National Library of Energy BETA

Sample records for intellectual property ip

  1. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  2. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  3. intellectual property license | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    intellectual property license Intellectual Property License Agreements transfer NETL-owned intellectual property (IP) from the government to the private sector both exclusively and...

  4. Value creation through intellectual property acquisition

    E-Print Network [OSTI]

    McMullin, Nathan K. (Nathan Keith), 1979-

    2015-01-01

    After Sanofi acquired intellectual property (IP) from bankrupt Pelikan Technologies it desired to leverage the IP to identify a product concept to enhance the company's portfolio. To facilitate the project, a structured ...

  5. Intellectual Property

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenryInhibiting IndividualIntegrating Information,Intellectual Property

  6. INVENTOR'S GUIDE INTELLECTUAL PROPERTY

    E-Print Network [OSTI]

    Maryland, Baltimore County, University of

    INVENTOR'S GUIDE TO INTELLECTUAL PROPERTY AND TECHNOLOGY TRANSFER © 2002 UMBC #12;2 Inventor..................................................................................................................................14 #12;3 This "Inventor's Guide to Intellectual Property and Technology Transfer" is intended

  7. Intellectual Property Management and Markets Intellectual Property Management and Markets

    E-Print Network [OSTI]

    Intellectual Property Management and Markets Intellectual Property Management and Markets Program are becoming cen- tral to the modern economy. IIT's Master of Intellectual Property Management and Markets exploitation. Graduates of this program will be equipped to take a strategic or leadership role leveraging

  8. Intellectual property : strategy and policy

    E-Print Network [OSTI]

    Ahuja, Rishi

    2012-01-01

    The thesis that follows is an attempt to gain a deeper understanding of intellectual property from a policy as well as a strategic perspective. While the discussion that follows is applicable to intellectual property in ...

  9. Intellectual Property Provisions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual Property

  10. Intellectual Property Provisions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual

  11. Intellectual Property Provisions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual15

  12. Intellectual Property Provisions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual15GNP-115

  13. Intellectual Property Provisions - Assistance

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual15GNP-11515

  14. Intellectual Property Provisions - Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions |DemonstrationIntellectual

  15. Intellectual Property Provisions

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual15GNP-115 1

  16. A legal solution to a real problem: the interface between intellectual property, competition and human rights 

    E-Print Network [OSTI]

    Brown, Abbe

    2009-01-01

    This thesis argues that the existing laws of competition and human rights can be combined to limit the rights of owners of intellectual property (IP). The need for this thesis arises from concerns about the impact of ...

  17. Follow the money: how does industry pay programmers' salaries when the required intellectual property is offshored?

    E-Print Network [OSTI]

    Wiederhold, Gio

    discussions is the offshoring of intellectual property (IP), the capital complement of the labor and capital not address the risk of misappropriation of IP when offshoring, a related but orthogonal issue; it only covers processes that are legal. That risk is addressed throughout the ACM report [ACM:06, pp.11+25]. Tax

  18. Intellectual Property and eScience

    E-Print Network [OSTI]

    Burk, DL

    2007-01-01

    on Properties of the Human Genome Project (pp. 97–122). SanStreet meets the human genome project: Intellectual propertycollaboratory? ’’ The human genome mapping project and the

  19. The potential impact of Intellectual Property Rights

    E-Print Network [OSTI]

    ­ The forestry value chain and intellectual property rights 4 Section 2 ­ International outlook of the forestry and Generation of Electric Energy using Wood as Fuel 61 ANNEX 4. Extended table of Forestry Value Chain 62 #12;3 INTRODUCTION This study is the result of an initiative of the World Intellectual Property Organization (WIPO

  20. The Justification of Intellectual Property: Contemporary Philosophical Disputes

    E-Print Network [OSTI]

    Himma, Kenneth

    2006-01-01

    intellectual property, and hacking. In Himma, K.E. (in internet security: hacking, counterhacking, and society.

  1. Essays on intellectual property rights policy 

    E-Print Network [OSTI]

    Hackett, Petal Jean

    2012-11-27

    This dissertation will take a theoretical approach to analyzing certain challenges in the design of intellectual property rights (`IPR') policy. The first essay looks the advisability of introducing IPR into a market ...

  2. Intellectual Property Provisions (GDSB-1003)

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15 Intellectual15GNP-115

  3. Intellectual Property | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenryInhibiting IndividualIntegrating Information,Intellectual

  4. INTELLECTUAL PROPERTY POLICY 1 STATEMENT AND SCOPE

    E-Print Network [OSTI]

    Daley, Monica A.

    INTELLECTUAL PROPERTY POLICY 1 STATEMENT AND SCOPE 1.1 This document describes the Royal Veterinary - the Patents Act 1977 and the Copyright, Designs and Patents Act 1988. These two Acts make it clear potentially significant result, whether patentable or not, developed or invented during the course of, and ar

  5. LOUISIANA TECH UNIVERSITY Intellectual Property 101

    E-Print Network [OSTI]

    Selmic, Sandra

    signature has been added, additional information or correction should be with new entry #12;LOUISIANA TECHLOUISIANA TECH UNIVERSITY Intellectual Property 101: Lab Notebooks Richard Kordal, PhD Director, OIPC #12;LOUISIANA TECH UNIVERSITY Invention Process · Conception AND · Diligence in Reducing

  6. Intellectual Property for Market Innovation

    E-Print Network [OSTI]

    Duffy, John F; Abramawitz, Micheal

    2006-01-01

    discourage future market innovation. Mobil Oil Corp. v.Property for Market Innovation by Michael Abramowicz * andHarvard College. Market Innovation example, whether consumer

  7. Socially responsible intellectual property: a solution? 

    E-Print Network [OSTI]

    Brown, Abbe

    2005-01-01

    This article reviews the extent to which the present global IP system contains an inherent imbalance between the rights of IP owning corporations and IP users, and the public benefit. It also studies the potential relevance ...

  8. Intellectual Property Agreement | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLANIs gravityIntellectual Property Agreement ATTENTION:

  9. Intellectual Property (IP) Service Providers for Acquisition and Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department of Energy

  10. Intellectual Property (IP) Service Providers for Acquisition and Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department of

  11. Standard Intellectual Property (IP) Provisions for Financial Assistance

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideoSolarSpace-Based

  12. Offshoring and Transfer of Intellectual Property Gio Wiederhold

    E-Print Network [OSTI]

    Wiederhold, Gio

    Offshoring and Transfer of Intellectual Property Gio Wiederhold Professor (Emeritus), Computer Abstract Offshore outsourcing of work to support software development and services is seen primarily wage rates, or offshoring, is increasing. The common concern when discussing offshoring is on jobs

  13. Intellectual property strategy : analysis of the flash memory industry

    E-Print Network [OSTI]

    Ogura, Tomoko H

    2006-01-01

    This thesis studies the intellectual property strategy of companies in the flash memory industry, with special emphasis on technology and the development of nitride-based flash, a new and emerging type of memory technology. ...

  14. Intellectual Property Rights For Digital Library And Hypertext Publishing

    E-Print Network [OSTI]

    Glushko, Robert J.

    Intellectual Property Rights For Digital Library And Hypertext Publishing Systems: An Analysis of digital media will inevitably require some adjustments in the copyright model if digital libraries. By far the most ambitious proposal for a digital library and hypertext publishing environment is Ted

  15. The Piracy Paradox: Innovation and Intellectual Property in Fashion Design

    E-Print Network [OSTI]

    Sprigman, Chris; Raustiala, K

    2006-01-01

    Sprigman: IP and Fashion Design Working Draft: January 2006distributed) fashion designs. See, e.g. Imperial Homes Corp.Sprigman: IP and Fashion Design Working Draft: January 2006

  16. Policy on Intellectual Property Page 1 of 8 Virginia Polytechnic Institute and State University No. 13000 Rev.: 5

    E-Print Network [OSTI]

    Policy on Intellectual Property Page 1 of 8 Virginia Polytechnic Institute and State University No. 13000 Rev.: 5 Policy and Procedures Date: June 30, 2015 __________________________________________________________________________________ Subject: Policy on Intellectual Property

  17. Power, responsibility and norms: could and should human rights be used as a curb on intellectual property rights? 

    E-Print Network [OSTI]

    Brown, Abbe

    Paper by Brown on whether human rights should be used as a curb for intellectual property rights....

  18. Management of Intellectual Property in Supply Chain Outsourcing 

    E-Print Network [OSTI]

    Sen Gupta, Rajorshi

    2012-10-19

    &D contractor emerges as a direct competitor of the principal firm, or the contractor sells the principal?s IP to a competitor. Contracts are developed to implement a ?carrot and stick? strategy, whereby firms share limited IP with their contractor and also...

  19. Intellectual property rights, market structure and social welfare : three essays in industrial organization

    E-Print Network [OSTI]

    Dutta, Antara

    2006-01-01

    This dissertation consists of three essays on the effects of intellectual property rights protection on market structure and social welfare in the Indian pharamaceutical industry. In contrast to pharmaceutical industries ...

  20. Text Categorization for Intellectual Property: Comparing Balanced Winnow with SVM on Different Document Representations 

    E-Print Network [OSTI]

    Beuls, Katrien M.B.

    2009-11-26

    This study investigates the effect of training different categorization algorithms on various patent document representations. The automation of knowledge and content management in the intellectual property domain has been ...

  1. Policing Access to Knowledge: An Analysis of the Intellectual Property Prohibition Regime 

    E-Print Network [OSTI]

    Logan, Paul Lucas

    2014-12-08

    This dissertation is an analysis of criminal enforcement of digital copyrights. I argue that an international prohibition regime to govern intellectual property rights (IPR) has emerged through systems of international trade and law enforcement...

  2. Technology Available for Licensing Intellectual Property Office -The Pennsylvania State University

    E-Print Network [OSTI]

    Lee, Dongwon

    CO2 without the need for high temperature, high energy-consuming processes. Along with its uniqueTechnology Available for Licensing Intellectual Property Office - The Pennsylvania State University showing inter-chain hydrogen bonding. Background Improving the mechanical properties of paper and reducing

  3. Intellectual Property as Informaiton: A law and economics approach

    E-Print Network [OSTI]

    Barbosa, Cláudio R.

    2007-01-01

    property and the information ecosystem. In. Mich. St. L.property and the information ecosystem. In. Mich. St. L.

  4. (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization

    E-Print Network [OSTI]

    Yao, Y. Lawrence

    ) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property.11.2003) PCT WO 03/097291 Al (51) International Patent Classification7: B23K 26/00 (74) Agents: TANG, Henry eta, SD, SE, SG, SK, SL, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW. (84) Designated

  5. 12 | BOISESTATE.EDU At Boise State, the Office of Technology Transfer manages intellectual property commercialization

    E-Print Network [OSTI]

    Barrash, Warren

    12 | BOISESTATE.EDU At Boise State, the Office of Technology Transfer manages intellectual property it to market," said Katy Ritter, director of the Office of Technology Transfer. "We hope that the result of our to Technology Transfer, as experienced by researchers in disciplines across campus. TECHNOLOGY TRANSFER TIMELINE

  6. Volume 7, Issue 1, April 2010 THE INTELLECTUAL PROPERTY IMPLICATIONS OF LOW-COST

    E-Print Network [OSTI]

    Martin, Ralph R.

    Volume 7, Issue 1, April 2010 THE INTELLECTUAL PROPERTY IMPLICATIONS OF LOW-COST 3D PRINTING Simon Bradshaw,* Adrian Bowyer° and Patrick Haufe Abstract In the late 1970s 3D printing started to become established as a manufacturing technology. Thirty years on the cost of 3D printing machines is falling

  7. Innovation in the life sciences : the impact of intellectual property rights on scientific knowledge diffusion, accumulation and utilization

    E-Print Network [OSTI]

    Huang, Kenneth Guang-Lih, 1978-

    2006-01-01

    The impact of intellectual property rights on the production, diffusion and accumulation of scientific knowledge has been a central concern of public policymakers and economists in both public and private institutions, and ...

  8. Response to Consultation on the UK implementation of the Directive on the enforcement of intellectual property rights (2004/48/EC) 

    E-Print Network [OSTI]

    Brown, Abbe; Waelde, Charlotte

    Response by Brown and Waelde to the Patent Office's consultation on the UK implementation of the directive on the enforcement of intellectual property rights 2004/48/EC

  9. Intellectual Property

    E-Print Network [OSTI]

    Gallagher, William T

    2008-01-01

    2005), ‘The Human Genome Diversity Project: The Politics of2005), ‘The Human Genome Diversity Project: The Politics ofthe controversial Human Genome Diversity Project, a research

  10. Intellectual Property

    E-Print Network [OSTI]

    Gallagher, William T

    2008-01-01

    in the (Not-So-Brave) New World Order of Internationalin the (Not-So-Brave) New World Order of International

  11. 5. Intellectual property David Keil Information Technology and Society 5/13 David Keil Information Technology and Society 5/13 1

    E-Print Network [OSTI]

    Keil, David M.

    5. Intellectual property David Keil Information Technology and Society 5/13 David Keil Information Technology and Society 5/13 1 David M. Keil,Framingham State University CSCI 135 Information Technologyand Technology and Society 5/13 2 Reading: Baase, Chapter 4 #12;5. Intellectual property David Keil Information

  12. Intellectual Patent Basics

    E-Print Network [OSTI]

    Heller, Barbara

    Intellectual Property Patent Basics Roland W. Norris Pauley Petersen Kinne & Erickson 2800 W;Introduction Intellectual property: Patents Trademarks Copyrights Trade Secrets #12;What is a Patent? A right For the term of the patent 20 years from date of filing of earliest related patent or application #12;A

  13. Alternative Value Capture Systems for Improved Wheat Variety Intellectual Property for Increased Access by Tanzanian Smallholder Emerging Farmers: A Case Study 

    E-Print Network [OSTI]

    King, Joseph N

    2014-08-26

    market access, and for social, environmental, and economic development of smallholder emerging farmer. The researcher explores the relationships between value chains, intellectual property rights, institutional innovation, and technology transfer...

  14. Intellectual Property Provisions - Assistance

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15

  15. Intellectual Property Provisions

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department ofCLB-115

  16. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  17. DOE General Counsel for Technology Transfer and Intellectual...

    Broader source: Energy.gov (indexed) [DOE]

    The Office of the Assistant General Counsel for Technology Transfer and Intellectual Property is responsible for providing legal counsel to Departmental elements on all matters...

  18. Commercial Speech, Intellectual Property Rights, and Advertising Using Virtual Images Inserted in TV, Film, and the Real World

    E-Print Network [OSTI]

    Barfield, Woodrow

    2006-01-01

    of derivative rights for advertising using virtual images isProperty Rights, and Advertising Using Virtual Imagesand Mediated Reality Advertising. B. Problems with Virtual

  19. The Impact of Intellectual Property Rights in the Plant/Seed Industry Tirtha Dhar and Jeremy Foltz*

    E-Print Network [OSTI]

    Foltz, Jeremy D.

    monopoly rights to their inventions, provide economic incentives for research and development. In exchange of plants and animals as standard utility patents. In the case of plants certain forms of property rights, for plant seeds the Plant Variety Protection Act (PVPA) and for tubular form plants the Plant Protection Act

  20. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  1. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  2. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  3. Intellectual Property and Electronic Theses 

    E-Print Network [OSTI]

    Andrew, Theo

    The role of this briefing paper is to raise awareness of the main issues involved when converting paper-based theses into a digital format. This change of media has many implications for the way theses are created, stored, ...

  4. Intellectual Property and Academic Science

    E-Print Network [OSTI]

    Thompson, Neil

    2012-01-01

    The second is to show that inventor-based matching, a new,17 Inventor-basedChapter 3 presents inventor- based matching, a novel way of

  5. Intellectual Property, Genetics, and Medicine

    E-Print Network [OSTI]

    Brutlag, Doug

    are awarded for new, useful and non-obvious inventions · Must be adequately described in order that others can Precedents · 1966 ­ Chemical compounds must have real world utility in order to be patentable. · 1980 potentially save millions of lives in the developing world? #12;The Major Questions As outlined recently

  6. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  7. IIT Bombay offers to license intellectual property (IP) created through its research and development efforts and which are available in the form of patents, patent applications, design, trademark, copy-

    E-Print Network [OSTI]

    Narayanan, H.

    compressing system 613/MUM/2003 EE 11 Porous gas diffusion for fuel cell and related electrochemical flow field design for fuel cells 2762/MUM/2010 EE 29 A system for extracting water from air superconducting transformer 1401/MUM/2008 EE 7 Energy efficient regeneration process 767/MUM/2002 EE 8 Freeze

  8. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  9. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  10. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  11. Intellectual Property Overview | Department of Energy

    Energy Savers [EERE]

    1950, as amended by Executive Order 10930, codified in 37 C.F.R. 501 whenever an invention is made by an employee of the Department of Energy (DOE), it is necessary to...

  12. Intellectual Property Provisions (CSB-1003) Cooperative Agreement...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Demonstration Domestic Small Businesses 01. FAR 52.227-1 Authorization and Consent (JUL 1995)-Alternate I (APR 1984) 02. FAR 52.227-2 Notice and Assistance Regarding Patent and...

  13. Intellectual Property Provisions (CSB-1003) Cooperative Agreement...

    Broader source: Energy.gov (indexed) [DOE]

    01. FAR 52.227-1 Authorization and Consent (JUL 1995)-Alternate I (APR 1984) 02. FAR 52.227-2 Notice and Assistance Regarding Patent and Copyright Infringement (AUG 1996) This...

  14. Undergraduate research and intellectual property rights

    E-Print Network [OSTI]

    Nordheden, Karen J.; Hoeflich, Michael H.

    1999-11-01

    , 1997; revised August 30, 1999. A different version of this article directed toward lawyers appeared in The Kansas Journal of Law and Public Policy. K. J. Nordheden is with the Department of Chemical and Petroleum Engineering, University of Kansas... of Energy called the “Science and Engineering Research Semester” (SERS). Second, many university faculty are recognizing the in- structional value of undergraduate research. Involvement of undergraduates in serious research activities is a form of “active...

  15. IDENTIFICATION OF BACKGROUND INTELLECTUAL PROPERTY (BIP)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    or is published copyrighted computer software; including minor modifications of such computer software. Background Patent means a patent covering an invention or discovery...

  16. Intellectual Property and Market Structure in Agriculture

    E-Print Network [OSTI]

    Rausser, Gordon C.; Scotchmer, Suzanne; Simon, Leo K.

