Internet Datacenters

    E-Print Network [OSTI]

    Xu, Dan

    2011-01-01

    To reduce datacenter energy consumption and cost, current practice has considered demand-proportional resource provisioning schemes, where servers are turned on/off according to the load of requests. Most existing work considers instantaneous (Internet) requests only, which are explicitly or implicitly assumed to be delay-sensitive. On the other hand, in datacenters, there exist a vast amount of delay-tolerant jobs, such as background/maintainance jobs. In this paper, we explicitly differentiate delay-sensitive jobs and delay tolerant jobs. We focus on the problem of using delay-tolerant jobs to fill the extra capacity of datacenters, referred to as trough/valley filling. Giving a higher priority to delay-sensitive jobs, our schemes complement to most existing demand-proportional resource provisioning schemes. Our goal is to design intelligent trough filling mechanisms that are energy efficient and also achieve good delay performance. Specifically, we propose two joint dynamic speed scaling and traffic shifti...

  12. August 1998Published for the Members of the IP Multicast Initiative. BROADCAST on page 6

    E-Print Network [OSTI]

    Touch, Joe

    and financial services, media and manufacturing, retail, energy, telecommunications, and more. Our services in the international business community, with offices in eight countries in North America, Asia, and Europe. Our-known aggregator of Internet audio sites, became America's best-ever initial publicoffering when its shares opened

  13. An Optimal Strong Password Authentication Protocol with USB Sticks

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    transactions require a more stringent authentication process [11]. The use of digital certificates issued authentication mechanism has three class classifications are: the password-only PA protocols, the dedicated device-aided protocols and memory device-aided protocols. The Password-only PA protocol, has no extra

  14. On the Complexity of Verifying Cyber-Physical Security Protocols

    E-Print Network [OSTI]

    Nigam, Vivek

    On the Complexity of Verifying Cyber-Physical Security Protocols Max Kanovich, Tajana Ban Kirigin agents. We classify such security protocols as Cyber-Physical.6 The key elements of such protocols important class of Bounded Memory Cyber-Physical Security19 Protocols with a Memory Bounded Intruder

  15. Validating a token coherence protocol for scientific Fernandez-Pascual

    E-Print Network [OSTI]

    Acacio, Manuel

    Validating a token coherence protocol for scientific workloads Ricardo Fern´andez-Pascual r.fernandez

  16. Automatic Protocol Selection in Secure Two-Party Computations

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Automatic Protocol Selection in Secure Two-Party Computations (Full Version) Florian Kerschbaum1 for the best performance. In this paper we propose automatic protocol selection which selects a protocol, based on an extended performance model we automatically select the best protocol for a sub

  17. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  18. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  19. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  20. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  1. Hybrid protocol of remote implementations of quantum operations

    E-Print Network [OSTI]

    Ning Bo Zhao; An Min Wang

    2007-08-04

    We propose a protocol of remote implementations of quantum operations by hybridizing bidirectional quantum state teleportation's (BQST) and Wang's one. The protocol is available for remote implemetations of quantum operations in the restricted sets specified in Sec. III. We also give the proof of the protocol and point out its optimization. As an extension, this hybrid protocol can be reduced to BQST and Wang protocols.

  2. Transport Protocol Services (TAPS) Problem: more and more transport protocols available, with various features,

    E-Print Network [OSTI]

    Welzl, Michael

    Transport Protocol Services (TAPS) · Problem: more and more transport protocols that would not offer "TCP or UDP" but "transport services" ­ A transport system: transport-services@ifi.uio.no hXps://sympa.uio.no/ifi.uio.no/info/transport-services · Problem

  3. Bandwidth Efficient Source Tracing (BEST) Routing Protocol for Wireless Networks

    E-Print Network [OSTI]

    Garcia-Luna-Aceves, J.J.

    2006-01-01

    to a real embedded wireless router. The stack uses IP as theinven- tion can be used as the basis for wireless routers.Wireless routers employing BEST will eliminate the need for

  4. Chapter 22: Compressed Air Evaluation Protocol

    SciTech Connect (OSTI)

    Benton, N.

    2014-11-01

    Compressed-air systems are used widely throughout industry for many operations, including pneumatic tools, packaging and automation equipment, conveyors, and other industrial process operations. Compressed-air systems are defined as a group of subsystems composed of air compressors, air treatment equipment, controls, piping, pneumatic tools, pneumatically powered machinery, and process applications using compressed air. A compressed-air system has three primary functional subsystems: supply, distribution, and demand. Air compressors are the primary energy consumers in a compressed-air system and are the primary focus of this protocol. The two compressed-air energy efficiency measures specifically addressed in this protocol are: high-efficiency/variable speed drive (VSD) compressor replacing modulating compressor; compressed-air leak survey and repairs. This protocol provides direction on how to reliably verify savings from these two measures using a consistent approach for each.

