Sample records for international comparative analysis

  1. Critical gradient for internal erosion in earthen d ams : a comparative analysis of two predictive methodologies

    E-Print Network [OSTI]

    Donohue, Catherine, M. Eng. Massachusetts Institute of Technology

    2013-01-01T23:59:59.000Z

    Minimizing the uncertainty in predicting the critical gradient of a dam (i.e. the critical reservoir pool level) is important during the risk analysis of dams. Uncertainty leads to inexact relative risk in portfolio ...

  2. Proceedings of the 1997 IEEE International Conference on Robotics and Automation Structural Design Optimization and Comparative Analysis of a New

    E-Print Network [OSTI]

    Whitcomb, Louis L.

    Optimization and Comparative Analysis of a New High­Performance Robot Arm via Finite Element Analysis Jaydeep Abstract This paper reports the structural design of a new high­ performance robot arm. Design objectives a robot arm for high perfor­ mance tracking and force control applications. This paper reports a first

  3. Comparative analysis of peat gasification reactor configuration

    SciTech Connect (OSTI)

    Not Available

    1981-07-01T23:59:59.000Z

    A comparative analysis of two generic (fluidized and entrained beds) and two specific (PEATGAS and the Rockwell International) hydrogasifiers involved data-base assessment, regression analysis, a chemical-engineering evaluation of down- and upstream equipment needs, and computer simulation. The study concluded that the PEATGAS reactor is closer to commercialization than the Rockwell.

  4. COMPARING THE VANCOUVER INTERNATIONAL AIRPORT AUTHORITY'S

    E-Print Network [OSTI]

    prescribed authorities to conduct environmental impact assessments (EIAs) of projects carried out on federal environmental management. The International Association for Impact Assessment's (IAIA) Principles for EIA Best if the proposed CEAA regulations come into force. Keywords: Environmental impact assessment; best practice

  5. Comparative Analysis of Proteome and Transcriptome Variation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Comparative Analysis of Proteome and Transcriptome Variation in Mouse. Comparative Analysis of Proteome and Transcriptome Variation in Mouse. Abstract: The relationships between...

  6. A Comparative Analysis of Mestizo and Indigenous Mayan Young Women in Guatemala: Attitudes and Knowledge of Sexual Reproduction and Health among Members of Children International's Youth Health Corps

    E-Print Network [OSTI]

    Trapp, Sarah Casement

    2011-04-21T23:59:59.000Z

    Children Internationals Youth Health Corps Program uses Peer Education techniques to teach impoverished adolescents about Sexual Health and Reproduction. In the Youth Health Corps in Guatemala, both rural indigenous Maya ...

  7. International Master's Program in Comparative Social Research

    E-Print Network [OSTI]

    Greifswald, Ernst-Moritz-Arndt-Universität

    . Academic skills ­ in particular, the ability to write scientific articles based on the analysis for top students. · Professional, program-specific staffing. · Academic orientation, with additionalD programs in collaboration with the HSE academic PhD program. 2. Skills of applied research analysis

  8. Comparative analysis of collaboration networks

    SciTech Connect (OSTI)

    Progulova, Tatiana; Gadjiev, Bahruz [International University for Nature, Society and Man, 19 Universitetskaya Street, Dubna, 141980 (Russian Federation)

    2011-03-14T23:59:59.000Z

    In this paper we carry out a comparative analysis of the word network as the collaboration network based on the novel by M. Bulgakov 'Master and Margarita', the synonym network of the Russian language as well as the Russian movie actor network. We have constructed one-mode projections of these networks, defined degree distributions for them and have calculated main characteristics. In the paper a generation algorithm of collaboration networks has been offered which allows one to generate networks statistically equivalent to the studied ones. It lets us reveal a structural correlation between word network, synonym network and movie actor network. We show that the degree distributions of all analyzable networks are described by the distribution of q-type.

  9. In Proceedings of the International Symposium on Performance Analysis of Systems and Software (ISPASS 2006). Comparing Multinomial and K-Means Clustering for SimPoint

    E-Print Network [OSTI]

    Calder, Bradley

    (ISPASS 2006). Comparing Multinomial and K-Means Clustering for SimPoint Greg Hamerly Erez Perelman Brad represent an accurate picture of the complete execution of the program. SimPoint is based on the k-means of us- ing k-means and multinomial clustering for SimPoint. We show that k-means performs better than

  10. Comparative analysis of selected fuel cell vehicles

    SciTech Connect (OSTI)

    NONE

    1993-05-07T23:59:59.000Z

    Vehicles powered by fuel cells operate more efficiently, more quietly, and more cleanly than internal combustion engines (ICEs). Furthermore, methanol-fueled fuel cell vehicles (FCVs) can utilize major elements of the existing fueling infrastructure of present-day liquid-fueled ICE vehicles (ICEVs). DOE has maintained an active program to stimulate the development and demonstration o fuel cell technologies in conjunction with rechargeable batteries in road vehicles. The purpose of this study is to identify and assess the availability of data on FCVs, and to develop a vehicle subsystem structure that can be used to compare both FCVs and ICEV, from a number of perspectives--environmental impacts, energy utilization, materials usage, and life cycle costs. This report focuses on methanol-fueled FCVs fueled by gasoline, methanol, and diesel fuel that are likely to be demonstratable by the year 2000. The comparative analysis presented covers four vehicles--two passenger vehicles and two urban transit buses. The passenger vehicles include an ICEV using either gasoline or methanol and an FCV using methanol. The FCV uses a Proton Exchange Membrane (PEM) fuel cell, an on-board methanol reformer, mid-term batteries, and an AC motor. The transit bus ICEV was evaluated for both diesel and methanol fuels. The transit bus FCV runs on methanol and uses a Phosphoric Acid Fuel Cell (PAFC) fuel cell, near-term batteries, a DC motor, and an on-board methanol reformer. 75 refs.

  11. A COMPARATIVE ANALYSIS OF THE INFLUENCE OF WEATHER ON THE

    E-Print Network [OSTI]

    Loon, E. Emiel van

    conditions (Bouten et al. 2003). This model will be used by experts as a decision support tool to reduceA COMPARATIVE ANALYSIS OF THE INFLUENCE OF WEATHER ON THE FLIGHT ALTITUDES OF BIRDS Meteorological/Bash/stats.html). The International Civil Aviation Organization (ICAO) has long acknowledged the risk of bird hazards to civil

  12. Sequence and comparative analysis of the chicken genome provide unique

    E-Print Network [OSTI]

    Edwards, Scott

    Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution International Chicken Genome Sequencing Consortium* *Lists of participants and affiliations appear ........................................................................................................................................................................................................................... We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken

  13. Issues in International Energy Consumption Analysis: Electricity...

    U.S. Energy Information Administration (EIA) Indexed Site

    Issues in International Energy Consumption Analysis: Electricity Usage in India's Housing Sector November 2014 Independent Statistics & Analysis www.eia.gov U.S. Department of...

  14. JD/LLM in International and Comparative Law

    E-Print Network [OSTI]

    Reif, John H.

    (919) 613-7020 admissions@law.duke.edu www.law.duke.edu/admis l a u n c h y o u r g l o b a l l aw p r a c t i c e h e r e APPLY NOW law.duke.edu/admis/degreeprograms/jd-llm/ Early Application Deadlines 11@ JD/LLM in International and Comparative Law Duke Law Admissions Duke University School of Law

  15. Comparative analysis of debrites, turbidites, and contourites

    E-Print Network [OSTI]

    Pluenneke, Judith Louise

    1976-01-01T23:59:59.000Z

    COMPARATIVE ANALYSIS OF DEBRITES, TURBIDITES, AND CONTOURITES A Thesis by JUDITH LOUISE PLUENNEKE Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement for the degree of MASTER OF SCIENCE May..., 1976 Major Subject: Oceanography COMPARATIVE ANALYSIS OF DEBRITES, TURBIDITES, AND CONTOURITES A Thesis by Judith Louise Pluenneke Approved as to style and content by: (C airman of Committee) (Head of Department (Member Member May 1976...

  16. INTERNAL HAZARDS ANALYSIS FOR LICENSE APPLICATION

    SciTech Connect (OSTI)

    R.J. Garrett

    2005-02-17T23:59:59.000Z

    The purpose of this internal hazards analysis is to identify and document the internal hazards and potential initiating events associated with preclosure operations of the repository at Yucca Mountain. Internal hazards are those hazards presented by the operation of the facility and by its associated processes that can potentially lead to a radioactive release or cause a radiological hazard. In contrast to external hazards, internal hazards do not involve natural phenomena and external man-made hazards. This internal hazards analysis was performed in support of the preclosure safety analysis and the License Application for the Yucca Mountain Project. The methodology for this analysis provides a systematic means to identify internal hazards and potential initiating events that may result in a radiological hazard or radiological release during the repository preclosure period. These hazards are documented in tables of potential internal hazards and potential initiating events (Section 6.6) for input to the repository event sequence categorization process. The results of this analysis will undergo further screening and analysis based on the criteria that apply to the performance of event sequence analyses for the repository preclosure period. The evolving design of the repository will be re-evaluated periodically to ensure that internal hazards that have not been previously evaluated are identified.

  17. International Monetary Policy Analysis with Durable Goods

    E-Print Network [OSTI]

    Lee, Kang Koo

    2010-10-12T23:59:59.000Z

    INTERNATIONAL MONETARY POLICY ANALYSIS WITH DURABLE GOODS A Dissertation by KANG KOO LEE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of DOCTOR OF PHILOSOPHY August 2009 Major Subject: Economics INTERNATIONAL MONETARY POLICY ANALYSIS WITH DURABLE GOODS A Dissertation by KANG KOO LEE Submitted to the Office of Graduate Studies of Texas A&M University...

  18. Comparative Analysis of Urban Atmospheric Aerosol by Particle...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Analysis of Urban Atmospheric Aerosol by Particle-Induced X-ray Emission (PIXE), Proton Elastic Scattering Analysis Comparative Analysis of Urban Atmospheric Aerosol by...

  19. Initial sequencing and comparative analysis of the mouse genome

    SciTech Connect (OSTI)

    Waterston, Robert H.; Lindblad-Toh, Kerstin; Birney, Ewan; Rogers, Jane; Abril, Josep F.; Agarwal, Pankaj; Agarwala, Richa; Ainscough, Rachel; Alexandersson, Marina; An, Peter; Antonarakis, Stylianos E.; Attwood, John; Baertsch, Robert; Bailey, Jonathon; Barlow, Karen; Beck, Stephan; Berry, Eric; Birren, Bruce; Bloom, Toby; Bork, Peer; Botcherby, Marc; Bray, Nicolas; Brent, Michael R.; Brown, Daniel G.; Brown, Stephen D.; Bult, Carol; Burton, John; Butler, Jonathan; Campbell, Robert D.; Carninci, Piero; Cawley, Simon; Chiaromonte, Francesca; Chinwalla, Asif T.; Church, Deanna M.; Clamp, Michele; Clee, Christopher; Collins, Francis S.; Cook, Lisa L.; Copley, Richard R.; Coulson, Alan; Couronne, Olivier; Cuff, James; Curwen, Val; Cutts, Tim; Daly, Mark; David, Robert; Davies, Joy; Delehaunty, Kimberly D.; Deri, Justin; Dermitzakis, Emmanouil T.; Dewey, Colin; Dickens, Nicholas J.; Diekhans, Mark; Dodge, Sheila; Dubchak, Inna; Dunn, Diane M.; Eddy, Sean R.; Elnitski, Laura; Emes, Richard D.; Eswara, Pallavi; Eyras, Eduardo; Felsenfeld, Adam; Fewell, Ginger A.; Flicek, Paul; Foley, Karen; Frankel, Wayne N.; Fulton, Lucinda A.; Fulton, Robert S.; Furey, Terrence S.; Gage, Diane; Gibbs, Richard A.; Glusman, Gustavo; Gnerre, Sante; Goldman, Nick; Goodstadt, Leo; Grafham, Darren; Graves, Tina A.; Green, Eric D.; Gregory, Simon; Guigo, Roderic; Guyer, Mark; Hardison, Ross C.; Haussler, David; Hayashizaki, Yoshihide; Hillier, LaDeana W.; Hinrichs, Angela; Hlavina, Wratko; Holzer, Timothy; Hsu, Fan; Hua, Axin; Hubbard, Tim; Hunt, Adrienne; Jackson, Ian; Jaffe, David B.; Johnson, L. Steven; Jones, Matthew; Jones, Thomas A.; Joy, Ann; Kamal, Michael; Karlsson, Elinor K.; Karolchik, Donna; Kasprzyk, Arkadiusz; Kawai, Jun; Keibler, Evan; Kells, Cristyn; Kent, W. James; Kirby, Andrew; Kolbe, Diana L.; Korf, Ian; Kucherlapati, Raju S.; Kulbokas III, Edward J.; Kulp, David; Landers, Tom; Leger, J.P.; Leonard, Steven; Letunic, Ivica; Levine, Rosie; et al.

    2002-12-15T23:59:59.000Z

    The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome and a key experimental tool for biomedical research. Here, we report the results of an international collaboration to produce a high-quality draft sequence of the mouse genome. We also present an initial comparative analysis of the mouse and human genomes, describing some of the insights that can be gleaned from the two sequences. We discuss topics including the analysis of the evolutionary forces shaping the size, structure and sequence of the genomes; the conservation of large-scale synteny across most of the genomes; the much lower extent of sequence orthology covering less than half of the genomes; the proportions of the genomes under selection; the number of protein-coding genes; the expansion of gene families related to reproduction and immunity; the evolution of proteins; and the identification of intraspecies polymorphism.

  20. Comparative Analysis of Genome Sequences with VISTA

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Dubchak, Inna

    VISTA is a comprehensive suite of programs and databases developed by and hosted at the Genomics Division of Lawrence Berkeley National Laboratory. They provide information and tools designed to facilitate comparative analysis of genomic sequences. Users have two ways to interact with the suite of applications at the VISTA portal. They can submit their own sequences and alignments for analysis (VISTA servers) or examine pre-computed whole-genome alignments of different species. A key menu option is the Enhancer Browser and Database at http://enhancer.lbl.gov/. The VISTA Enhancer Browser is a central resource for experimentally validated human noncoding fragments with gene enhancer activity as assessed in transgenic mice. Most of these noncoding elements were selected for testing based on their extreme conservation with other vertebrates. The results of this enhancer screen are provided through this publicly available website. The browser also features relevant results by external contributors and a large collection of additional genome-wide conserved noncoding elements which are candidate enhancer sequences. The LBL developers invite external groups to submit computational predictions of developmental enhancers. As of 10/19/2009 the database contains information on 1109 in vivo tested elements - 508 elements with enhancer activity.

  1. Comparative analysis of peat gasification reactor configuration. Final report

    SciTech Connect (OSTI)

    Not Available

    1981-07-01T23:59:59.000Z

    This report summarizes the comparative analysis of two generic gasifiers (fluidized bed and entrained bed) and two specific hydrogasifiers (IGT's Peat-gas and Rockwell International's hydrogasifier). The objective is to establish a basis for recommending a peat gasification reactor configuration for testing in a DOE peat gasification pilot plant project. The approach involved the following four steps: data base evaluation, regression analysis, a chemical engineering evaluation of upstream and downstream equipment requirement, and computer simulation. Mathematical models and computer programs were developed to simulate the entrained-bed and fluidized-bed reactors. Parametric analyses were made, using these computer programs, to test the sensitivity and effects of significant operating variables (temperature, pressure and feed gas composition, for instance) on the product gas composition in the IGT gasifier and Rockwell International gasifier. This review and analysis concentrates primarily upon the Peatgas process of the Institute of Gas Technology and the Rockwell International Hydrogasification Process. The two-stage Peatgas process appears to have advantages in higher thermal efficiency, smaller capital investment, and its application of existing commercial operations and proven design practices from other types of fluidized solids processing units. There are two problems concerning operability of the Peatgas process: (1) the design of a fluidized solids unit for quite low standpipe densities (approximately 11 to 15 pounds per cubic foot), which may become even lower upon operating upsets, and (2) the potential problem of ash sintering in the very hot combustion zone of the steam-oxygen gasifier. On a relative time scale of development, the Peatgas would seem to be much closer to possible early commercialization than is the Rockwell system.

  2. Comparative molecular dynamics analysis of tapasin-dependent...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    molecular dynamics analysis of tapasin-dependent and -independent MHC class I alleles. Comparative molecular dynamics analysis of tapasin-dependent and -independent MHC class I...

  3. Comparative naval architecture analysis of diesel submarines

    E-Print Network [OSTI]

    Torkelson, Kai Oscar

    2005-01-01T23:59:59.000Z

    Many comparative naval architecture analyses of surface ships have been performed, but few published comparative analyses of submarines exist. Of the several design concept papers, reports and studies that have been written ...

  4. Daylighting Prediction Software: Comparative Analysis and Application

    E-Print Network [OSTI]

    Estes, J. M. Jr.; Schreppler, S.; Newsom, T.

    2004-01-01T23:59:59.000Z

    in selecting a software program are presented. Radiance, a reverse ray tracing method software package, was chosen for use in the simulations. An existing school was modeled with the Radiance software and predictions of daylighting contributions were compared...

  5. Preparing Cities for Climate Change: An International Comparative Assessment of Urban Adaptation Planning. A Research Agenda

    E-Print Network [OSTI]

    Carmin, JoAnn

    2014-09-13T23:59:59.000Z

    The research objective of this project is to conduct an international comparative assessment of urban adaptation planning. Cities throughout the world are experiencing chronic problems and extreme events that are being ...

  6. Comparative analysis of plant oil based fuels

    SciTech Connect (OSTI)

    Ziejewski, M.; Goettler, H.J.; Haines, H.; Huong, C.

    1995-12-31T23:59:59.000Z

    This paper presents the evaluation results from the analysis of different blends of fuels using the 13-mode standard SAE testing method. Six high oleic safflower oil blends, six ester blends, six high oleic sunflower oil blends, and six sunflower oil blends were used in this portion of the investigation. Additionally, the results from the repeated 13-mode tests for all the 25/75% mixtures with a complete diesel fuel test before and after each alternative fuel are presented.

  7. TROPICAL DEFORESTATION MODELLING: A COMPARATIVE ANALYSIS OF DIFFERENT PREDICTIVE APPROACHES.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    TROPICAL DEFORESTATION MODELLING: A COMPARATIVE ANALYSIS OF DIFFERENT PREDICTIVE APPROACHES-time discretisation; Remote Sensing; Neural Networks; Markov Chains; MCE; Dinamica; Risk management; Deforestation

  8. Compound and Elemental Analysis At International Geothermal Area...

    Open Energy Info (EERE)

    New Zealand (Wood, 2002) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Compound and Elemental Analysis At International Geothermal Area, New...

  9. Commercial Property Assessed Clean Energy: A Comparative Analysis

    Broader source: Energy.gov [DOE]

    Hosted by the Technical Assistance Program (TAP), this webinar, held on Feb. 26, 2015, focused on a comparative analysis of program design elements of existing Property Assessed Clean Energy (PACE) programs across the country.

  10. TR-010 Hydrology March 2001 Comparative Analysis of Sediment Production

    E-Print Network [OSTI]

    TR-010 Hydrology March 2001 Comparative Analysis of Sediment Production in Two Partially Harvested Disciplines: Ecology ~ Geology ~ Geomorphology ~ Hydrology ~ Pedology ~ Silviculture ~ Wildlife Forest ~ Hydrology ~ Pedology ~ Silviculture ~ Wildlife CONTENTS ABSTRACT

  11. Probabilistic Approaches in Comparative Analysis of Biological Networks and Sequences

    E-Print Network [OSTI]

    Sahraeian, Sayed 1983-

    2013-01-07T23:59:59.000Z

    PROBABILISTIC APPROACHES IN COMPARATIVE ANALYSIS OF BIOLOGICAL NETWORKS AND SEQUENCES A Dissertation by SAYED MOHAMMAD EBRAHIM SAHRAEIAN Submitted to the O ce of Graduate Studies of Texas A&M University in partial ful llment...: Electrical Engineering Copyright 2013 Sayed Mohammad Ebrahim Sahraeian ABSTRACT Comparative analysis of genomic data investigates the relationship of genome structure and function across di erent biological species to shed light on their sim- ilarities...

  12. Roadmap: Political Science International RelationsComparative Politics -Bachelor of Arts

    E-Print Network [OSTI]

    Sheridan, Scott

    Roadmap: Political Science International RelationsComparative Politics - Bachelor of Arts [AS Updated: 8-May-12/LNHD This roadmap is a recommended semester-by-semester plan of study for this major (lower or upper division) 3 General Electives (upper division) 12 See note 2 on page 2 #12;Roadmap

  13. SynBrowse: A Synteny Browser for Comparative Sequence Analysis

    E-Print Network [OSTI]

    Brendel, Volker

    1 SynBrowse: A Synteny Browser for Comparative Sequence Analysis Xiaokang Pan * , Lincoln Stein published June 30, 2005 #12;Pan et al. 2005 2 ABSTRACT Motivation: The recent efforts of various sequence projects to sequence deeply into various phylogenies provide great resources for comparative sequence

  14. Genomewide comparative analysis of alternative splicing in plants

    E-Print Network [OSTI]

    Brendel, Volker

    Genomewide comparative analysis of alternative splicing in plants Bing-Bing Wang* and Volker in mamma- lian systems but much less in plants. Here we report AS events deduced from EST cDNA analysis in two model plants: Arabidopsis and rice. In Arabidopsis, 4,707 (21.8%) of the genes with EST c

  15. LIFE CYCLE ANALYSIS: COMPARING PLA PLASTIC FOOD USE PRODUCTS

    E-Print Network [OSTI]

    sections--agriculture, manufacture and transport. Energy inputs for each of these sections were determined in the analysis. BFS, however, avoids this energy input by purchasing a starch that is a waste stream from anotherLIFE CYCLE ANALYSIS: COMPARING PLA PLASTIC FOOD USE PRODUCTS ON THE BASIS OF ENERGY CONSUMPTION Sin

  16. Comparative genomics analysis of Liberibacter species to elucidate pathogenesis and culturability

    E-Print Network [OSTI]

    Leonard, Michael T.; Fagen, Jennie R.; McCullough, Connor M.; Davis-Richardson, Austin G.; Davis, Michael J.; Triplett, Eric W.

    2014-01-01T23:59:59.000Z

    Vol. 1 (2014) Comparative genomics analysis of Liberibacterof citrus, comparative genomics of this strain with other

  17. International PV QA Task Force's Proposed Comparative Rating System for PV Modules: Preprint

    SciTech Connect (OSTI)

    Wohlgemuth, J.; Kurtz, S.

    2014-10-01T23:59:59.000Z

    The International PV Quality Assurance Task Force is developing a rating system that provides comparative information about the relative durability of PV modules. Development of accelerated stress tests that can provide such comparative information is seen as a major step toward being able to predict PV module service life. This paper will provide details of the ongoing effort to determine the format of such an overall module rating system. The latest proposal is based on using three distinct climate zones as defined in IEC 60721-2-1 for two different mounting systems. Specific stresses beyond those used in the qualification tests are being developed for each of the selected climate zones.

  18. Comparative Analysis on the Effects of Diesel Particulate Filter and

    E-Print Network [OSTI]

    Wu, Mingshen

    Comparative Analysis on the Effects of Diesel Particulate Filter and Selective Catalytic Reduction February 15, 2008. Revised manuscript received May 2, 2008. Accepted May 27, 2008. Two methods, diesel that these aftertreatment systems may have on the emission levels of a wide spectrum of chemical species found in diesel

  19. Comparative Analysis of Conventional Oil and Gas and

    E-Print Network [OSTI]

    Jaramillo, Paulina

    Comparative Analysis of Conventional Oil and Gas and Wind Project Decommissioning Regulations Generation Energy, a non-profit renewable investment firm focusing on extending capital from private School and on the board of the Vermont Energy Investment Corporation, which manages ``Efficiency Vermont

  20. Initial sequencing and comparative analysis of the mouse genome

    E-Print Network [OSTI]

    Eddy, Sean

    Initial sequencing and comparative analysis of the mouse genome Mouse Genome Sequencing Consortium ........................................................................................................................................................................................................................... The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome collaboration to produce a high-quality draft sequence of the mouse genome. We also present an initial

  1. Globalization in the Study of Comparative and International Political Economy Assistant Professor of Political Science and Public Policy

    E-Print Network [OSTI]

    Shyy, Wei

    Globalization in the Study of Comparative and International Political Economy Jude Hays* Assistant Economy In their respective studies of globalization, both comparative and international political consequences for the global economy. We synthesize these two views by examining evidence at both the macro

  2. Las Cruces International Airport (LRU) Pavement Condition and Analysis

    E-Print Network [OSTI]

    Cal, Mark P.

    Las Cruces International Airport (LRU) Pavement Condition and Analysis Submitted to: Jane M. Lucero ........................................................................................................3. Airport Maintenance 14 .......................................4. Predicted Pavement Conditions Assuming No Maintenance 14 ...............Table 4. Predicted Pavement Conditions (PCI) Assuming

  3. Roswell International Air Center Airport (ROW) Pavement Condition and Analysis

    E-Print Network [OSTI]

    Cal, Mark P.

    Roswell International Air Center Airport (ROW) Pavement Condition and Analysis Submitted to: Jane M in December, 2009 18 .......................................4. Predicted Pavement Conditions Assuming No Maintenance 18 ...............Table 5. Predicted Pavement Conditions (PCI) Assuming no Maintenance After 2010

  4. Preparing Cities for Climate Change: An International Comparative Assessment of Urban Adaptation Planning. Semi-Structured Interview Instrument

    E-Print Network [OSTI]

    Carmin, JoAnn

    2014-09-13T23:59:59.000Z

    The research objective of this project is to conduct an international comparative assessment of urban adaptation planning. Cities throughout the world are experiencing chronic problems and extreme events that are being ...

  5. Preparing Cities for Climate Change: An International Comparative Assessment of Urban Adaptation Planning. MIT-ICLEI Climate Adaptation Survey Instrument

    E-Print Network [OSTI]

    Carmin, JoAnn

    2014-09-14T23:59:59.000Z

    The research objective of this project is to conduct an international comparative assessment of urban adaptation planning. Cities throughout the world are experiencing chronic problems and extreme events that are being ...

  6. Comparative analysis of evaluation techniques for transport policies

    SciTech Connect (OSTI)

    Browne, David, E-mail: davidbrowne2@gmail.co [Department of Civil, Structural and Environmental Engineering, Trinity College, Dublin (TCD), Dublin 2 (Ireland); Ryan, Lisa, E-mail: Lisa.RYAN@iea.or [International Energy Agency (IEA), Paris (France)

    2011-04-15T23:59:59.000Z

    The objective of this paper is to examine and compare the use of a number of policy evaluation tools, which can be used to measure the impact of transport policies and programmes as part of a strategic environmental assessment (SEA) or sustainability appraisal. The evaluation tools that were examined include cost-benefit analysis (CBA), cost-effectiveness analysis (CEA) and multi-criteria decision analysis (MCDA). It was concluded that both CEA and CBA are useful for estimating the costs and/or benefits associated with transport policies but are constrained by the difficulty in quantifying non-market impacts and monetising total costs and benefits. Furthermore, CEA is limited to identifying the most 'cost-effective policy' for achieving a single, narrowly defined objective, usually greenhouse gas (GHG) reduction and is, therefore, not suitable for evaluating policy options with ancillary costs or a variety of potential benefits. Thus, CBA or CEA evaluation should be complemented by a complete environmental and socio-economic impact assessment approach such as MCDA. This method allows for participatory analysis and qualitative assessment but is subject to caveats such as subjectivity and value-laden judgments.

  7. International Experience in Transportation Analysis and Planning

    E-Print Network [OSTI]

    material transportation regulatory training in association with the IAEA in the People's Republic of China. ORNL staff worked with Ministry of Transport of the People's Republic of China to train staff;Center for Transportation Analysis 2360 Cherahala Boulevard Knoxville, TN 37932 865-946-1311 Website: cta.ornl.gov

  8. 21st International Conference on Ion Beam Analysis

    SciTech Connect (OSTI)

    Thevuthasan, Suntharampillai; Shutthanandan, V.; Wang, Yongqiang; Vizkelethy, Gyorgy; Rout, Bibhudutta

    2014-08-01T23:59:59.000Z

    This special issue of Nuclear Instruments and Methods in Physics Research B contains the proceedings of the 21st International Conference on Ion Beam Analysis (IBA 2013). This conference was held in Marriott Waterfront in Seattle, Washington, USA during June 2328, 2013.

  9. Imaging hydrated microbial extracellular polymers: Comparative analysis by electron microscopy

    SciTech Connect (OSTI)

    Dohnalkova, A.C.; Marshall, M. J.; Arey, B. W.; Williams, K. H.; Buck, E. C.; Fredrickson, J. K.

    2011-01-01T23:59:59.000Z

    Microbe-mineral and -metal interactions represent a major intersection between the biosphere and geosphere but require high-resolution imaging and analytical tools for investigating microscale associations. Electron microscopy has been used extensively for geomicrobial investigations and although used bona fide, the traditional methods of sample preparation do not preserve the native morphology of microbiological components, especially extracellular polymers. Herein, we present a direct comparative analysis of microbial interactions using conventional electron microscopy approaches of imaging at room temperature and a suite of cryogenic electron microscopy methods providing imaging in the close-to-natural hydrated state. In situ, we observed an irreversible transformation of the hydrated bacterial extracellular polymers during the traditional dehydration-based sample preparation that resulted in their collapse into filamentous structures. Dehydration-induced polymer collapse can lead to inaccurate spatial relationships and hence could subsequently affect conclusions regarding nature of interactions between microbial extracellular polymers and their environment.

  10. Imaging Hydrated Microbial Extracellular Polymers: Comparative Analysis by Electron Microscopy

    SciTech Connect (OSTI)

    Dohnalkova, Alice; Marshall, Matthew J.; Arey, Bruce W.; Williams, Kenneth H.; Buck, Edgar C.; Fredrickson, Jim K.

    2011-02-01T23:59:59.000Z

    Microbe-mineral and -metal interactions represent a major intersection between the biosphere and geosphere but require high-resolution imaging and analytical tools for investigating microscale associations. Electron microscopy has been used extensively for geomicrobial investigations and although used bona fide, the traditional methods of sample preparation do not preserve the native morphology of microbiological components, especially extracellular polymers. Herein, we present a direct comparative analysis of microbial interactions using conventional electron microscopy approaches of imaging at room temperature and a suite of cryo-electron microscopy methods providing imaging in the close-to-natural hydrated state. In situ, we observed an irreversible transformation of bacterial extracellular polymers during the traditional dehydration-based sample preparation that resulted in the collapse of hydrated gel-like EPS into filamentous structures. Dehydration-induced polymer collapse can lead to inaccurate spatial relationships and hence could subsequently affect conclusions regarding nature of interactions between microbial extracellular polymers and their environment.

  11. An analysis of Argentine international economic policies: 1943-1955

    E-Print Network [OSTI]

    Bassett, Harold Sydney

    1958-01-01T23:59:59.000Z

    invest- ment snd to shift from a debtor to a creditor nation almost overnight. As was to be expected, the balance of payments position suffered criti- cally because of the rapid internal development program coupled with the repayment of foreign...L&BRA Ry A 4 N COLLEGE OF TEXAS AN ANALYSIS OF ARCRNTINR INTRRNATIONAL BCONOEEIC POLICINS & 1943-1955 A Thesis Harold S&~ Rassett Suhnitted to the Graduate School of the Agricultural and Mechanical College of Tunas in partial fulfillsnnt...

  12. Comparative Analysis of Cement and Lateralite on the Engineering Properties of Niger Delta Soils for Pavement Construction

    E-Print Network [OSTI]

    Alayaki, F. M.; Al-Tabbaa, A.; Meshida, E. A.; Ayotamuno, M. J.

    2015-05-13T23:59:59.000Z

    .BJAST.2015.254 ISSN: 2231-0843 SCIENCEDOMAIN international www.sciencedomain.org Comparative Analysis of Cement and Lateralite on the Engineering Properties of Niger Delta Soils for Pavement Construction F. M. Alayaki1*, A. Al... :1 and then stabilize with cement. However high strength reduction of about 40% was noted when the stabilized mixture was soaked in water even with as much as 10% cement, thus suggested the protection of the pavement from water ingress. [5] Noted...

  13. Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group Centerfor%-8531)1-803,% - or - Where Does Vibrio cholera come from? #12;Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU #12;Comparative Microbial Genomics

  14. analysis comparing coplanar: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Websites Summary: ANALYSIS OF THE TRANSITION BETWEEN TWO COPLANAR WAVEGUIDE TRANSMISSION LINES Abdelnasser A. Eldek approaches for the transition between two coplanar...

  15. Comparative Analysis of Second Language Instruction and Motivation

    E-Print Network [OSTI]

    Speights, Lara A.

    2010-07-14T23:59:59.000Z

    . And yet, our second language instruction continues to produce beginning-level speakers, while many other world players produce bilingual adults. The classroom environment is integral to understanding this discrepancy, and so this research compares high...

  16. analysis comparing microarrays: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Maize Human (partial) "I came into the class with little to no understanding of what genomics entailedGoals Full Genome Microarrays Data Analysis Bioinformatics RNA-free Teaching...

  17. Comparative genomic analysis as a tool for biologicaldiscovery

    SciTech Connect (OSTI)

    Nobrega, Marcelo A.; Pennacchio, Len A.

    2003-03-30T23:59:59.000Z

    Biology is a discipline rooted in comparisons. Comparative physiology has assembled a detailed catalogue of the biological similarities and differences between species, revealing insights into how life has adapted to fill a wide-range of environmental niches. For example, the oxygen and carbon dioxide carrying capacity of vertebrate has evolved to provide strong advantages for species respiring at sea level, at high elevation or within water. Comparative- anatomy, -biochemistry, -pharmacology, -immunology and -cell biology have provided the fundamental paradigms from which each discipline has grown.

  18. A Model of the Statistical Power of Comparative Genome Sequence Analysis

    E-Print Network [OSTI]

    Eddy, Sean

    A Model of the Statistical Power of Comparative Genome Sequence Analysis Sean R. Eddy Howard Hughes, Missouri, United States of America Comparative genome sequence analysis is powerful, but sequencing genomes is expensive. It is desirable to be able to predict how many genomes are needed for comparative genomics

  19. Comparative Analysis of Three Proposed Federal Renewable Electricity Standards

    SciTech Connect (OSTI)

    Sullivan, P.; Logan, J.; Bird, L.; Short, W.

    2009-05-01T23:59:59.000Z

    This paper analyzes potential impacts of proposed national renewable electricity standard (RES) legislation. An RES is a mandate requiring certain electricity retailers to provide a minimum share of their electricity sales from qualifying renewable power generation. The analysis focuses on draft bills introduced individually by Senator Jeff Bingaman and Representative Edward Markey, and jointly by Representative Henry Waxman and Markey. The analysis uses NREL's Regional Energy Deployment System (ReEDS) model to evaluate the impacts of the proposed RES requirements on the U.S. energy sector in four scenarios.

  20. Comparative promoter region analysis powered by CORG. Christoph Dieterich1

    E-Print Network [OSTI]

    Stadler, Peter F.

    are key players in gene regulation. They receive signals from various sources (e.g. cell surface receptors have included 5 species in our analysis pipeline (man, mouse, rat, fugu and zebrafish). We. Conclusions: The CORG platform is a versatile tool to support analyses of gene regulation in vertebrate

  1. Introduction Nonlinear Fourier Analysis Ocean Internal Waves KdV Hidden Solitons Closure Two case studies in nonlinear Fourier analysis

    E-Print Network [OSTI]

    Christov, Ivan C.

    Introduction Nonlinear Fourier Analysis Ocean Internal Waves KdV Hidden Solitons Closure Two case studies in nonlinear Fourier analysis: Ocean internal solitary waves and the ZabuskyKruskal solitons Ivan Engineering, The University of Sheffield September 10, 2010 Ivan C. Christov (NU) Nonlinear Fourier Analysis

  2. Introduction Nonlinear Fourier Analysis Ocean Internal Waves KdV Hidden Solitons Closure Two case studies in nonlinear Fourier analysis

    E-Print Network [OSTI]

    Christov, Ivan C.

    Introduction Nonlinear Fourier Analysis Ocean Internal Waves KdV Hidden Solitons Closure Two case studies in nonlinear Fourier analysis: Ocean internal solitary waves and the ZabuskyKruskal solitons Ivan Ivan C. Christov (PU) Nonlinear Fourier Analysis INRNE Seminar 1 / 26 #12;Introduction Nonlinear

  3. Comparative analyses for selected clean coal technologies in the international marketplace

    SciTech Connect (OSTI)

    Szpunar, C.B.; Gillette, J.L.

    1990-07-01T23:59:59.000Z

    Clean coal technologies (CCTs) are being demonstrated in research and development programs under public and private sponsorship. Many of these technologies could be marketed internationally. To explore the scope of these international opportunities and to match particular technologies with markets appearing to have high potential, a study was undertaken that focused on seven representative countries: Italy, Japan, Morocco, Turkey, Pakistan, the Peoples' Republic of China, and Poland. The results suggest that there are international markets for CCTs and that these technologies can be cost competitive with more conventional alternatives. The identified markets include construction of new plants and refurbishment of existing ones, especially when decision makers want to decrease dependence on imported oil. This report describes potential international market niches for U.S. CCTs and discusses the status and implications of ongoing CCT demonstration activities. Twelve technologies were selected as representative of technologies under development for use in new or refurbished industrial or electric utility applications. Included are the following: Two generic precombustion technologies: two-stage froth-flotation coal beneficiation and coal-water mixtures (CWMs); Four combustion technologies: slagging combustors, integrated-gasification combined-cycle (IGCC) systems, atmospheric fluidized-bed combustors (AFBCs), and pressurized fluidized-bed combustors (PFBCs); and Six postcombustion technologies: limestone-injection multistage burner (LIMB) systems, gas-reburning sorbent-injection (GRSI) systems, dual-alkali flue-gas desulfurization (FGD), spray-dryer FGD, the NOXSO process, and selective catalytic reduction (SCR) systems. Major chapters of this report have been processed separately for inclusion on the data base.

  4. Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU Minimal genomes in bacterial Genera Dave Ussery European Conference on Synthetic Biology: Design 2007 #12;Comparative Microbial Genomics group Centerfor

  5. Applications of shape analysis to domestic and international security.

    SciTech Connect (OSTI)

    Prasad, Lakshman; Skourikhine, A. N. (Alexei N.); Doak, J. E. (Justin E.)

    2002-01-01T23:59:59.000Z

    The rapidly growing area of cooperative international security calls for pervasive deployment of smart sensors that render valuable information and reduce operational costs and errors. Among the sensors used, vision sensors are by far the most versatile, tangible, and rich in the information they provide about their environment. On the flip side, they are also the most complex to analyze automatically for the extraction of high-level information. The ability to process imagery in a useful manner requires at least partial functional emulation of human capabilities of visual understanding. Of all visual cues available in image data, shape is perhaps the most important for understanding the content of an image. In this paper we present an overview of ongoing research at LANL on geometric shape analysis. The objective of our research is to develop a computational framework for multiscale characterization, analysis, and recognition of shapes. This framework will enable the development of a comprehensive and connected body of mathematical methods and algorithms, based on the topological, metrical, and morphological properties of shapes. We discuss its potential applications to automated surveillance, monitoring, container tracking and inspection, weapons dismantlement, and treaty verification. The framework will develop a geometric filtering scheme for extracting semantically salient shape features. This effort creates a paradigm for solving shape-related problems in Pattern Recognition, Computer Vision, and Image Understanding in a conceptually cohesive and algorithmically amenable manner. The research aims to develop an advanced image analysis capability at LANL for solving a wide range of problems in automated facility surveillance, nuclear materials monitoring, treaty verification, and container inspection and tracking. The research provides the scientific underpinnings that will enable us to build smart surveillance cameras, with a direct practical impact on LANL's capabilities in domestic and international safeguards and security.

  6. Scattering of particles by radiation fields: a comparative analysis

    E-Print Network [OSTI]

    Donato Bini; Andrea Geralico; Maria Haney; Robert T. Jantzen

    2014-08-22T23:59:59.000Z

    The features of the scattering of massive neutral particles propagating in the field of a gravitational plane wave are compared with those characterizing their interaction with an electromagnetic radiation field. The motion is geodesic in the former case, whereas in the case of an electromagnetic pulse it is accelerated by the radiation field filling the associated spacetime region. The interaction with the radiation field is modeled by a force term entering the equations of motion proportional to the 4-momentum density of radiation observed in the particle's rest frame. The corresponding classical scattering cross sections are evaluated too.

  7. Comparative sequence analysis for Brassica oleracea with similar sequences in B. rapa and Arabidopsis thaliana

    E-Print Network [OSTI]

    Qiu, Dan; Gao, Muqiang; Li, Genyi; Quiros, Carlos

    2009-01-01T23:59:59.000Z

    AND GENOMICS Comparative sequence analysis for Brassicaoleracea with similar sequences in B. rapa and Arabidopsisanalyzed them with similar sequences in A. thaliana and B.

  8. A comparative financial analysis of the automobile and public transportation in London

    E-Print Network [OSTI]

    Kothari, Tejus Jitendra

    2007-01-01T23:59:59.000Z

    Automobile systems and public transportation are often organized separately within government structure inhibiting a comparative analysis between the two modes. Further complicating the comparison is that in public ...

  9. International Financial Reporting Standards (IFRS) and the Institutional Environment: Their Joint Impact on Accounting Comparability

    E-Print Network [OSTI]

    Neel, Michael J.

    2012-10-19T23:59:59.000Z

    -IFRS domestic standards is higher in countries that provide strong reporting incentives (i.e. countries with strict enforcement regimes or high earnings transparency). Additionally, I found an increase in comparability following IFRS adoption (relative to a...

  10. Assigning protein functions by comparative genome analysis protein phylogenetic profiles

    DOE Patents [OSTI]

    Pellegrini, Matteo; Marcotte, Edward M.; Thompson, Michael J.; Eisenberg, David; Grothe, Robert; Yeates, Todd O.

    2003-05-13T23:59:59.000Z

    A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.

  11. A comparative analysis of empirical calibrators for nebular metallicity

    E-Print Network [OSTI]

    Enrique Perez-Montero; Angeles I. Diaz

    2005-06-15T23:59:59.000Z

    We present a new analysis of the main empirical calibrators of oxygen abundance for ionised gas nebulae. With that aim we have compiled an extensive sample of objects with emission line data including the near IR [SIII] lines and the weak auroral lines which allow for the determination of the gas electron temperature. For all the objects the oxygen abundances have been derived in a homogeneus way, using the most recent sets of atomic coefficients and taking into the account the effect of particle density on the temperature of O$^+$. The residuals between directly and empirically-derived abundances as a function of abundance have been studied. A grid of photo-ionisation models, covering the range of physical properties of the gas, has been used to explain the origin of the uncertainties affecting each abundance calibrator. The range of validity for each abundance parameter has been identified and its average uncertainty has been quantified.

  12. A comparative critical analysis of modern task-parallel runtimes.

    SciTech Connect (OSTI)

    Wheeler, Kyle Bruce; Stark, Dylan; Murphy, Richard C. [Micron Technology, Inc., Boise, ID

    2012-12-01T23:59:59.000Z

    The rise in node-level parallelism has increased interest in task-based parallel runtimes for a wide array of application areas. Applications have a wide variety of task spawning patterns which frequently change during the course of application execution, based on the algorithm or solver kernel in use. Task scheduling and load balance regimes, however, are often highly optimized for specific patterns. This paper uses four basic task spawning patterns to quantify the impact of specific scheduling policy decisions on execution time. We compare the behavior of six publicly available tasking runtimes: Intel Cilk, Intel Threading Building Blocks (TBB), Intel OpenMP, GCC OpenMP, Qthreads, and High Performance ParalleX (HPX). With the exception of Qthreads, the runtimes prove to have schedulers that are highly sensitive to application structure. No runtime is able to provide the best performance in all cases, and those that do provide the best performance in some cases, unfortunately, provide extremely poor performance when application structure does not match the scheduler's assumptions.