    1999-01-01

    the predominance of buyouts over other alternatives. In athe licensee. I n a cash buyout, the acquiring firm pays thet h r o u g h a cash buyout, but cannot agree to Integrate

  17. The Mythical Beginnings of Intellectual Property

    E-Print Network [OSTI]

    Silbey, Jessica M

    2007-01-01

    claimed invention, the inventor must show that she conceivedin the mind of the inventor. As one early Court said, “not the hands. ” 52 An inventor is one who is the first to

  18. Feminism and Dualism in Intellectual Property

    E-Print Network [OSTI]

    Burk, DL

    2007-01-01

    the patent will go to the inventor who filed his applicationone of ordinary skill, the inventor is by definition one ofwill be granted to the inventor who is able to show that he

  19. Appendix C-3, Intellectual Property Provisions

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O O D SFederal Facility Agreement and Consent04 STANDARD

  20. Intellectual Property Overview | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergy Copyrights ASite For additional information on

  1. intellectual property license | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistory OverUnconventional

  2. 2012 AT&T Intellectual Property. All rights reserved. AT&T and the AT&T logo are trademarks of AT&T Intellectual Property. Just as we prepare our networks and personnel, AT&T encourages residents and small

    E-Print Network [OSTI]

    Greenberg, Albert

    wireless phone batteries charged at all times. Have an alternative plan to recharge your battery in case batteries on hand. Keep your wireless phone dry. The biggest threat to your device during a hurricane and send photos -- even video clips -- of damaged property to your insurance company from your device

  3. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  4. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  5. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  6. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  7. Intellectual Contribution Policy College of Business and Economics

    E-Print Network [OSTI]

    Barrash, Warren

    Intellectual Contribution Policy College of Business and Economics Introduction: The creation and dissemination of intellectual contributions to business and economic theory, practice, and pedagogy and Economics (COBE) at Boise State University. Such intellectual contributions should continue throughout

  8. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  9. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  10. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  11. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  12. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  13. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  14. RELATING FIBER CROSSING IN HARDI TO INTELLECTUAL FUNCTION

    E-Print Network [OSTI]

    RELATING FIBER CROSSING IN HARDI TO INTELLECTUAL FUNCTION By Iman Aganj, Neda Jahanshad, Christophe in HARDI to Intellectual Function Iman Aganj,1 Neda Jahanshad,2 Christophe Lenglet,1,3 Arthur W. Toga,2

  15. a journey of intellectual inquiry university of north carolina wilmington

    E-Print Network [OSTI]

    Pawlik, Joseph

    a journey of intellectual inquiry university of north carolina wilmington a journey of intellectual inquiryof intellectual inquiryof university of north carolina wilmington re:search #12;University of North correspondence to: University of North Carolina Wilmington Research Services and Sponsored Programs 601 South

  16. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  17. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  18. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  19. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  20. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  1. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  2. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  3. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  4. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  5. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  6. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  7. The Effect of Judicial Ideology on Intellectual Property Cases

    E-Print Network [OSTI]

    Jacobi, Tonja; Sag, Matthew; Sytch, Maxim

    2007-01-01

    U.S. 150 (1999); Fla. Prepaid Postsecondary Educ. ExpenseU.S. 522 (1987); Fla. Prepaid Postsecondary Educ. Expense529 U.S. 205 (2000) Fla. Prepaid Postsecondary Educ. Expense

  8. Intellectual Property as Informaiton: A law and economics approach

    E-Print Network [OSTI]

    Barbosa, Cláudio R.

    2007-01-01

    John. Information feudalism. Who owns the knowledge economy?John. Information feudalism. Who owns the knowledge economy?

  9. Engineering for the Global Poor: The Role of Intellectual Property

    E-Print Network [OSTI]

    Booker, Kayje M.

    2014-01-01

    Gadgil describes as the “lightbulb factory. ” Under thatway that they might buy a lightbulb, take it home, screw itquality: you can’t use a lightbulb if there is no socket, no

  10. UC Davis Policy and Procedure Manual Chapter 250, Intellectual Property

    E-Print Network [OSTI]

    Ullrich, Paul

    organizations. II. Definitions Additional definitions are provided in Business and Finance Bulletin (BFB) G-40. The department chair can grant exemptions to individuals identified in BFB G-40. A form is available

  11. The Piracy Paradox: Innovation and Intellectual Property in Fashion Design

    E-Print Network [OSTI]

    Sprigman, Chris; Raustiala, K

    2006-01-01

    January 2006 to non-functional design elements. 30 Perhapstrade dress is limited to design elements that are “sourcenoted that few clothing design elements are protected under

  12. Policy on Intellectual Property Section 1 -Principles and Objectives

    E-Print Network [OSTI]

    Shoubridge, Eric

    with a qualifying word indicating a different meaning. "Electronic research material" or "ERM" means the electronic

  13. The Piracy Paradox: Innovation and Intellectual Property in Fashion Design

    E-Print Network [OSTI]

    Sprigman, Chris; Raustiala, K

    2006-01-01

    predict. Yet competition, innovation, and investment remaina constant stream of new innovation. Music, books, and theand technological innovations, as well as music, books,

  14. Intellectual Property as the Third Dimension of GMO Regulation

    E-Print Network [OSTI]

    Torrance, Andrew W.

    2007-01-01

    In the past, opposition to GMOs and GM crops has tended to focus on alleged dangers to human health and environmental safety. The United States, Canada, and Europe have all established regulatory frameworks whose stated aims are to ensure that GMOs...

  15. Intellectual Property Protection and Technology Transfer: Evidence From US Multinationals

    E-Print Network [OSTI]

    Kanwar, Sunil

    2007-01-01

    International Technology Transfer? Empirical Evidence FromEffects on Investment, Technology Transfer, and Innovation’r&d as a mode of technology transfer The median levels of

  16. Intellectual Property as Informaiton: A law and economics approach

    E-Print Network [OSTI]

    Barbosa, Cláudio R.

    2007-01-01

    A tutela jurídica da biotecnologia. São Paulo : RT, 1998.A tutela jurídica da biotecnologia. São Paulo : RT, 1998.

  17. U.S., China Reach Agreement on Intellectual Property Protections...

    Broader source: Energy.gov (indexed) [DOE]

    guidelines agreed upon by each of the three consortia comprising the U.S.-China Clean Energy Research Center. David Sandalow, Assistant Secretary for Policy and...

  18. Intellectual Property as Informaiton: A law and economics approach

    E-Print Network [OSTI]

    Barbosa, Cláudio R.

    2007-01-01

    que pretendiam englobar as tecnologias de comunicação epermite-se a proteção em tecnologias que são evidentes a

  19. The Strange Odyssey of Software Interfaces and Intellectual Property Law

    E-Print Network [OSTI]

    Samuelson, Pamela

    2008-01-01

    e.g. , Vault Corp. v. Quaid Software Ltd. , 847 F.2d 255 (5Zhu, What is the Impact of Software Patent Shifts? Evidenceof surge in patenting of software in the mid-1990’s). See,

  20. Software industry in India : product and intellectual property focus

    E-Print Network [OSTI]

    Kumar, Vishal, S.M. Massachusetts Institute of Technology

    2011-01-01

    India has established itself well as a powerhouse of talent in Information Technology (IT)/Software services, indicated by its exports of USD 54.33 Billion in 2010. Established in 1980s by the late Mr. Rajiv Gandhi, Prime ...

  1. Intellectual Property Provisions (CLB-115) Cooperative Agreement Research,

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergy Copyrights ASite For additional information

  2. Intellectual Property Provisions (CSB-1003) Cooperative Agreement Research,

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergy Copyrights ASite For additional

  3. Intellectual Property Provisions (NRD-115) Nonresearch and Development |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergy Copyrights ASite ForResearch, Development,Department

  4. Microsoft Word - Intellectual Property Provisions _NRD-1003_.doc

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE SafetyofDepartment. " 21 ran PPPO-03-1 025634-1 031,NRD-1003)

  5. Intellectual Property Provisions - Cooperative Agreement - Special Data Statute

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversions |15NRD-115) Nonresearch

  6. Microsoft Word - Intellectual Property Provisions _NRD-1003_.doc |

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May2.docTechnicalBARACK OBAMA October 31,

  7. Intellectual Property Provisions (CDLB-115) Cooperative Agreement - Special

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department ofCLB-115Data

  8. Intellectual Property Provisions (CDSB-115) Cooperative Agreement - Special

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department

  9. Intellectual Property Provisions (CSB-115) Cooperative Agreement Research,

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | DepartmentDevelopment, or

  10. Intellectual Property Provisions (GDLB-115) Grant - Special Data Statute

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | DepartmentDevelopment,

  11. Intellectual Property Provisions (GDSB-115) Grant - Special Data Statute

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions |

  12. Intellectual Property Provisions (GLB-115) Grant Research, Development, or

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions |Demonstration Large Business

  13. Intellectual Property Provisions (GNP-115) Grant and Cooperative Agreement

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions |Demonstration Large

  14. Intellectual Property Provisions (GSB-115) Grant Research, Development, or

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions |Demonstration

  15. DOE General Counsel for Technology Transfer and Intellectual Property |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels DataEnergy Webinar:IAbout Us »Buildings DOEDOE F 1340.3 DOE FG

  16. TThhee VVaalluuaattiioonn ooff TTeecchhnnoollooggyy--BBaasseedd IInntteelllleeccttuuaall PPrrooppeerrttyy iinn OOffffsshhoorriinngg DDeecciissiioonnss

    E-Print Network [OSTI]

    Wiederhold, Gio

    service-based offshoring arrangements as well. Some of these intangibles are considered to be intellectual property (IP). The transfer of intellectual property that accompanies such offshoring arrangements can have in the context of offshoring decisions and practices. Keywords Intellectual Property, Intangibles, Software

  17. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  18. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  19. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  20. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  1. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  2. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  3. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  4. Archival Report Autism with Intellectual Disability Related to

    E-Print Network [OSTI]

    McKeague, Ian

    Archival Report Autism with Intellectual Disability Related to Dynamics of Head Circumference dynamic features of head circumference growth are associated with autism. To address this issue, we; autism cases were identified from the Finnish Hospital and Outpatient Discharge Registry. METHODS

  5. When Students Grieve: Teachers of Students With Intellectual Disabilities 

    E-Print Network [OSTI]

    McAdams-Ducy, Elizabeth

    2014-04-30

    The identification and provision of support for the emotional needs of children with intellectual disabilities is essential as these students are often “disenfranchised grievers”-- meaning their grief is not recognized by others. The purpose...

  6. Teaching Shape Recognition to Students with Significant Intellectual Disabilities

    E-Print Network [OSTI]

    Lyon, Kristin Joannou

    2014-05-31

    Little research on teaching mathematics to students with significant intellectual disabilities exists, and that which does exist is largely in the areas of number and money skills. All students, including students with ...

  7. The Road to SDN: An Intellectual History of Programmable Networks

    E-Print Network [OSTI]

    Rexford, Jennifer

    The Road to SDN: An Intellectual History of Programmable Networks Nick Feamster Jennifer Rexford virtualization [54,67], energy- efficient networking [42], and seamless virtual-machine migration and user

  8. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  9. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  10. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  11. Optics and Fluid Dynamics Department Intellectual Capital Accounts 1998

    E-Print Network [OSTI]

    Optics and Fluid Dynamics Department Intellectual Capital Accounts 1998 Resources, production and results RISØ-R-1108(EN) Risø National Laboratory Optics and Fluid Dynamics Department Building 128 P for optical information storage, · novel schemes for spatial cryptography, and · new models for surface

  12. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  13. TThhee VVaalluuaattiioonn ooff IInntteelllleeccttuuaall PPrrooppeerrttyy iinn OOffffsshhoorriinngg DDeecciissiioonnss Gio Wiederhold

    E-Print Network [OSTI]

    Wiederhold, Gio

    of intangibles occur in many service-based offshoring arrangement as well. Some of these intangibles are considered intellectual property (IP). The transfer of IP that accompanies such offshoring arrangements can. The specific discussion focuses on IP transferred in the context of offshored services. Several alternatives

  14. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  15. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  16. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  17. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  18. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  19. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  20. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  1. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  2. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  3. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  4. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  5. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  6. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  7. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  8. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  9. Patent Litigation for High Technology and Life Sciences Companies

    E-Print Network [OSTI]

    Shamos, Michael I.

    Patent Litigation for High Technology and Life Sciences Companies #12;© 2005 Fenwick & West LLP Corporate (emerging growth, financings, securities, mergers & acquisitions) n Intellectual Property (patent, copyright, licensing, trademark) n Litigation (patent and other IP, securities, antitrust, employment

  10. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  11. Visual Power: 21st Century Native American Artists/Intellectuals

    E-Print Network [OSTI]

    Farris, Phoebe

    2006-10-01

    to include ex hibits reflecting such diverse cultures as African American Quilts, Ester Hernandez: The Art of Provocation, and Co-Madres Artistas: Voces de laMujer, while still maintaining a strong Native American presence. His own work uses pop culture... art. Visual Power is an outgrowth of a 2003 College Art Association panel that I chaired titled Native American Artists/Intellectuals: Speaking for Ourselves in the 21st Century and a concurrent art exhibition of the same title that I guest curated...

  12. Making the Best Use of What you Have Asia Intellectual Capital Alliances a te ectua Cap ta a ce

    E-Print Network [OSTI]

    BYOBBYOB ­ Making the Best Use of What you Have Asia Intellectual Capital Alliances a te ectua Cap ta a ce 24 October 2011 Copyright © 2011 Asia Intellectual Capital Alliance. All rights reserved. #12

  13. Family Needs and Family Quality of Life for Taiwanese Families of Children with Intellectual Disability and Developmental Delay

    E-Print Network [OSTI]

    Chiu, Chun-Yu

    2013-05-31

    intellectual disability 95 28.5 Severe and profound intellectual disability 76 22.8 24 being, Physical/Material Well-being, and Disability-related Services. The Beach Center Scale has a satisfactory internal consistency (?=.88) and test... intellectual disability 95 28.5 Severe and profound intellectual disability 76 22.8 24 being, Physical/Material Well-being, and Disability-related Services. The Beach Center Scale has a satisfactory internal consistency (?=.88) and test...

  14. University of California IP : 128.200.31.113

    E-Print Network [OSTI]

    Daraio, Chiara

    boiling point and toxic solvents, thus is amenable to an environ- mentally desirable, large strongly affect their magnetic properties. Using water-in-oil microemulsions (reverse micelles) as nanoscale reactors,11 it is possible to synthesize iron oxide nanoparticles with a narrowed size

  15. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  16. Synaptic Dysfunction in Neurodevelopmental Disorders Associated with Autism and Intellectual Disabilities

    E-Print Network [OSTI]

    Bear, Mark

    The discovery of the genetic causes of syndromic autism spectrum disorders and intellectual disabilities has greatly informed our understanding of the molecular pathways critical for normal synaptic function. The top-down ...

  17. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  18. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  19. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  20. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  1. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  2. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  3. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  4. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  5. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  6. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  7. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  8. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  9. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  10. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  11. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  12. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  13. Wellcome Trust The UK's innovation ecosystem

    E-Print Network [OSTI]

    Rambaut, Andrew

    Wellcome Trust The UK's innovation ecosystem Summary of a review commissioned by the Wellcome Trust innovation ecosystem does not always support its effective uptake. Good intellectual property (IP) management commissioned the consultancy Bain & Company to undertake an analysis of UK innovation and external IP

  14. July 17, 2001 UNIVERSITY OF MASSACHUSETTS AT AMHERST

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    a student of the University ("Prior IP"). However, if I continue to work on the Prior IP while I am's policy on intellectual property has only a minor impact on your freedom to publish your work. If you to publish their work and not be involved commercialization activities. Therefore, in consideration

  15. (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property

    E-Print Network [OSTI]

    Yao, Y. Lawrence

    ---- (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World.01.2005) PCT WO 2005/005069 A2 (51) International Patent Classification7: B21D (74) Agents: TANG, Henry eta, SG, SK, SL, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, YU, ZA, ZM, ZW. (84) Designated States

  16. Approved Module Information for BLM137, 2014/5 Module Title/Name: Intellectual Property Strategy &

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and 20th centauries land, labour and capital were the crucial factors in wealth creation; today, assess risk, reduce liabilities, improve its competitive position and substantially increase retur

  17. Intellectual Property -Ownership and Commercialisation Policy and Procedures Commencement Date: 25 March, 2011

    E-Print Network [OSTI]

    Mucina, Ladislav

    with the Rules for Degree of Master by Research or Degree of Doctor by Research. Collaborative Project Means: 1 agreement, contract of employment, duty statement or any other agreement between the Staff Member

  18. Towards an Intellectual Property Bargaining Theory: The Post-WTO Era

    E-Print Network [OSTI]

    Benoliel, Daniel; Salama, Bruno

    2009-01-01

    World Economic Outlook, Database—WEO Groups and AggregatesWorld Economic Outlook, Database—WEO Groups and Aggregates

  19. Government Practices in purchasing R&D: Intellectual Property Provisions at the Department of Energy

    Broader source: Energy.gov [DOE]

    Presentation by Paul Gottlieb and Julia Cook Moody at the October 24, 2006 Bio-Derived Liquids to Hydrogen Distributed Reforming Working Group Kick-Off Meeting.

  20. Cooperative innovation in the commons : rethinking distributed collaboration and intellectual property for sustainable design innovation

    E-Print Network [OSTI]

    Sawhney, Nitin, 1971-

    2003-01-01

    Addressing global design challenges in the environment and underserved communities requires a cooperative approach towards sustainable design innovation, one that embraces multidisciplinary expertise, participatory design ...

