Sample records for institute member benefits

  1. Member Benefits | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreaking ofOil & GasTechnicalMeeting with EarthJustice RegardingMember Benefits

  2. Hydraulic Institute Member Benefits | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed off Energy.gov.Energy02.pdf7 OPAM Flash2011-37EnergySubmit a Freedom ofof

  3. CMI Team Members | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteries BatteriesCAES HomeMaterials InstituteTeam

  4. CMI Membership Benefits | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteries BatteriesCAES Home HomeDevelopsEducationBenefits

  5. Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members Michael J.

  6. Transportation Cost and Benefit Analysis Congestion Costs Victoria Transport Policy Institute (www.vtpi.org)

    E-Print Network [OSTI]

    O'Donnell, Tom

    Transportation Cost and Benefit Analysis ­ Congestion Costs Victoria Transport Policy Institute congestion is considered one of the most significant transportation problems. The capacity of a road depends, Fundamentals of Traffic Engineering, 13th Edition, Institute of Transportation Studies, UBC (Berkeley; www

  7. University of California, Davis Institutional Review Board Committee Members IRB Number or

    E-Print Network [OSTI]

    Schladow, S. Geoffrey

    ; Alternate Member D Scientific A; D Brian Gallay PhD, MD Scientific Affiliated Member A; Alternate Member D

  8. Variables influencing family members' decisions regarding continued placement of family members with mental disabilities in one state-operated institution 

    E-Print Network [OSTI]

    Colvin, Alex Don

    2009-05-15T23:59:59.000Z

    , beginning of advocacy movement, expansion continues in 1950s and 1960s, Kennedy?s impact, decade of legal issues, deinstitutionalization and normalization introduced, and depopulation of institutions. 13 Historical Overview of the Origin...

  9. Domestic plan summary of benefits* SHIP members must use University Health Services (UHS) for allavailableprimary,urgent,andpreventive

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    -of-pocket expense. MedicalandMentalHealthCounselingservicesatUHSinclude: Primary Care;Women's Health; STITesting andMadisonOptometricCenter,globalOut-Of-Networkcoverage, andworldwideassistance(includingmedicalevacuationandrepatriation). Benefit Category Health Care at UHS Health Care In-Network** HealthCareOut-Of-Network 2013­14 premium rates -- Domestic plan PlanYear Deductible None $250 $500

  10. TN Consolidated Retirement System (TCRS) Benefit Estimate Request If you are a member of TCRS and an employee at the University of Memphis, you may request an estimate of your

    E-Print Network [OSTI]

    Dasgupta, Dipankar

    years of service OR at least 30 years of service) o Early Retirement (age 55 with at least 5 years TN Consolidated Retirement System (TCRS) Benefit Estimate Request If you are a member of TCRS and an employee at the University of Memphis, you may request an estimate of your retirement benefit by providing

  11. A "modest proposal" for the benefit of California's taxpayers, students, and institutions of higher education Andrew B. Kahng (abk@ucsd.edu), 2 January 2013

    E-Print Network [OSTI]

    Simunic, Tajana

    A "modest proposal" for the benefit of California's taxpayers, students, and institutions of higher, destined for inevitable extinction? Here is a simple, "modest proposal": The State of California that if the state of California were to implement this "modest proposal," it would be to the benefit of all

  12. OBSERVATORY SNO INSTITUTE MEMBERS

    E-Print Network [OSTI]

    Abolmaesumi, Purang

    neutrino telescope, the size of a ten-storey building, two kilometers underground in Inco's Creighton Mine their properties. For many years, the number of solar neutrinos measured by other underground detectors has been of the SNO detector to measure all three types of neutrinos to determine that solar neutrinos are changing

  13. A PUBLICATION OF THE TEXAS TRANSPORTATION INSTITUTE n MEMBER OF THE TEXAS A&M UNIVERSITY SYSTEM n VOL. 42 n NO. 2 n 2006 Inaugural Texas

    E-Print Network [OSTI]

    help improve transportation not only for the West Texas region, but for cities all along the UA PUBLICATION OF THE TEXAS TRANSPORTATION INSTITUTE n MEMBER OF THE TEXAS A&M UNIVERSITY SYSTEM n VOL. 42 n NO. 2 n 2006 Inaugural Texas Transportation Forum PAGE 4 TTI Council convenes PAGE 8 Teens

  14. A Publication of the Texas Transportation Institute Member of The Texas A&M University System Vol. 39 No. 1 2003 Transportation is critical

    E-Print Network [OSTI]

    A Publication of the Texas Transportation Institute · Member of The Texas A&M University System · Vol. 39 · No. 1 · 2003 #12;Transportation is critical to quality of life... and often, its preservation. TEXAS TRANSPORTATION RESEARCHER2 niversity transportation research has made significant

  15. InternatIonal student plan summary of benefIts* SHIP members must use University Health Services (UHS) for allavailableprimary,urgent,andpreventivecare.

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    , and a contraceptive benefit. MedicalandMentalHealthCounselingservicesatUHSinclude: Primary Care;Women's HealthMadisonOptometricCenter,globalOut-Of-Networkcoverage, andworldwideassistance(includingmedicalevacuationandrepatriation). Benefit Category Health Care at UHS Health Care In-Network** Health Care Out-Of-Network 2013­14 premIum rates -- InternatIonal plan PlanYear Deductible None None $500

  16. InternatIonal sCHolar plan summary of benefIts* SHIP members must use University Health Services (UHS) for allavailableprimary,urgent,andpreventivecare.

    E-Print Network [OSTI]

    Wisconsin at Madison, University of

    , and a contraceptive benefit. MedicalandMentalHealthCounselingservicesatUHSinclude: Primary Care;Women's HealthMadisonOptometricCenter,globalOut-Of-Networkcoverage, andworldwideassistance(includingmedicalevacuationandrepatriation). Benefit Category Health Care at UHS Health Care In-Network** Health Care Out-Of-Network 2013­14 premIum rates -- InternatIonal sCHolar plan PlanYear Deductible None

  17. international scholar plan sUMMary of benefits* SHIP members must use University Health Services (UHS) for allavailableprimary,urgent,andpreventivecare.

    E-Print Network [OSTI]

    Scharer, John E.

    ,and a contraceptive benefit. MedicalandMentalHealthCounselingservicesatUHSinclude:Primary Care;Women's HealthMadisonOptometricCenter,globalOut-Of-Networkcoverage, andworldwideassistance(includingmedicalevacuationandrepatriation). Benefit Category Health Care at UHS Health Care In-Network** Health Care Out-Of-Network 2012­13 preMiUM rates -- international scholar plan PlanYear Deductible None

  18. international stUdent plan sUMMary of benefits* SHIP members must use University Health Services (UHS) for allavailableprimary,urgent,andpreventivecare.

    E-Print Network [OSTI]

    Scharer, John E.

    ,and a contraceptive benefit. MedicalandMentalHealthCounselingservicesatUHSinclude: Primary Care;Women's HealthMadisonOptometricCenter,globalOut-Of-Networkcoverage, andworldwideassistance(includingmedicalevacuationandrepatriation). Benefit Category Health Care at UHS Health Care In-Network** Health Care Out-Of-Network 2012­13 preMiUM rates -- international plan PlanYear Deductible None None $500

  19. doMestic plan sUMMary of benefits* SHIP members must use University Health Services (UHS) for allavailableprimary,urgent,andpreventive

    E-Print Network [OSTI]

    Scharer, John E.

    -of-pocket expense. MedicalandMentalHealthCounselingservicesatUHSinclude: Primary Care;Women's Health;STITesting andMadisonOptometricCenter,globalOut-Of-Networkcoverage, andworldwideassistance(includingmedicalevacuationandrepatriation). Benefit Category Health Care at UHS Health Care In-Network** HealthCareOut-Of-Network 2012­13 preMiUM rates -- doMestic plan PlanYear Deductible None $250 $500

  20. Phase II - Procurement of State of the Art Research Equipment to Support Faculty Members with the RNA Therapeutics Institute, a component of the Advanced Therapeutics Cluster at the University of Massachusetts Medical School

    SciTech Connect (OSTI)

    Moore, Melissa

    2011-10-14T23:59:59.000Z

    This project supported the continued development of the RNA Therapeutics Institute at the UMass Medical School. This funding allows for the purchase of critical equipment that will enable faculty members to develop RNA technology in order to better understand the complexity that separates genome sequence from biological function, as well as to reduce the hyperactivity of harmful genes.

  1. Elastomeric member

    DOE Patents [OSTI]

    Hoppie, L.O.

    1985-07-30T23:59:59.000Z

    An energy storage device is disclosed consisting of a stretched elongated elastomeric member disposed within a tubular housing, which elastomeric member is adapted to be torsionally stressed to store energy. The elastomeric member is configured in the relaxed state with a uniform diameter body section, and transition end sections, attached to rigid end piece assemblies of a lesser diameter. The profile and deflection characteristic of the transition sections are such that upon stretching of the elastomeric member, a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing. Each of the transition sections are received within and bonded to a woven wire mesh sleeve having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve also contracts with the contraction of the associated transition section to maintain the bond there between. During manufacture, the sleeves are forced against a forming surface and bonded to the associated transition section to provide the correct profile and helix angle. 12 figs.

  2. Elastomeric member

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI)

    1985-01-01T23:59:59.000Z

    An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16) disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section (74), and transition end sections (76, 78), attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the elastomeric member (16), a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing (14). Each of the transition sections (76, 78) are received within and bonded to a woven wire mesh sleeve (26, 28) having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve (26, 28) also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle.

  3. Indian Institute of Technology, Faculty Members -Profiles

    E-Print Network [OSTI]

    Krishnapura, Nagendra

    based programs (M.Tech, Dual Degree and B.Tech). Back to top #12;Research Areas AERODYNAMICS: Subsonic for Numerical Methods in Gas Dynamics and Computational Fluid Dynamics Vortex Dynamics, Supersonic Mixing and Combustion Optical Flow Diagnostics AEROSPACE PROPULTION: Rocket Propulsion and Solid Propellant Combustion

  4. Critical Materials Institute Affiliates Program MEMBER AGREEMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisitingContract Management Fermi Site OfficeCourse Clusters CourseN NRev. 1 Page 1 of

  5. CMI Affiliate Members | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteries BatteriesCAES Home Home

  6. Member Institutions | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your Home andDispositionMechanicalAbout

  7. ORSSAB Members | Department of Energy

    Office of Environmental Management (EM)

    Read Bio Claire RowcliffeRead Bio Mary Smalling Member Read Bio Wanda Smith Member Read Bio Coralie (Corkie) Staley Member Read Bio Scott Stout Member...

  8. Colorado Forestry Advisory Board Members: Don Ament Tom Stone

    E-Print Network [OSTI]

    #12;Colorado Forestry Advisory Board Members: Don Ament Tom Stone Commissioner of Agriculture desired benefits? The members of Colorado's Forestry Advisory Board have presented this question, Colorado Forestry Advisory Board #12;2003 Report on the Health of Colorado's Forests 1 2003 Report

  9. Prescription Drug List --To be used by members

    E-Print Network [OSTI]

    Mullins, Dyche

    Prescription Program Drug List -- To be used by members (both National Accounts and Local Group), who have a tiered drug plan. Anthem Blue Cross prescription drug benefits include medications available on the Anthem Drug List. Our prescription drug benefits can offer potential savings when your

  10. Institute /or ADVANCED STUDY

    E-Print Network [OSTI]

    SCIENCE ACADEMIC ACTIVITIES MEMBERS, VISITORS AND RESEARCH STAFF 55 · REPORT OF THE INSTITUTE LIBRARIES 57 will permit." For nearly two-thirds of a century this founding principle has been sustained and has yielded

  11. Combustion Group Group members

    E-Print Network [OSTI]

    Wang, Wei

    Combustion Group Group members: Thierry Poinsot, Emilien Courtine, Luc Vervisch, Benjamin Farcy 2014 #12;Combustion Group Combustion Physics and Modeling Pollutants, Emissions, and Soot Formation Thermoacoustics and Combustion Dynamics Research focus § Examine mechanisms responsible for flame stabilization

  12. Combustion Group Group members

    E-Print Network [OSTI]

    Wang, Wei

    Combustion Group Group members: Thierry Poinsot, Emilien Courtine, Luc Vervisch, Benjamin Farcy § New combustion and energy-conversion concepts #12;Introduction Combustion research thrusts Combustion Dynamics and Flame-Stabilization Research objectives § Obtain fundamental understanding of combustion

  13. Retirement Benefits Scheme Benefiting from membership

    E-Print Network [OSTI]

    Mumby, Peter J.

    7 Temporary absence 8 Part-time employment 8 Normal retirement 8 Late retirement 9 Early retirementRetirement Benefits Scheme Benefiting from membership: Your guide to the Scheme www 9 Incapacity retirement 10 Cash sum options 10 Pension increases 10 Paymeny of pension 10 Leaving

  14. Members | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directed offOCHCO2:Introduction to EnergyDepartment ofMarginalPaul D. Jablonski National EnergyMemberMembers

  15. HEALTH NET PHARMACY BENEFITS Plan codes WEE, WKK, WQQ1

    E-Print Network [OSTI]

    Mullins, Dyche

    HEALTH NET PHARMACY BENEFITS Plan codes WEE, WKK, WQQ1 The following is a brief description of your Health Net Pharmacy benefits. PRESCRIPTIONS BY MAIL If your prescription is for a maintenance medication III. For complete information, log on as a Health Net member at www.healthnet.com > View prescription

  16. Institute for Molecular Engineering | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    at a molecular scale has the potential for societal impact in such areas as energy, health care, and the environment. The institute benefits from leading scientists and...

  17. Environmental Management Advisory Board Members | Department...

    Energy Savers [EERE]

    Member Read Bio David W. Swindle, Jr. EMAB Board Member Read Bio Robert J. Thompson EMAB Board Member Read Bio Lenn Vincent EMAB Board Member Read Bio Waste...

  18. Cryogenic support member

    DOE Patents [OSTI]

    Niemann, Ralph C. (Downers Grove, IL); Gonczy, John D. (Oak Lawn, IL); Nicol, Thomas H. (Aurora, IL)

    1987-01-01T23:59:59.000Z

    A cryogenic support member is comprised of a non-metallic rod having a depression in at least one end and a metallic end connection assembled to the rod. The metallic end connection comprises a metallic plug which conforms to the shape and is disposed in the depression and a metallic sleeve is disposed over the rod and plug. The plug and the sleeve are shrink-fitted to the depression in the rod to form a connection good in compression, tension and bending.

  19. Academy Member Annual Update Report 1Academy Member Update Report

    E-Print Network [OSTI]

    Academy Member Annual Update Report 1Academy Member Update Report The annual update report is an important activity associated with active membership in the Academy. These reports are due annually@lsuhsc.edu or call 504-568-2140 if you have other questions. Why an annual report? As an Academy member

  20. Benefits at a Glance 2014 Benefit Year

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    OF OKLAHOMA STATE UNIVERSITY BASIC BENEFITS OSU PAYS (Cost Per Month) EMPLOYEE PAYS (Cost Per Month) WHAT literature for detailed information. VISION PLAN VSP, Primary Vision Care, United Health Care, SuperiorStar Life OSU pays Basic Employee Life and Accidental Death & Dismemberment. Employee-Paid Supplemental

  1. Accessibility of Computer Science: A Reflection for Faculty Members

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    Accessibility of Computer Science: A Reflection for Faculty Members Dianne P. O'Leary \\Lambda June. This document benefitted from helpful advice and references from Nora Sleumer and Timothy O'Leary. Copyright Dianne P. O'Leary, 1999 Version 1: June 1999 1 Picture Yourself: You are male, almost 20 years old, naive

  2. CASAS: A Smart Home in a Box Diane J. Cook, IEEE Fellow, Aaron S. Crandall, IEEE Member, Brian L. Thomas, IEEE Member,

    E-Print Network [OSTI]

    Cook, Diane J.

    CASAS: A Smart Home in a Box Diane J. Cook, IEEE Fellow, Aaron S. Crandall, IEEE Member, Brian L,acrandal,bthomas,ckn}@eecs.wsu.edu Abstract. While the potential benefits of smart home technology are widely recognized, a lightweight design is needed for the benefits to be realized at a large scale. We introduce the CASAS "smart home in a box

  3. Melt containment member

    DOE Patents [OSTI]

    Rieken, Joel R.; Heidloff, Andrew J.

    2014-09-09T23:59:59.000Z

    A tubular melt containment member for transient containment of molten metals and alloys, especially reactive metals and alloys, includes a melt-contacting layer or region that comprises an oxygen-deficient rare earth oxide material that is less reactive as compared to the counterpart stoichiometric rare earth oxide. The oxygen-deficient (sub-stoichiometric) rare earth oxide can comprise oxygen-deficient yttria represented by Y.sub.2O.sub.3-x wherein x is from 0.01 to 0.1. Use of the oxygen-deficient rare earth oxide as the melt-contacting layer or region material reduces reaction with the melt for a given melt temperature and melt contact time.

  4. Benefits of Commisioning New & Existing Buildings

    E-Print Network [OSTI]

    Meline, K.

    2011-01-01T23:59:59.000Z

    of * Data from Whole Building Design Guide ? a program of National Institute of Building Sciences (06-21-2010) 5 $4.00 $1.00 WHY ARE OWNERS USING THE CX PROCESS? Data obtained from ?Costs and Benefits of Commissioning New and Existing Commercial... Buildings? ? June 21, 2005. LBNL, PECI, TAMU-ESL Data obtained from ?Costs and Benefits of Commissioning New and Existing Commercial Buildings? ? June 21, 2005. LBNL, PECI, TAMU-ESL WHAT HAPPENS WHEN NEW BUILDINGS AREN?T PROPERLY COMMISSIONED...

  5. Retirement Benefits Jeff Houser

    E-Print Network [OSTI]

    Vacant Retirement Benefits Specialist Jeff Houser Director, Recruiting & Staffing Services for Early Education Kimberly Abel Director, Professional Development Heather Wainer Information Baker Retirement Administration Manager Lisa Vaccaro Compensation Manager Jeff Houser Interim

  6. The Earth Institute, Columbia University6 scott barrett, the Lenfest-Earth Institute

    E-Print Network [OSTI]

    The Earth Institute, Columbia University6 scott barrett, the Lenfest-Earth Institute Professor faculty members whose positions have been endowed in the Earth Institute by Gerry and Marguerite Lenfest of the Earth Institute. As a Lenfest professor, Barrett studies the interactions between economic and natural

  7. Rediness Review Team Member Training

    Broader source: Energy.gov (indexed) [DOE]

    MEMBER TRAINING Idaho National Engineering Laboratory Michael Hillman DOE HQ - HSS Idaho National Engineering Laboratory Dan M. Stover, PE Technical And Professional Services, Inc....

  8. Methodological Approaches for Estimating the Benefits and Costs of Smart Grid Demonstration Projects

    SciTech Connect (OSTI)

    Lee, Russell [ORNL

    2010-01-01T23:59:59.000Z

    This report presents a comprehensive framework for estimating the benefits and costs of Smart Grid projects and a step-by-step approach for making these estimates. The framework identifies the basic categories of benefits, the beneficiaries of these benefits, and the Smart Grid functionalities that lead to different benefits and proposes ways to estimate these benefits, including their monetization. The report covers cost-effectiveness evaluation, uncertainty, and issues in estimating baseline conditions against which a project would be compared. The report also suggests metrics suitable for describing principal characteristics of a modern Smart Grid to which a project can contribute. This first section of the report presents background information on the motivation for the report and its purpose. Section 2 introduces the methodological framework, focusing on the definition of benefits and a sequential, logical process for estimating them. Beginning with the Smart Grid technologies and functions of a project, it maps these functions to the benefits they produce. Section 3 provides a hypothetical example to illustrate the approach. Section 4 describes each of the 10 steps in the approach. Section 5 covers issues related to estimating benefits of the Smart Grid. Section 6 summarizes the next steps. The methods developed in this study will help improve future estimates - both retrospective and prospective - of the benefits of Smart Grid investments. These benefits, including those to consumers, society in general, and utilities, can then be weighed against the investments. Such methods would be useful in total resource cost tests and in societal versions of such tests. As such, the report will be of interest not only to electric utilities, but also to a broad constituency of stakeholders. Significant aspects of the methodology were used by the U.S. Department of Energy (DOE) to develop its methods for estimating the benefits and costs of its renewable and distributed systems integration demonstration projects as well as its Smart Grid Investment Grant projects and demonstration projects funded under the American Recovery and Reinvestment Act (ARRA). The goal of this report, which was cofunded by the Electric Power Research Institute (EPRI) and DOE, is to present a comprehensive set of methods for estimating the benefits and costs of Smart Grid projects. By publishing this report, EPRI seeks to contribute to the development of methods that will establish the benefits associated with investments in Smart Grid technologies. EPRI does not endorse the contents of this report or make any representations as to the accuracy and appropriateness of its contents. The purpose of this report is to present a methodological framework that will provide a standardized approach for estimating the benefits and costs of Smart Grid demonstration projects. The framework also has broader application to larger projects, such as those funded under the ARRA. Moreover, with additional development, it will provide the means for extrapolating the results of pilots and trials to at-scale investments in Smart Grid technologies. The framework was developed by a panel whose members provided a broad range of expertise.

  9. Worker Safety and Security Teams Team Member Handbook

    SciTech Connect (OSTI)

    Sievers, Cindy S. [Los Alamos National Laboratory

    2012-06-11T23:59:59.000Z

    Worker Safety and Security Teams (WSSTs) are an effective way to promote safe workplaces. While WSSTs have a variety of structures and roles, they have one thing in common - employees and management collaborate to find ways to prevent accidents, injuries, and illnesses on the job. The benefits for all concerned are obvious in that employees have a safe place to work, employers save money on lost work time and workers compensation costs, and everyone returns home safe and healthy each day. A successful WSST will have the support and wholehearted participation of management and employees. LANL has a WSST at the institutional level (IWSST) and at all directorates and many divisions. The WSSTs are part of LANL's Voluntary Protection Program (VPP). The WSSTs meet at least monthly and follow an agenda covering topics such as safety shares, behavior based safety (BBS) observations, upcoming events or activities, issues, etc. A WSST can effectively influence safety programs and provide recommendations to managers, who have the resources and authority to implement changes in the workplace. WSSTs are effective because they combine the knowledge, expertise, perspective, enthusiasm, and effort of a variety of employees with diverse backgrounds. Those with experience in a specific job or work area know what the hazards or potential hazards are, and generally have ideas how to go about controlling them. Those who are less familiar with a job or area play a vital role too, by seeing what others may have overlooked or taken for granted. This booklet will cover the structure and operations of WSSTs, what needs to be done in order to be effective and successful, and how you can help, whether you're a WSST member or not.

  10. Benefits of Sustainable Building Design

    Broader source: Energy.gov [DOE]

    The application of sustainable building design not only helps Federal facilities meet laws and regulations, it also provides them with many other benefits. These benefits include:

  11. Student Health Benefit Plan

    E-Print Network [OSTI]

    Massachusetts at Amherst, University of

    and programs tailored to the needs of students. The SHBP coordinates care with University Health Services (UHS), UMass Amherst's fully accredited health center. UHS provides comprehensive primary care, walk-in care2 2013-2014 Student Health Benefit Plan (SHBP) Designed for the Students of Policy Period: August 1

  12. Benefits Overview Faculty / Staff

    E-Print Network [OSTI]

    Lichtarge, Olivier

    , marital problems, alcohol/drug abuse, and interpersonal and family problems. Emeriti Retirement Health Benefits Bright Horizons Backup Advantage Care Bright Horizons provides backup care for well children and mildly ill or recuperating children and adults. Eighty hours of center-based or in-home care

  13. Community Wind Benefits (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2012-11-01T23:59:59.000Z

    This fact sheet explores the benefits of community wind projects, including citations to published research.

  14. Benefits | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels DataEnergyDepartmentWind SitingVerificationCombined Heat &Benefits

  15. Trace fossils of Fort Hays Limestone Member of Niobrara Chalk (Upper Cretaceous), west-central Kansas

    E-Print Network [OSTI]

    Frey, R. W.

    1970-07-17T23:59:59.000Z

    THE UNIVERSITY OF KANSAS PALEONTOLOGICAL CONTRIBUTIONS ARTICLE 53 (CRETACEOUS 2) TRACE FOSSILS OF FORT HAYS LIMESTONE MEMBER OF NIOBRARA CHALK (UPPER CRETACEOUS), WEST-CENTRAL KANSAS ROBERT W. FREY University of Georgia Marine Institute, Sapelo... Figures, 10 Plates, 4 Tables TRACE FOSSILS OF FORT HAYS LIMESTONE MEMBER OF NIOBRARA CHALK (UPPER CRETACEOUS), WEST-CENTRAL KANSAS' ROBERT W. FREY University of Georgia Marine Institute, Sapelo Island, Georgia CONTENTS PAGE PAGE ABSTRACT 5 Thalassinoides...