  13. Comparative Analysis of Carbon Plasma in Arc and RF Reactors

    SciTech Connect (OSTI)

    Todorovic-Markovic, B.; Markovic, Z. ['Vinca' Institute of Nuclear Sciences, P.O.B. 522, 11001 Belgrade (Serbia and Montenegro); Mohai, I.; Szepvolgyi, J. [Research Laboratory of Materials and Environmental Chemistry, Chemical Research Center, Hungarian Academy of Sciences H-1525 Budapest, POB 17 (Hungary)

    2004-12-01T23:59:59.000Z

    Results on studies of molecular spectra emitted in the initial stages of fullerene formation during the processing of graphite powder in induction RF reactor and evaporation of graphite electrodes in arc reactor are presented in this paper. It was found that C2 radicals were dominant molecular species in both plasmas. C2 radicals have an important role in the process of fullerene synthesis. The rotational-vibrational temperatures of C2 and CN species were calculated by fitting the experimental spectra to the simulated ones. The results of optical emission study of C2 radicals generated in carbon arc plasma have shown that rotational temperature of C2 species depends on carbon concentration and current intensity significantly. The optical emission study of induction RF plasma and SEM analysis of graphite powder before and after plasma treatment have shown that evaporation of the processed graphite powder depends on feed rate and composition of gas phase significantly. Based on the obtained results, it was concluded that in the plasma region CN radicals could be formed by the reaction of C2 species with atomic nitrogen at smaller loads. At larger feed rate of graphite powder, CN species were produced by surface reaction of the hot carbon particles with nitrogen atoms. The presence of nitrogen in induction RF plasma reduces the fullerene yield significantly. The fullerene yield obtained in two different reactors was: 13% in arc reactor and 4.1% in induction RF reactor. However, the fullerene production rate was higher in induction RF reactor-6.4 g/h versus 1.7 g/h in arc reactor.

  14. Olive Tree-Ring Problematic Dating: A Comparative Analysis on Santorini (Greece)

    E-Print Network [OSTI]

    Olive Tree-Ring Problematic Dating: A Comparative Analysis on Santorini (Greece) Paolo Cherubini1-rings identification. Dendrochronological analyses of olive trees growing on the Aegean island Santorini (Greece) show: A Comparative Analysis on Santorini (Greece). PLoS ONE 8(1): e54730. doi:10.1371/journal.pone.0054730 Editor

  15. A model of the statistical power of comparative genome sequence analysis

    E-Print Network [OSTI]

    Eddy, Sean

    A model of the statistical power of comparative genome sequence analysis Sean R. Eddy Howard Hughes genome sequence analysis is powerful, but sequencing genomes is expensive. It is desirable to be able to predict how many genomes are needed to achieve a particular statistical power in comparative analyses

  16. Energy, Shading and Daylighting Analysis for the Austin Bergstrom International Airport Terminal

    E-Print Network [OSTI]

    Holder, L. M. III; Holder, L. M. IV

    2002-01-01T23:59:59.000Z

    Our firm was under contract with the City of Austin, Texas to perform energy analysis and analysis of the daylighting potential within the New Austin Bergstrom International Airport Terminal. Design of the Passenger Terminal Facility for the New...

  17. A Comparative Look at MBU Hazard Analysis Brandon D. Owens and Nancy G. Leveson

    E-Print Network [OSTI]

    Leveson, Nancy

    of the problems inherent in the quantitative analysis of expected incident/accident frequency will be exploredA Comparative Look at MBU Hazard Analysis Techniques Brandon D. Owens and Nancy G. Leveson Complex analysis techniques for hazards in highly complex and unique systems such as spacecraft. As a result

  18. Comparative Analysis of Control Techniques for Efficiency Improvement in Electric Vehicles

    E-Print Network [OSTI]

    energy efficient and less polluting drive-train alternative to conventional internal combustion engine, University of Biskra, Biskra, Algeria Abstract--This paper presents system analysis, modeling and simulation dynamics and system architecture. Simulation tests have been carried out on a 37-kW EV that consists

  19. Comparative analysis of Erk phosphorylation suggests a mixed strategy for measuring phospho-form

    E-Print Network [OSTI]

    Gunawardena, Jeremy

    Comparative analysis of Erk phosphorylation suggests a mixed strategy for measuring phospho of the well- studied mitogen-activated protein kinase Erk2, with two phosphorylation sites. The MS methods

  20. Comparative Analysis of CFD ?P vs. Measured ?P for Compressed Flexible Ducts

    E-Print Network [OSTI]

    Ugursal, A.; Culp, C.H.

    Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. Comparative Analysis of CFD [Delta]P vs. Measured [Delta]P for Compressed Flexible Ducts Ugursal, Ahmet;Culp, Charles ASHRAE Transactions; 2007...

  1. Identification of community power structure using the reputational approach: a comparative analysis of two Texas communities.

    E-Print Network [OSTI]

    Spiekerman, Ruth Danette Hill

    1968-01-01T23:59:59.000Z

    IDENTIFICATION OF COMMUNITY POWER STRUCTURE USING THE REPUTATIONAL APPROACH: A COMPARATIVE ANALYSIS OF TWO TEXAS COMMUNITIES A Thesis RUTH DANETTE HILL SPIEKERMAN Submitted to the Graduate College of Texas A&M University in partial... fulfillment of the requirements for the degree of MASTER OF SCIENCE August 1968 Major Subject: Sociology IDENTIFICATION OF COMMUNITY POWER STRUCTURE USING THE REPUTATIONAL APPROACH: A COMPARATIVE ANALYSIS OF TWO TEXAS COMMUNITIES A Thesis by RUTH...

  2. Comparative analysis of methods for determination of arsenic in coal and coal ash

    SciTech Connect (OSTI)

    Vukasinovic-Pesic, V.L.; Blagojevic, N.Z.; Rajakovic, L.V. [University of Montenegro, Podgorica (Montenegro)

    2009-07-01T23:59:59.000Z

    In this paper the comparative analysis of different methods for the preparation and analysis of arsenic content in coal and coal ash have been presented. The suggested method is coal digestion method, i.e., coal ash digestion using the mixture of acids: nitric and sulphuric in presence of vanadium-pentoxide as catalyzer. The comparative analysis of different recording techniques (AAS-GH, AAS-GF and ICP-AES) has also been presented. For arsenic recording the suggested technique is AAS-GF technique. The obtained results show that the method of high precision, high sensitivity and high reproductivity has been obtained.

  3. An analysis of Argentine international economic policies: 1943-1955

    E-Print Network [OSTI]

    Bassett, Harold Sydney

    1958-01-01T23:59:59.000Z

    . Further background information has been made available by including a discussion of the classical theory of international trade in order to understand early Argentine international policies snd to evaluate later economic policies, Through these methods..., Bureau of Foreign Commerce, World Trade Information Service, "Basic Data oa the Economy of Argentina, " Economic ~Re orts, Part I, No, 55-56 (Washingtonl U. S. Government Printing Office, 1955), 3. In composition, approximately eighty per cent of tha...

  4. International Workshop on Analysis Tools and Methodologies for Embedded and Real-time

    E-Print Network [OSTI]

    Lipari, Giuseppe

    1st International Workshop on Analysis Tools and Methodologies for Embedded and Real-time Systems application areas, from Real- Time Operating Systems to distributed systems, from safety critical to soft real of the International Workshop on Anaysis Tools and Methodologies for Embedded and Real-time Systems (WATERS

  5. Soft systems analysis of internship with Pioneer Hi-Bred International, Inc.

    E-Print Network [OSTI]

    Cloud, James Edward

    1989-01-01T23:59:59.000Z

    Record of Study SOFT SYSTEMS ANALYSIS OF INTERNSHIP HITH PIONEER HI-BRED INTERNATIONAL, INC. A PROFESSIONAL PAPER by James Edward Cloud Submitted to the College of Agriculture and Life Sciences of Texas ASM University in partial fulfillment... of the requirements for the degree of MASTER OF AGRICULTURE December, 1989 Soil and Crop Sciences Agronomy SOFT SYSTEMS ANALYSIS OF INTERNSHIP WITH PIONEER HI-BRED INTERNATIONAL, INC. A Professional Paper by James Edward Cloud Approved as to style...

  6. Data Envelopment Analysis: A Linear Programming Application to Measure the Relative Efficiencies of Internal Business Divisions

    E-Print Network [OSTI]

    Shockley, Laura

    2014-05-16T23:59:59.000Z

    that an A/E/C firm may want to evaluate include: 1. Customer Satisfaction Data Envelopment Analysis: A Linear Programming Application to Measure the Relative Efficiencies of Internal Business Divisions Laura Shockley 26 2. Percent Repeat Customer... the Relative Efficiencies of Internal Business Divisions Laura Shockley 1 Executive Summary Data Envelopment Analysis (DEA) is a non-parametric linear programming model used to determine relative efficiencies of similar decision making units based...

  7. MULTIRRESOLUTION SURVEYING OF COMPLEX FAADES: A COMPARATIVE ANALYSIS BETWEEN DIGITAL PHOTOGRAMMETRY AND 3D LASER SCANNING

    E-Print Network [OSTI]

    Llanos, Diego R.

    similar buildings presenting a similar high complexity for ornamental details. 1. INTRODUCTIONMULTIRRESOLUTION SURVEYING OF COMPLEX FAADES: A COMPARATIVE ANALYSIS BETWEEN DIGITAL@usuarios.retecal.es, jmr@ega.uva.es b MoBiVA-DAVAP Group, Lab. 2.2, R+D Building, M.Delibes Campus, 47011 Valladolid, Spain

  8. Microfluidic single cell real-time PCR for comparative analysis of gene expression patterns

    E-Print Network [OSTI]

    Quake, Stephen R.

    Microfluidic single cell real-time PCR for comparative analysis of gene expression patterns collection. We present here a high-content microfluidic real-time platform as a powerful tool expression; dynamic assay; microfluidic; pluripotent INTRODUCTION Novel genomic technologies have paved

  9. Threat to the point: improving the value of comparative extinction risk analysis for conservation action

    E-Print Network [OSTI]

    Davidson, Ana

    Threat to the point: improving the value of comparative extinction risk analysis for conservation of such analyses for conservation practice has been questioned. One reason for underperformance may be that threats this problem by (i) reviewing the use of threats in this field and (ii) quanti- tatively investigating

  10. Comparative Analysis of Balanced Winnow and SVM in Large Scale Patent Categorization

    E-Print Network [OSTI]

    Steels, Luc

    Comparative Analysis of Balanced Winnow and SVM in Large Scale Patent Categorization Katrien Beuls techniques, a collection of 1.2 million patent applications is used to build a classifier that is able). Contrary to SVM, Balanced Winnow is frequently applied in today's patent categorization systems. Results

  11. Crossing innovation & product projects management: A comparative analysis in automotive industry

    E-Print Network [OSTI]

    Paris-Sud XI, Universit de

    1 Crossing innovation & product projects management: A comparative analysis in automotive industry in automotive industry INTRODUCTION Projectification and platform approaches have been two main transformation in the automotive industry. This sector provides an interesting empirical opportunity to study this question, since

  12. Comparative analysis of Fuzzy ART and ART-2A network clustering performance

    E-Print Network [OSTI]

    Kuhlen, Torsten

    are used as an example of high- dimensional input patterns, modelling ART properties by clusteringComparative analysis of Fuzzy ART and ART-2A network clustering performance Thomas Frank, Karl networks, capable of clustering arbitrary sequences of input patterns into stable recogni- tion codes. Many

  13. Predicting household occupancy for smart heating control: A comparative performance analysis of

    E-Print Network [OSTI]

    , energy management, smart home, energy efficiency, thermostat strategy, heating setback Corresponding, a heating control system may require some time to heat a home to a comfortable temperature after itsPredicting household occupancy for smart heating control: A comparative performance analysis

  14. Predicting household occupancy for smart heating control: A comparative performance analysis of

    E-Print Network [OSTI]

    , occupancy prediction, smart heating, energy management, smart home, energy efficiency Corresponding author.e. the household having too low a temperature when the residents come back home triggering the heatingPredicting household occupancy for smart heating control: A comparative performance analysis

  15. An Automated Comparative Analysis of Seventeen Complete Microbial Arvind K. Bansal

    E-Print Network [OSTI]

    Bansal, Arvind K.

    #12;36 An Automated Comparative Analysis of Seventeen Complete Microbial Genomes Arvind K. Bansal Department of Mathematics and Computer Science, Kent State University, Kent, Ohio, USA As sequenced genomes become larger and sequencing becomes faster, there is a need to develop accurate automated genome

  16. Lessons Learned on Benchmarking from the International Human Reliability Analysis Empirical Study

    SciTech Connect (OSTI)

    Ronald L. Boring; John A. Forester; Andreas Bye; Vinh N. Dang; Erasmia Lois

    2010-06-01T23:59:59.000Z

    The International Human Reliability Analysis (HRA) Empirical Study is a comparative benchmark of the prediction of HRA methods to the performance of nuclear power plant crews in a control room simulator. There are a number of unique aspects to the present study that distinguish it from previous HRA benchmarks, most notably the emphasis on a method-to-data comparison instead of a method-to-method comparison. This paper reviews seven lessons learned about HRA benchmarking from conducting the study: (1) the dual purposes of the study afforded by joining another HRA study; (2) the importance of comparing not only quantitative but also qualitative aspects of HRA; (3) consideration of both negative and positive drivers on crew performance; (4) a relatively large sample size of crews; (5) the use of multiple methods and scenarios to provide a well-rounded view of HRA performance; (6) the importance of clearly defined human failure events; and (7) the use of a common comparison language to translate the results of different HRA methods. These seven lessons learned highlight how the present study can serve as a useful template for future benchmarking studies.

  17. Internal quantum efficiency analysis of solar cell by genetic algorithm

    SciTech Connect (OSTI)

    Xiong, Kanglin; Yang, Hui [Institute of Semiconductors, CAS, No. A35, Qing Hua East Road, Beijing 100083 (China); Suzhou Institute of Nano-tech and Nano-bionics, CAS, Ruoshui Road 398, Suzhou 215125 (China); Lu, Shulong; Zhou, Taofei; Wang, Rongxin; Qiu, Kai; Dong, Jianrong [Suzhou Institute of Nano-tech and Nano-bionics, CAS, Ruoshui Road 398, Suzhou 215125 (China); Jiang, Desheng [Institute of Semiconductors, CAS, No. A35, Qing Hua East Road, Beijing 100083 (China)

    2010-11-15T23:59:59.000Z

    To investigate factors limiting the performance of a GaAs solar cell, genetic algorithm is employed to fit the experimentally measured internal quantum efficiency (IQE) in the full spectra range. The device parameters such as diffusion lengths and surface recombination velocities are extracted. Electron beam induced current (EBIC) is performed in the base region of the cell with obtained diffusion length agreeing with the fit result. The advantage of genetic algorithm is illustrated. (author)

  18. Structural Design Optimization and Comparative Analysis of a New HighPerformance Robot Arm via Finite Element Analysis

    E-Print Network [OSTI]

    Whitcomb, Louis L.

    Structural Design Optimization and Comparative Analysis of a New High­Performance Robot Arm via, 1997 Abstract This paper reports the structural design of a new high­performance robot arm. Design Introduction Our goal is to design and build a robot arm for high performance tracking and force control

  19. HYDROGEN TECHNICAL ANALYSIS ON MATTERS BEING CONSIDERED BY THE INTERNATIONAL ENERGY AGENCY -

    E-Print Network [OSTI]

    when demand exceeds existing supply · Upstream costs of new hydrogen pipelines · Delivery distance of bulk hydrogen by truck or pipeline The end-use analysis addressed tailpipe emissions of various vehicleHYDROGEN TECHNICAL ANALYSIS ON MATTERS BEING CONSIDERED BY THE INTERNATIONAL ENERGY AGENCY

  20. COMPARATIVE ANALYSIS OF SELECTED EDDY CURRENT TRANSDUCERS FOR TITANIUM ALLOY EVALUATION

    SciTech Connect (OSTI)

    Chady, T.; Sikora, R.; Baniukiewicz, P.; Lopato, P.; Kowalczyk, J.; Psuj, G.; Caryk, M. [West Pomeranian University of Technology, Piastow 17, 70-310 Szczecin (Poland)

    2010-02-22T23:59:59.000Z

    Titanium alloy based details due to their mechanical properties continue to be in extensive use in various structures (mainly aerospace, automotive and petro-chemical industrial applications). In this paper comparative study of various types of eddy current NDT transducers for testing titanium elements was done. Probes of absolute, differential and array configurations were constructed and analyzed. Two and three dimensional numerical analysis (FEM) were done in order to find the best type and configuration of the proposed transducers.

  1. Preliminary analysis of the International Data Centre pipeline.

    SciTech Connect (OSTI)

    Gauthier, John Henry

    2009-07-01T23:59:59.000Z

    The International Data Centre of the Comprehensive Nuclear-Test-Ban Treaty Organization relies on automatic data processing as the first step in identifying seismic events from seismic waveform data. However, more than half of the automatically identified seismic events are eliminated by IDC analysts. Here, an IDC dataset is analyzed to determine if the number of automatically generated false positives could be reduced. Data that could be used to distinguish false positives from analyst-accepted seismic events includes the number of stations, the number of phases, the signal-to-noise ratio, and the pick error. An empirical method is devised to determine whether an automatically identified seismic event is acceptable, and the method is found to identify a significant number of the false positives in IDC data. This work could help reduce seismic analyst workload and could help improve the calibration of seismic monitoring stations. This work could also be extended to address identification of seismic events missed by automatic processing.

  2. Analysis of international efforts in energy research and development

    SciTech Connect (OSTI)

    Rezaiyan, A.J.; Gill, R.T.

    1995-09-01T23:59:59.000Z

    Research and experimental development comprise innovative and creative work undertaken systematically to increase the stock of knowledge of science, engineering, and society. This knowledge reserve is used to improve living conditions and standards, including economic growth. Research and development (R&D) expenditures are useful measures of the scale and direction of technological innovation within a country, industry, or scientific field. Administrators concerned with economic growth and performance rely on R&D statistics as one possible type of indicator of technological change. R&D statistics are an essential tool in many government programs and evaluations (OECD 1993). The objective of the analysis was to identify and evaluate R&D funding sources, levels, and trends in the energy sectors of selected industrialized countries (Australia, Belgium, Canada, Denmark, Finland, France, Germany, Italy, Japan, Netherlands, Norway, Sweden, Switzerland, United Kingdom, United States) and the European Union (EU). Fossil fuel technologies, particularly fuel cells and advanced gas turbines, were the focus of the analysis, whose results are presented in this report.

  3. Phylogenetic analysis of sclerospora graminicola using internal transcribed spaced region-2

    E-Print Network [OSTI]

    Viswanathan, Aparna

    2004-09-30T23:59:59.000Z

    analysis of the 5.8s and ITS-2 region sequences revealed both expected and unexpected relationships. For the most part, isolates from the same country are quite similar in sequence and in some cases identical. However, while the samples from India, Mali... PHYLOGENETIC ANALYSIS OF SCLEROSPORA GRAMINICOLA USING INTERNAL TRANSCRIBED SPACER REGION-2 A Thesis by APARNA VISWANATHAN Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment...

  4. Methods for preparing comparative standards and field samples for neutron activation analysis of soil

    SciTech Connect (OSTI)

    Glasgow, D.C.; Dyer, F.F.; Robinson, L.

    1994-06-01T23:59:59.000Z

    One of the more difficult problems associated with comparative neutron activation analysis (CNAA) is the preparation of standards which are tailor-made to the desired irradiation and counting conditions. Frequently, there simply is not a suitable standard available commercially, or the resulting gamma spectrum is convoluted with interferences. In a recent soil analysis project, the need arose for standards which contained about 35 elements. In response, a computer spreadsheet was developed to calculate the appropriate amount of each element so that the resulting gamma spectrum is relatively free of interferences. Incorporated in the program are options for calculating all of the irradiation and counting parameters including activity produced, necessary flux/bombardment time, counting time, and appropriate source-to-detector distance. The result is multi-element standards for CNAA which have optimal concentrations. The program retains ease of use without sacrificing capability. In addition to optimized standard production, a novel soil homogenization technique was developed which is a low cost, highly efficient alternative to commercially available homogenization systems. Comparative neutron activation analysis for large scale projects has been made easier through these advancements. This paper contains details of the design and function of the NAA spreadsheet and innovative sample handling techniques.

  5. Analysis of 2009 International Energy Conservation Code Requirements for Residential Buildings in Utah

    SciTech Connect (OSTI)

    Cole, Pamala C.; Lucas, Robert G.

    2009-05-01T23:59:59.000Z

    The 2009 International Energy Conservation Code (IECC) contains several major improvements in energy efficiency over the current Utah code, the 2006 IECC. The most notable changes are improved duct sealing and efficient lighting requirements. A limited analysis of these changes resulted in estimated savings of $168 to $188 for an average new house in Utah at recent fuel prices.

  6. International Conference on Machine Control & Guidance 2008 1 Generation and Analysis of Digital Terrain Models with

    E-Print Network [OSTI]

    1st International Conference on Machine Control & Guidance 2008 1 Generation and Analysis of Digital Terrain Models with Parallel Guidance Systems for Precision Agriculture Grres GRENZDRFFER models at no or little additional cost. In the paper the achievable data accuracy under different

  7. INTERNATIONAL JOURNAL OF c 2011 Institute for Scientific NUMERICAL ANALYSIS AND MODELING Computing and Information

    E-Print Network [OSTI]

    Brger, Raimund

    -dimensional model of sedimentation of suspensions of small solid particles dispersed in a viscous fluid. This model accepted spatially one-dimensional sedimentation model [35] gives rise to one scalar, nonlinear hyperbolicINTERNATIONAL JOURNAL OF c 2011 Institute for Scientific NUMERICAL ANALYSIS AND MODELING Computing

  8. INTERNATIONAL JOURNAL OF c 2012 Institute for Scientific NUMERICAL ANALYSIS AND MODELING Computing and Information

    E-Print Network [OSTI]

    Brger, Raimund

    -dimensional model of sedimentation of suspensions of small solid particles dispersed in a viscous fluid. This model accepted spatially one-dimensional sedimentation model [35] gives rise to one scalar, nonlinear hyperbolicINTERNATIONAL JOURNAL OF c 2012 Institute for Scientific NUMERICAL ANALYSIS AND MODELING Computing

  9. Comparative Analysis of the Effect of Different Alkaline Catalysts on Biodiesel Yield

    E-Print Network [OSTI]

    Cynthia Ofori-boateng; Ebenezer M. Kwofie; Moses Y. Mensah

    Abstract: A major challenge in the biodiesel industry is the comparatively high cost of raw materials for production. A cost build-up analysis of biodiesel production from J. curcas oil shows that catalyst alone contributes about 50.9 % of the total production cost. This paper aims at highlighting the effects of two different commonly used catalysts on the yield of biodiesel. Samples of biodiesel were produced by three different methods namely single stage transesterification (SST), double stage transesterification (DST) and foolproof (FP) processes in which sodium hydroxide (NaOH) and potassium hydroxide (KOH) were used. The effects of each catalyst on the production yield were analyzed and compared. NaOH gave production yields of 79%, 81% and 84 % for the SST, DST and FP processes respectively. KOH produced comparatively lower yields of 68%, 71 % and 75 % for SST, DST and fool proof processes respectively. Although the use of KOH slightly raises the cost of biodiesel production as compared to NaOH, the local production of KOH from cocoa husks could minimize the production cost. Abbreviations: BDF = Biodiesel fuel; PDF = Petroleum diesel fuel; DF = Diesel fuel Key words: Transesterification Alkaline catalysts Biodiesel yield Biodiesel KOH NaOH

  10. The Integrated Microbial Genomes (IMG) System: An Expanding Comparative Analysis Resource

    SciTech Connect (OSTI)

    Markowitz, Victor M.; Chen, I-Min A.; Palaniappan, Krishna; Chu, Ken; Szeto, Ernest; Grechkin, Yuri; Ratner, Anna; Anderson, Iain; Lykidis, Athanasios; Mavromatis, Konstantinos; Ivanova, Natalia N.; Kyrpides, Nikos C.

    2009-09-13T23:59:59.000Z

    The integrated microbial genomes (IMG) system serves as a community resource for comparative analysis of publicly available genomes in a comprehensive integrated context. IMG contains both draft and complete microbial genomes integrated with other publicly available genomes from all three domains of life, together with a large number of plasmids and viruses. IMG provides tools and viewers for analyzing and reviewing the annotations of genes and genomes in a comparative context. Since its first release in 2005, IMG's data content and analytical capabilities have been constantly expanded through regular releases. Several companion IMG systems have been set up in order to serve domain specific needs, such as expert review of genome annotations. IMG is available at .

  11. A comparative analysis of binding in ultralong-range Rydberg molecules

    E-Print Network [OSTI]

    Fey, Christian; Schmelcher, Peter; Rittenhouse, Seth T; Sadeghpour, Hossein R

    2015-01-01T23:59:59.000Z

    We perform a comparative analysis of different computational approaches employed to explore the electronic structure of ultralong-range Rydberg molecules. Employing the Fermi pseudopotential approach, where the interaction is approximated by an $s$-wave bare delta function potential, one encounters a non-convergent behavior in basis set diagonalization. Nevertheless, the energy shifts within the first order perturbation theory coincide with those obtained by an alternative approach relying on Green's function calculation with the quantum defect theory. A pseudopotential that yields exactly the results obtained with the quantum defect theory, i.e. beyond first order perturbation theory, is the regularized delta function potential. The origin of the discrepancies between the different approaches is analytically motivated.

  12. Comparative analysis of the life cycle impact assessment of available cement inventories in the EU

    SciTech Connect (OSTI)

    Josa, Alejandro [Technical University of Catalonia (UPC), School of Civil Engineering (ETSECCPB), C/Jordi Girona 1-3 Modul D2/C1, Barcelona 08034 (Spain)]. E-mail: alejandro.josa@upc.edu; Aguado, Antonio [Technical University of Catalonia (UPC), School of Civil Engineering (ETSECCPB), C/Jordi Girona 1-3 Modul D2/C1, Barcelona 08034 (Spain); Cardim, Arnaldo [Civil Engineering Department, Polytechnic School of Penambuco University, Rua Benfica, 455-Madalena, CEP 50.750-410 (Brazil); Byars, Ewan [Centre for Cement and Concrete, Department of Civil and Structural Engineering, University of Sheffield, Sir Frederick Mappin Building, Mappin Street, Sheffield S1 3JD (United Kingdom)

    2007-05-15T23:59:59.000Z

    Life cycle impact assessment (LCIA) is one of basic steps in life cycle assessment methodology (LCA). This paper presents a comparative study of the LCIA of different life cycle inventories (LCI) for EU cements. The analysis unit used is the manufacture of 1 kg of cement, from 'cradle to gate'. The impact categories considered are those resulting from the manufacture of cement and include greenhouse effects, acidification, eutrophication and summer and winter smog, amongst others. The results of the study highlighted some inconsistencies in existing inventories. As for the LCIA, the main environmental interventions related to cement manufacture were classified and characterised and their effect on different impact categories analysed. Differences observed in evaluation of the impact of cement type were essentially related to their clinker content.

  13. DOE'S ENERGY DATA BASE (EDB) VERSUS OTHER ENERGY-RELATED DATA BASES: A COMPARATIVE ANALYSIS

    E-Print Network [OSTI]

    Robinson, J.

    2010-01-01T23:59:59.000Z

    terns on safety and accident analysis since t h i s i s theACCIDENT ANALYSIS ACCIDENT, TRANSPORTATION SAFETY ANALYSISInformation Center Data Base RISK HAZARDS ANALYSIS ACCIDENT

  14. A comparative analysis of the cryo-compression and cryo-adsorption hydrogen storage methods

    SciTech Connect (OSTI)

    Petitpas, G [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States); Benard, P [Universite du Quebec a Trois-Rivieres (Canada); Klebanoff, L E [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Xiao, J [Universite du Quebec a Trois-Rivieres (Canada); Aceves, S M [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)

    2014-07-01T23:59:59.000Z

    While conventional low-pressure LH? dewars have existed for decades, advanced methods of cryogenic hydrogen storage have recently been developed. These advanced methods are cryo-compression and cryo-adsorption hydrogen storage, which operate best in the temperature range 30100 K. We present a comparative analysis of both approaches for cryogenic hydrogen storage, examining how pressure and/or sorbent materials are used to effectively increase onboard H? density and dormancy. We start by reviewing some basic aspects of LH? properties and conventional means of storing it. From there we describe the cryo-compression and cryo-adsorption hydrogen storage methods, and then explore the relationship between them, clarifying the materials science and physics of the two approaches in trying to solve the same hydrogen storage task (~58 kg H?, typical of light duty vehicles). Assuming that the balance of plant and the available volume for the storage system in the vehicle are identical for both approaches, the comparison focuses on how the respective storage capacities, vessel weight and dormancy vary as a function of temperature, pressure and type of cryo-adsorption material (especially, powder MOF-5 and MIL-101). By performing a comparative analysis, we clarify the science of each approach individually, identify the regimes where the attributes of each can be maximized, elucidate the properties of these systems during refueling, and probe the possible benefits of a combined hybrid system with both cryo-adsorption and cryo-compression phenomena operating at the same time. In addition the relationships found between onboard H? capacity, pressure vessel and/or sorbent mass and dormancy as a function of rated pressure, type of sorbent material and fueling conditions are useful as general designing guidelines in future engineering efforts using these two hydrogen storage approaches.

  15. Comparative Fellowships

    E-Print Network [OSTI]

    Watkins, Joseph C.

    Comparative Genomics IGERT Graduate Fellowships & Training Integrative Graduate Education for genomics, including genotyping, sequencing, microarray research, and computers for biocomputing needs. · Genomic Analysis and Technology Core · Biotechnology Computing Facility · Protemics Analysis Lab · Bio5

  16. Comparative analysis of nonlinear dimensionality reduction techniques for breast MRI segmentation

    SciTech Connect (OSTI)

    Akhbardeh, Alireza; Jacobs, Michael A. [Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 (United States); Russell H. Morgan Department of Radiology and Radiological Science, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 (United States) and Sidney Kimmel Comprehensive Cancer Center, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205 (United States)

    2012-04-15T23:59:59.000Z

    Purpose: Visualization of anatomical structures using radiological imaging methods is an important tool in medicine to differentiate normal from pathological tissue and can generate large amounts of data for a radiologist to read. Integrating these large data sets is difficult and time-consuming. A new approach uses both supervised and unsupervised advanced machine learning techniques to visualize and segment radiological data. This study describes the application of a novel hybrid scheme, based on combining wavelet transform and nonlinear dimensionality reduction (NLDR) methods, to breast magnetic resonance imaging (MRI) data using three well-established NLDR techniques, namely, ISOMAP, local linear embedding (LLE), and diffusion maps (DfM), to perform a comparative performance analysis. Methods: Twenty-five breast lesion subjects were scanned using a 3T scanner. MRI sequences used were T1-weighted, T2-weighted, diffusion-weighted imaging (DWI), and dynamic contrast-enhanced (DCE) imaging. The hybrid scheme consisted of two steps: preprocessing and postprocessing of the data. The preprocessing step was applied for B{sub 1} inhomogeneity correction, image registration, and wavelet-based image compression to match and denoise the data. In the postprocessing step, MRI parameters were considered data dimensions and the NLDR-based hybrid approach was applied to integrate the MRI parameters into a single image, termed the embedded image. This was achieved by mapping all pixel intensities from the higher dimension to a lower dimensional (embedded) space. For validation, the authors compared the hybrid NLDR with linear methods of principal component analysis (PCA) and multidimensional scaling (MDS) using synthetic data. For the clinical application, the authors used breast MRI data, comparison was performed using the postcontrast DCE MRI image and evaluating the congruence of the segmented lesions. Results: The NLDR-based hybrid approach was able to define and segment both synthetic and clinical data. In the synthetic data, the authors demonstrated the performance of the NLDR method compared with conventional linear DR methods. The NLDR approach enabled successful segmentation of the structures, whereas, in most cases, PCA and MDS failed. The NLDR approach was able to segment different breast tissue types with a high accuracy and the embedded image of the breast MRI data demonstrated fuzzy boundaries between the different types of breast tissue, i.e., fatty, glandular, and tissue with lesions (>86%). Conclusions: The proposed hybrid NLDR methods were able to segment clinical breast data with a high accuracy and construct an embedded image that visualized the contribution of different radiological parameters.

  17. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    SciTech Connect (OSTI)

    Zheng, Nina; Zhou, Nan; Fridley, David

    2010-09-01T23:59:59.000Z

    The past decade has seen the development of various scenarios describing long-term patterns of future Greenhouse Gas (GHG) emissions, with each new approach adding insights to our understanding of the changing dynamics of energy consumption and aggregate future energy trends. With the recent growing focus on China's energy use and emission mitigation potential, a range of Chinese outlook models have been developed across different institutions including in China's Energy Research Institute's 2050 China Energy and CO2 Emissions Report, McKinsey & Co's China's Green Revolution report, the UK Sussex Energy Group and Tyndall Centre's China's Energy Transition report, and the China-specific section of the IEA World Energy Outlook 2009. At the same time, the China Energy Group at Lawrence Berkeley National Laboratory (LBNL) has developed a bottom-up, end-use energy model for China with scenario analysis of energy and emission pathways out to 2050. A robust and credible energy and emission model will play a key role in informing policymakers by assessing efficiency policy impacts and understanding the dynamics of future energy consumption and energy saving and emission reduction potential. This is especially true for developing countries such as China, where uncertainties are greater while the economy continues to undergo rapid growth and industrialization. A slightly different assumption or storyline could result in significant discrepancies among different model results. Therefore, it is necessary to understand the key models in terms of their scope, methodologies, key driver assumptions and the associated findings. A comparative analysis of LBNL's energy end-use model scenarios with the five above studies was thus conducted to examine similarities and divergences in methodologies, scenario storylines, macroeconomic drivers and assumptions as well as aggregate energy and emission scenario results. Besides directly tracing different energy and CO{sub 2} savings potential back to the underlying strategies and combination of efficiency and abatement policy instruments represented by each scenario, this analysis also had other important but often overlooked findings.

  18. Scalability of Comparative Analysis, Novel Algorithms and Tools (MICW - Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    ScienceCinema (OSTI)

    Mavrommatis, Kostas [JGI

    2013-01-22T23:59:59.000Z

    DOE JGI's Kostas Mavrommatis, chair of the Scalability of Comparative Analysis, Novel Algorithms and Tools panel, at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  19. Scalability of Comparative Analysis, Novel Algorithms and Tools (MICW - Metagenomics Informatics Challenges Workshop: 10K Genomes at a Time)

    SciTech Connect (OSTI)

    Mavrommatis, Kostas [JGI] [JGI

    2011-10-12T23:59:59.000Z

    DOE JGI's Kostas Mavrommatis, chair of the Scalability of Comparative Analysis, Novel Algorithms and Tools panel, at the Metagenomics Informatics Challenges Workshop held at the DOE JGI on October 12-13, 2011.

  20. The agglomerative role of transportation investment : a comparative analysis of Portuguese and American high-speed rail proposals

    E-Print Network [OSTI]

    Westrom, Ryan J. (Ryan Jeremy)

    2014-01-01T23:59:59.000Z

    This research uses a comparative analysis of High-Speed Rail (HSR) impacts from proposals in both Portugal and Illinois to understand the wider economic implications of these proposed transportation links and corollary ...

  1. Contributions to a revision of the Compsoneura capitellata species group (Myristicaceae) through comparative analysis of androecium morphology

    E-Print Network [OSTI]

    Mistry, Manoj Girish

    2002-01-01T23:59:59.000Z

    &M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 2002 Major Subject: Biology CONTRIBUTIONS TO A REVISION OF THE COMPS01VEURA CAP1TELLATA SPECIES GROUP (MYRISTICACEAE) THROUGH COMPARATIVE ANALYSIS... (Member) Edward Mc illiams (Member) Terry Thomas (Head of Department) August 2002 Major Subject: Biology ABSTRACT Contributions to a Revision of the Compsoneura capitellata Species Group (Myristicaceae) Through Comparative Analysis of Androecium...

  2. A comparative study of extraction methods for analysis of chloride in plant tissue by means of the Cotlove chloridometer

    E-Print Network [OSTI]

    Norris, Richard Eugene

    1976-01-01T23:59:59.000Z

    A COMPARATIVE STUDY OF EXTRACTION METHODS FOR ANALYSIS OF CHLORIDE IN PLANT TISSUE BY MEANS OF THE COTLOVE CHLORIDOMETER A Thesis by RICHARD EUGENE NORRIS Submitted to the Graduate College of Texas A&M University in partial fulfillment... of the requirement for the degree of MASTER OF SCIENCE December 1976 Major Subject: Horticulture A COMPARATIVE STUDY OF EXTRACTION METHODS FOR ANALYSIS OF CHLORIDE IN PLANT TISSUE BY MEANS OF THE COTLOVE CHLORIDOMETER A Thesis by RICHARD EUGENE NORP...

  3. Comparative Analysis of Modeling Studies on China's Future Energy and Emissions Outlook

    E-Print Network [OSTI]

    Zheng, Nina

    2010-01-01T23:59:59.000Z

    International Energy Agency (IEA). 2009. World EnergyChina-specific section of the IEA World Energy Outlook 2009.while LBNL, McKinsey and IEA all employed bottom-up modeling

  4. Comparative analysis of LWR and FBR spent fuels for nuclear forensics evaluation

    SciTech Connect (OSTI)

    Permana, Sidik; Suzuki, Mitsutoshi; Su'ud, Zaki [Department of Science and Technology for Nuclear Material Management (STNM), Japan Atomic Energy Agency (JAEA), 2-4 Shirane, Shirakata, Tokai Mura, Naka-gun, Ibaraki 319-1195 Nuclear Physics and Bio (Indonesia); Department of Science and Technology for Nuclear Material Management (STNM), Japan Atomic Energy Agency (JAEA), 2-4 Shirane, Shirakata, Tokai Mura, Naka-gun, Ibaraki 319-1195 (Japan); Nuclear Physics and Bio Physics Research Group, Department of Physics, Bandung Institute of Technology, Gedung Fisika, Jl. Ganesha 10, Bandung 40132 (Indonesia)

    2012-06-06T23:59:59.000Z

    Some interesting issues are attributed to nuclide compositions of spent fuels from thermal reactors as well as fast reactors such as a potential to reuse as recycled fuel, and a possible capability to be manage as a fuel for destructive devices. In addition, analysis on nuclear forensics which is related to spent fuel compositions becomes one of the interesting topics to evaluate the origin and the composition of spent fuels from the spent fuel foot-prints. Spent fuel compositions of different fuel types give some typical spent fuel foot prints and can be estimated the origin of source of those spent fuel compositions. Some technics or methods have been developing based on some science and technological capability including experimental and modeling or theoretical aspects of analyses. Some foot-print of nuclear forensics will identify the typical information of spent fuel compositions such as enrichment information, burnup or irradiation time, reactor types as well as the cooling time which is related to the age of spent fuels. This paper intends to evaluate the typical spent fuel compositions of light water (LWR) and fast breeder reactors (FBR) from the view point of some foot prints of nuclear forensics. An established depletion code of ORIGEN is adopted to analyze LWR spent fuel (SF) for several burnup constants and decay times. For analyzing some spent fuel compositions of FBR, some coupling codes such as SLAROM code, JOINT and CITATION codes including JFS-3-J-3.2R as nuclear data library have been adopted. Enriched U-235 fuel composition of oxide type is used for fresh fuel of LWR and a mixed oxide fuel (MOX) for FBR fresh fuel. Those MOX fuels of FBR come from the spent fuels of LWR. Some typical spent fuels from both LWR and FBR will be compared to distinguish some typical foot-prints of SF based on nuclear forensic analysis.

  5. Analysis of core damage frequency: Peach Bottom, Unit 2 internal events

    SciTech Connect (OSTI)

    Kolaczkowski, A.M.; Cramond, W.R.; Sype, T.T.; Maloney, K.J.; Wheeler, T.A.; Daniel, S.L. (Science Applications International Corp., Albuquerque, NM (USA); Sandia National Labs., Albuquerque, NM (USA))

    1989-08-01T23:59:59.000Z

    This document contains the appendices for the accident sequence analysis of internally initiated events for the Peach Bottom, Unit 2 Nuclear Power Plant. This is one of the five plant analyses conducted as part of the NUREG-1150 effort for the Nuclear Regulatory Commission. The work performed and described here is an extensive reanalysis of that published in October 1986 as NUREG/CR-4550, Volume 4. It addresses comments from numerous reviewers and significant changes to the plant systems and procedures made since the first report. The uncertainty analysis and presentation of results are also much improved, and considerable effort was expended on an improved analysis of loss of offsite power. The content and detail of this report is directed toward PRA practitioners who need to know how the work was done and the details for use in further studies. 58 refs., 58 figs., 52 tabs.

  6. Comparative Microbial Genomics group CenterforBiologicalSequenceAnalysisTheTechnicalUniversityofDenmarkDTU

    E-Print Network [OSTI]

    Ussery, David W.

    Comparative Microbial Genomics group Centerfor systematics - is it relevant to modern science? Istanbul, Turkey 8 August, 2008 - or - What can genomics tell us about Vibrio species? Discovering natural groups in Vibrio #12;Comparative Microbial Genomics

  7. An International Analysis of the Role of Religion and Spirituality in Social Work Practice

    E-Print Network [OSTI]

    Furman, Leola Dyrud; Zahl, Mari-Anne; Benson, Perry W.; Canda, Edward R.

    2007-01-01T23:59:59.000Z

    . From 1950 on, the focus of the newly opened school of social work was directed toward managing a steadily growing bureau cracy designed to assist citizens. Dur ing the late 1960s and 1970s, schools of social work in Norway were strongly influenced...%, n = 1,806) agreed or s trongly agreed that spirituality is a fundamental part of 2 5 0 T A B L E 4 B . Spiritually Oriented Helping Activities by Country Furman, Zahl, Benson, & Canda I An International Analysis of the Role of Religion...

  8. TEMP-STRESS analysis of a reinforced concrete vessel under internal pressure

    SciTech Connect (OSTI)

    Marchertas, A.H.; Kennedy, J.M.; Pfeiffer, P.A.

    1987-01-01T23:59:59.000Z

    Prediction of the response of the Sandia National laboratory 1/6-scale reinforced concrete containment model test was obtained by Argonne National Laboratory (ANL) employing a computer program developed by ANL. The test model was internally pressurized to failure. The two-dimensional code TEMP-STRESS (1-5) has been developed at ANL for stress analysis of plane and axisymmetric 2-D reinforced structures under various thermal conditions. The program is applicable to a wide variety of nonlinear problems, and is utilized in the present study. The comparison of these pretest computations with test data on the containment model should be a good indication of the state of the code.

  9. Characterization of the mouse pancreatic islet proteome and comparative analysis with other mouse tissues

    SciTech Connect (OSTI)

    Petyuk, Vladislav A.; Qian, Weijun; Hinault, Charlotte; Gritsenko, Marina A.; Singhal, Mudita; Monroe, Matthew E.; Camp, David G.; Kulkarni, Rohit N.; Smith, Richard D.

    2008-08-01T23:59:59.000Z

    The pancreatic islets of Langerhans and insulin-producing beta cells in particular play a central role in the maintenance of glucose homeostasis and the islet dysfunction is associated with the pathogenesis of both type 1 and type 2 diabetes mellitus. To contribute to the understanding of the biology of the pancreatic islets we applied proteomic techniques based on liquid chromatography coupled with mass spectrometry. Here as an initial step we present the first comprehensive proteomic characterization of pancreas islets of the mouse, the commonly used animal model for diabetes research. Two-dimensional SCX LC/RP LC-MS/MS has been applied to characterize of the mouse islet proteome, resulting in the confident identification of 17,350 different tryptic peptides covering 2,612 proteins with at least two unique peptide identifications per protein. The dataset also allowed identification of a number of post-translational modifications including several modifications relevant to oxidative stress and phosphorylation. While many of the identified phosphorylation sites corroborates with previous known sites, the oxidative modifications observed on cysteinyl residues potentially reveal novel information related to the role of oxidation stress in islet functions. Comparative analysis of the islet proteome database with 15 available proteomic datasets from other mouse tissues and cells revealed a set of 68 proteins uniquely detected only in the pancreatic islets. Besides proteins with known functions, like islet secreted peptide hormones, this unique set contains a number of proteins with yet unknown functions. The resulting peptide and protein database will be available at ncrr.pnl.gov web site of the NCRR proteomic center (ncrr.pnl.gov).