  1. (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property

    E-Print Network [OSTI]

    Yao, Y. Lawrence

    , RU, RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, VA, UG, US, UZ, VC, VN, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, TM report (Art. 21(3)) before the expiration of the time limit for amending the claims and to be republished

  2. (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19)World Intellectual Property

    E-Print Network [OSTI]

    Shor, Leslie McCabe

    , PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, for every kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ with international search report (Art. 21(3)) (74) Agent: HARPER, David, S.; Mcdonnell Boehnen Hulbert & Berghoff

  3. Should Good Patents Come in Small Packages? A Welfare Analysis of Intellectual Property Bundling

    E-Print Network [OSTI]

    Gilbert, Richard J; Katz, Michael L

    2007-01-01

    Studies, 69 (3): 513-531. Beggs, A.W. (1992), “The LicensingGallini and Wright (1990), Beggs (1992), and Anton and Yao (

  4. Technology Available for Licensing Intellectual Property Office -The Pennsylvania State University

    E-Print Network [OSTI]

    Lee, Dongwon

    Polymer Electrolytes" Keywords: Gel polymer electrolytes; batteries Links: US Patent 6,605,237 Inventor are alternatives to both solid polymer electrolytes (SPEs) and liquid electrolytes for battery applications. In organic, liquid-filled batteries, the liquid electrolytes may escape or present a fire hazard and an inert

  5. The Digital Signature Scheme MQQ-SIG Intellectual Property Statement and Technical Description

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    . Bijective multivariate quadratic mapping P (x) Input: A vector x = (f1, . . . , fn) of n linear Boolean, . . . , xn), i = 9, . . . , n 1. Represent a vector x = (f1, . . . , fn) of n linear Boolean functions of n and Electrical Engineering, The Norwegian University of Science and Technology (NTNU), O.S.Bragstads plass 2E, N

  6. Entrepreneurship and Intellectual Property (096815) Teacher: Dr. Ze'ev Ganor

    E-Print Network [OSTI]

    in the Israeli high tech industry. The high tech entrepreneurial process involves the creation of a new: Creating new technologies and commercializing them into new products and services is a key competitive and Patent Filing; 4. Getting acquainted with the high tech industry and infrastructure in Israel; 5

  7. POLICY ON INTELLECTUAL PROPERTY Effective Date: January 16, 2015 Originating Office: Office of the Vice-

    E-Print Network [OSTI]

    Doedel, Eusebius

    protection, the University and the Inventor(s) have a responsibility to promote the development and utilization of all Inventions in an appropriate manner. The University considers the Inventor(s the person who has written or created a Work. Co-Inventor means, where there is more than one Inventor

  8. Technology Available for Licensing Intellectual Property Office -The Pennsylvania State University

    E-Print Network [OSTI]

    Lee, Dongwon

    -Step Catalytic Transformation of Carbohydrates to Liquid Fuels" Keywords: Alternative Energy, Liquid Fuels, Low by the absorption of water from the surrounding environment. 2,5-dimethylfuran (DMF), an alternative fuel, has. Existing technologies to produce liquid fuels from biomass are typically multi-step or energy intensive

  9. Towards an Intellectual Property Bargaining Theory: The Post-WTO Era

    E-Print Network [OSTI]

    Benoliel, Daniel; Salama, Bruno

    2009-01-01

    developing countries is low. 174 Similarly, a software industry requires an innovative-based infrastructure, such as electricity,

  10. U.S., China Reach Agreement on Intellectual Property Protections for

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OF APPLICABLEStatutoryin the Nation's, China Partner to Counter Nuclear

  11. 10 CFR 600.325 - Intellectual Property Provisions (GDLB-1003) Grant |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram:Y-12 Beta-3 Racetracks Y-12 Beta-3of/ The Office of

  12. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  13. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  14. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  15. Elman / Contemporary Chinese Intellectual History 371 Eighteenth-Century Studies, vol. 43, no. 3 (2010) Pp. 37191.

    E-Print Network [OSTI]

    Elman, Benjamin

    2010-01-01

    Elman / Contemporary Chinese Intellectual History 371 Eighteenth-Century Studies, vol. 43, no. 3 (2010) Pp. 371­91. The Failures oF ConTemporary Chinese inTelleCTual hisTory1 Benjamin A. Elman Prologue for elite Chinese males. Moreover, passing the civil service examinations required for becoming an official

  16. A Review of "Leibniz. An Intellectual Biography" by Maria Rosa Antognazza 

    E-Print Network [OSTI]

    Wright, Jonathan

    2011-01-01

    for it, this essay collection is a worthy tribute to Michael Lieb?s scholarly career. Maria Rosa Antognazza. Leibniz. An Intellectual Biography. Cambridge and New York: Cambridge University Press, 2009. xxvii + 623pp. $45.00. Review by Jonathan Wright...

  17. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  18. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  19. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  20. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  1. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  2. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  3. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  4. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  5. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  6. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  7. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  8. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  9. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  10. ATM Input-Buffered Switches with the Guaranteed-Rate Property

    E-Print Network [OSTI]

    McKeown, Nick

    ATM Input-Buffered Switches with the Guaranteed-Rate Property A. Hung G. Kesidis N. Mc the problem of how to support guaranteed-rate services in a single-stage, input-bu ered switch suitable for a LAN switch, an ATM switch or an IP router. Such a switch must be feasible at hightransmissionspeeds, o

  11. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  12. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  13. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  14. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  15. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  16. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  17. Intellectual Innovative

    E-Print Network [OSTI]

    entrepreneurial spirit and innovative thinking A university with an Institute for Advanced Study which seeks orthodoxy and push the knowledge envelope. I invite you to browse through these pages. Or better still, come will continue to drive forward in faculty development, innovation, knowledge transfer and the building

  18. intellectual Stimulating

    E-Print Network [OSTI]

    Miall, Chris

    and Environmental Sciences School of Biosciences 154 School of Geography, Earth and Environmental Sciences 158 Birmingham Business School 221 School of Education 235 School of Government and Society 248 School of Social are a truly global university: not only

  19. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  20. 2013 AT&T Intellectual Property. All rights reserved. AT&T and the AT&T logo are trademarks of AT&T Intellectual Property. Content-Based Scheduling of

    E-Print Network [OSTI]

    Greenberg, Albert

    OS'5.5 32% 376MB CentOS'5.0 28% CentOS'5.8 23% 376MB CentOS'5.0 0% CentOS'6.0'3'6.2 0% 0MB Fedora'16 33% Fedora'17 30% 720MB RHEL'6.0 56% RHEL'6.1 46% 730MB RHEL'6.0 50% RHEL'6.2 38% 650MB RHEL'6.1 56% RHEL'6.09GB Fedora'16 2.45GB 3.1GB Fedora'17 2.3GB 3GB Customized VM Images · Average content similarity among

  1. The Doha deadlock: intellectual property and climate change https://theconversation.edu.au/the-doha-deadlock-intellectual-property-and-climate-change-11244[11/12/2012 4:48:06 PM

    E-Print Network [OSTI]

    Botea, Adi

    and copyright law: the case of 3D printing 18 October 2012 The High Court and the Marlboro Man: the plain

  2. IV-3.20(A) page 1 IV-3.20(A) UNIVERSITY OF MARYLAND POLICY ON INTELLECTUAL PROPERTY

    E-Print Network [OSTI]

    Hill, Wendell T.

    and plant variety protection certificates and the physical embodiments of such human creativity. D. On-Line Studies. A planned and directed teaching/learning process that extends learning to learners in a location of significant University facilities, such as laboratories and equipment, will not qualify as

  3. Provably Complete Hardware Trojan Detection Using Test Point Insertion

    E-Print Network [OSTI]

    Potkonjak, Miodrag

    Koushanfar Miodrag Potkonjak Computer Science Department University of California, Los Angeles Los Angeles, the Intellectual Property (IP) providers, and the manufacturing plants are different entities, exposing the ICs or to redistribute to lists, requires prior specific permission and/or a fee. IEEE/ACM International Conference

  4. Engineering &Technology

    E-Print Network [OSTI]

    Wyatt, Lucy

    Dialog Semiconductor ECM Selection EDF Trading EDT: The Year in Industry EMC Edif ERA Ericsson Television R&D office in Oslo. We develop products which unite previously incompatible audio, video, and web processors, optimized intellectual property (IP) cores; reference designs examples, and a variety

  5. 1. Introduction1 As system complexity increases and design time

    E-Print Network [OSTI]

    Ould Ahmedou, Mohameden

    have driven many system, hardware, and software designers to create executable specifications enables, promotes and accelerates system-level intellectual property (IP) model exchange and co- design1. Introduction1 As system complexity increases and design time shrinks, it becomes extremely

  6. System Level Design Using the SystemC Modeling Platform 1

    E-Print Network [OSTI]

    Ould Ahmedou, Mohameden

    the correctness of such a specification. These drawbacks have driven many system, hardware, and software designers of the initiative, which enables, promotes, and accelerates system-level intellectual property (IP) model exchangeSystem Level Design Using the SystemC Modeling Platform 1 1. Introduction1 As system complexity

  7. IEEE TRANSACTIONS ON COMPUTER-AIDED DESIGN OF INTEGRATED CIRCUITS AND SYSTEMS, VOL. 21, NO. 6, JUNE 2002 715 Short Papers_______________________________________________________________________________

    E-Print Network [OSTI]

    Chakrabarty, Krishnendu

    integration and shorter time to market, intellectual property (IP) cores pose several difficult test. However, the input/output (I/O) channel capacity, speed and accuracy, and data memory of automatic test test data bandwidth and ATE channel capacity). Lower testing time increases production capacity as well

  8. Provably Secure Obfuscation of Diverse Watermarks for Sequential Circuits

    E-Print Network [OSTI]

    cryptographic results of provable obfuscation of this function family to build a secure sequential multi, or memory, and the company's revenue is based on the IP value. A major issue in this business model house A collects the royalty to allow company B the rights of using its intellectual property (denoted

  9. Access this brochure and other information Management (OTM), our services, and much

    E-Print Network [OSTI]

    Lee, Dongwon

    : 113 Technology Center Building University Park, PA 16802 Phone: 814-865-6227 email: otm@psu.edu The goal of the new approach to the management of intellectual property ("IP") in industry-spon- sored research agreements is to give Penn State re- searchers and their industry counter parts the op- portunity

  10. Involving Users in Preservation Metadata. A Report of the ALCTS PARS Intellectual Access to Preservation Metadata Interest Group Meeting. American Library Association Midwinter Meeting, Philadelphia, January 2014. 

    E-Print Network [OSTI]

    Potvin, Sarah; Rowell, Chelcie Juliet

    2014-01-01

    At the 2014 ALA Midwinter Meeting in Philadelphia, the Intellectual Access to Preservation Metadata Interest Group meeting centered on a case study of information professionals collaborating with content creators to generate metadata, in support...

  11. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  12. Delivered by ICEVirtualLibrary.com to: IP: 128.83.63.20

    E-Print Network [OSTI]

    Zornberg, Jorge G.

    of nonwoven geotextile-reinforced walls under wetting conditions: laboratory and field investigations F. H. M as an instrumented 10 m high geotextile-reinforced soil wall with a poorly draining backfill. This structure has been on the geotextile strength properties as well as the comparatively high interface shear strength between the fine

  13. Assessment of the Financial and Intellectual Value of a Research Library and its Application at the Idaho National Laboratory

    SciTech Connect (OSTI)

    Lynn E. Melander

    2012-08-01

    Over the last several decades, libraries across the nation have undergone dramatic budget cuts, despite being an important resource for regional and national economic growth and innovation. Numerous studies have attempted to show that libraries increase the intellectual level of users and contribute to the economic growth of communities through surveys and customer service data. Within this study, we have attempted to develop a more analytical method for assessing library performance, using the Idaho National Laboratory Research Library as a sample subject. We have developed a mathematical model to measure the financial value of a library’s material resources as well as its intellectual value to determine if the library is a positive contributor to the wider organization and community it serves.

  14. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  15. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  16. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  17. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  18. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  19. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  20. Personal Property

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-10-16

    This Guide provides non-regulatory guidance and information to assist DOE organizations and contractors in implementing the DOE-wide and site-specific personal property management programs. It supplements the policy, requirements, and responsibilities information contained in the DOE Order cited above and clarifies the regulatory requirements contained in the Federal Property Management Regulation (FMR) and specific contracts.

  1. A review of "Transforming the Republic of Letters: Pierre-Daniel Huet and European Intellectual Life" By April G. Shelford 

    E-Print Network [OSTI]

    Adkins, Matthew G.

    2008-01-01

    the Magnificent as Christ-like. April G. Shelford. Transforming the Republic of Letters: Pierre-Daniel Huet and European Intellectual Life, 1650-1720. Rochester: University of Rochester Press, 2007. xii + 264 pp. + 7 illus. $75.00 Review by G. MATTHEW ADKINS...-minded early modern scholars. Nevertheless, it has con- ventionally been seen as a small and exclusively European community sharing an erudite neo-Latin culture and ushering in the Age of Enlightenment with their free-thinking and secularism. The volume under...

  2. PROPERTY MANUAL Berkeley Laboratory Property Management

    E-Print Network [OSTI]

    Knowles, David William

    B: Sensitive Item Policy · APPENDIX C: Glossary Property Management System Review Property Manual of Energy (DOE). The Property Management charter ensures the efficient and effective protection and controlPROPERTY MANUAL Issued by Berkeley Laboratory Property Management Lawrence Berkeley National

  3. Cu{sup II} coordination polymers based on 5-methoxyisophthalate and flexible N-donor ligands: Structures and magnetic properties

    SciTech Connect (OSTI)

    Chang, Xin-Hong; Qin, Jian-Hua; Ma, Lu-Fang; Wang, Li-Ya

    2014-04-01

    Three Cu{sup II} coordination polymers, ([Cu{sub 2}(CH{sub 3}O-ip){sub 2}(bmib)]){sub n} (1), ([Cu{sub 2}(CH{sub 3}O-ip){sub 2}(bmib){sub 2}]){sub n} (2) and ([Cu(CH{sub 3}O-ip)(bbip)]?2H{sub 2}O){sub n} (3) (CH{sub 3}O-H{sub 2}ip is 5-methoxyisophthalic acid, bmib is 1,4-bis(2-methylimidazol-1-yl)butane and bbip is 1,3-bis(1H-benzimidazolyl)propane), have been synthesized by hydrothermal methods. Complexes 1–3 were structurally characterized by elemental analysis, infrared (IR) spectra and X-ray single-crystal diffraction. Complex 1 shows a 3D six-connected self-penetrating network based on paddlewheel secondary building units. Complex 2 has a 3-fold interpenetrating 3D diamond framework. Complex 3 possesses a 1D tube-like chain. Thermo-gravimetric and magnetic properties of 1–3 were also investigated. - Graphical abstract: Structures and magnetic properties of copper(II) coordination polymers constructed from 5-methoxyisophthalate linker and two flexible N-donor ancillary ligands. Three copper(II) coordination polymers with 5-methoxyisophthalate and two related flexible N-donor ancillary ligands have been synthesized and structurally characterized. Moreover, thermal behaviors and magnetic properties of these complexes have also been investigated. - Highlights: • Three Cu(II) coordination polymers were synthesized. • The conformations of N-donor ligands and pH value have an effect on the final structures. • The magnetic properties of 1–3 have been investigated.

  4. Personal Property

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2015-06-09

    This Guide provides non-regulatory guidance and information to assist DOE organizations and contractors in implementing the DOE-wide and site-specific personal property management programs. Supersedes DOE G 580.1-1.

  5. Low-Resolution STELab IPS 3D Reconstructions of the Whole Heliosphere Interval and Comparison with in-Ecliptic Solar Wind Measurements from STEREO and Wind Instrumentation

    E-Print Network [OSTI]

    Bisi, M. M.; Jackson, B. V.; Buffington, A.; Clover, J. M.; Hick, P. P.; Tokumaru, M.

    2009-01-01

    structure of the fast solar wind. J. Geophys. Res. 112,observations of the solar wind. Proc. SPIE 6689, 668911-1.W.A. , Maagoe, S. : 1972, Solar wind velocity from ips

  6. Reprogramming peripheral blood mononuclear cells using an efficient feeder-free, non-integration method to generate iPS cells and the effect of immunophenotype and epigenetic state on HSPC fate 

    E-Print Network [OSTI]

    Liu, Jing

    2014-11-28

    Background and objectives In 2006 Shinya Yamanaka successfully reprogrammed mouse fibroblasts back to an embryonic stem cell-like state (called induced pluripotent cells, iPS cells) using retrovirus to introduce four ...

  7. Why do seizures occur when they do? Situations perceived to be associated with increased or decreased seizure likelihood in people withepilepsy and intellectual disability

    E-Print Network [OSTI]

    Illingworth, Josephine L.; Watson, Peter; Ring, Howard

    2014-09-16

    ] Harvey MT, Kennedy CH. Polysomnographic phenotypes in developmental disabil- ities. Int J Dev Neurosci 2002;20:443–8. [49] Miano S, Bruni O, Elia M, Scifo L, Smerieri A, Trovato A, et al. Sleep phenotypes of intellectual disability: a polysomnographic...

  8. Oklahoma State University Policy and Procedures 1.01 An institution's reputation and intellectual freedom depend on its uncompromising commitment to the ideal of

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    Oklahoma State University Policy and Procedures POLICY 1.01 An institution's reputation and intellectual freedom depend on its uncompromising commitment to the ideal of academic integrity. Oklahoma State University is committed to instilling and upholding integrity as a core value. This policy embodies Oklahoma

  9. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  10. Two coordination polymers of manganese(II) isophthalate and their preparation, structures, and magnetic properties

    SciTech Connect (OSTI)

    Chen Jinxi; Wang Jingjing; Ohba, Masaaki

    2012-01-15

    Two manganese coordination polymers, [Mn{sub 2}(ip){sub 2}(dmf)]{center_dot}dmf (1) and [Mn{sub 4}(ip){sub 4}(dmf){sub 6}]{center_dot}2dmf (2) (ip=isophthalate; dmf=N,N-dimethylformamide), have been synthesized and characterized. X-ray crystal structural data reveal that compound 1 crystallizes in triclinic space group P-1, a=9.716(3) A, b=12.193(3) A, c=12.576(3) A, {alpha}=62.19(2) Degree-Sign , {beta}=66.423(17) Degree-Sign , {gamma}=72.72(2) Degree-Sign , Z=2, while compound 2 crystallizes in monoclinic space group Cc, a=19.80(3) A, b=20.20(2) A, c=18.01(3) A, {beta}=108.40(4) Degree-Sign , Z=4. Variable-temperature magnetic susceptibilities of compounds 1 and 2 exhibit overall weak antiferromagnetic coupling between the adjacent Mn(II) ions. - Graphical abstract: Three-dimensional porous and two-dimensional layered manganese isophthalates have been prepared. Magnetic susceptibility measurements exhibit overall weak antiferromagnetic interactions between the Mn(II) ions in both compounds. Highlights: Black-Right-Pointing-Pointer Two manganese isophthalates have been prepared. Black-Right-Pointing-Pointer Compound 1 adopts a three-dimensional porous structure. Black-Right-Pointing-Pointer Compound 2 adopts a two-dimensional layered structure. Black-Right-Pointing-Pointer Magnetic properties of both compounds are investigated.

  11. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  12. Make-buy decisions in the face of radical innovations.

    E-Print Network [OSTI]

    Perrons, Robert Kirby

    2004-10-26

    Connect DEC Digital Equipment Corporation DVD Digital Video Disc EM Expectation Maximization GDP Gross Domestic Product GE General Electric GM General Motors IBM International Business Machines IP Intellectual Property... ______________________________________________________________________________ Make-Buy Decisions in the Face of Radical Innovations 5 Balloon Tire Bicycle,” the “Aero Cycle,” and the built-in “Cycle Lock” brought about a quantum leap in the industry. Instead of outsourcing the production of the parts for his bicycles as had been...

  13. Infusing self-determination into 18-21 services for students with intellectual or developmental disabilities: A multi-stage, multiple component model

    E-Print Network [OSTI]

    Wehmeyer, Michael L.; Garner, Nancy; Danna, Yeager; Lawrence, Margaret; Davis, Anna Kay

    2006-01-01

    Education and Training in Developmental Disabilities, 2006, 41(1), 3-13 © Division on Developmental Disabilities Infusing Self-Determination into 18 - 21 Services for Students with Intellectual or Developmental Disabilities: A Multi-Stage, Multiple... outcomes (Wehmeyer & Palmer, 2003; Wehmeyer & Schwartz, 1997). Infusing Student Involvement and Self- Determination into High Quality 18 - 21 Supports The focus of our work has centered on the final quality indicator, that of promoting stu- dent involvement...