  16. HEALTH NET PHARMACY BENEFITS Plan codes WEE and 21B (HMO)1

    E-Print Network [OSTI]

    Mullins, Dyche

    HEALTH NET PHARMACY BENEFITS Plan codes WEE and 21B (HMO)1 Plan codes WQQ and 22B (EOA)1 The following is a brief description of your Health Net Pharmacy benefits. PRESCRIPTIONS BY MAIL If your / $70 level III. For complete information, log on as a Health Net member at www.healthnet.com > View

  17. Members

    Broader source: Energy.gov [DOE]

    Membership in the Consortium is open to municipalities, utilities, and energy efficiency organizations, with participation at various levels from other interested parties.

  18. Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings

  19. Employee Benefit Options

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMFormsGasRelease Date:researchEmerging Threats and OpportunitiesBenefit

  20. Employee Benefits | Careers | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField Campaign:INEAWater UseCElizabethTwo States CARLSBAD,EmilioRonBenefits

  1. National Heart, Lung, and Blood Institute

    E-Print Network [OSTI]

    Bandettini, Peter A.

    National Heart, Lung, and Blood Institute A T - A - G L A N C E : Physical Activity and Your Heart benefits. It can strengthen your heart and improve lung func- tion, and it may help prevent certain types

  2. North American Reciprocal Museum List Members from the de Saisset Museum, who present a membership card validated with a gold North American Reciprocal

    E-Print Network [OSTI]

    Schwarz, Thomas

    North American Reciprocal Museum List Members from the de Saisset Museum, who present a membership at participating museums: Free/member admission during regular museum hours, member discounts at museum shops, and discounts. on concert/lecture tickets. Please note: Some museums restrict benefits. Please see notes

  3. BENEFITS BULLETIN April 30, 2012

    E-Print Network [OSTI]

    are eligible for benefits as early as age 62 Full retirement age is staggered Payroll deduction is 6BENEFITS BULLETIN April 30, 2012 BULLETIN NO: 12-05 SUBJECT: FERS Retirement Basics TO: All Employees FROM: Kathy Shearman, Benefits Officer Are you under the Federal Employees Retirement System (FERS

  4. Joseph M. Juran Team Members

    E-Print Network [OSTI]

    Vardeman, Stephen B.

    Joseph M. Juran I E 361 Fall 2002 Team Members: Dragui Nestorovic Gonzalo Rodriguez Monica Kroh Jaroslav Sebek #12;Introduction Joseph M. Juran has led a life of success and accomplishments. Using his. Background Joseph M. Juran was born in Brailia, Romania, during December of 1904. When Joseph was five years

  5. Financial Institutions

    Broader source: Energy.gov [DOE]

    A lending program begins with a financial institution that procures the funds they lend from a number of other sources.

  6. ENTERPRISE RISK MANAGEMENT PLAN Texas Transportation Institute

    E-Print Network [OSTI]

    1 ENTERPRISE RISK MANAGEMENT PLAN Texas Transportation Institute The Texas A&M University System and a member of The Texas A&M University System. This document sets forth TTI's risk management plan and our strategy for enterprise risk management. This plan is intended to complement and expand upon the Institute

  7. Wind Energy Benefits (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2015-01-01T23:59:59.000Z

    This fact sheet outlines the top 10 benefits of wind energy, including cost, water savings, job creation, indigenous resource, and low operating costs.

  8. Ecosystem Services and Environmental Benefits

    E-Print Network [OSTI]

    Tsien, Roger Y.

    Ecosystem Services and Environmental Benefits of the UC San Diego Campus Forest 10 February 2009 #12;2 #12;3 Ecosystem Services and Environmental Benefits of the UC San Diego Campus Forest 10 buildings. By consuming solar energy in the process of evapotranspiration and blocking winter winds

  9. Marine renewable energy: potential benefits to biodiversity? An urgent call for research

    E-Print Network [OSTI]

    Exeter, University of

    Marine renewable energy: potential benefits to biodiversity? An urgent call for research Richard 1 Centre for Ecology and Conservation and Peninsula Research Institute for Marine Renewable Energy driver. In response, many governments have initiated programmes of energy production from renewable

  10. Institute for Plant Genomics and Biotechnology GENOMICS AND BIOTECHNOLOGY

    E-Print Network [OSTI]

    Institute for Plant Genomics and Biotechnology GENOMICS AND BIOTECHNOLOGY A multidisciplinary organization, the Institute for Plant Genomics and Biotechnology is a composed of faculty members representing projects at the Institute for Plant Genomics and Biotechnology include the development of transgenic plants

  11. Faculty Member Complete the Paid Parental Leave

    E-Print Network [OSTI]

    Meyers, Steven D.

    Faculty Member Complete the Paid Parental Leave (PPL) Request Form Human Resources Evaluate determination notice to the employee with copies to the department Enroll faculty member in the PPL Leave Plan and endorse the faculty member's PPL Request Form Review contingency planning and forward supporting rationale

  12. Department of the Navy Civilian Benefits Center

    E-Print Network [OSTI]

    Department of the Navy Civilian Benefits Center Date: 28 November 2011 From: DON Benefits Officer and Flexible Spending Account. The Department of the Navy Benefit Civilian Human Resources Web site at http://www.public.navy.mil/donhr/Benefits/Pages/BenefitsOpenSeason.aspx is an excellent source of Open Season

  13. Innovative Mercury Treatment Benefits Stream, Fish | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Mercury Treatment Benefits Stream, Fish Innovative Mercury Treatment Benefits Stream, Fish October 1, 2012 - 12:00pm Addthis Oak Ridge scientists Kelly Roy, left, and Trent Jett...

  14. Benefits | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    about their benefits, including FMLA coverage, on their internal Benefits website. Health Care Options Medical Plans, which include Vision Care and Prescription Drug Plans...

  15. BIOENERGIZEME INFOGRAPHIC CHALLENGE: Environmental Benefits of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Environmental Benefits of Bioenergy Corn Can Save the Earth BIOENERGIZEME INFOGRAPHIC CHALLENGE: Environmental Benefits of Bioenergy Corn Can Save the Earth BIOENERGIZEME...

  16. Interagency Energy Management Task Force Members

    Broader source: Energy.gov [DOE]

    The Interagency Energy Management Task Force is led by the Federal Energy Management Program director. Members include energy and sustainability managers from federal agencies.

  17. Optimize Storage Placement in Sensor Bo Sheng, Member, IEEE, Qun Li, Member, IEEE, and Weizhen Mao, Member, IEEE

    E-Print Network [OSTI]

    Mao, Weizhen

    nodes with much larger permanent storage (e.g., flash memory) and more battery power can be deployed-by-hop relay of other sensor nodes, the problem of limited storage, com- munication capacity, and battery power1 Optimize Storage Placement in Sensor Networks Bo Sheng, Member, IEEE, Qun Li, Member, IEEE

  18. Duke University Benefits Overview: Exempt

    E-Print Network [OSTI]

    Reif, John H.

    and Affordable Care Act (otherwise known as National Health Care Reform). You have the benefit of paying premiums is an open access Health Maintenance Organization, or HMO. If you choose this plan you must receive care from if you choose a provider outside of the network. Blue Care is an open access Health Maintenance

  19. Economic benefits of greenspace Research Report

    E-Print Network [OSTI]

    Economic benefits of greenspace Research Report #12;#12;Research Report Economic benefits of greenspace A critical assessment of evidence of net economic benefits Forestry Commission: Edinburgh Vadim. ISBN 978-0-85538-865-2 Saraev, V. (2012) Economic benefits of greenspace: a critical assessment

  20. Department of the Navy Civilian Benefits Center

    E-Print Network [OSTI]

    Department of the Navy Civilian Benefits Center Date: 26 June 2012 From: DON Benefits Officer To of the Navy systems are now ready to accept employee's Roth TSP transactions (regular and catch-up). The TSP available at http://www.public.navy.mil/donhr/Benefits/resources/Documents/Benefits%20Bulletin%2020 12

  1. Department of the Navy Civilian Benefits Center

    E-Print Network [OSTI]

    Department of the Navy Civilian Benefits Center Benefits Line 888-320-2917 M - F, 7:30 a.m. ­ 7:30 p.m. ET TTY: 866-359-5277 Email: navybenefits@navy.mil http://www.public.navy.mil/donhr/Benefits Department of the Navy Civilian Benefits Center Benefits Line 888-320-2917 M - F, 7:30 a.m. ­ 7:30 p.m. ET

  2. Health Benefits of Particle Filtration

    SciTech Connect (OSTI)

    Fisk, William J.

    2013-10-01T23:59:59.000Z

    The evidence of health benefits of particle filtration in homes and commercial buildings is reviewed. Prior reviews of papers published before 2000 are summarized. The results of 16 more recent intervention studies are compiled and analyzed. Also, reviewed are four studies that modeled health benefits of using filtration to reduce indoor exposures to particles from outdoors. Prior reviews generally concluded that particle filtration is, at best, a source of small improvements in allergy and asthma health effects; however, many early studies had weak designs. A majority of recent intervention studies employed strong designs and more of these studies report statistically significant improvements in health symptoms or objective health outcomes, particularly for subjects with allergies or asthma. The percent age improvement in health outcomes is typically modest, for example, 7percent to 25percent. Delivery of filtered air to the breathing zone of sleeping allergic or asthmatic persons may be more consistently effective in improving health than room air filtration. Notable are two studies that report statistically significant improvements, with filtration, in markers that predict future adverse coronary events. From modeling, the largest potential benefits of indoor particle filtration may be reductions in morbidity and mortality from reducing indoor exposures to particles from outdoor air.

  3. Health Benefits of Particle Filtration

    SciTech Connect (OSTI)

    Fisk, William J.

    2013-10-01T23:59:59.000Z

    The evidence of health benefits of particle filtration in homes and commercial buildings is reviewed. Prior reviews of papers published before 2000 are summarized. The results of 16 more recent intervention studies are compiled and analyzed. Also reviewed are four studies that modeled health benefits of using filtration to reduce indoor exposures to particles from outdoors. Prior reviews generally concluded that particle filtration is, at best, a source of small improvements in allergy and asthma health effects; however, many early studies had weak designs. A majority of recent intervention studies employed strong designs and more of these studies report statistically significant improvements in health symptoms or objective health outcomes, particularly for subjects with allergies or asthma. The percentage improvement in health outcomes is typically modest, e.g., 7percent to 25percent. Delivery of filtered air to the breathing zone of sleeping allergic or asthmatic persons may be more consistently effective in improving health than room air filtration. Notable are two studies that report statistically significant improvements, with filtration, in markers that predict future adverse coronary events. From modeling, the largest potential benefits of indoor particle filtration may be reductions in morbidity and mortality from reducing indoor exposures to particles from outdoor air.

  4. Institute for Mineral and Energy Resources

    E-Print Network [OSTI]

    Institute for Mineral and Energy Resources #12;IMER VISION IMER's vision is to enable the efficient and sustainable use and development of the world's mineral and energy resources for the benefit of society resources. IMER OBJECTIVES · Advance the science and technology required to enhance the prospectivity

  5. 9/17/12 Jack Liu tracks our ecological footprint | AAAS MemberCentral 1/5membercentral.aaas.org/blogs/member-spotlight/jack-liu-tracks-our-ecological-footprint

    E-Print Network [OSTI]

    ://pubs.aaas.org/org_membership/aaas_member_ren.asp) Take a Tour (http://membercentral.aaas.org/trialthree) Cutting Edge (/cutting-edge) Benefits plans. AAAS MC: Much of your work takes a holistic approach, looking at many seemingly unrelated factors

  6. STRUCTURAL PERFORMANCE OF DEGRADED REINFORCED CONCRETE MEMBERS.

    SciTech Connect (OSTI)

    Braverman, J.I.; Miller, C.A.; Ellingwood, B.R.; Naus, D.J.; Hofmayer, C.H.; Bezler, P.; Chang, T.Y.

    2001-03-22T23:59:59.000Z

    This paper describes the results of a study to evaluate, in probabilistic terms, the effects of age-related degradation on the structural performance of reinforced concrete members at nuclear power plants. The paper focuses on degradation of reinforced concrete flexural members and shear walls due to the loss of steel reinforcing area and loss of concrete area (cracking/spalling). Loss of steel area is typically caused by corrosion while cracking and spalling can be caused by corrosion of reinforcing steel, freeze-thaw, or aggressive chemical attack. Structural performance in the presence of uncertainties is depicted by a fragility (or conditional probability of failure). The effects of degradation on the fragility of reinforced concrete members are calculated to assess the potential significance of various levels of degradation. The fragility modeling procedures applied to degraded concrete members can be used to assess the effects of degradation on plant risk and can lead to the development of probability-based degradation acceptance limits.

  7. Elastomeric member for energy storage device

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI); Chute, Richard (Birmingham, MI)

    1985-01-01T23:59:59.000Z

    An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16), disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section, transition end sections, and is attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the member, a substantially uniform diameter assembly results to minimize the required volume of the surrounding housing (14). During manufacture, woven wire mesh sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle. Each sleeve (26, 28) contracts with the contraction of the associated transition section to maintain the bond therebetween.

  8. Engineering Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMFormsGasReleaseSpeeches Energy Speeches RSS JuneInstitute Engineering

  9. Seaborg Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of ScienceandMesa del Sol HomeFacebook Twitter PrincipalfuelTorusconditionsSupportedScottInstitute

  10. Advanced Studies Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Engineering Institute Advanced Studies Institute Contact Institute Director Charles Farrar (505) 663-5330 Email UCSD EI Director Michael Todd (858) 534-5951 Professional Staff...

  11. Benefit Forms | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy:WhetherNovember 13, 2009OakDepartment ofThe employment and benefits

  12. Benefits of a Miniaturized Approach

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplex historian ...BESFor41BeforeAllenBenefits of a

  13. Benefits Forms & Required Notices

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplex historian ...BESFor41BeforeAllenBenefits of

  14. Benefits Plan Reports & Notices

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplex historian ...BESFor41BeforeAllenBenefits

  15. Benefits | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn AprilA groupTuba City, Arizona,Site Operations GuideAlternate WatchBenefits | National

  16. Methodologies for Determining Persistence of Commissioning Benefits

    E-Print Network [OSTI]

    Claridge, D. E.

    2006-01-01T23:59:59.000Z

    Studies on the persistence of commissioning benefits to date have used a variety of methods to evaluate this persistence. This paper proposes a consistent framework for describing and evaluating the persistence of commissioning benefits. It begins...

  17. Quantifying the benefits of hybrid vehicles

    E-Print Network [OSTI]

    Turrentine, Tom; Delucchi, Mark; Heffner, Reid R.; Kurani, Kenneth S; Sun, Yongling

    2006-01-01T23:59:59.000Z

    The Emergence of Hybrid Vehicles: Ending oil’s strangleholdthe benefits of hybrid vehicles Dr. Thomas Turrentine Dr.the benefits of hybrid vehicles Report prepared for CSAA Dr.

  18. Department of the Navy Civilian Benefits Center

    E-Print Network [OSTI]

    Department of the Navy Civilian Benefits Center Benefits Bulletin 2010-2 DON Civilian Human Resources Web Site: Benefits Information The Deputy Assistant Secretary of the Navy (Civilian Human Resources) launched a new Web site at http://www.public.navy.mil/donhr that provides Department of the Navy

  19. Duke University Benefits Overview: Non-Exempt

    E-Print Network [OSTI]

    Reif, John H.

    Protection and Affordable Care Act (otherwise known as National Health Care Reform). You have the benefit Health Maintenance Organization, or HMO. If you choose this plan you must receive care from of some of the benefits that Duke offers: I. HEALTH BENEFITS Medical Insurance Duke offers four options

  20. The University of Oklahoma Benefits Guide 2012

    E-Print Network [OSTI]

    Oklahoma, University of

    The University of Oklahoma Benefits Guide 2012 Norman ­ Oklahoma City ­ Tulsa #12;2 The University of Oklahoma Benefits Guide Norman - Oklahoma City - Tulsa Table of Contents Introduction NOTICE: The Board of Regents of the University of Oklahoma reserves the right to change any benefit plans

  1. The University of Oklahoma Benefits Guide 2013

    E-Print Network [OSTI]

    Oklahoma, University of

    The University of Oklahoma Benefits Guide 2013 Norman ­ Oklahoma City ­ Tulsa #12;2 The University of Oklahoma Benefits Guide Norman - Oklahoma City - Tulsa Table of Contents Introduction NOTICE: The Board of Regents of the University of Oklahoma reserves the right to change any benefit plans

  2. Better Buildings Residential Network All-Member Peer Exchange Call: Member Reporting and Benefits, Call Slides and Discussion Summary, May 22, 2014

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn't Your Destiny: The FutureCommentsEnergy Christopher|for1, 20114,Residential 2014(BBRN)All-

  3. Wireless Technology in Industrial Networks Andreas Willig, Member, IEEE, Kirsten Matheus, Member, IEEE, Adam Wolisz, Senior

    E-Print Network [OSTI]

    Wichmann, Felix

    of existing wireless technologies for this specific field of applications, and iii) the creation of hybrid1 Wireless Technology in Industrial Networks Andreas Willig, Member, IEEE, Kirsten Matheus, Member), pp. 1130-1151 Abstract With the success of wireless technologies in consumer electronics, standard

  4. E cient Retiming of Large Circuits Naresh Maheshwari, Student Member, IEEE, and Sachin Sapatnekar, Member, IEEE

    E-Print Network [OSTI]

    Sapatnekar, Sachin

    , Member, IEEE Abstract| Retiming, introduced by Leiserson and Saxe, is a powerful transformation1 E cient Retiming of Large Circuits Naresh Maheshwari, Student Member, IEEE, and Sachin Sapatnekar not capable of handling large circuits in a reasonable time. This work de nes the relationship be- tween

  5. Color Imaging for Multimedia GAURAV SHARMA, MEMBER, IEEE, MICHAEL J. VRHEL, MEMBER, IEEE, AND

    E-Print Network [OSTI]

    Sharma, Gaurav

    Color Imaging for Multimedia GAURAV SHARMA, MEMBER, IEEE, MICHAEL J. VRHEL, MEMBER, IEEE, AND H. JOEL TRUSSELL, FELLOW, IEEE To a significant degree, multimedia applications derive their effectiveness-based multimedia systems have grown from their humble beginnings into systems that truly allow the integration

  6. Security Games for Vehicular Networks Tansu Alpcan, Member, IEEE, and Sonja Buchegger, Member, IEEE

    E-Print Network [OSTI]

    Chen, Ing-Ray

    . The effectiveness of the security game solutions is evaluated numerically using realistic simulation data obtainedSecurity Games for Vehicular Networks Tansu Alpcan, Member, IEEE, and Sonja Buchegger, Member, IEEE Abstract--Vehicular networks (VANETs) can be used to improve transportation security, reliability

  7. Residential Network Members Impact More Than 42,000 Households...

    Energy Savers [EERE]

    Members Impact More Than 42,000 Households Photo of a row of townhomes. Eligible Better Buildings Residential Network members reported completing 27,563 home energy upgrades...

  8. Texas 4-H Member Achievement Plan

    E-Print Network [OSTI]

    Lepley, Toby

    2000-08-07T23:59:59.000Z

    The Member Achievement Plan (M.A.P.) provides 4-Hers with forms and journal pages to help them plan their 4-H projects, set goals and evaluate their accomplishments. Using this will help teach record-keeping skills. It is part of the new "For...

  9. Elastomeric member and method of manufacture therefor

    DOE Patents [OSTI]

    Hoppie, L.O.

    1985-12-10T23:59:59.000Z

    An energy storage device is disclosed consisting of a stretched elongated elastomeric member disposed within a tubular housing, which elastomeric member is adapted to be torsionally stressed to store energy. The elastomeric member is configured in the relaxed state with a uniform diameter body section, and transition end sections, attached to rigid end piece assemblies of a lesser diameter. The profile and deflection characteristic of the transition sections are such that upon stretching of the elastomeric member, a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing. Each of the transition sections are received within and bonded to a woven wire mesh sleeve having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves are forced against a forming surface and bonded to the associated transition section to provide the correct profile and helix angle. 12 figs.

  10. Who are the members of the

    E-Print Network [OSTI]

    Baker, Chris I.

    are the members of your research team? The outcomes of clinical research affect much of adult who may not be ableMatch.org Opportunities for research volunteers The NIH Clinical Center Volunteers FirstNews and Information from the NIH Clinical Research Volunteer Program Winter 2011 Dr. John I. Gallin, CC director (second, from left

  11. Balfour Library Guide Members of other

    E-Print Network [OSTI]

    Balfour Library Guide for Members of other Departments in the University (e.g. postgraduate, post times 3 Out of hours access 3 Contact details 3 Library facilities 3 Computers 3 Use of laptops, using LibrarySearch 6 Classification of books in the Balfour Library 6 Loan periods 7 Registration

  12. Elastomeric member and method of manufacture therefor

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI)

    1985-01-01T23:59:59.000Z

    An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16) disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section (74), and transition end sections (76, 78), attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the elastomeric member (16), a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing (14). Each of the transition sections (76, 78) are received within and bonded to a woven wire mesh sleeve (26, 28) having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve (26, 28) also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle.

  13. Service Members Aim High-- for Energy Savings

    Broader source: Energy.gov [DOE]

    Service members are helping reduce our dependency on oil, and saving taxpayers' money, with their energy-saving efforts. Operation Change Out has cut $26.3 million in total energy costs and helped prevent more than 396 lbs. of carbon dioxide.

  14. Carbon calculator tracks the climate benefits of managed private forests

    E-Print Network [OSTI]

    Stewart, William C; Sharma, Benktesh D

    2015-01-01T23:59:59.000Z

    forests provide more carbon sequestration benefits than let-the relative carbon sequestration benefits of let-growlife cycle carbon sequestration benefits, averaged over 120,

  15. Post-Closure Benefits: DOE Complex vs Closure Sites | Department...

    Office of Environmental Management (EM)

    Post-Closure Benefits: DOE Complex vs Closure Sites Status of Contractor Pension and PRB Benefit Programs - September 30, 2013 DOE Wide Closure Sites Defined Benefit Pension...

  16. BioenergizeME Virtual Science Fair: The Environmental Benefit...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    The Environmental Benefit of Bioenergy BioenergizeME Virtual Science Fair: The Environmental Benefit of Bioenergy BioenergizeME Virtual Science Fair: The Environmental Benefit of...

  17. Environmental Change Institute Environmental Change Institute

    E-Print Network [OSTI]

    Oxford, University of

    Environmental Change Institute 2012/13 eci Environmental Change Institute #12;ii Environmental 06 Educating environmental leaders 08 Centre for interdisciplinary doctoral training 10 A thriving, Dumfriesshire (ECI) #12;1 The Environmental Change Institute has 21 years' experience in helping governments

  18. Benefits Summary - Temporary Job Classification | Argonne National...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Temporary Job Classification Download a summary of benefits offered to employees in the temporary job classification (at least 6 months term and 20 hoursweek). 2015 Long Term...

  19. Institute for ADVANCED STUDY

    E-Print Network [OSTI]

    OF EVENTS 91 · REPORT OF THE INSTITUTE LIBRARIES 93 · INSTITUTE FOR ADVANCED STUDY/PARK CITY MATHEMATICS. The Institute for Advanced Study has sustained this founding principle for more than sixty-five years

  20. Institute /or ADVANCED STUDY

    E-Print Network [OSTI]

    OF THE INSTITUTE LIBRARIES 63 INSTITUTE FOR ADVANCED STUDY/PARK CITY MATHEMATICS INSTITUTE 66 · MENTORING PROGRAM sustained and has yielded an unsurpassed record of definitive scholarship. Although small in scale

  1. Managed Lane Choices by Carpools Comprised of Family Members Compared to Non-family Members

    E-Print Network [OSTI]

    Pannu, Mandeep S.

    2011-02-22T23:59:59.000Z

    Turnbull Head of Department, Mark Burris December 2009 Major Subject: Civil Engineering iii ABSTRACT Managed Lane Choices by Carpools Comprised of Family Members Compared to Non- Family Members. (December 2009) Mandeep Singh Pannu, B..., Maryland; Boston; Minneapolis; New Jersey Turnpike; New York City; Portland; Ottawa, Ontario; Memphis; Nashville; Dallas; Northern Virginia; Norfolk/Virginia Beach; Seattle; Houston; and numerous California counties (HOV Systems Manual, 1998; Stockton...