  10. First Steps Toward a Quality of Climate Finance Scorecard (QUODA-CF): Creating a Comparative Index to Assess International Climate Finance Contributions

    SciTech Connect (OSTI)

    Sierra, Katherine; Roberts, Timmons; de Nevers, Michele; Langley, Claire; Smith, Cory

    2013-06-15T23:59:59.000Z

    Are climate finance contributor countries, multilateral aid agencies and specialized funds using widely accepted best practices in foreign assistance? How is it possible to measure and compare international climate finance contributions when there are as yet no established metrics or agreed definitions of the quality of climate finance? As a subjective metric, quality can mean different things to different stakeholders, while of donor countries, recipients and institutional actors may place quality across a broad spectrum of objectives. This subjectivity makes the assessment of the quality of climate finance contributions a useful and necessary exercise, but one that has many challenges. This work seeks to enhance the development of common definitions and metrics of the quality of climate finance, to understand what we can about those areas where climate finance information is available and shine a light on the areas where there is a severe dearth of data. Allowing for comparisons of the use of best practices across funding institutions in the climate sector could begin a process of benchmarking performance, fostering learning across institutions and driving improvements when incorporated in internal evaluation protocols of those institutions. In the medium term, this kind of benchmarking and transparency could support fundraising in contributor countries and help build trust with recipient countries. As a feasibility study, this paper attempts to outline the importance of assessing international climate finance contributions while describing the difficulties in arriving at universally agreed measurements and indicators for assessment. In many cases, data are neither readily available nor complete, and there is no consensus on what should be included. A number of indicators are proposed in this study as a starting point with which to analyze voluntary contributions, but in some cases their methodologies are not complete, and further research is required for a robust measurement tool to be created.

  11. Comparative analysis of hole transport in compressively strained InSb and Ge quantum well heterostructures

    SciTech Connect (OSTI)

    Agrawal, Ashish; Barth, Michael; Madan, Himanshu; Datta, Suman [Department of Electrical Engineering, The Pennsylvania State University, University Park, Pennsylvania 16802 (United States); Lee, Yi-Jing; Lin, You-Ru; Wu, Cheng-Hsien; Ko, Chih-Hsin; Wann, Clement H. [Taiwan Semiconductor Manufacturing Company, Hsinchu 30078, Taiwan (China); Loubychev, Dmitri; Liu, Amy; Fastenau, Joel [IQE, Inc., Bethlehem, Pennsylvania 18015 (United States); Lindemuth, Jeff [Lake Shore Cryotronics, Westerville, Ohio 43082 (United States)

    2014-08-04T23:59:59.000Z

    Compressively strained InSb (s-InSb) and Ge (s-Ge) quantum well heterostructures are experimentally studied, with emphasis on understanding and comparing hole transport in these two-dimensional confined heterostructures. Magnetotransport measurements and bandstructure calculations indicate 2.5 lower effective mass for s-InSb compared to s-Ge quantum well at 1.9??10{sup 12}?cm{sup 2}. Advantage of strain-induced m* reduction is negated by higher phonon scattering, degrading hole transport at room temperature in s-InSb quantum well compared to s-Ge heterostructure. Consequently, effective injection velocity is superior in s-Ge compared to s-InSb. These results suggest s-Ge quantum well heterostructure is more favorable and promising p-channel candidate compared to s-InSb for future technology node.

  12. A comparative analysis of numerical simulation and analytical modeling of horizontal well cyclic steam injection

    E-Print Network [OSTI]

    Ravago Bastardo, Delmira Cristina

    2005-08-29T23:59:59.000Z

    The main objective of this research is to compare the performance of cyclic steam injection using horizontal wells based on the analytical model developed by Gunadi against that based on numerical simulation. For comparison, ...

  13. Magnetism and magnetocaloric effect in multicomponent Laves-phase compounds: Study and comparative analysis

    SciTech Connect (OSTI)

    ?wik, J., E-mail: cwikjac@ml.pan.wroc.pl

    2014-01-15T23:59:59.000Z

    This paper presents a review and results of comparative study of the influence of Gd on some physical properties of (R{sub 0.9}R?{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} solid solutions with R=Dy, Ho and R?=Er, Ho and x varied from 0.05 to 0.15. Powder X-ray diffraction analysis performed at room temperature revealed that all studied solid solutions solidify with the formation of a Laves-phase MgCu{sub 2}-type structure (space group Fd?3m). The magnetization behavior and the magnetic transition are analyzed in terms of the Landau theory. The studies of magnetic properties and heat capacity showed that a relatively small Gd addition significantly increases T{sub C} of the compounds. The maximum percentage increase in T{sub C}, namely, ?43% was observed for (Ho{sub 0.9}Er{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2}. However, the highest temperature was noted for the (Dy{sub 0.9}Ho{sub 0.1}){sub 0.85}Gd{sub 0.15}Co{sub 2} solid solution; it is T{sub C}=183.4 K. Below the ordering temperature, all samples are ferrimagnetically ordered; at high temperatures, they are CurieWeiss paramagnets. Moreover, a small Gd addition eliminates the field-induced magnetic transition near T{sub C} and, as consequence, transforms the nature of magnetic transition from the first- to second-order. The magnetocaloric effect has been estimated in terms of both isothermal magnetic entropy and adiabatic temperature changes. The highest adiabatic temperature change ?T{sub ad}=3 K and highest isothermal entropy change ?S{sub mag}=12.1 J/kg K were observed for (Ho{sub 0.9}Er{sub 0.1}){sub 0.95}Gd{sub 0.05}Co{sub 2} at ?90 K in magnetic fields of 2 T and 3 T, respectively. A decrease in the entropy change has been observed with increasing Gd content in all studied samples. The smallest values of ?S{sub mag} were observed for the (Dy{sub 0.9}Ho{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} solid solutions. Under an external field change of from 0 to 3 T, the maximum entropy change for (Dy{sub 0.9}Ho{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} compounds decreases from 6.9 at x=0.054.3 J/kg K at x=0.15. The refrigerant capacity for all solid solutions (with 0.05?x?0.15) is reported. The effect of increasing Gd content in the solid solutions on their magnetic and magnetocaloric properties is discussed. - Graphical abstract: Temperature dependencies of ?T{sub ad} induced by {sub 0}H=1 and 2 T in (a) (Ho{sub 0.9}Er{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} and (b) (Dy{sub 0.9}Er{sub 0.1}){sub 1?x}Gd{sub x}Co{sub 2} solid solutions. Display Omitted.

  14. Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain Paper number: 197

    E-Print Network [OSTI]

    Grilli, Stéphan T.

    . Madrid, Spain Paper number: 197 #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis

  15. Comparative analysis of surface power system architectures for human Mars exploration

    E-Print Network [OSTI]

    Cooper, Chase Allen

    2009-01-01T23:59:59.000Z

    This thesis provides a comprehensive analysis of surface power generation and energy storage architectures for human Mars surface missions, including tracking and non-tracking photovoltaic power generation, nuclear fission ...

  16. Probabilistic accident consequence uncertainty analysis -- Uncertainty assessment for internal dosimetry. Volume 2: Appendices

    SciTech Connect (OSTI)

    Goossens, L.H.J.; Kraan, B.C.P.; Cooke, R.M. [Delft Univ. of Technology (Netherlands); Harrison, J.D. [National Radiological Protection Board (United Kingdom); Harper, F.T. [Sandia National Labs., Albuquerque, NM (United States); Hora, S.C. [Univ. of Hawaii, Hilo, HI (United States)

    1998-04-01T23:59:59.000Z

    The development of two new probabilistic accident consequence codes, MACCS and COSYMA, was completed in 1990. These codes estimate the consequence from the accidental releases of radiological material from hypothesized accidents at nuclear installations. In 1991, the US Nuclear Regulatory Commission and the Commission of the European Communities began cosponsoring a joint uncertainty analysis of the two codes. The ultimate objective of this joint effort was to systematically develop credible and traceable uncertainty distributions for the respective code input variables. A formal expert judgment elicitation and evaluation process was identified as the best technology available for developing a library of uncertainty distributions for these consequence parameters. This report focuses on the results of the study to develop distribution for variables related to the MACCS and COSYMA internal dosimetry models. This volume contains appendices that include (1) a summary of the MACCS and COSYMA consequence codes, (2) the elicitation questionnaires and case structures, (3) the rationales and results for the panel on internal dosimetry, (4) short biographies of the experts, and (5) the aggregated results of their responses.

  17. Analysis of core damage frequency: Peach Bottom, Unit 2 internal events appendices

    SciTech Connect (OSTI)

    Kolaczkowski, A.M.; Cramond, W.R.; Sype, T.T.; Maloney, K.J.; Wheeler, T.A.; Daniel, S.L. (Science Applications International Corp., Albuquerque, NM (USA); Sandia National Labs., Albuquerque, NM (USA))

    1989-08-01T23:59:59.000Z

    This document contains the appendices for the accident sequence analysis of internally initiated events for the Peach Bottom, Unit 2 Nuclear Power Plant. This is one of the five plant analyses conducted as part of the NUREG-1150 effort for the Nuclear Regulatory Commission. The work performed and described here is an extensive reanalysis of that published in October 1986 as NUREG/CR-4550, Volume 4. It addresses comments from numerous reviewers and significant changes to the plant systems and procedures made since the first report. The uncertainty analysis and presentation of results are also much improved, and considerable effort was expended on an improved analysis of loss of offsite power. The content and detail of this report is directed toward PRA practitioners who need to know how the work was done and the details for use in further studies. The mean core damage frequency is 4.5E-6 with 5% and 95% uncertainty bounds of 3.5E-7 and 1.3E-5, respectively. Station blackout type accidents (loss of all ac power) contributed about 46% of the core damage frequency with Anticipated Transient Without Scram (ATWS) accidents contributing another 42%. The numerical results are driven by loss of offsite power, transients with the power conversion system initially available operator errors, and mechanical failure to scram. 13 refs., 345 figs., 171 tabs.

  18. Analysis of 2009 International Energy Conservation Code Requirements for Residential Buildings in Kansas City, Missouri

    SciTech Connect (OSTI)

    Lucas, Robert G.

    2011-09-30T23:59:59.000Z

    The 2009 International Energy Conservation Code (IECC) contains several major improvements in energy efficiency over the 2006 IECC. The notable changes are: (1) Improved duct sealing verified by testing the duct system; (2) Increased duct insulation; (3) Improvement of window U-factors from 0.40 to 0.35; and (4) Efficient lighting requirements. An analysis of these changes resulted in estimated annual energy cost savings of about $145 a year for an average new house. Construction cost increases are estimated at $655. Home owners will experience an annual cost savings of close to $100 a year because reduction to energy bills will more than compensate for increased mortgage payments and other costs.

  19. Gunavarman (367-431): A Comparative Analysis of the Biographies found in the Chinese Tripitaka

    E-Print Network [OSTI]

    Stache-Rosen, Valentina

    Chiao Lu, by Tsche Ching, 730 A.D. F T 2157 Cheng Yuan Hsin Ting Che Chiao Mu Lu, by Y~n Chao, 7th century -1- G T 2034 Li Tai San Pao Chi, by Fei Chang-fang, S97 A.D. T 2149 Ta Tang Nei Tien Lu, by Tao Hauan, 7th century T 2 I 3 I Fan I Ming I Chi... . 60 In the North the Sutras became separated and could no~ be united and then the old arrangement was adhered to. 3. Pu~sha nei chiai china (Sutra on the internal rules of a Bodhi sattva, Nj 1082). This is in the above catalogue. 4. Yu-po-sha wu...

  20. Comparative analysis of remaining oil saturation in waterflood patterns based on analytical modeling and simulation

    E-Print Network [OSTI]

    Azimov, Anar Etibar

    2006-08-16T23:59:59.000Z

    development. While special core analysis, log-inject-log, and thermal-decay time-log-evaluation techniques are available, they provide only single-point values and a snapshot in time near a wellbore. Also, they can quickly add up to an expensive program...

  1. Comparative Analysis of GALLEX-GNO Solar Neutrino Data and SOHO/MDI Helioseismology Data; Further Evidence for Rotational Modulation of the Solar Neutrino Flux

    E-Print Network [OSTI]

    Peter A. Sturrock; Mark A. Weber

    2001-03-10T23:59:59.000Z

    We carry out a comparative analysis of the GALLEX-GNO solar neutrino data and estimates of the solar internal rotation rate derived from the MDI helioseismology experiment on the SOHO spacecraft. We introduce a statistic, which we evaluate as a function of radius and latitude, that is a measure of the degree of "resonance" of oscillations in the neutrino flux and the synodic solar rotation rate at that radius and latitude. A map of this statistic indicates that the probable location is deep in the convection zone near the equator. We also examine the integral of this statistic over the equatorial section of the convection zone. This provides a measure of the likelihood that the variability of the solar neutrino flux, as measured by the GALLEX-GNO data, has its origin in the equatorial section of the convection zone. We apply the shuffle test, randomly reassigning measurements among runs, to estimate the significance of the value of the statistic computed from the actual data. This test implies that the result is significant at the 0.2% level. When, for comparison, we repeat this analysis for the radiative zone, we find that the integral resonance statistic is not significant. These results support earlier evidence for rotational modulation of the solar neutrino flux.

  2. Comparative analysis of 11 different radioisotopes for palliative treatment of bone metastases by computational methods

    SciTech Connect (OSTI)

    Guerra Liberal, Francisco D. C., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Adriana Alexandre S., E-mail: meb12020@fe.up.pt, E-mail: adriana-tavares@msn.com; Tavares, Joo Manuel R. S., E-mail: tavares@fe.up.pt [Instituto de Engenharia Mecnica e Gesto Industrial, Faculdade de Engenharia, Universidade do Porto, Rua Dr. Roberto Frias s/n, Porto 4200-465 (Portugal)

    2014-11-01T23:59:59.000Z

    Purpose: Throughout the years, the palliative treatment of bone metastases using bone seeking radiotracers has been part of the therapeutic resources used in oncology, but the choice of which bone seeking agent to use is not consensual across sites and limited data are available comparing the characteristics of each radioisotope. Computational simulation is a simple and practical method to study and to compare a variety of radioisotopes for different medical applications, including the palliative treatment of bone metastases. This study aims to evaluate and compare 11 different radioisotopes currently in use or under research for the palliative treatment of bone metastases using computational methods. Methods: Computational models were used to estimate the percentage of deoxyribonucleic acid (DNA) damage (fast Monte Carlo damage algorithm), the probability of correct DNA repair (Monte Carlo excision repair algorithm), and the radiation-induced cellular effects (virtual cell radiobiology algorithm) post-irradiation with selected particles emitted by phosphorus-32 ({sup 32}P), strontium-89 ({sup 89}Sr), yttrium-90 ({sup 90}Y ), tin-117 ({sup 117m}Sn), samarium-153 ({sup 153}Sm), holmium-166 ({sup 166}Ho), thulium-170 ({sup 170}Tm), lutetium-177 ({sup 177}Lu), rhenium-186 ({sup 186}Re), rhenium-188 ({sup 188}Re), and radium-223 ({sup 223}Ra). Results: {sup 223}Ra alpha particles, {sup 177}Lu beta minus particles, and {sup 170}Tm beta minus particles induced the highest cell death of all investigated particles and radioisotopes. The cell survival fraction measured post-irradiation with beta minus particles emitted by {sup 89}Sr and {sup 153}Sm, two of the most frequently used radionuclides in the palliative treatment of bone metastases in clinical routine practice, was higher than {sup 177}Lu beta minus particles and {sup 223}Ra alpha particles. Conclusions: {sup 223}Ra and {sup 177}Lu hold the highest potential for palliative treatment of bone metastases of all radioisotopes compared in this study. Data reported here may prompt future in vitro and in vivo experiments comparing different radionuclides for palliative treatment of bone metastases, raise the need for the careful rethinking of the current widespread clinical use of {sup 89}Sr and {sup 153}Sm, and perhaps strengthen the use of {sup 223}Ra and {sup 177}Lu in the palliative treatment of bone metastases.

  3. A Comparative Analysis of the Perceptions of Special Education Teachers Regarding Educative Activities To Further Develop Teaching Skills

    E-Print Network [OSTI]

    Arocha-Gill, Theresa A.

    2010-07-14T23:59:59.000Z

    A COMPARATIVE ANALYSIS OF THE PERCEPTIONS OF SPECIAL EDUCATION TEACHERS REGARDING EDUCATIVE ACTIVITIES TO FURTHER DEVELOP TEACHING SKILLS A Dissertation by THERESA AROCHA-GILL Submitted to the Office of Graduate Studies of Texas A&M University... DEVELOP TEACHING SKILLS A Dissertation by THERESA AROCHA-GILL Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY Approved by: Co-Chairs of Committee, Homer...

  4. Analysis of core damage frequency from internal events: Peach Bottom, Unit 2

    SciTech Connect (OSTI)

    Kolaczkowski, A.M.; Lambright, J.A.; Ferrell, W.L.; Cathey, N.G.; Najafi, B.; Harper, F.T.

    1986-10-01T23:59:59.000Z

    This document contains the internal event initiated accident sequence analyses for Peach Bottom, Unit 2; one of the reference plants being examined as part of the NUREG-1150 effort by the Nuclear Regulatory Commission. NUREG-1150 will document the risk of a selected group of nuclear power plants. As part of that work, this report contains the overall core damage frequency estimate for Peach Bottom, Unit 2, and the accompanying plant damage state frequencies. Sensitivity and uncertainty analyses provided additional insights regarding the dominant contributors to the Peach Bottom core damage frequency estimate. The mean core damage frequency at Peach Bottom was calculated to be 8.2E-6. Station blackout type accidents (loss of all ac power) were found to dominate the overall results. Anticipated Transient Without Scram accidents were also found to be non-negligible contributors. The numerical results are largely driven by common mode failure probability estimates and to some extent, human error. Because of significant data and analysis uncertainties in these two areas (important, for instance, to the most dominant scenario in this study), it is recommended that the results of the uncertainty and sensitivity analyses be considered before any actions are taken based on this analysis.

  5. Comparative analysis of compact heat exchangers for application as the intermediate heat exchanger for advanced nuclear reactors

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Bartel, N.; Chen, M.; Utgikar, V. P.; Sun, X.; Kim, I. H.; Christensen, R.; Sabharwall, P.

    2015-07-01T23:59:59.000Z

    A comparative evaluation of alternative compact heat exchanger designs for use as the intermediate heat exchanger in advanced nuclear reactor systems is presented in this article. Candidate heat exchangers investigated included the Printed circuit heat exchanger (PCHE) and offset strip-fin heat exchanger (OSFHE). Both these heat exchangers offer high surface area to volume ratio (a measure of compactness [m2/m3]), high thermal effectiveness, and overall low pressure drop. Heliumhelium heat exchanger designs for different heat exchanger types were developed for a 600 MW thermal advanced nuclear reactor. The wavy channel PCHE with a 15 pitch angle was found to offer optimummorecombination of heat transfer coefficient, compactness and pressure drop as compared to other alternatives. The principles of the comparative analysis presented here will be useful for heat exchanger evaluations in other applications as well.less

  6. Comparative analysis of continuous-wave surface-plasma negative ion sources with various discharge geometry

    SciTech Connect (OSTI)

    Belchenko, Yu, E-mail: belchenko@inp.nsk.su [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation)] [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation); Sanin, A.; Sotnikov, O. [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation) [Budker Institute of Nuclear Physics, Siberian Branch of Russian Academy of Sciences, Novosibirsk (Russian Federation); Novosibirsk State University, Novosibirsk, 630090 (Russian Federation)

    2014-02-15T23:59:59.000Z

    Negative ion extraction from continuous-wave (CW) magnetron and semiplanotron discharges was studied and it was compared with that for the source with Penning electrode geometry. The CW negative ion beam up current to 13 mA was extracted from the magnetron source with emission aperture of 3.5 mm in diameter, while the beam with current up to 8 mA was obtained from the semiplanotron source modification. Characteristics of CW magnetron and semiplanotron sources are presented and analyzed.

  7. IEEE International Workshop on Analysis and Modeling of Faces and Gestures, 2003. Human Body Tracking with Auxiliary Measurements

    E-Print Network [OSTI]

    Cohen, Issac

    in interactive virtual environment, human computer interaction, motion capture for human animation and videoIEEE International Workshop on Analysis and Modeling of Faces and Gestures, 2003. Human Body-0273 {munlee|icohen}@usc.edu Abstract This paper presents two techniques for improving human body tracking

  8. The analysis and evaluation of ISO/IEC91263 internal quality measures applicability: state-of-the-art 2006

    E-Print Network [OSTI]

    Suryn, Witold

    The analysis and evaluation of ISO/IEC91263 internal quality measures applicability: state in ISO/IEC 9126-3:2003 standard for software quality measurement and evaluation. As a result, the recommendations for modifications to the current set of ISO/IEC 9126-3 set of measures as well as to the existing

  9. Comparative quantification and statistical analysis of ?? and ? precipitates in aluminum alloy AA7075-T651 by TEM and AFM

    SciTech Connect (OSTI)

    Garcia-Garcia, Adrian Luis, E-mail: agarciag@ipn.mx; Dominguez-Lopez, Ivan, E-mail: idominguezl@ipn.mx; Lopez-Jimenez, Luis, E-mail: llopez1002@ipn.mx; Barceinas-Sanchez, J.D. Oscar, E-mail: obarceinas@ipn.mx

    2014-01-15T23:59:59.000Z

    Quantification of nanometric precipitates in metallic alloys has been traditionally performed using transmission electron microscopy, which is nominally a low throughput technique. This work presents a comparative study of quantification of ?? and ? precipitates in aluminum alloy AA7075-T651 using transmission electron microscopy (TEM) and non-contact atomic force microscopy (AFM). AFM quantification was compared with 2-D stereological results reported elsewhere. Also, a method was developed, using specialized software, to characterize nanometric size precipitates observed in dark-field TEM micrographs. Statistical analysis of the quantification results from both measurement techniques supports the use of AFM for precipitate characterization. Once the precipitate stoichiometry has been determined by appropriate analytical techniques like TEM, as it is the case for ?? and ? in AA7075-T651, the relative ease with which specimens are prepared for AFM analysis could be advantageous in product and process development, and quality control, where a large number of samples are expected for analysis on a regular basis. - Highlights: Nanometric MgZn{sub 2} precipitates in AA7075-T651 were characterized using AFM and TEM. Phase-contrast AFM was used to differentiate metal matrix from MgZn{sub 2} precipitates. TEM and AFM micrographs were analyzed using commercially available software. AFM image analysis and TEM 2-D stereology render statistically equivalent results.

  10. Comparative analysis of thorium and uranium fuel for transuranic recycle in a sodium cooled Fast Reactor

    SciTech Connect (OSTI)

    C. Fiorina; N. E. Stauff; F. Franceschini; M. T. Wenner; A. Stanculescu; T. K. Kim; A. Cammi; M. E. Ricotti; R. N. Hill; T. A. Taiwo; M. Salvatores

    2013-12-01T23:59:59.000Z

    The present paper compares the reactor physics and transmutation performance of sodium-cooled Fast Reactors (FRs) for TRansUranic (TRU) burning with thorium (Th) or uranium (U) as fertile materials. The 1000 MWt Toshiba-Westinghouse Advanced Recycling Reactor (ARR) conceptual core has been used as benchmark for the comparison. Both burner and breakeven configurations sustained or started with a TRU supply, and assuming full actinide homogeneous recycle strategy, have been developed. State-of-the-art core physics tools have been employed to establish fuel inventory and reactor physics performances for equilibrium and transition cycles. Results show that Th fosters large improvements in the reactivity coefficients associated with coolant expansion and voiding, which enhances safety margins and, for a burner design, can be traded for maximizing the TRU burning rate. A trade-off of Th compared to U is the significantly larger fuel inventory required to achieve a breakeven design, which entails additional blankets at the detriment of core compactness as well as fuel manufacturing and separation requirements. The gamma field generated by the progeny of U-232 in the U bred from Th challenges fuel handling and manufacturing, but in case of full recycle, the high contents of Am and Cm in the transmutation fuel impose remote fuel operations regardless of the presence of U-232.

  11. A comparative analysis of numerical approaches to the mechanics of elastic sheets

    E-Print Network [OSTI]

    Michael Taylor; Benny Davidovitch; Zhanlong Qiu; Katia Bertoldi

    2014-11-25T23:59:59.000Z

    Numerically simulating deformations in thin elastic sheets is a challenging problem in computational mechanics due to destabilizing compressive stresses that result in wrinkling. Determining the location, structure, and evolution of wrinkles in these problems have important implications in design and is an area of increasing interest in the fields of physics and engineering. In this work, several numerical approaches previously proposed to model equilibrium deformations in thin elastic sheets are compared. These include standard finite element-based static post-buckling approaches as well as a recently proposed method based on dynamic relaxation, which are applied to the problem of an annular sheet with opposed tractions where wrinkling is a key feature. Numerical solutions are compared to analytic predictions, enabling a quantitative evaluation of the predictive power of the various methods. Results indicate that static finite element approaches are highly sensitive to initial imperfections, relying on \\textit{a priori} knowledge of the equilibrium wrinkling pattern to generate optimal results. In contrast, dynamic relaxation is much less sensitive to initial imperfections and can generate solutions for a wide variety of loading conditions without requiring knowledge of the equilibrium solution beforehand.

  12. Comparative life-cycle cost analysis for low-level mixed waste remediation alternatives

    SciTech Connect (OSTI)

    Jackson, J.A.; White, T.P.; Kloeber, J.M.; Toland, R.J.; Cain, J.P.; Buitrago, D.Y.

    1995-03-01T23:59:59.000Z

    The purpose of this study is two-fold: (1) to develop a generic, life-cycle cost model for evaluating low-level, mixed waste remediation alternatives, and (2) to apply the model specifically, to estimate remediation costs for a site similar to the Fernald Environmental Management Project near Cincinnati, OH. Life-cycle costs for vitrification, cementation, and dry removal process technologies are estimated. Since vitrification is in a conceptual phase, computer simulation is used to help characterize the support infrastructure of a large scale vitrification plant. Cost estimating relationships obtained from the simulation data, previous cost estimates, available process data, engineering judgment, and expert opinion all provide input to an Excel based spreadsheet for generating cash flow streams. Crystal Ball, an Excel add-on, was used for discounting cash flows for net present value analysis. The resulting LCC data was then analyzed using multi-attribute decision analysis techniques with cost and remediation time as criteria. The analytical framework presented allows alternatives to be evaluated in the context of budgetary, social, and political considerations. In general, the longer the remediation takes, the lower the net present value of the process. This is true because of the time value of money and large percentage of the costs attributed to storage or disposal.

  13. Comparative genomic analysis of the thermophilic biomass-degrading fungi Myceliophthora thermophila and Thielavia terrestris

    SciTech Connect (OSTI)

    Berka, Randy M.; Grigoriev, Igor V.; Otillar, Robert; Salamov, Asaf; Grimwood, Jane; Reid, Ian; Ishmael, Nadeeza; John, Tricia; Darmond, Corinne; Moisan, Marie-Claude; Henrissat, Bernard; Coutinho, Pedro M.; Lombard, Vincent; Natvig, Donald O.; Lindquist, Erika; Schmutz, Jeremy; Lucas, Susan; Harris, Paul; Powlowski, Justin; Bellemare, Annie; Taylor, David; Butler, Gregory; de Vries, Ronald P.; Allijn, Iris E.; van den Brink, Joost; Ushinsky, Sophia; Storms, Reginald; Powell, Amy J.; Paulsen, Ian T.; Elbourne, Liam D. H.; Baker, Scott. E.; Magnuson, Jon; LaBoissiere, Sylvie; Clutterbuck, A. John; Martinez, Diego; Wogulis, Mark; Lopez de Leon, Alfredo; Rey, Michael W.; Tsang, Adrian

    2011-05-16T23:59:59.000Z

    Thermostable enzymes and thermophilic cell factories may afford economic advantages in the production of many chemicals and biomass-based fuels. Here we describe and compare the genomes of two thermophilic fungi, Myceliophthora thermophila and Thielavia terrestris. To our knowledge, these genomes are the first described for thermophilic eukaryotes and the first complete telomere-to-telomere genomes for filamentous fungi. Genome analyses and experimental data suggest that both thermophiles are capable of hydrolyzing all major polysaccharides found in biomass. Examination of transcriptome data and secreted proteins suggests that the two fungi use shared approaches in the hydrolysis of cellulose and xylan but distinct mechanisms in pectin degradation. Characterization of the biomass-hydrolyzing activity of recombinant enzymes suggests that these organisms are highly efficient in biomass decomposition at both moderate and high temperatures. Furthermore, we present evidence suggesting that aside from representing a potential reservoir of thermostable enzymes, thermophilic fungi are amenable to manipulation using classical and molecular genetics.

  14. Comparative analysis of environmental impacts of maize-biogas and photovoltaics on a land use basis

    SciTech Connect (OSTI)

    Graebig, Markus; Fenner, Richard [Centre for Sustainable Development, Department of Engineering, University of Cambridge (United Kingdom); Bringezu, Stefan [Wuppertal Institute for Climate, Environment and Energy. P.B. 100480, 42004 Wuppertal (Germany)

    2010-07-15T23:59:59.000Z

    This study aims to stimulate the discussion on how to optimize a sustainable energy mix from an environmental perspective and how to apply existing renewable energy sources in the most efficient way. Ground-mounted photovoltaics (PV) and the maize-biogas-electricity route are compared with regard to their potential to mitigate environmental pressure, assuming that a given agricultural area is available for energy production. Existing life cycle assessment (LCA) studies are taken as a basis to analyse environmental impacts of those technologies in relation to conventional technology for power and heat generation. The life-cycle-wide mitigation potential per area used is calculated for the impact categories non-renewable energy input, green house gas (GHG) emissions, acidification and eutrophication. The environmental performance of each system depends on the scenario that is assumed for end energy use (electricity and heat supply have been contemplated). In all scenarios under consideration, PV turns out to be superior to biogas in almost all studied impact categories. Even when maize is used for electricity production in connection with very efficient heat usage, and reduced PV performance is assumed to account for intermittence, PV can still mitigate about four times the amount of green house gas emissions and non-renewable energy input compared to maize-biogas. Soil erosion, which can be entirely avoided with PV, exceeds soil renewal rates roughly 20-fold on maize fields. Regarding the overall Eco-indicator 99 (H) score under most favourable assumptions for the maize-biogas route, PV has still a more than 100% higher potential to mitigate environmental burden. At present, the key advantages of biogas are its price and its availability without intermittence. In the long run, and with respect to more efficient land use, biogas might preferably be produced from organic waste or manure, whereas PV should be integrated into buildings and infrastructures. (author)

  15. Comparative Wakefield Analysis of a First Prototype of a DDS Structure for CLIC Main Linac

    E-Print Network [OSTI]

    D'Elia, A; Khan, V F; Grudiev, A; Wuensch, W

    2011-01-01T23:59:59.000Z

    A Damped Detuned Structure (DDS) for CLIC main linac has been proposed as an alternative to the present baseline design which is based on heavy damping. A first prototype, CLIC_DDS_A, for high power tests has been already designed and is under construction. It is also foreseen to design a further prototype, CLIC_DDS_B, to test both the wakefield suppression and high power performances. Wakefield calculations for DDS are, in the early design stage, based on single infinitely periodic cells. Though cell-to-cell interaction is taken into account to calculate the wakefields, it is important to study full structure properties using computational tools. In particular this is fundamental for defining the input parameters for the HOM coupler that is crucial for the performances of DDS. In the following a full analysis of wakefields and impedances based on simulations conducted with finite difference based electromagnetic computer code GdfidL will be presented.

  16. Gene co-expression network analysis in Rhodobacter capsulatus and application to comparative expression analysis of Rhodobacter sphaeroides

    SciTech Connect (OSTI)

    Pena-Castillo, Lourdes; Mercer, Ryan; Gurinovich, Anastasia; Callister, Stephen J.; Wright, Aaron T.; Westbye, Alexander; Beatty, J. T.; Lang, Andrew S.

    2014-08-28T23:59:59.000Z

    The genus Rhodobacter contains purple nonsulfur bacteria found mostly in freshwater environments. Representative strains of two Rhodobacter species, R. capsulatus and R. sphaeroides, have had their genomes fully sequenced and both have been the subject of transcriptional profiling studies. Gene co-expression networks can be used to identify modules of genes with similar expression profiles. Functional analysis of gene modules can then associate co-expressed genes with biological pathways, and network statistics can determine the degree of module preservation in related networks. In this paper, we constructed an R. capsulatus gene co-expression network, performed functional analysis of identified gene modules, and investigated preservation of these modules in R. capsulatus proteomics data and in R. sphaeroides transcriptomics data. Results: The analysis identified 40 gene co-expression modules in R. capsulatus. Investigation of the module gene contents and expression profiles revealed patterns that were validated based on previous studies supporting the biological relevance of these modules. We identified two R. capsulatus gene modules preserved in the protein abundance data. We also identified several gene modules preserved between both Rhodobacter species, which indicate that these cellular processes are conserved between the species and are candidates for functional information transfer between species. Many gene modules were non-preserved, providing insight into processes that differentiate the two species. In addition, using Local Network Similarity (LNS), a recently proposed metric for expression divergence, we assessed the expression conservation of between-species pairs of orthologs, and within-species gene-protein expression profiles. Conclusions: Our analyses provide new sources of information for functional annotation in R. capsulatus because uncharacterized genes in modules are now connected with groups of genes that constitute a joint functional annotation. We identified R. capsulatus modules enriched with genes for ribosomal proteins, porphyrin and bacteriochlorophyll anabolism, and biosynthesis of secondary metabolites to be preserved in R. sphaeroides whereas modules related to RcGTA production and signalling showed lack of preservation in R. sphaeroides. In addition, we demonstrated that network statistics may also be applied within-species to identify congruence between mRNA expression and protein abundance data for which simple correlation measurements have previously had mixed results.

  17. Comparisons between measurement and analysis of fluid motion in internal combustion engines

    SciTech Connect (OSTI)

    Witze, P.O. (ed.)

    1981-10-01T23:59:59.000Z

    The Engine Combustion Technology Project was created for the purpose of promoting the development of advanced piston engine concepts by the development of techniques to measure, analyze, and understand the combustion process. The technologies emphasized in the project include laser-based measurement techniques and large-scale computer simulations. Considerable progress has already been achieved by project participants in modeling engine air motion, fuel sprays, and engine combustion phenomena. This milestone report covers one part of that progress, summarizing the current capabilities of multi-dimensional computer codes being developed by the project to predict the behavior of turbulent air motion in an engine environment. Computed results are compared directly with experimental data in six different areas of importance to internal combustion engines: (1) Induction-generated ring-vortex structures; (2) Piston-induced vortex roll-up; (3) Behavior of turbulence during compression; (4) Decay of swirling flow during compression; (5) Decay of swirling flow in a constant volume engine simulator; (6) Exhaust-pipe flow. The computational procedures used include vortex dynamics, rapid distortion theory, and finite difference models employing two-equation and subgrid-scale turbulence models. Although the capability does not yet exist to predict the air motion in an engine from its geometric configuration alone, the results presented show that many flowfield sub-processes can be predicted given well-specified initial and boundary conditions.

  18. Analysis Of Exhaust Emission Of Internal Combustion Engine Using Biodiesel Blend

    E-Print Network [OSTI]

    Suvendu Mohanty; Dr. Om Prakash; Reasearch Scholar

    Abstract-The main purpose of this research is to study the effect of various blends of an environmental friendly alternative fuel such as biodiesel on the performance of diesel engine. In the Present investigation experimental work has been carried out to analyze the performance and exhaust emission characteristics of a single cylinder internal combustion engine fuelled with biodiesel blend at the different load. In this experiment the biodiesel which is use as a waste cooking oil (WCO) biodiesel.To investigation of the emission characteristics of the engine loads, which is supplied from the alternator. The experiment was carried out different load i.e. (NO LOAD, 100W 200W, 500W, 1000W, 1500W, 2000W, 2500W & 3000Watt) at engine speed 1500 rpm/min. A test was applied in which an engine was fuel with diesel and seven different blends of diesel. Biodiesel (B5, B10, B20, B40, B60, B80, B100) made from waste cooking oil and the results were analyzed.The emission of were measured carbon monoxide (CO), hydrocarbon carbon(HC), Oxides of nitrogen (NOX) and oxygen ().The experimental results will be compared with biodiesel blends and diesel. The biodiesel results of (WCO) in lower emission of hydro carbon (HC) and (CO) and increase emission of (NO2). This study showed that the results of exhaust emission of biodiesel blends were lower than the diesel fuel. Keyword- Biodiesel (WCO), diesel engine, gas analyzer, Exhaust emission. I.

  19. Mixed-waste treatment -- What about the residuals? A comparative analysis of MSO and incineration

    SciTech Connect (OSTI)

    NONE

    1993-06-01T23:59:59.000Z

    This report examines the issues concerning final waste forms, or residuals, that result from the treatment of mixed waste in molten salt oxidation (MSO) and incinerator systems. MSO is a technology with the potential to treat a certain segment of the waste streams at US Department of Energy (DOE) sites. MSO was compared with incineration because incineration is the best demonstrated available technology (BDAT) for the same waste streams. The Grand Junction Projects Office (GJPO) and Oak Ridge National Laboratory (ORNL) prepared this report for the DOE Office of Environmental Restoration (OER). The goals of this study are to objectively evaluate the anticipated residuals from MSO and incineration, examine regulatory issues for these final waste forms, and determine secondary treatment options. This report, developed to address concerns that MSO residuals present unique disposal difficulties, is part of a larger effort to successfully implement MSO as a treatment technology for mixed and hazardous waste. A Peer Review Panel reviewed the MSO technology in November 1991, and the implementation effort is ongoing under the guidance of the MSO Task Force.

  20. Comparative Analysis of Non-thermal Emissions and Study of Electron Transport in a Solar Flare

    E-Print Network [OSTI]

    T. Minoshima; T. Yokoyama; N. Mitani

    2007-10-02T23:59:59.000Z

    We study the non-thermal emissions in a solar flare occurring on 2003 May 29 by using RHESSI hard X-ray (HXR) and Nobeyama microwave observations. This flare shows several typical behaviors of the HXR and microwave emissions: time delay of microwave peaks relative to HXR peaks, loop-top microwave and footpoint HXR sources, and a harder electron energy distribution inferred from the microwave spectrum than from the HXR spectrum. In addition, we found that the time profile of the spectral index of the higher-energy ($\\gsim 100$ keV) HXRs is similar to that of the microwaves, and is delayed from that of the lower-energy ($\\lsim 100$ keV) HXRs. We interpret these observations in terms of an electron transport model called {\\TPP}. We numerically solved the spatially-homogeneous {\\FP} equation to determine electron evolution in energy and pitch-angle space. By comparing the behaviors of the HXR and microwave emissions predicted by the model with the observations, we discuss the pitch-angle distribution of the electrons injected into the flare site. We found that the observed spectral variations can qualitatively be explained if the injected electrons have a pitch-angle distribution concentrated perpendicular to the magnetic field lines rather than isotropic distribution.

  1. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    SciTech Connect (OSTI)

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D'Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14T23:59:59.000Z

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  2. Comparative analysis of energy data bases for the industrial and commercial sectors

    SciTech Connect (OSTI)

    Roop, J.M.; Belzer, D.B.; Bohn, A.A.

    1986-12-01T23:59:59.000Z

    Energy data bases for the industrial and commercial sectors were analyzed to determine how valuable this data might be for policy analysis. The approach is the same for both end-use sectors: first a descrption or overview of relevant data bases identifies the available data; the coverage and methods used to generate the data are then explained; the data are then characterized and examples are provided for the major data sets under consideration. A final step assesses the data bases under consideration and draws conclusions. There are a variety of data bases considered for each of the end-use sectors included in this report. Data bases for the industrial sector include the National Energy Accounts, process-derived data bases such as the Drexel data base and data obtained from industry trade associations. For the commercial sector, three types of data bases are analyzed: the Nonresidential Building Energy Consumption Surveys, Dodge Construction Data and the Building Owners and Manager's Association Experience Exchange Report.

  3. Comparative analysis of discharges into Lake Michigan, Phase I - Southern Lake Michigan.

    SciTech Connect (OSTI)

    Veil, J. A.; Elcock, D.; Gasper, J. R.; Environmental Science Division

    2008-06-30T23:59:59.000Z

    BP Products North America Inc. (BP) owns and operates a petroleum refinery located on approximately 1,700 acres in Whiting, East Chicago, and Hammond, Indiana, near the southern tip of Lake Michigan. BP provided funding to Purdue University-Calumet Water Institute (Purdue) and Argonne National Laboratory (Argonne) to conduct studies related to wastewater treatment and discharges. Purdue and Argonne are working jointly to identify and characterize technologies that BP could use to meet the previous discharge permit limits for total suspended solids (TSS) and ammonia after refinery modernization. In addition to the technology characterization work, Argonne conducted a separate project task, which is the subject of this report. In Phase I of a two-part study, Argonne estimated the current levels of discharge to southern Lake Michigan from significant point and nonpoint sources in Illinois, Indiana, and portions of Michigan. The study does not consider all of the chemicals that are discharged. Rather, it is narrowly focused on a selected group of pollutants, referred to as the 'target pollutants'. These include: TSS, ammonia, total and hexavalent chromium, mercury, vanadium, and selenium. In Phase II of the study, Argonne will expand the analysis to cover the entire Lake Michigan drainage basin.

  4. Health impact assessment of Roma housing policies in Central and Eastern Europe: A comparative analysis

    SciTech Connect (OSTI)

    Molnar, Agnes, E-mail: molnar.agnes@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary); Adam, Balazs, E-mail: adam.balazs@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary); Antova, Temenujka, E-mail: t.antova@ncphp.government.bg [National Center of Public Health Protection, 15, Ivan Ev. Geshov blvd, 1431 Sofia (Bulgaria); Bosak, Lubos, E-mail: bosak@centrum.sk [Department of Public Health, Faculty of Health Care and Social Work, Trnava University, 1 Univerzitne namestie, 917 00 Trnava (Slovakia); Dimitrov, Plamen, E-mail: p.dimitrov@ncphp.government.bg [National Center of Public Health Protection, 15, Ivan Ev. Geshov blvd, 1431 Sofia (Bulgaria); Mileva, Hristina, E-mail: hmileva@yahoo.com [Ministry of Health, 5 Sveta Nedelya Square, 1000 Sofia (Bulgaria); Pekarcikova, Jarmila, E-mail: jkorcova@truni.sk [Department of Public Health, Faculty of Health Care and Social Work, Trnava University, 1 Univerzitne namestie, 917 00 Trnava (Slovakia); Zurlyte, Ingrida, E-mail: ingrida@post.omnitel.net [State Environmental Health Center, Kalvariju str. 153, 08221 Vilnius (Lithuania); Gulis, Gabriel, E-mail: GGulis@health.sdu.dk [Unit for Health Promotion Research, University of Southern Denmark, Niels Bohrs Vej 9, 6700 Esbjerg (Denmark); Adany, Roza, E-mail: adany.roza@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary); Kosa, Karolina, E-mail: karolina.kosa@sph.unideb.hu [Faculty of Public Health, Medical and Health Science Centre, University of Debrecen, PO Box 2, H-4012 Debrecen (Hungary)

    2012-02-15T23:59:59.000Z

    Marginalised Roma communities in European countries live in substandard housing conditions the improvement of which has been one of the major issues of the Decade of Roma Inclusion, the ongoing intergovernmental European Roma programme. The paper presents EU-funded health impact assessments of national Roma housing policies and programmes in 3 Central and Eastern European countries in light of the evaluation of a completed local project in a fourth CEE country so as to compare predicted effects to observed ones. Housing was predicted to have beneficial health effects by improving indoor and outdoor conditions, access to services, and socioeconomic conditions. Negative impacts were predicted only in terms of maintenance expenses and housing tenure. However, observed impacts of the completed local project did not fully support predictions especially in terms of social networks, satisfaction with housing and neighbourhood, and inhabitant safety. In order to improve the predictive value of HIA, more evidence should be produced by the careful evaluation of locally implemented housing projects. In addition, current evidence is in favour of planning Roma housing projects at the local rather than at the national level in alignment with the principle of subsidiarity. - Highlights: Black-Right-Pointing-Pointer Predictive validity of HIA of national Roma housing policies - in light of current evidence - is low. Black-Right-Pointing-Pointer Implemented housing projects should be comprehensively evaluated to improve reliability of HIA. Black-Right-Pointing-Pointer Roma housing projects should be planned at the local rather than at the national level. Black-Right-Pointing-Pointer HIA should be used to plan Roma housing projects at the local level.