  14. (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) W(4orld Intellectual Property Organization III IIIIIIInIIIIIIII p aIIIIII IIIIIIIIIIIIIII III IIIII

    E-Print Network [OSTI]

    Robins, Gabriel

    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) W(4orld.04.2012) PCT WO 20 12/047559 A2 (51) International Patent Classification: GOIS 5/02 (2010.01) G06K17/00 (2006, VC, VN, ZA, ZM, ZW. (84) Designated States (unless otherwise indicated,for every kind

  15. Intellectual Property and Propriety in Scholarly Communication: How Open Approaches to Publication in the Humanities Increase the Reach and Visibility of Research

    E-Print Network [OSTI]

    Carroll, Michael W.

    2014-04-29

    , and scholarly publications, is different from that associated with the model of technology transfer that applies to many inventions created on campus. Specifically focused on publication practices, this talk explains how copyright applies to works of scholarly...

  16. IIT Bombay offers intellectual property available as patents / published patent applications, based on its research and development efforts, for licensing to interested parties in the areas

    E-Print Network [OSTI]

    Narayanan, H.

    11 Porous gas diffusion for fuel cell and related electrochemical applications 959/MUM/2006 EE 12 7 Energy efficient regeneration process 767/MUM/2002 EE 8 Freeze concentration system 1000/MUM/2002

  17. Antitrust/Competition Commercial Damages Environmental Litigation and Regulation Forensic Economics Intellectual Property International Arbitration International Trade Product Liability Regulatory Finance and Accounting Risk Management Securities Tax Util

    E-Print Network [OSTI]

    and Power On all sides: dynamic forces · Climate change goals, externality/future costs, subsidies Coal Petroleum Natural Gas Nuclear Power Pumped

  18. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  19. Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too: Understanding action representation in left aIPS. Neuropsychologia (2010), doi:10.1016/j.neuropsychologia.2010.04.028

    E-Print Network [OSTI]

    Hamilton, Antonia

    2010-01-01

    Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too communication Triangles have goals too: Understanding action representation in left aIPS Richard Ramsey of animacy Corresponding author. E-mail address: richard.ramsey@nottingham.ac.uk (R. Ramsey). and brain

  20. A review of "John Goodwin and the Puritan Revolution: Religion and Intellectual Change in Seventeenth-Century England" by John Coffey 

    E-Print Network [OSTI]

    Prior, Charles W. A.

    2007-01-01

    and the Puritan Revolution: Religion and Intellectual Change in Seventeenth-Century England. Woodbridge, Suffolk: The Boydell Press, 2006. 352 pp. + 4 illus. $105. Review by CHARLES W. A. PRIOR, UNIVERSITY OF HULL. This is John Coffey?s second detailed... of a sub- stantial array of sources and complex currents of thought on the intersection of politics and religion. This was followed by a survey of debates on perse- cution and toleration from the age of Elizabeth to the revolution of 1688. Coffey has...

  1. SN 2005ip: A luminous type IIn supernova emerging from a dense circumstellar medium as revealed by X-ray observations

    SciTech Connect (OSTI)

    Katsuda, Satoru [RIKEN (The Institute of Physical and Chemical Research) Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Maeda, Keiichi [Department of Astronomy, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Nozawa, Takaya [Kavli Institute for the Physics and Mathematics of the Universe (WPI), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Pooley, David [Department of Physics, Sam Houston State University, Huntsville, TX 77341-2267 (United States); Immler, Stefan [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 2077 (United States)

    2014-01-10

    We report on the X-ray spectral evolution of the nearby Type IIn supernova (SN) 2005ip based on Chandra and Swift observations covering ?1-6 yr after explosion. X-ray spectra in all epochs are well fitted by a thermal emission model with kT ? 7 keV. The somewhat high temperature suggests that the X-ray emission mainly arises from the circumstellar medium (CSM) heated by the forward shock. We find that the spectra taken two to three years after the explosion are heavily absorbed (N {sub H} ? 5 × 10{sup 22} cm{sup –2}), but the absorption gradually decreases to the level of the Galactic absorption (N {sub H} ? 4 × 10{sup 20} cm{sup –2}) at the final epoch. This indicates that the SN went off in a dense CSM and that the forward shock has overtaken it. The intrinsic X-ray luminosity stays constant until the final epoch, when it drops by a factor of ?2. The intrinsic 0.2-10 keV luminosity during the plateau phase is measured to be ?1.5 × 10{sup 41} erg s{sup –1}, ranking SN 2005ip as one of the brightest X-ray SNe. Based on the column density, we derive a lower limit of a mass-loss rate to be M-dot ?1.5×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, which roughly agrees with that inferred from the X-ray luminosity, M-dot ?2×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, where V{sub w} is the circumstellar wind speed. Such a high mass-loss rate suggests that the progenitor star had eruptive mass ejections similar to a luminous blue variable star. The total mass ejected in the eruptive period is estimated to be ?15 M {sub ?}, indicating that the progenitor mass is ? 25 M {sub ?}.

  2. Changing the intellectual climate

    E-Print Network [OSTI]

    Castree, Noel; Adams, William M.; Barry, John; Brockington, Daniel; Büscher, Bram; Corbera, Esteve; Demeritt, David; Duffy, Rosaleen; Neves, Katja; Newell, Peter; Pellizzoni, Luigi; Rigby, Kate; Robbins, Paul; Robin, Libby; Rose, Deborah Bird; Ross, Andrew; Schlosberg, David; Sörlin, Sverker; West, Paige; Whitehead, Mark; Wynne, Brian

    2014-08-27

    environmental management (such as international carbon emissions trading). Determining the range of possible values, means and ends that together might inform deliberations and decisions about future societal trajectories is something that GEC scientists...

  3. The Transdisciplinary Intellectual Adventure

    E-Print Network [OSTI]

    Yamamoto, Hirosuke

    major programs have been launched to use GSFS technologies to develop the Kashiwa area into a smart city to identify technologies necessary for smart cities, and these technologies will be translated into new export

  4. Office of the Assistant General Counsel for Technology Transfer...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Technology Transfer & Intellectual Property Office of the Assistant General Counsel for Technology Transfer & Intellectual Property The Office of the Assistant General Counsel for...

  5. 2011 AT&T Intellectual Property. All rights reserved. AT&T and the AT&T logo are trademarks of AT&T Intellectual Property. Whether family members are at work or school, in the same home or geographically separated, AT&T

    E-Print Network [OSTI]

    Greenberg, Albert

    plan to recharge your battery in case of power outages (e.g., charging via your car charger, extra be reached quickly to dial for help. Create IDs. Create photo IDs for every family member using the template aren't getting through. Keep your wireless phone batteries charged at all times. Have an alternate

  6. Electromagnetic properties of neutrinos

    E-Print Network [OSTI]

    Carlo Giunti; Alexander Studenikin

    2010-06-08

    A short review on electromagnetic properties of neutrinos is presented. In spite of many efforts in the theoretical and experimental studies of neutrino electromagnetic properties, they still remain one of the main puzzles related to neutrinos.

  7. Dyula intellectualism in the Ivory Coast and Ghana : a study of the life and career of Al-H?a?jj S?a?lih? b. Muh?ammad b. Uthma?n 

    E-Print Network [OSTI]

    Muhammad, Akbar

    1974-01-01

    This thesis is concerned with the 19th century politico-religious and intellectual aspects of the Dyula of Bondoukou and the career of al-H?a?jj S?a?lih? b. Muh?ammad b. Uthma?n of Jinini (d. 1932). Among the points of discussion...

  8. RNA Extraction and Labeling 1. To IP pellet (~ 25 l vol), add 175 l of: 10 mM HEPES-NaOH, pH 7.5

    E-Print Network [OSTI]

    Aris, John P.

    85 RNA Extraction and Labeling 1. To IP pellet (~ 25 µl vol), add 175 µl of: 10 mM HEPES-NaOH, pH 7 Speed-Vac. 7. Labeling 3' ends. To each pellet, add 10 µl containing: 1 X NEB RNA Ligase buffer 10% DMSO precipitate. Use DEPC-treated 3M NaOAc, pH 5. Wash with 75% EtOH and dry. 12. Resuspend pellet completely in 5

  9. 4. Wrzburger Workshop ,,IP Netzmanagement, IP Netzplanung und Optimierung"

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    Protocol (ICMP, ,,ping" and ,,traceroute" Funktionen) - Simple Network Management Protocol (SNMP) - DNSRessourcenmanagement Architektur R R R R R R S R R R S S QoS Architektur Harte und weiche QoS Garantien DiffServ Netz mit

  10. Industrial Property Management Specialist

    Broader source: Energy.gov [DOE]

    A successful candidate in this position will administer the property management program and establish policies, regulations and procedures. Verify that sound internal processes and good business...

  11. TJNAF Property Manual

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    NATIONAL ACCELERATOR FACILITY PROPERTY MANAGEMENT POLICY AND PROCEDURES MANAGED BY JEFFERSON SCIENCE ASSOCIATES, LLC FOR THE U. S. DEPARTMENT OF ENERGY May 2014 S UBMIITED By'...

  12. Properties of Biomaterials

    E-Print Network [OSTI]

    Heller, Barbara

    Mechanical Properties of Biomaterials Academic Resource Center #12;Determining Biomaterial during testing. #12;Compression Testing · Performed mainly for biomaterials subjected to compressive

  13. Dynaically Responsive IP Window Coatings

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pacific Northwest National Laboratory Dynamically Responsive IR Window Coatings 2014 Building Technologies Office Peer Review 2 Project Summary Timeline: Start date:...

  14. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of a publication or guarantee its technical correctness. Title: Northern New Mexico Climate, Water Year 2012 at Los Alamos National Laboratory, Poster, Individual Permit for...

  15. IP Awareness Seminar Presented by

    E-Print Network [OSTI]

    Yang, Eui-Hyeok

    /Patent Process at Stevens Inventor Idea Issued Patent 2 ­ 4 Years US PTO Inventor Incentives Inventor OIE: Details, Details, 1. "First-Inventor-to-File" system ­ Effective Date: March 16, 2013. 3. Post requirement that an individual inventor be listed as the applicant. Effective Date: Applies to applications

  16. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch88 Sign In About | Careers |

  17. http://journals.cambridge.org Downloaded: 14 Jul 2009 IP address: 131.111.16.227 J. Fkid Mech. (1996),wl.321, pp. 395419

    E-Print Network [OSTI]

    Hinch, John

    1996-01-01

    of industrial applications including advanced materials processing, waste treatment, enhanced oil recovery, food of the attractive mechanical properties that can be achieved and because of the need for recycling plastics

  18. Life-cycle Assessment of Semiconductors

    E-Print Network [OSTI]

    Boyd, Sarah B.

    2009-01-01

    semiconductor processing materials are closely held intellectual property. Chemical textbooks and handbooks

  19. Petroleum property valuation

    E-Print Network [OSTI]

    Smith, James L.

    2003-01-01

    This paper provides an overview of the principal economic methods employed to assess the value of petroleum properties. The difference between wellhead and in situ resource values is examined, as well as drawbacks inherent ...

  20. Top Quark Properties

    E-Print Network [OSTI]

    Tony M. Liss

    2012-12-03

    I review the latest results on properties of the top quark from the Tevatron and the LHC, including results measured in $t\\bar{t}$ and single-top events on the mass, width, couplings, and spin correlations.

  1. Headquarters Personal Property Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2004-10-25

    To establish procedures for managing Government personal property owned or leased by the Department of Energy and in the custody of DOE Headquarters employees, including those in the National Nuclear Security Administration. Cancels DOE HQ O 580.1A

  2. Transport Properties of Nanocomposites 

    E-Print Network [OSTI]

    Narayanunni, Vinay

    2010-07-14

    , and vital information regarding the electrical properties of the fibers and fiberfiber junctions was obtained for the case of two stabilizers used during composite preparation ? Gum Arabic (GA) and Poly(3,4-ethylenedioxythiophene) poly...

  3. Mechanical Properties of Nanocrystal Supercrystals

    E-Print Network [OSTI]

    Tam, Enrico

    2010-01-01

    and Its Impact on Mechanical Properties. MacromoleculesO. L. ; Minor, A. M. , Mechanical annealing and source-Mechanical Properties of Nanocrystal Supercrystals Enrico

  4. Commercial Solar Property Tax Exemption

    Broader source: Energy.gov [DOE]

    The tax exemption is generally for “certified pollution control equipment and facilities” which includes any property including real or personal property, equipment, facilities, or devices used t...

  5. Personal Property Policy | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Personal Property Policy Personal Property Policy Personal Property Policy The DOE Personal Property Policy Division is responsible for development and oversight of the...

  6. Real Property Asset Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-09-24

    The directive establishes an integrated corporate-level, performance based approach to the life-cycle management of our real property assets. It links real property asset planning, programming, budgeting and evaluation to the Department's multi-faceted missions. Successful implementation of this order will enable the Department to carry out our stewardship responsibilities, and will ensure that our facilities and infrastructure are properly sized and in a condition to meet our mission requirements today and in the future. Chg 1, dated 2-8-08. Chg 2, dated 4-25-11

  7. Real Property Asset Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-09-24

    The directive establishes an integrated corporate-level, performance based approach to the life-cycle management of our real property assets. It links real property asset planning, programming, budgeting and evaluation to the Department's multi-faceted missions. Successful implementation of this order will enable the Department to carry out our stewardship responsibilities, and will ensure that our facilities and infrastructure are properly sized and in a condition to meet our mission requirements today and in the future. Cancels: DOE O 430.1A. Chg 1, dated 2-8-08. Chg 2, dated 4-25-11

  8. EERE-SBIR technology transfer opportunity. H2 Safety Sensors for H2

    SciTech Connect (OSTI)

    Johnston, Mariann R.

    2015-12-01

    The Office of Energy Efficiency and Renewable Energy’s Fuel Cell Technologies Office (FCTO) works in partnership with industry (including small businesses), academia, and DOE's national laboratories to establish fuel cell and hydrogen energy technologies as economically competitive contributors to U.S. transportation needs. The work that is envisioned between the SBIR/STTR grantee and Los Alamos National Laboratory would involve Technical Transfer of Los Alamos Intellectual Property (IP) on Thin-film Mixed Potential Sensor (U.S. Patent 7,264,700) and associated know-how for H2 sensor manufacturing and packaging.

  9. Self-Charging Battery Project

    SciTech Connect (OSTI)

    Yager, Eric

    2007-07-25

    In March 2006, a Cooperative Research and Development Agreement (CRADA) was formed between Fauton Tech, Inc. and INL to develop a prototype for a commercial application that incorporates some INL-developed Intellectual Properties (IP). This report presents the results of the work performed at INL during Phase 1. The objective of Phase 1 was to construct a prototype battery in a “D” cell form factor, determine optimized internal components for a baseline configuration using a standard coil design, perform a series of tests on the baseline configuration, and document the test results in a logbook.

  10. GRAPHENE: ELECTRON PROPERTIES AND

    E-Print Network [OSTI]

    Gabrieli, John

    GRAPHENE: ELECTRON PROPERTIES AND TRANSPORT PHENOMENA Leonid Levitov MIT Lecture notes and HW and magnetoresistance Quantum Hall effect reminder The half-integer QHE in graphene Energy gaps and splitting of Landau levels QHE in p-n and p-n-p junctions Spin transport at graphene edge Fine structure constant

  11. Representation of State Property Systems

    E-Print Network [OSTI]

    Diederik Aerts; Sylvia Pulmannova

    2008-11-15

    A 'state property system' is the mathematical structure which models an arbitrary physical system by means of its set of states, its set of properties, and a relation of 'actuality of a certain property for a certain state'. We work out a new axiomatization for standard quantum mechanics, starting with the basic notion of state property system, and making use of a generalization of the standard quantum mechanical notion of 'superposition' for state property systems.

  12. Top Mass and Properties

    E-Print Network [OSTI]

    Yen-Chu Chen

    2008-05-15

    The top quark was discovered in 1995. The top quark mass is now well measured at the Tevatron, with uncertainty getting below 1% of the top mass. The world average from last year was 170.9 $\\pm$ 1.8 GeV/$c^2$. The new CDF measurement is 172 $\\pm$ 1.2 (stat) $\\pm$ 1.5 (sys) GeV/$c^2$, and D0 will soon present a new measurement. The top quark mass is an important parameter in the Standard Model, and should be measured as precisely as possible. To learn more about the top quark observed and study possible new physics, other properties also should be measured. At the Tevatron, the charge of the top quark can be measured directly. Examples of other properties studied and reported in this presentation are W helicity, top decay branching ratio to b ($R_b$), searches for $t \\to H b$ and for flavor changing neutral current (FCNC). The results are all consistent with the Standard Model within current statistics. With significantly more data being collected at the Tevatron, precision measurements of the top properties are just starting.

  13. Top Quark Properties

    E-Print Network [OSTI]

    Yvonne Peters; for the Atlas Collaboration; CDF Collaboration; CMS Collaboration; D0 Collaboration

    2011-12-02

    Since its discovery in 1995 by the CDF and D0 collaborations at the Fermilab Tevatron collider, the top quark has undergone intensive studies. Besides the Tevatron experiments, with the start of the LHC in 2010 a top quark factory started its operation. It is now possible to measure top quark properties simultaneously at four different experiments, namely ATLAS and CMS at LHC and CDF and D0 at Tevatron. Having collected thousands of top quarks each, several top quark properties have been measured precisely, while others are being measured for the first time. In this article, recent measurements of top quark properties from ATLAS, CDF, CMS and D0 are presented, using up to 5.4 fb-1 of integrated luminosity at the Tevatron and 1.1 fb^-1 at the LHC. In particular, measurements of the top quark mass, mass difference, forward backward charge asymmetry, tt - spin correlations, the ratio of branching fractions, W helicity, anomalous couplings, color flow and the search for flavor changing neutral currents are discussed.

  14. Introduction Dynamical properties of (-)-transformation Dynamical properties of

    E-Print Network [OSTI]

    /04/2010 Digital expansions, dynamics and tilings, Aussois Dynamical properties of the (-)-transformation 1/17 #12 of (-)-transformation Digital expansions, dynamics and tilings, Aussois Dynamical properties of the (-)-transformation 2/17 #12;Introduction Dynamical properties of (-)-transformation Introduction Digital expansions, dynamics

  15. ISSN 0362 1197, Human Physiology, 2012, Vol. 38, No. 2, pp. 121128. Pleiades Publishing, Inc., 2012. Original Russian Text I.P. Ganin, S.L. Shishkin, A. G. Kochetova, A.Ya. Kaplan, 2012, published in Fiziologiya Cheloveka, 2012, Vol. 38, No. 2, pp. 513.