  2. Approaches to Creating and Controlling Motion in MRI Gregory S. Fischer, Member, IEEE, Gregory Cole, Student Member, IEEE and Hao Su, Student Member, IEEE

    E-Print Network [OSTI]

    Camesano, Terri

    Approaches to Creating and Controlling Motion in MRI Gregory S. Fischer, Member, IEEE, Gregory Cole, Student Member, IEEE and Hao Su, Student Member, IEEE Abstract-- Magnetic Resonance Imaging (MRI) can is complicated by factors including: the high magnetic field strength, the requirement that such devices should

  3. On the Capacity of k-MPR Wireless Networks Ming-Fei Guo, Member, IEEE, Xinbing Wang, Member, IEEE, Min-You Wu, Senior Member, IEEE

    E-Print Network [OSTI]

    Wang, Xinbing

    1 On the Capacity of k-MPR Wireless Networks Ming-Fei Guo, Member, IEEE, Xinbing Wang, Member, IEEE, Min-You Wu, Senior Member, IEEE Abstract--The capacity of wireless ad hoc networks is mainly the capacity of 2-D wireless networks wherein each node can decode at most k simultaneous transmis- sions

  4. Institut Eurecom1 Institut Eurecom research is partially supported by its industrial members: BMW Group Research & Technology BMW Group

    E-Print Network [OSTI]

    Gesbert, David

    : BMW Group Research & Technology ­ BMW Group Company, Bouygues Telecom, Cisco Systems, France Telecom

  5. Duke University Health System Benefits Overview: Exempt

    E-Print Network [OSTI]

    Reif, John H.

    Protection and Affordable Care Act (otherwise known as National Health Care Reform). You have the benefit Health Maintenance Organization, or HMO. If you choose this plan you must receive care fromDuke University Health System Benefits Overview: Exempt 2014 We are pleased to provide you

  6. The University of Oklahoma Benefits Guide 2014

    E-Print Network [OSTI]

    Oklahoma, University of

    The University of Oklahoma Benefits Guide 2014 Norman ­ Oklahoma City ­ Tulsa #12;2 The University of Oklahoma Benefits Guide Norman - Oklahoma City - Tulsa Table of Contents Introduction A IMPORTANT NOTICE: The Board of Regents of the University of Oklahoma reserves the right to change any

  7. Evaluating Economic andEvaluating Economic and Environmental BenefitsEnvironmental Benefits

    E-Print Network [OSTI]

    Evaluating Economic andEvaluating Economic and Environmental BenefitsEnvironmental Benefits of Soil@missouri.edu) Coordinator Publications & Communications, FAPRI­MU. #12;Evaluating Economic and Environmental Benefits a combination of methods to evaluate the value of Missouri's Department of Natural Resources (MODNR

  8. Theme 1 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect,LLCStartup America1 Members

  9. Theme 2 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect,LLCStartup America1 Members2

  10. Theme 3 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect,LLCStartup America1 Members23

  11. Cumberland Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand JumpConceptual Model, clickInformationNew|CoreCpWing County,Electric Coop,Cumberland Elec Member

  12. Energy-Smart Building Choices: How School Administrators and Board Members Are Improving Learning and Saving Money (Revision)

    SciTech Connect (OSTI)

    Not Available

    2002-02-01T23:59:59.000Z

    Most school administrators and board members today must perform a tough juggling act. You're challenged to fulfill increasingly complex educational missions, meet rising community expectations, and serve growing student populations all with constrained operating budgets. As districts consider renovating their facilities or building new schools, many have found that smart energy choices can have lasting benefits for their schools, their communities, and the environment.

  13. Impact assessment: Eroding benefits through streamlining?

    SciTech Connect (OSTI)

    Bond, Alan, E-mail: alan.bond@uea.ac.uk [School of Environmental Sciences, University of East Anglia (United Kingdom) [School of Environmental Sciences, University of East Anglia (United Kingdom); School of Geo and Spatial Sciences, North-West University (South Africa); Pope, Jenny, E-mail: jenny@integral-sustainability.net [Integral Sustainability (Australia) [Integral Sustainability (Australia); Curtin University Sustainability Policy Institute (Australia); Morrison-Saunders, Angus, E-mail: A.Morrison-Saunders@murdoch.edu.au [School of Geo and Spatial Sciences, North-West University (South Africa) [School of Geo and Spatial Sciences, North-West University (South Africa); Environmental Science, Murdoch University (Australia); Retief, Francois, E-mail: francois.retief@nwu.ac.za [School of Geo and Spatial Sciences, North-West University (South Africa)] [School of Geo and Spatial Sciences, North-West University (South Africa); Gunn, Jill A.E., E-mail: jill.gunn@usask.ca [Department of Geography and Planning and School of Environment and Sustainability, University of Saskatchewan (Canada)

    2014-02-15T23:59:59.000Z

    This paper argues that Governments have sought to streamline impact assessment in recent years (defined as the last five years) to counter concerns over the costs and potential for delays to economic development. We hypothesise that this has had some adverse consequences on the benefits that subsequently accrue from the assessments. This hypothesis is tested using a framework developed from arguments for the benefits brought by Environmental Impact Assessment made in 1982 in the face of the UK Government opposition to its implementation in a time of economic recession. The particular benefits investigated are ‘consistency and fairness’, ‘early warning’, ‘environment and development’, and ‘public involvement’. Canada, South Africa, the United Kingdom and Western Australia are the jurisdictions tested using this framework. The conclusions indicate that significant streamlining has been undertaken which has had direct adverse effects on some of the benefits that impact assessment should deliver, particularly in Canada and the UK. The research has not examined whether streamlining has had implications for the effectiveness of impact assessment, but the causal link between streamlining and benefits does sound warning bells that merit further investigation. -- Highlights: • Investigation of the extent to which government has streamlined IA. • Evaluation framework was developed based on benefits of impact assessment. • Canada, South Africa, the United Kingdom, and Western Australia were examined. • Trajectory in last five years is attrition of benefits of impact assessment.

  14. Geophysical Institute biennial report 1995--1996

    SciTech Connect (OSTI)

    NONE

    1998-06-01T23:59:59.000Z

    The mission of the Geophysical Institute is to understand the basic physical processes governing Earth, especially as they occur in, or are relevant to the Arctic; to train graduate and undergraduate students to play leading roles in tomorrow`s society; to solve applied geophysical problems and develop resource-oriented technology of importance to the state and the nation; and to satisfy the intellectual and technological needs of fellow Alaskans through public service. The variety of subjects studied by the faculty, research staff members, and graduate students at the Geophysical Institute include auroral physics and chemistry, arctic haze, ice fog, atmospheric dynamics, ozone, Alaska weather patterns, regional meteorology and climatology, global climate change, cloud physics and radiation, permafrost, glaciers, sea ice, remote sensing, geothermal energy, tectonics, volcanoes and earthquakes. Summaries are presented of the projects undertaken by the Institute in these fields.

  15. Multiple capillary biochemical analyzer with barrier member

    DOE Patents [OSTI]

    Dovichi, N.J.; Zhang, J.Z.

    1996-10-22T23:59:59.000Z

    A multiple capillary biochemical analyzer is disclosed for sequencing DNA and performing other analyses, in which a set of capillaries extends from wells in a microtiter plate into a cuvette. In the cuvette the capillaries are held on fixed closely spaced centers by passing through a sandwich construction having a pair of metal shims which squeeze between them a rubber gasket, forming a leak proof seal for an interior chamber in which the capillary ends are positioned. Sheath fluid enters the chamber and entrains filament sample streams from the capillaries. The filament sample streams, and sheath fluid, flow through aligned holes in a barrier member spaced close to the capillary ends, into a collection chamber having a lower glass window. The filament streams are illuminated above the barrier member by a laser, causing them to fluoresce. The fluorescence is viewed end-on by a CCD camera chip located below the glass window. The arrangement ensures an equal optical path length from all fluorescing spots to the CCD chip and also blocks scattered fluorescence illumination, providing more uniform results and an improved signal-to-noise ratio. 12 figs.

  16. Multiple capillary biochemical analyzer with barrier member

    DOE Patents [OSTI]

    Dovichi, Norman J. (Edmonton, CA); Zhang, Jian Z. (Edmonton, CA)

    1996-01-01T23:59:59.000Z

    A multiple capillary biochemical analyzer for sequencing DNA and performing other analyses, in which a set of capillaries extends from wells in a microtiter plate into a cuvette. In the cuvette the capillaries are held on fixed closely spaced centers by passing through a sandwich construction having a pair of metal shims which squeeze between them a rubber gasket, forming a leak proof seal for an interior chamber in which the capillary ends are positioned. Sheath fluid enters the chamber and entrains filament sample streams from the capillaries. The filament sample streams, and sheath fluid, flow through aligned holes in a barrier member spaced close to the capillary ends, into a collection chamber having a lower glass window. The filament streams are illuminated above the barrier member by a laser, causing them to fluoresce. The fluorescence is viewed end-on by a CCD camera chip located below the glass window. The arrangement ensures an equal optical path length from all fluorescing spots to the CCD chip and also blocks scattered fluorescence illumination, providing more uniform results and an improved signal to noise ratio.

  17. The European Forest Institute and the Finnish Forest Research Institute: The supply of woody biomass from the forests in the EU can be

    E-Print Network [OSTI]

    biomass from the forests in the EU can be significantly increased The supply of woody biomass from and recycled wood) for the 27 EU member states. As with woody biomass from forests, the supply of woody biomassThe European Forest Institute and the Finnish Forest Research Institute: The supply of woody

  18. Dana-Farber Cancer Institute, Inc. Members of the Board of Trustees

    E-Print Network [OSTI]

    Liu, Xiaole Shirley

    Thomas A. Farrington 1 James L. Fine 1 Stephen A. Fine 1 Deborah S. First 1 Robert C. First 4 Charles D William M. Gillen 2 Christopher R. Gordon 2 Michael S. Gordon 2 James D. Griffin, M.D. 3 Phillip T. Gross. Norberg 1 John J. O'Connor 1 Vincent M. O'Reilly 4 Stuart H. Orkin, M.D. 3 Edward O. Owens 1 Karen Linde

  19. American Institute of Aeronautics and Astronautics 1. AIAA Member; Senior Research Scientist

    E-Print Network [OSTI]

    , ceramic membrane, cryogenic air separation, and hybrids [2]. The NEA contains usually more than 90 percent such as lightning strikes, artillery shells, static discharge, wiring sparks, and heating sources. Air separation technologies for the Air Separation Module (ASM) include pressure swing adsorption, hollow fiber membrane

  20. Networking Call for Residential Network Members Peer Exchange...

    Energy Savers [EERE]

    Networking Call for Residential Network Members Peer Exchange Call Networking Call for Residential Network Members Peer Exchange Call March 12, 2015 12:30PM to 2:0...

  1. TU DELFT PROCESS TECHNOLOGY INSTITUTE INSTITUTE LECTURE

    E-Print Network [OSTI]

    Lindken, Ralph

    TU DELFT PROCESS TECHNOLOGY INSTITUTE INSTITUTE LECTURE CHEMICAL REACTORS WITH DIRECT HEATING is in contrast with conventional operation of catalytic reactors, where heat is generally supplied through the reactor wall and unnecessary heating of the fluid phase, catalyst support and reactor materials occur

  2. DIABETES, OBESITY AND METABOLISM INSTITUTE

    E-Print Network [OSTI]

    Engman, David M.

    DIABETES, OBESITY AND METABOLISM INSTITUTE AT NORTHWESTERN MEDICINE THE INSTITUTES AT NORTHWESTERN MEDICINE #12;THE INSTITUTES AT NORTHWESTERN MEDICINE DIABETES, OBESITY AND METABOLISM INSTITUTE AT NORTHWESTERN MEDICINE "As we launch the Diabetes, Obesity and Metabolism Institute at Northwestern Medicine, I

  3. NEJC Board Member Receives 2015 National Planning Excellence Award

    Broader source: Energy.gov [DOE]

    National Environmental Justice Conference, Inc. Board of Directors Member Receives American Planning Association 2015 National Planning Excellence Award

  4. Air Emissions and Oil Displacement Benefits

    E-Print Network [OSTI]

    Michalek, Jeremy J.

    might eventually offer the greatest benefits at competitive costs if gasoline prices and battery life gasoline prices, low- emiss may (1) produce fewer greenhouse gas emissions when powered by electricity instead of gasoline

  5. DTC DATA MINING CONSORTIUM MEMBERSHIP BENEFITS

    E-Print Network [OSTI]

    Minnesota, University of

    DTC DATA MINING CONSORTIUM MEMBERSHIP BENEFITS I Collaboration with leading companies I BEHAVIORAL ECOLOGY DRUG DISCOVERY BUSINESS SALES & MARKETING AUTOMOTIVE CRM GOVERNMENT CYBER SECURITY Creation Analysis Optimization Scalable Database Mining Auto-Mining Agents CUTTING-EDGE CAPABILITIES

  6. The Economic Benefits of Recycling in Virginia

    E-Print Network [OSTI]

    Lewis, Robert Michael

    The Economic Benefits of Recycling in Virginia Alexander P. Miller Hang T. Nguyen Samantha D, and the recycling contacts from the participating Solid Waste Planning Units discussed in this study. #12;3 Table Determinants of Recycling_______________________________ 12 State Reports

  7. WVU Personal Rapid Transit Benefit Cost Analysis

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    WVU Personal Rapid Transit Benefit Cost Analysis Morgantown, West Virginia Prepared For: West.......................................................................................... 15 Travel Time Value - Understanding Travel Time Costs................................................. 15 Travel Time Value - Understanding Travel Time Costs

  8. ACTUARIAL VALUATION OF BENEFITS PROVIDED UNDER THE

    E-Print Network [OSTI]

    Lotze, Heike K.

    .........................................................................................................................................6 Section 5. ACTUARIAL VALUATION METHODS AND ASSUMPTIONS - PENSION PLAN LIABILITIES.......................................................................................9 Table 6 ­ ACTUARIAL ASSUMPTIONS AND COST METHOD ADOPTED IN CONDUCTING THE VALUATION OF THE DALHOUSIEACTUARIAL VALUATION OF BENEFITS PROVIDED UNDER THE DALHOUSIE UNIVERSITY STAFF PENSION PLAN

  9. Benefits of Thermoelectric Technology for the Automobile

    Broader source: Energy.gov [DOE]

    Discusses improved fuel efficiency and other benefits of automotive application of thermoelectric (power generation and heating/cooling) and the need for production quantities of high-efficiency thermoelectric modules

  10. Wider benefits of Space Science & Exploration

    E-Print Network [OSTI]

    Anand, Mahesh

    academia who build subsystems) · Platforms and platform systems, solar panels etc. · Propulsion ­ electric systems #12;Benefits summary Better solar panels CFRP construction Techniques Electric propulsion New · Drivers: ­ Lowest cost systems ­ Robust supply chain ­ Reliability/Quality ­ Speed of build · Willing

  11. NOAA Committee Memberships, 2004-2008 Eddie N. Bernard, Member, NOAA Tsunami Program Team, 2005-present

    E-Print Network [OSTI]

    . Koehn, Member, NOAA Science, Technology, and Infusion Program Team, 2003-2005 Mark P. Koehn, Member

  12. NSTX Data Usage and Publication Agreement NSTX Research is carried out by a multi-institutional collaborative Research Team. All Research Team

    E-Print Network [OSTI]

    Princeton Plasma Physics Laboratory

    -institutional collaborative Research Team. All Research Team members are offered full access to NSTX data as it is collected and analyzed. This privilege entails responsibility by the Research Team members, both on-site and off for the provided measurements, systems operations, and analyses. The undersigned member of the NSTX Research Team

  13. Quantitative Assessment of Distributed Energy Resource Benefits

    SciTech Connect (OSTI)

    Hadley, S.W.

    2003-05-22T23:59:59.000Z

    Distributed energy resources (DER) offer many benefits, some of which are readily quantified. Other benefits, however, are less easily quantifiable because they may require site-specific information about the DER project or analysis of the electrical system to which the DER is connected. The purpose of this study is to provide analytical insight into several of the more difficult calculations, using the PJM power pool as an example. This power pool contains most of Pennsylvania, New Jersey, Maryland, and Delaware. The techniques used here could be applied elsewhere, and the insights from this work may encourage various stakeholders to more actively pursue DER markets or to reduce obstacles that prevent the full realization of its benefits. This report describes methodologies used to quantify each of the benefits listed in Table ES-1. These methodologies include bulk power pool analyses, regional and national marginal cost evaluations, as well as a more traditional cost-benefit approach for DER owners. The methodologies cannot however determine which stakeholder will receive the benefits; that must be determined by regulators and legislators, and can vary from one location to another.

  14. Blind System Identification KARIM ABED-MERAIM, WANZHI QIU, MEMBER, IEEE, AND YINGBO HUA, SENIOR MEMBER, IEEE

    E-Print Network [OSTI]

    Hua, Yingbo

    Blind System Identification KARIM ABED-MERAIM, WANZHI QIU, MEMBER, IEEE, AND YINGBO HUA, SENIOR MEMBER, IEEE Blind system identification (BSI) is a fundamental signal processing technology aimed applications such as mobile communications, speech reverberation cancellation, and blind image restoration

  15. SHERPA Document SHERPA Document -Institutional Repositories: Staff and Skills Requirements

    E-Print Network [OSTI]

    Southampton, University of

    SHERPA Document SHERPA Document - Institutional Repositories: Staff and Skills Requirements Mary This document began in response to requests received by the core SHERPA team for examples of job descriptions and UKCORR members. This document will be revised annually (July/August) to reflect changing needs

  16. Summer Research Institute Interfacial and Condensed Phase Chemical Physics

    SciTech Connect (OSTI)

    Barlow, Stephan E.

    2004-10-01T23:59:59.000Z

    Pacific Northwest National Laboratory (PNNL) hosted its first annual Summer Research Institute in Interfacial and Condensed Phase Chemical Physics from May through September 2004. During this period, fourteen PNNL scientists hosted sixteen young scientists from eleven different universities. Of the sixteen participants, fourteen were graduate students; one was transitioning to graduate school; and one was a university faculty member.

  17. Australia-Asia-Pacific Institute 2012 Annual Report

    E-Print Network [OSTI]

    : Tomb of Cyrus the Great (ca 550 BC), Pasargadae, Southern Iran (Photo Ali Mozaffari, 2011 ©). #12, as outlined in the following pages of the annual report. While Linda Briskman, Karen Soldatic and Miyume Tanji and Ali Mozaffari, bringing to twenty-eight the institute's total membership for the year. Members

  18. Institute for Materials Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Institute for Material Science Who we are and what we do 2:23 Institute for Materials Science: Alexander V. Balatsky IMS is an interdisciplinary research and educational center...

  19. Institute for ADVANCED STUDY

    E-Print Network [OSTI]

    · PROGRAM IN THEORETICAL BIOLOGY 103 · REPORT OF THE INSTITUTE LIBRARIES 107 INSTITUTE FOR ADVANCED STUDY Study has sustained its founding principle for seventy years. This com- mitment his yielded

  20. Dual mode fuel injector with one piece needle valve member

    DOE Patents [OSTI]

    Lawrence, Keith E. (Peoria, IL); Hinrichsen, Michael H. (Goodfield, IL); Buckman, Colby (Bellville, MI)

    2005-01-18T23:59:59.000Z

    A fuel injector includes a homogenous charge nozzle outlet set and a conventional nozzle outlet set controlled respectively by inner and outer needle value members. The homogenous charged nozzle outlet set is defined by an outer needle value member that is moveably positioned in an injector body, which defines the conventional nozzle outlet set. The inner needle valve member is positioned in the outer needle valve member. The outer needle valve member is a piece component that includes at least one external guide surface, an external value surface and an internal valve seat.

  1. Modeling and Simulation of Power Electronic DRAGAN MAKSIMOVIC , MEMBER, IEEE, ALEKSANDAR M. STANKOVIC , MEMBER, IEEE,

    E-Print Network [OSTI]

    Stankoviæ, Aleksandar

    composed of semiconductor switches such as thyristors, MOSFETs, and diodes, along with passive elements, Mesquite, TX 75149 USA. G. C. Verghese is with the Massachusetts Institute of Technology, Cam- bridge, MA

  2. Mixed mode fuel injector with individually moveable needle valve members

    DOE Patents [OSTI]

    Stewart, Chris; Chockley, Scott A.; Ibrahim, Daniel R.; Lawrence, Keith; Tomaseki, Jay; Azam, Junru H.; Tian, Steven Ye; Shafer, Scott F.

    2004-08-03T23:59:59.000Z

    A fuel injector includes a homogenous charge nozzle outlet set and a conventional nozzle outlet set controlled respectively, by first and second needle valve members. One of the needle valve members moves to an open position while the other needle valve member remains stationary for a homogeneous charge injection event. The former needle valve member stays stationary while the other needle valve member moves to an open position for a conventional injection event. One of the needle valve members is at least partially positioned in the other needle valve member. Thus, the injector can perform homogeneous charge injection events, conventional injection events, or even a mixed mode having both types of injection events in a single engine cycle.

  3. The National Cancer Institute,

    E-Print Network [OSTI]

    The National Cancer Institute, International Cancer Information Center Bldg. 82, Rm 123 Bethesda, MD 20892 The National Cancer Institute (NCI) is part of the Federal Government. NCI coordinates the government's cancer research program. It is the largest of the 17 biomedical research institutes and centers

  4. OIL & GAS INSTITUTE Introduction

    E-Print Network [OSTI]

    Mottram, Nigel

    OIL & GAS INSTITUTE CONTENTS Introduction Asset Integrity Underpinning Capabilities 2 4 4 6 8 9 10 COMPETITIVENESS UNIVERSITY of STRATHCLYDE OIL & GAS INSTITUTE OIL & GAS EXPERTISE AND PARTNERSHIPS #12;1 The launch of the Strathclyde Oil & Gas Institute represents an important step forward for the University

  5. institution-logo Introduction

    E-Print Network [OSTI]

    Langerhans, Brian

    institution-logo Introduction Model Selection Experimental Design Bacteremia Summary Experimental in Validating Models of Infectious Diseases #12;institution-logo Introduction Model Selection Experimental Summary D. M. Bortz Experimental Design in Validating Models of Infectious Diseases #12;institution-logo

  6. 1 Member Raoul Adamchak University of California Davis Agriculture Lecture 2 Member Jeffrey Amthor US DOE, Climate and Environmental Sceiences Div Agriculture Room A

    E-Print Network [OSTI]

    Corr Archer Daniels Midland Co. Energy Lecture 3 Member Matthew Frome Solazyme Energy Room B 4 Member

  7. Food and Resource Economic Institute Report No. 179

    E-Print Network [OSTI]

    Food and Resource Economic Institute Report No. 179 ECONOMIC VALUATION OF THE VISUAL EXTERNALITIES #12;2 FOI Economic valuation of the visual externalities of off-shore wind farms #12;3Economic ............................................................................................... 24 2. Economic Valuation and Cost Benefit Analysis

  8. Summary and Presentations from "Estimating the Benefits and Costs...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Summary and Presentations from "Estimating the Benefits and Costs of Distributed Energy Technologies" Workshop Now Available Summary and Presentations from "Estimating the Benefits...

  9. General Dynamics and Nissan Case Studies Highlight Benefits of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    General Dynamics and Nissan Case Studies Highlight Benefits of Superior Energy Performance General Dynamics and Nissan Case Studies Highlight Benefits of Superior Energy...

  10. The Potential Benefits of Distributed Generation and the Rate...

    Broader source: Energy.gov (indexed) [DOE]

    The Potential Benefits of Distributed Generation and the Rate-Related Issues That May Impede Its Expansion The Potential Benefits of Distributed Generation and the Rate-Related...

  11. The Practice of Cost Benefit Analysis in the Transport Sector...

    Open Energy Info (EERE)

    Practice of Cost Benefit Analysis in the Transport Sector a Mexican Perspective Jump to: navigation, search Tool Summary LAUNCH TOOL Name: The Practice of Cost Benefit Analysis in...

  12. DOE Releases EPRI Report on Benefits of Regional Coordination...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Releases EPRI Report on Benefits of Regional Coordination in Wind Energy Transfers DOE Releases EPRI Report on Benefits of Regional Coordination in Wind Energy Transfers February...

  13. Wind Energy Benefits, Wind Powering America (WPA) (Fact Sheet...

    Broader source: Energy.gov (indexed) [DOE]

    Energy Benefits, Wind Powering America (WPA) (Fact Sheet), Wind And Water Power Program (WWPP) Wind Energy Benefits, Wind Powering America (WPA) (Fact Sheet), Wind And Water Power...