  5. Genetic analysis of inflorescence and plant height components in sorghum (Panicoidae) and comparative genetics with rice (Oryzoidae)

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Zhang, Dong [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab. and Inst. of Bioinformatics; Kong, Wenqian [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab. and Dept. of Crop and Soil Sciences; Robertson, Jon [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Goff, Valorie H [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Epps, Ethan [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Kerr, Alexandra [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Mills, Gabriel [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Cromwell, Jay [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Lugin, Yelena [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Phillips, Christine [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab.; Paterson, Andrew H [Univ. of Georgia, Athens, GA (United States). Plant Genome Mapping Lab., Inst. of Bioinformatics, Dept. of Crop and Soil Sciences, Dept. of Plant Biology, Dept. of Genetics

    2015-12-01T23:59:59.000Z

    Domestication has played an important role in shaping characteristics of the inflorescence and plant height in cultivated cereals. Taking advantage of meta-analysis of QTLs, phylogenetic analyses in 502 diverse sorghum accessions, GWAS in a sorghum association panel (n = 354) and comparative data, we provide insight into the genetic basis of the domestication traits in sorghum and rice. We performed genome-wide association studies (GWAS) on 6 traits related to inflorescence morphology and 6 traits related to plant height in sorghum, comparing the genomic regions implicated in these traits by GWAS and QTL mapping, respectively. In a search for signatures of selection, we identify genomic regions that may contribute to sorghum domestication regarding plant height, flowering time and pericarp color. Comparative studies across taxa show functionally conserved hotspots in sorghum and rice for awn presence and pericarp color that do not appear to reflect corresponding single genes but may indicate co-regulated clusters of genes. We also reveal homoeologous regions retaining similar functions for plant height and flowering time since genome duplication an estimated 70 million years ago or more in a common ancestor of cereals. In most such homoeologous QTL pairs, only one QTL interval exhibits strong selection signals in modern sorghum. Intersections among QTL, GWAS and comparative data advance knowledge of genetic determinants of inflorescence and plant height components in sorghum, and add new dimensions to comparisons between sorghum and rice.

  6. Behavioral Response to Hydrogen Fuel Cell Vehicles and Refueling: A Comparative Analysis of Short- and Long-Term Exposure

    E-Print Network [OSTI]

    Martin, Elliot; Shaheen, Susan; Lipman, Timothy; Lidicker, Jeffery

    2008-01-01T23:59:59.000Z

    combustion engine transit bus demonstration and hydrogenHydrogen FCVs have some important differences from gasoline internal combustion engine (

  7. A Cost Benefit Analysis of a V2G-Capable Electric School Bus Compared to a Traditional Diesel School Bus

    E-Print Network [OSTI]

    Firestone, Jeremy

    A Cost Benefit Analysis of a V2G-Capable Electric School Bus Compared to a Traditional Diesel analysis of a V2G-capable electric school bus compared to a traditional diesel school bus. Applied Energy 19716 Abstract Fuel expenses, diesel exhaust health externalities, and climate change are concerns

  8. International Workshop on Gamma Spectrometry Analysis Codes for U and Pu Isotopics: Workshop Results and Next Steps

    SciTech Connect (OSTI)

    McGinnis, Brent R [ORNL; Solodov, Alexander A [ORNL; Shipwash, Jacqueline L [ORNL; Zhernosek, Alena V [ORNL; McKinney, Teressa L [ORNL; Pickett, Chris A [ORNL; Peerani, Paolo [ORNL

    2009-01-01T23:59:59.000Z

    In November 2008, the Institute of Nuclear Materials Management (INMM) and the European Safeguards Research and Development Association (ESARDA) co-hosted the International Workshop on Gamma Spectrometry Analysis Codes for U and Pu Isotopics at the Oak Ridge National Laboratory (ORNL). This workshop was conducted in response to needs expressed by the international safeguards community to understand better the capabilities and limitations of the codes; to ensure these codes are sustained; and to ensure updates or revisions are performed in a controlled manner. The workshop was attended by approximately 100 participants. The participants included code developers, code suppliers, safeguards specialists, domestic and international inspectors, process operators, regulators, and programme sponsors from various government agencies. The workshop provided a unique opportunity for code developers, commercial distributors and end users to interact in a hands-on laboratory environment to develop solutions for programmatic and technical issues associated with the various codes. The workshop also provided an international forum for discussing development of an internationally accepted standard test method. This paper discusses the organization of the workshop, its goals and objectives and feedback received from the participants. The paper also describes the significance of the working group's contribution to improving codes that are commonly used during inspections to verify that nuclear facilities are compliant with treaty obligations that ensure nuclear fuel cycle facilities are used for peaceful purposes.

  9. International dispute settlement system design : analysis of the World Trade Organization

    E-Print Network [OSTI]

    Martinez, Janet Kathryn Griffin, 1951-

    2004-01-01T23:59:59.000Z

    The dispute settlement process established by the World Trade Organization (WTO) in 1994, (the "DSU"), has drawn widespread attention. While the DSU is the most used international dispute settlement process, it is geared ...

  10. Analysis of Bitcoin as a peer-to-peer network for international payments

    E-Print Network [OSTI]

    Bhme, Sascha

    2014-01-01T23:59:59.000Z

    The payment system is due for an overhaul. The antiquated infrastructure that runs the funds transfer network belongs to the pre-Internet era. As a result, international payments are expensive, slow, cumbersome, and not ...

  11. Climate of Change: A Foreign Policy Analysis of China's Participation in International Environmental Agreements

    E-Print Network [OSTI]

    Hodgson, Andrew

    2011-04-25T23:59:59.000Z

    In 2007 China became the world's largest emitter of carbon dioxide. China's increased emissions have more than offset all reductions made under the 1997 Kyoto Protocol. This makes China's participation in international environmental agreements...

  12. An analysis of Sovereign Wealth Funds and international real estate investments

    E-Print Network [OSTI]

    Sharma, Pulkit

    2010-01-01T23:59:59.000Z

    In recent times Sovereign Wealth Funds (SWFs) have become an important source of international real estate investments. A number of reports predict the swelling of SWF combined assets from its current figure of $3-4 trillion ...

  13. Energy use in Poland, 1970--1991: Sectoral analysis and international comparison

    SciTech Connect (OSTI)

    Meyers, S.; Schipper, L.; Salay, J.

    1993-07-01T23:59:59.000Z

    This report provides an analysis of how and why energy use has changed in Poland since the 1970s, with particular emphasis on changes since the country began its transition from a centrally planned to a market economy in 1989. The most important factors behind the large decline in Polish energy use in 1990 were a sharp fall in industrial output and a huge drop in residential coal use driven by higher prices. The structural shift away from heavy industry was slight. Key factors that worked to increase energy use were the rise in energy intensity in many heavy industries and the shift toward more energy intensive modes of transport. The growth in private activities in 1991 was nearly sufficient to balance out continued decline in industrial energy use in that year. We compared energy use in Poland and the factors that shape it with similar elements in the West. We made a number of modifications to the Polish energy data to bring it closer to a Western energy accounting framework, and augmented these with a variety of estimates in order to construct a sufficiently detailed portrait of Polish energy use to allow comparison with Western data. Per capita energy use in Poland was not much below W. European levels despite Poland`s much lower GDP per capita. Poland has comparatively high energy intensities in manufacturing and residential space heating, and a large share of heavy industries in manufacturing output, all factors that contribute to higher energy use per capita. The structure of passenger and freight transportation and the energy intensity of automobiles contribute to lower energy use per capita in Poland than in Western Europe, but the patterns in Poland are moving closer to those that prevail in the West.

  14. Comparative Performance Analysis of IADR Operating in Natural Gas-Fired and Waste-Heat CHP Modes

    SciTech Connect (OSTI)

    Petrov, Andrei Y [ORNL; Sand, James R [ORNL; Zaltash, Abdolreza [ORNL

    2006-01-01T23:59:59.000Z

    Fuel utilization can be dramatically improved through effective recycle of 'waste' heat produced as a by-product of on-site or near-site power generation technologies. Development of modular compact cooling, heating, and power (CHP) systems for end-use applications in commercial and institutional buildings is a key part of the Department of Energy's (DOE) energy policy. To effectively use the thermal energy from a wide variety of sources which is normally discarded to the ambient, many components such as heat exchangers, boilers, absorption chillers, and desiccant dehumidification systems must be further developed. Recently a compact, cost-effective, and energy-efficient integrated active-desiccant vapor-compression hybrid rooftop (IADR) unit has been introduced in the market. It combines the advantages of an advanced direct-expansion cooling system with the dehumidification capability of an active desiccant wheel. The aim of this study is to compare the efficiency of the IADR operation in baseline mode, when desiccant wheel regeneration is driven by a natural gas burner, and in CHP mode, when the waste heat recovered from microturbine exhaust gas is used for desiccant regeneration. Comparative analysis shows an excellent potential for more efficient use of the desiccant dehumidification as part of a CHP system and the importance of proper sizing of the CHP components. The most crucial factor in exploiting the efficiency of this application is the maximum use of thermal energy recovered for heating of regeneration air.

  15. Comparative Analysis of a Transition Region Bright Point with a Blinker and Coronal Bright Point Using Multiple EIS Emission Lines

    E-Print Network [OSTI]

    Orange, N Brice; Chesny, David L; Patel, Maulik; Hesterly, Katie; Preuss, Lauren; Neira, Chantale; Turner, Niescja E

    2015-01-01T23:59:59.000Z

    Since their discovery twenty year ago, transition region bright points (TRBPs) have never been observed spectroscopically. Bright point properties have not been compared with similar transition region and coronal structures. In this work we have investigated three transient quiet Sun brightenings including a TRBP, a coronal BP (CBP) and a blinker. We use time-series observations of the extreme ultraviolet emission lines of a wide range of temperature T (log T = 5.3 - 6.4) from the EUV imaging spectrometer (EIS) onboard the Hinode satellite. We present the EIS temperature maps and Doppler maps, which are compared with magnetograms from the Michelson Doppler Imager (MDI) onboard the SOHO satellite. Doppler velocities of the TR BP and blinker are <,25 km s$^{-1}$, which is typical of transient TR phenomena. The Dopper velocities of the CBP were found to be < 20 km s^{-1} with exception of those measured at log T = 6.2 where a distinct bi-directional jet is observed. From an EM loci analysis we find evidenc...

  16. Environmental Conservation: page 1 of 9 C Foundation for Environmental Conservation 2013 doi:10.1017/S0376892913000015 Rethinking property rights: comparative analysis of conservation

    E-Print Network [OSTI]

    Rissman, Adena

    Environmental Conservation: page 1 of 9 C Foundation for Environmental Conservation 2013 doi:10 INTRODUCTION Property is central to environmental conservation (Naughton- Treves&Sanderson1995.1017/S0376892913000015 Rethinking property rights: comparative analysis of conservation easements

  17. Evaluation of potential severe accidents during low power and shutdown operations at Surry, Unit 1: Analysis of core damage frequency from internal events during mid-loop operations. Appendix E (Sections E.9-E.16), Volume 2, Part 3B

    SciTech Connect (OSTI)

    Chu, T.L.; Musicki, Z.; Kohut, P.; Yang, J.; Bozoki, G.; Hsu, C.J.; Diamond, D.J.; Wong, S.M. [Brookhaven National Lab., Upton, NY (United States); Bley, D.; Johnson, D. [PLG Inc., Newport Beach, CA (United States)] [and others

    1994-06-01T23:59:59.000Z

    Traditionally, probabilistic risk assessments (PRA) of severe accidents in nuclear power plants have considered initiating events potentially occurring only during full power operation. Some previous screening analyses that were performed for other modes of operation suggested that risks during those modes were small relative to full power operation. However, more recent studies and operational experience have implied that accidents during low power and shutdown could be significant contributors to risk. Two plants, Surry (pressurized water reactor) and Grand Gulf (boiling water reactor), were selected as the plants to be studied. The objectives of the program are to assess the risks of severe accidents initiated during plant operational states other than full power operation and to compare the estimated core damage frequencies, important accident sequences and other qualitative and quantitative results with those accidents initiated during full power operation as assessed in NUREG-1150. The scope of the program includes that of a level-3 PRA. In phase 2, mid-loop operation was selected as the plant configuration to be analyzed based on the results of the phase 1 study. The objective of the phase 2 study is to perform a detailed analysis of the potential accident scenarios that may occur during mid-loop operation, and compare the results with those of NUREG-1150. The scope of the level-1 study includes plant damage state analysis, and uncertainty analysis. Volume 1 summarizes the results of the study. Internal events analysis is documented in Volume 2. It also contains an appendix that documents the part of the phase 1 study that has to do with POSs other than mid-loop operation. Internal fire and internal flood analyses are documented in Volumes 3 and 4. A separate study on seismic analysis, documented in Volume 5, was performed for the NRC by Future Resources Associates, Inc. Volume 6 documents the accident progression, source terms, and consequence analysis.

  18. Evaluation of potential severe accidents during low power and shutdown operations at Surry, Unit-1: Analysis of core damage frequency from internal events during mid-loop operations. Appendices F-H, Volume 2, Part 4

    SciTech Connect (OSTI)

    Chu, T.L.; Musicki, Z.; Kohut, P.; Yang, J.; Bozoki, G.; Hsu, C.J.; Diamond, D.J. [Brookhaven National Lab., Upton, NY (United States); Bley, D.; Johnson, D. [PLG Inc., Newport Beach, CA (United States); Holmes, B. [AEA Technology, Dorset (United Kingdom)] [and others

    1994-06-01T23:59:59.000Z

    Traditionally, probabilistic risk assessments (PRA) of severe accidents in nuclear power plants have considered initiating events potentially occurring only during full power operation. Some previous screening analyses that were performed for other modes of operation suggested that risks during those modes were small relative to full power operation. However, more recent studies and operational experience have implied that accidents during low power and shutdown could be significant contributors to risk. Two plants, Surry (pressurized water reactor) and Grand Gulf (boiling water reactor), were selected as the plants to be studied. The objectives of the program are to assess the risks of severe accidents initiated during plant operational states other than full power operation and to compare the estimated core damage frequencies, important accident sequences and other qualitative and quantitative results with those accidents initiated during full power operation as assessed in NUREG-1150. The scope of the program includes that of a level-3 PRA. In phase 2, mid-loop operation was selected as the plant configuration to be analyzed based on the results of the phase 1 study. The objective of the phase 2 study is to perform a detailed analysis of the potential accident scenarios that may occur during mid-loop operation, and compare the results with those of NUREG-1150. The scope of the level-1 study includes plant damage state analysis, and uncertainty analysis. Volume 1 summarizes the results of the study. Internal events analysis is documented in Volume 2. It also contains an appendix that documents the part of the phase 1 study that has to do with POSs other than mid-loop operation. Internal fire and internal flood analyses are documented in Volumes 3 and 4. A separate study on seismic analysis, documented in Volume 5, was performed for the NRC by Future Resources Associates, Inc. Volume 6 documents the accident progression, source terms, and consequence analysis.

  19. Cooling towers among ivory towers : a comparative analysis of research universities, electricity consumption, and greenhouse gas emissions

    E-Print Network [OSTI]

    Keegan, Brian C. (Brian Christopher)

    2006-01-01T23:59:59.000Z

    The rationale for university sustainability and existing international agreements on sustainability in higher education are reviewed in the context of developing a model to determine the linkages between three environmental ...

  20. Discussion of "Analysis of a Large Database of GCL Internal Shear

    E-Print Network [OSTI]

    Zornberg, Jorge G.

    .edu The authors have presented an extensive and valuable study on the internal shear strength of geosynthetic clay liners GCLs . The discusser has also performed extensive tests of these materials and can comment for quality geosynthetic shear testing. Some of the test data in the authors' database are also found

  1. Imaging Hydrated Microbial Extracellular Polymers: Comparative...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hydrated Microbial Extracellular Polymers: Comparative Analysis by Electron Microscopy . Imaging Hydrated Microbial Extracellular Polymers: Comparative Analysis by Electron...

  2. INTERNATIONAL International Internship for

    E-Print Network [OSTI]

    Napier, Terrence

    OFFICE OF INTERNATIONAL AFFAIRS International Internship for Global Leadership Program Student Portugal ­ Laura Sieger Ukraine ­ Mary Brune 2012 Internship Locations #12;Dear Friends and Colleagues of Lehigh University: The International Internship for Global Leadership Program provides Lehigh students

  3. Updated mortality analysis of radiation workers at Rocketdyne (Atomics International), 1948-2008

    SciTech Connect (OSTI)

    Boice, John [Vanderbilt University; Cohen, Sarah [IEI; Mumma, Michael [IEI; Ellis, Elizabeth D [ORNL; Eckerman, Keith F [ORNL; Leggett, Richard Wayne [ORNL; Boecker, Bruce [LRRI; Brill, Bertrand [Vanderbilt University; Henderson, Brian [University of Southern California, Los Angeles

    2011-01-01T23:59:59.000Z

    Updated analyses of mortality data are presented on 5,801 radiation workers, including 2,232 monitored for radionuclide intakes, and 41,169 non-radiation workers employed 1948-1999 at Rocketdyne (Atomics International). The worker population is unique in that lifetime occupational doses from all places of employment were sought and incorporated into the analyses. Further, radiation doses from intakes of 14 different radionuclides were calculated for 16 organs or tissues using biokinetic models of the International Commission on Radiation Protection (ICRP). The mean dose from external radiation was 13.5 mSv (maximum 1 Sv), and the mean lung dose from external and internal radiation combined was 19.0 mSv (maximum 3.6 Sv). An additional nine years of follow-up, from December 31,1999 through 2008, increased the person-years of observation by 21.7% to 196,674 (mean 33.9 years) and the number of cancer deaths by 50% to 684. Analyses included comparisons with the general population and the computation of standardized mortality ratios (SMRs), and internal comparisons using proportional hazards models. All cancers taken together (SMR 0.88; 95% CI 0.81-0.95), lung cancer (SMR 0.87; 95% CI 0.76-1.00) and leukemia other than chronic lymphocytic leukemia (CLL) (SMR 1.04; 95% 0.67-1.53) were not significantly elevated. Cox regression analyses revealed no significant dose-response trends for any cancer. For all cancers excluding leukemia, the relative risk (RR) at 100 mSv was estimated as 0.98 (95% CI 0.82-1.17) and for all leukemia other than CLL it was 1.06 (95% CI 0.50-2.23). Uranium was the primary radionuclide contributing to internal exposures, but significant increases in lung and kidney disease were not seen. The extended follow-up re-enforces the findings in the previous study in failing to observe a detectable increase in cancer deaths associated with radiation, but strong conclusions still cannot be drawn because of small numbers and relatively low career doses. Larger combined studies of early workers in the United States following similar methodologies are warranted to refine and clarify radiation risks following protracted exposures.

  4. Numerical Analysis of the Internal Kinematics and Dynamics of Three-dimensional Breaking Waves on B. Biausser, S.T. Grilli, P. Frauni

    E-Print Network [OSTI]

    Grilli, Stéphan T.

    Numerical Analysis of the Internal Kinematics and Dynamics of Three-dimensional Breaking Waves/Navier-Stokes solver. Analysis of wave profiles and kinematics (velocity, vorticity, pressure) are carried out. Keyword the breaking and post-breaking in a three- dimensional numerical wave tank of a solitary wave over a sloping

  5. International Interdisciplinary Research Collaboration and Geospatial Analysis as an Integrative Tool

    E-Print Network [OSTI]

    Tool Melinda Laituri, Colorado State University This talk will focus on the role of interdisciplinary new methods and tools for analysis. Geospatial technologies provide useful tools for furthering

  6. A comparative analysis of the attitudes of present male students toward selected environmental factors of Texas A&M University

    E-Print Network [OSTI]

    Blum, Maryann Baird

    1965-01-01T23:59:59.000Z

    for the Statement The Grading System Defined in the Catalog and Used by Most Professors Is Fair 13. Comparative Percentages for the Statement The Recent Ruling Which Makes Corps Membership Optional' Will Improve ABdi 14. Comparative Percentages...

  7. Evaluation of potential severe accidents during low power and shutdown operations at Grand Gulf, Unit 1. Volume 2, Part 1C: Analysis of core damage frequency from internal events for plant operational State 5 during a refueling outage, Main report (Sections 11--14)

    SciTech Connect (OSTI)

    Whitehead, D. [Sandia National Labs., Albuquerque, NM (United States); Darby, J. [Science and Engineering Associates, Inc., Albuquerque, NM (United States); Yakle, J. [Science Applications International Corp., Albuquerque, NM (United States)] [and others

    1994-06-01T23:59:59.000Z

    This document contains the accident sequence analysis of internally initiated events for Grand Gulf, Unit 1 as it operates in the Low Power and Shutdown Plant Operational State 5 during a refueling outage. The report documents the methodology used during the analysis, describes the results from the application of the methodology, and compares the results with the results from two full power analyses performed on Grand Gulf.

  8. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    Wind Power Capital Cost Assumptions (Base-Case Analysis).27. Wind Power Capital Cost Assumptions (Base-Case Analysis)wind cost assumptions employed in most of the RPS analyses

  9. Analysis of International Policies In The Solar Electricity Sector: Lessons for India

    E-Print Network [OSTI]

    Deshmukh, Ranjit

    2011-01-01T23:59:59.000Z

    biomass, compared to solar power to meet their objectives ofmake it diffi cult for solar power to compete in the marketswhich would enable solar power to penetrate a large part of

  10. Wavelet Analysis of Cycle-to-Cycle Pressure Variations in an Internal Combustion Engine

    E-Print Network [OSTI]

    Asok K. Sen; Grzegorz Litak; Rodolfo Taccani; Robert Radu

    2006-07-19T23:59:59.000Z

    Using a continuous wavelet transform we have analyzed the cycle-to-cycle variations of pressure in an internal combustion engine. The time series of maximum pressure variations are examined for different loading and their wavelet power spectrum is calculated for each load. From the wavelet power spectrum we detected the presence of long, intermediate and short-term periodicities in the pressure signal. It is found that depending on the load, the long and intermediate-term periodicities may span several cycles, whereas the short-period oscillations tend to appear intermittently. Knowledge of these periodicities may be useful to develop effective control strategies for efficient combustion.

  11. Issues in International Energy Consumption Analysis: Electricity Usage in Indias Housing Sector

    Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122 40 Buildingto17 3400, U.S.MajorMarketsNov-14 Dec-14Has|Issues in International

  12. Is it Worth it? A Comparative Analysis of Cost-Benefit Projections for State Renewables Portfolio Standards

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2006-01-01T23:59:59.000Z

    wind costs; the uncertainties involved with predicting these two inputs highlight the importance of performing scenario analysis.

  13. Updated Mortality Analysis of Radiation Workers at Rocketdyne (Atomics International), 1948-2008

    SciTech Connect (OSTI)

    Boice Jr JD, Colen SS, Mumma MT, Ellis ED, Eckerman DF, Leggett RW, Boecker BB, Brill B, Henderson BE

    2011-08-01T23:59:59.000Z

    Updated analyses of mortality data are presented on 46,970 workers employed 1948-1999 at Rocketdyne (Atomics International). Overall, 5,801 workers were involved in radiation activities, including 2,232 who were monitored for intakes of radionuclides, and 41,169 workers were engaged in rocket testing or other non-radiation activities. The worker population is unique in that lifetime occupational doses from all places of employment were sought, updated and incorporated into the analyses. Further, radiation doses from intakes of 14 different radionuclides were calculated for 16 organs or tissues using biokinetic models of the International Commission on Radiation Protection (ICRP). Because only negligible exposures were received by the 247 workers monitored for radiation activities after 1999, the mean dose from external radiation remained essentially the same at 13.5 mSv (maximum 1 Sv) as reported previously, as did the mean lung dose from external and internal radiation combined at 19.0 mSv (maximum 3.6 Sv). An additional 9 years of follow-up, from December 31,1999 through 2008, increased the person-years of observation for the radiation workers by 21.7% to 196,674 (mean 33.9 years) and the number of cancer deaths by 50% to 684. Analyses included external comparisons with the general population and the computation of standardized mortality ratios (SMRs) and internal comparisons using proportional hazards models and the computation of relative risks (RRs). A low SMR for all causes of death (SMR 0.82; 95% CI 0.78-0.85) continued to indicate that the Rocketdyne radiation workers were healthier than the general population and were less likely to die. The SMRs for all cancers taken together (SMR 0.88; 95% CI 0.81-0.95), lung cancer (SMR 0.87; 95% CI 0.76-1.00) and leukemia other than chronic lymphocytic leukemia (CLL) (SMR 1.04; 95% 0.67-1.53) were not significantly elevated. Cox regression analyses revealed no significant dose-response trends for any cancer. For all cancers excluding leukemia, the RR at 100 mSv was estimated as 0.98 (95% CI 0.82-1.17), and for all leukemia other than CLL it was 1.06 (95% CI 0.50-2.23). Uranium was the primary radionuclide contributing to internal exposures, but no significant increases in lung and kidney disease were seen. The extended follow-up reinforces the findings in the previous study in failing to observe a detectable increase in cancer deaths associated with radiation, but strong conclusions still cannot be drawn because of small numbers and relatively low career doses. Larger combined studies of early workers in the United States using similar methodologies are warranted to refine and clarify radiation risks after protracted exposures.

  14. Weighing the Costs and Benefits of Renewables Portfolio Standards: A Comparative Analysis of State-Level Policy Impact Projections

    E-Print Network [OSTI]

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-01T23:59:59.000Z

    detailed wholesale electricity price projections as a modelelectricity bills, and renewable energy certificate (REC) prices. Developing a consistent set of metrics for comparing cost projections

  15. Analysis of Variability and Uncertainty in Wind Power Forecasting: An International Comparison (Presentation)

    SciTech Connect (OSTI)

    Zhang, J.; Hodge, B.; Miettinen, J.; Holttinen, H.; Gomez-Lozaro, E.; Cutululis, N.; Litong-Palima, M.; Sorensen, P.; Lovholm, A.; Berge, E.; Dobschinski, J.

    2013-10-01T23:59:59.000Z

    This presentation summarizes the work to investigate the uncertainty in wind forecasting at different times of year and compare wind forecast errors in different power systems using large-scale wind power prediction data from six countries: the United States, Finland, Spain, Denmark, Norway, and Germany.

  16. International Conference on Machine Control & Guidance 2008 1 Kinematic Surface Analysis by Terrestrial Laser Scanning

    E-Print Network [OSTI]

    by Terrestrial Laser Scanning Hans-Martin ZOGG*, David GRIMM* ETH Zurich, Switzerland Abstract This paper presents terrestrial laser scanning with emphasis on kinematic surface analysis. Besides an overview of terrestrial laser scanning in general, the 2D-laser scanner SICK LMS200-30106 is introduced as well

  17. International ELECTRIMACS Congress, Montral, august 2002. Analysis and Experimental Validation of Various

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Validation of Various Photovoltaic System Models O. GERGAUD, B. MULTON, H. BEN AHMED LESiR - Brittany Branch. Index Terms -- Photovoltaic power system, modeling, power and energy analysis. I. INTRODUCTION The work to distinguish energy transfers and fast enough to enable optimizing the sizing and/or handling of the system

  18. ECONOMICS WITHIN SOCIAL STUDIES: A COMPARATIVE ANALYSIS OF STUDENT PERFORMANCE ON THE 2012 KANSAS HISTORY-GOVERNMENT ASSESSMENT

    E-Print Network [OSTI]

    Deplazes, Svetlana

    2014-05-31T23:59:59.000Z

    research questions in order to: (1) determine the level of student knowledge of assessed economic indicators and concepts; (2) investigate how student demographics relate to economic understanding; (3) compare test results in economics with those in other...

  19. Internal hydraulic analysis of impeller rounding in centrifugal pumps as turbines

    SciTech Connect (OSTI)

    Singh, Punit; Nestmann, Franz [Institute of Water and River Basin Management (IWG), Karlsruhe Institute of Technology, Kaiser Str. 12, D 76131 Karlsruhe (Germany)

    2011-01-15T23:59:59.000Z

    The use of pumps as turbines in different applications has been gaining importance in the recent years, but the subject of hydraulic optimization still remains an open research problem. One of these optimization techniques that include rounding of the sharp edges at the impeller periphery (or turbine inlet) has shown tendencies of performance enhancement. In order to understand the effect of this hydraulic optimization, the paper introduces an analytical model in the pump as turbine control volume and brings out the functionalities of the internal variables classified under control variables consisting of the system loss coefficient and exit relative flow direction and under dependent variables consisting of net tangential flow velocity, net head and efficiency. The paper studies the effects of impeller rounding on a combination of radial flow and mixed flow pumps as turbines using experimental data. The impeller rounding is seen to have positive impact on the overall efficiency in different operating regions with an improvement in the range of 1-3%. The behaviour of the two control variables have been elaborately studied in which it is found that the system loss coefficient has reduced drastically due to rounding effects, while the extent of changes to the exit relative flow direction seems to be limited in comparison. The reasons for changes to these control variables have been physically interpreted and attributed to the behaviour of the wake zone at the turbine inlet and circulation within the impeller control volume. The larger picture of impeller rounding has been discussed in comparison with performance prediction models in pumps as turbines. The possible limitations of the analytical model as well as the test setup are also presented. The paper concludes that the impeller rounding technique is very important for performance optimization and recommends its application on all pump as turbine projects. It also recommends the standardization of the rounding effects over wide range of pump shapes including axial pumps. (author)

  20. HEATING6 analysis of international thermal benchmark problem sets 1 and 2

    SciTech Connect (OSTI)

    Childs, K.W.; Bryan, C.B.

    1986-10-01T23:59:59.000Z

    In order to assess the heat transfer computer codes used in the analysis of nuclear fuel shipping casks, the Nuclear Energy Agency Committee on Reactor Physics has defined seven problems for benchmarking thermal codes. All seven of these problems have been solved using the HEATING6 heat transfer code. This report presents the results of five of the problems. The remaining two problems were used in a previous benchmarking of thermal codes used in the United States, and their solutions have been previously published.

  1. Paper No. 2003-JSC-340 Biausser 1 Numerical analysis of the internal kinematics and dynamics of three-dimensional breaking waves on

    E-Print Network [OSTI]

    Grilli, Stéphan T.

    Paper No. 2003-JSC-340 Biausser 1 Numerical analysis of the internal kinematics and dynamics of three-dimensional breaking waves on slopes B. Biausser(1),(3) , S.T. Grilli (2) , R. Marcer (3) , P- dimensional numerical wave tank of a solitary wave over a sloping ridge. The numerical model is based

  2. International Journal of Robotics & Automation, Vol. 10, No. 4, 1995, pp. 159166 Kinematic Analysis of a Hybrid SerialandParallelDriven

    E-Print Network [OSTI]

    Cheng, Harry H.

    interest in the design of hybrid serial­and­parallel­driven robot manipulators which can provide goodInternational Journal of Robotics & Automation, Vol. 10, No. 4, 1995, pp. 159­166 Kinematic presents kinematic analysis of the prototype UPSarm which is designed for studying the feasibility

  3. Technical Letter Report: Evaluation and Analysis of a Few International Periodic Safety Review Summary Reports

    SciTech Connect (OSTI)

    Chopra, Omesh K. [Argonne National Lab., IL (United States). Environmental Science Division; Diercks, Dwight R. [Argonne National Lab., IL (United States). Nuclear Engineering Division; Ma, David Chia-Chiun [Argonne National Lab., IL (United States). Environmental Science Division; Garud, Yogendra S. [Argonne National Lab., IL (United States). Environmental Science Division

    2013-12-17T23:59:59.000Z

    At the request of the United States (U.S.) government, the International Atomic Energy Agency (IAEA) assembled a team of 20 senior safety experts to review the regulatory framework for the safety of operating nuclear power plants in the United States. This review focused on the effectiveness of the regulatory functions implemented by the NRC and on its commitment to nuclear safety and continuous improvement. One suggestion resulting from that review was that the U.S. Nuclear Regulatory Commission (NRC) incorporate lessons learned from periodic safety reviews (PSRs) performed in other countries as an input to the NRCs assessment processes. In the U.S., commercial nuclear power plants (NPPs) are granted an initial 40-year operating license, which may be renewed for additional 20-year periods, subject to complying with regulatory requirements. The NRC has established a framework through its inspection, and operational experience processes to ensure the safe operation of licensed nuclear facilities on an ongoing basis. In contrast, most other countries do not impose a specific time limit on the operating licenses for NPPs, they instead require that the utility operating the plant perform PSRs, typically at approximately 10-year intervals, to assure continued safe operation until the next assessment. The staff contracted with Argonne National Laboratory (Argonne) to perform a pilot review of selected translated PSR assessment reports and related documentation from foreign nuclear regulatory authorities to identify any potential new regulatory insights regarding license renewal-related topics and NPP operating experience (OpE). A total of 14 PSR assessment documents from 9 countries were reviewed. For all of the countries except France, individual reports were provided for each of the plants reviewed. In the case of France, three reports were provided that reviewed the performance assessment of thirty-four 900-MWe reactors of similar design commissioned between 1978 and 1988. All of the reports reviewed were the regulators assessment of the PSR findings rather than the original PSR report, and all but one were English translations from the original language. In these reviews, it was found that most of the countries base their regulatory guidance to some extent (and often to a large extent) on U.S. design codes and standards, NRC regulatory guidance, and U.S. industry guidance. In addition, many of the observed operational technical issues and OpE events reported for U.S. reactors are also cited in the PSR reports. The PSR reports also identified a number of potential technical material/component performance issues and OpE events that are not commonly reported for U.S. plants.

  4. A comparative molecular analysis of water-filled limestone sinkholes in north-eastern Mexicoemi_2324 226..240

    E-Print Network [OSTI]

    Science and Engineering, Colorado School of Mines, Golden, CO 80401, USA. 2 Department of geological. Summary Sistema Zacatn in north-eastern Mexico is host to several deep, water-filled, anoxic, karstic (Huber et al., 2007) and soil (Roesch et al., 2007) samples. Comparative methods that exploit the large

  5. Analysis of International Commodity Shipping Data and the Shipment of NORM to the United States

    SciTech Connect (OSTI)

    Baciak, James E.; Ely, James H.; Schweppe, John E.; Sandness, Gerald A.; Robinson, Sean M.

    2011-10-01T23:59:59.000Z

    As part of the Spreader Bar Radiation Detector project, PNNL analyzed US import data shipped through US ports collected over the 12 months of 2006 (over 4.5 million containers). Using these data, we extracted a variety of distributions that are of interest to modelers and developers of active and passive detection systems used to 'scan' IMCCs for potential contraband. This report expands on some of the analysis presented in an earlier report from LLNL, by investigation the foreign port distribution of commodities shipped to the US. The majority of containers shipped to the United States are 40 ft containers ({approx}70%); about 25% are 20 ft; and about 3.6% are 45 ft containers. A small fraction (<1%) of containers are of other more specialized sizes, and very few ports actually ship these unique size containers (a full distribution for all foreign ports is shown in Appendix A below). The primary foreign ports that ship the largest fraction of each container are shown in the table below. Given that 45 ft containers comprise 1 of out every 27 containers shipped to the US, and given the foreign ports from which they are shipped, they should not be ignored in screening; further testing and analysis of radiation measurements for national security with this size container is warranted. While a large amount of NORM is shipped in IMCCs, only a few specific commodities are shipped with enough frequency to present potential issues in screening IMCCs at ports. The majority of containers with NORM will contain fertilizers (5,700 containers), granite (59,000 containers), or ceramic (225,000 containers) materials. Fertilizers were generally shipping in either 20- or 40 ft containers with equal frequency. While granite is mostly shipped in 20 ft containers, ceramic materials can be shipped in either 20- or 40 ft containers. The size of container depended on the specific use of the ceramic or porcelain material. General construction ceramics (such as floor and roofing tiles) tend to be shipped in 20 ft containers. Consumer products made from ceramic materials (e.g., tableware, sinks, and toilets) are generally shipped in 40 ft containers. This distinct discrepancy is due in large part to the packaging of the commodity. Consumer products are generally shipped packed in a box loaded with Styrofoam or other packing material to protect the product from breakage. Construction ceramic materials are generally shipped in less packing material, many times consisting of only a cardboard or wooden box. Granite is almost always shipped in a 20 ft container, given its very high density.

  6. Analysis of International Policies In The Solar Electricity Sector: Lessons for India

    SciTech Connect (OSTI)

    Deshmukh, Ranjit; Bharvirkar, Ranjit; Gambhir, Ashwin; Phadke, Amol

    2011-08-10T23:59:59.000Z

    Although solar costs are dropping rapidly, solar power is still more expensive than conventional and other renewable energy options. The solar sector still needs continuing government policy support. These policies are driven by objectives that go beyond the goal of achieving grid parity. The need to achieve multiple objectives and ensure sufficient political support for solar power makes it diffi cult for policy makers to design the optimal solar power policy. The dynamic and uncertain nature of the solar industry, combined with the constraints offered by broader economic, political and social conditions further complicates the task of policy making. This report presents an analysis of solar promotion policies in seven countries - Germany, Spain, the United States, Japan, China, Taiwan, and India - in terms of their outlook, objectives, policy mechanisms and outcomes. The report presents key insights, primarily in qualitative terms, and recommendations for two distinct audiences. The first audience consists of global policy makers who are exploring various mechanisms to increase the penetration of solar power in markets to mitigate climate change. The second audience consists of key Indian policy makers who are developing a long-term implementation plan under the Jawaharlal Nehru National Solar Mission and various state initiatives.

  7. Determination for the 2006 International Energy Conservation Code, Residential Buildings Technical Support Document

    SciTech Connect (OSTI)

    Lucas, Robert G.

    2009-09-26T23:59:59.000Z

    Provides a technical analysis showing that the 2006 International Energy Conservation Code contains improvements in energy efficiency compared to its predecessor, the 2003 International Energy Conservation Code. DOE is required by law to issue "determinations" of whether or not new editions of the IECC improve energy efficiency.

  8. International Policy International Development

    E-Print Network [OSTI]

    Watson, Andrew

    Research Strategy 2006-2009 International Policy Energy Adaptation International Development Coasts Change Research. Our strategy builds upon our previous work on integrated assessment, energy, adaptation of time. In this spirit, the Centre reconfirms its vision statement: "The Tyndall Centre is the UK network

  9. Effects of internal gain assumptions in building energy calculations

    SciTech Connect (OSTI)

    Christensen, C.; Perkins, R.

    1981-01-01T23:59:59.000Z

    The utilization of direct solar gains in buildings can be affected by operating profiles, such as schedules for internal gains, thermostat controls, and ventilation rates. Building energy analysis methods use various assumptions about these profiles. The effects of typical internal gain assumptions in energy calculations are described. Heating and cooling loads from simulations using the DOE 2.1 computer code are compared for various internal-gain inputs: typical hourly profiles, constant average profiles, and zero gain profiles. Prototype single-family-detached and multi-family-attached residential units are studied with various levels of insulation and infiltration. Small detached commercial buildings and attached zones in large commercial buildings are studied with various levels of internal gains. The results of this study indicate that calculations of annual heating and cooling loads are sensitive to internal gains, but in most cases are relatively insensitive to hourly variations in internal gains.

  10. Electric industry restructuring and environmental issues: A comparative analysis of the experience in California, New York, and Wisconsin

    SciTech Connect (OSTI)

    Fang, J.M.; Galen, P.S.

    1996-08-01T23:59:59.000Z

    Since the California Public Utilities Commission (CPUC) issued its April 20, 1994, Blue Book proposal to restructure the regulation of electric utilities in California to allow more competition, over 40 states have initiated similar activities. The question of how major public policy objectives such as environmental protection, energy efficiency, renewable energy, and assistance to low-income customers can be sustained in the new competitive environment is also an important element being considered. Because many other states will undergo restructuring in the future, the experience of the {open_quotes}early adopter{close_quotes} states in addressing public policy objectives in their electric service industry restructuring processes can provide useful information to other states. The Competitive Resource Strategies Program of the U.S. Department of Energy`s (DOE`s) Office of Utility Technologies, is interested in documenting and disseminating the experience of the pioneering states. The Center for Energy Analysis and Applications of the National Renewable Energy Laboratory assisted the Office of Utility Technologies in this effort with a project on the treatment of environmental issues in electric industry restructuring.

  11. Weighing the Costs and Benefits of Renewables Portfolio Standards:A Comparative Analysis of State-Level Policy Impact Projections

    SciTech Connect (OSTI)

    Chen, Cliff; Wiser, Ryan; Bolinger, Mark

    2007-01-16T23:59:59.000Z

    State renewables portfolio standards (RPS) have emerged as one of the most important policy drivers of renewable energy capacity expansion in the U.S. Collectively, these policies now apply to roughly 40% of U.S. electricity load, and may have substantial impacts on electricity markets, ratepayers, and local economies. As RPS policies have been proposed or adopted in an increasing number of states, a growing number of studies have attempted to quantify the potential impacts of these policies, focusing primarily on projecting cost impacts, but sometimes also estimating macroeconomic and environmental effects. This report synthesizes and analyzes the results and methodologies of 28 distinct state or utility-level RPS cost impact analyses completed since 1998. Together, these studies model proposed or adopted RPS policies in 18 different states. We highlight the key findings of these studies on the costs and benefits of RPS policies, examine the sensitivity of projected costs to model assumptions, assess the attributes of different modeling approaches, and suggest possible areas of improvement for future RPS analysis.

  12. Evaluation of potential severe accidents during low power and shutdown operations at Surry, Unit-1: Analysis of core damage frequency from internal events during mid-loop operations. Appendix I, Volume 2, Part 5

    SciTech Connect (OSTI)

    Chu, T.L.; Musicki, Z.; Kohut, P.; Yang, J.; Bozoki, G.; Hsu, C.J.; Diamond, D.J. [Brookhaven National Lab., Upton, NY (United States); Bley, D.; Johnson, D. [PLG Inc., Newport Beach, CA (United States); Holmes, B. [AEA Technology, Dorset (United Kingdom)] [and others

    1994-06-01T23:59:59.000Z

    Traditionally, probabilistic risk assessments (PRA) of severe accidents in nuclear power plants have considered initiating events potentially occurring only during full power operation. Some previous screening analyses that were performed for other modes of operation suggested that risks during those modes were small relative to full power operation. However, more recent studies and operational experience have implied that accidents during low power and shutdown could be significant contributors to risk. During 1989, the Nuclear Regulatory Commission (NRC) initiated an extensive program to carefully examine the potential risks during low power and shutdown operations. The program includes two parallel projects being performed by Brookhaven National Lab. (BNL) and Sandia National Labs. (SNL). Two plants, Surry (pressurized water reactor) and Grand Gulf (boiling water reactor), were selected as the plants to be studied. The objectives of the program are to assess the risks of severe accidents initiated during plant operational states other than full power operation and to compare the estimated core damage frequencies, important accident sequences and other qualitative and quantitative results with those accidents initiated during full power operation as assessed in NUREG-1150. The objective of this volume of the report is to document the approach utilized in the level-1 internal events PRA for the Surry plant, and discuss the results obtained. A phased approach was used in the level-1 program. In phase 1, which was completed in Fall 1991, a coarse screening analysis examining accidents initiated by internal events (including internal fire and flood) was performed for all plant operational states (POSs). The objective of the phase 1 study was to identify potential vulnerable plant configurations, to characterize (on a high, medium, or low basis) the potential core damage accident scenarios, and to provide a foundation for a detailed phase 2 analysis.

  13. Test Comparability

    E-Print Network [OSTI]

    Keller, Christine; Shulenburger, David E.

    2010-01-01T23:59:59.000Z

    KU ScholarWorks | http://kuscholarworks.ku.edu Test Comparability 2010 by Christine Keller and David Shulenburger This work has been made available by the University of Kansas Libraries Office of Scholarly Communication and Copyright. Please... and Shulenburger, David. Test comparability, with Christine Keller in the Letters section of Change, September/October 2010, p. 6. Published version: http://www.changemag.org/Archives/Back%20 Issues/September-October%202010/letters-to-editor.html Terms of Use...