    E-Print Network [OSTI]

    Kaplan, Alexander

    ., 2012. Original Russian Text © I.P. Ganin, S.L. Shishkin, A. G. Kochetova, A.Ya. Kaplan, 2012, published of the Stimulus Position in a Stimulus Train I. P. Ganin, S. L. Shishkin, A. G. Kochetova, and A. Ya. Kaplan

  16. Testing symmetric properties of distributions

    E-Print Network [OSTI]

    Valiant, Paul (Paul Andrew)

    2008-01-01

    We introduce the notion of a Canonical Tester for a class of properties on distributions, that is, a tester strong and general enough that "a distribution property in the class is testable if and only if the Canonical ...

  17. Time translation of quantum properties

    E-Print Network [OSTI]

    L. Vanni; R. Laura

    2008-12-03

    Based on the notion of time translation, we develop a formalism to deal with the logic of quantum properties at different times. In our formalism it is possible to enlarge the usual notion of context to include composed properties involving properties at different times. We compare our results with the theory of consistent histories.

  18. Property Postings - SRSCRO

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid youOxygen Generation | CenterPressthis site »ProgrammingProperty

  19. Electronic and Spintronic Properties of Graphene

    E-Print Network [OSTI]

    Pi, Keyu

    2010-01-01

    Electronic and Spintronic Properties of Graphene by Ke-yu Piproperties and spintronic properties of transition metal45 Chapter 4: Spintronic properties of

  20. Becoming a Global Intellectual Hub

    E-Print Network [OSTI]

    Calgary, University of

    Highstrategicvisiondocument, published2011 Cover: Designed by renowned Spanish architect Santiago Calatrava, Calgary's Peace Bridge accommodates some 6000 pedestrians and cyclists who cross the Bow River each day to access the city's downtown

  1. Neutrino Sources and Properties

    E-Print Network [OSTI]

    Francesco Vissani

    2015-05-19

    In this lecture, prepared for PhD students, basic considerations on neutrino interactions, properties and sites of production are overviewed. The detailed content is as follows: Sect. 1, Weak interactions and neutrinos: Fermi coupling; definition of neutrinos; global numbers. Sect. 2, A list of neutrino sources: Explanatory note and examples (solar pp- and supernova-neutrinos). Sect. 3, Neutrinos oscillations: Basic formalism (Pontecorvo); matter effect (Mikheev, Smirnov, Wolfenstein); status of neutrino masses and mixings. Sect. 4, Modifying the standard model to include neutrinos masses: The fermions of the standard model; one additional operator in the standard model (Weinberg); implications. One summary table and several exercises offer the students occasions to check, consolidate and extend their understanding; the brief reference list includes historical and review papers and some entry points to active research in neutrino physics.

  2. Materials Classification & Accelerated Property Predictions using...

    Office of Scientific and Technical Information (OSTI)

    Materials Classification & Accelerated Property Predictions using Machine Learning Citation Details In-Document Search Title: Materials Classification & Accelerated Property...

  3. Government Personal Property Asset Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1998-05-11

    Establishes procedures for managing Government personal property owned or leased by and in the custody of Department of Energy (DOE) Headquarters employees. Cancels HQ 1400.1.

  4. Thermodynamic Properties of Supported Catalysts

    SciTech Connect (OSTI)

    Gorte, Raymond J.

    2014-03-26

    The goals of this work were to develop Coulometric Titration as a method for characterizing the thermodynamic redox properties of oxides and to apply this technique to the characterization of ceria- and vanadia-based catalysts. The redox properties of ceria and vanadia are a major part of what makes these materials catalytically active but their properties are also dependent on their structure and the presence of other oxides. Quantifying these properties through the measurement of oxidation energetics was the goal of this work.

  5. Federal Real Property Council Guidance

    Office of Environmental Management (EM)

    real property uses: A. Land Predominant Use: 1. Agriculture: Land under cultivation for food or fiber production. 2. Grazing: Conservation lands primarily administered to...

  6. Fundamental Properties of Salts

    SciTech Connect (OSTI)

    Toni Y Gutknecht; Guy L Fredrickson

    2012-11-01

    Thermal properties of molten salt systems are of interest to electrorefining operations, pertaining to both the Fuel Cycle Research & Development Program (FCR&D) and Spent Fuel Treatment Mission, currently being pursued by the Department of Energy (DOE). The phase stability of molten salts in an electrorefiner may be adversely impacted by the build-up of fission products in the electrolyte. Potential situations that need to be avoided, during electrorefining operations, include (i) fissile elements build up in the salt that might approach the criticality limits specified for the vessel, (ii) electrolyte freezing at the operating temperature of the electrorefiner due to changes in the liquidus temperature, and (iii) phase separation (non-homogenous solution). The stability (and homogeneity) of the phases can be monitored by studying the thermal characteristics of the molten salts as a function of impurity concentration. Simulated salt compositions consisting of the selected rare earth and alkaline earth chlorides, with a eutectic mixture of LiCl-KCl as the carrier electrolyte, were studied to determine the melting points (thermal characteristics) using a Differential Scanning Calorimeter (DSC). The experimental data were used to model the liquidus temperature. On the basis of the this data, it became possible to predict a spent fuel treatment processing scenario under which electrorefining could no longer be performed as a result of increasing liquidus temperatures of the electrolyte.

  7. Properties of Liquid Plutonium

    SciTech Connect (OSTI)

    Freibert, Franz J.; Mitchell, Jeremy N.; Schwartz, Daniel S.; Saleh, Tarik A.; Migliori, Albert

    2012-08-02

    Unalloyed polycrystalline Pu displays extreme thermal expansion behavior, i.e., {alpha} {yields} {beta} {yields} {gamma} {yields} {delta} increases by 25% in volume and {delta} {yields} {var_epsilon} {yields} liquid decreases by 4.5% in volume. Thus, making it difficult to measure density into the liquid state. Dilatometer outfitted with CaF molten metal cell offers a proven capability to measure thermal expansion in molten metals, but has yet to be proven for Pu. Historic data from the liquid nuclear fuels program will prove extremely useful as a guide to future measurements. 3.3at% Ga changes Pu molten metal properties: 50% increase in viscosity and {approx}3% decrease in density. Fe may decrease the density by a small amount assuming an averaging of densities for Pu-Ga and Pu-Fe liquids. More recent Boivineau (2009) work needs some interpretation, but technique is being employed in (U,Pu)O{sub 2} nuclear fuels program (Pu Futures, 2012).

  8. Appendix C: Hazardous Property Assessment

    E-Print Network [OSTI]

    Siddharthan, Advaith

    Appendix C: Hazardous Property Assessment The aim of this appendix is to: · give advice on the hazards properties H1 to H14 identified in Annex III of the HWD; · provide assessment methods and threshold concentrations for the hazards; and · advise on which test methods should be considered

  9. Analysing Java System Properties Implementation

    E-Print Network [OSTI]

    Nierstrasz, Oscar

    Analysing Java System Properties Implementation Supplementary documentation to the Bachelor. It introduces the Java Platform Debugger Architecture (JPDA), looks at the Java Debug Interface (JDI;Analysing Java System Properties Contents David Wettstein, 8. Dezember 2013 3 Contents 1 Standard System

  10. Analysis of Hydrologic Properties Data

    SciTech Connect (OSTI)

    L. Pan

    2004-10-04

    This analysis report describes the methods used to determine hydrologic properties based on the available field data from the unsaturated zone (UZ) at Yucca Mountain, Nevada. The technical scope, content, and management of this analysis report are described in the planning document ''Technical Work Plan for: Unsaturated Zone Flow Analysis and Model Report Integration'' (BSC 2004 [DIRS 169654], Sections 2, 4, and 8). Fracture and matrix properties are developed by analyzing available survey data from the Exploratory Studies Facility (ESF), the Enhanced Characterization of Repository Block (ECRB) Cross-Drift, and/or boreholes; air-injection testing data from surface boreholes and from boreholes in the ESF; and data from laboratory testing of core samples. In addition, the report ''Geologic Framework Model'' (GFM2000) (BSC 2004 [DIRS 170029]) also serves as a source report by providing the geological framework model of the site. This report is a revision of the model report under the same title (BSC 2003 [DIRS 161773]), which in turn superceded the analysis report under the same title. The principal purpose of this work is to provide representative uncalibrated estimates of fracture and matrix properties for use in the model report Calibrated Properties Model. The term ''uncalibrated'' is used to distinguish the properties or parameters estimated in this report from those obtained from the inversion modeling used in ''Calibrated Properties Model''. The present work also provides fracture geometry properties for generating dual-permeability grids as documented in the scientific analyses report, ''Development of Numerical Grids for UZ Flow and Transport Modeling''.

  11. Thermoelectric properties of nanoporous Ge

    E-Print Network [OSTI]

    Lee, Joo-Hyoung

    We computed thermoelectric properties of nanoporous Ge (np-Ge) with aligned pores along the [001] direction through a combined classical molecular dynamics and first-principles electronic structure approach. A significant ...

  12. Thermodynamic properties of uranium dioxide

    SciTech Connect (OSTI)

    Fink, J.K.; Chasanov, M.G.; Leibowitz, L.

    1981-04-01

    In order to provide reliable and consistent data on the thermophysical properties of reactor materials for reactor safety studies, this revision is prepared for the thermodynamic properties of the uranium dioxide portion of the fuel property section of the report Properties for LMFBR Safety Analysis. Since the original report was issued in 1976, there has been international agreement on a vapor pressure equation for the total pressure over UO/sub 2/, new methods have been suggested for the calculation of enthalpy and heat capacity, and a phase change at 2670 K has been proposed. In this report, an electronic term is used in place of the Frenkel defect term in the enthalpy and heat capacity equation and the phase transition is accepted.

  13. Division 1137 property control system

    SciTech Connect (OSTI)

    Pastor, D.J.

    1982-01-01

    An automated data processing property control system was developed by Mobile and Remote Range Division 1137. This report describes the operation of the system and examines ways of using it in operational planning and control.

  14. Renewable Energy Property Tax Assessment

    Broader source: Energy.gov [DOE]

    Solar photovoltaic (PV) and wind energy facilities with a capacity of 2 megawatts (MW) AC or less are assessed locally for property taxes. Additionally, low impact hydro, geothermal, and biomass...

  15. Property Rules, Liability Rules, and Molecular Futures: Bargaining in the Shadow of the Cathedral

    E-Print Network [OSTI]

    Burk, DL

    2009-01-01

    J. et. al. , ‘Patent Damages and Real Options: How Judicialliterature on IP and real options. I conclude with someRules’. Dan L. Burk Real options in the cathedral I have so

  16. Local Option- Property Assessed Clean Energy Financing

    Broader source: Energy.gov [DOE]

    Property-Assessed Clean Energy (PACE) financing effectively allows property owners to borrow money to pay for energy improvements. The amount borrowed is typically repaid via property taxes, with...

  17. IPMP COMMENTS 2-11-2011 (J1490880.DOCX;1)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Intellectual Property Management Plan L3:NFA.CC.P2.01 May 4, 2011 CASL-U-2011-0036-001 Intellectual Property Management Plan ii CASL-U-2011-0036-001 REVISION LOG Revision Date...

  18. Green Energy Property Tax Assessment (Tennessee) | Department...

    Broader source: Energy.gov (indexed) [DOE]

    the Treasury Tennessee offers a special ad valorem property tax assessment for certified green energy production facilities. Property that generates electricity from a certified...

  19. Electrical and Mechanical Properties of Graphene

    E-Print Network [OSTI]

    Bao, Wenzhong

    2011-01-01

    der Zande, P.L. McEuen, Mechanical properties of suspendedA. Bachtold, Imaging mechanical vibrations in suspendedPhani, Effective elastic mechanical properties of single

  20. MECHANICAL PROPERTIES OF POROUS PNZT POLYCRYSTALLINE CERAMICS

    E-Print Network [OSTI]

    Biswas, D.R.

    2010-01-01

    F. P. Knudsen, "Dependence of Mechanical Strength of BrittleMicrostruc- ture on the Mechanical Properties of Ceramics,"of Porosity on the Mechanical Properties of Lead Zirconate-

  1. "Covalent functionalization and electron-transfer properties...

    Office of Scientific and Technical Information (OSTI)

    to combine the outstanding stability and electrochemical properties of carbon-based structures with the unique properties of molecular structures for applications such as...

  2. Standardization of Transport Properties Measurements: Internal...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Standardization of Transport Properties Measurements: Internal Energy Agency (IEA-AMT) Annex on Thermoelectric Standardization of Transport Properties Measurements: Internal Energy...

  3. Electrical and Mechanical Properties of Graphene

    E-Print Network [OSTI]

    Bao, Wenzhong

    2011-01-01

    Nano Letters, 5 [67] G. Liu, Electrical Transport in CarbonOF CALIFORNIA RIVERSIDE Electrical and Mechanical PropertiesOF THE DISSERTATION Electrical and Mechanical Properties of

  4. Property:ElectricalMeasurement | Open Energy Information

    Open Energy Info (EERE)

    search Property Name ElectricalMeasurement Property Type String Description MHK Electrical & Power Measurement Categories Used in FormTemplate MHKSensor Allows Values...

  5. Basic energy properties of electrolytic solutions database. ...

    Office of Scientific and Technical Information (OSTI)

    Basic energy properties of electrolytic solutions database. Viscosity, thermal conductivity, density, enthalpy Citation Details In-Document Search Title: Basic energy properties...

  6. Correlation Between Structure and Thermoelectric Properties of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Correlation Between Structure and Thermoelectric Properties of Bulk High Performance Materials for Energy Conversion Correlation Between Structure and Thermoelectric Properties of...

  7. Towards more power efficient IP lookup engines 

    E-Print Network [OSTI]

    Ahmad, Seraj

    2007-04-25

    on the routing table compaction using logic minimization techniques. The second stream focuses on routing table partitioning. This work proposes to bridge the gap by employing strategies to combine these two leading state of the art schemes. The existing...

  8. Consultancy and Research IP and licensing

    E-Print Network [OSTI]

    Miall, Chris

    and public policy. Recent clients include the NHS, Proctor & Gamble, the Royal Navy and Severn Trent Water has a large portfolio of medical, biomedical, engineering and environmental patents available: Dr John Pearson Email: patents@alta.bham.ac.uk Tel: +44 (0)121 414 8632 Fax: +44 (0)121 414 9040

  9. Sports over IP : dynamics and perspectives

    E-Print Network [OSTI]

    Blain, Emmanuel

    2010-01-01

    Technological advances are allowing the use of the Internet Protocol and the Internet infrastructure mainly built by cable and telecom operators for broadcasting purposes in the U.S. This disruption raises a business issue ...

  10. Overview: IP routing o Bellman-Ford

    E-Print Network [OSTI]

    Biagioni, Edoardo S.

    if M 0new entries to all my, adding cost of reaching that router to see if route is better than what we have to each of the neighbor's metrics 2. for each entry (D, P', M') in the updated neighbor

  11. IPS- Industrial Power Systems | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavy ElectricalsFTLTechnology SrlWindHydrodynamic

  12. IP Kids Page | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D.FoodHydropower, WaveID-11383 Revision 2TOIOR

  13. Chip-Secured Data Access: Confidential Data on Untrusted Servers

    E-Print Network [OSTI]

    by the Computer Security Institute (CSI) and the FBI [FBI01], the theft of intellectual property due to database

  14. Microsoft Word - FY10PropertyBSCContractor.doc

    Energy Savers [EERE]

    Items Performance Measure 3: Property Management Accounting and Control - High Risk Property, as defined in DOE Property Management Regulation (PMR) and DOE Property...

  15. 1.2 Electromagnetic (EM) properties Physical properties

    E-Print Network [OSTI]

    Zhang, Guifu

    index: m = n' + in" relative dielectric constant: !r = !' + i!" · They are closely related: !r = m2 but, with different application: m for propagation !r for scattering #12;Refractive index propagation property Phase: kn'r Attenuation: kn"r! n = n'= c v Dielectric constant (permittivity) EM theory includes Maxwell

  16. Real Property and Asset Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-09-24

    The directive establishes an integrated corporate-level, performance based approach to the life-cycle management of our real property assets. It links real property asset planning, programming, budgeting and evaluation to the Department's multi-faceted missions. Successful implementation of this order will enable the Department to carry out stewardship responsibilities, and will ensure that facilities and infrastructure are properly sized and in a condition to meet our mission requirements today and in the future. Supersedes DOE O 430.1A Chg 1.

  17. Property | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) by Carbon-Rich MatricesstudentsProjectsProperty - THERE ARE NO PROPERTY

  18. Mechanical properties and tribological behavior of contaminate...

    Office of Scientific and Technical Information (OSTI)

    AND MISCELLANEOUSMATHEMATICS, COMPUTING, AND INFORMATION SCIENCE; MECHANICAL PROPERTIES; TRIBOLOGY; PARTICULATES; NANOSTRUCTURES; IMPURITIES; MACHINE PARTS; MINIATURIZATION...

  19. Superconductivity and Magnetism: Materials Properties

    E-Print Network [OSTI]

    .g. within high-Tc superconductivity, magnetic superconductors, MgB2, CMR materials, nanomagnetism and spin#12;#12;Superconductivity and Magnetism: Materials Properties and Developments #12;Copyright 2003 Risø National Laboratory Roskilde, Denmark ISBN 87-550-3244-3 ISSN 0907-0079 #12;Superconductivity

  20. December 2010 FACILITIES & PROPERTY MANAGEMENT

    E-Print Network [OSTI]

    change with carbon management being the key issue for many organisations. The HE sector must play itsDecember 2010 FACILITIES & PROPERTY MANAGEMENT CARBON MANAGEMENT AND SUSTAINABILITY ACTIVITIES REPORT 2009/10 #12;Contents Page · Introduction 1 · Carbon and Energy Management 3 · Waste and Recycling

  1. Headquarters Personal Property Asset Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-09-26

    To establish procedures for managing Government personal property owned or leased by the Department of Energy and in the custody of DOE Headquarters employees, including those in the National Nuclear Security Administration. Cancels DOE HQ O 580.1B. Canceled by DOE N 251.69.

  2. Property

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested PartiesBuildingBudget || Department of Energy ProjectsER-B-98-07 AUDIT

  3. ATLAS results on top properties

    E-Print Network [OSTI]

    F. Derue

    2014-08-26

    Recent measurements of top quark properties using $t{\\bar t}$ events produced in proton-proton collisions at the Large Hadron Collider with centre of mass energies of 7 and 8 TeV and detected by the ATLAS experiment are presented. These results include top quark mass, the top and anti-top mass difference, the electric charge, the top quark polarization and spin correlation, the $t{\\bar t}$ charge asymmetry and the search for flavour changing neutral currents.

  4. Thermoplastics Properties J. D. Muzzy

    E-Print Network [OSTI]

    Colton, Jonathan S.