  5. Chapter 15: Commercial New Construction Protocol

    SciTech Connect (OSTI)

    Keates, S.

    2014-09-01

    This protocol is intended to describe the recommended method when evaluating the whole-building performance of new construction projects in the commercial sector. The protocol focuses on energy conservation measures (ECMs) measures (or packages of measures) where evaluators can best analyze impacts using building simulation. These ECMs typically require the use of calibrated building simulations under Option D of the International Performance Measurement and Verification Protocol. Examples of such measures include Leadership in Energy and Environmental Design building certification, novel and/or efficient heating, ventilation, and air conditioning system designs, and extensive building controls systems. In general, it is best to evaluate any ECM (or set of measures) expected to significantly interact with other systems within the building and with savings sensitive to seasonal variations in weather.

  6. Quantum Communication Protocol Employing Weak Measurements

    E-Print Network [OSTI]

    Alonso Botero; Benni Reznik

    1999-09-27

    We propose a communication protocol exploiting correlations between two events with a definite time-ordering: a) the outcome of a {\\em weak measurement} on a spin, and b) the outcome of a subsequent ordinary measurement on the spin. In our protocol, Alice, first generates a "code" by performing weak measurements on a sample of N spins. The sample is sent to Bob, who later performs a post-selection by measuring the spin along either of two certain directions. The results of the post-selection define the "key', which he then broadcasts publicly. Using both her previously generated code and this key, Alice is able to infer the {\\em direction} chosen by Bob in the post-selection. Alternatively, if Alice broadcasts publicly her code, Bob is able to infer from the code and the key the direction chosen by Alice for her weak measurement. Two possible experimental realizations of the protocols are briefly mentioned.

  7. Int. J. Internet Protocol Technology, Vol. 2, Nos. 3/4, 2007 141 Copyright 2007 Inderscience Enterprises Ltd.

    E-Print Network [OSTI]

    Sheng, Michael

    in the College of Information Technology at Zayed University in Dubai, UAE. He holds a PhD Degree in Computer tremendous opportunities for linking various objects from the real world. These objects are numbered

  8. ACCEPTED -IEEE INTERNATIONAL SYMPOSIUM ON INTELLIGENT CONTROL -2003 1 Internet-like Protocols for the Control and

    E-Print Network [OSTI]

    Mexico Albuquerque, NM 87131-0001 {rsandova,chaouki,hokayem}@eece.unm.edu Abstract In this paper we show, priced, and corrupted". However, and for control purposes, it is also "timed". To make the general idea, Mexico. The research of C.T. Abdallah and P.F. Hokayem is supported by NSF-0233205. #12;ACCEPTED - IEEE

  9. Light storage protocols in Tm:YAG

    E-Print Network [OSTI]

    T. Chanelière; R. Lauro; J. Ruggiero; J. -L. Le Gouët

    2009-11-17

    We present two quantum memory protocols for solids: A stopped light approach based on spectral hole burning and the storage in an atomic frequency comb. These procedures are well adapted to the rare-earth ion doped crystals. We carefully clarify the critical steps of both. On one side, we show that the slowing-down due to hole-burning is sufficient to produce a complete mapping of field into the atomic system. On the other side, we explain the storage and retrieval mechanism of the Atomic Frequency Comb protocol. This two important stages are implemented experimentally in Tm$^{3+}$- doped yttrium-aluminum-garnet crystal.

  10. Financial Incentives for Route Aggregation and Efficient Address Utilization in the Internet

    E-Print Network [OSTI]

    Resnick, Paul

    . The technology growth curve may also be unable to keep up with the growth of the Internet. Sometimes Bellovin (AT&T Labs­­ Research) smb@research.att.com Abstract Growth of the Internet is limited both Internet growth through the smallest resource expenditures possible. The Internet consists of many

  11. In Things We Trust? Towards trustability in the Internet of Things

    E-Print Network [OSTI]

    Hoepman, Jaap-Henk

    2011-01-01

    This essay discusses the main privacy, security and trustability issues with the Internet of Things.

  12. Towards 3D Internet: Why, What, and How? Tansu Alpcan, Christian Bauckhage, Evangelos Kotsovinos

    E-Print Network [OSTI]

    Alpcan, Tansu

    Towards 3D Internet: Why, What, and How? Tansu Alpcan, Christian Bauckhage, Evangelos Kotsovinos paradigm, the 3D Internet. We provide an overview of the concept 3D Internet and discuss why it is a goal communities. We explore first the motivation for the 3D Internet and the possibilities it brings. Subsequently

  13. MAC in Motion: Impact of Mobility on the MAC of Drive-Thru Internet

    E-Print Network [OSTI]

    Shen, Xuemin "Sherman"