  14. Estimated Benefits of IBWC Rio Grande Flood-Control Projects in the United States

    E-Print Network [OSTI]

    Sturdivant, Allen W.; Lacewell, Ronald D.; Michelsen, Ari M.; Rister, M. Edward; Assadian, Naomi; Eriksson, Marian; Freeman, Roger; Jacobs, Jennifer H.; Madison, W. Tom; McGuckin, James T.; Morrison, Wendy; Robinson, John R.C.; Staats, Chris; Sheng, Zhuping; Srinivasan, R.; Villalobos, Joshua I.

    TR- 275 2004 Estimated Benefits of IBWC Rio Grande Flood-Control Projects in the United States Allen W. Sturdivant Ronald D. Lacewell Ari M. Michelsen M. Edward Rister Naomi Assadian Marian Eriksson Roger Freeman Jennifer H... Flood-Control Projects in the United States Prepared for: INTERNATIONAL BOUNDARY AND WATER COMMISSION, UNITED STATES SECTION EL PASO, TEXAS SEPTEMBER 2004 Prepared by: Texas Agriculture Experiment Station, and Texas Water Resources Institute of the Texas...

  15. Indian Institute of Technology Bombay INDIAN INSTITUTE OF TECHNOLOGY BOMBAY

    E-Print Network [OSTI]

    Narayanan, H.

    Indian Institute of Technology Bombay INDIAN INSTITUTE OF TECHNOLOGY BOMBAY INVITATION Description of work Estimated cost (1) (2) (3) 1 Construction of Institutional/Residential buildings, external development, HVAC, Elevators etc. for Indian Institute of Technology Bombay, at the campus

  16. Austrian refiner benefits from advanced control

    SciTech Connect (OSTI)

    Richard, L.A.; Spencer, M. [Setpoint Inc., Houston, TX (United States); Schuster, R.; Tuppinger, D.M.; Wilmsen, W.F. [OeMV-AG Energy, Schwechat (Austria)

    1995-03-20T23:59:59.000Z

    OeMV-AG Energy implemented advanced process controls on 27 units at its refinery in Schwechat, Austria. A variety of controls were implemented on the butadiene and methyl tertiary butyl ether (MTBE) units in January 1993. After more than 1 year of operation, the butadiene/MTBE project has shown a number of benefits, including reduced energy consumption and increased capacity in both units. The paper discusses the process, advanced control, the simple model predictive controller, control objectives, the butadiene unit, the MTBE unit, and benefits of the advanced controllers.

  17. Chapter 2 Interchanges and Contracts 2.01 Inter-Institutional Agreements

    E-Print Network [OSTI]

    Sheridan, Jennifer

    -Madison department, Dean or Director, Office of Human Resources and appropriate officials at the other UW institution's extramural support fringe benefit rate. iii. "Accounting Code" Line 1. If UW-Madison is the buying institution, the "Accounting Code" line should be used to specify the fund, account, UDDS, and activity code

  18. A Research Agenda for Radiation Oncology: Results of the Radiation Oncology Institute's Comprehensive Research Needs Assessment

    SciTech Connect (OSTI)

    Jagsi, Reshma, E-mail: rjagsi@med.umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)] [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Bekelman, Justin E. [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, PA (United States)] [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, PA (United States); Brawley, Otis W. [Department of Hematology and Oncology, Emory University, and American Cancer Society, Atlanta, Georgia (United States)] [Department of Hematology and Oncology, Emory University, and American Cancer Society, Atlanta, Georgia (United States); Deasy, Joseph O. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Le, Quynh-Thu [Department of Radiation Oncology, Stanford University, Stanford, CA (United States)] [Department of Radiation Oncology, Stanford University, Stanford, CA (United States); Michalski, Jeff M. [Department of Radiation Oncology, Washington University, St. Louis, MO (United States)] [Department of Radiation Oncology, Washington University, St. Louis, MO (United States); Movsas, Benjamin [Department of Radiation Oncology, Henry Ford Health System, Detroit, MI (United States)] [Department of Radiation Oncology, Henry Ford Health System, Detroit, MI (United States); Thomas, Charles R. [Department of Radiation Oncology, Oregon Health and Sciences University, Portland, OR (United States)] [Department of Radiation Oncology, Oregon Health and Sciences University, Portland, OR (United States); Lawton, Colleen A. [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, WI (United States)] [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, WI (United States); Lawrence, Theodore S. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)] [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Hahn, Stephen M. [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, PA (United States)] [Department of Radiation Oncology, University of Pennsylvania, Philadelphia, PA (United States)

    2012-10-01T23:59:59.000Z

    Purpose: To promote the rational use of scarce research funding, scholars have developed methods for the systematic identification and prioritization of health research needs. The Radiation Oncology Institute commissioned an independent, comprehensive assessment of research needs for the advancement of radiation oncology care. Methods and Materials: The research needs assessment used a mixed-method, qualitative and quantitative social scientific approach, including structured interviews with diverse stakeholders, focus groups, surveys of American Society for Radiation Oncology (ASTRO) members, and a prioritization exercise using a modified Delphi technique. Results: Six co-equal priorities were identified: (1) Identify and develop communication strategies to help patients and others better understand radiation therapy; (2) Establish a set of quality indicators for major radiation oncology procedures and evaluate their use in radiation oncology delivery; (3) Identify best practices for the management of radiation toxicity and issues in cancer survivorship; (4) Conduct comparative effectiveness studies related to radiation therapy that consider clinical benefit, toxicity (including quality of life), and other outcomes; (5) Assess the value of radiation therapy; and (6) Develop a radiation oncology registry. Conclusions: To our knowledge, this prioritization exercise is the only comprehensive and methodologically rigorous assessment of research needs in the field of radiation oncology. Broad dissemination of these findings is critical to maximally leverage the impact of this work, particularly because grant funding decisions are often made by committees on which highly specialized disciplines such as radiation oncology are not well represented.

  19. Current Research at the University of Chicago Enrico Fermi Institute and James Franck Institute

    ScienceCinema (OSTI)

    Simon Swordy

    2010-01-08T23:59:59.000Z

    These talks will give an overview of physics research at the University of Chicago centered in two research institutes. The Enrico Fermi Institute pursues research in some core areas of the physical sciences. These include cosmology, particle physics, theoretical physics, particle astrophysics, and cosmochemistry. The EFI talk will focus on some examples of these activities which together will provide a broad overview of EFI science. Research at the James Franck Institute centers on the intersection between physics, chemistry and materials science, with the aim to unravel the complex connections between structure and dynamics in condensed matter systems. The JFI is also home to the Chicago Materials Research Science and Engineering Center. The JFI talk will provide highlights of current projects by JFI members.

  20. Testing and evaluation of grout repaired tubular members 

    E-Print Network [OSTI]

    Nunn, John Mansfield

    1992-01-01T23:59:59.000Z

    of Failed Weld Seam page 64 65 66 69 73 74 80 82 31 Ideahzed Tubular Dented Member for the Taby, Zhou, and the Parsanejad Methods. . . . . . . . . . . . . . , . 92 32 Dent Geometry for the Elhnas Method 96 33 Experimental Ultimate Capamty vs P... commonly used to repiur damaged tubular members. These include 1 ) welding a sleeve around the outside of the member in the location of the damage, 2 ) applying an externally grouted clamp, and 3 ) applying internal grout Ideally, the repair method...

  1. EMPLOYEE BENEFIT SERVICE Signature Service Oil Change

    E-Print Network [OSTI]

    New Mexico, University of

    UNM Staff EMPLOYEE BENEFIT SERVICE Jiffy Lube Signature Service Oil Change Fast - No Appointment We change your oil with up to 5 quarts of major brand motor oil We install a new oil fi We visually inspect. ASE training programs · Jiffy Lube uses top quality products that meet or exceed vehicle warranty

  2. Research Summary Health Benefits of Street Trees

    E-Print Network [OSTI]

    pollution, noise levels, wind speeds, summer temperatures, and ultraviolet (UV) radiation through shading benefits from reductions in noise, UV radiation, and wind speeds in winter is especially limited at present any measurable health outcomes such as avoided excess morbidity and mortality, increases in quality

  3. Medical research: assessing the benefits to society

    E-Print Network [OSTI]

    Rambaut, Andrew

    independent Academy of Medical Sciences promotes advances in medical science and campaigns to ensure from medical advances: `Exceptional Returns' 26 3.6 Discussion and conclusions 27 4 Bringing togetherMay 2006 Medical research: assessing the benefits to society A report by the UK Evaluation Forum

  4. Quality health plans & benefits Healthier living

    E-Print Network [OSTI]

    to the Affordable Care Act, also known as the health care reform law, will comply with requirements for WomenQuality health plans & benefits Healthier living Financial well-being Intelligent solutions 05's Preventive Health Services. This means that for women with reproductive capacity, certain women

  5. Benefits of multisensory learning Ladan Shams1

    E-Print Network [OSTI]

    Shams, Ladan B.

    of learning? Acquiring this skill can involve many types of learning and here we focus on aspectsBenefits of multisensory learning Ladan Shams1 and Aaron R. Seitz2 1 Department of Psychology, Riverside, CA 92521, USA Studies of learning, and in particular perceptual learning, have focused

  6. Renewable Portfolio Standards: Costs and Benefits (Poster)

    SciTech Connect (OSTI)

    Bird, L.; Heeter, J.; Barbose, G.; Weaver, S.; Flores, F.; Kuskova-Burns, K.; Wiser, R.

    2014-10-01T23:59:59.000Z

    This report summarizes state-level RPS costs to date, and considers how those costs may evolve going forward given scheduled increases in RPS targets and cost containment mechanisms. The report also summarizes RPS benefits estimates, based on published studies for individual states and discusses key methodological considerations.

  7. Zero Waste Program 2011 Recycling Benefits

    E-Print Network [OSTI]

    Delgado, Mauricio

    Rutgers Zero Waste Program 2011 Recycling Benefits Through WM's Recycling Program, our company saved energy and reduced Greenhouse Gases through recycling. Recycling uses less energy, preserves from recycled material than from virgin, raw material. RESOURCE SAVINGS 4203 Metric Tons (MTCO2E

  8. Part-Time Employee Benefits Packet

    E-Print Network [OSTI]

    Dasgupta, Dipankar

    plans. TN Consolidated Retirement System is a defined benefit plan. Higher education employees the investment accounts offered under the company's annuity contract, subject to restrictions of the contract-supported, non- contributory retirement system. The University pays all retirement contributions; you pay nothing

  9. University of Maryland, College Park Benefits Orientation

    E-Print Network [OSTI]

    Shapiro, Benjamin

    Mental Health and Substance Abuse Vision Care Personal Accident and Dismemberment Flexible Spending 1. #12;State Sponsored Benefits Health Insurance/Vision Care Prescription Drug Card Dental Plans Accounts Long Term Care Term Life Insurance #12;Health Insurance Plans PPO Preferred Provider

  10. results and benefits... The Bittern Line Carbon

    E-Print Network [OSTI]

    Everest, Graham R

    results and benefits... The Bittern Line Carbon Neutral Stations Transport Regeneration Ltd. June 2008 c a s e s t u d yCRed carbon reduction Project Summary Our client, Transport Regeneration Ltd., aims to make nine stations on the Bittern Line between Norwich and Sheringham carbon neutral

  11. Contractor Employee Pension and Medical Benefits Policy

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2006-06-19T23:59:59.000Z

    To ensure that reimbursement of costs incurred by Department of Energy (DOE) contractors' pension and medical benefits are reasonable in accordance with applicable laws, regulations and contract requirements and reflect prudent business practices. This directive has been suspended as of June 19, 2006, for 1 year. For more information, see DOE N 251.66.

  12. ABSL Space Products 2011 BENEFITS / ECONOMIC PROSPECTS

    E-Print Network [OSTI]

    Anand, Mahesh

    © ABSL Space Products 2011 BENEFITS / ECONOMIC PROSPECTS: Future exploration ­ Roving ­ Rendezvous Space Products 2011 ABSL Space Products for Growth: HERITAGE & RELEVANCE ABSL flew the first Lithium-Ion battery in space with 70 launched to date Now 100 people working on space batteries, including US office

  13. This Document Contains: Indefinite Layoff Benefits Checklist

    E-Print Network [OSTI]

    Jun, Suckjoon

    Company This Document Contains: · Indefinite Layoff Benefits Checklist · HR Vice Chancellor may be eligible for rehire privileges. See page 4. This checklist does not apply to Managers, Senior Professionals, or Senior Managers, for whom there are no layoff provisions. It also does not apply to career

  14. adult family members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Ecology Websites Summary: APPLICATION PACKAGE for Family Members 1 ACICISStudy Indonesia These guidelines contain information ONLY: ARRIVAL DATES ARE INFLEXIBLE. YOU MAY NOT...

  15. acylase family members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Ecology Websites Summary: APPLICATION PACKAGE for Family Members 1 ACICISStudy Indonesia These guidelines contain information ONLY: ARRIVAL DATES ARE INFLEXIBLE. YOU MAY NOT...

  16. Approved Members of the Indian Country Energy And Infrastructure...

    Broader source: Energy.gov (indexed) [DOE]

    INDIAN COUNTRY ENERGY AND INFRASTRUCTURE WORKING GROUP ICEIWG APPROVED MEMBERS Blue Lake Rancheria Jana Ganion, BLR Energy Director Confederated Tribes of the Warm Springs...

  17. White House Meeting Honors New Superior Energy Performance Members...

    Broader source: Energy.gov (indexed) [DOE]

    New Superior Energy Performance (SEP) members 3M Company, Cummins Inc., General Dynamics OTS, Nissan, Schneider Electric, and Volvo Group North America from industry, and the...

  18. auxiliary unit members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    auxiliary microphones. This paper presents two approaches to compensate 183 Joseph M. Juran Team Members Mathematics Websites Summary: old his father left Romania and came to...

  19. California Member Connects Solar Adoption With Upgrades | Department...

    Broader source: Energy.gov (indexed) [DOE]

    Residential Network member Center for Sustainable Energy (CSE) in California are helping solar companies realize that partnering with local energy efficiency programs can help...

  20. GreenTouch Consortium Passes 50-Member Milestone, Adds Seven...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    will define them. The new members are: CommScopeAndrew - United States Energy Sciences Network (ESnet)Lawrence Berkeley National Laboratory - United States Korea Advanced...

  1. Petrogenesis of Valle Grande Member Rhyolites, Valles Caldera...

    Open Energy Info (EERE)

    of Valle Grande Member Rhyolites, Valles Caldera, New Mexico- Implications for Evolution of the Jemez Mountains Magmatic System Jump to: navigation, search OpenEI Reference...

  2. Will Workers Benefit from This Economic Recovery?

    E-Print Network [OSTI]

    Kochan, Thomas Anton

    Every 2 years, staff at the Economic Policy Institute publishes a labor market and employment sourcebook. The State of Working America 2008-2009 is an especially important and valuable contribution. It documents how poorly ...

  3. Edison Electric Institute Update

    Broader source: Energy.gov [DOE]

    Presentation—given at the Fall 2011 Federal Utility Partnership Working Group (FUPWG) meeting—discusses the Edison Electric Institute (EEI) and the current electricity landscape.

  4. UNCLASSIFIED Institute for Materials ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Institute for Materials Science Lecture Series Dr Roger D Doherty M.A. D. Phil., Fellow TMS Emeritus Professor of Materials Science and Engineering, Drexel University,...

  5. INSTITUTE OF COMPUTER SCIENCE

    E-Print Network [OSTI]

    Institute of Computer Science, Academy of Sciences of the Czech Republic. Pod vodÆrenskou v 2, 182 07 Prague 8, Czech Republic. phone: (+420)266052083 ...

  6. IACM Institute Overview

    Energy Savers [EERE]

    Institute Overview Craig Blue, Oak Ridge National Laboratory 2015 AMO Peer Review - May 28, 2015 This presentation does not contain any proprietary, confidential, or otherwise...

  7. Analysis of Benefits of an Energy Imbalance Market in the NWPP

    SciTech Connect (OSTI)

    Samaan, Nader A.; Bayless, Rich; Symonds, Mark; Nguyen, Tony B.; Jin, Chunlian; Wu, Di; Diao, Ruisheng; Makarov, Yuri V.; Kannberg, Landis D.; Guo, Tao; Dennison-Leonard , Sarah; Goodenough, Mike; Schellberg, Ron; Conger, Sid; Harris, Kevin; Rarity, Matt; Wallace, Steven; Austin, Jamie; Noteboom, Rod; Van Blaricom , Tim; McRunnel, Kim; Apperson, John; Empey, Marshall; Etingov, Pavel V.; Warady, Debra; Brush, Ray; Newkirk, Joshua; Williams, Peter; Landauer, Marv; Owen, Hugh; Morter, Wayne; Haraguchi, Keli; Portouw, Jim; Downey, kathryn; Sorey, Steve; Williams, Stan; Gossa, Teyent; Kalich, Clint; Damiano, Patrick; Macarthur, Clay; Martin, Tom; Hoerner, Joe; Knudsen, Steve; Johnson, Anders; Link, Rick; Holcomb, Dennis

    2013-10-18T23:59:59.000Z

    The Northwest Power Pool (NWPP) Market Assessment Committee (MC) Initiative, which was officially launched on March 19, 2012, set out to explore a range of alternatives that could help the Balancing Authorities and scheduling utilities in the NWPP area address growing operational and commercial challenges affecting the regional power system. The MC formed an Analytical Team with technical representatives from each of the member Balancing Areas in the NWPP and with staff of Pacific Northwest National Laboratory (PNNL). This Analytical Team was instructed to conduct extensive studies of intra-hour operation of the NWPP system in the year 2020 and of the NWPP region with 14,671 MW of wind penetration. The effort utilized a sub-hourly production cost model (the PLEXOS® computer model) that inputs data from the Western Electricity Coordinating Council (WECC)-wide Production Cost Model (PCM) to evaluate potential production cost savings. The Analytical Team was given two general options to evaluate: •Energy Imbalance Market (EIM): establishment of an automated, organized NWPP area market for economically supplying energy imbalance within the hour. •Enhanced Market-Operational Tools (EMT) that might augment or replace an EIM. The Analytical The Analytical Team built on the WECC-wide PCM data from prior work done in the WECC and carried forward the evolution of the original WECC Transmission Expansion Planning Policy Committee (TEPPC) 2020 PC0 data base. A large number of modifications and improvements were made to this case and the data were subjected to extensive review by the team members to improve the model representation of the Northwest (NW). MC meetings that were open to the public were held for interested parties to review and provide input to the study. Results for the test, base, and sensitivity case studies performed by the MC Initiative Analytical Team indicate that there are a wide range of benefits that could be obtained from the operation of an EIM in the NWPP depending on what assumptions are made. The instructions from the MC were to determine a "minimum high confidence" range of potential benefits. The results for the Base Case indicate that the EIM benefits ranged from approximately $40 million to $70 million in annual savings from the operation of an EIM in the NWPP footprint. A number of additional relevant sensitivity cases were performed, including low and high water conditions, low and high natural gas prices, and various flex reserve requirements, resource operations, and amounts of resource capability held back during the preschedule period. Along with the results for the Base Case, the results for these studies yielded EIM benefits that clustered within the range of $70 to $80 million dollars per year with potential benefits ranging from approximately $125 million to as little as $17 million per year. Because the design and operation of an EIM could enable participating Balancing Authorities (BAs) to collectively lower the quantity of resources they must carry to meet within-hour balancing needs, a sensitivity case was also performed to analyze the impact that such reductions might have on the benefits from an EIM. The results for this sensitivity case indicate that such reductions could increase the benefits from the operation of an EIM in the NWPP into the range of approximately $130 million to $160 million per year. Also, a sensitivity case for a WECC-wide EIM was performed with the results indicating that the potential benefits to the NWPP could increase into the range of $197 million to $233 million per year. While there may be potential reliability benefits from the coordinated dispatch process underlying the operation of an EIM, reliability benefits from an EIM were out of the scope of this study. The EIM benefit analyses that were performed by the Analytical Team are provided in this report.

  8. American Institute of Aeronautics and Astronautics Efficiency Benefits Using the Terminal Area Precision

    E-Print Network [OSTI]

    of Operations (ConOps).2 The NextGen goals include the desire to expand airport capacity and protect

  9. The institutional needs of joint implementation projects

    SciTech Connect (OSTI)

    Watt, E.; Sathaye, J. [Lawrence Berkeley Lab., CA (United States); Buen, O. de; Masera, O. [National Univ. of Mexico, Mexico City (Mexico); Gelil, I.A. [Organization of Energy Conservation and Planning, Cairo (Egypt); Ravindranath, N.H. [Indian Inst. of Science, Bangalore (India); Zhou, D.; Li, J. [Energy Research Inst., Beijing (China); Intarapravich, D. [Thailand Environmental Inst., Bangkok (Thailand)

    1995-10-21T23:59:59.000Z

    In this paper, the authors discuss options for developing institutions for joint implementation (JI) projects. They focus on the tasks which are unique to JI projects or require additional institutional needs--accepting the project by the host and investor countries and assessing the project`s greenhouse gas (GHG) emission reduction or sequestration--and they suggest the types of institutions that would enhance their performance. The evaluation is based on four sets of governmental and international criteria for JI projects, the experiences of ten pilot JI projects, and the perspectives of seven collaborating authors from China, Egypt, India, Mexico, and Thailand, who interviewed relevant government and non-government staff involved in JI issue assessment in their countries. After examining the roles for potential JI institutions, they present early findings arguing for a decentralized national JI structure, which includes: (1) national governmental panels providing host country acceptance of proposed JI projects; (2) project parties providing the assessment data on the GHG reduction or sequestration for the projects; (3) technical experts calculating these GHG flows; (4) certified verification teams checking the GHG calculations; and (5) members of an international JI Secretariat training and certifying the assessors, as well as resolving challenges to the verifications. 86 refs.

  10. Colorado Forestry Advisory Board Members: April 6, 2005

    E-Print Network [OSTI]

    #12;Colorado Forestry Advisory Board Members: April 6, 2005 The 2004 Report on the Health types that characterize Colora- do's unique landscapes. As members of the Colorado Forestry Advisory will motivate and inform your involvement. Sincerely, Nancy M. Fishering Chairperson, Colorado Forestry Advisory

  11. The 2014 SPECTRA Program Employer, Coach, Mentor or Community Member

    E-Print Network [OSTI]

    Kasman, Alex

    1 The 2014 SPECTRA Program Employer, Coach, Mentor or Community Member Recommendation Form #2 To the applicant Please complete the top section of this form and submit it to your employer, coach, mentor: _________________________________________________________________ Name of Employer, Coach, Mentor or Community Member completing this form

  12. UC Davis Personnel Policies for Staff Members Introduction

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    Resources & Risk Management. Note 6--Distribution. Personnel Policies for Staff Members is a public documentUC Davis Personnel Policies for Staff Members Introduction Date: 6/3/02 Supersedes: New Responsible Department: Human Resources Source Document: UC Introduction 1 of 1 Note 1--Employment by Statute. A public

  13. INSTITUTES AT NORTHWESTERN

    E-Print Network [OSTI]

    Engman, David M.

    revolutionized how we deliver modern medicine to patients. Treatments for breast cancer, AIDS, leukemia for the treatment of cancer." Leonidas C. Platanias, MD, PhD, Interim Director of the Lurie Cancer Center and JesseTHE CANCER INSTITUTES AT NORTHWESTERN MEDICINE DEPARTMENT OF CANCER BIOLOGY THE INSTITUTES

  14. University Materials Institute INTRODUCTION

    E-Print Network [OSTI]

    Escolano, Francisco

    University Materials Institute INTRODUCTION The University Materials Science Institute of Alicante the needed multidisciplinary character of the materials area. It is important to highlight the fact participate in the Materials Science PhD program which is imparted at the UA. Scientific research

  15. IntroducingBenefits+ a smarter way to pay for your benefits

    E-Print Network [OSTI]

    Müller, Jens-Dominik

    : · you earn less than £6,500 a year, the Benefits+ Pay Protection Limit (PPL) or · your earnings fall checking your earnings against the PPL and NMW. More information is given on page 16. The University

  16. Comparative costs and benefits of hydrogen vehicles

    SciTech Connect (OSTI)

    Berry, G.D. [Lawrence Livermore National Lab., CA (United States)

    1996-10-01T23:59:59.000Z

    The costs and benefits of hydrogen as a vehicle fuel are compared to gasoline, natural gas, and battery-powered vehicles. Costs, energy, efficiency, and tail-pipe and full fuel cycle emissions of air pollutants and greenhouse gases were estimated for hydrogen from a broad range of delivery pathways and scales: from individual vehicle refueling systems to large stations refueling 300 cars/day. Hydrogen production from natural gas, methanol, and ammonia, as well as water electrolysis based on alkaline or polymer electrolytes and steam electrolysis using solid oxide electrolytes are considered. These estimates were compared to estimates for competing fuels and vehicles, and used to construct oil use, air pollutant, and greenhouse gas emission scenarios for the U.S. passenger car fleet from 2005-2050. Fuel costs need not be an overriding concern in evaluating the suitability of hydrogen as a fuel for passenger vehicles. The combined emissions and oil import reduction benefits of hydrogen cars are estimated to be significant, valued at up to {approximately}$400/yr for each hydrogen car when primarily clean energy sources are used for hydrogen production. These benefits alone, however, become tenuous as the basis supporting a compelling rationale for hydrogen fueled vehicles, if efficient, advanced fossil-fuel hybrid electric vehicles (HEV`s) can achieve actual on-road emissions at or below ULEV standards in the 2005-2015 timeframe. It appears a robust rationale for hydrogen fuel and vehicles will need to also consider unique, strategic, and long-range benefits of hydrogen vehicles which can be achieved through the use of production, storage, delivery, and utilization methods for hydrogen which are unique among fuels: efficient use of intermittent renewable energy sources, (e,g, wind, solar), small-scale feasibility, fuel production at or near the point of use, electrolytic production, diverse storage technologies, and electrochemical conversion to electricity.