    2.3 Thermoplastics ­ Properties J. D. Muzzy Georgia Institute of Technology, Atlanta, GA, USA 2.3.4 THERMOPLASTIC GROUPS 2.3.4.1.1 Polyolefins 2.3.4.1.2 Styrenics 2.3.4.1.3 Vinyls 2.3.4.1.9 Polyethers 2.3.4.1.10 Sulfur Containing polymers 2.3.4.1.11 Additional Thermoplastics 2.3.5 ACKNOWLEDGEMENTS

  5. Department of Energy Personal Property Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-12-07

    This Order provides responsibilities and requirements for personal property management at the Department. Change 1, dated 5-8-08, includes responsibilities for heads of Departmental elements to be accountable for personal property inventories.

  6. Department of Energy Personal Property Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-12-07

    This Order provides responsibilities and requirements for personal property management at the Department. Change 1, dated 5-8-08, includes responsibilities for heads of Departmental elements to be accountable for personal property inventories. Cancels DOE O 580.1.

  7. Property Testing: Theory and Applications Sofya Raskhodnikova

    E-Print Network [OSTI]

    Smith, Adam D.

    properties require (n) queries, even for adaptive tests. We show that testing properties defined by 2CNFProperty Testing: Theory and Applications by Sofya Raskhodnikova Submitted to the Department. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Michael Sipser Professor of Mathematics Thesis Supervisor Accepted

  8. Property Testing: Theory and Applications Sofya Raskhodnikova

    E-Print Network [OSTI]

    Smith, Adam D.

    properties require ## n) queries, even for adaptive tests. We show that testing properties defined by 2CNFProperty Testing: Theory and Applications by Sofya Raskhodnikova Submitted to the Department by . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Michael Sipser Professor of Mathematics Thesis Supervisor Accepted

  9. Carroll County- Green Building Property Tax Credit

    Broader source: Energy.gov [DOE]

    The state of Maryland permits Carroll County (Md Code: Property Tax § 9-308(e)) to offer property tax credits for high performance buildings if it chooses to do so.* Carroll County has exercised...

  10. Local Option- Property Assessed Clean Energy Financing

    Broader source: Energy.gov [DOE]

    Property-Assessed Clean Energy (PACE) financing effectively allows property owners to borrow money from the local government to pay for energy improvements. The amount borrowed is typically repai...

  11. Testability of linear-invariant properties

    E-Print Network [OSTI]

    Bhattacharyya, Arnab

    2011-01-01

    Property Testing is the study of super-efficient algorithms that solve "approximate decision problems" with high probability. More precisely, given a property P, a testing algorithm for P is a randomized algorithm that ...

  12. Rheological and Thermal Properties of Icy Materials

    E-Print Network [OSTI]

    Durham, William B.

    Laboratory measurements of physical properties of planetary ices generate information for dynamical models of tectonically active icy bodies in the outer solar system. We review the methods for measuring both flow properties ...

  13. Department of Energy Personal Property Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30

    The order sets forth requirements for personal property management and accountability. Admin Chg 1, dated 10-22-12.

  14. Nanogeochemistry: Nanostructures emergent properties and their...

    Office of Scientific and Technical Information (OSTI)

    Nanogeochemistry: Nanostructures emergent properties and their implications to chemical reactions and mass transfers. Citation Details In-Document Search Title:...

  15. Mechanical properties of insulators for Accelerator Magnets

    E-Print Network [OSTI]

    McDonald, Kirk

    Mechanical properties of insulators for Accelerator Magnets WAMSDO 14/11/2011 George Ellwood 1 #12 is critical to the composite's performance ·The mechanical performance is dependent on fibre orientation Effects in Resins · Changes in Mechanical properties ­ Particularly matrix dependent properties

  16. Structural Evaluation by Generalized Integral Property

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    Structural Evaluation by Generalized Integral Property Yosuke Todo NTT Secure Platform Laboratories cryptanalyses are distinguishing attacks by an improved integral distinguisher. The integral distinguisher the propagation characteristic of integral properties, e.g., the ALL or BALANCE property. However, the integral

  17. III 1111111111111111111111111111111111 Physical Properties Data Compilations

    E-Print Network [OSTI]

    PB280·795 III 1111111111111111111111111111111111 Physical Properties Data Compilations Relevant under title: Physical properties data compilations relevant to energy storage. (Nat. stand. ref. data. SHEET NSRDS-NBS 61, Part 1 4. TITLE AND SUATITLE Physical Properties Data Compilations Relevant

  18. The alternative Daugavet property. Characterizations for C

    E-Print Network [OSTI]

    Martín, Miguel

    The alternative Daugavet property. Characterizations for C -algebras and von Neumann preduals of a Banach space The alternative Daugavet property Summary of results The talk is based on these papers M. Martín and T. Oikhberg, An alternative Daugavet property. Journal of Mathematical Analysis

  19. Real Property | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergyPresidentialThis 3-D renderingPartnership of the AmericasProperty

  20. Property Values | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,Energy LLCALLETE Inc d b a Minnesota PowerView NewProperty

  1. Calculation of thermophysical properties of sodium. [LMFBR

    SciTech Connect (OSTI)

    Fink, J.K.; Leibowitz, L.

    1981-01-01

    The thermodynamic properties of sodium previously recommended by Padilla have been updated. As much as possible, the approach described by Padilla has been used. For sodium in the states of saturated liquid and vapor, subcooled liquid and superheated vapor, the following thermodynamic properties were determined: enthalpy, heat capacity (constant pressure and constant volume), pressure, density, thermal-expansion coefficient, and compressibility (adiabatic and isothermal). In addition to the above properties, thermodynamic properties including heat of fusion, heat of vaporization, surface tension, speed of sound and transport properties of themal conductivity, thermal diffusivity, emissivity, and viscosity were determined for saturated sodium.

  2. 1MSE 2090: Introduction to Materials Science Chapter 6, Mechanical Properties Mechanical Properties of Metals

    E-Print Network [OSTI]

    Zhigilei, Leonid V.

    1MSE 2090: Introduction to Materials Science Chapter 6, Mechanical Properties Mechanical Properties, variability of material properties (starting from the middle of page 174) #12;2MSE 2090: Introduction to Materials Science Chapter 6, Mechanical Properties To understand and describe how materials deform (elongate

  3. Electroweak Baryogenesis and Higgs Properties

    SciTech Connect (OSTI)

    Cohen, Timothy; Morrissey, David E.; Pierce, Aaron; /Michigan U., MCTP

    2012-03-13

    We explore the connection between the strength of the electroweak phase transition and the properties of the Higgs boson. Our interest is in regions of parameter space that can realize electroweak baryogenesis. We do so in a simplified framework in which a single Higgs field couples to new scalar fields charged under SU(3){sub c} by way of the Higgs portal. Such new scalars can make the electroweak phase transition more strongly first-order, while contributing to the effective Higgs boson couplings to gluons and photons through loop effects. For Higgs boson masses in the range 115 {approx}< m{sub h} {approx}< 130 GeV, whenever the phase transition becomes strong enough for successful electroweak baryogenesis, we find that Higgs boson properties are modified by an amount observable by the LHC. We also discuss the baryogenesis window of the minimal supersymmetric standard model (MSSM), which appears to be under tension. Furthermore, we argue that the discovery of a Higgs boson with standard model-like couplings to gluons and photons will rule out electroweak baryogenesis in the MSSM.

  4. Sustained signalling by PTH modulates IP3 accumulation and IP3 receptors via cyclic AMP junctions

    E-Print Network [OSTI]

    Meena, Abha; Tovey, Stephen C.; Taylor, Colin W.

    2014-11-27

    , S., Nelson, C. D., Wang, S., Eckhardt, A. 549 E., Cowan, C. L., Spurney, R. F., Luttrell, L. M. et al. (2006). Distinct ?-arrestin- and 550 G protein-dependent pathways for parathyroid hormone receptor-stimulated ERK1/2 551 activation. J. Biol...

  5. Probing mechanical properties of graphene with Raman spectroscopy

    E-Print Network [OSTI]

    Ferralis, Nicola

    2010-01-01

    010-4673-3 REVIEW Probing mechanical properties of graphenetechniques to study the mechanical properties of graphene ?the relation between mechanical and thermal properties is

  6. Investigation into mechanical properties of bone and its main constituents

    E-Print Network [OSTI]

    Evdokimenko, Ekaterina

    2012-01-01

    mineral to the elastic-plastic properties of bone. J Bonec properties, hardness, viscosity and plastic deformation ofin the plastic region is a function of collagen properties

  7. DOE Real Property Asset Management Plan 2005 | Department of...

    Office of Environmental Management (EM)

    DOE Real Property Asset Management Plan 2005 DOE Real Property Asset Management Plan 2005 RealPropertyAssetManagmentPlanAMPReportAug05.pdf More Documents & Publications DOE...

  8. Department of Energy Personal Property Management Guide - DOE...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ARCHIVED DOE G 580.1-1, Department of Energy Personal Property Management Guide by Meredith Williams Functional areas: Business and Support Services, Personal Property, Property...

  9. Annual Property Training & Validations Must be Completed Between...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Annual Property Training & Validations Must be Completed Between March 26 & April 24 It is that time again for all property custodians to take the annual Property Custodian...

  10. Segmented Nanowires Displaying Locally Controllable Properties

    Energy Innovation Portal (Marketing Summaries) [EERE]

    2011-04-22

    The electrical, chemical, mechanical, and optical properties of nanostructures depend on their physical dimensions and chemical compositions. Current methods of forming nanowires rely on knowing the average values for these parameters. As a result, there is poor control over local properties of the nanowires, which may vary from spot to spot in an uncontrolled fashion. By using knowledge of the size-dependent phase diagram, the inventors have developed methods of controlling the properties...

  11. Electronic, Vibrational and Thermoelectric Properties of Two-Dimensional Materials

    E-Print Network [OSTI]

    Wickramaratne, Darshana

    2015-01-01

    Landauer Thermoelectric3 Electronic and Thermoelectric Properties of Few-Layer5 Electronic and thermoelectric properties of van der Waals

  12. Emission properties of radiative chiral nematic liquid crystals

    E-Print Network [OSTI]

    Mavrogordatos, Themistoklis

    2015-01-06

    the fluorescence characteristics from a † I.P. Il'chishin, E.A. Tikhonov, V.G. Tishchenko and M.T. Shpak, Generation of a tunable radiation by impurity cholesteric liquid crystals, JETP Lett., Vol. 32, 24-27 (1980). x xi dye-doped chiral nematic LC in the region... nematic crystal is determined by the specification of the director n alongside the usual quantities (mass density ?, pressure p and velocity v) for a liquid. In equi- librium, a nematic liquid crystal at rest under no external forces (including the forces...

  13. Department of Energy Personal Property Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2012-03-30

    The order sets forth requirements for personal property management and accountability. Admin Chg 1, dated 10-22-12, supersedes DOE O 580.1A.

  14. Biomineralized structural materials with functional optical properties

    E-Print Network [OSTI]

    Li, Ling, Ph. D. Massachusetts Institute of Technology

    2014-01-01

    Many biological structural materials exhibit "mechanical property amplification" through their intricate hierarchical composite designs. In the past several decades, significant progress has been achieved in elucidating ...

  15. Electronic and Spintronic Properties of Graphene

    E-Print Network [OSTI]

    Pi, Keyu

    2010-01-01

    and Spintronic Properties of Graphene by Ke-yu Pi Doctor ofof transition metal doped graphene over the last six years.steps including our graphene exfoliation, graphene

  16. Electrical and Thermoelectrical Transport Properties of Graphene

    E-Print Network [OSTI]

    Wang, Deqi

    2011-01-01

    IV Large Memory Effect in Graphene Based Devices IV-1Transport Properties of Graphene A Dissertation submitted into study the new material, graphene. By investigating the

  17. Measuring Atomic Properties with an Atom Interferometer

    E-Print Network [OSTI]

    Roberts, Tony David

    2006-06-28

    Two experiments are presented which measure atomic properties using an atom interferometer. The interferometer splits the sodium de Broglie wave into two paths,

  18. Electronic structural and electrochemical properties of lithium...

    Office of Scientific and Technical Information (OSTI)

    Journal Article: Electronic structural and electrochemical properties of lithium zirconates and their capabilities of CO2 capture: A first-principles density-functional theory and...

  19. MECHANICAL PROPERTIES OF POROUS PNZT POLYCRYSTALLINE CERAMICS

    E-Print Network [OSTI]

    Biswas, D.R.

    2010-01-01

    Mechanical Properties of Ceramics," Proc. Brit. Ceram. S oon the Uniaxial Strength of Ceramics," J. Am. Ceram. Soc. ,Lead Zirconate-Titanate Ceramics," Ph.D. Thesi' , University

  20. Microstructure and Thermoelectric Properties of Mechanically...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Microstructure and Thermoelectric Properties of Mechanically Robust PbTe-Si Eutectic Composites Home Author: J. R. Sootsman, J. He, V. P. Dravid, S. Ballikaya, D. Vermeulen, C....

  1. GAO-15-305, DOE Real Property, Better Data and a More Proactive Approach Needed to Facilitate Property Disposal

    Broader source: Energy.gov [DOE]

    GAO-15-305, DOE Real Property, Better Data and a More Proactive Approach Needed to Facilitate Property Disposal

  2. Three Theorems Regarding Testing Graph Properties*

    E-Print Network [OSTI]

    Trevisan, Luca

    Three Theorems Regarding Testing Graph Properties* Oded Goldreich,1, Luca Trevisan2 1 Department-mail: luca@eecs.berkeley.edu Received 9 December 2001; accepted 18 September 2002 DOI 10.1002/rsa.10078 ABSTRACT: Property testing is a relaxation of decision problems in which it is required to distinguish YES

  3. TOPOLOGICAL PROPERTIES OF REFLECTIONLESS JACOBI MATRICES

    E-Print Network [OSTI]

    Remling, Christian

    TOPOLOGICAL PROPERTIES OF REFLECTIONLESS JACOBI MATRICES CHRISTIAN REMLING Abstract. We study the topological properties of spaces of re- flectionless Jacobi matrices. 1. Introduction This paper is part of my attempts to achieve a better understand- ing of the absolutely continuous spectrum of Jacobi matrices and

  4. AUTOMATIC IDENTIFICATION OF ENVIRONMENT HAPTIC PROPERTIES1

    E-Print Network [OSTI]

    Dupont, Pierre

    AUTOMATIC IDENTIFICATION OF ENVIRONMENT HAPTIC PROPERTIES1 Pierre E. Dupont Capt Timothy M sensory information collected during telemanipulation tasks in order to automatically identify properties, is considered. An algorithm is presented which automatically segments the data collected during the task, given

  5. E:FoodEngineering& PhysicalProperties

    E-Print Network [OSTI]

    Page, John

    E:FoodEngineering& PhysicalProperties JFS E: Food Engineering and Physical Properties Ultrasonic pressure or under vacuum (to minimize bubble nucleation). Ultrasonic velocity and attenuation (nominally were evident in both air-mixed and vacuum-mixed doughs, suggesting that ultrasound was sensitive

  6. (Basic properties of coals and other solids)

    SciTech Connect (OSTI)

    Not Available

    1991-11-25

    This report discusses basic properties of bituminous, subbituminous, and lignite coals. Properties of coal liquids are also investigated. Heats of immersion in strong acids are found for Pittsburgh {number sign}8, Illinois {number sign}6, and Wyodak coals. Production of coal liquids by distillation is discussed. Heats of titration of coal liquids and coal slurries are reported. (VC)

  7. Property Variability Stochastic Multiscale Analysis and Design

    E-Print Network [OSTI]

    Zabaras, Nicholas J.

    Property Variability Stochastic Multiscale Analysis and Design of Engine Disks N. Zabaras, B. Wen in nickel-based superalloy turbine disks. Issues: Property variability of turbine disk due to high-dimensional multiscale sources Rolls-Royce RB211- 535 turbofan Nickel-base superalloy turbine disk Superalloy

  8. Security properties and CSP Steve Schneider

    E-Print Network [OSTI]

    Doran, Simon J.

    Security properties and CSP Steve Schneider Royal Holloway, University of London Egham, Surrey, TW, the use of a process algebra such as Communicating Sequential Processes (CSP) seems appropriate to describe and analyse them. This paper explores ways in which security properties may be described as CSP

  9. Tensile Properties of Austenitic Stainless Steel

    E-Print Network [OSTI]

    Cambridge, University of

    Tensile Properties of Austenitic Stainless Steel by Iqbal Shah Corpus Christi College, Cambridge;Abstract The short-term mechanical properties of austenitic stainless steels can be affected by a myriad of factors. Materials scientists conduct countless trials to find new steel compositions, in an attempt

  10. Tensile Properties of Austenitic Stainless Steel

    E-Print Network [OSTI]

    Cambridge, University of

    Tensile Properties of Austenitic Stainless Steel by Iqbal Shah Corpus Christi College, Cambridge; Abstract The short­term mechanical properties of austenitic stainless steels can be affected by a myriad of factors. Materials scientists conduct countless trials to find new steel compositions, in an attempt

  11. Enhancement of mechanical properties of 123 superconductors

    DOE Patents [OSTI]

    Balachandran, Uthamalingam (Hinsdale, IL)

    1995-01-01

    A composition and method of preparing YBa.sub.2 Cu.sub.3 O.sub.7-x superconductor. Addition of tin oxide containing compounds to YBCO superconductors results in substantial improvement of fracture toughness and other mechanical properties without affect on T.sub.c. About 5-20% additions give rise to substantially improved mechanical properties.

  12. Enhancement of mechanical properties of 123 superconductors

    DOE Patents [OSTI]

    Balachandran, U.

    1995-04-25

    A composition and method are disclosed of preparing YBa{sub 2}Cu{sub 3}O{sub 7{minus}x} superconductor. Addition of tin oxide containing compounds to YBCO superconductors results in substantial improvement of fracture toughness and other mechanical properties without affect on T{sub c}. About 5-20% additions give rise to substantially improved mechanical properties.

  13. 1MSE 2090: Introduction to Materials Science Chapter 6, Mechanical Properties Mechanical Properties of Metals

    E-Print Network [OSTI]

    Zhigilei, Leonid V.

    1 1MSE 2090: Introduction to Materials Science Chapter 6, Mechanical Properties Mechanical, variability of material properties (starting from the middle of page 174) 2MSE 2090: Introduction to Materials Science Chapter 6, Mechanical Properties To understand and describe how materials deform (elongate

  14. Biomass Feedstock Composition and Property Database

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Office of Energy Efficiency and Renewable Energy's Biomass Program works with industry, academia and national laboratory partners on a balanced portfolio of research in biomass feedstocks and conversion technologies. Through research, development, and demonstration efforts geared at the development of integrated biorefineries, the Biomass Program is helping transform the nation's renewable and abundant biomass resources into cost competitive, high performance biofuels, bioproducts, and biopower.(From the Biomass Program's home page at http://www1.eere.energy.gov/biomass/) The Biomass Feedstock Composition and Property Database allows the user to choose from more than 150 types of biomass samples. The specialized interface then guides the user through choices within the sample (such as "Ash" as a choice in the "Hardwood" sample and displays tables based on choice of composition properties, structure properties, elemental properties, extractive properties, etc.