  14. A Comparative SWOT Analysis of the National Agricultural Extension Program Organization to Determine Best-Fit Program Model: A Case Study of the North West and South West Regions of Cameroon.

    E-Print Network [OSTI]

    Nyambi, Gwendoline

    2012-07-16T23:59:59.000Z

    A COMPARATIVE SWOT ANALYSIS OF THE NATIONAL AGRICULTURAL EXTENSION PROGRAM ORGANIZATION TO DETERMINE BEST-FIT PROGRAM MODEL: A CASE STUDY OF THE NORTH WEST AND SOUTH WEST REGIONS OF CAMEROON A Dissertation by GWENDOLINE NA-AH NYAMBI... A Comparative SWOT Analysis of the National Agricultural Extension Program Organization to Determine Best-Fit Program Model: A Case Study of the North West and South West Regions of Cameroon Copyright 2012 Gwendoline Na-ah Nyambi A COMPARATIVE...

  15. Comparative analysis of Nigerian international oil marketing model (NIOMM) and the models of four selected OPEC members; and a proposed new model for Nigeria

    SciTech Connect (OSTI)

    Udeke, O.O.

    1986-01-01T23:59:59.000Z

    This study demonstrates that NIOMM has deficiencies and, as a result, has affected the progress of Nigeria's political and socio-economic development. One finding is that Nigeria is beset with ineffective planning, lack of marketing expertise, and inadequate marketing strategies. Other findings show that: (1) the Nigerian oil industry (HOI) is suffering from mismanagement stemming from corruption, tribalism, Federal Character Policy, and lack of dedication and patriotism by the Nigerian workers; (2) there is inefficiency in the Nigerian national petroleum corporation (NNPC) but, at the same time, the inefficiency is partly because of the government policies, conflicts, interference by high government officials and politicians, and the enormous size of the oil industry; (3) oil revenues are improperly utilized; (4) neither the multinational oil corporations (MNOCs) nor multinational corporations (MNCs) are assisting the oil producing nations (OPNs) or developing countries (DCs) in their economic development, and MNOCs and MNCs are interested in profit maximization; and (5) MNCs do not transfer the type of technology that meets the needs of DCs, and sometimes the technology creates problems for DCs which ultimately results into conflicts between MNCs and DCs. The inverse of these problems has been a sine qua non for success in the IOMMs of the four OPEC member, especially in Saudi Arabia.

  16. Educational Poverty in a Comparative Perspective

    E-Print Network [OSTI]

    Moeller, Ralf

    Educational Poverty in a Comparative Perspective: Theoretical and Empirical Implications SFB 882 Ferger Educational Poverty in a Comparative Perspective: Theoretical and Empirical Implications SFB 882 and Education: An International Comparison of Educational Poverty" This project studies the determinants

  17. Experimental Analysis of the Single-Phase Heat Transfer and Friction Factor inside the Horizontal Internally Micro-Fin Tube

    E-Print Network [OSTI]

    Ghajar, Afshin J.

    ; micro-fin tube I. INTRODUCTION Single-phase liquid flow in internally enhanced tubes is becoming more of tube is widely used in high flow rate applications because the heat transfer enhancement in high flow that the secondary flow inside the tube with longitudinal fins was insignificant in the laminar flow and the thermal

  18. Abstract--With increasing international trade of secondary materials it is imperative to start including it in our analysis of

    E-Print Network [OSTI]

    Gutowski, Timothy

    Abstract-- With increasing international trade of secondary materials it is imperative to start, exhibiting an increase in waste recovery and recycling rates. However, the key underlying factor driving trade, taking recycling overseas, where there exists not only a greater demand for secondary materials

  19. Quantitative analysis of silicate certified reference materials by LA-ICPMS with and without an internal standard

    E-Print Network [OSTI]

    Long, Bernard

    August 2008 DOI: 10.1039/b801807n Quantitative analysis of silicate minerals by laser ablation Quantitative analysis of silicates by laser ablation inductively- coupled plasma mass spectrometry (LA

  20. Multi-scale comparative spectral analysis of satellite total solar irradiance measurements from 2003 to 2013 reveals a planetary modulation of solar activity and its non-linear dependence on the 11-year solar cycle

    E-Print Network [OSTI]

    Nicola Scafetta; Richard C. Willson

    2013-11-26T23:59:59.000Z

    Herein we adopt a multi-scale dynamical spectral analysis technique to compare and study the dynamical evolution of the harmonic components of the overlapping ACRIMSAT/ACRIM3, SOHO/VIRGO and SORCE/TIM total solar irradiance (TSI) records during 2003.15 to 2013.16 in solar cycles 23 and 24. The three TSI time series present highly correlated patterns. Significant power spectral peaks are common to these records and are observed at the following periods: 0.070 year, 0.097 year, 0.20 year, 0.25 year, 0.30-0.34 year, 0.39 year. Less certain spectral peaks occur at about 0.55 year, 0.60-0.65 year and 0.7-0.9 year. Four main frequency periods at 24.8 days (0.068 year), 27.3 days (0.075 year), at 34-35 days (0.093-0.096 year) and 36-38 days (0.099-0.104 year) characterize the solar rotation cycle. The amplitude of these oscillations, in particular of those with periods larger than 0.5 year, appears to be modulated by the 11-year solar cycle. Similar harmonics have been found in other solar indices. The observed periodicities are found highly coherent with the spring, orbital and synodic periods of Mercury, Venus, Earth and Jupiter. We conclude that solar activity is likely modulated by planetary gravitational and electromagnetic forces acting on the sun. The strength of the sun's response to planetary forcing depends non-linearly on the state of internal solar dynamics: planetary-sun coupling effects are enhanced during solar activity maxima and attenuated during minima.

  1. Policy Analysis Comparative Analysis of the

    E-Print Network [OSTI]

    Jaramillo, Paulina

    sector (2). As a response to concerns over petroleum consumption, interest in alternative transportation, Tepper School of Business, and Department of Engineering and Public Policy, Carnegie Mellon University its energy security, and at the same time significantly reducing its GHG emissions, neither CTL nor

  2. Comparative life-cycle energy payback analysis of multi-junction a-SiGe and nanocrystalline/a-Si modules

    SciTech Connect (OSTI)

    Fthenakis, V.; Kim, H.

    2010-07-15T23:59:59.000Z

    Despite the publicity of nanotechnologies in high tech industries including the photovoltaic sector, their life-cycle energy use and related environmental impacts are understood only to a limited degree as their production is mostly immature. We investigated the life-cycle energy implications of amorphous silicon (a-Si) PV designs using a nanocrystalline silicon (nc-Si) bottom layer in the context of a comparative, prospective life-cycle analysis framework. Three R and D options using nc-Si bottom layer were evaluated and compared to the current triple-junction a-Si design, i.e., a-Si/a-SiGe/a-SiGe. The life-cycle energy demand to deposit nc-Si was estimated from parametric analyses of film thickness, deposition rate, precursor gas usage, and power for generating gas plasma. We found that extended deposition time and increased gas usages associated to the relatively high thickness of nc-Si lead to a larger primary energy demand for the nc-Si bottom layer designs, than the current triple-junction a-Si. Assuming an 8% conversion efficiency, the energy payback time of those R and D designs will be 0.7-0.9 years, close to that of currently commercial triple-junction a-Si design, 0.8 years. Future scenario analyses show that if nc-Si film is deposited at a higher rate (i.e., 2-3 nm/s), and at the same time the conversion efficiency reaches 10%, the energy-payback time could drop by 30%.

  3. A Novel Approach to Internal Medicine Education for Emergency Medicine Residents

    E-Print Network [OSTI]

    Gemme, S R; Cohn, J; Smith, J

    2014-01-01T23:59:59.000Z

    to discuss internal medicine topics. At the completion ofprogram on an internal medicine topic of interest. A six-compared to an internal medicine floor. The overall quality

  4. Comparative Analysis of Natural Convection Flows Simulated by both the Conservation and Incompressible Forms of the Navier-Stokes Equations in a Differentially-Heated Square Cavity

    SciTech Connect (OSTI)

    Richard C. Martineau; Ray A. Berry; Aurlia Esteve; Kurt D. Hamman; Dana A. Knoll; Ryosuke Park; William Taitano

    2009-01-01T23:59:59.000Z

    This report illustrates a comparative study to analyze the physical differences between numerical simulations obtained with both the conservation and incompressible forms of the Navier-Stokes equations for natural convection flows in simple geometries. The purpose of this study is to quantify how the incompressible flow assumption (which is based upon constant density advection, divergence-free flow, and the Boussinesq gravitational body force approximation) differs from the conservation form (which only assumes that the fluid is a continuum) when solving flows driven by gravity acting upon density variations resulting from local temperature gradients. Driving this study is the common use of the incompressible flow assumption in fluid flow simulations for nuclear power applications in natural convection flows subjected to a high heat flux (large temperature differences). A series of simulations were conducted on two-dimensional, differentially-heated rectangular geometries and modeled with both hydrodynamic formulations. From these simulations, the selected characterization parameters of maximum Nusselt number, average Nusselt number, and normalized pressure reduction were calculated. Comparisons of these parameters were made with available benchmark solutions for air with the ideal gas assumption at both low and high heat fluxes. Additionally, we generated body force, velocity, and divergence of velocity distributions to provide a basis for further analysis. The simulations and analysis were then extended to include helium at the Very High Temperature gas-cooled Reactor (VHTR) normal operating conditions. Our results show that the consequences of incorporating the incompressible flow assumption in high heat flux situations may lead to unrepresentative results. The results question the use of the incompressible flow assumption for simulating fluid flow in an operating nuclear reactor, where large temperature variations are present. The results show that the use of the incompressible flow assumption with the Boussinesq gravitational body force approximation should be restricted to flows where the density change of a fluid particle along a pathline is negligible.

  5. International Conference on Machine Control & Guidance, June 24-26, 2008 Kinematic Surface Analysis by Terrestrial Laser Scanning

    E-Print Network [OSTI]

    Giger, Christine

    Analysis by Terrestrial Laser Scanning Hans-Martin Zogg* David Grimm* ETH Zurich, Switzerland [zogg, grimm]@geod.baug.ethz.ch Abstract This paper presents terrestrial laser scanning with emphasis on kinematic surface analysis. Besides an overview of terrestrial laser scanning in general, the 2D-laser scanner SICK LMS200

  6. Amnesty International

    ScienceCinema (OSTI)

    None

    2011-04-25T23:59:59.000Z

    Martin Ennals est secrtaire gnral d'Amnesty International et fait un discours sur les droits de l'homme

  7. International Energy Agency

    Broader source: Energy.gov [DOE]

    DOE's market transformation efforts have reached to European and other countries who are part of the international distributed and decentralized energy community. Through its partnership with DOE, the combined heat and power (CHP) program of the International Energy Agency (IEA) conducts research and analysis of CHP markets and deployment efforts around the world and has used lessons learned from U.S. research, development, and deployment efforts to recommend market transformation activities and policies that will lead to new CHP installations worldwide.

  8. ENGINEERING INTERNATIONAL

    E-Print Network [OSTI]

    University of Technology, Sydney

    COURSE GUIDE 2013 UTS: ENGINEERING INTERNATIONAL UNDERGRADUATE w w w.eng.uts.edu.au #12;2 / ENGINEERING IN AUSTRALIA Internationally, Australian universities have a reputation for high quality research developed close links with many international institutions, particularly in Asia. ENGINEERING IN SYDNEY

  9. Internal Turing Machines

    E-Print Network [OSTI]

    Ken Loo

    2004-07-28T23:59:59.000Z

    Using nonstandard analysis, we will extend the classical Turing machines into the internal Turing machines. The internal Turing machines have the capability to work with infinite ($*$-finite) number of bits while keeping the finite combinatoric structures of the classical Turing machines. We will show the following. The internal deterministic Turing machines can do in $*$-polynomial time what a classical deterministic Turing machine can do in an arbitrary finite amount of time. Given an element of $\\in HALT$ (more precisely, the $*$-embedding of $HALT$), there is an internal deterministic Turing machine which will take $$ as input and halt in the $"yes"$ state. The language ${}^*Halt$ can not be decided by the internal deterministic Turing machines. The internal deterministic Turing machines can be viewed as the asymptotic behavior of finite precision approximation to real number computations. It is possible to use the internal probabilistic Turing machines to simulate finite state quantum mechanics with infinite precision. This simulation suggests that no information can be transmitted instantaneously and at the same time, the Turing machine model can simulate instantaneous collapse of the wave function. The internal deterministic Turing machines are powerful, but if $P \

  10. Subclavian Vein Versus Arm Vein for Totally Implantable Central Venous Port for Patients with Head and Neck Cancer: A Retrospective Comparative Analysis

    SciTech Connect (OSTI)

    Akahane, Akio, E-mail: a.akahane@gmail.com; Sone, Miyuki; Ehara, Shigeru; Kato, Kenichi; Tanaka, Ryoichi; Nakasato, Tatsuhiko [Iwate Medical University School of Medicine, Department of Radiology (Japan)

    2011-12-15T23:59:59.000Z

    Purpose: This study was designed to compare central venous ports (CVP) from two different routes of venous access-the subclavian vein and arm vein-in terms of safety for patients with head and neck cancer (HNC). Methods: Patients with HNC who underwent image-guided implantations of CVPs were retrospectively evaluated. All CVPs were implanted under local anesthesia. Primary outcome measurements were rates and types of adverse events (AEs). Secondary outcomes included technical success and rate and reason of CVP removal. Results: A total of 162 patients (subclavian port group, 47; arm port group, 115) were included in this study. Technical success was achieved in all patients. The median follow-up period was 94 (range, 1-891) days. Two patients in the subclavian port group experienced periprocedural complications. Postprocedural AEs were observed in 8.5 and 22.6% of the subclavian port and arm port group patients, respectively (P = 0.044). Phlebitis and system occlusions were observed only in the arm port group. The rate of infection was not significantly different between the two groups. The CVP was removed in 34 and 39.1% of the subclavian port and arm port patients, respectively. Conclusions: Both subclavian and arm CVPs are feasible in patients with HNC. AEs were more frequent in the arm port group; thus, the arm port is not recommended as the first choice for patients with HNC. However, further experience is needed to improve the placement technique and the maintenance of CVPs and a prospective analysis is warranted.

  11. Comparative DNA microarray analysis of human monocyte derived dendritic cells and MUTZ-3 cells exposed to the moderate skin sensitizer cinnamaldehyde

    SciTech Connect (OSTI)

    Python, Francois [Experimental Product Safety, Procter and Gamble Co., Cosmital SA, Marly (Switzerland); Goebel, Carsten [Product Safety, Human Safety Assessment, Procter and Gamble Service GmbH, Darmstadt (Germany); Aeby, Pierre [Experimental Product Safety, Procter and Gamble Co., Cosmital SA, Marly (Switzerland)], E-mail: pierre_aeby@bluewin.ch

    2009-09-15T23:59:59.000Z

    The number of studies involved in the development of in vitro skin sensitization tests has increased since the adoption of the EU 7th amendment to the cosmetics directive proposing to ban animal testing for cosmetic ingredients by 2013. Several studies have recently demonstrated that sensitizers induce a relevant up-regulation of activation markers such as CD86, CD54, IL-8 or IL-1{beta} in human myeloid cell lines (e.g., U937, MUTZ-3, THP-1) or in human peripheral blood monocyte-derived dendritic cells (PBMDCs). The present study aimed at the identification of new dendritic cell activation markers in order to further improve the in vitro evaluation of the sensitizing potential of chemicals. We have compared the gene expression profiles of PBMDCs and the human cell line MUTZ-3 after a 24-h exposure to the moderate sensitizer cinnamaldehyde. A list of 80 genes modulated in both cell types was obtained and a set of candidate marker genes was selected for further analysis. Cells were exposed to selected sensitizers and non-sensitizers for 24 h and gene expression was analyzed by quantitative real-time reverse transcriptase-polymerase chain reaction. Results indicated that PIR, TRIM16 and two Nrf2-regulated genes, CES1 and NQO1, are modulated by most sensitizers. Up-regulation of these genes could also be observed in our recently published DC-activation test with U937 cells. Due to their role in DC activation, these new genes may help to further refine the in vitro approaches for the screening of the sensitizing properties of a chemical.

  12. Internal reforming solid oxide fuel cell-gas turbine combined cycles (IRSOFC-GT): Part A -- Cell model and cycle thermodynamic analysis

    SciTech Connect (OSTI)

    Massardo, A.F.; Lubelli, F.

    2000-01-01T23:59:59.000Z

    The aim of this work is to investigate the performance of internal reforming solid oxide fuel cell (IRSOFC) and gas turbine (GT) combined cycles. To study complex systems involving IRSOFC a mathematical model has been developed that simulates the fuel cell steady-state operation. The model, tested with a data available in literature, has been used for a complete IRSOFC parametric analysis taking into account the influence of cell operative pressure, cell and stream temperatures, fuel oxidant flow rates and composition, etc. The analysis of IRSOFC-GT combined cycles has been carried out by using the Thermo Economic Modular Program TEMP.The code has been modified to allow IRSOFC, external reformer and flue gas condenser performance to be taken into account. Using as test case the IRSOFC-GT combined plant proposed by Harvey and Richter (1994) the capability of the modified TEMP code has been demonstrated. The thermodynamic analysis of a number of IRSOFC-GT combined cycles is presented and discussed, taking into account the influence of several technological constraints. The results are presented for both atmospheric and pressurized IRSOFC.

  13. A Comparative Analysis of Residential Energy Use for 2009 IECC Code Compliance and 2001 IECC Compliance with 2006 NAECA Appliance Standards for Selected Climate Zones in Texas

    E-Print Network [OSTI]

    Mukhopadhyay, J.; Baltazar, J. C.; Liu, Z.; Haberl, J.; Culp, C.; Yazdani, B.

    2010-01-01T23:59:59.000Z

    single-family residential construction. The analysis uses a DOE-2 simulation for five locations in Texas (Houston, Brownsville, Dallas/Fort Worth, El Paso and Amarillo). The analysis shows that a code compliant house built to the specifications...

  14. Analysis of operational, institutional and international limitations for alternative fuel vehicles and technologies: Means/methods for implementing changes

    SciTech Connect (OSTI)

    Not Available

    1992-07-01T23:59:59.000Z

    This project focused upon the development of an approach to assist public fleet managers in evaluating the characteristics and availability of alternative fuels (AF`s) and alternative fuel vehicles (AFV`s) that will serve as possible replacements for vehicles currently serving the needs of various public entities. Also of concern were the institutional/international limitations for alternative fuels and alternative fuel vehicles. The City of Detroit and other public agencies in the Detroit area were the particular focus for the activities. As the development and initial stages of use of alternative fuels and alternative fuel vehicles proceeds, there will be an increasing need to provide information and guidance to decision-makers regarding differences in requirements and features of these fuels and vehicles. There wig be true differences in requirements for servicing, managing, and regulating. There will also be misunderstanding and misperception. There have been volumes of data collected on AFV`S, and as technology is improved, new data is constantly added. There are not, however, condensed and effective sources of information for public vehicle fleet managers on vehicle and equipment sources, characteristics, performance, costs, and environmental benefits. While theoretical modeling of public fleet requirements has been done, there do not seem to be readily available ``practical``. There is a need to provide the best possible information and means to minimize the problems for introducing the effective use of alternative fuels and alternative fuel vehicles.

  15. "Renewable Energy Transition and International Climate Cooperation

    E-Print Network [OSTI]

    Sheridan, Jennifer

    "Renewable Energy Transition and International Climate Cooperation: The German Experience" Jürgen and sustainability science; complex systems analysis, mathematical modeling and computer simulation; technology assessment, arms control and international security. For more information: eucenter

  16. INTERNATIONAL AGREEMENTS

    Office of Environmental Management (EM)

    generators, reactor pressure vessel and internals, cables, piping, pumps, valves) - optimization of nuclear power plant generation capacity (digital I&C upgrades, advanced...

  17. Internal Technical Report, 1981 Annual Report, An Analysis of the Response of the Raft River Geothermal Site Monitor Wells

    SciTech Connect (OSTI)

    Thurow, T.L.; Large, R.M.; Allman, D.W.; Tullis, J.A.; Skiba, P.A.

    1982-04-01T23:59:59.000Z

    A groundwater monitoring program has been established on the Raft River Geothermal Site since 1978. The objective of this program is to document possible impacts that may be caused by geothermal production and injection on the shallow aquifers used for culinary and irrigation purposes. This annual progress report summarizes data from 12 monitor wells during 1981. These data are compared with long-term trends and are correlated with seasonal patterns, irrigation water use and geothermal production and testing. These results provide a basis for predicting long-term impacts of sustained geothermal production and testing. To date, there has been no effect on the water quality of the shallow aquifers.

  18. Developing an approach utilizing local deterministic analysis to predict the cycle friction of the piston ring-pack in internal combustion engines

    E-Print Network [OSTI]

    Liu, Yang, S.M. Massachusetts Institute of Technology

    2013-01-01T23:59:59.000Z

    Nowadays, a rapid growth of internal combustion (IC) engines is considered to be a major contributor to energy crisis. About 20% of the mechanical loss in internal combustion engines directly goes to the friction loss ...

  19. International Electricity Trade - Open Access | Department of...

    Broader source: Energy.gov (indexed) [DOE]

    DOE has consistently expressed its policy that international electricity trade should be subject to the same principles of comparable open access and non-discrimination that apply...

  20. Second United Nations International Conference

    Office of Scientific and Technical Information (OSTI)

    Second United Nations International Conference on the Peaceful Uses of Atomic Energy ON THE ANALYSIS O F BUBBLE CHAMBER TRACKS Q Hugh Bradner and F r a n k Solmitz INTRODUCTION A j...

  1. A comparative analysis of drilling results obtained with oil mud vs. water-base mud at High Island block A-270

    SciTech Connect (OSTI)

    Nance, W.B.; Garrett, M.M.; Gault, A.D.; Kortlang, W.F.; Muncy, D.D.

    1983-02-01T23:59:59.000Z

    Three wells on the High Island A-270B platform were drilled with water base muds and three were drilled with inverted emulsion oil muds. The drilling performance of these two mud types was compared for the six wells. Overall drilling costs were significantly lower with the oil muds due to the elimination of differential pressure pipe and casing sticking.

  2. Evaluation of potential severe accidents during low power and shutdown operations at Surry, Unit 1: Analysis of core damage frequency from internal floods during mid-loop operations. Volume 4

    SciTech Connect (OSTI)

    Kohut, P. [Brookhaven National Lab., Upton, NY (United States)

    1994-07-01T23:59:59.000Z

    The major objective of the Surry internal flood analysis was to provide an improved understanding of the core damage scenarios arising from internal flood-related events. The mean core damage frequency of the Surry plant due to internal flood events during mid-loop operations is 4.8E-06 per year, and the 5th and 95th percentiles are 2.2E-07 and 1.8E-05 per year, respectively. Some limited sensitivity calculations were performed on three plant improvement options. The most significant result involves modifications of intake-level structure on the canal, which reduced core damage frequency contribution from floods in mid-loop by about 75%.

  3. International Programs and Services International Programs

    E-Print Network [OSTI]

    Stephens, Graeme L.

    International Programs and Services _______________ 1.5 Page 1 International Programs and Services OFFICE OF INTERNATIONAL PROGRAMS Offices in Laurel Hall (970) 491-5917 www.international.colostate.edu James A. Cooney, Vice Provost for International Affairs The Office of International Programs acts

  4. International Programs and Services International Programs

    E-Print Network [OSTI]

    Collett Jr., Jeffrey L.

    International Programs and Services International Programs and Services OFFICE OF INTERNATIONAL PROGRAMS Offices in Laurel Hall (970) 491-5917 international.colostate.edu James A. Cooney, Vice Provost for International Affairs The Office of International Programs acts as a catalyst for ideas that bring about

  5. International energy strategies

    SciTech Connect (OSTI)

    Dunkerley, J. (ed.)

    1980-01-01T23:59:59.000Z

    The sharp rise in oil prices and the embargo of 1973 to 1974 stimulated a growing interest in international energy questions. One indicator of this interest was the decision in late 1977 to establish an International Association of Energy Economists (IAEE). In 1979 the officers of the IAEE proposed to hold not only an initial annual meeting of the association, but also a two-day Conference on International Energy Issues. Resources for the Future, a Washington-based independent research institute, was asked to cosponsor the two-day conference. These two meetings were held in Washington, DC, on June 4, 5, and 6, 1979. This volume contains the 34 papers of the proceedings, and a separate abstract was prepared for each paper for Energy Abstracts for Policy Analysis (EAPA); 13 papers were selected for Energy Research Abstracts (ERA).

  6. Effects of CCR5-32, CCR2-64I, and SDF-1 3 A Alleles on HIV-1 Disease Progression: An International Meta-Analysis of

    E-Print Network [OSTI]

    Effects of CCR5- 32, CCR2-64I, and SDF-1 3 A Alleles on HIV-1 Disease Progression: An International seroconverters and seroprevalent patients. In contrast, SDF-1 3 A homozygotes showed no decreased risk for AIDS of HIV-1 infection, but SDF-1 3 A homozygosity carried no such protection. Ann Intern Med. 2001

  7. Internal shim

    DOE Patents [OSTI]

    Barth, Clyde H.; Blizinski, Theodore W.

    2003-05-13T23:59:59.000Z

    An internal shim used to accurately measure spaces in conjunction with a standard small probe has a shim top and a chassis. The internal shim is adjustably fixed within the space to be measured using grippers that emerge from the chassis and which are controlled by an arm pivotably attached to the shim top. A standard small probe passes through the shim along guides on the chassis and measures the distance between the exterior of the chassis and the boundary. By summing the measurements on each side of the chassis and the width of the chassis, the dimension of the space can be determined to within 0.001 inches.

  8. International Educational

    E-Print Network [OSTI]

    Yu, Alex

    International Journal of Educational Technology Opportunities and options for Web-enabled databases.D., Arizona State University The landscape of Web-based instruction is changing due to the convergence of the Web and database servers. Web-based database (WBD) servers enhance Web-based instruction by providing

  9. Comparative analysis of the high-order harmonic generation in the laser ablation plasmas prepared on the surfaces of complex and atomic targets

    SciTech Connect (OSTI)

    Ganeev, R. A. [Scientific Association Akadempribor, Academy of Sciences of Uzbekistan, Akademgorodok, Tashkent 100125 (Uzbekistan); Institute for Solid State Physics, University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8581 (Japan); Milosevic, D. B. [Faculty of Science, University of Sarajevo, Zmaja od Bosne 35, 71000 Sarajevo (Bosnia and Herzegowina); Max-Born-Institut, Max-Born-Strasse 2a, 12489 Berlin (Germany)

    2008-07-15T23:59:59.000Z

    We analyzed high-order harmonic generation from the plasma plumes prepared on the surfaces of complex targets. The studies of In-Ag targets showed that the characteristics of the high-order harmonics from the double-target plume were the same as those from the single-target plasmas. For the chromium-tellurium plasma, the enhancements of the 29th and 27th harmonics were obtained, thus indicating the appearance of the enhancement properties from both components of the double-target plasma. These comparative studies also showed higher enhancement of a single harmonic in the case of atomic plasma (Sb) with regard to the molecular one (InSb). The additional component can only decrease the enhancement factor of the medium, due to the change of the oscillator strength and spectral distribution of the transitions involved in the resonance enhancement of the specific harmonic order. The theoretical calculations have shown the enhancement of specific harmonics for the Sb, Te, and Cr plasmas in the double-target configurations.

  10. Comparative Survival Study (CSS) of Hatchery PIT-tagged Spring/Summer Chinook; Migration Years 1997-2000 Mark/Recapture Activities and Bootstrap Analysis, 2002 Annual Report.

    SciTech Connect (OSTI)

    Berggren Thomas J.; Franzoni, Henry; Basham, Larry R. (Columbia Basin Fish and Wildlife Authority, Fish Passage Center, Portland, OR)

    2005-04-01T23:59:59.000Z

    The Comparative Survival Study (CSS) was initiated in 1996 as a multi-year program of the fishery agencies and tribes to estimate survival rates over different life stages for spring and summer chinook (hereafter, chinook) produced in major hatcheries in the Snake River basin and from selected hatcheries in the lower Columbia River. Much of the information evaluated in the CSS is derived from fish tagged with Passive Integrated Transponder (PIT) tags. A comparison of survival rates of chinook marked in two different regions (which differ in the number of dams chinook have to migrate through) provides insight into the effects of the Snake/Columbia hydroelectric system (hydrosystem). The CSS also compares the smolt-to-adult survival rates (SARs) for Snake River chinook that were transported versus those that migrated in-river to below Bonneville Dam. Additional comparisons can be made within in-river experiences as well comparison between the different collector projects from which smolts are transported. CSS also compares these survival rates for wild Snake River spring and summer chinook. These comparisons generate information regarding the relative effects of the current management actions used to recover this listed species. Scientists and managers have recently emphasized the importance of delayed hydrosystem mortality to long-term management decisions. Delayed hydrosystem mortality may be related to the smolts experience in the Federal Columbia River Power System, and could occur for both smolts that migrate in-river and smolts that are transported. The CSS PIT tag information on in-river survival rates and smolt-to-adult survival rates (SARs) of transported and in-river fish are relevant to estimation of ''D'', which partially describes delayed hydrosystem mortality. The parameter D is the differential survival rate of transported fish relative to fish that migrate in-river, as measured from below Bonneville Dam to adults returning to Lower Granite Dam. When D = 1, there is no difference in survival rate after hydrosystem passage. When D < 1, then transported smolts die at a greater rate after release below Bonneville Dam than smolts that have migrated in-river to below Bonneville Dam. While the relative survival rates of transported and in-river migrants are important, the SARs must be also be sufficient to allow the salmon to persist and recover (Mundy et al. 1994). Decreased SARs could result from delayed hydrosystem mortality for either transported or in-river migrants, or both. Major objectives of the CSS include: (1) development of a long-term index of transport SAR to in-river SAR for Snake River hatchery and wild spring and summer chinook smolts measured at Lower Granite Dam; (2) develop a long-term index of survival rates from release of smolts at Snake River hatcheries to return of adults to the hatcheries; (3) compute and compare the overall SARs for selected upriver and downriver spring and summer chinook hatchery and wild stocks; and (4) begin a time series of SARs for use in hypothesis testing and in the regional long-term monitoring and evaluation program. Primary CSS focus in this report is for wild and hatchery spring/summer chinook that outmigrated in 1997 to 2000 and returned in 2003. Another goal of CSS was to help resolve uncertainty concerning marking, handling and bypass effects associated with control fish used in National Marine Fisheries Service's (NMFS) transportation research and evaluation. Significant concern had been raised that the designated control groups, which were collected, marked and released at dams, did not experience the same conditions as the in-river migrants which were not collected and bypassed under existing management, and that the estimated ratios of SARs of transported fish to SARs of control fish may be biased (Mundy et al. 1994). Instead of marking at the dams, as traditionally done for NMFS transportation evaluations, CSS began marking sufficient numbers of fish at the hatcheries and defining in-river groups from the detection histories at the dams (e.g., total

  11. Comparative Genomics Analysis and Phenotypic Characterization of Shewanella putrefaciens W3-18-1: Anaerobic Respiration, Bacterial Microcompartments, and Lateral Flagella

    SciTech Connect (OSTI)

    Qiu, D.; Tu, Q.; He, Zhili; Zhou, Jizhong

    2010-05-17T23:59:59.000Z

    Respiratory versatility and psychrophily are the hallmarks of Shewanella. The ability to utilize a wide range of electron acceptors for respiration is due to the large number of c-type cytochrome genes present in the genome of Shewanella strains. More recently the dissimilatory metal reduction of Shewanella species has been extensively and intensively studied for potential applications in the bioremediation of radioactive wastes of groundwater and subsurface environments. Multiple Shewanella genome sequences are now available in the public databases (Fredrickson et al., 2008). Most of the sequenced Shewanella strains were isolated from marine environments and this genus was believed to be of marine origin (Hau and Gralnick, 2007). However, the well-characterized model strain, S. oneidensis MR-1, was isolated from the freshwater lake sediment of Lake Oneida, New York (Myers and Nealson, 1988) and similar bacteria have also been isolated from other freshwater environments (Venkateswaran et al., 1999). Here we comparatively analyzed the genome sequence and physiological characteristics of S. putrefaciens W3-18-1 and S. oneidensis MR-1, isolated from the marine and freshwater lake sediments, respectively. The anaerobic respirations, carbon source utilization, and cell motility have been experimentally investigated. Large scale horizontal gene transfers have been revealed and the genetic divergence between these two strains was considered to be critical to the bacterial adaptation to specific habitats, freshwater or marine sediments.

  12. airway epithelium compared: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    comparative analysis could be asked to explain why the period of an oscillating ... Weld, Daniel S. 1987-11-01 132 Comparative Smootheology Mathematics Websites Summary: erent...

  13. International Feedstock

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't YourTransport(FactDepartment of EnergyIndustry15Among Statesfor a Smart1.2.1.5 International

  14. International Conference

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn Other NewsSpinInteragency1Princeton PlasmaInternationalA

  15. International H

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn OtherEnergy International Fuel Services and Commercial2

  16. International Sunport

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHigh SchoolIn OtherEnergy International Fuel Services»Challenges

  17. Using wavelet analysis to compare the QCD prediction and experimental data on $R_{e^+e^-}$ and to determine parameters of the charmonium states above the $D\\bar D$ threshold

    E-Print Network [OSTI]

    Henner, V K; Belozerova, T S

    2015-01-01T23:59:59.000Z

    The first part of our analysis uses the wavelet method to compare the Quantum Chromodynamic (QCD) prediction for the ratio of hadronic to muon cross sections in electron-positron collisions, $R$, with experimental data for $R$ over a center of mass energy range up to 7.5 GeV. A direct comparison of the raw experimental data and the QCD prediction is difficult because the data have a wide range of structures and large statistical errors and the QCD description contains sharp quark-antiquark thresholds. However, a meaningful comparison can be made if a type of "smearing" procedure is used to smooth out rapid variations in both the theoretical and experimental values of $R$. A wavelet analysis (WA) can be used to achieve this smearing effect. In the second part of the analysis we concentrate on the 3.0 - 6.0 GeV energy region containing the relatively wide charmonium resonances $\\psi(1^-)$. We use the wavelet methodology to distinguish these resonances from experimental noise, background and from each other, and...

  18. Using wavelet analysis to compare the QCD prediction and experimental data on $R_{e^+e^-}$ and to determine parameters of the charmonium states above the $D\\bar D$ threshold

    E-Print Network [OSTI]

    V. K. Henner; C. L. Davis; T. S. Belozerova

    2015-06-12T23:59:59.000Z

    The first part of our analysis uses the wavelet method to compare the Quantum Chromodynamic (QCD) prediction for the ratio of hadronic to muon cross sections in electron-positron collisions, $R$, with experimental data for $R$ over a center of mass energy range up to 7.5 GeV. A direct comparison of the raw experimental data and the QCD prediction is difficult because the data have a wide range of structures and large statistical errors and the QCD description contains sharp quark-antiquark thresholds. However, a meaningful comparison can be made if a type of "smearing" procedure is used to smooth out rapid variations in both the theoretical and experimental values of $R$. A wavelet analysis (WA) can be used to achieve this smearing effect. In the second part of the analysis we concentrate on the 3.0 - 6.0 GeV energy region containing the relatively wide charmonium resonances $\\psi(1^-)$. We use the wavelet methodology to distinguish these resonances from experimental noise, background and from each other, and are thus able to determine more reliably the parameters of these states. These two analyses are examples of the usefulness of WA in extracting information in a model independent way from high energy physics data.

  19. A Technical, Financial, and Policy Analysis of the RAMSES RFID Inventory Management System for NASA's International Space Station: Prospects for SBIR/STTR Technology Infusion

    E-Print Network [OSTI]

    's International Space Station: Prospects for SBIR/STTR Technology Infusion by Abraham T. Grindle Honors B for SBIR/STTR Technology Infusion by Abraham T. Grindle Honors B.S. Aerospace Engineering Saint Louis that might be unique to SBIR/STTR technologies that are successfully infused into the mainstream NASA

  20. Maerz, N. H., and Palangio, T. C. WipFrag System II -Online fragmentation analysis. FRAGBLAST 6, Sixth International Symposium For Rock Fragmentation By Blasting, Johannesburg, South Africa,

    E-Print Network [OSTI]

    Maerz, Norbert H.

    , Sixth International Symposium For Rock Fragmentation By Blasting, Johannesburg, South Africa, Aug. 8 Professor, Rock Mechanics and Explosives Research Center, University of Missouri-Rolla, MO, USA, (573) 341 . By far the most significant source of error is sampling, whether the source is a result of: 1. Poor

  1. Operating Reserves and Wind Power Integration: An International Comparison; Preprint

    SciTech Connect (OSTI)

    Milligan, M.; Donohoo, P.; Lew, D.; Ela, E.; Kirby, B.; Holttinen, H.; Lannoye, E.; Flynn, D.; O'Malley, M.; Miller, N.; Eriksen, P. B.; Gottig, A.; Rawn, B.; Gibescu, M.; Lazaro, E. G.; Robitaille, A.; Kamwa, I.

    2010-10-01T23:59:59.000Z

    This paper provides a high-level international comparison of methods and key results from both operating practice and integration analysis, based on an informal International Energy Agency Task 25: Large-scale Wind Integration.

  2. Published in the Proceedings of the 2nd International Symposium on Image and Signal Processing and Analysis, pages 530-534, June 2001, Pula, Croatia.

    E-Print Network [OSTI]

    Kliewer, Joerg

    and Analysis, pages 530-534, June 2001, Pula, Croatia. On the Design of Near-Perfect-Reconstruction IIR QMF

  3. Healthcare Policy Modeling, Simulation, and Analysis: COMPARE

    E-Print Network [OSTI]

    individual or group that is seriously interested in improving the health care system -- including reform are important issues for the American public, the healthcare industry, policy analysts assess the intended and unintended consequences of such reforms. Until now, it has been practically

  4. A Comparative Analysis of Influenza Vaccination Programs

    E-Print Network [OSTI]

    Bansal, Shweta

    , Texas, United States of America, 2 UBC Centre for Disease Control, University of British Columbia and Molecular Biology, University of Texas Austin, Austin, Texas, United States of America, 4 External Faculty, Santa Fe Institute, Santa Fe, New Mexico, United States of America Funding: We acknowledge the financial

  5. Comparative analysis of properties of channels of deuteron and tritium production in {sup 16}Op collisions at a projectile momentum of 3.25 GeV/c per nucleon

    SciTech Connect (OSTI)

    Olimov, K., E-mail: olimov@uzsci.net [Uzbek Academy of Sciences, Physical Technical Institute, Scientific Production Association Physics-Sun (Uzbekistan); Glagolev, V. V. [Joint Institute for Nuclear Research (Russian Federation); Gulamov, K. G.; Kurbanov, A.; Lutpullaev, S. L.; Olimov, A. K.; Petrov, V. I.; Yuldashev, A. A. [Uzbek Academy of Sciences, Physical Technical Institute, Scientific Production Association Physics-Sun (Uzbekistan)

    2014-12-15T23:59:59.000Z

    The results of a comparative analysis of channels involving the inclusive production of deuterons and tritons in {sup 16}Op collisions at a projectile momentum of 3.25 GeV/c per nucleon are presented. The mechanisms governing proton, deuteron, and triton production in the fragmentation of oxygen nuclei are found to be independent. It is shown that the observed proton-multiplicity correlations are associated predominantly with the character of the primary event of a proton-nucleon collision in {sup 16}Op interactions. It is found that, in reactions involving triton production, the contributions of processes leading to an increase in the mean proton multiplicity (n ? p + ?{sup ?} and np ? pn) and processes leading to its decrease (p ? n + ?{sup +}) compensate each other.

  6. International Student Services Office International Student Mentor

    E-Print Network [OSTI]

    Dawson, Jeff W.

    International Student Services Office International Student Mentor Undergraduate and Graduate stages of their transition to academic life at Carleton University. Mentors play a central role in ensuring student success by providing guidance and academic coaching. All ISSO mentors report

  7. Comparative genomics and bioenergetics Jose Castresana *

    E-Print Network [OSTI]

    Castresana, Jose

    Review Comparative genomics and bioenergetics Jose Castresana * European Molecular Biology conclusions about the phylogenetic distribution and evolution of bioenergetic pathways to be drawn conservation used by prokaryotes. In addition, a thorough phylogenetic analysis of other bioenergetic protein

  8. 21 11 13 INTERNATIONAL

    E-Print Network [OSTI]

    Yamamoto, Hirosuke

    31 E 32 F 32 #12; iv INTERNATIONAL ERGONOMICS ASSOCIATION #12; 3 INTERNATIONAL ERGONOMICS ASSOCIATION CODE OF CONDUCT ERGONOMICS ASSOCIATION (2006) http://www.iea.cc/browse.php?contID=international_ergonomics_association A6

  9. international engagement

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysisDarby Dietrich5 |0/%2A0/%2Agtri5/%2A7/%2A en

  10. international exercises

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysisDarby Dietrich5 |0/%2A0/%2Agtri5/%2A7/%2A

  11. international programs

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysisDarby Dietrich5 |0/%2A0/%2Agtri5/%2A7/%2A9/%2A

  12. international security

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA Approved:AdministrationAnalysisDarby Dietrich5

  13. ON THE INTERNAL DYNAMICS OF STARLESS CORES: STABILITY OF STARLESS CORES WITH INTERNAL MOTIONS AND COLLAPSE DYNAMICS

    SciTech Connect (OSTI)

    Seo, Young Min; Shirley, Yancy L. [Department of Astronomy and Steward Observatory, University of Arizona, Tucson, AZ (United States); Hong, Seung Soo [Astronomy Program, Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of)

    2013-05-20T23:59:59.000Z

    In order to understand the collapse dynamics of observed low-mass starless cores, we revise the conventional stability condition of hydrostatic Bonnor-Ebert spheres to take internal motions into account. Because observed starless cores resemble Bonnor-Ebert density structures, the stability and dynamics of the starless cores are frequently analyzed by comparing to the conventional stability condition of a hydrostatic Bonnor-Ebert sphere. However, starless cores are not hydrostatic but have observed internal motions. In this study, we take gaseous spheres with a homologous internal velocity field and derive stability conditions of the spheres utilizing a virial analysis. We propose two limiting models of spontaneous gravitational collapse: the collapse of critical Bonnor-Ebert spheres and uniform density spheres. The collapse of these two limiting models is intended to provide the lower and the upper limits, respectively, of the infall speeds for a given density structure. The results of our study suggest that the stability condition sensitively depends on internal motions. A homologous inward motion with a transonic speed can reduce the critical size compared to the static Bonnor-Ebert sphere by more than a factor of two. As an application of the two limiting models of spontaneous gravitational collapse, we compare the density structures and infall speeds of the observed starless cores L63, L1544, L1689B, and L694-2 to the two limiting models. L1689B and L694-2 seem to have been perturbed to result in faster infall motions than for spontaneous gravitational collapse.

  14. Student Trainee (Engineering)- Intern

    Broader source: Energy.gov [DOE]

    The purpose of the Pathways Intern Employment Program is to provide the intern with exposure to public service, enhance educational experience, and support educational goals. The program is...

  15. International Commitments Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2008-11-18T23:59:59.000Z

    This Order establishes a process to manage the Department's International Commitments under the administrative direction of the Office of Policy and International Affairs. No cancellation.

  16. Internal Controls Evaluations

    Broader source: Energy.gov (indexed) [DOE]

    iPortal Space. III. GAO Standards for Internal Control in the Federal Government In 1999, GAO issued revised Standards for Internal Control in the Federal Government. This...

  17. International Subcommittee Report

    Energy Savers [EERE]

    and overall U.S. international nuclear commercial leadership as part of the "Team USA" approach NEAC Meeting December 10, 2014 4 Recommendations by the NEAC International...

  18. 1 Elliott School of International Affairs ELLIOTT SCHOOL OF

    E-Print Network [OSTI]

    Vertes, Akos

    1 Elliott School of International Affairs ELLIOTT SCHOOL OF INTERNATIONAL AFFAIRS Dean M.E. Brown Associate Deans H. Agnew, L. Stephenson, D. Shaw The Elliott School of International Affairs offers graduate. The historical roots of the Elliott School extend back to the establishment of the School of Comparative

  19. INTERNATIONAL COMPARISON OF RESIDENTIAL ENERGY USE: INDICATORS OF RESIDENTIAL ENERGY USE AND EFFICIENCY PART ONE: THE DATA BASE

    E-Print Network [OSTI]

    Schipper, L.