  17. Alabama Institute for Deaf and Blind Biodiesel Project Green

    SciTech Connect (OSTI)

    Edmiston, Jessica L

    2012-09-28T23:59:59.000Z

    Through extensive collaboration, Alabama Institute for Deaf and Blind (AIDB) is Alabama's first educational entity to initiate a biodiesel public education, student training and production program, Project Green. With state and national replication potential, Project Green benefits local businesses and city infrastructures within a 120-mile radius; provides alternative education to Alabama school systems and to schools for the deaf and blind in Appalachian States; trains students with sensory and/or multiple disabilities in the acquisition and production of biodiesel; and educates the external public on alternative fuels benefits.

  18. National Institutes of Health National Institute of Mental Health

    E-Print Network [OSTI]

    Baker, Chris I.

    National Institutes of Health National Institute of Mental Health Department of Health and HumanNational Institute of Mental Health Division of Intramural Research Programs http://intramural.nimh.nih.gov/ [NIMH of Fellowship Training] National Institutes of Health National Institute of Mental Health Department of Health

  19. Survey of Reactive Power Planning Methods Wenjuan Zhang, Student Member, IEEE, Leon M. Tolbert, Senior Member, IEEE

    E-Print Network [OSTI]

    Tolbert, Leon M.

    Survey of Reactive Power Planning Methods Wenjuan Zhang, Student Member, IEEE, Leon M. Tolbert, Senior Member, IEEE Abstract Reactive power planning (RPP) involves optimal allocation and determination to solve the RPP problem. Index Terms -- reactive power planning, reactive power optimization, optimal

  20. Clinical Education Award This award will be given to a member or members of the graduating class who

    E-Print Network [OSTI]

    Chisholm, Rex L.

    Clinical Education Award This award will be given to a member or members of the graduating class who demonstrate(s) superior clinical abilities. More than one student may qualify for this award this award must show excellence in clinical education based on all of the following accomplishments

  1. Energy-Aware MPEG-4 FGS Streaming Kihwan Choi, Member IEEE, Kwanho Kim, Member IEEE, and Massoud Pedram, Fellow IEEE

    E-Print Network [OSTI]

    Pedram, Massoud

    Energy-Aware MPEG-4 FGS Streaming Kihwan Choi, Member IEEE, Kwanho Kim, Member IEEE, and Massoud Pedram, Fellow IEEE Abstract -- In this paper, we propose an energy-aware MPEG-4 FGS video streaming 20% communication energy reduction at the client by making the MPEG-4 FGS streamer energy-aware

  2. On-Road Vehicle Detection: A Review Zehang Sun, Member, IEEE, George Bebis, Member, IEEE, and Ronald Miller

    E-Print Network [OSTI]

    Bebis, George

    On-Road Vehicle Detection: A Review Zehang Sun, Member, IEEE, George Bebis, Member, IEEE about driving environments, and possible collision with other vehicles has attracted a lot of attention lately. In these systems, robust and reliable vehicle detection is a critical step. This paper presents

  3. Potential Benefits of Commissioning California Homes

    SciTech Connect (OSTI)

    Matson, Nance; Wray, Craig; Walker, Iain; Sherman, Max

    2002-01-01T23:59:59.000Z

    Commissioning California's houses can result in better performing systems and houses. In turn, this will result in more efficient use of energy, carbon emission reductions, and improved occupant comfort. In particular, commissioning houses can save a significant amount of HVAC-related energy (15 to 30% in existing houses, 10 to 20% in new conventional houses, and up to 8% in advanced energy efficiency houses). The process that we considered includes corrective measures that could be implemented together during construction or during a single site visit (e.g., air tightening, duct sealing, and refrigerant and air handler airflow corrections in a new or existing house). Taking advantage of additional, more complex opportunities (e.g., installing new windows in an existing house, replacing the heating and air conditioning system in a new or existing house) can result in additional HVAC-related energy savings (60 to 75% in existing houses, and 50 to 60% in new conventional houses). The commissioning-related system and house performance improvements and energy savings translate to additional benefits throughout California and beyond. By applying commissioning principles to their work, the building community (builders and contractors) benefit from reduced callbacks and lower warranty costs. HERS raters and inspectors will have access to an expanded market sector. As the commissioning process rectifies construction defects and code problems, building code officials benefit from better compliance with codes. The utilities benefit from reduced peak demand, which can translate into lower energy acquisition costs. As houses perform closer to expectations, governmental bodies (e.g., the California Energy Commission and the Air Resources Board) benefit from greater assurance that actual energy consumption and carbon emissions are closer to the levels mandated in codes and standards, resulting in better achievement of state energy conservation and environmental goals. California residents' quality of life is improved through better indoor environmental comfort and lower energy bills. Lower energy bills free up money for residents to spend on other needs or goals, such as additional education and health and welfare. With an expansion of existing industries and the development of new commissioning-related industries, related jobs and tax revenues will increase, further increasing the quality of life for California.

  4. Method for brazing together planar and nonplanar metal members

    DOE Patents [OSTI]

    Hammersand, Fred G. (East Petersburg, PA); Witkowski, Anthony J. (Lancaster, PA)

    1985-01-01T23:59:59.000Z

    The invention relates to a method and apparatus for brazing two metal members together, at least one of which is nonplanar, in a brazing furnace using a substantially pure brazing material. The method comprises the steps of utilizing a brazing fixture to hold the two metal members in tangential relation to one another along a portion of each member so that a cavity is formed adjacent to the contacting portions. A braze material is then positioned within the cavity. The braze fixture, the metal members, and the braze material are then placed in a brazing furnace. A heat shield is then placed over the braze fixture, the metal members, and the braze material to shield the braze material from direct furnace radiation. The furnace temperature is linearly increased at a rate of about 180.degree. C. per hour until a temperature of 350.degree. C. is achieved. Heat is transferred by conduction from the metal members to the braze material to cause the braze material to melt. Some material from the metal members slowly diffuses into the braze material forming a braze joint. The furnace is rapidly cooled to room temperature using nitrogen gas. The brazed assemblies made according to this method are superior to assemblies formed by heliarc welding.

  5. CALIFORNIA ENERGY Homeowners Benefits To Ducts In

    E-Print Network [OSTI]

    , it is not individual building components, equipment, or materials that optimize energy efficiency. Instead, energy efficiency is improved through the integrated design, construction, and operation of building systems. Roger Hedrick, Lead Author Park Ridge, Illinois Managed By: New Buildings Institute Cathy Higgins

  6. Means to flexibly attach lens frames to temple members

    DOE Patents [OSTI]

    Smith, Harry D. (Richland, WA)

    1995-01-01T23:59:59.000Z

    The invention is a band hinge for flexibly connecting the temple member to the lens frame thereby preventing damage from inadvertent pressure or cyclic wear. A distinguishing feature of the invention is the use of a band hinge that holds together the temple member and the lens frame without the use of a pin or screw hinging mechanism. The invention allows for a high degree of freedom of movement for the temple member with respect to the lens frame which will prevent most forms of damages to the glasses from these types of events.

  7. Institute of Nuclear Power Operations annual report, 1993

    SciTech Connect (OSTI)

    NONE

    1993-12-31T23:59:59.000Z

    This annual report highlights the activities of the Institute of Nuclear Power Operations. The topics of the report include the president and chairmen`s joint message, overview of programs serving as the foundation for most of its activities, performance indicators for the US nuclear utility industry, and INPO`s 1993 financial reports and rosters. INPO has four technical cornerstone programs that serve as the foundation for most of its activities. (1) Evaluations of nuclear power plants operated by member utilities are conducted on a regularly scheduled basis. (2) INPO supports its member utilities in their work to achieve and maintain accreditation of training programs. (3) Events analysis programs identify and communicate lessons learned from plant events so utilities can take action to prevent similar events at their plants. (4) INPO helps members improve in nuclear operations areas through assistance programs and other activities that continually evolve to meet the changing needs of the nuclear industry.

  8. Use of Institutional Controls

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-04-09T23:59:59.000Z

    The Policy ensures that the Department of Energy will use institutional controls in the management of resources, facilities and properties under its control, and in implementing its programmatic responsibilities. Certified 1-28-11.

  9. Critical Materials Institute

    SciTech Connect (OSTI)

    Alex King

    2013-01-09T23:59:59.000Z

    Ames Laboratory Director Alex King talks about the goals of the Critical Materials Institute in diversifying the supply of critical materials, developing substitute materials, developing tools and techniques for recycling critical materials, and forecasting materials needs to avoid future shortages.

  10. Critical Materials Institute

    ScienceCinema (OSTI)

    Alex King

    2013-06-05T23:59:59.000Z

    Ames Laboratory Director Alex King talks about the goals of the Critical Materials Institute in diversifying the supply of critical materials, developing substitute materials, developing tools and techniques for recycling critical materials, and forecasting materials needs to avoid future shortages.

  11. Junggon Kim Robotics Institute

    E-Print Network [OSTI]

    Treuille, Adrien

    planning algorithm for industrial robots. - Contributed to reducing noise and vibration of industrial robots. Research Assistant (Part-time internship) 3/1998 ­ 2/2000 Korea Institute of Science

  12. New England Fuel Institute

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Testimony of Michael C. Trunzo, President and CEO of the New England Fuel Institute Before the U.S. Department of Energy and the Quadrennial Energy Review Task Force Public Hearing...

  13. Petroleum Institute Scholarly Publications

    E-Print Network [OSTI]

    2008 #12;- 5 - Scholarly Publications 2007 | The Petroleum Institute Patents Chemical Engineering Editor: C. Brandt Program Editors: K. Nandakumar Chemical Engineering A. A. Shehada Electrical Engineering A. Goharzadeh Mechanical Engineering F. Akgun Engineering S. Morad Petroleum Geosciences H. L. Lim

  14. Benefits Forms and Information | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy:WhetherNovember 13, 2009OakDepartment ofThe employment and benefitsAs a

  15. Benefits of Hydropower | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy:WhetherNovember 13, 2009OakDepartment ofThe employment and benefitsAs

  16. Post-Closure Benefits | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible forPortsmouth/Paducah Project Office Press ReleasesPost-Closure Benefits Post-Closure

  17. Sandia National Laboratories: Careers: Benefits and Perks

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItemResearch > TheNuclear PressLaboratorySoftware100 ResilientHistoryBenefits and

  18. Alternative Fuels Data Center: Biodiesel Benefits

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWP RelatedCellulase C.Tier 2 andIndependenceFuelsas aBenefits to

  19. Alternative Fuels Data Center: Natural Gas Benefits

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWP RelatedCellulaseFuels and VehiclesMethanolBenefits to someone

  20. Alternative Fuels Data Center: Propane Benefits

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWP RelatedCellulaseFuels andConversionsAssumptionsBenefits to

  1. Lawrence D. Brown Date of Birth: 12/16/40 B.S. 1961 California Institute of Technology

    E-Print Network [OSTI]

    Brown, Lawrence D.

    .M.S.) and the American Statistical Association (A.S.A) Wald Lecturer, Institute of Mathematical Statistics, August 1985 of Science (Honorary), Purdue University, 1993 Recipient, Wilks Award of the American Statistical Association Member Institute of Mathematical Statistics, American Statistical Association and International

  2. Benefits of battery-uItracapacitor hybrid energy storage systems

    E-Print Network [OSTI]

    Smith, Ian C., S.M. (Ian Charles). Massachusetts Institute of Technology

    2012-01-01T23:59:59.000Z

    This thesis explores the benefits of battery and battery-ultracapacitor hybrid energy storage systems (ESSs) in pulsed-load applications. It investigates and quantifies the benefits of the hybrid ESS over its battery-only ...

  3. An evaluation of Cydcoed: the social and economic benefits of

    E-Print Network [OSTI]

    An evaluation of Cydcoed: the social and economic benefits of using trees and woodlands & Economic Research Group Environmental & Human Sciences Division The Research Agency of the Forestry social, economic and environmental benefits and; individuals able to play a positive role

  4. Technical benefits and cultural barriers of networked Autonomous Undersea Vehicles

    E-Print Network [OSTI]

    Wineman, Patrick L

    2013-01-01T23:59:59.000Z

    The research presented in this thesis examines the technical benefits to using a collaborative network of Autonomous Undersea Vehicles (AUVs) in place of individual vehicles. Benefits could be achieved in the areas of ...

  5. Indirect Benefits (Increased Roof Life and HVAC Savings) from...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Indirect Benefits (Increased Roof Life and HVAC Savings) from a Solar PV System at the San Jos Convention Center Indirect Benefits (Increased Roof Life and HVAC Savings) from a...

  6. The contracting benefits of accounting conservatism to lenders and borrowers

    E-Print Network [OSTI]

    Zhang, Jieying, Ph. D. Massachusetts Institute of Technology

    2005-01-01T23:59:59.000Z

    In this paper, I examine the ex post and ex ante benefits of conservatism to lenders and borrowers in the debt contracting process. First, I argue that conservatism benefits lenders ex post through a timely signal of default ...

  7. Alaska Energy in Action: Akiak Reaps Benefits of PCE Technical...

    Energy Savers [EERE]

    in Action: Akiak Reaps Benefits of PCE Technical Assistance Alaska Energy in Action: Akiak Reaps Benefits of PCE Technical Assistance March 11, 2015 - 1:16pm Addthis Ruth Gilila...

  8. Energy information systems (EIS): Technology costs, benefit, and best

    E-Print Network [OSTI]

    LBNL-6476E 1 Energy information systems (EIS): Technology costs, benefit, and best practice uses, Lin, G, Piette, MA. Energy information systems (EIS): Technology costs, benefits, and best practice

  9. Benefits of Site-wide NEPA National Environmental Policy Act...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Benefits of Site-wide NEPA National Environmental Policy Act Review (1994) Benefits of Site-wide NEPA National Environmental Policy Act Review (1994) The purpose of this guidance...

  10. Colorado Forestry Advisory Board Members: Don Ament Tom Stone

    E-Print Network [OSTI]

    #12;Colorado Forestry Advisory Board Members: Don Ament Tom Stone Commissioner of Agriculture As Chairperson of Colorado's newly created Forestry Advisory Board, I would like to thank you for taking the time

  11. Team 2 Inspection Josh Goss Team chair member

    E-Print Network [OSTI]

    Team 2 Inspection Josh Goss ­ Team chair member Capasso, Golovchenko, and Stubbs Lab We were very intensity of these light sources while configured in a typical experimental setup? Many thanks! Team 2 #12;

  12. Agricultural Engineering and Socio-Economics Division Field Contents Member

    E-Print Network [OSTI]

    Banbara, Mutsunori

    Agricultural Engineering and Socio-Economics Division Field Contents Member Environmental, H. Professor TADA,A.Associate Professor Geotechnical and Environmental Engineering for Agricultural for agricultural land and rural areas including bountiful beautiful nature; Geotechnical and environmental

  13. DOE appoints four new members to advisory board

    Broader source: Energy.gov [DOE]

    DOE has appointed four new members to its Environmental Management advisory board in Oak Ridge. Leon Baker, Richard Burroughs, Terri Likens and Ed Trujillo were introduced during the Oak Ridge Site Specific Advisory Board’s February meeting.

  14. Actuator assembly including a single axis of rotation locking member

    DOE Patents [OSTI]

    Quitmeyer, James N.; Benson, Dwayne M.; Geck, Kellan P.

    2009-12-08T23:59:59.000Z

    An actuator assembly including an actuator housing assembly and a single axis of rotation locking member fixedly attached to a portion of the actuator housing assembly and an external mounting structure. The single axis of rotation locking member restricting rotational movement of the actuator housing assembly about at least one axis. The single axis of rotation locking member is coupled at a first end to the actuator housing assembly about a Y axis and at a 90.degree. angle to an X and Z axis providing rotation of the actuator housing assembly about the Y axis. The single axis of rotation locking member is coupled at a second end to a mounting structure, and more particularly a mounting pin, about an X axis and at a 90.degree. angle to a Y and Z axis providing rotation of the actuator housing assembly about the X axis. The actuator assembly is thereby restricted from rotation about the Z axis.

  15. Accessibility of Computer Science: A Reflection for Faculty Members

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    Accessibility of Computer Science: A Reflection for Faculty Members Dianne P. O'Leary http O'Leary. Copyright Dianne P. O'Leary, 1999 Version 1: June 1999 1 Picture Yourself: You are male

  16. Members' attainment of National FFA leadership and personal growth precepts

    E-Print Network [OSTI]

    Ambrose, Misty Jean

    2002-01-01T23:59:59.000Z

    MEMBERS' ATTAINMENT OF NATIONAL FFA LEADERSHIP AND PERSONAL GROWTH PRECEPTS A Thesis by MISTY JEAN AMBROSE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May 2002 Major Subject: Agricultural Education MEMBERS% ATTAINMENT OF NATIONAL FFA LEADERSHIP AND PERSONAL GROWTH PRECEPTS A Thesis by MISTY JEAN AMBROSE Submitted to Texas ARM University in partial fulfillment...

  17. Comparing Emissions Benefits from Regulating Heavy Vehicle Idling...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    from Regulating Heavy Vehicle Idling Comparing Emissions Benefits from Regulating Heavy Vehicle Idling 2005 Diesel Engine Emissions Reduction (DEER) Conference...

  18. Rural Communities Benefit from Wind Energy's Continued Success

    Broader source: Energy.gov [DOE]

    John Stulp, Colorado Interbasin Compact Committee chairman, discusses how wind energy benefits rural communities, farms, and ranches.

  19. Better Buildings Residential Network Reporting and Benefits Template

    Broader source: Energy.gov [DOE]

    Better Buildings Residential Network Reporting and Benefits Template, from the U.S. Department of Energy Better Buildings Residential Network.

  20. Better Buildings Residential Network Reporting and Benefits FAQ

    Broader source: Energy.gov [DOE]

    Better Buildings Residential Network Reporting and Benefits FAQ, from the U.S. Department of Energy Better Buildings Residential Network.

  1. Strategies for Achieving Institutional Change

    Broader source: Energy.gov [DOE]

    Many strategies—including those derived from Institutional Change Principles–may be used to effect institutional change in support of energy and sustainability objectives.

  2. Assessment of Indoor Air Quality Benefits and Energy Costs of

    E-Print Network [OSTI]

    Assessment of Indoor Air Quality Benefits and Energy Costs of Mechanical Ventilation J.M.Logue1,P Quality Benefits and Energy Costs of Mechanical Ventilation LBNL-4945E Disclaimer This document.H. Sherman, B.C. Singer, Assessment of Indoor Air Quality Benefits and Energy Costs of Mechanical Ventilation

  3. Transportation Agency Tool to Analyze Benefits of Living Snow Fences

    E-Print Network [OSTI]

    Minnesota, University of

    Transportation Agency Tool to Analyze Benefits of Living Snow Fences 5/31/12 Transportation Agency/31/12 Transportation Agency Tool to Analyze Benefits of Living Snow Fences Center for Integrated Natural Resources, Mobility, & Transportation Authority Benefits, Farmer Costs, & Carbon Impacts Focus Groups and Surveys

  4. Net Environmental Benefit Analysis: A New Assessment Methodology

    E-Print Network [OSTI]

    Net Environmental Benefit Analysis: A New Assessment Methodology R. A. Efroymson, efroymsonra.S. Department of Energy Dec-05 Net Environmental Benefit Analysis: A New Assessment Methodology R. A. Efroymson environmental assessment methodologies such as risk assessment, by explicitly considering benefits (not just

  5. Lewis B. Puller, Jr. Veterans Benefits Clinic FINAL REPORT

    E-Print Network [OSTI]

    Lewis, Robert Michael

    Lewis B. Puller, Jr. Veterans Benefits Clinic ! ! ! FINAL REPORT To: The Lewis B. Puller, Jr. Veterans Benefits Clinic From: K.N. Barrett, Ian Mahoney, and Jaclyn Petruzzelli; The PRS/VBC Team Date: 11 product delivered by the PRS/VBC team to the Lewis B. Puller, Jr. Veterans Benefits Clinic (Puller Clinic

  6. Plan Benefits Administered by Delta Dental of New Mexico

    E-Print Network [OSTI]

    New Mexico, University of

    Plan Benefits Administered by Delta Dental of New Mexico Dental Benefits Handbook Frm 108 Updated as of January 2009 #12;Delta Dental of New Mexico Frm 108 ­ 01/09 Welcome to the growing number of people who receive dental coverage administered by Delta Dental of New Mexico. This Dental Benefit Handbook, along

  7. Cost-effective Resource Provisioning for MapReduce in a Balaji Palanisamy, Member, IEEE, Aameek Singh, Member, IEEE Ling Liu, Senior Member, IEEE

    E-Print Network [OSTI]

    Liu, Ling

    some slack. By effectively multiplexing the available cloud resources among the jobs based on the job1 Cost-effective Resource Provisioning for MapReduce in a Cloud Balaji Palanisamy, Member, IEEE, unlike existing services that require customers to decide the resources to be used for the jobs, Cura

  8. On Fast Transmission Topology Control Heuristics Pablo A. Ruiz, Member, IEEE, Justin M. Foster, Student Member, IEEE, Aleksandr Rudkevich, Member, IEEE,

    E-Print Network [OSTI]

    Caramanis, Michael

    flow, renewable integra- tion. I. INTRODUCTION TRADITIONALLY, power system operational decision making1 On Fast Transmission Topology Control Heuristics Pablo A. Ruiz, Member, IEEE, Justin M. Foster the OPF problem accordingly. This paper discusses the inclusion of tractable dynamic transmission topol

  9. On the Power Management of Simultaneous Multithreading Ahmed Youssef, Student Member, IEEE, Mohamed Zahran, Senior Member, IEEE, Mohab Anis, Member, IEEE,

    E-Print Network [OSTI]

    Zahran, Mohamed M.

    1 On the Power Management of Simultaneous Multithreading Processors Ahmed Youssef, Student Member various workloads to assess their effectiveness in leakage power management. Results show that the dynamic to be re-assessed. There has been a large body of work in power-management and temperature aware computing

  10. THE INSTITUTES AT NORTHWESTERN MEDICINE THE HEART INSTITUTES

    E-Print Network [OSTI]

    Engman, David M.

    THE INSTITUTES AT NORTHWESTERN MEDICINE THE HEART INSTITUTES AT NORTHWESTERN MEDICINE #12;THE INSTITUTES AT NORTHWESTERN MEDICINE THE HEART INSTITUTES AT NORTHWESTERN MEDICINE "At the Bluhm disease as an ever-present threat. The great progress we have made to date has been heralded

  11. Addressing resource over-exploitation via cooperative institutions: Insights from sector level technology roadmapping

    E-Print Network [OSTI]

    More, Elliott; Phaal, Dr. Robert; Probert, David

    2015-01-01T23:59:59.000Z

    investment in rail networks [27]. There is some existing research on the benefit of using roadmapping to achieve industry-level collaboration. In the UK automotive industry, Phaal et al. [21] documented communication and network development benefits arising... are dependent on sustainable resource management to ensure their long term survival. This paper examines the potential for roadmapping to foster collaboration between firms in an industry to create cooperative institutions such as those examined by Ostrom...

  12. LANL Institutes - Information Science and Technology Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Institute (EI) Information Science and Technology Institute (ISTI) Institute for Geophysics, Planetary Physics and Signatures (IGPPS) Institute for Materials Science (IMS)...