  15. Call For Native Genius and Indigenous Intellectualism

    E-Print Network [OSTI]

    Fixico, Donald L.

    2000-03-01

    for social acceptance and validated by kinship and symbolic kinship relationships, the tribal society acknowledges all members of the community. In writing the early classic, Social Organization: A Study of the Larger Mind, Charles Horton Cooley stressed... is done in a circle. The sky is round ... and so are all the stars. The wind, in its greatest power whirls. Birds make their nests in circles, for theirs is the same religion as ours. The sun comes forth and goes down again in a circle. The moon does...

  16. Replacing the Rare Earth Intellectual Capital

    SciTech Connect (OSTI)

    Gschneidner, Jr., Karl

    2011-04-01

    The rare earth crisis slowly evolved during a 10 to 15 year period beginning in the mid-1980s, when the Chinese began to export mixed rare earth concentrates. In the early 1990s, they started to move up the supply chain and began to export the individual rare earth oxides and metals. By the late 1990s the Chinese exported higher value products, such as magnets, phosphors, polishing compounds, catalysts; and in the 21st century they supplied finished products including electric motors, computers, batteries, liquid-crystal displays (LCDs), TVs and monitors, mobile phones, iPods and compact fluorescent lamp (CFL) light bulbs. As they moved to higher value products, the Chinese slowly drove the various industrial producers and commercial enterprises in the US, Europe and Japan out of business by manipulating the rare earth commodity prices. Because of this, the technically trained rare earth engineers and scientists who worked in areas from mining to separations, to processing to production, to manufacturing of semifinished and final products, were laid-off and moved to other fields or they retired. However, in the past year the Chinese have changed their philosophy of the 1970s and 1980s of forming a rare earth cartel to control the rare earth markets to one in which they will no longer supply the rest of the world (ROW) with their precious rare earths, but instead will use them internally to meet the growing demand as the Chinese standard of living increases. To this end, they have implemented and occasionally increased export restrictions and added an export tariff on many of the high demand rare earth elements. Now the ROW is quickly trying to start up rare earth mines, e.g. Molycorp Minerals in the US and Lynas Corp. in Australia, to cover this shortfall in the worldwide market, but it will take about five years for the supply to meet the demand, even as other mines in the ROW become productive. Unfortunately, today there is a serious lack of technically trained personnel to bring the entire rare earth industry, from mining to original equipment manufacturers (OEM), up to full speed in the next few years. Accompanying this decline in technical expertise, innovation and new products utilizing rare earth elements has slowed dramatically, and it may take a decade or more to recapture America's leading role in technological advancements of rare earth containing products. Before the disruption of the US rare earth industry, about 25,000 people were employed in all aspects of the industry from mining to OEM. Today, only about 1,500 people are employed in these fields. The ratio of non-technically trained persons to those with college degrees in the sciences or engineering varies from about 8 to 1 to about 4 to 1, depending on the particular area of the industry. Assuming an average of 6 to 1, the number of college degree scientists and engineers has decreased from about 4,000 to 250 employed today. In the magnetic industry the approximate numbers are: 6,000 total with 750 technically trained people in the 1980s to 500 totally employed today of which 75 have degrees. The paucity of scientists and engineers with experience and/or training in the various aspects of production and commercialization of the rare earths is a serious limitation to the ability of the US to satisfy its own needs for materials and technologies (1) to maintain our military strength and posture, (2) to assume leadership in critical energy technologies, and (3) to bring new consumer products to the marketplace. The lack of experts is of even greater national importance than the halting in the 1990s and the recent restart of the mining/benification/separation effort in the US; and thus governmental intervention and support for at least five to 10 years will be required to ameliorate this situation. To respond quickly, training programs should be established in conjunction with a national research center at an educational institution with a long tradition in multiple areas of rare earth and other critical elements research and technology. This center should

  17. George Eliot: a biographical and intellectual study

    E-Print Network [OSTI]

    Gottlieb, Avivah H.

    1971-05-04

    sense , create the world , Hho have the power of imposing their inner vision on the intractable material of reality . And it is this ' tTIlth of feeling ' that , for harian , is the ' only universal bond of 'O.nion ': this is the real stuff...

  18. Applied Intellectual Capital AIC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EAandAmminex A S Jump to:AngolaEnergy Management Jump to:

  19. Effects of chronic cadmium exposure on the conditioned reinforcing properties of morphine and fentanyl in rats 

    E-Print Network [OSTI]

    Miller, Dennis K

    1997-01-01

    as determined on a pre-test. In Experiment 1. control and cadmium-exposed rats received 0, 0.6, 1.25, 2.5. or 5 mg/kg morphine sulfate (ip) for 4 days, and vehicle only for 4 days. Control animals showed a preference for the drug-paired side at 1.25, 2.5. and 5...

  20. Thermophysical Properties of Fluids and Fluid Mixtures

    SciTech Connect (OSTI)

    Sengers, Jan V.; Anisimov, Mikhail A.

    2004-05-03

    The major goal of the project was to study the effect of critical fluctuations on the thermophysical properties and phase behavior of fluids and fluid mixtures. Long-range fluctuations appear because of the presence of critical phase transitions. A global theory of critical fluctuations was developed and applied to represent thermodynamic properties and transport properties of molecular fluids and fluid mixtures. In the second phase of the project, the theory was extended to deal with critical fluctuations in complex fluids such as polymer solutions and electrolyte solutions. The theoretical predictions have been confirmed by computer simulations and by light-scattering experiments. Fluctuations in fluids in nonequilibrium states have also been investigated.

  1. Department of Energy Personal Property Management Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-12-07

    This Guide provides nonregulatory guidance and information to assist DOE organizations and contractors in implementing the DOE-wide and site-specific personal property management programs. Does not cancel other directives.

  2. Spherical Carbon with Unique Architectures and Properties

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Spherical Carbon with Unique Architectures and Properties V.G. Pol, K.C. Lau, L.A. Curtiss, J.G. Wen, D.J. Miller, and M.M. Thackeray, Argonne National Laboratory Carbon atoms can...

  3. Mechanical property measurement by indentation techniques 

    E-Print Network [OSTI]

    Janakiraman, Balasubramanian

    2006-04-12

    The mechanical properties of materials are usually evaluated by performing a tensile or hardness test on the sample. Tensile tests are often time consuming, destructive and need specially prepared specimens. On the other hand, there is no direct...

  4. Formation mechanical properties and the sonic log

    SciTech Connect (OSTI)

    Elphick, R.Y.

    1988-11-01

    A program is presented that calculates the mechanical properties of reservoir rocks from sonic logs. The program was written in Microsoft BASIC and the source code for MS-DOS, Apple Macintosh, and Amiga personal computers is given.

  5. Geometric properties of Bernoulli-type minimizers

    E-Print Network [OSTI]

    2003-06-02

    We next observe that (4.7) implies that w0 = v0 + c in B5/8. Hence also ..... 19. Definition 8.1 Let E ? Rn, ? ? Rn. We say that E satisfies the Birkhoff property.

  6. Personal Property - DOE Directives, Delegations, and Requirements

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Standards Related to: JM DOE G 580.1-1, Notice of Intent to Revise Department of Energy Guide 580.1-1, Personal Property Management Guide Cancels: DOE G 580.1-1,...

  7. Physical Properties of Hanford Transuranic Waste

    SciTech Connect (OSTI)

    Berg, John C.

    2010-03-25

    The research described herein was undertaken to provide needed physical property descriptions of the Hanford transuranic tank sludges under conditions that might exist during retrieval, treatment, packaging and transportation for disposal. The work addressed the development of a fundamental understanding of the types of systems represented by these sludge suspensions through correlation of the macroscopic rheological properties with particle interactions occurring at the colloidal scale in the various liquid media. The results of the work have advanced existing understanding of the sedimentation and aggregation properties of complex colloidal suspensions. Bench scale models were investigated with respect to their structural, colloidal and rheological properties that should be useful for the development and optimization of techniques to process the wastes at various DOE sites.

  8. Sec$on Summary ! Properties of Algorithms

    E-Print Network [OSTI]

    #12;Sec$on Summary ! Properties of Algorithms ! Algorithms for Searching and Sorting ! Greedy Algorithms ! Halting Problem #12;Problems and Algorithms ! In many. This procedure is called an algorithm. #12;Algorithms Definition: An algorithm

  9. Conference Registration Form Property Summer School (Chemistry)

    E-Print Network [OSTI]

    Crawford, T. Daniel

    Conference Registration Form Property Summer School (Chemistry) June 29 - July 3, 2015 Virginia with payment by May 30, 2015 (no staples, tape, or paper clips, please) to: Conference Registrar Continuing

  10. A Monotonicity Property of Binomial Probabilities

    E-Print Network [OSTI]

    Hart, Sergiu

    A Monotonicity Property of Binomial Probabilities Sergiu Hart Benjamin Weiss May 11, 2008 Let n 1 of Jerusalem, 91904 Jerusalem, Israel. e-mail: hart@huji.ac.il web page: http://www.ma.huji.ac.il/hart

  11. Robusta Eucalyptus Wood: Its Properties and Uses

    E-Print Network [OSTI]

    Robusta Eucalyptus Wood: Its Properties and Uses Roger G. Skolmen U. S. FOREST SERVICE RESEARCH in forestry from the University of California, Berkeley. #12;R obusta eucalyptus (Eucalyptus robusta Sm

  12. Thermal properties of soils and soils testing

    SciTech Connect (OSTI)

    Not Available

    1981-02-17

    The thermal properties of soils are reviewed with reference to the use of soils as heat sources, heat sinks, or thermal storage. Specific heat and thermal conductivity are discussed. (ACR)

  13. Handbook of gas hydrate properties and occurrence

    SciTech Connect (OSTI)

    Kuustraa, V.A.; Hammershaimb, E.C.

    1983-12-01

    This handbook provides data on the resource potential of naturally occurring hydrates, the properties that are needed to evaluate their recovery, and their production potential. The first two chapters give data on the naturally occurring hydrate potential by reviewing published resource estimates and the known and inferred occurrences. The third and fourth chapters review the physical and thermodynamic properties of hydrates, respectively. The thermodynamic properties of hydrates that are discussed include dissociation energies and a simplified method to calculate them; phase diagrams for simple and multi-component gases; the thermal conductivity; and the kinetics of hydrate dissociation. The final chapter evaluates the net energy balance of recovering hydrates and shows that a substantial positive energy balance can theoretically be achieved. The Appendices of the Handbook summarize physical and thermodynamic properties of gases, liquids and solids that can be used in designing and evaluating recovery processes of hydrates. 158 references, 67 figures, 47 tables.

  14. Energy Services for State Properties - German Experiences 

    E-Print Network [OSTI]

    Eikmeier, B.

    2008-01-01

    In 2002 the pilot project, Contracting Campaign for State Properties,has been initiated, the realization is assigned to the German Energy Agency (dena). An evaluation of this Project was made by the Bremer Energy Institute in 2007. Until 31...

  15. Property Tax Assessment for Commercial Wind Farms

    Broader source: Energy.gov [DOE]

    In 2010, S.B. 918 consolidated and amended property tax assessment laws in Pennsylvania. The provisions governing the assessment of wind energy facilities were relocated at this time, but not cha...

  16. Property Tax Exemption for Residential Solar Systems

    Broader source: Energy.gov [DOE]

    A solar energy system is defined as a system that provides space heat, water heat, or electricity to the property. The term specifically does not include windows, dark-colored water tanks, or non...

  17. Property Tax Exemption for Wind Generators

    Broader source: Energy.gov [DOE]

    In May 2015, Oklahoma enacted a bill (SB 498) ending the property tax exemption for wind power generators. The exemption will end on January 1, 2017; projects currently in production or put into...

  18. Attributing Mental Properties to Wide Subjects 

    E-Print Network [OSTI]

    Butts, Evan

    2008-12-04

    Rob Wilson (2001) claims that mental properties are not attributable to wide subjects, despite the claims of authors like Clark and Chalmers (1998). I examine Wilson's objection and endeavor to demonstrate that Clark and Chalmers' account does...

  19. Property:Incentive/Name | Open Energy Information

    Open Energy Info (EERE)

    Showing 25 pages using this property. (previous 25) (next 25) 2 2003 Climate Change Fuel Cell Buy-Down Program (Federal) + 2003 Climate Change Fuel Cell Buy-Down Program + 3...

  20. Combustor technology for broadened-properties fuels

    SciTech Connect (OSTI)

    Dodds, W.J.

    1984-01-01

    In order to increase the availability and reduce the cost of future fuels for aircraft gas turbine engines, it may be necessary to broaden fuel specifications. Anticipated changes in fuel properties, and the effects of these changes on combustion system performance, operating characteristics, durability, and emissions are briefly reviewed, and results to date of a program being conducted to develop and demonstrate combustor technology required to utilize broadened-properties fuels in current and next-generation engines are described. Combustion system design considerations and tradeoffs for burning broadened-properties fuels are discussed, and test experience with several applicable combustor design modifications to the G.E. CF6-80A combustion system is reviewed. Modifications have been demonstrated to improve liner cooling and reduce smoke in the conventional annular combustor, thereby reducing effects of variations in fuel hydrogen content. Advanced staged and variable geometry combustor concepts for burning broadened-properties fuels have also been demonstrated.

  1. VOLATILITY TIME AND PROPERTIES OF OPTION PRICES

    E-Print Network [OSTI]

    Janson, Svante

    VOLATILITY TIME AND PROPERTIES OF OPTION PRICES volatility time, to show convexity of option prices in the underlying asset if the contract function is convex as well as continuity and monotonicity of the option price in the volatility

  2. Radiation absorption properties of different plaster samples

    SciTech Connect (OSTI)

    Akkurt, Iskender; Guenoglu, Kadir; Mavi, Betuel; K Latin-Small-Letter-Dotless-I l Latin-Small-Letter-Dotless-I ncarslan, Semsettin; Seven, Aysun

    2012-09-06

    Although the plaster is one of the oldest known synthetic building materials, nowadays, it is used as interior coating of walls and ceilings of buildings. Thus measuring its radiation shielding properties is vital. For this purpose, radiation absorption properties of different plaster samples in this study. The measurements have been performed using gamma spectrometer system which connected to 3'' Multiplication-Sign 3''NaI (TI) detector.

  3. Interfacial Properties of Electron Beam Cured Composites

    SciTech Connect (OSTI)

    Eberle, C.C.

    1999-12-30

    The objectives of the CRADA are to: Confirm that fiber-resin adhesion is responsible for the observed poor shear properties; Determine the mechanism(s) responsible for poor adhesion between carbon fibers and epoxy resins after e-beam curing; Develop and evaluate resin systems and fiber treatments to improve the properties of e-beam cured, carbon-fiber-reinforced composites; and Develop refined methods for processing e-beam cured, carbon-fiber-reinforced composites.

  4. Thorium dioxide: properties and nuclear applications

    SciTech Connect (OSTI)

    Belle, J.; Berman, R.M.

    1984-01-01

    This is the sixth book on reactor materials published under sponsorship of the Naval Reactors Office of the United States Department of Energy, formerly the United States Atomic Energy Commission. This book presents a comprehensive compilation of the most significant properties of thorium dioxide, much like the book Uranium Dioxide: Properties and Nuclear Applications presented information on the fuel material used in the Shippingport Pressurized Water Reactor core.

  5. Tables of thermodynamic properties of sodium

    SciTech Connect (OSTI)

    Fink, J.K.

    1982-06-01

    The thermodynamic properties of saturated sodium, superheated sodium, and subcooled sodium are tabulated as a function of temperature. The temperature ranges are 380 to 2508 K for saturated sodium, 500 to 2500 K for subcooled sodium, and 400 to 1600 K for superheated sodium. Tabulated thermodynamic properties are enthalpy, heat capacity, pressure, entropy, density, instantaneous thermal expansion coefficient, compressibility, and thermal pressure coefficient. Tables are given in SI units and cgs units.

  6. Mechanical properties of radial truck tires 

    E-Print Network [OSTI]

    Wasti, Mansoor-ul-Hassan

    1992-01-01

    MECHANICAL PROPERTIES OF RADIAL TRUCK TIRES A Thesis by MANSOOR-UL-HASSAN WASTI Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE December 1992... Major Subject: Mechanical Engineering MECHANICAL PROPERTIES OF RADIAL TRUCK TIRES A Thesis by Mansoor-ul-Hassan Wasti Approved as to style and content by: R. . Alexander (Chair of Committee) C. . Hough (Member) Donal ayl (M mber) W. L. radley...

  7. Top quark properties at the Tevatron

    E-Print Network [OSTI]

    Andreas Werner Jung

    2014-12-12

    Recent measurements of top-quark properties at the Tevatron, including top quark production asymmetries and properties, are presented. Latest updates of measurements of top quark production asymmetries include the measurement of the $t\\bar{t}$ production asymmetry by D0 employing the full Run II data set, in the lepton + jets and dilepton decay channel. Within their uncertainties the results from all these measurements agree with their respective Standard Model expectation.

  8. Logistic Growth and Ergodic Properties of Urban Forms

    E-Print Network [OSTI]

    Masucci, A Paolo; Wang, Jiaqiu; Hatna, Erez; Stanilov, Kiril; Batty, Michael

    2015-01-01

    Urban morphology has presented significant intellectual challenges to mathematicians and physicists ever since the eighteenth century, when Euler first explored the famous Konigsberg bridges problem. Many important regularities and allometries have been observed in urban studies, including Zipf's law and Gibrat's law, rendering cities attractive systems for analysis within statistical physics. Nevertheless, a broad consensus on how cities and their boundaries are defined is still lacking. Applying percolation theory to the street intersection space, we show that growth curves for the maximum cluster size of the largest cities in the UK and in California collapse to a single curve, namely the logistic. Subsequently, by introducing the concept of the condensation threshold, we show that natural boundaries of cities can be well defined in a universal way. This allows us to study and discuss systematically some of the allometries that are present in cities, thus casting light on the concept of ergodicity as relat...

  9. Sediment Properties: E-Area Completion Project

    SciTech Connect (OSTI)

    Millings, M.; Bagwell, L.; Amidon, M.; Dixon, K.