    2013-01-01T23:59:59.000Z

    and Analysis of Swedish Residential Energy Use Data 1960-80.1980. International Residential Energy Use and ConservationInternational Comparison of Residential Energy ! Js~. Report

  20. Mechanical code comparator

    DOE Patents [OSTI]

    Peter, Frank J. (Albuquerque, NM); Dalton, Larry J. (Bernalillo, NM); Plummer, David W. (Albuquerque, NM)

    2002-01-01T23:59:59.000Z

    A new class of mechanical code comparators is described which have broad potential for application in safety, surety, and security applications. These devices can be implemented as micro-scale electromechanical systems that isolate a secure or otherwise controlled device until an access code is entered. This access code is converted into a series of mechanical inputs to the mechanical code comparator, which compares the access code to a pre-input combination, entered previously into the mechanical code comparator by an operator at the system security control point. These devices provide extremely high levels of robust security. Being totally mechanical in operation, an access control system properly based on such devices cannot be circumvented by software attack alone.

  1. Comparing greenhouse gasses

    E-Print Network [OSTI]

    Reilly, John M.; Babiker, Mustafa H.M.; Mayer, Monika.

    Controlling multiple substances that jointly contribute to climate warming requires some method to compare the effects of the different gases because the physical properties (radiative effects, and persistence in the ...

  2. Blackbody comparator for thermocouple calibration

    SciTech Connect (OSTI)

    Ojanen, M.; Hahtela, O. M.; Heinonen, M. [Centre for Metrology and Accreditation (MIKES), P.O.Box 9, FI-02151 Espoo (Finland)

    2013-09-11T23:59:59.000Z

    MIKES is developing a measurement set-up for calibrating thermocouples in the temperature range 960 C - 1500 C. The calibration method is based on direct comparison of thermocouples and radiation thermometers. We have designed a graphite blackbody comparator cell, which is operated in a horizontal single-zone tube furnace. The cell includes two blackbody cavities for radiation temperature measurements. The cavities have openings on opposite sides of the cell, allowing simultaneous measurement with two radiation thermometers. The design of the comparator allows three thermocouples to be calibrated simultaneously. The thermocouples to be calibrated are inserted in thermometer wells around one of the measurement cavities. We characterize the blackbody comparator in terms of repeatability, temperature distribution and emissivity. Finally, we validate the uncertainty analysis by comparing calibration results obtained for type B and S thermocouples to the calibration results reported by Technical Research Institute of Sweden (SP), and MIKES. The agreement in the temperature range 1000 C - 1500 C is within 0.90 C, the average deviation being 0.17 C.

  3. Some results of analysis of source position time series

    E-Print Network [OSTI]

    Malkin, Zinovy

    2015-01-01T23:59:59.000Z

    Source position time series produced by International VLBI Service for Geodesy and astrometry (IVS) Analysis Centers were analyzed. These series was computed using different software and analysis strategy. Comparison of this series showed that they have considerably different scatter and systematic behavior. Based on the inspection of all the series, new sources were identified as sources with irregular (non-random) position variations. Two statistics used to estimate the noise level in the time series, namely RMS and ADEV were compared.

  4. Assessor Training International

    E-Print Network [OSTI]

    NVLAP Assessor Training International Arrangements #12;Assessor Training 2009: International;Assessor Training 2009: International Arrangements 3 2009 is the 10th anniversary of the signing granted by a signatory to the ILAC Arrangement #12;Assessor Training 2009: International Arrangements 4

  5. STEP Intern Job Description

    Broader source: Energy.gov [DOE]

    STEP Intern Job Description, from the Tool Kit Framework: Small Town University Energy Program (STEP).

  6. IN TODAY'S PAPER International

    E-Print Network [OSTI]

    India's participation in the multi-billion-dollar International Thermonuclear Reactor project which aims

  7. International District Energy Association

    Broader source: Energy.gov [DOE]

    Since its formation in 1909, the International District Energy Association (IDEA) has served as a principal industry advocate and management resource for owners, operators, developers, and suppliers of district heating and cooling systems in cities, campuses, bases, and healthcare facilities. Today, with over 1,400 members in 26 countries, IDEA continues to organize high-quality technical conferences that inform, connect, and advance the industry toward higher energy efficiency and lower carbon emissions through innovation and investment in scalable sustainable solutions. With the support of DOE, IDEA performs industry research and market analysis to foster high impact projects and help transform the U.S. energy industry. IDEA was an active participant in the original Vision and Roadmap process and has continued to partner with DOE on combined heat and power (CHP) efforts across the country.

  8. International Journal of Systems Science, 1998, volume 29, number 9, pages 939-951 Performance analysis of serial production lines with quality

    E-Print Network [OSTI]

    Lim, Jong-Tae

    defective parts. The rejection rate of quality inspection machines should be considered as . . total number analysis of serial production lines with quality inspection machines M.-S. HANt, i.-T. LIMt* and D. The high production rate of machines in isolation and quality inspection machines are the basis of highly

  9. Clay Templeton, Kenneth R. Fleischmann, and Jordan Boyd-Graber. Simulating Audiences: Automating Analysis of Values, Attitudes, and Sentiment. IEEE International Conference on Social Computing, 2011.

    E-Print Network [OSTI]

    Boyd-Graber, Jordan

    Clay Templeton, Kenneth R. Fleischmann, and Jordan Boyd-Graber. Simulating Audiences: Automating. @inproceedings{Templeton:Fleischmann:Boyd-Graber-2011, Author = {Clay Templeton and Kenneth R. Fleischmann, and Sentiment}, } 1 #12;Simulating Audiences Automating Analysis of Values, Attitudes, and Sentiment Thomas Clay

  10. Y. Yiliyasi and D. Berleant, "World oil reserves data: information quality assessment and analysis," 16th International Conference on Information Quality, Nov. 18-20, 2011, Adelaide, Australia

    E-Print Network [OSTI]

    Berleant, Daniel

    Y. Yiliyasi and D. Berleant, "World oil reserves data: information quality assessment and analysis a framework for assessing the information quality of world oil reserves data. The framework is applied of oil reserve data. Keywords: Data Quality, Information Quality, Information Quality Framework

  11. 7th International Workshop on Large-Scale Integration of Wind Power and on Transmission Networks for Offshore Wind Farms Models for HLI analysis of power systems with

    E-Print Network [OSTI]

    Bak-Jensen, Birgitte

    for Offshore Wind Farms 1 Models for HLI analysis of power systems with offshore wind farms and distributed power plants, distributed generation and offshore wind farms. Particular attention is paid to the latter]-[4], but there is a lack of models of offshore wind farms, which introduce new issues for their representation, due to some

  12. Comparative Analysis of the 15.5kD Box C/D snoRNP Core Protein in the Primitive Eukaryote Giardia lamblia Reveals Unique Structural and Functional Features

    SciTech Connect (OSTI)

    Biswas, Shyamasri; Buhrman, Greg; Gagnon, Keith; Mattos, Carla; Brown, II, Bernard A.; Maxwell, E. Stuart (NCSU); (UTSMC)

    2012-07-11T23:59:59.000Z

    Box C/D ribonucleoproteins (RNP) guide the 2'-O-methylation of targeted nucleotides in archaeal and eukaryotic rRNAs. The archaeal L7Ae and eukaryotic 15.5kD box C/D RNP core protein homologues initiate RNP assembly by recognizing kink-turn (K-turn) motifs. The crystal structure of the 15.5kD core protein from the primitive eukaryote Giardia lamblia is described here to a resolution of 1.8 {angstrom}. The Giardia 15.5kD protein exhibits the typical {alpha}-{beta}-{alpha} sandwich fold exhibited by both archaeal L7Ae and eukaryotic 15.5kD proteins. Characteristic of eukaryotic homologues, the Giardia 15.5kD protein binds the K-turn motif but not the variant K-loop motif. The highly conserved residues of loop 9, critical for RNA binding, also exhibit conformations similar to those of the human 15.5kD protein when bound to the K-turn motif. However, comparative sequence analysis indicated a distinct evolutionary position between Archaea and Eukarya. Indeed, assessment of the Giardia 15.5kD protein in denaturing experiments demonstrated an intermediate stability in protein structure when compared with that of the eukaryotic mouse 15.5kD and archaeal Methanocaldococcus jannaschii L7Ae proteins. Most notable was the ability of the Giardia 15.5kD protein to assemble in vitro a catalytically active chimeric box C/D RNP utilizing the archaeal M. jannaschii Nop56/58 and fibrillarin core proteins. In contrast, a catalytically competent chimeric RNP could not be assembled using the mouse 15.5kD protein. Collectively, these analyses suggest that the G. lamblia 15.5kD protein occupies a unique position in the evolution of this box C/D RNP core protein retaining structural and functional features characteristic of both archaeal L7Ae and higher eukaryotic 15.5kD homologues.

  13. Analysis of operational, institutional and international limitations for alternative fuel vehicles and technologies: Means/methods for implementing changes. [Public fleet groups--information needs

    SciTech Connect (OSTI)

    Not Available

    1992-07-01T23:59:59.000Z

    This project focused upon the development of an approach to assist public fleet managers in evaluating the characteristics and availability of alternative fuels (AF's) and alternative fuel vehicles (AFV's) that will serve as possible replacements for vehicles currently serving the needs of various public entities. Also of concern were the institutional/international limitations for alternative fuels and alternative fuel vehicles. The City of Detroit and other public agencies in the Detroit area were the particular focus for the activities. As the development and initial stages of use of alternative fuels and alternative fuel vehicles proceeds, there will be an increasing need to provide information and guidance to decision-makers regarding differences in requirements and features of these fuels and vehicles. There wig be true differences in requirements for servicing, managing, and regulating. There will also be misunderstanding and misperception. There have been volumes of data collected on AFV'S, and as technology is improved, new data is constantly added. There are not, however, condensed and effective sources of information for public vehicle fleet managers on vehicle and equipment sources, characteristics, performance, costs, and environmental benefits. While theoretical modeling of public fleet requirements has been done, there do not seem to be readily available practical''. There is a need to provide the best possible information and means to minimize the problems for introducing the effective use of alternative fuels and alternative fuel vehicles.

  14. Lattice effect in solid state internal conversion

    SciTech Connect (OSTI)

    Kalman, Peter; Keszthelyi, Tamas [Budapest University of Technology and Economics, Department of Experimental Physics, Budafoki ut 8. F. I.I.10, H-1521 Budapest (Hungary)

    2009-03-15T23:59:59.000Z

    The effect of the crystal lattice on nuclear fusion reactions p+d{yields}{sup 3}He taking place in internal conversion channels is studied. Fusionable particles solved in the investigated crystalline material form a sublattice. Fusion reaction is generated by a flux of incoming fusionable particles. The calculated cross sections are compared with those of an ordinary fusion reaction. The internal conversion coefficients are also calculated.

  15. Paskhevich A., Wenger P. et Chablat D., "Kinematic and stiffness analysis of the Orthoglide, a PKM with simple, regular workspace and homogeneous performances", IEEE International Conference On Robotics And Automation, Rome, Italie, Avril, 2007.

    E-Print Network [OSTI]

    Boyer, Edmond

    with simple, regular workspace and homogeneous performances", IEEE International Conference On Robotics, regular workspace and homogeneous performances Anatoly Pashkevich, Philippe WENGER, Damien CHABLAT Robotic of a prescribed cubic Cartesian workspace that is free of singularities and internal collision. The interesting

  16. AGEING PROCEDURES ON LITHIUM BATTERIES IN AN INTERNATIONAL COLLABORATION CONTEXT

    SciTech Connect (OSTI)

    Jeffrey R. Belt; Ira Bloom; Mario Conte; Fiorentino Valerio Conte; Kenji Morita; Tomohiko Ikeya; Jens Groot

    2010-11-01T23:59:59.000Z

    The widespread introduction of electrically-propelled vehicles is currently part of many political strategies and introduction plans. These new vehicles, ranging from limited (mild) hybrid to plug-in hybrid to fully-battery powered, will rely on a new class of advanced storage batteries, such as those based on lithium, to meet different technical and economical targets. The testing of these batteries to determine the performance and life in the various applications is a time-consuming and costly process that is not yet well developed. There are many examples of parallel testing activities that are poorly coordinated, for example, those in Europe, Japan and the US. These costs and efforts may be better leveraged through international collaboration, such as that possible within the framework of the International Energy Agency. Here, a new effort is under development that will establish standardized, accelerated testing procedures and will allow battery testing organizations to cooperate in the analysis of the resulting data. This paper reviews the present state-of-the-art in accelerated life testing in Europe, Japan and the US. The existing test procedures will be collected, compared and analyzed with the goal of international collaboration.

  17. International Facility Management Association Strategic Facility

    Broader source: Energy.gov (indexed) [DOE]

    be identified between the current situations and analyzed needs. Gap analysis-a business resource assessment tool enabling an organization to compare its actual performance with...

  18. Internal Wave Interferometry

    E-Print Network [OSTI]

    Mathur, Manikandan S.

    Internal waves are a ubiquitous and significant means of momentum and energy transport in the oceans, atmosphere, and astrophysical bodies. Here, we show that internal wave propagation in nonuniform density stratifications, ...

  19. Essays in international trade

    E-Print Network [OSTI]

    Romalis, John

    2001-01-01T23:59:59.000Z

    This thesis is a collection of essays on the effect of trade costs on international trade. Chapter 1 derives and empirically examines how factor proportions determine the structure of commodity trade when international ...

  20. International aeronautical user charges

    E-Print Network [OSTI]

    Odoni, Amedeo R.

    1985-01-01T23:59:59.000Z

    Introduction: 1.1 BACKGROUND AND MOTIVATION Very few issues relating to the international air transportation industry are today as divisive as those pertaining to user charges imposed at international airports and enroute ...

  1. Ferroelectric optical image comparator

    DOE Patents [OSTI]

    Butler, M.A.; Land, C.E.; Martin, S.J.; Pfeifer, K.B.

    1993-11-30T23:59:59.000Z

    A ferroelectric optical image comparator has a lead lanthanum zirconate titanate thin-film device which is constructed with a semi-transparent or transparent conductive first electrode on one side of the thin film, a conductive metal second electrode on the other side of the thin film, and the second electrode is in contact with a nonconducting substrate. A photoinduced current in the device represents the dot product between a stored image and an image projected onto the first electrode. One-dimensional autocorrelations are performed by measuring this current while displacing the projected image. 7 figures.

  2. International Exeter annual report

    E-Print Network [OSTI]

    -chancellor's international engagement 68 China and Hong Kong 74 India 78 United States of America 82 United Arab Emirates 88

  3. International Exeter annual report

    E-Print Network [OSTI]

    -Chancellor's international engagement 66 China and Hong Kong 72 India 76 United States of America 80 United Arab Emirates 86

  4. International and Finance

    E-Print Network [OSTI]

    Little, Tony

    MSc International Accounting and Finance #12;What is International Accounting and Finance and why involved. Why study International Accounting and Finance at Stirling? One In the most recent Research Assessment Exercise, the University of Stirling's division of Accounting and Finance was rated first equal

  5. INTERNATIONAL STUDENT ADMISSIONS

    E-Print Network [OSTI]

    Fernandez, Eduardo

    Marine Renewable Energy Center, one of only three in the country. u Benefit from FAU's collaborativeADMISSIONS INTERNATIONAL STUDENT ADMISSIONS INTERNATIONAL STUDENT ADMISSIONS A cutting-edge research university that offers a high-quality education WWW.FAU.EDU/INTERNATIONAL[FAU] #12;WORLD

  6. Energy Supplier Obligations and White Certificate Schemes: Comparative...

    Open Energy Info (EERE)

    Results in the European Union Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Energy Supplier Obligations and White Certificate Schemes: Comparative Analysis of Results...

  7. From Domestic vs. International to Domestic and International

    E-Print Network [OSTI]

    Amin, S. Massoud

    % 20% 30% 40% 50% 60% 70% 80% 90% 100% Domestic International International Domestic 100% 67% 86% 29

  8. Advanced Fuel Cycle Economic Sensitivity Analysis

    SciTech Connect (OSTI)

    David Shropshire; Kent Williams; J.D. Smith; Brent Boore

    2006-12-01T23:59:59.000Z

    A fuel cycle economic analysis was performed on four fuel cycles to provide a baseline for initial cost comparison using the Gen IV Economic Modeling Work Group G4 ECON spreadsheet model, Decision Programming Language software, the 2006 Advanced Fuel Cycle Cost Basis report, industry cost data, international papers, the nuclear power related cost study from MIT, Harvard, and the University of Chicago. The analysis developed and compared the fuel cycle cost component of the total cost of energy for a wide range of fuel cycles including: once through, thermal with fast recycle, continuous fast recycle, and thermal recycle.

  9. 10. international mouse genome conference

    SciTech Connect (OSTI)

    Meisler, M.H.

    1996-12-31T23:59:59.000Z

    Ten years after hosting the First International Mammalian Genome Conference in Paris in 1986, Dr. Jean-Louis Guenet presided over the Tenth Conference at the Pasteur Institute, October 7--10, 1996. The 1986 conference was a satellite to the Human Gene Mapping Workshop and had approximately 50 attendees. The 1996 meeting was attended by 300 scientists from around the world. In the interim, the number of mapped loci in the mouse increased from 1,000 to over 20,000. This report contains a listing of the program and its participants, and two articles that review the meeting and the role of the laboratory mouse in the Human Genome project. More than 200 papers were presented at the conference covering the following topics: International mouse chromosome committee meetings; Mutant generation and identification; Physical and genetic maps; New technology and resources; Chromatin structure and gene regulation; Rate and hamster genetic maps; Informatics and databases; and Quantitative trait analysis.

  10. Internal dosimetry software comparison

    E-Print Network [OSTI]

    Fulmer, Judith Renee

    1992-01-01T23:59:59.000Z

    (ICRP) published in 1979 provided an improved approach for the assessment of internal dose. The ICRP recommendations were implemented in federal regulations promulgated by the Nuclear Regulatory Commission (NRC) in the Code of Federal Regulations (10... in the assessment of internal dose has led to the development of various computer software. In this study, several internal dosimetry codes were examined using a standard set of benchmark problems incorporating authentic exposure data. Personal computer...

  11. EM International. Volume 1

    SciTech Connect (OSTI)

    Not Available

    1993-07-01T23:59:59.000Z

    It is the intent of EM International to describe the Office of Environmental Restoration and Waste Management`s (EM`s) various roles and responsibilities within the international community. Cooperative agreements and programs, descriptions of projects and technologies, and synopses of visits to international sites are all highlighted in this semiannual journal. Focus on EM programs in this issue is on international collaboration in vitrification projects. Technology highlights covers: in situ sealing for contaminated sites; and remote sensors for toxic pollutants. Section on profiles of countries includes: Arctic contamination by the former Soviet Union, and EM activities with Germany--cooperative arrangements.

  12. Master of International Public Affairs Degree Program

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    to be considered for admission. Prerequisites u One course in international or comparative politics u One course States of Micronesia u Congressional-Executive Commission on China u National Democratic Institute career, when I was on rotation at the national renewable energy lab. From there I worked in the wind

  13. Propagation and reflection of internal waves B. R. Sutherlanda)

    E-Print Network [OSTI]

    Sutherland, Bruce

    Propagation and reflection of internal waves B. R. Sutherlanda) Department of Mathematical Sciences 01205-2 I. INTRODUCTION An internal wave is a disturbance propagating under the effects of buoyancy gravity waves incident upon a level where the Doppler-shifted frequency of the waves is comparable

  14. Reference set of regulons in Desulfovibrionales inferred by comparative genomics approach

    E-Print Network [OSTI]

    Kazakov, A.E.

    2011-01-01T23:59:59.000Z

    inferred by comparative genomics approach 1 Lawrenceout large-scale comparative genomics analysis of regulatoryEnvironmental Research, Genomics:GTL Foundational Science

  15. Comparative genomics of metabolic capacities of regulons controlled by cis-regulatory RNA motifs in bacteria

    E-Print Network [OSTI]

    Sun, Eric I; Leyn, Semen A; Kazanov, Marat D; Saier, Milton H; Novichkov, Pavel S; Rodionov, Dmitry A

    2013-01-01T23:59:59.000Z

    RH, Breaker RR: Comparative genomics reveals 104 candidateof transporters. BMC Genomics 2008, 9:330. 16. Green NJ,in proteobacteria: comparative genomics analysis. FEMS

  16. Exports and productivity --Comparable evidence for 14 countries

    E-Print Network [OSTI]

    Paris-Sud XI, Universit de

    Exports and productivity -- Comparable evidence for 14 countries N 2007-36 Dcembre 2007 The International Study Group on Exports and Productivity Flora BELLONE Universit de Nice Sophia Antipolis Liza Lionel NESTA OFCE-DRIC Stefano SCHIAVO OFCE-DRIC hal-00973116,version1-3Apr2014 #12;Exports

  17. COMPARING ALASKA'S OIL PRODUCTION TAXES: INCENTIVES AND ASSUMPTIONS1

    E-Print Network [OSTI]

    Pantaleone, Jim

    context of Alaska oil production taxes, comparing MAPA and ACES to the original petroleum profits tax (PPT1 COMPARING ALASKA'S OIL PRODUCTION TAXES: INCENTIVES AND ASSUMPTIONS1 Matthew Berman In a recent analysis comparing the current oil production tax, More Alaska Production Act (MAPA, also known as SB 21

  18. Supplemental Data. Graeber et al. (2011). A Guideline to Family-wide Comparative State-of-the-art qRT-PCR Analysis Exemplified with a Brassicaceae Cross-species

    E-Print Network [OSTI]

    Leubner, Gerhard

    Supplemental Data. Graeber et al. (2011). A Guideline to Family-wide Comparative State-of-the-art q Methods #12;Supplemental Data. Graeber et al. Plant Cell. (2011): PLANTCELL/2011/084103 2 Supplemental. Graeber et al. Plant Cell. (2011): PLANTCELL/2011/084103 3 Supplemental Table 1. Sequence similarities

  19. International Programs in Agriculture

    E-Print Network [OSTI]

    International Programs in Agriculture MessagefromtheDirector Staying Ahead of Globalization and more prosperous place for all. Fortunately, Purdue International Programs in Agriculture (IPIA) has natural disasters caution us to remember the power of nature. The United Nations Food and Agriculture

  20. Conference Proceedings International Conference

    E-Print Network [OSTI]

    Hemmers, Oliver

    Conference Proceedings 10th International Conference on Hand-Arm Vibration 7-11 June 2004 Flamingo related to HAVS. The published proceedings from these conferences have become blueprints for assessing, the entertainment capital of the world: The 10th International Hand-Arm Vibration Conference will be the second time

  1. Blue Award 2012 International

    E-Print Network [OSTI]

    Blue Award 2012 · International Student Competition for Sustainable Architecture Sign in: www.blueaward.at Blue Award 2012 · International Student Competition for Sustainable Architecture Organizers Vienna blueaward.at Organizers Vienna University of Technology Department for Spatial and Sustainable Design

  2. International Conference on

    E-Print Network [OSTI]

    Zevenhoven, Ron

    of energy systems; 5.Refrigeration & air conditioning; Heat pumps; 6.Fuel cells; 7.Biomass / biofuels; bio E C o S 2 0 JuNE 15-19 27th International Conference on Efficiency, Cost, 1 4 Optimization International Conference on Efficiency, Cost, Optimization, Simulation and Environmental Impact of Energy

  3. IRO INTERNAL MANAGEMENT Funded by the

    E-Print Network [OSTI]

    Management OGPI approach Information and Management Systems #12; The analysis will be focus "tools" that improve the quality of the costs management: The Economic Management Tool (IntranetIRO INTERNAL MANAGEMENT - UA - Funded by the European Union 3rd Workshop: IROs Models Tunisia, 30

  4. Interns for Indiana (IFI) Project descriptions

    E-Print Network [OSTI]

    with the company after graduation, which allows him to work on cutting edge projects, aid in company growthInterns for Indiana (IFI) Projects Project descriptions: · Software development, database design analysis Past student project Development of animated graphics for web portal and product demos -Kevin

  5. An analysis of international grain freight rates

    E-Print Network [OSTI]

    Jonnala, Sneha Latha

    1999-01-01T23:59:59.000Z

    of the dependent variable was included in the model as an explanatory variable. The estimated econometric model was designed to explain ocean freight rates for grain. Results indicate rates increase at a decreasing rate with distance and rates decrease at a...

  6. International Monetary Policy Analysis with Durable Goods

    E-Print Network [OSTI]

    Lee, Kang Koo

    2010-10-12T23:59:59.000Z

    The dissertation studies a model of an economy which produces and exports durable goods. It analyzes the optimal monetary policy for such a country. Generally, monetary policy has a bigger economic effect on durable goods ...

  7. An analysis of international grain freight rates

    E-Print Network [OSTI]

    Jonnala, Sneha Latha

    1999-01-01T23:59:59.000Z

    and large holds arranged and structurally reinforced to carry ore, oil and light bulk cargoes. Other types include ore/oil (OO) and ore/slurry/oil (OSO). These tankers have a tight hatch provided on top of a central tank (Bernhard 1980). While adding... and suggestions for further research. CHAPTER H OVERVIEW OF OCEAN SHIPPING INDUSTRY Ocean shipping is often divided into the carriage of liquid and dry cargoes. The discussion in this chapter is mainly concentrated on ocean shipping of dry cargoes. The dry...

  8. Cuttings Analysis At International Geothermal Area, Indonesia...

    Open Energy Info (EERE)

    Nemcok, Norman, Powell and Stimac. The approach we are using is to characterize the petrology, geochemistry and fractures in core and cuttings samples and then integrate these...

  9. Cuttings Analysis At International Geothermal Area, Philippines...

    Open Energy Info (EERE)

    Nemcok, Norman, Powell and Stimac. The approach we are using is to characterize the petrology, geochemistry and fractures in core and cuttings samples and then integrate these...

  10. An analysis of internal zones of discontinuity

    E-Print Network [OSTI]

    Bellue, Dan Gordon

    1972-01-01T23:59:59.000Z

    error of 1. 5 m sec at 700 mb, 2. 5 m -1 -1 sec at 500 mb, and 4. 0 m sec at 300 mb. The wind direction had rms errors of 2' at 700 mb, 3 at 500 mb, and 5' at 300 mb, based on -1 speeds of 10 m sec The extra care used to read the recording charts... of discontinuity are enclosed by dashed lines. Term II is s ddt. ? Z~ (ap -11 -1 -1 Units are 10 deg m sec . ) 32 700 mb. The latter center weakened rapidly from 00 to 06 GMi. The center over HTS weakened also, but less rapidly. Regions of frontogenesis which...

  11. International Clean Energy Analysis | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are8COaBulkTransmissionSitingProcess.pdfGetecGtelInterias Solar Energy Jump to: navigation,Machines Corp IBMsource

  12. International Clean Energy Analysis | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, searchOf Kilauea Volcano, Hawaii | Open Energy Informationsource History View

  13. Freshwater Availability Anomalies and Outbreak of Internal War

    E-Print Network [OSTI]

    Columbia University

    Freshwater Availability Anomalies and Outbreak of Internal War: Results from a Global Spatial Time, Asker, near Oslo, 2123 June 2005 Organizers: Centre for the Study of Civil War, International Peace War: Results from a Global Spatial Time Series Analysis1 Abstract We investigated the relationship

  14. Students' Perceptions of International Agriculture After an International Agricultural Experience

    E-Print Network [OSTI]

    Miller, Kasey Lynn

    2012-02-14T23:59:59.000Z

    /schedule, language, safety and health, and time away from home; finally, benefits included experience in international agriculture and natural resources, culture, international travel, global perspective, and education. This study found that international agriculture...

  15. Sustainable Development Summer Intern Report 2013 Sustainable Development Summer Intern

    E-Print Network [OSTI]

    Sustainable Development Summer Intern Report 2013 Sustainable Development Summer Intern Final amongst university's invested in sustainable development. Our small but mighty size allows us to build through positive sustainable practices. As the Sustainable Development Summer Intern I am fortunate enough

  16. Sustainable Development Summer Intern Report 2010 Sustainable Development Summer Intern

    E-Print Network [OSTI]

    Sustainable Development Summer Intern Report 2010 1 Sustainable Development Summer Intern Final of Bishop's University. The role of the Sustainable Development Summer Intern (SDSI) is to coordinate and organize sustainable development information and activities during the summer months. Ensuring

  17. Comparative studies of diverged members of the phosphotriesterase family

    E-Print Network [OSTI]

    Arriens, Cristina Gale

    2013-02-22T23:59:59.000Z

    -ndel ponl-sap pon I -Gsap pon1-sap* pon1-sap+ CGGCTTCCGCATATGGCGAAGCTGATTGCG GCTCTTCCGCATTAGAGCTCACAGTAAAGAGC GGTGGTTGCTCTTCCGCATTAGAGCTCACAGT AAAGAGC GCTCTTCTCTGTTAGAGACAGTAAAGAGC CGGCTTATGGCATGGGTGCGCTCTTCTCTGTTA GAGACAGTAAAGAGC Reactions were... Technologies Lab of the Institute of Developmental /k Molecular for analysis. The sequencing protocol was repeated using internal primers PON I-201a and PONI-201 to obtain the complete sequence of the gene. INTRODUCTION OF RESTRICTION SITES Primers PONI-sap...

  18. Comparing and Contrasting Health and

    E-Print Network [OSTI]

    Entekhabi, Dara

    / private partnership Institutional Change In Health: The Affordable Care Act (ACA) The recognitionComparing and Contrasting Health and Transportation as Complex Sociotechnical Systems System: Comparing and Contrasting Health and Transportation as Complex Sociotechnical Systems Ideas about

  19. DOE Tribal Intern Focuses on Integrating Energy Policy and Navajo...

    Energy Savers [EERE]

    model I'm developing for the Navajo Nation uses the Tools for Energy Model Optimization and Analysis (TEMOA), an open-source energy system model based on the International...

  20. INTERNATIONAL SPACE EXPLORATION COORDINATION GROUP

    E-Print Network [OSTI]

    space exploration infrastructure standards facilitating interoperability through an international with relevant existing international working groups/ organisations. · Preparation and Organization of a WS1 INTERNATIONAL SPACE EXPLORATION COORDINATION GROUP WORKPLAN Update following 3rd ISECG Meeting

  1. International energy annual 1996

    SciTech Connect (OSTI)

    NONE

    1998-02-01T23:59:59.000Z

    The International Energy Annual presents an overview of key international energy trends for production, consumption, imports, and exports of primary energy commodities in over 220 countries, dependencies, and areas of special sovereignty. Also included are population and gross domestic product data, as well as prices for crude oil and petroleum products in selected countries. Renewable energy reported in the International Energy Annual includes hydroelectric power, geothermal, solar, and wind electric power, biofuels energy for the US, and biofuels electric power for Brazil. New in the 1996 edition are estimates of carbon dioxide emissions from the consumption of petroleum and coal, and the consumption and flaring of natural gas. 72 tabs.

  2. international | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    International Activity in Gasification and Coal to Liquids Development News Gasifipedia Coal-Biomass Feed Advanced Fuels Synthesis Systems Analyses International Activity Project...

  3. INTERNATIONAL PACIFIC RESEARCH CENTER

    E-Print Network [OSTI]

    Wang, Yuqing

    INTERNATIONAL PACIFIC RESEARCH CENTER APRIL 2004MARCH 2005 REPORT SCHOOL OF OCEAN AND EARTH RESEARCH HIGHLIGHTS Indo-Pacific Ocean Climate Pacific Research Center Design by: Susan Yamamoto Printed by: Hagadone Printing Company Photo: Waikiki

  4. CSU Office of International

    E-Print Network [OSTI]

    CSU Office of International Programs - Education Abroad Program Types Currently 750 programs on the OIP Education Abroad website. CSU, through Division of Continuing Education/ Online Education Abroad website. Transfer Semester, year & possibly summer CSU tuition and fees (All other fees

  5. International petroleum statistics report

    SciTech Connect (OSTI)

    NONE

    1996-03-01T23:59:59.000Z

    This report presents data on international oil production, demand, imports, exports, and stocks. World oil production and OECD demand data are for the years 1970 through 1994; OECD stocks from 1973 through 1994; and OECD trade from 1984 through 1994.

  6. Essays on International Economics

    E-Print Network [OSTI]

    Cravino, Javier Pablo

    2013-01-01T23:59:59.000Z

    Journal of International Economics, Vol. 65, 37599. [33]Journal of Monetary Economics, Vol. 51, No. 1, pp. 132. [Trade, Journal of Monetary Economics, Vol. 54, No. 6, pp.

  7. Formula Hybrid International Competition

    E-Print Network [OSTI]

    Carver, Jeffrey C.

    torque at low speeds than do internal combustion engines, a hybrid could offer competitive advantages with a traditional combustion engine into a hybrid vehicle, overcoming numerous technical challenges along the way

  8. International Studies Degree

    E-Print Network [OSTI]

    Moore, Paul A.

    Attorney Simpson Moncif Law, LLC Customer Service Representative Schindler Elevator Corporation Director Insurance Logistics Account Executive Total Quality Logistics, Inc. Manager of Strategic Planning Eaton Corporation Self-employed/Business Owner Indy Associates, Original Impulse Senior Associate International

  9. International Programs in Agriculture

    E-Print Network [OSTI]

    have any questions or comments. Jess Lowenberg-DeBoer Associate Dean and Director of International husband Luc and son Léonce, moved to Kansas for their new venture in farming; and to Corey Kujawa who left

  10. OE's SGIG Program Featured in International Publication

    Broader source: Energy.gov [DOE]

    An article in the March 2012 issue of the quarterly publication Metering International focuses on DOE's Smart Grid Investment Grant program, highlighting how the program is improving the reliability and resiliency of the US electric grid. The article examines the need to protect the grid and the benefits of modernization, including reduced demand, increased capacity, and faster recovery. OE's Debbie Haught, who oversees the SGIG program, and Joseph Palladino, who leads the analysis of the program, authored the piece. Metering International provides information on trends and developments in the industry.

  11. SWAT Goes International

    E-Print Network [OSTI]

    Wythe, Kathy

    2007-01-01T23:59:59.000Z

    #1; tx H2O | pg. 18 International researchers and program managers in 90 countries around the world use the Soil and Water Assessment Tool (SWAT) model. Germany, the first country interested in SWAT, uses it to model its large watersheds, said... issues and used SWAT to help assess watersheds and transboundary water issues of the 15-country union, increasing the use of the modeling tool throughout Europe. The U.S. Agency for International Development funded a research project for the Kenyan...

  12. Wood Resources International

    E-Print Network [OSTI]

    .3% Sweden 5.3% Finland 4.1% Russia 13.8% US 37.3% Germany 3.3% France 2.8% Poland 2.1% Other Europe 14 International Wood Fuel Removals in Europe 2002 Turkey 12.2% Poland 3.6% Romania 5.3% Hungary 4.1% Germany 7;Wood Resources International Production of energy from wood fuels in 2000 Source: EUBIONET 0 50 100 150

  13. Weighing international ESCO opportunities

    SciTech Connect (OSTI)

    Smith, D.O.

    1997-06-01T23:59:59.000Z

    The decision to expand into an international market is not an easy one. There are many things to consider. It`s probably an even tougher decision for our type business, energy efficiency Performance Contracting, than most because the ESCO business is so complex and carries a considerable amount of project risks which can be considerably magnified in an international setting. The author presents five areas which need to be addressed in making the decision to pursue the international market. (1) Is the international market worth pursuing? (2) Is your company ready to go international? Can your company handle an international venture in stride without disrupting your domestic business plans? (3) Can you afford it financially? What is the risk? (4) Evaluation of target countries. (5) What about a local partner? What will be the roles of you and your prospective partner, both now and long term? What value will your company continue to bring over the years to assure a successful long term business relationship, not just a short term technology transfer?

  14. Assessment of Impacts from Adopting the 2009 International Energy Conservation Code for Residential Buildings in Michigan

    SciTech Connect (OSTI)

    Lucas, Robert G.

    2009-10-18T23:59:59.000Z

    Energy and economic analysis comparing the current Michigan residential energy efficiency code to the 2009 IECC.

  15. Comparative Survival Study (CSS) of Hatchery PIT-tagged Spring/Summer Chinook; Migration Years 1997-2002 Mark/Recapture Activities and Bootstrap Analysis, 2003-2004 Biennial Report.

    SciTech Connect (OSTI)

    Berggren, Thomas J.; Franzoni, Henry; Basham, Larry R. (Columbia Basin Fish and Wildlife Authority, Fish Passage Center, Portland, OR)

    2003-11-01T23:59:59.000Z

    The Comparative Survival Study (CSS) was initiated in 1996 as a multi-year program of the fishery agencies and tribes to estimate survival rates over different life stages for spring and summer Chinook (hereafter, Chinook) produced in major hatcheries in the Snake River basin and from selected hatcheries in the lower Columbia River. Much of the information evaluated in the CSS is derived from fish tagged with Passive Integrated Transponder (PIT) tags. A comparison of survival rates of Chinook marked in two different regions (which differ in the number of dams Chinook have to migrate through) provides insight into the effects of the Snake/Columbia hydroelectric system (hydrosystem). The CSS also compares the smolt-to-adult survival rates (SARs) for Snake River Chinook that were transported versus those that migrated in-river to below Bonneville Dam. Additional comparisons can be made within in-river experiences as well as comparison between the different collector projects from which smolts are transported. CSS also compares survival rates for wild Snake River spring and summer Chinook. These comparisons generate information regarding the relative effects of the current management actions used to recover this listed species. Scientists and managers have recently emphasized the importance of delayed hydrosystem mortality to long-term management decisions. Delayed hydrosystem mortality may be related to the smolts experience in the Federal Columbia River Power System, and could occur for both smolts that migrate in-river and smolts that are transported. The CSS PIT tag information on in-river survival rates and smolt-to-adult survival rates (SARs) of transported and in-river fish are relevant to estimation of ''D'', which partially describes delayed hydrosystem mortality. The parameter D is the differential survival rate of transported fish relative to fish that migrate in-river, as measured from below Bonneville Dam to adults returning to Lower Granite Dam. When D = 1, there is no difference in survival rate after hydrosystem passage. When D < 1, then transported smolts die at a greater rate after release below Bonneville Dam than smolts that have migrated in-river to below Bonneville Dam Major objectives of the CSS include: (1) development of a long-term index of transport SAR to in-river SAR for Snake River hatchery and wild spring and summer Chinook smolts measured at Lower Granite Dam; (2) develop a long-term index of survival rates from release of smolts at Snake River hatcheries to return of adults to the hatcheries; (3) compute and compare the overall SARs for selected upriver and downriver spring and summer Chinook hatchery and wild stocks; and (4) begin a time series of SARs for use in hypothesis testing and in the regional long-term monitoring and evaluation program. Primary CSS focus in this report is for wild and hatchery spring/summer Chinook that outmigrated in 1997 to 2002 and their respective adult returns through 2004.

  16. Direct comparative study on the energy level alignments in unoccupied/occupied states of organic semiconductor/electrode interface by constructing in-situ photoemission spectroscopy and Ar gas cluster ion beam sputtering integrated analysis system

    SciTech Connect (OSTI)

    Yun, Dong-Jin, E-mail: Dongjin.yun@samsung.com; Chung, JaeGwan; Kim, Yongsu; Park, Sung-Hoon; Kim, Seong-Heon; Heo, Sung [Analytical Science Laboratory of Samsung Advanced Institute of Technology, PO Box 14-1, Yongin 446-712 (Korea, Republic of)

    2014-10-21T23:59:59.000Z

    Through the installation of electron gun and photon detector, an in-situ photoemission and damage-free sputtering integrated analysis system is completely constructed. Therefore, this system enables to accurately characterize the energy level alignments including unoccupied/occupied molecular orbital (LUMO/HOMO) levels at interface region of organic semiconductor/electrode according to depth position. Based on Ultraviolet Photoemission Spectroscopy (UPS), Inverse Photoemission Spectroscopy (IPES), and reflective electron energy loss spectroscopy, the occupied/unoccupied state of in-situ deposited Tris[4-(carbazol-9-yl)phenyl]amine (TCTA) organic semiconductors on Au (E{sub LUMO}: 2.51?eV and E{sub HOMO}: 1.35?eV) and Ti (E{sub LUMO}: 2.19?eV and E{sub HOMO}: 1.69?eV) electrodes are investigated, and the variation of energy level alignments according to work function of electrode (Au: 4.81?eV and Ti: 4.19?eV) is clearly verified. Subsequently, under the same analysis condition, the unoccupied/occupied states at bulk region of TCTA/Au structures are characterized using different Ar gas cluster ion beam (Ar GCIB) and Ar ion sputtering processes, respectively. While the Ar ion sputtering process critically distorts both occupied and unoccupied states in UPS/IPES spectra, the Ar GCIB sputtering process does not give rise to damage on them. Therefore, we clearly confirm that the in-situ photoemission spectroscopy in combination with Ar GCIB sputtering allows of investigating accurate energy level alignments at bulk/interface region as well as surface region of organic semiconductor/electrode structure.

  17. Harbour Island: The Comparative Archaeology of a Maritime Community

    E-Print Network [OSTI]

    Hatch, Heather E

    2013-08-01T23:59:59.000Z

    assemblages of maritime communities that indicate maritimity. Analysis relies on Stanley South's artifact classification system and his Carolina Artifact pattern. The nine properties are compared among themselves as well as with four other sites from...

  18. International Oil Supplies and Demands

    SciTech Connect (OSTI)

    Not Available

    1992-04-01T23:59:59.000Z

    The eleventh Energy Modeling Forum (EMF) working group met four times over the 1989--1990 period to compare alternative perspectives on international oil supplies and demands through 2010 and to discuss how alternative supply and demand trends influence the world's dependence upon Middle Eastern oil. Proprietors of eleven economic models of the world oil market used their respective models to simulate a dozen scenarios using standardized assumptions. From its inception, the study was not designed to focus on the short-run impacts of disruptions on oil markets. Nor did the working group attempt to provide a forecast or just a single view of the likely future path for oil prices. The model results guided the group's thinking about many important longer-run market relationships and helped to identify differences of opinion about future oil supplies, demands, and dependence.

  19. International Oil Supplies and Demands

    SciTech Connect (OSTI)

    Not Available

    1991-09-01T23:59:59.000Z

    The eleventh Energy Modeling Forum (EMF) working group met four times over the 1989--90 period to compare alternative perspectives on international oil supplies and demands through 2010 and to discuss how alternative supply and demand trends influence the world's dependence upon Middle Eastern oil. Proprietors of eleven economic models of the world oil market used their respective models to simulate a dozen scenarios using standardized assumptions. From its inception, the study was not designed to focus on the short-run impacts of disruptions on oil markets. Nor did the working group attempt to provide a forecast or just a single view of the likely future path for oil prices. The model results guided the group's thinking about many important longer-run market relationships and helped to identify differences of opinion about future oil supplies, demands, and dependence.

  20. Assessor Training Internal Audits and

    E-Print Network [OSTI]

    NVLAP Assessor Training Internal Audits and Management Reviews #12;Assessor Training 2009, quarterly, etc., schedule throughout the year #12;Assessor Training 2009: Internal Audits and Management a copy of the full internal audit schedule. #12;Assessor Training 2009: Internal Audits and Management

  1. STEP Intern Reference Check Sheet

    Broader source: Energy.gov [DOE]

    STEP Intern Reference Check Sheet, from the Tool Kit Framework: Small Town University Energy Program (STEP).

  2. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    5.A.6 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURE for REPORTING PHYSICAL PLANT AND ENVIRONMENTAL CONDITIONS ABNORMALITIES AT THE COMPARATIVE MEDICINE LABORATORY ANIMAL investigator to keep her/him informed of the progress or resolution of the problem. #12;

  3. ALGORITHMS FOR CONSTRUCTING COMPARATIVE MAPS

    E-Print Network [OSTI]

    Kleinberg, Jon

    (i.e. that the segments are homeologous). The construction of comparative maps between the genomes and phylogenetic relationships among species as well as fundamental principles of genome evolution. Comparative maps allow us to use structural and functional information about one genome to make predictions about

  4. New airport liquid analysis system undergoes testing at Albuquerque...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New airport liquid analysis system New airport liquid analysis system undergoes testing at Albuquerque International Sunport A new tool that distinguishes potential-threat liquids...