  13. Integrating local agriculture into nutrition programs can benefit children's health

    E-Print Network [OSTI]

    Scherr, Rachel E; Cox, Rachel J; Feenstra, Gail; Zidenberg-Cherr, Sheri

    2013-01-01T23:59:59.000Z

    Progress in Obesity Prevention: Solving the Weight of the Nation. Institute of Medicine.Progress in Preventing Childhood Obesity: How Do We Measure Up? Institute of Medicine.

  14. Executive Service Benefits The benefits associated with the Executive Service Class are as follows

    E-Print Network [OSTI]

    Wu, Shin-Tson

    Management Service Class instead of Regular Class. The retirement percentage value for calculating the annual information. UCF currently covers the full cost of Group Term Life Insurance coverage valued at $25 retirement benefit is 2.0% instead of 1.60 ­ 1.68%. Annual leave is earned at 9.195 hours per pay period

  15. Master Gardener Advisory Committee Members Ed Thralls Advisor Extension Agent ed.thralls@ocfl.net

    E-Print Network [OSTI]

    Jawitz, James W.

    Master Gardener Advisory Committee Members 2014 Ed Thralls Advisor Extension Agent ed.thralls@ocfl.net@me.com Pam Paisley Member Master Gardener pppaisley@earthlink.net Dailey Smith Member Master Gardener pirate45@gmail.com Regina Dunay Member Master Gardener dunayr@earthlink.net Jennifer Helvenston Member

  16. INSTITUTE ON ASSETS & SOCIAL POLICY

    E-Print Network [OSTI]

    Snider, Barry B.

    INSTITUTE ON ASSETS & SOCIAL POLICY LIVING LONGER ON LESS IN MASSACHUSETTS: THE NEW ECONOMIC (IN)SECURITY OF SENIORS Tatjana Meschede Laura Sullivan Thomas Shapiro #12;About the Institute on Assets and Social Policy The Institute on Assets and Social Policy (IASP), a research institute at the Heller School for Social Policy

  17. Advanced Studies Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041cloth DocumentationProducts (VAP) VAP7-0973 1BP-14 PowerAdvancedInstitute Engineering Institute

  18. Vibration dampener for dampening vibration of a tubular member

    DOE Patents [OSTI]

    Obermeyer, F.D.; Middlebrooks, W.B.; DeMario, E.E.

    1994-10-18T23:59:59.000Z

    Vibration dampener for dampening vibration of a tubular member, such as an instrumentation tube of the type found in nuclear reactor pressure vessels is disclosed. The instrumentation tube is received in an outer tubular member, such as a guide thimble tube. The vibration dampener comprises an annular sleeve which is attachable to the inside surface of the guide thimble tube and which is sized to surround the instrumentation tube. Dimples are attached to the interior wall of the sleeve for radially supporting the instrumentation tube. The wall of the sleeve has a flexible spring member, which is formed from the wall, disposed opposite the dimples for biasing the instrumentation tube into abutment with the dimples. Flow-induced vibration of the instrumentation tube will cause it to move out of contact with the dimples and further engage the spring member, which will flex a predetermined amount and exert a reactive force against the instrumentation tube to restrain its movement. The amount by which the spring member will flex is less than the unrestrained amplitude of vibration of the instrumentation tube. The reactive force exerted against the instrumentation tube will be sufficient to return it to its original axial position within the thimble tube. In this manner, vibration of the instrumentation tube is dampened so that in-core physics measurements are accurate and so that the instrumentation tube will not wear against the inside surface of the guide thimble tube. 14 figs.

  19. The Forestry and Agricultural Biotechnology Institute (FABI) is located at the University of Pretoria. The primary objectives of the Institute are to

    E-Print Network [OSTI]

    1 The Forestry and Agricultural Biotechnology Institute (FABI) is located at the University benefits to the forestry and agricultural sectors of South Africa · Establish partnerships with industries linked to agriculture and forestry, both nationally and internationally, to produce new and improved

  20. The Forestry and Agricultural Biotechnology Institute (FABI) is located on the campus of the University of Pretoria. The primary objectives of the Institute are to

    E-Print Network [OSTI]

    #12;The Forestry and Agricultural Biotechnology Institute (FABI) is located on the campus and long term benefits to the forestry and agricultural sectors of South Africa · Establish partnerships with industries linked to agriculture and forestry, both nationally and internationally, to produce new

  1. The Forestry and Agricultural Biotechnology Institute (FABI) is located on the campus of the University of Pretoria. The primary objectives of the Institute are to

    E-Print Network [OSTI]

    #12;The Forestry and Agricultural Biotechnology Institute (FABI) is located on the campus and longer term benefits to the forestry and agricultural sectors of South Africa · Establish partnerships with industries linked to agriculture and forestry, both nationally and internationally, to produce new

  2. Michigan Institute Science and

    E-Print Network [OSTI]

    Shyy, Wei

    . Kaita's present research interests focus on plasma-surface interactions and the use of liquid metalsMichigan Institute for Plasma Science and Engineering Seminar Up Against the Wall: Liquid Lithium for the Chamber Technology Challenge in Fusion Energy Dr. Robert Kaita Princeton Plasma Physics Laboratory 3:00 pm

  3. Institute for ADVANCED STUDY

    E-Print Network [OSTI]

    to the Institute's Trustees, dated June 6, 1930. Newark, New Jersey. It is fiindamental in our purpose, and our energetic objects in the Universe? To answer these questions, astronomers and astrophysicists use paper, Adassadnisetts HYMAN BASS Adrain Professor of Mathematics, Cohimbia University Neiv York, New York RICHARD B

  4. Cancer Research Beckman Institute

    E-Print Network [OSTI]

    Illinois at Urbana-Champaign, University of

    Cancer Research Beckman Institute FOR ADVANCED SCIENCE AND TECHNOLOGY #12;T The medical and scientific worlds have known for many years that in order to truly understand and treat cancer, the fight has and cancerous tumors have to first be visualized at the smallest scales possible, and then treated in the most

  5. Exotensioned structural members with energy-absorbing effects

    DOE Patents [OSTI]

    Brockwell, Michael Ian

    2014-01-07T23:59:59.000Z

    Structural members having enhanced load bearing capacity per unit mass include a skeleton structure formed from strips of material. Notches may be placed on the strips and a weave of tensile material placed in the notches and woven around the skeleton structure. At least one pair of structural members can be jointed together to provide very strong joints due to a weave patterns of tensile material, such as Kevlar, that distributes stress throughout the structure, preventing stress from concentrating in one area. Methods of manufacturing such structural members include molding material into skeletons of desired cross section using a matrix of molding segments. Total catastrophic failures in composite materials are substantially avoided and the strength to weight ratio of structures can be increased.

  6. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members Michael J.Members

  7. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members MichaelMembers

  8. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings MembersMembers Nuclear

  9. Institutions or, who does what and why

    E-Print Network [OSTI]

    Handy, Susan L.

    it is infused with value" ­ Philip Selznick #12;Importance of Institutions Institutional characteristics

  10. Careers | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruary 26,ComputersTrinity /Paths |BenefitsWhyCareers

  11. Benjamin Richards > Member - Hanrath Group > Researchers, Postdocs &

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWP TWPAlumniComplex historianBenefits of BES BasicBenefits

  12. If there is a discrepancy between this document and the official Plan Document the official Plan Document(s) will govern. Massachusetts Institute of Technology

    E-Print Network [OSTI]

    Reuter, Martin

    If there is a discrepancy between this document and the official Plan Document the official Plan Document(s) will govern. 1/01/2014 Massachusetts Institute of Technology Summary of 2014 Benefits to manage their healthcare. "In-network" benefits are also provided for employees and their dependents who

  13. 2001: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS

    E-Print Network [OSTI]

    RadioAstronomie Millimétrique, Institut de (IRAM)

    2001: PUBLICATIONS WITH IRAM STAFF MEMBERS AS (CO-)AUTHORS 877. SEARCH FOR NH3 ICE IN COLD DUST ENVELOPES AROUND YSO's E. Dartois, L. d'Hendecourt 2001, A&A 365, 144 878. DISKS AND OUTFLOWS AROUND-Franco, F. Palla 2001, A&A 366, 873 879. SiO EMISSION FROM A HUGE, DETACHED SHELL IN IRC+10420 A. Castro

  14. Nuclear Waste Technical Review Board Members Appendix A 53

    E-Print Network [OSTI]

    51 Appendix A Nuclear Waste Technical Review Board Members #12;#12;Appendix A 53 B. John Garrick, Ph.D., P.E. Chairman Dr. B. John Garrick was appointed to the U.S. Nuclear Waste Technical Review, on the U.S. Nuclear Regula- tory Commission's Advisory Committee on Nuclear Waste. His areas of expertise

  15. U.S. Nuclear Waste Technical Review Board Members

    E-Print Network [OSTI]

    Appendix A Appendix A U.S. Nuclear Waste Technical Review Board Members Jared L. Cohon, Ph.D.; Chairman On June 29, 1995, President Bill Clinton appointed Jared Cohon to the Nuclear Waste Technical, and Asia and on energy facil ity siting, including nuclear waste shipping and storage. In addition to his

  16. Fully Affiliated Members Aero/Astro Austin DiOrio

    E-Print Network [OSTI]

    Williams, Brian C.

    Fully Affiliated Members Aero/Astro Austin DiOrio Alpha Phi OmegaAPO Nicole Gagnier ARA Richard) Daniel Chavas East Campus Juliana Wu Eastgate Elliot Greenblatt Economics Dept. Kyle Greenberg Edgerton Center Chaithanya Bandi Parsons Benzhang Zhao Phi Beta Epsilon Daniel Ronde Phi Kappa Sigma (Skullhouse

  17. TEAM AWARDS TEAM SUBMITTED BY ENDORSEMENT DATE AWARDED # OF MEMBERS

    E-Print Network [OSTI]

    Oliver, Douglas L.

    TEAM AWARDS TEAM SUBMITTED BY ENDORSEMENT DATE AWARDED # OF MEMBERS Neuromuscular Team Deborah Feigenbaum ALS Association & Patients 9/17/2007 9 Affirmative Action Production Team Carolyn Lyle Susan Whetstone & Brian Eaton 4/17/2007 4 Labor & Delivery Team Samtha Angelini & Gwyn Muscillo Ellen Leone & Joan

  18. Team Member Guide http://walkacrosstexas.tamu.edu

    E-Print Network [OSTI]

    Team Member Guide http://walkacrosstexas.tamu.edu #12;2 Updated September 2012. Educational will be appointed as the Site Manager for Walk Across Texas. The Site Manager will find Team Captains. The Team Captains then recruit seven people for their team. Once teams of eight are formed, a AKick-Off@ event marks

  19. THE UNIVERSITY OF BRITISH COLUMBIA Curriculum Vitae for Faculty Members

    E-Print Network [OSTI]

    Karczmarek, Joanna

    THE UNIVERSITY OF BRITISH COLUMBIA Curriculum Vitae for Faculty Members Date: May 5. 2009 Initials-1980 University of British Columbia M Sc Physics 1980-1982 University of British Columbia Ph D Physics 1982 The University of British Columbia Study Leave 07/2007-06/2008 8. TEACHING (a) Areas of special interest

  20. Hybrid FRP/Concrete Structural Members and Sami Rizkalla

    E-Print Network [OSTI]

    with differentfiber orientations partially and/or totallyfilled with concrete. Hollow FRP and steel tubes were testedHybrid FRP/Concrete Structural Members Amir Fam1 and Sami Rizkalla 2 Department of Civil, highway overhead sign structures and bridges. The experimental program included testing to failure tubes

  1. Independent Scientific Advisory Board: Member Resume David P. Philipp

    E-Print Network [OSTI]

    Independent Scientific Advisory Board: Member Resume David P. Philipp Appointed to Board: 1999. Claussen, and D. P. Philipp. Effect of population size structure on reproductive investment of male bluegill. North American Journal of Fisheries Management 17: 516-524. 1997 Philipp, D. P., C. A. Toline, D

  2. Modal Analysis of Continuous Structrual System with Tapered Cantilevered Members

    E-Print Network [OSTI]

    Kim, Yoon Mo

    2012-02-14T23:59:59.000Z

    OF CONVENTIONAL CONTINUOUS SYSTEM ............ 9 2.1. Transverse Vibration in Conventional Continuous System Model .................... 9 2.2. Equation of Motion for Flexural Member .......................................................... 9 2.3 Boundary.......................................... 19 2.6 Conclusion ........................................................................................................ 20 3. MODAL ANALYSIS OF DISCRETIZED CONTINUOUS SYSTEM ............... 21 3.1. Transverse Vibration in Discretized Continuous...

  3. Dean's Leadership Circle 2011-2012 Annual Member Pledge Form

    E-Print Network [OSTI]

    Stanford, Kyle

    Dean's Leadership Circle 2011-2012 Annual Member Pledge Form For more information, contact Sandra Findly, Senior Director of Development Dean's Leadership Circle Fund 3048 Appeal Code: B1S40 MPAA Building, Suite 210, Irvine, CA 92697-3130 ­ Phone 949-824-8865 ­ Secure Fax 949-824-8866 ­ Email DeansLeadership

  4. Dean's Leadership Circle 2010-2011 Member Pledge Form

    E-Print Network [OSTI]

    Loudon, Catherine

    Dean's Leadership Circle 2010-2011 Member Pledge Form For more information, contact: SECURE FAX LINE: 949-824-8866 MPAA Building, Suite 210 Sandra Findly, Director, Dean's Leadership Circle Irvine, CA 92697-3130 (949) 824-8865 ­ DeansLeadershipCircle@uci.edu www.merage.uci.edu/go/DLC DLC Fund 3048

  5. AQU 04 Portable Algae Flow Cytometer Team Members

    E-Print Network [OSTI]

    California at Los Angeles, University of

    AQU 04 Portable Algae Flow Cytometer Team Members · David Caron, Faculty · Han-Chieh Chang · Yu-Chong Tai, Faculty, PI* * Primary Contact Overview The portable algae flow cytometer is a project that aims to expedite research in algae biology using microfluid-based and state-of-the-art detection

  6. Work and Energy Simulation Name_______________________ Lab Worksheet Group member names__________________________________

    E-Print Network [OSTI]

    Winokur, Michael

    Work and Energy Simulation Name_______________________ Lab Worksheet Group member names://phet.colorado.edu, in a browser and click on the Go to the simulations button. Open Work, Energy, and Power on the left. This lab uses three of the simulations on this page, Masses and Springs, Energy Skate Park, and The Ramp. I

  7. Change of Dissertation Adviser or Reading Committee Member Stanford University

    E-Print Network [OSTI]

    Ford, James

    Change of Dissertation Adviser or Reading Committee Member Stanford University Please address approval for a change of dissertation adviser, the addition or deletion of a doctoral dissertation reading of the dissertation. Policy: The reading committee must conform to University regulations at the time of degree

  8. Transportation Institutional Plan

    SciTech Connect (OSTI)

    Not Available

    1986-08-01T23:59:59.000Z

    This Institutional Plan is divided into three chapters. Chapter 1 provides background information, discusses the purposes of the Plan and the policy guidance for establishing the transportation system, and describes the projected system and the plans for its integrated development. Chapter 2 discusses the major participants who must interact to build the system. Chapter 3 suggests mechanisms for interaction that will foster wide participation in program planning and implementation and provides a framework for managing and resolving the issues related to development and operation of the transportation system. A list of acronyms and a glossary are included for the reader's convenience. Also included in this Plan are four appendices. Of particular importance is Appendix A, which includes detailed discussion of specific transportation issues. Appendices B, C, and D provide supporting material to assist the reader in understanding the roles of the involved institutions.

  9. Exploring the Additive Benefit of Parental Nurturance Training on Parent and Child Shared Reading Outcomes: A Pilot Intervention Study

    E-Print Network [OSTI]

    Terry, Megan

    2012-10-19T23:59:59.000Z

    , Anita McCormick Jorge Gonzalez Erin McTigue Head of Department, Victor Willson August 2011 Major Subject: School Psychology iii ABSTRACT Exploring the Additive Benefit of Parental Nurturance Training on Parent and Child Shared Reading... and skills. A special thank you goes out to each one of my committee members: Anita McCormick, Jorge Gonzalez, and Erin McTigue. I was blessed to have a team of scholars whose knowledge and passions were so nicely aligned to this project. I am thankful...

  10. Estimating the Benefits and Costs of Distributed Energy Technologies...

    Broader source: Energy.gov (indexed) [DOE]

    - Carl Imhoff, PNNL More Documents & Publications Estimating the Benefits and Costs of Distributed Energy Technologies Workshop - Day 1 Presentations Estimating the...

  11. Estimating the Benefits and Costs of Distributed Energy Technologies...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1 Presentations Estimating the Benefits and Costs of Distributed Energy Technologies Workshop - Day 1 Presentations On September 30 and October 1, 2014, the Department of Energy...

  12. Estimating the Benefits and Costs of Distributed Energy Technologies...

    Broader source: Energy.gov (indexed) [DOE]

    2014, the Department of Energy hosted a 2-day workshop on "Estimating the Benefits and Costs of Distributed Energy Technologies." The purpose of the workshop was to foster...

  13. Assessing the Costs and Benefits of the Superior Energy Performance...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Presentation Assessing the Costs and Benefits of the Superior Energy Performance Program Presentation Superior Energy Performance logo Nine companies certified under the U.S....

  14. Panel 2, Modeling the Financial and System Benefits of Energy...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Modeling the Financial and System Benefits of Energy Storage Applications in Distribution Systems Patrick Balducci, Senior Economist, Pacific NW National Laboratory Hydrogen Energy...

  15. CIGNA Study Uncovers Relationship of Disabilities to Total Benefits...

    Office of Environmental Management (EM)

    findings of a new study reveal an interesting trend. Integrating disability programs with health care programs can potentially lower employers' total benefits costs and help...

  16. assessment benefits environmental: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Uses of BC's Inland Rainforest Research Bulletin, May 2011-economic benefits of non-timber uses of the inland rainforest of the upper Fraser River valley in British...

  17. Accounting for Co-benefits in Asia's Transportation Sector: Methods...

    Open Energy Info (EERE)

    has two objectives. The first is to examine methodological issues involved in using guidelines to measure co-benefits from transport projects (developing baselines,...

  18. Benefits of Using Mobile Transformers and Mobile Substations...

    Broader source: Energy.gov (indexed) [DOE]

    Benefits of Using Mobile Transformers and Mobile Substations for Rapidly Restoring Electrical Service: a Report to the United States Congress Pursuant to Section 1816 of the Energy...

  19. Notice of Study Availability - Potential Benefits of Distributed...

    Broader source: Energy.gov (indexed) [DOE]

    Federal Register Notice of availability of a study of the potential benefits of distributed generation and rate-related issues that may impede their expansion, and request for...

  20. Valuing the Environmental Benefits of Urban WaterConservation

    SciTech Connect (OSTI)

    Coughlin, Katie M.; Bolduc, Chris A.; Chan, Peter T.; Dunham-Whitehead, C.; Van Buskirk, R.D.

    2007-05-01T23:59:59.000Z

    This report documents a project undertaken for theCalifornia Urban Water Conservation Council (the Council) to create a newmethod of accounting for the diverse environmental benefits of raw watersavings. The environmental benefits (EB) model was designed to providewater utilities with a practical tool that they can use to assign amonetary value to the benefits that may accrue from implementing any ofthe Council-recommended Best Management Practices. The model treats onlyenvironmental services associated directly with water, and is intended tocover miscellaneous impacts that are not currently accounted for in anyother cost-benefit analysis.

  1. Fuel Consumption and Cost Benefits of DOE Vehicle Technologies...

    Office of Environmental Management (EM)

    Consumption and Cost Benefits of DOE Vehicle Technologies Program 2012 DOE Hydrogen and Fuel Cells Program and Vehicle Technologies Program Annual Merit Review and Peer...

  2. Major habitat purchase in Columbia estuary benefits salmon ...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Fredlund, Corps, 503-808-4510 (EDITORS: Click for maps, photos and video.) Major habitat purchase in Columbia estuary benefits salmon The Columbia Land Trust, Bonneville Power...

  3. Health and productivity benefits of improved indoor air quality

    SciTech Connect (OSTI)

    Dorgan, C.B. [Dorgan Associates, Inc., Madison, WI (United States); Dorgan, C.E.; Kanarek, M.S. [Univ. of Wisconsin, Madison, WI (United States); Willman, A.J. [Quantum Technology, Inc., Springfield, VA (United States)

    1998-10-01T23:59:59.000Z

    This paper is a summary of two studies completed for a national contractor`s association on the health costs and productivity benefits of improved IAQ. The original study documented the general health costs and productivity benefits of improved IAQ. The second study expanded the scope to include medical cost reductions for specific illnesses from improved IAQ. General information on the objectives, assumptions, definitions, and results of the studies are presented, followed by detailed information on research methodology, building inventory and wellness categories, health and medical effects of poor IAQ, health cost benefits, productivity benefits, recommended improvements, and conclusions and future improvements.

  4. Microsoft Word - Understanding Smart Grid Benefits_final.docx

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    done with today's grid. These new smart grid capabilities will generate significant emission reductions over BAU. Electricity Supplier Benefits New opportunities for...

  5. Measuring the Costs and Economic, Social, and Environmental Benefits...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the Costs and Economic, Social, and Environmental Benefits of Nationwide Geothermal Heat Pump Deployment and The Potential Employment, Energy, and Environmental Impacts of...

  6. Measuring the Costs and Economic, Social, and Environmental Benefits...

    Broader source: Energy.gov (indexed) [DOE]

    the Costs and Economic, Social, and Environmental Benefits of Nationwide Geothermal Heat Pump Deployment and The Potential Employment, Energy, and Environmental Impacts of Direct...

  7. BENEFIT 2015 Funding Opportunity Announcement Webinar 1 (Text Version)

    Broader source: Energy.gov [DOE]

    Below is the text version of the webinar, BENEFIT 2015 Funding Opportunity Announcement, presented in October 2014 by Antonio Bouza, technology manager, and Pat Phelan, program manager, Building...

  8. Wind Energy Benefits, Wind Powering America (WPA) (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2011-04-01T23:59:59.000Z

    This fact sheet outlines the top 10 benefits of wind energy, including cost, water savings, job creation, indigenous resource, and low operating costs.

  9. arthroplasty patients benefit: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    D. 3 Student Clinic Patient Benefits Biology and Medicine Websites Summary: oral health care rehabilitation at the LSUHSC School of Dentistry. In addition to services offered...

  10. Institutional Scholarship Awards: The Role of Student and Institutional Characteristics

    E-Print Network [OSTI]

    Heller, Don

    Institutional Scholarship Awards: The Role of Student and Institutional Characteristics Paper analyzes data from the National Postsecondary Student Aid Study (NPSAS) to examine the awarding are those of the author alone. © 2000, Donald E. Heller #12;Institutional Scholarship Awards: The Role

  11. Creating a Pathway to Sustainability IIT Wanger Institute for Sustainable Energy Research

    E-Print Network [OSTI]

    Heller, Barbara

    ............................................................................................................3 Clean Coal Technology Production of Methane from Hydrates and Unconventional Sources Biofuels IIT first developed a formal affiliation with the Institute of Gas Technology (IGT), establishing member hired by IIT to establish the Energy Technology education and research program. As part

  12. FACILITIES and EQUIPMENT DESCRIPTION The UCR Institute for Integrative Genome Biology

    E-Print Network [OSTI]

    Lyubomirsky, Ilya

    1 FACILITIES and EQUIPMENT DESCRIPTION The UCR Institute for Integrative Genome Biology interdisciplinary, four-story Genomics Building in 2009 to accommodate over 200 faculty members, graduate students one roof who use modern genetic tools, genomics and bioinformatics to help address basic and applied

  13. 2005 Annual Report Summer Research Institute Interfacial and Condensed Phase Chemical Physics

    SciTech Connect (OSTI)

    Barlow, Stephan E.

    2005-11-15T23:59:59.000Z

    The Pacific Northwest National Laboratory (PNNL) hosted its second annual Summer Research Institute in Interfacial and Condensed Phase Chemical Physics from May through September 2005. During this period, sixteen PNNL scientists hosted fourteen young scientists from eleven different universities. Of the fourteen participants, twelve were graduate students; one was a postdoctoral fellow; and one was a university faculty member.

  14. Colorado Forestry Advisory Board Members: Don Ament Tom Stone

    E-Print Network [OSTI]

    significant stress. Our changing human values and land management policies are partially responsible attention. We demand and receive a number of benefits from our forested landscapes and watersheds. If we annual report builds on the foundation laid in that original docu- ment by updating readers on issues

  15. Sustainable Development Research Institute fonds

    E-Print Network [OSTI]

    Handy, Todd C.