    2011-04-29

    To accommodate a future need for additional waste disposal facilities at the Savannah River Site, the Solid Waste Management Division (SWMD) designated nine additional plots for development (Kasraii 2007; SRS 2010); these plots are collectively known as the E Area Completion Project (ECP). Subsurface samples were collected from ECP plots 6, 7, 8 and 9 (Figure 1) for chemical and physical property analyses to support Performance Assessment (PA) and Special Analyses (SA) modeling. This document summarizes the sampling and analysis scheme and the resultant data, and provides interpretations of the data particularly in reference to existing soil property data. Analytical data in this document include: gamma log, cone penetrometer log, grain size (sieve and hydrometer), water retention, saturated hydraulic conductivity (falling head permeameter), porosity, dry bulk density, total organic carbon, x-ray diffraction, and x-ray fluorescence data. SRNL provided technical and safety oversight for the fieldwork, which included completion of eight soil borings, four geophysical logs, and the collection of 522 feet of core and 33 Shelby tubes from ECP plots 6, 7, 8, and 9. Boart Longyear provided sonic drilling and logging services. Two soil borings were completed at each location. The first set of boreholes extended into (but did not fully penetrate) the Warley Hill Formation. These boreholes were continuously cored, then geophysically (gamma ray) logged. The recovered core was split, photographed, and described; one half of the core was archived at SRS's Core Lab facilities, and the remaining half was consumed as necessary for testing at SRS and off-site labs. Core descriptions and geophysical data were used to calculate target elevations for Shelby tube samples, which were obtained from the second set of boreholes. Shelby tubes were shipped to MACTEC Engineering and Consulting Inc. (MACTEC) in Atlanta for physical property testing. SRNL deployed their Site Characterization and Analysis Penetrometer System (SCAPS) cone penetrometer test (CPT) truck at ECP plots 6, 7, 8 and 9 to collect inferred lithology data for the vadose zone. Results from this study are used to make recommendations for future modeling efforts involving the ECP plots. The conceptual model of the ECP hydrogeology differs from the conceptual model of the current ELLWF disposal area in that for the ECP plots, the topography (ground surface) is generally lower in elevation; The Upland and top of Tobacco Road lithostratigraphic units are missing (eroded); The water table occurs lower in elevation (i.e., it occurs in lower stratigraphic units); and the Tan Clay Confining Zone (TCCZ) often occurs within the vadose zone (rather than in the saturated zone). Due to the difference in the hydrogeology between the current ELLWF location and the ECP plots, different vadose zone properties are recommended for the ECP plots versus the properties recommended by Phifer et al. (2006) for the current disposal units. Results from this study do not invalidate or conflict with the current PA's use of the Upper and Lower Vadose Zone properties as described by Phifer et al. (2006) for the current ELLWF disposal units. The following modeling recommendations are made for future modeling of the ECP plots where vadose zone properties are required: (1) If a single vadose zone property is preferred, the properties described by Phifer et al. (2006) for the Upper Vadose Zone encompass the general physical properties of the combined sands and clays in the ECP vadose zone sediments despite the differences in hydrostratigraphic units. (2) If a dual zone system is preferred, a combination of the Lower Zone properties and the Clay properties described by Phifer et al. (2006) are appropriate for modeling the physical properties of the ECP vadose zone. The Clay properties would be assigned to the Tan Clay Confining Zone (TCCZ) and any other significant clay layers, while the Lower Zone properties would be assigned for the remainder of the vadose zone. No immediate updates or changes are recommended for

  10. Effective material properties in twinned ferroelectric crystals Jiri Erharta)

    E-Print Network [OSTI]

    Cao, Wenwu

    Effective material properties in twinned ferroelectric crystals Jiri´ Erharta) and Wenwu Caob symmetry and effective material properties resulting from different twinning configurations. Numerical. INTRODUCTION The macroscopic material properties of a multidomain ferroelectric system are the collective

  11. From Microstructures to Properties: Statistical Aspects of Computational Materials Science

    E-Print Network [OSTI]

    Ji, Chuanshu

    From Microstructures to Properties: Statistical Aspects of Computational Materials Science Chuanshu and materials properties. Materials scientists have applied homogenization theory and the finite element method to FEM. Key Words: materials science, microstructure, effective property, homogenization, fi- nite

  12. DOE/ME-0060, Real Property Asset Management Plan | Department...

    Energy Savers [EERE]

    DOEME-0060, Real Property Asset Management Plan DOEME-0060, Real Property Asset Management Plan DOE-ME-0060RealPropertyAssetManagementPlan2005-08.pdf More Documents &...

  13. Physical and Hydrodynamic Properties of Flocs Produced During Biological

    E-Print Network [OSTI]

    Physical and Hydrodynamic Properties of Flocs Produced During Biological Hydrogen Production Jian in continuous culture bioreactors used for hydrogen production, but the fractal and hydrodynamic properties imperme- able flocs are produced in biohydrogen reactors that have settling properties in reasonable

  14. Property Tax Exemption for Residential Renewable Energy Equipment

    Broader source: Energy.gov [DOE]

    For Colorado property taxation purposes, solar energy facilities property used to produce two (2) megawatts or less of AC electricity and wind energy facilities property used to produce two (2) m...

  15. ORIGINAL PAPER Functional coordination between branch hydraulic properties

    E-Print Network [OSTI]

    Malhi, Yadvinder

    ORIGINAL PAPER Functional coordination between branch hydraulic properties and leaf functional coordination between branch hydraulic properties and leaf functional traits among nine miombo woodlands canopy the question: are branch hydraulic properties coordinated with leaf functional traits linked to plant drought

  16. ELECTRICAL PROPERTIES OF DISLOCATIONS IN ULTRA-PURE GERMANIUM

    E-Print Network [OSTI]

    Hubbard, G. Scott

    2010-01-01

    Material-. , Volume 9. ELECTRICAL PROPERTIES OF DISLOCATIONS9. LBL-9342 MASTER ELECTRICAL PROPERTIES OF DISLOCATIONS IN9 4 7 M L3L-934? ELECTRICAL PROPERTIES Or DISLOCATIONS* IN

  17. Corporate Property Tax Reduction for New/Expanded Generating Facilities

    Broader source: Energy.gov [DOE]

    The taxable value varies, depending on the property ownership. If owned by a utility, an exempt wholesale generator or certain other electricity producers, the property is class 13 property and...

  18. Howard County- High Performance and Green Building Property Tax Credit

    Broader source: Energy.gov [DOE]

    The state of Maryland permits local governments (Md Code: Property Tax § 9-242) to offer property tax credits for high performance buildings and energy conservation devices (Md Code: Property Tax §...

  19. Critically Evaluated Thermochemical Properties of Polycyclic Aromatic Hydrocarbons

    E-Print Network [OSTI]

    Chickos, James S.

    values for these thermochemical properties and for the enthalpies of formation in the gas state at T=298Critically Evaluated Thermochemical Properties of Polycyclic Aromatic Hydrocarbons María Victoria Experimental thermochemical properties of benzene, toluene, and 63 polycyclic aro- matic hydrocarbons

  20. Influence of Mechanical Properties Relevant to Standoff Deflection...

    Office of Scientific and Technical Information (OSTI)

    Influence of Mechanical Properties Relevant to Standoff Deflection of Hazardous Asteroids Citation Details In-Document Search Title: Influence of Mechanical Properties Relevant to...

  1. Radiation-induced mechanical property changes in filled rubber...

    Office of Scientific and Technical Information (OSTI)

    Radiation-induced mechanical property changes in filled rubber Citation Details In-Document Search Title: Radiation-induced mechanical property changes in filled rubber In a recent...

  2. 1. INTRODUCTION. Evaluation of the geomechanical properties of

    E-Print Network [OSTI]

    Maerz, Norbert H.

    1. INTRODUCTION. Evaluation of the geomechanical properties of shales, especially weak ones acknowledgement of where and by whom the paper was presented. ABSTRACT: Evaluation of the geomechanical properties

  3. Property Prediction Tools for Tailored Polymer Composite Structures...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    2.pdf More Documents & Publications Engineering Property Prediction Tools for Tailored Polymer Composite Structures Property Prediction Tools for Tailored Polymer Composite...

  4. Property Prediction Tools for Tailored Polymer Composite Structures...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1.pdf More Documents & Publications Engineering Property Prediction Tools for Tailored Polymer Composite Structures Engineering Property Prediction Tools for Tailored Polymer...

  5. Superconducting properties in tantalum decorated three-dimensional...

    Office of Scientific and Technical Information (OSTI)

    properties in tantalum decorated three-dimensional graphene and carbon structures Citation Details In-Document Search Title: Superconducting properties in tantalum...

  6. Properties of Inconel 625 Mesh Structures Grown by Electron Beam...

    Office of Scientific and Technical Information (OSTI)

    Properties of Inconel 625 Mesh Structures Grown by Electron Beam Additive Manufacturing Citation Details In-Document Search Title: Properties of Inconel 625 Mesh Structures Grown...

  7. Solar Photovoltaic Financing: Deployment on Public Property by...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Solar Photovoltaic Financing: Deployment on Public Property by State and Local Governments Solar Photovoltaic Financing: Deployment on Public Property by State and Local...

  8. Real Property Asset Management Plan | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    coverbooked.indd More Documents & Publications DOEME-0060, Real Property Asset Management Plan DOE Real Property Asset Management Plan 2005 coverbooked.indd...

  9. Guiding Principles of Real Property Asset Management | Department...

    Office of Environmental Management (EM)

    Guiding Principles of Real Property Asset Management Guiding Principles of Real Property Asset Management frpcguidancefinal.pdf More Documents & Publications 2015 Federal Real...

  10. CNG, Hydrogen, CNG-Hydrogen Blends - Critical Fuel Properties...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    CNG, Hydrogen, CNG-Hydrogen Blends - Critical Fuel Properties and Behavior CNG, Hydrogen, CNG-Hydrogen Blends - Critical Fuel Properties and Behavior Presentation given by Jay...

  11. Promoting Combined Heat and Power (CHP) for Multifamily Properties...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Promoting Combined Heat and Power (CHP) for Multifamily Properties, 2008 Promoting Combined Heat and Power (CHP) for Multifamily Properties, 2008 The U.S. Department of Housing and...

  12. Overcomplete Radon Bases for Target Property Management in Sensor Networks

    E-Print Network [OSTI]

    Guibas, Leonidas J.

    Overcomplete Radon Bases for Target Property Management in Sensor Networks Xiaoye Jiang Stanford, exploiting an overcomplete Radon basis dictionary to model property uncertainty in such cir- cumstances

  13. Property:FluidMechanicsMeasurement | Open Energy Information

    Open Energy Info (EERE)

    Property Name FluidMechanicsMeasurement Property Type String Description MHK Fluid Mechanics Measurement Categories Used in FormTemplate MHKSensor Allows Values Differential...

  14. Impact of Biodiesel on Ash Emissions and Lubricant Properties...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Biodiesel on Ash Emissions and Lubricant Properties Affecting Fuel Economy and Engine Wear Impact of Biodiesel on Ash Emissions and Lubricant Properties Affecting Fuel Economy and...

  15. Property:RAPID/Contact/ID9/Name | Open Energy Information

    Open Energy Info (EERE)

    page using this property. U Utah Department of Environmental Quality + Doug Hansen + Retrieved from "http:en.openei.orgwindex.php?titleProperty:RAPIDContactID9...

  16. Los Alamos researchers uncover new properties in nanocomposite...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    New properties in nanocomposite oxide ceramics Los Alamos researchers uncover new properties in nanocomposite oxide ceramics for reactor fuel, fast-ion conductors In a...

  17. Nanoscale friction properties of graphene and graphene oxide...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Nanoscale friction properties of graphene and graphene oxide Title Nanoscale friction properties of graphene and graphene oxide Publication Type Journal Article Year of Publication...

  18. Properties of nuclear matter within the JISP16NNinteraction ...

    Office of Scientific and Technical Information (OSTI)

    Properties of nuclear matter within the JISP16NNinteraction Citation Details In-Document Search Title: Properties of nuclear matter within the JISP16NNinteraction Authors:...

  19. Physical Properties of Gas Hydrates: A Review

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Gabitto, Jorge F.; Tsouris, Costas

    2010-01-01

    Methane gas hydrates in sediments have been studied by several investigators as a possible future energy resource. Recent hydrate reserves have been estimated at approximately 10 16 ? m 3 of methane gas worldwide at standard temperature and pressure conditions. In situ dissociation of natural gas hydrate is necessary in order to commercially exploit the resource from the natural-gas-hydrate-bearing sediment. The presence of gas hydrates in sediments dramatically alters some of the normal physical properties of the sediment. These changes can be detectedmore »by field measurements and by down-hole logs. An understanding of the physical properties of hydrate-bearing sediments is necessary for interpretation of geophysical data collected in field settings, borehole, and slope stability analyses; reservoir simulation; and production models. This work reviews information available in literature related to the physical properties of sediments containing gas hydrates. A brief review of the physical properties of bulk gas hydrates is included. Detection methods, morphology, and relevant physical properties of gas-hydrate-bearing sediments are also discussed. « less

  20. Development of Property-Transfer Models for Estimating the Hydraulic Properties of Deep

    E-Print Network [OSTI]

    Development of Property-Transfer Models for Estimating the Hydraulic Properties of Deep Sediments at the Idaho National Engineering and Environmental Laboratory, Idaho Scientific Investigations Report 2005 Survey DOE/ID-22196 #12;Cover: Graph showing example of water-retention (q(y)) curve showing components

  1. Testing of NCSX Composite Coil Material Properties

    SciTech Connect (OSTI)

    Kozub, Thomas; Jurczynski, Stephan; Chrzanowski, James [Princeton Plasma Physics Laboratory (United States)

    2005-05-15

    The National Compact Stellarator Experiment (NCSX) is now in design and requires 18 modular coils that are constructed to a highly complex geometry. The modular coil conductors are designed as a composite of a fine gauge stranded copper cable shaped to the required geometry and vacuum impregnated with a resin. These composite conductors exhibit unique material properties that must be determined and verified through testing. The conductor material properties are necessary for design modeling and performance validation. This paper will present the methods used to test and measure the coil conductor material properties, the unique challenges in measuring these complex materials at both room and liquid nitrogen temperatures and the results of those tests.

  2. Dielectric properties and electronic applications of aerogels

    SciTech Connect (OSTI)

    Hrubesh, L.W.; Pekala, R.W.

    1993-07-01

    Among their other exceptional properties, aerogels also exhibits unusual dielectric properties due to their nano-sized structures and high porosities. For example, our measurements of the dielectric constants and loss tangents for several aerogel varieties at microwave frequencies show that they both vary linearly with the aerogel density, indicating that the dielectric behavior of aerogels is more gas-like than solid-like. We have also measured the dielectric strength of silica aerogels and find that they are better than ceramics for high voltage insulation. The low dielectric constants and loss tangents of aerogels, along with their controllable thermal expansion properties, make them desirable materials for use as thin films in high speed integrated digital and microwave circuitry.

  3. Mechanical Properties of Ingot Nb Cavities

    SciTech Connect (OSTI)

    Ciovati, Gianluigi; Dhakal, Pashupati; Kneisel, Peter; Mammosser, John; Matalevich, Joseph; Rao Myneni, Ganapati

    2014-07-01

    This contribution presents the results of measurements of the resonant frequency and of strain along the contour of a single-cell cavity made of ingot Nb subjected to increasing uniform differential pressure, up to 6 atm. The data were used to infer mechanical properties of this material after cavity fabrication, by comparison with the results from simulation calculations done with ANSYS. The objective is to provide useful information about the mechanical properties of ingot Nb cavities which can be used in the design phase of SRF cavities intended to be built with this material.

  4. Nanodiamonds: Their Structure and Optical Properties

    SciTech Connect (OSTI)

    Raty, J.-Y.; van Buuren, T.; Galli, G.

    2002-05-14

    Nanometer sized diamond is a constituent of diverse systems ranging from interstellar dusts and meteorites [1] to carbonaceous residues of detonations [2] and diamond-like films [3-5]. Many of the properties of bulk diamond have been well understood for decades, those of nanodiamond are mostly unexplored. We present a combined theoretical and experimental study showing that diamond has unique properties not only as a bulk material but also at the nanoscale, where size reduction and surface reconstruction effects are fundamentally different from those found, e.g. in Si and Ge.

  5. Stainless Steel Microstructure and Mechanical Properties Evaluation

    SciTech Connect (OSTI)

    Switzner, Nathan T

    2010-06-01

    A nitrogen strengthened 21-6-9 stainless steel plate was spinformed into hemispherical test shapes. A battery of laboratory tests was used to characterize the hemispheres. The laboratory tests show that near the pole (axis) of a spinformed hemisphere the yield strength is the lowest because this area endures the least “cold-work” strengthening, i.e., the least deformation. The characterization indicated that stress-relief annealing spinformed stainless steel hemispheres does not degrade mechanical properties. Stress-relief annealing reduces residual stresses while maintaining relatively high mechanical properties. Full annealing completely eliminates residual stresses, but reduces yield strength by about 30%.

  6. In-medium properties of nucleon resonances

    E-Print Network [OSTI]

    B. Krusche

    2004-12-06

    Recent experimental results for the in-medium properties of nucleon resonances are discussed. The experiments were done with the TAPS detector at the tagged photon beam of the MAMI accelerator in Mainz. Measured was the photoproduction of mesons (final states $\\pi^o X$, $\\eta X$, $2\\pi^oX$ and $\\pi^o\\pi^{\\pm}X$) from the nuclei $^{12}$C, $^{40}$Ca, $^{93}$Nb, and $^{208}$Pb up to the second resonance region. The results were analyzed in view of the in-medium properties of the P$_{33}$(1232), the D$_{13}$(1520), and the S$_{11}$(1535) resonances.

  7. Property:Challenges | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceIIInformationEnergyReportNumber Jump to: navigation,Property EditProperty

  8. Property:CommProtocol | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceIIInformationEnergyReportNumber Jump to: navigation,PropertyCitationProperty

  9. Property:DIA/Type | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation, search Property Name DIA/Topics/Environmental PropertyType Jump

  10. Property:DOEFunding | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation, search Property Name DIA/Topics/Environmental PropertyType

  11. Property:Deployment | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation, search Property NameDefinition Jump to:Property Edit with form

  12. Property:DeploymentSector | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation, search Property NameDefinition Jump to:Property Edit with

  13. Property:Depth(m) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation, search Property NameDefinition Jump to:Property Edit

  14. Property:DeviceType | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation, search Property NameDefinition Jump to:PropertyDevice

  15. Property:Experience | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation,Property Edit with form History Property:ExpActivityDateEnd

  16. Property:Facility Name | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation,Property Edit withExplorationTimePerMetricProperty Edit with

  17. Property:FieldProcedures | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation,Property Edit withExplorationTimePerMetricProperty Edit

  18. Property:File/Author | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation,Property Edit withExplorationTimePerMetricProperty EditAuthor

  19. Property:File/Description | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to: navigation,Property Edit withExplorationTimePerMetricPropertyDescription

  20. Department of Energy Personal Property Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2010-11-11

    DOE Order 580.1, initially issued December 2005 and revised in May 2008, provides Department-level requirements and performance expectations for proper accountability and management of personal property owned by the Department of Energy (DOE), whether in the hands of the Federal government or the contractor.