  5. Improving Surface Analysis Methods for Characterization of Advanced...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    useful information from a variety of different analysis tools. The International Organization for Standardization (ISO) Committee TC 201 on Surface Chemical Analysis and ASTM...

  6. 62 Studies in Comparative International Development / Summer 2005 Studies in Comparative International Development, Summer 2005, Vol. 40, No. 2, pp. 62-84.

    E-Print Network [OSTI]

    Sanders, Seth

    in global economic power. Simon Kuznets described "epochal innovations" as "major breakthroughs to a substantial part of the world" (Kuznets, 1973). Many have argued that digital technologies of computation and communica- tion will constitute a Kuznets-style epochal innovation, and that economic and so- cial

  7. Synergy among international monitoring system technologies

    SciTech Connect (OSTI)

    Edenburn, M.W.; Bunting, M.L.; Payne, A.C.; Preston, R.R.; Trost, L.C.

    1996-08-01T23:59:59.000Z

    This paper describes the results of an International Monitoring System synergy study using Sandia National Laboratory`s IVSEM (Integrated Verification System Evaluation Model). The study compares individual subsystem performance (seismic, infrasound, radionuclide, and hydroacoustic) with integrated system performance. The integrated system exhibits synergy because different sensor technologies cover different locations; thus, the integrated system covers more locations than can any individual subsystem. Energy and system performance can be further enhanced by allowing mixed technology detection and location.

  8. International symposium on peat utilization

    SciTech Connect (OSTI)

    Fuchsman, C.H.; Spigarelli, S.A. (eds.)

    1983-01-01T23:59:59.000Z

    This symposium was designed to provide a forum for peat scientists and engineers to discuss recent developments in the utilization of peat. It is thus the second international peat symposium to be held in Bemidji, the first having occurred two years earlier. Delegates to the 1983 Symposium represented eight nations (Finland, Sweden, Ireland, The Netherlands, Poland, Hungary, Canada, and the US), and a broad spectrum of peat interests. The objective was to survey world-wide activities in peat utilization and to report interesting developments and research results. A separate abstract was prepared for each of 50 items; all will appear in the Energy Data Base, 2 in Energy Research Abstracts, and 16 in Energy Abstracts for Policy Analysis. One paper was processed earlier.

  9. International energy outlook 1994

    SciTech Connect (OSTI)

    Not Available

    1994-07-01T23:59:59.000Z

    The International Energy Outlook 1994 (IEO94) presents an assessment by the Energy Information Administration (EIA) of the outlook for international energy markets between 1990 and 2010. The report is provided as a statistical service to assist energy managers and analysts, both in government and in the private sector. These forecasts are used by international agencies, Federal and State governments, trade associations, and other planners and decisionmakers. They are published pursuant to the Depart. of Energy Organization Act of 1977 (Public Law 95-91), Section 205(c). The IEO94 projections are based on US and foreign government policies in effect on October 1, 1993-which means that provisions of the Climate Change Action Plan unveiled by the Administration in mid-October are not reflected by the US projections.

  10. International energy annual 1997

    SciTech Connect (OSTI)

    NONE

    1999-04-01T23:59:59.000Z

    The International Energy Annual presents an overview of key international energy trends for production, consumption, imports, and exports of primary energy commodities in over 220 countries, dependencies, and areas of special sovereignty. Also included are population and gross domestic product data, as well as prices for crude oil and petroleum products in selected countries. Renewable energy reported in the International Energy Annual includes hydroelectric power and geothermal, solar, and wind electric power. Also included are biomass electric power for Brazil and the US, and biomass, geothermal, and solar energy produced in the US and not used for electricity generation. This report is published to keep the public and other interested parties fully informed of primary energy supplies on a global basis. The data presented have been largely derived from published sources. The data have been converted to units of measurement and thermal values (Appendices E and F) familiar to the American public. 93 tabs.

  11. INTERNAL REPAIR OF PIPELINES

    SciTech Connect (OSTI)

    Robin Gordon; Bill Bruce; Nancy Porter; Mike Sullivan; Chris Neary

    2003-05-01T23:59:59.000Z

    The two broad categories of deposited weld metal repair and fiber-reinforced composite repair technologies were reviewed for potential application for internal repair of gas transmission pipelines. Both are used to some extent for other applications and could be further developed for internal, local, structural repair of gas transmission pipelines. Preliminary test programs were developed for both deposited weld metal repairs and for fiber-reinforced composite repair. To date, all of the experimental work pertaining to the evaluation of potential repair methods has focused on fiber-reinforced composite repairs. Hydrostatic testing was also conducted on four pipeline sections with simulated corrosion damage: two with composite liners and two without.

  12. International petroleum statistics report

    SciTech Connect (OSTI)

    Not Available

    1994-12-01T23:59:59.000Z

    This document is a monthly publication that provides current international oil data. The Report presents data on international oil production, demand, imports, exports, and stocks. Section 1 contains time series data on world oil production, and on oil demand and stocks in the OECD. Section 2 presents an oil supply/demand balance for the world. This balance is presented in quarterly intervals for the most recent two years. Section 3 presents data on oil imports by OECD countries. Section 4 presents annual time series data on world oil production and oil stocks, demand and trade in OECD countries.

  13. Technical Intern Go to www.fidelitycareers.com and apply to Req #1208187

    E-Print Network [OSTI]

    Pohl, Karsten

    Quality Assurance & Systems Analysis Intern Quality Assurance - Unit Testing, System Integration Testing relationship management software utilized by our call center representatives Quality Assurance tested Life-Cycle - focused on systems analysis, design, development, testing and support of software

  14. Enhancer Identification through Comparative Genomics

    E-Print Network [OSTI]

    Visel, Axel; Bristow, James; Pennacchio, Len A.

    2006-01-01T23:59:59.000Z

    through Comparative Genomics Axel Visel, James Bristow andWalnut Creek, CA 94598 USA. Genomics Division, MS 84-171,Len A. Pennacchio, Genomics Division, One Cyclotron Road, MS

  15. Computational Analysis of Merchant Marine GPS Data* CASOS Technical Report

    E-Print Network [OSTI]

    Sadeh, Norman M.

    . Keywords: Geospatial analysis, network analysis, clustering * This work was supported in partComputational Analysis of Merchant Marine GPS Data* CASOS Technical Report George B. Davis ISRI - Institute for Software Research International CASOS - Center for Computational Analysis

  16. 4, 43254360, 2007 Comparing model

    E-Print Network [OSTI]

    Paris-Sud XI, Universit de

    HESSD 4, 43254360, 2007 Comparing model performance in the Rhine basin A. H. te Linde et al. Title different atmospheric forcing data sets A. H. te Linde 1 , J. C. J. H. Aerts 1 , R. T. W. L. Hurkmans 2 Correspondence to: A. H. te Linde (aline.te.linde@ivm.vu.nl) 4325 #12;HESSD 4, 43254360, 2007 Comparing model

  17. Science and Technology Challenges for International Safeguards

    SciTech Connect (OSTI)

    Mark Schanfein

    2009-07-01T23:59:59.000Z

    The science and technology challenges for international safeguards range from cutting edge physics needs to practical technology solutions for high volume data handling and analysis issues. This paper will take a narrow look at some of the predominant challenges, which include those at high throughput commercial facilities and those in the detection of undeclared facilities. It is hoped that by highlighting these areas it can encourage a concerted effort by scientific institutions and industry to provide robust cost-effective solutions.

  18. IJOPE Paper No JC-343AB-final 9/26/04 Biausser Page number 1 Numerical Analysis of the Internal Kinematics and Dynamics of 3D Breaking Waves on Slopes

    E-Print Network [OSTI]

    Grilli, Stéphan T.

    Kinematics and Dynamics of 3D Breaking Waves on Slopes Benjamin Biausser1 , Stéphan T. Grilli2 , Philippe and internal kinematics (velocity, vorticity, pressure) are presented. KEY WORDS: breaking ocean waves years, our understanding of wave breaking dynamics and kinematics is still quite incomplete. Due

  19. Internal Control Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2008-10-28T23:59:59.000Z

    To ensure sound internal controls and overall consistency in exercising the statutory authorities that vest in the Secretary, the Administrator, National Nuclear Security Administration (NNSA), and Department's Chief Financial Officer (CFO), and to implement the Federal Managers' Financial Integrity Act of 1982 and related central agency guidance. Cancels DOE O 413.1A.

  20. International Student Guide

    E-Print Network [OSTI]

    International Student Guide #12;#12;Contents Measures of Quality ...................... 2 No matter Undergraduate programs of study: 250+ majors, minors and concentrations Graduate majors: 100+ Total enrollment-track faculty with doctorate/terminal degrees: 99% 1 #12;Measures of Quality To learn more about Colorado State

  1. Global Network International Relations

    E-Print Network [OSTI]

    Takada, Shoji

    on "Challenges in Organic Materials and Supramolecular Chemistry." The symposium was co-hosted by the Royal twenty-six talks by leading experts in the fields of porous, self-assembled and organic materials; supramolecular chemistry; and sensing and imaging. The 10th International Symposia on Advancing the Chemical

  2. admission guide International

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    Networks Computer Science Computer Science: Computer Game Design Electrical Engineering Communications2015/ 2016 admission guide International First-Year Students #12;2 3 WORLDWIDE RECOGNITION (2008, Science Watch) (2007, Science Watch) (2013, Times Higher Education World University Rankings) (2014, Times

  3. International Pacific Research Center

    E-Print Network [OSTI]

    Wang, Yuqing

    International Pacific Research Center APRIL 2007MARCH 2008 REPORT School of Ocean and Earth Center i Foreword ii iv Indo-Pacific Ocean Climate 1 Regional-Ocean Influences 13 Asian by the following broad research themes and goals of the IPRC Science Plan. Indo-Pacific Ocean Climate

  4. INTERNATIONAL PACIFIC RESEARCH CENTER

    E-Print Network [OSTI]

    Wang, Yuqing

    INTERNATIONAL PACIFIC RESEARCH CENTER APRIL 2005MARCH 2006 REPORT SCHOOL OF OCEAN AND EARTH Center 1 The Year's Highlights 3 Indo-Pacific Ocean Climate 4 Regional-Ocean Influences 10 Asian Ocean Climate: To understand climate variations in the Pacific and Indian oceans on interannual

  5. INTERNATIONAL PACIFIC RESEARCH CENTER

    E-Print Network [OSTI]

    Wang, Yuqing

    INTERNATIONAL PACIFIC RESEARCH CENTER Annual Report April 2006 March 2007 School of Ocean Research Center 1 2 The Year's Highlights 3 Research Accomplishments Indo-Pacific Ocean Climate 4 Regional-Ocean Ocean Climate: To understand climate variations in the Pacific and Indian oceans on inter- annual

  6. International energy outlook 1996

    SciTech Connect (OSTI)

    NONE

    1996-05-01T23:59:59.000Z

    This International Energy Outlook presents historical data from 1970 to 1993 and EIA`s projections of energy consumption and carbon emissions through 2015 for 6 country groups. Prospects for individual fuels are discussed. Summary tables of the IEO96 world energy consumption, oil production, and carbon emissions projections are provided in Appendix A. The reference case projections of total foreign energy consumption and of natural gas, coal, and renewable energy were prepared using EIA`s World Energy Projection System (WEPS) model. Reference case projections of foreign oil production and consumption were prepared using the International Energy Module of the National Energy Modeling System (NEMS). Nuclear consumption projections were derived from the International Nuclear Model, PC Version (PC-INM). Alternatively, nuclear capacity projections were developed using two methods: the lower reference case projections were based on analysts` knowledge of the nuclear programs in different countries; the upper reference case was generated by the World Integrated Nuclear Evaluation System (WINES)--a demand-driven model. In addition, the NEMS Coal Export Submodule (CES) was used to derive flows in international coal trade. As noted above, foreign projections of electricity demand are now projected as part of the WEPS. 64 figs., 62 tabs.

  7. Requirements for Xenon International

    SciTech Connect (OSTI)

    Hayes, James C.; Ely, James H.

    2013-09-26T23:59:59.000Z

    This document defines the requirements for the new Xenon International radioxenon system. The output of this project will be a Pacific Northwest National Laboratory (PNNL) developed prototype and a manufacturer-developed production prototype. The two prototypes are intended to be as close to matching as possible; this will be facilitated by overlapping development cycles and open communication between PNNL and the manufacturer.

  8. NEW EDITION! A comprehensive review of the changing patterns of the international pulpwood fiber trade.

    E-Print Network [OSTI]

    also includes data on specialized woodchip carriers, examines the international market for biofuels Regional analysis of changes in consumption/supply Analysis of international biofuels markets The 15 th importers/exporters, pulp producers, transport/shipping companies and investors. More than 70 export

  9. International energy indicators. [International and US statistics

    SciTech Connect (OSTI)

    Bauer, E.K. (ed.)

    1980-03-01T23:59:59.000Z

    For the international sector, a table of data is first presented followed by corresponding graph of the data for the following: (1) Iran: crude oil capacity, production, and shut-in, 1974 to February 1980; (2) Saudi Arabia (same as Iran); (3) OPEC (ex-Iran and Saudi Arabia); capacity, production, and shut-in, 1974 to January 1980; (4) non-OPEC Free World and US production of crude oil, 1973 to January 1980; (5) oil stocks: Free World, US, Japan, and Europe (landed), 1973 to 1979; (6) petroleum consumption by industrial countries, 1973 to October 1979; (7) USSR crude oil production, 1974 to February 1980; (8) Free World and US nuclear generation capacity, 1973 to January 1980. For the United States, the same data format is used for the following: (a) US imports of crude oil and products 1973 to January 1980; (b) landed cost of Saudi Arabia crude oil in current and 1974 dollars, 1974 to October 1979; (c) US trade in coal, 1973 to 1979; (d) summary of US merchandise trade, 1976 to January 1980; and (e) US energy/GNP ratio (in 1972 dollars), 1947 to 1979.

  10. Sensitivity of transitions in internal rotor molecules to a possible variation of the proton-to-electron mass ratio

    SciTech Connect (OSTI)

    Jansen, Paul; Ubachs, Wim; Bethlem, Hendrick L. [Institute for Lasers, Life and Biophotonics, VU University Amsterdam, De Boelelaan 1081, NL-1081 HV Amsterdam (Netherlands); Kleiner, Isabelle [Laboratoire Interuniversitaire des Systemes Atmospheriques (LISA), CNRS UMR 7583 et Universites Paris 7 et Paris Est, 61 avenue du General de Gaulle, FR-94010 Creteil Cedex (France); Xu, Li-Hong [Department of Physics and Centre for Laser, Atomic, and Molecular Sciences, University of New Brunswick, Saint John, New Brunswick, Canada E2L 4L5 (Canada)

    2011-12-15T23:59:59.000Z

    Recently, methanol was identified as a sensitive target system to probe variations of the proton-to-electron mass ratio {mu}[Jansen et al., Phys. Rev. Lett. 106, 100801 (2011)]. The high sensitivity of methanol originates from the interplay between overall rotation and hindered internal rotation of the molecule; that is, transitions that convert internal rotation energy into overall rotation energy, or vice versa, have an enhanced sensitivity coefficient, K{sub {mu}}. As internal rotation is a common phenomenon in polyatomic molecules, it is likely that other molecules display similar or even larger effects. In this paper we generalize the concepts that form the foundation of the high sensitivity in methanol and use this to construct an approximate model which makes it possible to estimate the sensitivities of transitions in internal rotor molecules with C{sub 3v} symmetry, without performing a full calculation of energy levels. We find that a reliable estimate of transition sensitivities can be obtained from the three rotational constants (A, B, and C) and three torsional constants (F, V{sub 3}, and {rho}). This model is verified by comparing obtained sensitivities for methanol, acetaldehyde, acetamide, methyl formate, and acetic acid with a full analysis of the molecular Hamiltonian. Of the molecules considered, methanol is by far the most suitable candidate for laboratory and cosmological tests searching for a possible variation of {mu}.

  11. International Perspective on Fukushima Accident

    Broader source: Energy.gov [DOE]

    Presenter: Miroslav Lipr, Head, Operational Safety Section, Department of Nuclear Safety and Security, International Atomic Energy Agency

  12. Hanford internal dosimetry program manual

    SciTech Connect (OSTI)

    Carbaugh, E.H.; Sula, M.J.; Bihl, D.E.; Aldridge, T.L.

    1989-10-01T23:59:59.000Z

    This document describes the Hanford Internal Dosimetry program. Program Services include administrating the bioassay monitoring program, evaluating and documenting assessments of internal exposure and dose, ensuring that analytical laboratories conform to requirements, selecting and applying appropriate models and procedures for evaluating internal radionuclide deposition and the resulting dose, and technically guiding and supporting Hanford contractors in matters regarding internal dosimetry. 13 refs., 16 figs., 42 tabs.

  13. International Refrigeration: Order (2012-CE-1510) | Department...

    Energy Savers [EERE]

    International Refrigeration: Order (2012-CE-1510) International Refrigeration: Order (2012-CE-1510) July 20, 2012 DOE ordered International Refrigeration Products to pay an 8,000...

  14. International Fuel Services and Commercial Engagement | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    International Fuel Services and Commercial Engagement International Fuel Services and Commercial Engagement The Office of International Nuclear Energy Policy and Cooperation...

  15. COMPARING FOREST MANAGEMENT PRACTICES UNDER

    E-Print Network [OSTI]

    COMPARING FOREST MANAGEMENT PRACTICES UNDER COMMUNITY-BASED AND CONVENTIONAL TENURES IN BRITISH OF MASTER OF RESOURCE MANAGEMENT In the School of Resource and Environmental Management © David Mealiea 2011 of Canada, this work may be reproduced, without authorization, under the conditions for Fair Dealing

  16. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    4.A.7 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURES LUNAR PIXIMUS MACHINE 1.0 Purpose This procedure outlines precautions, maintenance and use of the Lunar PIXImus Machine housed in room 310 BEB. 2.0 Scope This procedure applies to all CMLAF and principal investigator staff. 3

  17. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    3.E.1 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURES for ACCESS, and the correct way to leave the facility. 2.0 Scope: This procedure applies to all CMLAF staff, maintenance, ENTRY, AND EXIT PROCEDURES FOR THE ANIMAL BIOSAFETY SUITE ROOM 305 BEB 1.0 Purpose: The Biosafety suite

  18. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    5.A.4 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURE for CRITICAL Plant and maintenance personnel as well as CMLAF personnel that will be notified. 3.0 Procedure ALARM RESPONSE PROCEDURE FOR CHILLED WATER PLANT 1.0 Purpose: This SOP outlines the procedure

  19. COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES

    E-Print Network [OSTI]

    Krovi, Venkat

    1.E.1 COMPARATIVE MEDICINE LABORATORY ANIMAL FACILITIES STANDARD OPERATING PROCEDURE for ENTRY RODENT FACILITY 1. I have read, understand, and will follow the Standard Operating Procedures listed: This procedure applies to all CMLAF, principal investigator and maintenance personnel 3.0 Procedure: 3

  20. International Nuclear Security

    SciTech Connect (OSTI)

    Doyle, James E. [Los Alamos National Laboratory

    2012-08-14T23:59:59.000Z

    This presentation discusses: (1) Definitions of international nuclear security; (2) What degree of security do we have now; (3) Limitations of a nuclear security strategy focused on national lock-downs of fissile materials and weapons; (4) What do current trends say about the future; and (5) How can nuclear security be strengthened? Nuclear security can be strengthened by: (1) More accurate baseline inventories; (2) Better physical protection, control and accounting; (3) Effective personnel reliability programs; (4) Minimize weapons-usable materials and consolidate to fewer locations; (5) Consider local threat environment when siting facilities; (6) Implement pledges made in the NSS process; and (7) More robust interdiction, emergency response and special operations capabilities. International cooperation is desirable, but not always possible.

  1. WORKFLOW SIMULATION FOR INTERNATIONAL TRADE

    E-Print Network [OSTI]

    Thomborson, Clark

    WORKFLOW SIMULATION FOR INTERNATIONAL TRADE Qiang Dong Supervised by Professor Clark Thomborson's competitive world. International trade has received some academic attention as an application of Business Process Reengineering. A major issue in international trade is due to problems pertaining to mutual

  2. MENTAL HEALTH and INTERNATIONAL STUDENTS

    E-Print Network [OSTI]

    MENTAL HEALTH and INTERNATIONAL STUDENTS: What Educators Need to Know Ingle International cares not adequately researched, it is well accepted by health care professionals that early intervention could about you and your students www.studyinsured.com #12;www.studyinsured.comMental Health and International

  3. TOWARDS INTERNATIONAL STANDARDS FOR LANGUAGE

    E-Print Network [OSTI]

    Ide, Nancy

    ) developed by the International Standards Organization TC32 SC4, which is to serve as a basis for harmonizing. It is in this context that a committee of the International Standards Organization (ISO), TC 37/SC 4Chapter # TOWARDS INTERNATIONAL STANDARDS FOR LANGUAGE RESOURCES Nancy Ide and Laurent Romary

  4. TOWARDS INTERNATIONAL STANDARDS FOR LANGUAGE

    E-Print Network [OSTI]

    Boyer, Edmond

    ) developed by the International Standards Organization TC32 SC4, which is to serve as a basis for harmonizingChapter # TOWARDS INTERNATIONAL STANDARDS FOR LANGUAGE RESOURCES Nancy Ide and Laurent Romary-284" #12;2 Chapter # Language Engineering Standards (EAGLES) and the International Standard for Language

  5. INTERNATIONAL JOURNAL OF DEVELOPMENT ISSUES

    E-Print Network [OSTI]

    INTERNATIONAL JOURNAL OF DEVELOPMENT ISSUES VOL. 4 No. 2 December 2005 CONTENTS Jeffrey D. Sachs-97 and the Bulgarian currency board 95 #12;#12;International Journal of Development Issues Vol. 4, No. 2 (2005) 1 Science, University of Sydney, New South Wales, Australia. #12;J.D. Sachs /International Journal

  6. Polarized internal target apparatus

    DOE Patents [OSTI]

    Holt, R.J.

    1984-10-10T23:59:59.000Z

    A polarized internal target apparatus with a polarized gas target of improved polarization and density (achieved by mixing target gas atoms with a small amount of alkali metal gas atoms, and passing a high intensity polarized light source into the mixture to cause the alkali metal gas atoms to become polarized which interact in spin exchange collisions with target gas atoms yielding polarized target gas atoms) is described.

  7. International petroleum statistics report

    SciTech Connect (OSTI)

    Not Available

    1995-01-01T23:59:59.000Z

    This monthly publication provides current data on international oil production, demand, imports, exports, and stocks. Section 1 contains time series data on world oil production, and on oil demand and stocks in the OECD. Section 2 presents an oil supply/demand balance for the world. Section 3 presents data on oil imports by OECD countries. Section 4 presents annual time series data on world oil production and oil stocks, demand, and trade in OECD countries.

  8. International energy outlook 2006

    SciTech Connect (OSTI)

    NONE

    2006-06-15T23:59:59.000Z

    This report presents international energy projections through 2030, prepared by the Energy Information Administration. After a chapter entitled 'Highlights', the report begins with a review of world energy and economic outlook, followed by energy consumption by end-use sector. The next chapter is on world oil markets. Natural gas, world coal market and electricity consumption and supply are then discussed. The final chapter covers energy-related carbon dioxide emissions.

  9. International markets for CCTs

    SciTech Connect (OSTI)

    Ferriter, J.P. [International Energy Agency, Paris (France)

    1997-12-31T23:59:59.000Z

    The paper begins by describing the role of the International Energy Agency, the importance of coal, what the IEA is doing in the area of clean coal technology, and the role of the IEA Coal Industry Advisory Board. The paper then discusses which coal technologies will be chosen, what the problem areas are, and what can be done to accelerate the take-up of clean coal technologies.

  10. Comparative Study of Vented vs. Unvented Crawlspaces

    SciTech Connect (OSTI)

    Biswas, Kaushik [ORNL; Christian, Jeffrey E [ORNL; Gehl, Anthony C [ORNL

    2011-10-01T23:59:59.000Z

    There has been a significant amount of research in the area of building energy efficiency and durability. However, well-documented quantitative information on the impact of crawlspaces on the performance of residential structures is lacking. The objective of this study was to evaluate and compare the effects of two crawlspace strategies on the whole-house performance of a pair of houses in a mixed humid climate. These houses were built with advanced envelope systems to provide energy savings of 50% or more compared to traditional 2010 new construction. One crawlspace contains insulated walls and is sealed and semi-conditioned. The other is a traditional vented crawlspace with insulation in the crawlspace ceiling. The vented (traditional) crawlspace contains fiberglass batts installed in the floor chase cavities above the crawl, while the sealed and insulated crawlspace contains foil-faced polyisocyanurate foam insulation on the interior side of the masonry walls. Various sensors to measure temperatures, heat flux through crawlspace walls and ceiling, and relative humidity were installed in the two crawlspaces. Data from these sensors have been analyzed to compare the performance of the two crawlspace designs. The analysis results indicated that the sealed and insulated crawlspace design is better than the traditional vented crawlspace in the mixed humid climate.

  11. International petroleum statistics report

    SciTech Connect (OSTI)

    NONE

    1997-07-01T23:59:59.000Z

    The International Petroleum Statistics Report is a monthly publication that provides current international data. The report presents data on international oil production, demand, imports, and stocks. The report has four sections. Section 1 contains time series data on world oil production, and on oil demand and stocks in the Organization for Economic Cooperation and Development (OECD). This section contains annual data beginning in 1985, and monthly data for the most recent two years. Section 2 presents an oil supply/demand balance for the world. This balance is presented in quarterly intervals for the most recent two years. Section 3 presents data on oil imports by OECD countries. This section contains annual data for the most recent year, quarterly data for the most recent two quarters, and monthly data for the most recent 12 months. Section 4 presents annual time series data on world oil production and oil stocks, demand, and trade in OECD countries. World oil production and OECD demand data are for the years 1970 through 1996; OECD stocks from 1973 through 1996; and OECD trade from 1986 through 1996.

  12. Internal Audit OverviewInternal Audit Overview Audit's Role in Governance, Risk Management and Internal Control

    E-Print Network [OSTI]

    Buehrer, R. Michael

    Internal Audit OverviewInternal Audit Overview Audit's Role in Governance, Risk Management Activities - Risk Management Scope of Audit Activities - Risk Management Risk is the possibility exposures to risk, assessing the effectiveness of the University's risk management system, and contributing

  13. Lessons from a Comparative Analysis of California and PJM Electricity

    E-Print Network [OSTI]

    Delaware, University of

    .4 Market Performance Before the State's Crisis:1998-1999......................11 2.4.1 Wholesale Market.1.1 High Wholesale Prices.................................................................15 3..................................................................................16 3.2.1 Mismatch: Wholesale and Retail Electricity Prices.....................17 3.2.2 Lack

  14. Fast food in a Chinese provincial city: a comparative analysis

    E-Print Network [OSTI]

    Zhu, Haiying

    2006-08-16T23:59:59.000Z

    More than a decade ago American fast food entered the Chinese market. Since then the number of fast food and organized chain restaurants in China has multiplied. Chinese consumers, especially those who live in large urban ...

  15. Fast food in a Chinese provincial city: a comparative analysis

    E-Print Network [OSTI]

    Zhu, Haiying

    2006-08-16T23:59:59.000Z

    ), the attributes of criterion with which consumers differentiate between fast food restaurants are found to include: taste, price, nutrition, cleanliness, environment, speed of service, convenient location, fashion & novelty, friendliness, and variety of menu..., service, cleanliness, and general appearance. Considering the comprehension skills of students, I included only 15 multiple choice questions, making the questionnaire much shorter than the one I administered to consumers. The questionnaire was designed...

  16. Comparative analysis of aviation safety information feedback systems

    E-Print Network [OSTI]

    Funahashi, Yoshifuru

    2010-01-01T23:59:59.000Z

    In the aviation system, there are several feedback systems to prevent an accident. First of all, the accident and serious incident reporting and investigation system is established by the Chicago Convention. In general, ...

  17. Comparative Usability Study of Two Space Logistics Analysis Tools

    E-Print Network [OSTI]

    Lee, Chairwoo

    Future space exploration missions and campaigns will require sophisticated tools to help plan and analyze logistics. To encourage their use, space logistics tools must be usable: a design concept encompassing terms such ...

  18. Comparative Analysis of Second Language Instruction and Motivation

    E-Print Network [OSTI]

    Speights, Lara A.

    2010-07-14T23:59:59.000Z

    school second language instruction in Buenos Aires, Argentina and College Station, Texas. The purpose of this study is to explain theoretical and motivational pedagogical strategies, as well as to understand the differences in motivation and how...

  19. RESEARCH ARTICLE Open Access Comparative analysis of missing value imputation

    E-Print Network [OSTI]

    Paris-Sud XI, Universit de

    algorithms is a complex task, we observed that k-means approach is more efficient to conserve gene obtained by classical clustering methods, e.g., hierarchical clustering [19], k-means clustering [20 the quality of the imputation method and the gene cluster stability. Even if the comparison between clustering

  20. Accuracy of Contemporary Parametric Software Estimation Models: A Comparative Analysis

    E-Print Network [OSTI]

    Tomkins, Andrew

    with delays and being costly and error- prone. Inaccurate estimation of project resources is considered as one the costs, schedule and the resources for IT projects. Software estimation is the process of predicting the effort, duration and cost required to develop a software system [2]. Estimators often rely on one or more

  1. analysis comparing responses: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    tax revenues of the Consolidated Budget of Ukraine took place. With Approval of the Budgetary Code the situation slightly improved as far as local finances are concerned. As a...

  2. Using IMG: Comparative Analysis with the Integrated Microbial Genomes System

    E-Print Network [OSTI]

    2008-01-01T23:59:59.000Z

    for genome annotation: PRIAM. Nucleic Acids Research 31 (RPS-BLAST against the PRIAM database (12), as a complementBLAST computations. Computation COG PRIAM Tool Low- Maximum

  3. Comparative analysis of sesame varieties from diverse climates

    E-Print Network [OSTI]

    Nwe, Tin

    1986-01-01T23:59:59.000Z

    -LP-3-4 Pa lorna Eva U. S. A. U. S. A. U. S. A. U. S. A. U. S. A. Yambio Bakibo Bura Jar Sudan Sudan Sudan Sudan 12 2. Days to first flowering - They were calculated by observing the number of days from planting to the first bloom. 3..., SW-16, and SB-9-LP-3-4, produced the heaviest seed while the varieties, Jar and Kyemachaung produced the lightest. Judian, Nedawletthe, Pope Pye, Yegyaw, Gwataya, UCR-3-RA-12, Paloma, Eva, Yambio, Bakibo, and Bura, produced seed that were medium...

  4. Phylogeny and comparative genome analysis of a Basidiomycete fungi

    E-Print Network [OSTI]

    Riley, Robert W.

    2011-01-01T23:59:59.000Z

    lack carbohydrate metabolism enzymes 9,1893 clusters 190,095 proteins ?Protein kinase Aldo_ket_red GMC_oxred_C Aldo-keto reductase Oxidoreductase, possible cellobiose dehydrogenase ?Brown rots (BR) virtually lack

  5. COMPARATIVE STATISTICAL ANALYSIS OF TEST PARTS MANUFACTURED IN PRODUCTION

    E-Print Network [OSTI]

    Gilsinn, David E.

    measured using a laser ball bar instrument. Twenty-one copies of the part were produced and measured to actual part error uncertainties. Keywords: coordinate measuring machine, drilling, error uncertainties, laser ball bar, machine tools, machine tool errors, milling, Monte Carlo, propagation of uncertainty

  6. User-orientated comparative analysis of climate compatible development...

    Open Energy Info (EERE)

    private sector, NGO and country-led methodologies for climate compatible development strategy building and planning. There are many methodologies being developed and utilised...

  7. A comparative analysis of area navigation systems for general aviation

    E-Print Network [OSTI]

    Dodge, Steven Malcolm

    1973-01-01T23:59:59.000Z

    Within the next decade area navigation is to become the primary method of air navigation within the United States. There are numerous radio navigation systems that offer the capabilities of area navigation to general ...

  8. Comparative analysis of proteome and transcriptome variation in mouse

    E-Print Network [OSTI]

    2011-01-01T23:59:59.000Z

    Ghazalpour 1 * . , Brian Bennett 1. , Vladislav A. PetyukNat Genet 41: 166167. 12. Bennett BJ, Farber CR, Orozco L,Citation: Ghazalpour A, Bennett B, Petyuk VA, Orozco L,

  9. ccsd00001953, A comparative analysis of the electron energy

    E-Print Network [OSTI]

    -1027, 11801 M#19;exico D. F., MEXICO E-mail: cgt@nuclear.inin.mx Abstract. To establish the electron energy

  10. Comparative Genomic Analysis of Human Fungal Pathogens Causing Paracoccidioidomycosis

    E-Print Network [OSTI]

    Holder, Jason W.

    Paracoccidioides is a fungal pathogen and the cause of paracoccidioidomycosis, a health-threatening human systemic mycosis endemic to Latin America. Infection by Paracoccidioides, a dimorphic fungus in the order Onygenales, ...

  11. Comparative DNA Sequence Analysis of Wheat and Rice Genomes

    E-Print Network [OSTI]

    Gill, Kulvinder

    . Gill,4 David E. Matthews,5 Gerard R. Lazo,5 Shiaoman Chao,5 Olin D. Anderson,5 Hugh Edwards,6 Anna M,8 Nora L.V. Lapitan,8 Jose L. Gonzalez-Hernandez,9 James A. Anderson,9 Khwaja Hossain,10 Venu. Gill,12 Camille Steber,12 Mary K. Walker-Simmons,13 Patrick E. McGuire,14 and Calvin O. Qualset14 1

  12. User-orientated comparative analysis of climate compatible development

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown of Ladoga,planning methodologies and tools | Open Energy Information

  13. The International Large Detector: Letter of Intent

    E-Print Network [OSTI]

    Abe, Toshinori; Abramowicz, Halina; Adamus, Marek; Adeva, Bernardo; Afanaciev, Konstantin; Aguilar-Saavedra, Juan Antonio; Alabau Pons, Carmen; Albrecht, Hartwig; Andricek, Ladislav; Anduze, Marc; Aplin, Steve J.; Arai, Yasuo; Asano, Masaki; Attie, David; Attree, Derek J.; Burger, Jochen; Bailey, David; Balbuena, Juan Pablo; Ball, Markus; Ballin, James; Barbi, Mauricio; Barlow, Roger; Bartels, Christoph; Bartsch, Valeria; Bassignana, Daniela; Bates, Richard; Baudot, Jerome; Bechtle, Philip; Beck, Jeannine; Beckmann, Moritz; Bedjidian, Marc; Behnke, Ties; Belkadhi, Khaled; Bellerive, Alain; Bentvelsen, Stan; Bergauer, Thomas; Berggren, C.Mikael U.; Bergholz, Matthias; Bernreuther, Werner; Besancon, Marc; Besson, Auguste; Bhattacharya, Sudeb; Bhuyan, Bipul; Biebel, Otmar; Bilki, Burak; Blair, Grahame; Blumlein, Johannes; Bo, Li; Boisvert, Veronique; Bondar, A.; Bonvicini, Giovanni; Boos, Eduard; Boudry, Vincent; Bouquet, Bernard; Bouvier, Joel; Bozovic-Jelisavcic, Ivanka; Brient, Jean-Claude; Brock, Ian; Brogna, Andrea; Buchholz, Peter; Buesser, Karsten; Bulgheroni, Antonio; Butler, John; Buttar, Craig; Buzulutskov, A.F.; Caccia, Massimo; Caiazza, Stefano; Calcaterra, Alessandro; Caldwell, Allen; Callier, Stephane L.C.; Calvo Alamillo, Enrique; Campbell, Michael; Campbell, Alan J.; Cappellini, Chiara; Carloganu, Cristina; Castro, Nuno; Castro Carballo, Maria Elena; Chadeeva, Marina; Chakraborty, Dhiman; Chang, Paoti; Charpy, Alexandre; Chen, Xun; Chen, Shaomin; Chen, Hongfang; Cheon, Byunggu; Choi, Suyong; Choudhary, B.C.; Christen, Sandra; Ciborowski, Jacek; Ciobanu, Catalin; Claus, Gilles; Clerc, Catherine; Coca, Cornelia; Colas, Paul; Colijn, Auke; Colledani, Claude; Combaret, Christophe; Cornat, Remi; Cornebise, Patrick; Corriveau, Francois; Cvach, Jaroslav; Czakon, Michal; D'Ascenzo, Nicola; Da Silva, Wilfrid; Dadoun, Olivier; Dam, Mogens; Damerell, Chris; Danilov, Mikhail; Daniluk, Witold; Daubard, Guillaume; David, Dorte; David, Jacques; De Boer, Wim; De Groot, Nicolo; De Jong, Sijbrand; De Jong, Paul; De La Taille, Christophe; De Masi, Rita; De Roeck, Albert; Decotigny, David; Dehmelt, Klaus; Delagnes, Eric; Deng, Zhi; Desch, Klaus; Dieguez, Angel; Diener, Ralf; Dima, Mihai-Octavian; Dissertori, Gunther; Dixit, Madhu S.; Dolezal, Zdenek; Dolgoshein, Boris A.; Dollan, Ralph; Dorokhov, Andrei; Doublet, Philippe; Doyle, Tony; Doziere, Guy; Dragicevic, Marko; Drasal, Zbynek; Drugakov, Vladimir; Duarte Campderros, Jordi; Dulucq, Frederic; Dumitru, Laurentiu Alexandru; Dzahini, Daniel; Eberl, Helmut; Eckerlin, Guenter; Ehrenfeld, Wolfgang; Eigen, Gerald; Eklund, Lars; Elsen, Eckhard; Elsener, Konrad; Emeliantchik, Igor; Engels, Jan; Evrard, Christophe; Fabbri, Riccardo; Faber, Gerard; Faucci Giannelli, Michele; Faus-Golfe, Angeles; Feege, Nils; Feng, Cunfeng; Ferencei, Jozef; Fernandez Garcia, Marcos; Filthaut, Frank; Fleck, Ivor; Fleischer, Manfred; Fleta, Celeste; Fleury, Julien L.; Fontaine, Jean-Charles; Foster, Brian; Fourches, Nicolas; Fouz, Mary-Cruz; Frank, Sebastian; Frey, Ariane; Frotin, Mickael; Fujii, Hirofumi; Fujii, Keisuke; Fujimoto, Junpei; Fujita, Yowichi; Fusayasu, Takahiro; Fuster, Juan; Gaddi, Andrea; Gaede, Frank; Galkin, Alexei; Galkin, Valery; Gallas, Abraham; Gallin-Martel, Laurent; Gamba, Diego; Gao, Yuanning; Garrido Beltran, Lluis; Garutti, Erika; Gastaldi, Franck; Gaur, Bakul; Gay, Pascal; Gellrich, Andreas; Genat, Jean-Francois; Gentile, Simonetta; Gerwig, Hubert; Gibbons, Lawrence; Ginina, Elena; Giraud, Julien; Giraudo, Giuseppe; Gladilin, Leonid; Goldstein, Joel; Gonzalez Sanchez, Francisco Javier; Gournaris, Filimon; Greenshaw, Tim; Greenwood, Z.D.; Grefe, Christian; Gregor, Ingrid-Maria; Grenier, Gerald Jean; Gris, Philippe; Grondin, Denis; Grunewald, Martin; Grzelak, Grzegorz; Gurtu, Atul; Haas, Tobias; Haensel, Stephan; Hajdu, Csaba; Hallermann, Lea; Han, Liang; Hansen, Peter H.; Hara, Takanori; Harder, Kristian; Hartin, Anthony; Haruyama, Tomiyoshi; Harz, Martin; Hasegawa, Yoji; Hauschild, Michael; He, Qing; Hedberg, Vincent; Hedin, David; Heinze, Isa; Helebrant, Christian; Henschel, Hans; Hensel, Carsten; Hertenberger, Ralf; Herve, Alain; Higuchi, Takeo; Himmi, Abdelkader; Hironori, Kazurayama; Hlucha, Hana; Hommels, Bart; Horii, Yasuyuki; Horvath, Dezso; Hostachy, Jean-Yves; Hou, Wei-Shu; Hu-Guo, Christine; Huang, Xingtao; Huppert, Jean Francois; Ide, Yasuhiro; Idzik, Marek; Iglesias Escudero, Carmen; Ignatenko, Alexandr; Igonkina, Olga; Ikeda, Hirokazu; Ikematsu, Katsumasa; Ikemoto, Yukiko; Ikuno, Toshinori; Imbault, Didier; Imhof, Andreas; Imhoff, Marc; Ingbir, Ronen; Inoue, Eiji

    2010-01-01T23:59:59.000Z

    The International Large Detector (ILD) is a concept for a detector at the International Linear Collider, ILC. The ILC will collide electrons and positrons at energies of initially 500 GeV, upgradeable to 1 TeV. The ILC has an ambitious physics program, which will extend and complement that of the Large Hadron Collider (LHC). A hallmark of physics at the ILC is precision. The clean initial state and the comparatively benign environment of a lepton collider are ideally suited to high precision measurements. To take full advantage of the physics potential of ILC places great demands on the detector performance. The design of ILD is driven by these requirements. Excellent calorimetry and tracking are combined to obtain the best possible overall event reconstruction, including the capability to reconstruct individual particles within jets for particle ow calorimetry. This requires excellent spatial resolution for all detector systems. A highly granular calorimeter system is combined with a central tracker which st...

  14. Framework for a Comparative Accelerated Testing Standard for PV Modules: Preprint

    SciTech Connect (OSTI)

    Kurtz, S.; Wohlgemuth, J.; Yamamichi, M.; Sample, T.; Miller, D.; Meakin, D.; Monokroussos, C.; TamizhMani, M.; Kempe, M.; Jordan, D.; Bosco, N.; Hacke, P.; Bermudez, V.; Kondo, M.

    2013-08-01T23:59:59.000Z

    As the photovoltaic industry has grown, the interest in comparative accelerated testing has also grown. Private test labs offer testing services that apply greater stress than the standard qualification tests as tools for differentiating products and for gaining increased confidence in long-term PV investments. While the value of a single international standard for comparative accelerated testing is widely acknowledged, the development of a consensus is difficult. This paper strives to identify a technical basis for a comparative standard.

  15. M. Toubin, C. Dumont, E. P. Verrechia, O. Lalligant, A. Diou, F. Truchetet, and M. A. Abidi, "A Multi-scale Analysis of shell growth increments using wavelet transform," Computers & Geosciences, Journal of the International Association for Mathematical Ge

    E-Print Network [OSTI]

    Abidi, Mongi A.

    been tried (Dolman, 1975) using a Fourier transform. This method, based on power spectra analysis Multi-scale Analysis of shell growth increments using wavelet transform," Computers & Geosciences of environments). The search for these two types of information inside accretionary shells of living or fossil

  16. Numerical and experimental investigation of melting with internal heat generation within cylindrical enclosures

    SciTech Connect (OSTI)

    Amber Shrivastava; Brian Williams; Ali S. Siahpush; Bruce Savage; John Crepeau

    2014-06-01T23:59:59.000Z

    There have been significant efforts by the heat transfer community to investigate the melting phenomenon of materials. These efforts have included the analytical development of equations to represent melting, numerical development of computer codes to assist in modeling the phenomena, and collection of experimental data. The understanding of the melting phenomenon has application in several areas of interest, for example, the melting of a Phase Change Material (PCM) used as a thermal storage medium as well as the melting of the fuel bundle in a nuclear power plant during an accident scenario. The objective of this research is two-fold. First a numerical investigation, using computational fluid dynamics (CFD), of melting with internal heat generation for a vertical cylindrical geometry is presented. Second, to the best of authors knowledge, there are very limited number of engineering experimental results available for the case of melting with Internal Heat Generation (IHG). An experiment was performed to produce such data using resistive, or Joule, heating as the IHG mechanism. The numerical results are compared against the experimental results and showed favorable correlation. Uncertainties in the numerical and experimental analysis are discussed. Based on the numerical and experimental analysis, recommendations are made for future work.

  17. AVTA: 2010 Electric Vehicles International Neighborhood Electric...

    Energy Savers [EERE]

    10 Electric Vehicles International Neighborhood Electric Vehicle Testing Results AVTA: 2010 Electric Vehicles International Neighborhood Electric Vehicle Testing Results The...