    Sustainable Development Research Institute fonds Compiled by Erwin Wodarczak and Melanie Hardbattle Projects series Sous-fonds Description o "Women and Sustainable Development: Canadian Perspectives (UBC Library catalogue) #12;Fonds Description Sustainable Development Research Institute fonds. ­ 1985

  16. Science Prospects And Benefits with Exascale Computing

    SciTech Connect (OSTI)

    Kothe, Douglas B [ORNL

    2007-12-01T23:59:59.000Z

    Scientific computation has come into its own as a mature technology in all fields of science. Never before have we been able to accurately anticipate, analyze, and plan for complex events that have not yet occurred from the operation of a reactor running at 100 million degrees centigrade to the changing climate a century down the road. Combined with the more traditional approaches of theory and experiment, scientific computation provides a profound tool for insight and solution as we look at complex systems containing billions of components. Nevertheless, it cannot yet do all we would like. Much of scientific computation s potential remains untapped in areas such as materials science, Earth science, energy assurance, fundamental science, biology and medicine, engineering design, and national security because the scientific challenges are far too enormous and complex for the computational resources at hand. Many of these challenges are of immediate global importance. These challenges can be overcome by a revolution in computing that promises real advancement at a greatly accelerated pace. Planned petascale systems (capable of a petaflop, or 1015 floating point operations per second) in the next 3 years and exascale systems (capable of an exaflop, or 1018 floating point operations per second) in the next decade will provide an unprecedented opportunity to attack these global challenges through modeling and simulation. Exascale computers, with a processing capability similar to that of the human brain, will enable the unraveling of longstanding scientific mysteries and present new opportunities. Table ES.1 summarizes these scientific opportunities, their key application areas, and the goals and associated benefits that would result from solutions afforded by exascale computing.

  17. Institutions G.C. Sciara

    E-Print Network [OSTI]

    Handy, Susan L.

    an institution when it is infused with value" ­ Philip Selznick #12;Why they matter... ·They plan, implement

  18. Supplemental Material of "Collaborative Mobile Sheng Zhang, Student Member, IEEE, Jie Wu, Fellow, IEEE, and Sanglu Lu, Member, IEEE

    E-Print Network [OSTI]

    Wu, Jie

    by induction on M. When M = 1 or M = 2, we can prove SolelyCharge is optimal using a similar method1 Supplemental Material of "Collaborative Mobile Charging" Sheng Zhang, Student Member, IEEE, Jie a sufficiently large WSN (X, Y, B, T) and a charging model (P, c, v, 1, 2), which satisfy conditions K1K2K3

  19. Standards-enabled Smart Grid for the Future Valeriy Vyatkin, Senior Member, IEEE, Gulnara Zhabelova, non-member,

    E-Print Network [OSTI]

    Ulieru, Mihaela

    1 Standards-enabled Smart Grid for the Future EnergyWeb Valeriy Vyatkin, Senior Member, IEEE for the Smart Grid is proposed which combines two recently developed industrial standards. The utility network that can be created using interoperable Smart Grid devices. Using Matlab-based simulation environment we

  20. EXIT Charts for Turbo Trellis Coded Modulation Hangjun Chen, Student Member, IEEE, and Alexander Haimovich, Senior Member, IEEE

    E-Print Network [OSTI]

    Haimovich, Alexander

    EXIT Charts for Turbo Trellis Coded Modulation Hangjun Chen, Student Member, IEEE, and Alexander information transfer charts (EXIT) method to the analysis of the convergence of turbo codes to turbo trellis can be used as a tool in the design of TTCM. Index Terms-- Turbo trellis coded modulation, convergence

  1. Intentional Islanded Operation of Converter Fed Microgrids Charles K. Sao, Student Member, IEEE, and Peter W. Lehn, Member, IEEE

    E-Print Network [OSTI]

    Lehn, Peter W.

    . INTRODUCTION Many new distributed power sources, such as wind turbine generators and fuel cells, do is determined by the reactive power balance. Such steady state relations have been identified in the literature, and Peter W. Lehn, Member, IEEE Abstract-- This paper develops a dynamic model of a converter fed is- landed

  2. National Institute of Standards and Technology Technology Administration U.S. Department of Commerce February 2007

    E-Print Network [OSTI]

    National Institute of Standards and Technology · Technology Administration · U.S. Department of Commerce February 2007 ATP-Funded Green Process Technologies: Improving U.S. Industrial Competitiveness With Applications in Packaging, Metals Recycling, Energy, and Water Treatment GCR 06-897 Thomas Pelsoci A Benefit-Cost

  3. Energy Star program benefits Con Edison

    SciTech Connect (OSTI)

    NONE

    1995-05-01T23:59:59.000Z

    Impressed with savings in energy costs achieved after upgrading the lighting and air conditioning systems at its Manhattan headquarters, Home Box Office (HBO) wanted to do more, James Flock, vice president for computer and office systems, contacted Con Edison Co. of New York in March 1991 to determine what the company could do to save money by reducing energy consumed by personal computers. Arthur Kressner, Con Edison Research and Development manager contacted industry organizations and manufacturers for advice, but was told only to shut off computers at night and on weekends. Kressner arranged a series of meetings with IBM and the Electric Power Research Institute (EPRI) to discuss the issue, then approached the U.S. Environmental Protection Agency (EPA), which was designing a program to promote the introduction and use of energy-efficient office equipment. In 1992, the EPA announced the Energy Star program for PCs, enabling manufacturers to display the Energy Star logo on machines meeting program criteria, including the ability to enter a sleep mode in which neither the computer nor monitor consume more than 30 W or electricity. Industry experts estimate national energy consumption by office equipment could double by the year 2000, but Energy Star equipment is expected to improve efficiency and help maintain electric loads.

  4. Committees (present) Member of the national Topteam on Energy, Ministry of Economic Affairs, Agriculture and Innovation

    E-Print Network [OSTI]

    ) Member of the review committee CAREM nuclear reactor design, National Atomic Energy Commission Argentina

  5. Finally, the Academy has ac-cepted eleven new members, for a

    E-Print Network [OSTI]

    Finally, the Academy has ac- cepted eleven new members, for a total of 73 members. Please see of educators. If you are not already an Academy member, please consider submitting your application. A review of member- ship categories is on page 2 of this Academy Bulletin. Complete de- tails are on the Academy

  6. Mid-Atlantic Regional Wind Energy Institute

    SciTech Connect (OSTI)

    Courtney Lane

    2011-12-20T23:59:59.000Z

    As the Department of Energy stated in its 20% Wind Energy by 2030 report, there will need to be enhanced outreach efforts on a national, state, regional, and local level to communicate wind development opportunities, benefits and challenges to a diverse set of stakeholders. To help address this need, PennFuture was awarded funding to create the Mid-Atlantic Regional Wind Energy Institute to provide general education and outreach on wind energy development across Maryland, Virginia, Delaware, Pennsylvania and West Virginia. Over the course of the two-year grant period, PennFuture used its expertise on wind energy policy and development in Pennsylvania and expanded it to other states in the Mid-Atlantic region. PennFuture accomplished this through reaching out and establishing connections with policy makers, local environmental groups, health and economic development organizations, and educational institutions and wind energy developers throughout the Mid-Atlantic region. PennFuture conducted two regional wind educational forums that brought together wind industry representatives and public interest organizations from across the region to discuss and address wind development in the Mid-Atlantic region. PennFuture developed the agenda and speakers in collaboration with experts on the ground in each state to help determine the critical issue to wind energy in each location. The sessions focused on topics ranging from the basics of wind development; model ordinance and tax issues; anti-wind arguments and counter points; wildlife issues and coalition building. In addition to in-person events, PennFuture held three webinars on (1) Generating Jobs with Wind Energy; (2) Reviving American Manufacturing with Wind Power; and (3) Wind and Transmission. PennFuture also created a web page for the institute (http://www.midatlanticwind.org) that contains an online database of fact sheets, research reports, sample advocacy letters, top anti-wind claims and information on how to address them, wind and wildlife materials and sample model ordinances. Video and presentations from each in-person meeting and webinar recordings are also available on the site. At the end of the two-year period, PennFuture has accomplished its goal of giving a unified voice and presence to wind energy advocates in the Mid-Atlantic region. We educated a broad range of stakeholders on the benefits of wind energy and gave them the tools to help make a difference in their states. We grew a database of over 500 contacts and hope to continue the discussion and work around the importance of wind energy in the region.

  7. THE COSTS AND BENEFITS OF A PUBLIC OPTION IN

    E-Print Network [OSTI]

    Kammen, Daniel M.

    THE COSTS AND BENEFITS OF A PUBLIC OPTION IN HEALTH CARE REFORM: An Economic Analysis Ethan Kaplan on Health, Economic & Family Security #12;i Berkeley Center on Health, Economic & Family Security|The Costs Security|The Costs and Benefits of a Public Option in Health Care Reform: An Economic Analysis EXECUTIVE

  8. Duke University Health System Benefits Overview: Non-Exempt

    E-Print Network [OSTI]

    Reif, John H.

    Protection and Affordable Care Act (otherwise known as National Health Care Reform). You have the benefit Health Maintenance Organization, or HMO. If you choose this plan you must receive care fromDuke University Health System Benefits Overview: Non-Exempt 2014 We are pleased to provide you

  9. Expected Economic Benefits of the El Morillo Drain

    E-Print Network [OSTI]

    Lacewell, Ronald D.; Rister, M. Edward; Sturdivant, Allen W.; DuBois, Megan; Rogers, Callie; Seawright, Emily

    2007-01-02T23:59:59.000Z

    with conservation of approximately 900,000 acre feet of water annually. Abstract The study of the benefits (damages averted) attributable to the El Morillo Drain encompasses U.S. municipalities, industry, and agriculture. It is conservatively estimated... ......................................................................................................................... 2 Benefits .............................................................................................................................. 4 Municipal Impacts...

  10. Measuring the Costs & Benefits of Nationwide Geothermal Heat

    E-Print Network [OSTI]

    Measuring the Costs & Benefits of Nationwide Geothermal Heat Pump (GHP) Deployment ­ A Progress to measure the costs and benefits of nationwide geothermal heat pump (GHP) deployment. · First market study to quantify the entire GHP chain ­ Manufacturing ­ Design ­ Installation · GHPsRUS is short for "geothermal

  11. Real time sensors in geothermal fluids: their costs and benefits

    SciTech Connect (OSTI)

    Jensen, G.A.; Shannon, D.W.; Hazelton, R.F.

    1982-02-01T23:59:59.000Z

    A summary of the PNL effort, a background discussion on geothermal power plants, and a discussion of several cases where problems were identified and in some cases prevented are included. Cost factors, savings, and benefits-costs to the sponsor are summarized and brief conclusions concerning the benefits of having real time instrumentation installed in the power plant are characterized.

  12. Mapping the Economic Costs and Benefits of Conservation

    E-Print Network [OSTI]

    Vermont, University of

    ]. And understanding benefits--``ecosystem services'' such as flood control from wetlands and carbon sequestration from, existence value, and carbon storage in aboveground biomass) and compared them to estimates over this relatively small (;3,000 km2 ) landscape. Benefits exceeded costs in some areas, with carbon

  13. Lifetime Benefits through Load Balancing in Homogeneous Sensor Networks

    E-Print Network [OSTI]

    Haenggi, Martin

    , battery depletion is emulated so that it becomes possible to actually measure the load balancingLifetime Benefits through Load Balancing in Homogeneous Sensor Networks Daniele Puccinelli network. The use of load balancing schemes can be expected to provide significant lifetime benefits

  14. Institute for Materials Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC) EnvironmentalGyroSolé(tm)HydrogenRFPTri-PartyForThe StandardInspiringJennaInstitute

  15. IACM Institute Overview

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742Energy ChinaofSchaefer To:Department ofOral TestimonyEnergy Hydrogen5 , 3004GuidanceInstitute

  16. Enrolling in Benefits Using PeopleSoft Use this document to assist in your benefits enrollment. Your New Hire packet contains the information you need to

    E-Print Network [OSTI]

    Goodrich, Lisa V.

    to make your benefit elections. Save vs. Submit: You may Save your elections and return to make changes will save your elections). If you do not submit your benefits before the enrollment period ends, your .................................................................................................................................................................... 5 Saving Benefit Selections

  17. Method for making an elastomeric member with end pieces

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI); McNinch, Jr., Joseph H. (Livonia, MI); Nowell, Gregory C. (Livonia, MI)

    1984-01-01T23:59:59.000Z

    A molding process for molding an elongated elastomeric member (60) with wire mesh sleeves (16) bonded to the ends (14). A molding preform (10) of elastomeric material is positioned within a seamless mold cylinder (26), and the open ends of the wire mesh sleeves (16) are mounted to end plug assemblies (30) slidably received into the mold cylinder (26) and positioned against the ends (14) of the preform (10). A specialized profile is formed into surfaces (44) of the respective end plug assemblies (30) and by heating of the mold (26), the ends (14) of the elastomeric preform (10) are molded to the profile, as well as bonded to the reinforcing wire mesh sleeves (16). Vacuum is applied to the interior of the mold to draw outgassing vapors through relief spaces therethrough. The completed elastomeric member (60) is removed from the mold cylinder (26) by stretching, the consequent reduction in diameter enabling ready separation from the mold cylinder (26) and removal thereof.

  18. Turbine blade squealer tip rail with fence members

    DOE Patents [OSTI]

    Little, David A

    2012-11-20T23:59:59.000Z

    A turbine blade includes an airfoil, a blade tip section, a squealer tip rail, and a plurality of chordally spaced fence members. The blade tip section includes a blade tip floor located at an end of the airfoil distal from the root. The blade tip floor includes a pressure side and a suction side joined together at chordally spaced apart leading and trailing edges of the airfoil. The squealer tip rail extends radially outwardly from the blade tip floor adjacent to the suction side and extends from a first location adjacent to the airfoil trailing edge to a second location adjacent to the airfoil leading edge. The fence members are located between the airfoil leading and trailing edges and extend radially outwardly from the blade tip floor and axially from the squealer tip rail toward the pressure side.

  19. Institut Eurecom1 Department of Mobile Communications

    E-Print Network [OSTI]

    Gesbert, David

    is partially supported by its industrial members: BMW Group Research & Technology ­ BMW Group Company, Bouygues

  20. Cyclooctanoid Natural Products Synthesis of eight-membered ring

    E-Print Network [OSTI]

    Stoltz, Brian M.

    Cyclooctanoid Natural Products Synthesis of eight-membered ring containing terpenoids Chris Henry Stoltz Group Literature Presentation June 15th, 2008 147 Noyes, 8:00 PM O O H H H plagiospirolide E Group Literature Group Meeting 2 April 2007 HO H OH O Br H O H O H OH OH H H O OH O O H O OH H OHH O O H

  1. Evaluation of compression members with non-ideal end conditions

    E-Print Network [OSTI]

    Marek, David Leslie

    1993-01-01T23:59:59.000Z

    f/ cr effective connection restraint (k-in/rad), modulus of elasticity (ksi), yield stress of steel (ksi), ratio of stiffness (non-dimensional), moment of inertia about axis of buckling (in4), effective length factor (non-dimensional), length... of compression member (in), plastic moment capacity of the column (k-in), critical buckling load (kips) rotational stiffness of connection (k-in/rad), end restraint parameter (non-dimensional), buckling load parameter (non-dimensional), approximate function...

  2. Institute for Advanced Materials at University of Louisville

    SciTech Connect (OSTI)

    Sunkara, Mahendra; Sumaneskara, Gamini; Starr, Thomas L; Willing, G A; Robert W, Cohn

    2009-10-29T23:59:59.000Z

    In this project, a university-wide, academic center has been established entitled ?Institute for Advanced Materials and Renewable Energy?. In this institute, a comprehensive materials characterization facility has been established by co-locating several existing characterization equipment and acquiring several state of the art instrumentation such as field emission transmission electron microscope, scanning electron microscope, high resolution X-ray diffractometer, Particle Size Distribution/Zeta Potential measurement system, and Ultra-microtome for TEM specimen. In addition, a renewable energy conversion and storage research facility was also established by acquiring instrumentation such as UV-Vis absorption spectroscopy, Atomic Layer Deposition reactor, Solar light simulator, oxygen-free glove box, potentiostat/galvanostats and other miscellaneous items. The institute is staffed with three full-time staff members (one senior research technologist, a senior PhD level research scientist and a junior research scientist) to enable proper use of the techniques. About thirty faculty, fifty graduate students and several researchers access the facilities on a routine basis. Several industry R&D organizations (SudChemie, Optical Dynamics and Hexion) utilize the facility. The established ?Institute for Advanced Materials? at UofL has three main objectives: (a) enable a focused research effort leading to the rapid discovery of new materials and processes for advancing alternate energy conversion and storage technologies; (b) enable offering of several laboratory courses on advanced materials science and engineering; and (c) develop university-industry partnerships based on the advanced materials research. The Institute?s efforts were guided by an advisory board comprising eminent researchers from outside KY. Initial research efforts were focused on the discovery of new materials and processes for solar cells and Li ion battery electrodes. Initial sets of results helped PIs to secure a successful EPSCoR cluster implementation grant by teaming with additional researchers from UK. In addition to research efforts, the project enabled several other outcomes: (a) helped recruit a junior faculty member (Dr. Moises Carreon) and establish a lab focused on meso-porous materials toward separation and catalysis; (b) enabled offering of three new, graduate level courses (Materials characterization using spectroscopy and microscopy; Electron and x-ray diffraction; and renewable energy systems); and (c) mentoring of a junior faculty members (Dr. Gerold Willing).

  3. Tokyo Institute of Technology Tokyo Institute of Technology

    E-Print Network [OSTI]

    Shimodaira, Hidetoshi

    Tokyo Institute of Technology 2004 #12; Tokyo Institute of Technology k O(n-k/2) (Efron et al 1996) 2O(B) (Shimodaira 2002, 2004) O(B) #12; Tokyo Institute of Technology of Technology 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 23 4 5 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5 1 23 4 5 1 2 3 4 5

  4. Computer Science Research Institute 2003 annual report of activities.

    SciTech Connect (OSTI)

    DeLap, Barbara J.; Womble, David Eugene; Ceballos, Deanna Rose

    2006-03-01T23:59:59.000Z

    This report summarizes the activities of the Computer Science Research Institute (CSRI) at Sandia National Laboratories during the period January 1, 2003 to December 31, 2003. During this period the CSRI hosted 164 visitors representing 78 universities, companies and laboratories. Of these 78 were summer students or faculty members. The CSRI partially sponsored 5 workshops and also organized and was the primary host for 3 workshops. These 3 CSRI sponsored workshops had 178 participants--137 from universities, companies and laboratories, and 41 from Sandia. Finally, the CSRI sponsored 18 long-term collaborative research projects and 5 Sabbaticals.

  5. Cyclotron Institute Upgrade Project

    SciTech Connect (OSTI)

    Clark, Henry [Texas A& M University; Yennello, Sherry [Texas A& M University; Tribble, Robert [Texas A& M University

    2014-08-26T23:59:59.000Z

    The Cyclotron Institute at Texas A&M University has upgraded its accelerator facilities to extend research capabilities with both stable and radioactive beams. The upgrade is divided into three major tasks: (1) re-commission the K-150 (88”) cyclotron, couple it to existing beam lines to provide intense stable beams into the K-500 experimental areas and use it as a driver to produce radioactive beams; (2) develop light ion and heavy ion guides for stopping radioactive ions created with the K-150 beams; and (3) transport 1+ ions from the ion guides into a charge-breeding electron-cyclotron-resonance ion source (CB-ECR) to produce highly-charged radioactive ions for acceleration in the K-500 cyclotron. When completed, the upgraded facility will provide high-quality re-accelerated secondary beams in a unique energy range in the world.

  6. Benefits | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find More Like3.3Benefits ofBenefits ScienceBenefits

  7. Joint Genome Institute's Automation Approach and History

    E-Print Network [OSTI]

    Roberts, Simon

    2006-01-01T23:59:59.000Z

    Joint Genome Institute’s Automation Approach and Historythroughput environment; – automation does not necessarilyissues “Islands of Automation” – modular instruments with

  8. Southface Energy Institute: Advanced Commercial Buildings Initiative...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Southface Energy Institute: Advanced Commercial Buildings Initiative - 2015 Peer Review Southface Energy Institute: Advanced Commercial Buildings Initiative - 2015 Peer Review...

  9. IFI TECHNICAL REPORTS Institute of Computer Science,

    E-Print Network [OSTI]

    Behnke, Sven

    version) Alexander GreÃ?1 and Gabriel Zachmann2 1 Institute of Computer Science II 2 Institute of Computer

  10. Social Network and Communications Institutional Change Principle...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Network and Communications Institutional Change Principle Social Network and Communications Institutional Change Principle Federal agencies can use social networks and...

  11. Comparative studies of diverged members of the phosphotriesterase family 

    E-Print Network [OSTI]

    Arriens, Cristina Gale

    2013-02-22T23:59:59.000Z

    -ndel ponl-sap pon I -Gsap pon1-sap* pon1-sap+ CGGCTTCCGCATATGGCGAAGCTGATTGCG GCTCTTCCGCATTAGAGCTCACAGTAAAGAGC GGTGGTTGCTCTTCCGCATTAGAGCTCACAGT AAAGAGC GCTCTTCTCTGTTAGAGACAGTAAAGAGC CGGCTTATGGCATGGGTGCGCTCTTCTCTGTTA GAGACAGTAAAGAGC Reactions were... Technologies Lab of the Institute of Developmental /k Molecular for analysis. The sequencing protocol was repeated using internal primers PON I-201a and PONI-201 to obtain the complete sequence of the gene. INTRODUCTION OF RESTRICTION SITES Primers PONI-sap...

  12. Networks, Local Institutions and Agriculture

    E-Print Network [OSTI]

    Udry, Chris

    2009-01-01T23:59:59.000Z

    Working Paper Series Agriculture for Development Paper No.Institutions and Agriculture. Chris Udry Yale UniversityMay 2009 Conference on “Agriculture for Development in Sub-

  13. Elektronisk Institut Danmarks Tekniske Universitet

    E-Print Network [OSTI]

    Mosegaard, Klaus

    Elektronisk Institut Danmarks Tekniske Universitet Bygning 349 2800 Lyngby Eksamensprojekt tjener som dokumentation for et eksamensprojekt i forbindel­ se med civilingeniørstudiet ved Danmarks

  14. PRITZKER INSTITUTE FOR BIOMEDICAL SCIENCE

    E-Print Network [OSTI]

    Heller, Barbara

    for undergraduate students, such as Engineering Themes in Health, REU and PURE. 2. Promote innovative thinking academic units and elevate international reputation of the Pritzker Institute. #12;

  15. Energy conversion device with support member having pore channels

    DOE Patents [OSTI]

    Routkevitch, Dmitri [Longmont, CO; Wind, Rikard A [Johnstown, CO

    2014-01-07T23:59:59.000Z

    Energy devices such as energy conversion devices and energy storage devices and methods for the manufacture of such devices. The devices include a support member having an array of pore channels having a small average pore channel diameter and having a pore channel length. Material layers that may include energy conversion materials and conductive materials are coaxially disposed within the pore channels to form material rods having a relatively small cross-section and a relatively long length. By varying the structure of the materials in the pore channels, various energy devices can be fabricated, such as photovoltaic (PV) devices, radiation detectors, capacitors, batteries and the like.

  16. Central Georgia El Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual Siteof EnergyInnovation inOpenadd: China DatangCentral El tricaCentral Georgia El Member

  17. Niobrara Valley El Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |JilinLuOpen EnergyNelsoniX LtdNewNingguoNiobrara Valley El Member Corp

  18. South River Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro Industries Pvt LtdShawangunk, NewSingaporeSonixInformation ParkRiver Elec Member Corp Jump

  19. Joe Wheeler Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup |Jilin Zhongdiantou New Energy Co LtdJinzhouJoe Wheeler Elec Member Corp

  20. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members Michael

  1. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members

  2. Members | ANSER Center | Argonne-Northwestern National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your Home andDispositionMechanicalAboutMembers Home >

  3. United Rural Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnualProperty Edit withTianlin BaxinUmwelt Management AG UMaAG JumpEuropeUnited Rural Elec Member

  4. Tri-State Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov YouKizildere IRaghuraji Agro IndustriesTown of Ladoga, Indiana (UtilityTri-State Electric Member Corp Jump to: navigation,

  5. ancillary benefit modeling: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    benefits for the environment? Not all agree on this. This article discusses how a smart meter helps a utility to monitor energy usage. That monitoring data then allows the...

  6. additional virological benefit: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    benefits for the environment? Not all agree on this. This article discusses how a smart meter helps a utility to monitor energy usage. That monitoring data then allows the...