    MAC in Motion: Impact of Mobility on the MAC of Drive-Thru Internet Tom H. Luan, Xinhua Ling decade has made possible for the easy Internet access from a vehicle, notably drive-thru Internet the throughput of DCF in the large scale drive-thru Internet scenario. Our model incorporates the high

  14. Personal Internet Presence: Job Seeker Self-Audit Ready Reference D-17

    E-Print Network [OSTI]

    Personal Internet Presence: Job Seeker Self-Audit Ready Reference D-17 College of Engineering Internet Presence Job Seeker Self-Audit to evaluate your e-image on a regular basis. Personal Internet your resume been posted on the internet by your academic department? Yes No I don't know Do you belong

  15. Has Internet Delay Gotten Better or Worse? DK Lee, Kenjiro Cho

    E-Print Network [OSTI]

    Moon, Sue B.

    Has Internet Delay Gotten Better or Worse? DK Lee, Kenjiro Cho , Gianluca Iannaccone , and Sue@iijlab.net, gianluca.iannaccone@intel.com ABSTRACT Delay is a key Internet performance metric and its stability, vari the Internet-wide delay distribution. In order to build a representative sample set for the Internet-wide de

  16. Internet Engineering Task Force (IETF) Y. Cheng Request for Comments: 7413 J. Chu

    E-Print Network [OSTI]

    Cortes, Corinna

    Internet Engineering Task Force (IETF) Y. Cheng Request for Comments: 7413 J. Chu Category. Status of This Memo This document is not an Internet Standards Track specification; it is published for the Internet community. This document is a product of the Internet Engineering Task Force (IETF). It represents

  17. Using the `Internet of Things' to Support Dynamic Risk Assessment in Future Concepts of Operation for

    E-Print Network [OSTI]

    Johnson, Chris

    Using the `Internet of Things' to Support Dynamic Risk Assessment in Future://www.dcs.gla.ac.uk/~johnson Keywords: Internet of Things, Area Navigation (RNAV), Dynamic Risk Assessment. Abstract. The `Internet. In contrast, this paper uses concepts from the Internet of Things to inform the dynamic risk assessments

  18. Internet Requests for Comments (RFCs) as Scholarly Publications

    E-Print Network [OSTI]

    Goodman, James R.

    Internet Requests for Comments (RFCs) as Scholarly Publications Brian E. Carpenter Department be considered the equivalent of scholarly publications. Categories and Subject Descriptors A.m [Miscellaneous common scholarly publication system. It

  19. Knowledge Media Institute Representing Scholarly Claims in Internet Digital

    E-Print Network [OSTI]

    Knowledge Media Institute Representing Scholarly Claims in Internet Digital Libraries: A Knowledge in Computer Science (Eds.) Serge Abiteboul and Anne-Marie Vercoustre. Representing Scholarly Claims with tracking and interpreting scholarly documents in distributed research communities. We argue that current

  20. Misinformation on the Internet?: A Study of Vaccine Safety Beliefs

    E-Print Network [OSTI]

    Doty, Colin

    2015-01-01

    criticism on the World Wide Web. Journal of Medical InternetOpportunities and challenges of Web 2.0 for vaccinationactivists on the world wide web. Archives of Disease in

  1. Benefit from Web services in the mobile Internet industry

    E-Print Network [OSTI]

    Ikeda, Daizo, 1974-

    2004-01-01

    Over the past five years, mobile Internet services in Japan have seen major expansion as a result of collaboration between mobile operators acting as mobile portal providers, and their complementors, namely, content ...

  2. The consumer Internet in South Korea : an American's perspective

    E-Print Network [OSTI]

    Byun, Jeffrey

    2008-01-01

    This thesis will explore the consumer internet industry in South Korea from the perspective of an American with Western values and sensibilities. South Korea is widely considered to be one of the most connected and ...

  3. Data Mining and Internet Profiling: Emerging Regulatory and Technological Approaches

    E-Print Network [OSTI]

    Schwartz, Paul M.; Lee, Ronald D.; Rubinstein, Ira

    2008-01-01

    of consensus safeguards around government data mining tocommercial data mining, the extent and speed of ad- funded2/19/2008 3:00:00 PM Data Mining and Internet Profiling:

  4. The Spatiality of Power in Internet Control and Cyberwar

    E-Print Network [OSTI]

    Ashraf, Cameran Hooshang

    2015-01-01

    D. (1989). The longest war: the Iran-Iraq military conflict.2013). Internet censorship in Iran: A first look. Free andC. (2011a). Understanding Iran’s Cyberpolitical Context.

  5. Standards as interdependent artifacts : the case of the Internet

    E-Print Network [OSTI]

    Hsieh, Mo-Han

    2008-01-01

    This thesis has explored a new idea: viewing standards as interdependent artifacts and studying them with network analysis tools. Using the set of Internet standards as an example, the research of this thesis includes the ...