  18. Natural System Evaluation and Tool Development: International...

    Energy Savers [EERE]

    Natural System Evaluation and Tool Development: International Collaborations - FY'13 Progress Report Natural System Evaluation and Tool Development: International Collaborations -...

  19. International Collaborations on Engineered Barrier Systems: Experiment...

    Energy Savers [EERE]

    International Collaborations on Engineered Barrier Systems: Experimental and Modeling Investigations International Collaborations on Engineered Barrier Systems: Experimental and...

  20. Upcoming Webinar December 16: International Hydrogen Infrastructure...

    Energy Savers [EERE]

    Upcoming Webinar December 16: International Hydrogen Infrastructure Challenges NOW, DOE, and NEDO Upcoming Webinar December 16: International Hydrogen Infrastructure Challenges...

  1. INTERNAL REPAIR OF PIPELINES

    SciTech Connect (OSTI)

    Robin Gordon; Bill Bruce; Ian Harris; Dennis Harwig; Nancy Porter; Mike Sullivan; Chris Neary

    2004-04-12T23:59:59.000Z

    The two broad categories of deposited weld metal repair and fiber-reinforced composite liner repair technologies were reviewed for potential application for internal repair of gas transmission pipelines. Both are used to some extent for other applications and could be further developed for internal, local, structural repair of gas transmission pipelines. Preliminary test programs were developed for both deposited weld metal repair and for fiber-reinforced composite liner repair. Evaluation trials have been conducted using a modified fiber-reinforced composite liner provided by RolaTube and pipe sections without liners. All pipe section specimens failed in areas of simulated damage. Pipe sections containing fiber-reinforced composite liners failed at pressures marginally greater than the pipe sections without liners. The next step is to evaluate a liner material with a modulus of elasticity approximately 95% of the modulus of elasticity for steel. Preliminary welding parameters were developed for deposited weld metal repair in preparation of the receipt of Pacific Gas & Electric's internal pipeline welding repair system (that was designed specifically for 559 mm (22 in.) diameter pipe) and the receipt of 559 mm (22 in.) pipe sections from Panhandle Eastern. The next steps are to transfer welding parameters to the PG&E system and to pressure test repaired pipe sections to failure. A survey of pipeline operators was conducted to better understand the needs and performance requirements of the natural gas transmission industry regarding internal repair. Completed surveys contained the following principal conclusions: (1) Use of internal weld repair is most attractive for river crossings, under other bodies of water, in difficult soil conditions, under highways, under congested intersections, and under railway crossings. (2) Internal pipe repair offers a strong potential advantage to the high cost of horizontal direct drilling (HDD) when a new bore must be created to solve a leak or other problem. (3) Typical travel distances can be divided into three distinct groups: up to 305 m (1,000 ft.); between 305 m and 610 m (1,000 ft. and 2,000 ft.); and beyond 914 m (3,000 ft.). All three groups require pig-based systems. A despooled umbilical system would suffice for the first two groups which represents 81% of survey respondents. The third group would require an onboard self-contained power unit for propulsion and welding/liner repair energy needs. (4) Pipe diameter sizes range from 50.8 mm (2 in.) through 1,219.2 mm (48 in.). The most common size range for 80% to 90% of operators surveyed is 508 mm to 762 mm (20 in. to 30 in.), with 95% using 558.8 mm (22 in.) pipe. An evaluation of potential repair methods clearly indicates that the project should continue to focus on the development of a repair process involving the use of GMAW welding and on the development of a repair process involving the use of fiber-reinforced composite liners.

  2. Internal absorber solar collector

    DOE Patents [OSTI]

    Sletten, Carlyle J. (106 Nagog Hill Rd., Acton, MA 01720); Herskovitz, Sheldon B. (88 Hammond St., Acton, MA 01720); Holt, F. S. (46 Emerson Rd., Winchester, MA 01890); Sletten, E. J. (Chestnut Hill Rd. R.F.D. Rte. #4, Amherst, NH 03031)

    1981-01-01T23:59:59.000Z

    Thin solar collecting panels are described made from arrays of small rod collectors consisting of a refracting dielectric rod lens with an absorber imbedded within it and a reflecting mirror coated on the back side of the dielectric rod. Non-tracking collector panels on vertical walls or roof tops receive approximately 90% of solar radiation within an acceptance zone 60.degree. in elevation angle by 120.degree. or more in the azimuth sectors with a collector concentration ratio of approximately 3.0. Miniaturized construction of the circular dielectric rods with internal absorbers reduces the weight per area of glass, plastic and metal used in the collector panels. No external parts or insulation are needed as heat losses are low due to partial vacuum or low conductivity gas surrounding heated portions of the collector. The miniature internal absorbers are generally made of solid copper with black selective surface and the collected solar heat is extracted at the collector ends by thermal conductivity along the absorber rods. Heat is removed from end fittings by use of liquid circulants. Several alternate constructions are provided for simplifying collector panel fabrication and for preventing the thermal expansion and contraction of the heated absorber or circulant tubes from damaging vacuum seals. In a modified version of the internal absorber collector, oil with temperature dependent viscosity is pumped through a segmented absorber which is now composed of closely spaced insulated metal tubes. In this way the circulant is automatically diverted through heated portions of the absorber giving higher collector concentration ratios than theoretically possible for an unsegmented absorber.

  3. Internal combustion engine

    SciTech Connect (OSTI)

    Evans, H.G.; Speer, S.

    1991-12-31T23:59:59.000Z

    This patent describes improvement in a 2-cycle, diesel cycle internal combustion engine comprising a single in-line engine block, internal wall surfaces defining at least one cylinder within the engine block, the central longitudinal axis of each cylinder being within a common plane extending longitudinally of the engine block, the axially extending internal wall surface of each cylinder being closed at one end and having at least one air intake port therethrough, a piston axially and reciprocally movable within each cylinder over a permitted stroke distance, so as to alternately cover and expose each air intake port for a finite time period; an exhaust port at the closed end of the cylinder above the piston, and a mechanically operated valve for opening and closing such exhaust port located immediately adjacent such port, a substantially rigid connecting rod pivotably connected at one end of each piston, and a crankshaft, rotatably connected to the second end of each connecting rod, such that the crankshaft is caused to rotate connecting means between the piston and the connecting rod. The improvement comprises the diameter of the cylinder is greater than the permitted stroke distance of the piston within the cylinder, and the axis of the crankshaft is parallel to and laterally offset from the common plane by a distance sufficient to form an angle alpha between the connecting rod and the axis of the cylinder, when the piston is at top-dead center, of at least about 12 degrees, such that the time during which each air intake port is exposed is increased when the direction of crankshaft rotation is opposite to the direction of the crankshaft offset from the common plane.

  4. DOE Hydrogen Program Systems Analysis Workshop

    E-Print Network [OSTI]

    ) Define analysis scenarios NREL SYSTEMS INTEGRATION Accountable for analysis activities Provide inputs Coordinate and provide ideas/recommendations to SI on cross-cutting analysis Manage analysis tasks internal to DOE (Labs/FFRDCs only) Perform analysis of technoeconomic topics for TA and SI Perform subprogram

  5. International Business Machines Corporation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    We respond below to DOE's questions. In Exhibit A we compare the terms of the CRADA, WFO and Proprietary and Non-Proprietary User Agreements and we suggest and explain...

  6. International energy annual 1995

    SciTech Connect (OSTI)

    NONE

    1996-12-01T23:59:59.000Z

    The International Energy Annual presents information and trends on world energy production and consumption for petroleum, natural gas, coal, and electricity. Production and consumption data are reported in standard units as well as British thermal units (Btu). Trade and reserves are shown for petroleum, natural gas, and coal. Data are provided on crude oil refining capacity and electricity installed capacity by type. Prices are included for selected crude oils and for refined petroleum products in selected countries. Population and Gross Domestic Product data are also provided.

  7. International energy outlook 2005

    SciTech Connect (OSTI)

    NONE

    2005-07-01T23:59:59.000Z

    This report presents international energy projections through 2025, prepared by the Energy Information Administration. The outlooks for major energy fuels are discussed, along with electricity, transportation, and environmental issues. After a chapter entitled 'Highlights', the report begins with a review of world energy and an economic outlook. The IEO2005 projections cover a 24 year period. The next chapter is on world oil markets. Natural gas and coal reserves and resources, consumption and trade discussed. The chapter on electricity deals with primary fuel use for electricity generation, and regional developments. The final section is entitled 'Energy-related greenhouse gas emissions'.

  8. International energy annual, 1993

    SciTech Connect (OSTI)

    NONE

    1995-05-08T23:59:59.000Z

    This document presents an overview of key international energy trends for production, consumption, imports, and exports of primary energy commodities in over 200 countries, dependencies, and areas of special sovereignty. Also included are population and gross domestic product data, as well as prices for crude oil and petroleum products in selected countries. Renewable energy includes hydroelectric, geothermal, solar and wind electric power and alcohol for fuel. The data were largely derived from published sources and reports from US Embassy personnel in foreign posts. EIA also used data from reputable secondary sources, industry reports, etc.

  9. International Energy Statistics - EIA

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItemResearch > The Energy Materials Center at CornellOfvia aEnergyInternational

  10. Sandia Energy - International Leadership

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Scienceand RequirementsCoatingsUltra-High-VoltagePower Company'sInAsInternational Leadership Home

  11. NEAC International Subcommittee Recommendations

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaeferApril 1,(EAC)TABLEChallenges areNational Defense IndustrialInternational

  12. Effects of Various Blowout Panel Configurations on the Structural Response of LANL Building 16-340 to Internal Explosions

    SciTech Connect (OSTI)

    Jason P. Wilke

    2005-09-30T23:59:59.000Z

    The risk of accidental detonation is present whenever any type of high explosives processing activity is performed. These activities are typically carried out indoors to protect processing equipment from the weather and to hide possibly secret processes from view. Often, highly strengthened reinforced concrete buildings are employed to house these activities. These buildings may incorporate several design features, including the use of lightweight frangible blowout panels, to help mitigate blast effects. These panels are used to construct walls that are durable enough to withstand the weather, but are of minimal weight to provide overpressure relief by quickly moving outwards and creating a vent area during an accidental explosion. In this study the behavior of blowout panels under various blast loading conditions was examined. External loadings from explosions occurring in nearby rooms were of primary interest. Several reinforcement systems were designed to help blowout panels resist failure from external blast loads while still allowing them to function as vents when subjected to internal explosions. The reinforcements were studied using two analytical techniques, yield-line analysis and modal analysis, and the hydrocode AUTODYN. A blowout panel reinforcement design was created that could prevent panels from being blown inward by external explosions. This design was found to increase the internal loading of the building by 20%, as compared with nonreinforced panels. Nonreinforced panels were found to increase the structural loads by 80% when compared to an open wall at the panel location.

  13. Energy analysis program. 1994 annual report

    SciTech Connect (OSTI)

    Levine, M.D.

    1995-04-01T23:59:59.000Z

    This report provides an energy analysis overview. The following topics are described: building energy analysis; urban and energy environmental issues; appliance energy efficiency standards; utility planning and policy; energy efficiency, economics, and policy issues; and international energy and environmental issues.

  14. International energy outlook 1998

    SciTech Connect (OSTI)

    NONE

    1998-04-01T23:59:59.000Z

    The International Energy Outlook 1998 (IEO98) presents an assessment by the Energy Information Administration (EIA) of the outlook for international energy markets through 2020. Projections in IEO98 are displaced according to six basic country groupings. The industrialized region includes projections for four individual countries -- the United States, Canada, Mexico, and Japan -- along with the subgroups Western Europe and Australasia (defined as Australia, New Zealand, and the US Territories). The developing countries are represented by four separate regional subgroups: developing Asia, Africa, Middle East, and Central and South America. China and India are represented in developing Asia. New to this year`s report, country-level projections are provided for Brazil -- which is represented in Central and South America. Eastern Europe and the former Soviet Union (EE/FSU) are considered as a separate country grouping. The report begins with a review of world trends in energy demand. Regional consumption projections for oil, natural gas, coal, nuclear power, and renewable energy (hydroelectricity, geothermal, wind, solar, and other renewables) are presented in five fuel chapters, with a review of the current status of each fuel on a worldwide basis. Summary tables of the IEO98 projections for world energy consumption, carbon emissions, oil production, and nuclear power generating capacity are provided in Appendix A. 88 figs., 77 tabs.

  15. The International Linear Collider

    E-Print Network [OSTI]

    Barish, Barry

    2013-01-01T23:59:59.000Z

    In this article, we describe the key features of the recently completed technical design for the International Linear Collider (ILC), a 200-500 GeV linear electron-positron collider (expandable to 1 TeV) that is based on 1.3 GHz superconducting radio-frequency (SCRF) technology. The machine parameters and detector characteristics have been chosen to complement the Large Hadron Collider physics, including the discovery of the Higgs boson, and to further exploit this new particle physics energy frontier with a precision instrument. The linear collider design is the result of nearly twenty years of R&D, resulting in a mature conceptual design for the ILC project that reflects an international consensus. We summarize the physics goals and capability of the ILC, the enabling R&D and resulting accelerator design, as well as the concepts for two complementary detectors. The ILC is technically ready to be proposed and built as a next generation lepton collider, perhaps to be built in stages beginning as a Hig...

  16. International petroleum statistics report

    SciTech Connect (OSTI)

    NONE

    1995-11-01T23:59:59.000Z

    The International Petroleum Statistics Report presents data on international oil production, demand, imports, exports, and stocks. The report has four sections. Section 1 contains time series data on world oil production, and on oil demand and stocks in the Organization for Economic Cooperation and Development (OECD). This section contains annual data beginning in 1985, and monthly data for the most recent two years. Section 2 presents an oil supply/demand balance for the world. This balance is presented in quarterly intervals for the most recent two years. Section 3 presents data on oil imports by OECD countries. This section contains annual data for the most recent year, quarterly data for the most recent two quarters, and monthly data for the most recent twelve months. Section 4 presents annual time series data on world oil production and oil stocks, demand, and trade in OECD countries. World oil production and OECD demand data are for the years 1970 through 1994; OECD stocks from 1973 through 1994; and OECD trade from 1984 through 1994.

  17. International Clean Energy Coalition

    SciTech Connect (OSTI)

    Erin Skootsky; Matt Gardner; Bevan Flansburgh

    2010-09-28T23:59:59.000Z

    In 2003, the National Association of Regulatory Utility Commissioners (NARUC) and National Energy Technology Laboratories (NETL) collaboratively established the International Clean Energy Coalition (ICEC). The coalition consisting of energy policy-makers, technologists, and financial institutions was designed to assist developing countries in forming and supporting local approaches to greenhouse gas mitigation within the energy sector. ICEC's work focused on capacity building and clean energy deployment in countries that rely heavily on fossil-based electric generation. Under ICEC, the coalition formed a steering committee consisting of NARUC members and held a series of meetings to develop and manage the workplan and define successful outcomes for the projects. ICEC identified India as a target country for their work and completed a country assessment that helped ICEC build a framework for discussion with Indian energy decisionmakers including two follow-on in-country workshops. As of the conclusion of the project in 2010, ICEC had also conducted outreach activities conducted during United Nations Framework Convention on Climate Change (UNFCCC) Ninth Conference of Parties (COP 9) and COP 10. The broad goal of this project was to develop a coalition of decision-makers, technologists, and financial institutions to assist developing countries in implementing affordable, effective and resource appropriate technology and policy strategies to mitigate greenhouse gas emissions. Project goals were met through international forums, a country assessment, and in-country workshops. This project focused on countries that rely heavily on fossil-based electric generation.

  18. Understanding Lustre Internals

    SciTech Connect (OSTI)

    Wang, Feiyi [ORNL; Oral, H Sarp [ORNL; Shipman, Galen M [ORNL; Drokin, Oleg [ORNL; Wang, Di [ORNL; Huang, He [ORNL

    2009-04-01T23:59:59.000Z

    Lustre was initiated and funded, almost a decade ago, by the U.S. Department of Energy (DoE) Office of Science and National Nuclear Security Administration laboratories to address the need for an open source, highly-scalable, high-performance parallel filesystem on by then present and future supercomputing platforms. Throughout the last decade, it was deployed over numerous medium-to-large-scale supercomputing platforms and clusters, and it performed and met the expectations of the Lustre user community. As it stands at the time of writing this document, according to the Top500 list, 15 of the top 30 supercomputers in the world use Lustre filesystem. This report aims to present a streamlined overview on how Lustre works internally at reasonable details including relevant data structures, APIs, protocols and algorithms involved for Lustre version 1.6 source code base. More importantly, it tries to explain how various components interconnect with each other and function as a system. Portions of this report are based on discussions with Oak Ridge National Laboratory Lustre Center of Excellence team members and portions of it are based on our own understanding of how the code works. We, as the authors team bare all responsibilities for all errors and omissions in this document. We can only hope it helps current and future Lustre users and Lustre code developers as much as it helped us understanding the Lustre source code and its internal workings.

  19. INTERNAL REPAIR OF PIPELINES

    SciTech Connect (OSTI)

    Bill Bruce; Nancy Porter; George Ritter; Matt Boring; Mark Lozev; Ian Harris; Bill Mohr; Dennis Harwig; Robin Gordon; Chris Neary; Mike Sullivan

    2005-07-20T23:59:59.000Z

    The two broad categories of fiber-reinforced composite liner repair and deposited weld metal repair technologies were reviewed and evaluated for potential application for internal repair of gas transmission pipelines. Both are used to some extent for other applications and could be further developed for internal, local, structural repair of gas transmission pipelines. Principal conclusions from a survey of natural gas transmission industry pipeline operators can be summarized in terms of the following performance requirements for internal repair: (1) Use of internal repair is most attractive for river crossings, under other bodies of water, in difficult soil conditions, under highways, under congested intersections, and under railway crossings. (2) Internal pipe repair offers a strong potential advantage to the high cost of horizontal direct drilling when a new bore must be created to solve a leak or other problem. (3) Typical travel distances can be divided into three distinct groups: up to 305 m (1,000 ft.); between 305 m and 610 m (1,000 ft. and 2,000 ft.); and beyond 914 m (3,000 ft.). All three groups require pig-based systems. A despooled umbilical system would suffice for the first two groups which represents 81% of survey respondents. The third group would require an onboard self-contained power unit for propulsion and welding/liner repair energy needs. (4) The most common size range for 80% to 90% of operators surveyed is 508 mm (20 in.) to 762 mm (30 in.), with 95% using 558.8 mm (22 in.) pipe. Evaluation trials were conducted on pipe sections with simulated corrosion damage repaired with glass fiber-reinforced composite liners, carbon fiber-reinforced composite liners, and weld deposition. Additional un-repaired pipe sections were evaluated in the virgin condition and with simulated damage. Hydrostatic failure pressures for pipe sections repaired with glass fiber-reinforced composite liner were only marginally greater than that of pipe sections without liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. In lieu of a field installation on an abandoned pipeline, a preliminary nondestructive testing protocol is being developed to determine the success or failure of the fiber-reinforced liner pipeline repairs. Optimization and validation activities for carbon-fiber repair methods are ongoing.

  20. INTERNAL REPAIR OF PIPELINES

    SciTech Connect (OSTI)

    Robin Gordon; Bill Bruce; Ian Harris; Dennis Harwig; George Ritter; Bill Mohr; Matt Boring; Nancy Porter; Mike Sullivan; Chris Neary

    2004-12-31T23:59:59.000Z

    The two broad categories of fiber-reinforced composite liner repair and deposited weld metal repair technologies were reviewed and evaluated for potential application for internal repair of gas transmission pipelines. Both are used to some extent for other applications and could be further developed for internal, local, structural repair of gas transmission pipelines. Principal conclusions from a survey of natural gas transmission industry pipeline operators can be summarized in terms of the following performance requirements for internal repair: (1) Use of internal repair is most attractive for river crossings, under other bodies of water, in difficult soil conditions, under highways, under congested intersections, and under railway crossings. (2) Internal pipe repair offers a strong potential advantage to the high cost of horizontal direct drilling when a new bore must be created to solve a leak or other problem. (3) Typical travel distances can be divided into three distinct groups: up to 305 m (1,000 ft.); between 305 m and 610 m (1,000 ft. and 2,000 ft.); and beyond 914 m (3,000 ft.). All three groups require pig-based systems. A despooled umbilical system would suffice for the first two groups which represents 81% of survey respondents. The third group would require an onboard self-contained power unit for propulsion and welding/liner repair energy needs. (4) The most common size range for 80% to 90% of operators surveyed is 508 mm (20 in.) to 762 mm (30 in.), with 95% using 558.8 mm (22 in.) pipe. Evaluation trials were conducted on pipe sections with simulated corrosion damage repaired with glass fiber-reinforced composite liners, carbon fiber-reinforced composite liners, and weld deposition. Additional un-repaired pipe sections were evaluated in the virgin condition and with simulated damage. Hydrostatic failure pressures for pipe sections repaired with glass fiber-reinforced composite liner were only marginally greater than that of pipe sections without liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. The first round of optimization and validation activities for carbon-fiber repairs are complete. Development of a comprehensive test plan for this process is recommended for use in the field trial portion of this program.

  1. INTERNAL REPAIR OF PIPELINES

    SciTech Connect (OSTI)

    Robin Gordon; Bill Bruce; Ian Harris; Dennis Harwig; George Ritter; Bill Mohr; Matt Boring; Nancy Porter; Mike Sullivan; Chris Neary

    2004-08-17T23:59:59.000Z

    The two broad categories of fiber-reinforced composite liner repair and deposited weld metal repair technologies were reviewed and evaluated for potential application for internal repair of gas transmission pipelines. Both are used to some extent for other applications and could be further developed for internal, local, structural repair of gas transmission pipelines. Principal conclusions from a survey of natural gas transmission industry pipeline operators can be summarized in terms of the following performance requirements for internal repair: (1) Use of internal repair is most attractive for river crossings, under other bodies of water, in difficult soil conditions, under highways, under congested intersections, and under railway. (2) Internal pipe repair offers a strong potential advantage to the high cost of horizontal direct drilling when a new bore must be created to solve a leak or other problem. (3) Typical travel distances can be divided into three distinct groups: up to 305 m (1,000 ft.); between 305 m and 610 m (1,000 ft. and 2,000 ft.); and beyond 914 m (3,000 ft.). All three groups require pig-based systems. A despooled umbilical system would suffice for the first two groups which represents 81% of survey respondents. The third group would require an onboard self-contained power unit for propulsion and welding/liner repair energy needs. (4) The most common size range for 80% to 90% of operators surveyed is 508 mm (20 in.) to 762 mm (30 in.), with 95% using 558.8 mm (22 in.) pipe. Evaluation trials were conducted on pipe sections with simulated corrosion damage repaired with glass fiber-reinforced composite liners, carbon fiber-reinforced composite liners, and weld deposition. Additional un-repaired pipe sections were evaluated in the virgin condition and with simulated damage. Hydrostatic failure pressures for pipe sections repaired with glass fiber-reinforced composite liner were only marginally greater than that of pipe sections without liners, indicating that this type of liner is only marginally effective at restoring the pressure containing capabilities of pipelines. Failure pressures for larger diameter pipe repaired with a semi-circular patch of carbon fiber-reinforced composite lines were also marginally greater than that of a pipe section with un-repaired simulated damage without a liner. These results indicate that fiber reinforced composite liners have the potential to increase the burst pressure of pipe sections with external damage Carbon fiber based liners are viewed as more promising than glass fiber based liners because of the potential for more closely matching the mechanical properties of steel. Pipe repaired with weld deposition failed at pressures lower than that of un-repaired pipe in both the virgin and damaged conditions, indicating that this repair technology is less effective at restoring the pressure containing capability of pipe than a carbon fiber-reinforced liner repair. Physical testing indicates that carbon fiber-reinforced liner repair is the most promising technology evaluated to-date. Development of a comprehensive test plan for this process is recommended for use in the field trial portion of this program.

  2. International Voluntary Renewable Energy Markets (Presentation)

    SciTech Connect (OSTI)

    Heeter, J.

    2012-06-01T23:59:59.000Z

    This presentation provides an overview of international voluntary renewable energy markets, with a focus on the United States and Europe. The voluntary renewable energy market is the market in which consumers and institutions purchase renewable energy to match their electricity needs on a voluntary basis. In 2010, the U.S. voluntary market was estimated at 35 terawatt-hours (TWh) compared to 300 TWh in the European market, though key differences exist. On a customer basis, Australia has historically had the largest number of customers, pricing for voluntary certificates remains low, at less than $1 megawatt-hour, though prices depend on technology.

  3. Comparative genomics and evolution of eukaryotic phospholipidbiosynthesis

    SciTech Connect (OSTI)

    Lykidis, Athanasios

    2006-12-01T23:59:59.000Z

    Phospholipid biosynthetic enzymes produce diverse molecular structures and are often present in multiple forms encoded by different genes. This work utilizes comparative genomics and phylogenetics for exploring the distribution, structure and evolution of phospholipid biosynthetic genes and pathways in 26 eukaryotic genomes. Although the basic structure of the pathways was formed early in eukaryotic evolution, the emerging picture indicates that individual enzyme families followed unique evolutionary courses. For example, choline and ethanolamine kinases and cytidylyltransferases emerged in ancestral eukaryotes, whereas, multiple forms of the corresponding phosphatidyltransferases evolved mainly in a lineage specific manner. Furthermore, several unicellular eukaryotes maintain bacterial-type enzymes and reactions for the synthesis of phosphatidylglycerol and cardiolipin. Also, base-exchange phosphatidylserine synthases are widespread and ancestral enzymes. The multiplicity of phospholipid biosynthetic enzymes has been largely generated by gene expansion in a lineage specific manner. Thus, these observations suggest that phospholipid biosynthesis has been an actively evolving system. Finally, comparative genomic analysis indicates the existence of novel phosphatidyltransferases and provides a candidate for the uncharacterized eukaryotic phosphatidylglycerol phosphate phosphatase.

  4. Comparative Deregulation of Far Eastern Telecommunications Markets: Economic Incentives and International Competitive Strategies

    E-Print Network [OSTI]

    Davidson, Jacob

    The deregulation of telecommunications has taken a major step with the WTO agreements in February of

  5. Prophylactic radiotherapy against heterotopic ossification following internal fixation of acetabular fractures: a comparative estimate of risk

    E-Print Network [OSTI]

    Burnet, N. G.; Nasr, P.; Yip, G.; Scaife, J. E.; House, T.; Thomas, S. J.; Harris, F.; Owen, P. J.; Hull, P.

    2014-09-08T23:59:59.000Z

    necrotic muscle debridement diminishes heterotopic ossification after acetabular fracture fixation. Injury. 2002; 33(9): 7516. 22. Balboni TA, Gaccione P, Gobezie R, Mamon HJ. Shielding of the hip prosthesis during radiation therapy for heterotopic...

  6. The International Journal of Comparative Psychology,Vol. 2, No. 3, Spring 1989 ADAPTATION VERSUS PHYLOGENY

    E-Print Network [OSTI]

    Cosmides, Leda

    -typical traits, whereas using animal psychology to exfoliate general principles of behavioral ecology represents

  7. Comparing Fail-Silence Provided by Process Duplication versus Internal Error Detection for DHCP Server

    E-Print Network [OSTI]

    Newcastle upon Tyne, University of

    architectures to protect an application from faults. These two architectures are Voltan, which uses process architectures for providing fail silence: Voltan [2] and Chameleon ARMORs (Adaptive Reconfigurable Mo- bile Objects for Reliability) [13]. Voltan uses replicated processes and a voting algorithm between processes

  8. international | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    International Activity in Gasification and Coal to Liquids Development News Gasifipedia Gasifier Optimization Feed Systems Syngas Processing Systems Analyses Gasification Plant...

  9. Honeywell International ESCO Qualification Sheet

    Broader source: Energy.gov [DOE]

    Document outlines the energy service company (ESCO) qualifications for Honeywell International in relation to the U.S. Department of Energy's (DOEs) energy savings performance contracts (ESPC).

  10. International Quality Assurance Standards (Presentation)

    SciTech Connect (OSTI)

    Kurtz, S.; Hacke, P.; Wohlgemuth, J.; Kempe, M.; Yamamichi, M.

    2011-02-01T23:59:59.000Z

    Tests to make quantitative predictions about photovoltaic (PV) modules are needed. This presentation proposes the creation of international quality assurance standards for PV modules.

  11. Propagation and Re ection of Internal Waves B. R. Sutherland

    E-Print Network [OSTI]

    Sutherland, Bruce

    the frequency spectrum of the waves. I INTRODUCTION An internal wave is a disturbance propagating under the e a level where the Doppler-shifted frequency of the waves is comparable with the background buoyancy frequency. Although linear theory predicts that the waves should re ect if the Doppler-shifted frequency

  12. Annual report of the international nuclear research initiative OSMOSE project (FY05).

    SciTech Connect (OSTI)

    Klann, R. T.; Hudelot, J. P.; Perret, G.; Drin, N.; Nuclear Engineering Division; Commissariat a l'Energie Atomique

    2007-10-03T23:59:59.000Z

    The goal of the OSMOSE program is to measure the reactivity effect of minor actinides in known neutron spectra of interest to the Generation-IV reactor program and other programs and to create a database of these results for use as an international benchmark for the minor actinides. The results are then compared to calculational models to verify and validate integral absorption cross-sections for the minor actinides. The OSMOSE program includes all aspects of the experimental program -- including the fabrication of fuel pellets and samples, the oscillation of the samples in the MINERVE reactor for the measurement of the reactivity effect, reactor physics modeling of the MINERVE reactor, and the data analysis and interpretation of the experimental results.

  13. Annual report of the international nuclear energy research initiative OSMOSE project (FY06).

    SciTech Connect (OSTI)

    Klann, R. T.; Hudelot, J. P.; Drin, N.; Zhong, Z.; Nuclear Engineering Division; Commissariat a l Energie Atomique

    2007-08-29T23:59:59.000Z

    The goal of the OSMOSE program is to measure the reactivity effect of minor actinides in known neutron spectra of interest to the Generation-IV reactor program and other programs and to create a database of these results for use as an international benchmark for the minor actinides. The results are then compared to calculation models to verify and validate integral absorption cross-sections for the minor actinides. The OSMOSE program includes all aspects of the experimental program--including the fabrication of fuel pellets and samples, the oscillation of the samples in the MINERVE reactor for the measurement of the reactivity effect, reactor physics modeling of the MINERVE reactor, and the data analysis and interpretation of the experimental results.

  14. Corporate International Operations | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model, clickInformationNew|Core Analysis At Geysers|Cornwall,CorporateInternational

  15. Rotary internal combustion engine

    SciTech Connect (OSTI)

    Crittenden, W.

    1987-01-27T23:59:59.000Z

    This patent describes an improved rotary internal combustion engine comprising: (a) a combustion chamber which is generally circular in cross-section and which has a ring-like peripheral wall; (b) a driven shaft member journaled for rotation and disposed to pass eccentrically through the combustion chamber; (c) a compression chamber which is generally circular in cross-section positioned with a ring-like wall is adjacent to and spatially offset with the combustion chamber such that the driven shaft passes centrally therethrough; and (d) a circular combustion rotor fixed concentrically to the shaft member for rotation eccentrically within the combustion chamber. The combustion rotor is positioned such that the space between the periphery of the rotor and the periphery of the combustion chamber results in a crescent shape.

  16. Progress Towards International Repositories

    SciTech Connect (OSTI)

    McCombie, C.; Chapman, N.

    2002-02-27T23:59:59.000Z

    The nuclear fuel cycle is designed to be very international, with some specialist activities (e.g. fuel fabrication, reprocessing, etc.) being confined to a few countries. Nevertheless, political and public opposition has in the past been faced by proposals to internationalise the back-end of the cycle, in particular waste disposal. Attitudes, however, have been changing recently and there is now more acceptance of the general concept of shared repositories and of specific proposals such as that of Pangea. However, as for national facilities, progress towards implementation of shared repositories will be gradual. Moreover, the best vehicle for promoting the concept may not be a commercial type of organization. Consequently the Pangea project team are currently establishing a widely based Association for this purpose.

  17. INTERNATIONAL DECOMMISSIONING SYMPOSIUM 2000

    SciTech Connect (OSTI)

    M.A. Ebadian, Ph.D.

    2001-01-01T23:59:59.000Z

    The purpose of IDS 2000 was to deliver a world-class conference on applicable global environmental issues. The objective of this conference was to publicize environmental progress of individual countries, to provide a forum for technology developer and problem-holder interaction, to facilitate environmental and technology discussions between the commercial and financial communities, and to accommodate information and education exchange between governments, industries, universities, and scientists. The scope of this project included the planning and execution of an international conference on the decommissioning of nuclear facilities, and the providing of a business forum for vendors and participants sufficient to attract service providers, technology developers, and the business and financial communities. These groups, when working together with attendees from regulatory organizations and government decision-maker groups, provide an opportunity to more effectively and efficiently expedite the decommissioning projects.

  18. If the internship is international or involves international travel, the

    E-Print Network [OSTI]

    Hart, Gus

    If the internship is international or involves international travel, the student does not need to complete the IRAMS student internship ap- plication, but should contact the Kennedy Center for internship approval and course registration. Flag will be removed, and students will be able to add their internship

  19. If the internship is international or involves international travel, the

    E-Print Network [OSTI]

    Dahl, David B.

    If the internship is international or involves international travel, the student does not need to complete the IRAMS student internship application, but should contact the Kennedy Center for internship approval and course registration. Flag will be removed, and students will be able to add their internship

  20. International PatentInternational Patent Protection: 1990 -Protection: 1990 -

    E-Print Network [OSTI]

    Lansky, Joshua

    International PatentInternational Patent Protection: 1990 -Protection: 1990 - 20052005 Measurement and TrendsMeasurement and Trends Patent Strength and Stages of EconomicPatent Strength and Stages of Economic DevelopmentDevelopment #12;I. Measurement & TrendsI. Measurement & Trends Patent Rights Index (0

  1. PEFC Uruguay Seeks International Recognition JUL 26 2010 | INTERNATIONAL

    E-Print Network [OSTI]

    PEFC Uruguay Seeks International Recognition JUL 26 2010 | INTERNATIONAL Uruguay has become important and fastest growing sectors in Uruguay, the sustainable management of the forest resource the organization. If approved, Uruguay would become the third Latin American country featuring a PEFC

  2. An ISP-27 accident scenario for analysis of Krsko Nuclear Power Plant SBLOCA

    SciTech Connect (OSTI)

    Petelin, S.; Mavko, B.; Gortnar, O.; Parzer, I.

    1994-12-31T23:59:59.000Z

    The reactor safety analysis group of Jozef Stefan Institute (IJS) has participated in analyses of International Standard Problem 27 (ISP-27), which was based on test 9.1 b performed at the BETHSY experimental facility (France). In addition, we realized the ISP-27 transient scenario in the analysis of a small-break loss-of-coolant accident (SBLOCA) for Krsko nuclear power plant (NPP). The objective was to evaluate the effectiveness of the ISP-27 proposed accident management procedure for a real NPP and to compare the physical phenomena known from experimental background with the phenomena predicted by simulation of a real plant transient.

  3. A Comparison of Sport Consumption Motives Between American Students and Asian International Students

    E-Print Network [OSTI]

    Kang, Chanho

    2011-02-22T23:59:59.000Z

    sporting events. This study designed to provide sport marketers and athletic directors within intercollegiate programs a more comprehensive understanding of Asian international students and American students' characteristics by comparing the differences...

  4. Comparative and Functional Genomics Comp Funct Genom 2003; 4: 239245.

    E-Print Network [OSTI]

    Wurtele, Eve Syrkin

    Comparative and Functional Genomics Comp Funct Genom 2003; 4: 239245. Published online 1 April://www.botany.iastate.edu/mash/metnetex/metabolicnetex.html) is pub- licly available software in development for analysis of genome-wide RNA, protein and metabolite in the post-genome era is to understand how interactions among molecules in a cell determine its form

  5. A Comparative Life Cycle Assessment of Petroleum and

    E-Print Network [OSTI]

    Illinois at Chicago, University of

    A Comparative Life Cycle Assessment of Petroleum and Soybean-Based Lubricants S H E L I E A . M I L assessment examining soybean and petroleum-based lubricants is compiled using Monte Carlo analysis to assess in this paper suggests that such potential exists. Over two billion gallons (7.5 billion liters) of petroleum

  6. Comparing systemic risk in European government bonds and national indices

    E-Print Network [OSTI]

    Jurczyk, Jan; Morgenstern, Ingo

    2015-01-01T23:59:59.000Z

    It has been shown, that the systemic risk contained in financial markets can be indicated by the change of cross-correlation between different indices and stocks. This change is tracked by using principle component analysis (PCA). We use this technique to investigate the systemic risk contained in European economy by comparing government long term bonds and indices.

  7. International Trends in Green Building

    E-Print Network [OSTI]

    Zhang, Junshan

    International Trends in Green Building Friday, August 26, 2011 Registration 8:00 a.m. Presentation, Canada Green Building Council The presentation will cover international trends and innovations in the green-building industry as well as new opportunities for green-building collaboration with Arizona

  8. Evaluation of the Fogarty International

    E-Print Network [OSTI]

    Bandettini, Peter A.

    to consider helping to fund the successful FIRCAs from their grantees. Many of the ICs responded positively both to support their grantees' international collaborative research and encourage more international, grantees and reviewers over the years, FIC revamped the FIRCA program to meet the evolving needs

  9. Proceedings on the Workshop on METHODOLOGIES FOR INTERNATIONAL

    E-Print Network [OSTI]

    on April 1-2, 1996, was organized by the Canadian Industry Energy End-use Data and Analysis Center (CIEEDAC energy efficiency indicators and energy data collection methods adopted by countries represented;Proceedings on the Workshop on METHODOLOGIES FOR INTERNATIONAL COMPARISONS OF INDUSTRIAL ENERGY EFFICIENCY

  10. Proceedings of the 7th international coal testing conference

    SciTech Connect (OSTI)

    Not Available

    1989-01-01T23:59:59.000Z

    This book contains the proceedings of the 7th international coal testing conference. Topics covered include: a continuous program for sample system evaluation; coal ash analysis by inductively coupled plasma; bias testing of mechanical sampling systems; physical implementation; and statistical approaches to laboratory quality control.

  11. Proceedings of IEEE International Symposium on Electronics & the Environment

    E-Print Network [OSTI]

    Shu, Lily H.

    , Colorado Williams & Shu Page 279 ANALYSIS OF REMANUFACTURER WASTE STREAMS FOR ELECTRONIC PRODUCTS J for remanufacture in these sectors, waste streams of remanufacturers of different electronic products, namely laserProceedings of IEEE International Symposium on Electronics & the Environment 7-9 May, 2001, Denver

  12. Methodology and Analysis Monthly Natural Gas Gross Production...

    U.S. Energy Information Administration (EIA) Indexed Site

    International's review paper given to the American Statistical Association Committee on Energy Statistics PDF 5 Other Sources: EIA-914 Estimates Compared with Other sources PDF 6...

  13. An optimized international vehicle monitor

    SciTech Connect (OSTI)

    York, R.L.; Close, D.A.; Fehlau, P.E.

    1997-03-01T23:59:59.000Z

    The security plans for many DOE facilities require the monitoring of pedestrians and vehicles to control the movement of special nuclear material (SNM). Vehicle monitors often provide the outer-most barrier against the theft of SNM. Automatic monitors determine the presence of SNM by comparing the gamma-ray and neutron intensity while occupied, to the continuously updated background radiation level which is measured while the unit is unoccupied. The most important factors in choosing automatic vehicle monitors are sensitivity, cost and in high traffic applications total monitoring time. The two types of automatic vehicle monitors presently in use are the vehicle monitoring station and the drive-through vehicle monitor. These two types have dramatically different cost and sensitivities. The vehicle monitoring station has a worst-case detection sensitivity of 40 g of highly enriched uranium, HEU, and a cost approximately $180k. This type of monitor is very difficult to install and can only be used in low traffic flow locations. The drive-through vehicle portal has a worst-case detection sensitivity of 1 kg of HEU and a cost approximately $20k. The world`s political situation has created a pressing need to prevent the diversion of SNM from FSU nuclear facilities and across international borders. Drive-through vehicle monitors would be an effective and practical nuclear material proliferation deterrent if their sensitivity can be improved to a sufficient level. The goal of this project is to evaluate different detector configurations as a means of improving the sensitivity of these instruments to achieve a vehicle monitor that is economical, practical to install, and has adequate sensitivity to be an effective barrier to illegal transportation of SNM.

  14. Cetane Performance and Chemistry Comparing Conventional Fuels...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Performance and Chemistry Comparing Conventional Fuels and Fuels Derived from Heavy Crude Sources Cetane Performance and Chemistry Comparing Conventional Fuels and Fuels...

  15. VISTA - computational tools for comparative genomics

    E-Print Network [OSTI]

    Frazer, Kelly A.; Pachter, Lior; Poliakov, Alexander; Rubin, Edward M.; Dubchak, Inna

    2004-01-01T23:59:59.000Z

    tools for comparative genomics Kelly A. Frazer 1 , LiorBerkeley, CA, 94720 Genomics Division, Lawrence Berkeleymultiple comparative genomics tools and provides users with

  16. International energy outlook 1999

    SciTech Connect (OSTI)

    NONE

    1999-03-01T23:59:59.000Z

    This report presents international energy projections through 2020, prepared by the Energy Information Administration. The outlooks for major energy fuels are discussed, along with electricity, transportation, and environmental issues. The report begins with a review of world trends in energy demand. The historical time frame begins with data from 1970 and extends to 1996, providing readers with a 26-year historical view of energy demand. The IEO99 projections covers a 24-year period. The next part of the report is organized by energy source. Regional consumption projections for oil, natural gas, coal, nuclear power, and renewable energy (hydroelectricity, geothermal, wind, solar, and other renewables) are presented in the five fuel chapters, along with a review of the current status of each fuel on a worldwide basis. The third part of the report looks at energy consumption in the end-use sectors, beginning with a chapter on energy use for electricity generation. New to this year`s outlook are chapters on energy use in the transportation sector and on environmental issues related to energy consumption. 104 figs., 87 tabs.

  17. Praxis compiler internals

    SciTech Connect (OSTI)

    Evans, A. Jr.

    1981-01-01T23:59:59.000Z

    Praxis is a high level machine-oriented algebraic computer language, designed by Bolt Beranek and Newman, Inc. (BBN) and intended for such applications as process control, communications, and system programming in general. Under contract to Lawrence Livermore National Laboratories (LLNL), BBN has implemented the following three compilers for Praxis: a VAX compiler, running on VAX and producing VAX code; a PDP-11 compiler, running on the PDP-11 and producing code for that machine; and a cross compiler, running on VAX and producing code for the PDP-11. The compilers are written in Praxis and so compile themselves. Further, most of the code is common to the three compilers. This document describes the internal operation of the compilers. The emphasis is on the major data bases and interfaces with little discussion of the details of algorithms, since the latter can readily be deduced from study of the listings providing that the data being manipulated are understood. The purpose of this document is to provide enough information to a maintenance staff that does not include the initial implementors so that they can maintain the compiler and make modifications as requirements change.

  18. Inside this Issue Changes to the International Vo

    E-Print Network [OSTI]

    ), the International Standardization Organization (ISO), and the International Electrotechnical Commission (IEC the International Bureau of Weights and Measures (BIPM), the International Organization of Legal Metrology (OIML cosponsoring organizations: the International Federation of Clinical Chemistry (IFCC), the International Union

  19. Office of the Assistant General Counsel for International and...

    Office of Environmental Management (EM)

    programs, international science and technology cooperation programs; international trade investment and procurement activities, and other DOE programs involving international...

  20. Innovative Design Concept for the New Bangkok International Airport, NBIA

    E-Print Network [OSTI]

    Kessling, W.; Holst, S.; Schuler, M.

    2004-01-01T23:59:59.000Z

    the zenith. The situation of an international airport with 24- hours working days and high internal heat loads from people, electric equipment and lighting combined with the desired indoor climate conditions of 24 ?C room temperature and 50 to 60 % relative... the existing hourly weather data for Bangkok a period with extremely high daily top temperatures of 34 ?C and a horizontal solar radiation of 1,000 W/m? was chosen as the basis for comparing several concept variants. The model has four thermal zones: First...