  6. High-Speed Network Enables Industrial Internet | GE Global Research

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Infrastructure to Connect Machines, Data and People at Light Speed to the Industrial Internet Click to email this to a friend (Opens in new window) Share on Facebook (Opens in new...

  7. T-593: Microsoft Internet Explorer unspecified code execution

    Broader source: Energy.gov [DOE]

    Unspecified vulnerability in Microsoft Internet Explorer 8 on Windows 7 allows remote attackers to bypass Protected Mode and create arbitrary files by leveraging access to a Low integrity process.

  8. GE Showcases Industrial Internet Innovations and Promotes Win...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Showcases Industrial Internet Innovations and Promotes Win-Win Cooperation at 2015 TECHfest Click to email this to a friend (Opens in new window) Share on Facebook (Opens in new...

  9. A mixture model of global Internet capacity distributions

    E-Print Network [OSTI]

    Seo, Hyunjin; Thorson, Stuart

    2015-05-13

    This article develops a preferential attachment-based mixture model of global Internet bandwidth and investigates it in the context of observed bandwidth distributions between 2002 and 2011. Our longitudinal analysis shows, among other things...

  10. Three Korean perspectives on U.S. internet public diplomacy

    E-Print Network [OSTI]

    Seo, Hyunjin; Kinsey, Dennis F.

    2013-12-01

    methodology and survey research were used to investigate these issues. Data come from South Korean adult internet users, including members of Café USA, an online community run by the U.S. Embassy in Seoul. Three relationship perspectives were identified...

  11. Painting the Internet: A Different Kind of Warhol John Aycock

    E-Print Network [OSTI]

    Aycock, John

    Painting the Internet: A Different Kind of Warhol Worm John Aycock Department of Computer Science as one gigantic painting.' ­ Robert Rauschenberg, American artist1 It is unusual to find any connections

  12. The Internet as recommendation engine : implications of online behavioral targeting

    E-Print Network [OSTI]

    Smith-Grieco, Anthony Nicoll

    2010-01-01

    This thesis discusses the economic implications of Internet behavioral advertising, which targets ads to individuals based on extensive detailed data about the specific websites users have visited. Previous literature on ...

  13. Texas science teachers' use of TENET and the internet 

    E-Print Network [OSTI]

    Edwards, Eleanor Evelyn

    1995-01-01

    The wealth of information available on TENET, the Texas Education Network, and the Internet has the potential to bring dramatic changes to science classrooms throughout Texas. Networking technology removes the limits of classrooms walls and opens...

  14. An Open Source project building the framework for the Internet...

    Broader source: Energy.gov (indexed) [DOE]

    with the Internet of Things Today NOW PLAYING: Artist: Flowers Song: Daisy Fridge Cloud Laundry Cloud Lighting B Cloud Speaker B Cloud Speaker A Cloud TV Cloud Lighting A...

  15. ObjectGlobe: Ubiquitous Query Processing on the Internet

    E-Print Network [OSTI]

    Kemper, Alfons

    for scalable Internet applications, such as business-to-business (B2B) e-commerce systems like SAP's "mySAP capabilities. The goal of the ObjectGlobe project is to establish an open market place in which data and query on the Internet. One of the main challenges in the design of such an open system is to ensure privacy and security

  16. Snap: Robust Tool for Internet-wide Operating System Fingerprinting 

    E-Print Network [OSTI]

    Nandwani, Ankur Bharatbhushan

    2012-02-14

    FOR INTERNET-WIDE OPERATING SYSTEM FINGERPRINTING A Thesis by ANKUR BHARATBHUSHAN NANDWANI Submitted to the O?ce of Graduate Studies of Texas A&M University in partial fulflllment of the requirements for the degree of MASTER OF SCIENCE December 2010... Major Subject: Computer Science SNAP: ROBUST TOOL FOR INTERNET-WIDE OPERATING SYSTEM FINGERPRINTING A Thesis by ANKUR BHARATBHUSHAN NANDWANI Submitted to the O?ce of Graduate Studies of Texas A&M University in partial fulflllment...

  17. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  18. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  19. The world in the network: the Interop trade show, Carl Malamud's Internet 1996 Exposition, and the politics of internet commercialization

    E-Print Network [OSTI]

    Kaman, Colleen E

    2010-01-01

    In the early 1990s, the Internet emerged as a commercially viable global communications medium. This study considers the role that representatives of the military-industrial research world played in the physical expansion ...

  20. Transposon extraction protocol Maitreya Dunham November 2006

    E-Print Network [OSTI]

    Dunham, Maitreya

    Transposon extraction protocol Maitreya Dunham November 2006 modification of the Qiagen HSE precipitate. Mix equal amounts of DNA from each digest if multiple digests. Extraction In a screw-cap tube (Qiagen), and water to bring to 30 µl total. Heat for 15 minutes at 95C with a 100C block on top (blocks