  7. Adult Female English Language Learners: Investment, Identity and Benefits 

    E-Print Network [OSTI]

    Wharton, Anna

    2013-07-31T23:59:59.000Z

    for investing in the English language. This study explores the self-recounted experiences of three adult female English language learners’ (ELLs) motivation for investing in English language learning, their identities and the benefits gained in a nonacademic...

  8. Program Focuses on Genetic Benefits and Improved Pregnancy Rates

    E-Print Network [OSTI]

    , sire evaluation and selection, diagnostic palpation, and other core practices. Since 2007, the schools 86,000 head of cattle. Economic Impact The economic benefit of the schools was measured in terms

  9. Benefit-cost assessment of aviation environmental policies

    E-Print Network [OSTI]

    Gilmore, Christopher K. (Christopher Kenneth)

    2012-01-01T23:59:59.000Z

    This thesis aids in the development of a framework in which to conduct global benefit-cost assessments of aviation policies. Current policy analysis tools, such as the aviation environmental portfolio management tool (APMT), ...

  10. Environmental Benefits and Performance Measures: Defining National Ecosystem Restoration and

    E-Print Network [OSTI]

    US Army Corps of Engineers

    Environmental Benefits and Performance Measures: Defining National Ecosystem Restoration and how of Engineers #12;The Issue The Corps created an ecosystem restoration mission out of congressional authorities ecosystem services enough to reduce national welfare. Implementing projects under that mission requires

  11. Can propane school buses save money and provide other benefits...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Can propane school buses save money and provide other benefits? October 1, 2014 Tweet EmailPrint School districts across the country are looking for ways to save money and be more...

  12. Verifying the Benefits and Resolving the Issues in the Commercializati...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Sponsored by the U.S. DOE's EERE FreedomCar and Fuel Partnership and 21st Century Truck Programs. 2006deerkaufman.pdf More Documents & Publications Key Benefits in Using...

  13. analyzes risks benefits: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the uncertainty and risk associated with power planning. The difficult lessons we have learned may benefit other parts of the country. In the 1970s, utility planners... Sheets, E....

  14. Desiccants: Benefits for the Second Century of Air-Conditioning

    E-Print Network [OSTI]

    McGahey, K.; Harriman, L.

    1996-01-01T23:59:59.000Z

    Desiccant technology now stands where mechanical cooling stood in the 1930's. Desiccant systems have been used by industrial engineers to achieve productivity and energy benefits which far outweigh their installed cost. Now, with lower cost...

  15. THE UNIVERSITY OF RHODE ISLAND FRINGE BENEFIT AVERAGE RATE

    E-Print Network [OSTI]

    Rhode Island, University of

    THE UNIVERSITY OF RHODE ISLAND FRINGE BENEFIT AVERAGE RATE FY 2015 Allocation Cost or Classified.2% URI Budget & Financial Planning Office 9.17.14 Office:fringebenefits:office of sponsored projects: FY2015 Allocation #12;

  16. 2014 EMPLOYEE BENEFIT INSURANCE PLAN CONTACTS Health Insurance

    E-Print Network [OSTI]

    2014 EMPLOYEE BENEFIT INSURANCE PLAN CONTACTS Health Insurance Anthem Blue Cross and Blue Shield www.anthem.com Ù BlueAdvantage Point of Service Plan (HMO/POS) Ù PRIME Health Plan (PPO) and Custom Plus Health Plan Phone

  17. DIRECTOR CIVILIAN BENEFITS CENTER Date: 3 October 2013

    E-Print Network [OSTI]

    annuity. Join James Marshall of Federal Retirement Planning, LLC, as he discusses options you might.public.navy.mil/donhr/Benefits/ebis/Pages/Default.aspx. Thank you, Mary E. Foley #12;

  18. Net Benefits to Agriculture from the Trinity River Project, Texas

    E-Print Network [OSTI]

    Fish, B.; Williford, G.; Elling, H.; Lacewell, R. D.; Hosch, P.; Griffin, W.; Reddell, D. L.; Hiler, E. A.; Bausch, W.

    by applying published seasonal flood damage factors and flood frequency as developed from a producer survey to annual gross returns. Annual net benefits were calculated as net returns with flood protection less net returns without flood protection...

  19. Indoor Environmental Quality Benefits of Apartment Energy Retrofits

    E-Print Network [OSTI]

    Urban Habitat Initiatives Inc. Boston, MA, USA June 2013 Funding was provided by the California Energy energy consumption and improving indoor environmental quality (IEQ). Retrofit measures varied among1 Indoor Environmental Quality Benefits of Apartment Energy Retrofits Federico Norisa, , Gary

  20. BENEFIT 2015 Funding Opportunity Announcement Webinar 2 (Text Version)

    Broader source: Energy.gov [DOE]

    Below is the text version of the webinar, BENEFIT 2015 Funding Opportunity Announcement 2, presented in October 2014 by Antonio Bouza and Jim Payne of the Building Technologies Office.

  1. Do job-seekers benefit from contacts? : a direct test

    E-Print Network [OSTI]

    Lan, George

    2012-01-01T23:59:59.000Z

    While it is intuitively plausible that using contacts in job search benefits a job-seeker, there is still both theoretical disagreement and inconclusive empirical evidence on why a job-seeker's social capital is associated ...

  2. Benefits Summary - Term Appointments in Regular Job Class | Argonne...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Term Appointments in Regular Job Class Download a brochure on benefits offered to term appointments in the regular job class (over 6 months). 2015 Long Term Appts. in Regular...

  3. Climate VISION: Resources and Links - Programs and Partnerships

    Office of Scientific and Technical Information (OSTI)

    The Electric Power Research Institute (EPRI), founded in 1973, is a non-profit energy research consortium benefiting utility members, their customers, and society. EPRI's...

  4. Generalization Improvement in Multi-Objective Learning Lars Graning, Yaochu Jin, Senior Member, IEEE, and Bernhard Sendhoff, Senior Member, IEEE

    E-Print Network [OSTI]

    Jin, Yaochu

    and Bernhard Sendhoff are with Honda Re- search Institute Europe GmbH, Carl-Legien-Strasse 30, D-63073 Offenbach (Main), Germany (email: lars.graening@honda-ri.de; yaochu.jin@honda- ri.de; bernhard.sendhoff@honda

  5. Integrative Bioengineering Institute

    SciTech Connect (OSTI)

    Eddington, David; Magin,L,Richard; Hetling, John; Cho, Michael

    2009-01-09T23:59:59.000Z

    Microfabrication enables many exciting experimental possibilities for medicine and biology that are not attainable through traditional methods. However, in order for microfabricated devices to have an impact they must not only provide a robust solution to a current unmet need, but also be simple enough to seamlessly integrate into standard protocols. Broad dissemination of bioMEMS has been stymied by the common aim of replacing established and well accepted protocols with equally or more complex devices, methods, or materials. The marriage of a complex, difficult to fabricate bioMEMS device with a highly variable biological system is rarely successful. Instead, the design philosophy of my lab aims to leverage a beneficial microscale phenomena (e.g. fast diffusion at the microscale) within a bioMEMS device and adapt to established methods (e.g. multiwell plate cell culture) and demonstrate a new paradigm for the field (adapt instead of replace). In order for the field of bioMEMS to mature beyond novel proof-of-concept demonstrations, researchers must focus on developing systems leveraging these phenomena and integrating into standard labs, which have largely been ignored. Towards this aim, the Integrative Bioengineering Institute has been established.

  6. Mainstreaming Transport Co-benefits Approach: A Guide to Evaluating...

    Open Energy Info (EERE)

    Guide to Evaluating Transport Projects AgencyCompany Organization: Institute for Global Environmental Strategies Focus Area: Multi-sector Impact Evaluation Topics: Best Practices...

  7. Incorporating Non-energy Benefits into Energy Savings Performance Contracts

    E-Print Network [OSTI]

    Larsen, Peter

    2013-01-01T23:59:59.000Z

    Retrofits for ESCOs and ESCO Customers. ” Nationalperformance of the U.S. ESCO industry: Results from theInstitutional Markets for ESCO Services: Comparing Programs,

  8. The Health Benefits of Tackling Climate Change: An Executive...

    Open Energy Info (EERE)

    National Institute for Health Research, London School of Hygiene and Tropical Medicine, Economic and Social Research Council, Department of Health, The Academy of Medical...

  9. Michigan Institute for Plasma Sci-

    E-Print Network [OSTI]

    Shyy, Wei

    This talk will focus on the achievements of the Drexel Plasma Institute in direct application of plasmasMichigan Institute for Plasma Sci- ence and Engi- neering Seminar Plasma Medicine: Mechanisms of Direct Non-Thermal Plasma Interaction with Living Tissue Prof. Alexander Fridman Drexel University

  10. Joint Seminar Risk Management Institute &

    E-Print Network [OSTI]

    Chaudhuri, Sanjay

    Joint Seminar Risk Management Institute & Department of Decision Sciences Details of Seminar Date and statistics is leading to a greatly broadened theory of regression which draws on tools of convex analysis with factor analysis in finance and economics. Risk Management Institute Joint Seminar #12;

  11. WANGER INSTITUTE FOR SUSTAINABLE ENERGY

    E-Print Network [OSTI]

    Heller, Barbara

    WANGER INSTITUTE FOR SUSTAINABLE ENERGY RESEARCH (WISER) Strategic Plan Summary #12;WISER Strategic Plan Summary | 1 WANGER INSTITUTE FOR SUSTAINABLE ENERGY RESEARCH (WISER) STRATEGIC PLAN SUMMARY 1 by developing and supporting undergraduate research in energy and sustainability related areas. · Develop co

  12. UNIVERSITT POTSDAM Institut fr Mathematik

    E-Print Network [OSTI]

    Potsdam, Universität

    . But it will be clear that the proposed procedures can be used as a pretreatment in other data structures for generatingUNIVERSITÄT POTSDAM Institut für Mathematik Statistical Scaling of Categorical Data Henning Läuter of Categorical Data Henning Läuter and Ayad Ramadan Institute of Mathematics, University of Potsdam e

  13. UNIVERSITT POTSDAM Institut fr Mathematik

    E-Print Network [OSTI]

    Potsdam, Universität

    . But it will be clear that the proposed procedures can be used as a pretreatment in other data structures for generatingUNIVERSITÄT POTSDAM Institut für Mathematik Modeling and Scaling of Categorical Data Henning Läuter of Categorical Data Henning Läuter and Ayad Ramadan Institute of Mathematics, University of Potsdam e

  14. DEPARTMENTOFHEALTHANDHUMANSERVICES National Institutes of Health

    E-Print Network [OSTI]

    Baker, Chris I.

    DEPARTMENTOFHEALTHANDHUMANSERVICES National Institutes of Health Office of Extramural Research 9000 Institutes of Health (NIH), part of the Department of Health and Human Services (DHHS), is the principal health research agency of the U.S. Federal Government. The Office of Extramural Research (OER) provides

  15. Institute for Mineral and Energy

    E-Print Network [OSTI]

    for energy. Mining and processing are vulnerable to energy price increases. Power is the largest contributingInstitute for Mineral and Energy Resources Answering Global Resource and Energy Challenges #12;Answering Global Resource and Energy Challenges 2 Vision The vision of the Institute for Mineral and Energy

  16. INSTITUTE ON ASSETS & SOCIAL POLICY

    E-Print Network [OSTI]

    Snider, Barry B.

    INSTITUTE ON ASSETS & SOCIAL POLICY Tatjana Meschede Thomas M. Shapiro Laura Sullivan Jennifer Wheary LIVING LONGER ON LESS REPORT #3 #12;DevelopeD by: The Institute on Assets and Social Policy The Heller School for Social Policy and Management Brandeis University in collaboration with: Dmos | www

  17. April 19, 2011 Smithsonian Institution

    E-Print Network [OSTI]

    Mathis, Wayne N.

    -fuel and hybrid vehicles. The Smithsonian fulfilled the renewable energy goal by purchasing green power from windApril 19, 2011 Smithsonian Institution 2010 Scorecard on Sustainability and Energy Performance Below is the Smithsonian Institution's fiscal year 2010 scorecard on sustainability and energy

  18. New York Network Members Join Forces to Create Green Jobs | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    York Network Members Join Forces to Create Green Jobs New York Network Members Join Forces to Create Green Jobs Photo of a group of five people standing, looking at the camera....

  19. ORSSAB Member Greg Paulus Served His Country, Helped People with Disabilities

    Broader source: Energy.gov [DOE]

    ORSSAB member Greg Paulus is a Top Gun. He earned that distinction flying F4 fighters for the Air Force.

  20. 31320-2014-EN Member states -Service contract -Prior Information Notice -Not applicable 1/2

    E-Print Network [OSTI]

    Crowther, Paul

    OJ/S S20 29/01/2014 31320-2014-EN Member states - Service contract - Prior Information Notice - Not applicable 1/2 29/01/2014 S20 http://ted.europa.eu/TED Member states - Service contract - Prior Information/S S20 29/01/2014 31320-2014-EN Member states - Service contract - Prior Information Notice

  1. Certification of Health Care Provider for Family Member's Serious Health Condition

    E-Print Network [OSTI]

    Myers, Lawrence C.

    Certification of Health Care Provider for Family Member's Serious Health Condition Family FMLA protections because of a need for leave to care for a covered family member with a serious health condition to submit a medical certification issued by the health care provider of the covered family member

  2. NWEC Comments: Environmental Costs and Benefits 1 Methodology for Determining Quantifiable Environmental Costs

    E-Print Network [OSTI]

    NWEC Comments: Environmental Costs and Benefits 1 Methodology for Determining Quantifiable Environmental Costs and Benefits Comments of the NW Energy Coalition October 31, 2014 Introduction: Applying (Council) to include a methodology for determining quantifiable environmental costs and benefits in its

  3. 04/18/2005 1 of 3 Voluntary and Involuntary Termination Benefits Guidelines

    E-Print Network [OSTI]

    Yamamoto, Keith

    04/18/2005 1 of 3 Voluntary and Involuntary Termination Benefits Guidelines Governmental Accounting Standards Board (GASB) Statement #47 requires two classification types of termination benefits ­ voluntary and involuntary. Voluntary termination benefits include inducements to hasten separation from employment

  4. Algal Biofuels: Long-Term Energy Benefits Drive U.S. Research...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Biofuels: Long-Term Energy Benefits Drive U.S. Research Algal Biofuels: Long-Term Energy Benefits Drive U.S. Research Algal Biofuels: Long-Term Energy Benefits Drive U.S. Research...

  5. An investigation of buckling of compression members having initial curvature

    E-Print Network [OSTI]

    Robertson, Raymond Coy

    1962-01-01T23:59:59.000Z

    be solved as p &2EI Por= AL2 ~ Eq. 4 This equation is Euler's equation as it is known today, and in this form 1t is used as the basis for many column design formula. A discussion of the various forms of this equation may be found in any good book... distribution procedure are tabulated below. Member P (klps) kL SL/EI EI/1" S Sb 8, Sd BC CD 234 4. 74 W. 8064 2. 50 - 2. 02 -2. 02 0 4 0000 3, 75 15 F 00 15 F 00 15. 00 0 0 4. 0000 3, 33 13, 33 13. 00 13, 33 CF 585 5. 30 -3. 769 5. 00 -18. S6 -18. 86...

  6. The University of Puerto Rico is a well established and mature institution, with a total enrollment of

    E-Print Network [OSTI]

    Gilbes, Fernando

    The University of Puerto Rico is a well established and mature institution, with a total enrollment of Puerto Rico. It holds membership in the Middle States Commission on Higher Education since 1946 by professional entities. The Mayagüez Campus of the University of Puerto Rico is a member of Oak Ridge Associated

  7. POSTDOCTORAL FELLOWSHIP: DIGITAL HUMANITIES AND NEW MEDIA The Institute for Women's and Gender Studies (IWGS) at the University of

    E-Print Network [OSTI]

    Martin, Jeff

    POSTDOCTORAL FELLOWSHIP: DIGITAL HUMANITIES AND NEW MEDIA The Institute for Women's and Gender in Digital Humanities and New Media starting as soon as possible, and lasting up to two years. The successful Postdoctoral Fellow will consult and collaborate with faculty members on digital and new media projects. S

  8. Materials Research Institute 199 Materials Research Institute Building

    E-Print Network [OSTI]

    Lee, Dongwon

    to biotechnology, building materials to automobiles, and much more. With more than a century of expertise projects in Penn State history. MRI and the Huck Institutes for the Life Sciences will join together

  9. Stefan Meyer Institute for Subatomic Physics

    E-Print Network [OSTI]

    Drmota, Michael

    Stefan Meyer Institute for Subatomic Physics Contact: Stefan Meyer Institute for Subatomic Physics, Austria Content: Stefan Meyer Institute for Subatomic Physics Layout: Ing. Doris Stückler, Mag. Angelika Eckel Copyright: Stefan Meyer Institute for Subatomic Physics Photographs: Stefan Meyer Institute

  10. Costs and Benefits of Renewables Portfolio Standards in the United States

    E-Print Network [OSTI]

    Barbose, Galen

    2014-01-01T23:59:59.000Z

    Approval of Its Amended Renewable Energy Plan. June 3, 2013.Benefits of Complying with Renewable Portfolio Standards:The Costs and Benefits of Renewable Resource Procurement in

  11. BTS: SEP How To Guide: Access Systems Benefit Charges for Programs

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    will strengthen the Energy Offices and produce multiple energy, environmental, and economic benefits for the States. Secure funding through System Benefit Charges for energy...

  12. Energy information systems (EIS): Technology costs, benefit, and best practice uses

    E-Print Network [OSTI]

    Granderson, Jessica

    2014-01-01T23:59:59.000Z

    systems (EIS): Technology costs, benefit, and best practicesystems (EIS): Technology costs, benefits, and best practicesystems: 1. What are the technology costs of an EIS? 2. What

  13. Institutional computing (IC) information session

    SciTech Connect (OSTI)

    Koch, Kenneth R [Los Alamos National Laboratory; Lally, Bryan R [Los Alamos National Laboratory

    2011-01-19T23:59:59.000Z

    The LANL Institutional Computing Program (IC) will host an information session about the current state of unclassified Institutional Computing at Los Alamos, exciting plans for the future, and the current call for proposals for science and engineering projects requiring computing. Program representatives will give short presentations and field questions about the call for proposals and future planned machines, and discuss technical support available to existing and future projects. Los Alamos has started making a serious institutional investment in open computing available to our science projects, and that investment is expected to increase even more.

  14. Section 8 Termination of a Tenured Faculty Member and Procedures for Termination of a Tenured Faculty Member for Adequate Cause4

    E-Print Network [OSTI]

    Cui, Yan

    The appointment of a tenured faculty member may be terminated because of: (a) resignation; (b) retirement; (c be made early enough to obviate embarrassment or inconvenience to UTHSC. Faculty members who wish's Appointment Due to Retirement Policies and procedures governing retirement, including disability retirement

  15. Replicating the benefits of closed timelike curves without breaking causality

    E-Print Network [OSTI]

    Xiao Yuan; Syed M. Assad; Jayne Thompson; Jing Yan Haw; Vlatko Vedral; Timothy C. Ralph; Ping Koy Lam; Christian Weedbrook; Mile Gu

    2014-12-17T23:59:59.000Z

    In general relativity, closed timelike curves can break causality with remarkable and unsettling consequences. At the classical level, they induce causal paradoxes disturbing enough to motivate conjectures that explicitly prevent their existence. At the quantum level, resolving such paradoxes induce radical benefits - from cloning unknown quantum states to solving problems intractable to quantum computers. Instinctively, one expects these benefits to vanish if causality is respected. Here we show that in harnessing entanglement, we can efficiently solve NP-complete problems and clone arbitrary quantum states - even when all time-travelling systems are completely isolated from the past. Thus, the many defining benefits of closed timelike curves can still be harnessed, even when causality is preserved. Our results unveil the subtle interplay between entanglement and general relativity, and significantly improve the potential of probing the radical effects that may exist at the interface between relativity and quantum theory.

  16. Demand response compensation, net Benefits and cost allocation: comments

    SciTech Connect (OSTI)

    Hogan, William W.

    2010-11-15T23:59:59.000Z

    FERC's Supplemental Notice of Public Rulemaking addresses the question of proper compensation for demand response in organized wholesale electricity markets. Assuming that the Commission would proceed with the proposal ''to require tariff provisions allowing demand response resources to participate in wholesale energy markets by reducing consumption of electricity from expected levels in response to price signals, to pay those demand response resources, in all hours, the market price of energy for such reductions,'' the Commission posed questions about applying a net benefits test and rules for cost allocation. This article summarizes critical points and poses implications for the issues of net benefit tests and cost allocation. (author)

  17. Benefits | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find More Like3.3Benefits of ParticipatingBenefits

  18. Benefits | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced Materials Find More Like3.3Benefits ofBenefits Science

  19. Universitat Wurzburg Institut fur Informatik

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    pruft, ob zwischen allen Punkten eines Netzes eine elektrische Verbindung besteht. IsolationstestUniversitat Wurzburg Institut fur Informatik Research Report Series Kunstliche Neuronale Netze fur, die notwen- dige elektrische Verschaltung der Bauteile realisiert. Bei der Herstellung von Leiterplat

  20. Community Development Financial Institutions Fund

    Broader source: Energy.gov [DOE]

    The U.S. Department of Treasury is accepting applications on the Community Development Financial Institutions (CDFI) Fund, which has opened the fiscal year 2015 funding round for the CDFI Program...

  1. Multiple Motivations Institutional Change Principle

    Broader source: Energy.gov [DOE]

    The multiple motivations principle suggests that a portfolio approach—rather than a single strategy—may be required to achieve change. Research demonstrates that people and institutions adopt new...

  2. INSTITUT FRANAIS ECOLE NATIONALE SUPERIEURE

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    INSTITUT FRANÇAIS DU PETROLE J)\\J MONT ECOLE NATIONALE SUPERIEURE DES MINES DE PARIS -THESE PETROLE Soutenue le 29 avril 1988 devant lejury composé de : Réf. I.F.P. 37269 P.c. de GRACIANSKY M

  3. Bioinformatics InstituteBII 2009

    E-Print Network [OSTI]

    Tan, Chew Lim

    bioinformatics Institute is dedicated to discover biomolecular mechanisms in a computational biology of biomolecular mechanisms that link genome information and phenotypes. Computational biology has entered a new biology becomes instrumental to generate qualitatively new biological insight. The Bioinformatics

  4. Proposed Program: Voluntary Retirement Incentive Program for Staff Proposed by: University of Tennessee Institute of Agriculture (UTIA)

    E-Print Network [OSTI]

    Tennessee, University of

    : 1. Eligible for federal retirement benefits under a Voluntary Early Retirement Authority (VERA)2#12;#12;Proposed Program: Voluntary Retirement Incentive Program for Staff Proposed by: University of Tennessee Institute of Agriculture (UTIA) Purpose: The UTIA Voluntary Retirement Incentive Program for Staff

  5. Puerto Rico Water Resources & Environmetal Research Institute

    E-Print Network [OSTI]

    Puerto Rico Water Resources & Environmetal Research Institute Annual Technical Report FY 2013 Puerto Rico Water Resources & Environmetal Research Institute Annual Technical Report FY 20131 #12;Introduction The Puerto Rico Water Resources and Environmental Research Institute (PRWRERI) is located

  6. Puerto Rico Water Resources & Environmetal Research Institute

    E-Print Network [OSTI]

    Puerto Rico Water Resources & Environmetal Research Institute Annual Technical Report FY 2012 Puerto Rico Water Resources & Environmetal Research Institute Annual Technical Report FY 20121 #12;Introduction The Puerto Rico Water Resources and Environmental Research Institute (PRWRERI) is located

  7. Global Compact for Higher Education Institutions

    E-Print Network [OSTI]

    Global Compact for Higher Education Institutions Communicating on Progress for Université Laval Guide to the United Nations Global Compact for Higher Education Institutions: Implementing the Global to the United Nations Global Compact for Higher Education Institutions: Implementing the Global Compact

  8. 2006 Annual Report Summer Research Institute Interfacial and Condensed Phase Chemical Physics

    SciTech Connect (OSTI)

    Avery, Nikki B.; Barlow, Stephan E.

    2006-11-10T23:59:59.000Z

    The Pacific Northwest National Laboratory (PNNL) hosted its third annual Summer Research Institute in Interfacial and Condensed Phase Chemical Physics from May through September 2006. During this period, twenty PNNL scientists hosted twenty-seven scientists from twenty-five different universities. Of the twenty-seven participants, one was a graduating senior; twenty-one were graduate students; one was a postdoctoral fellow; and four were university faculty members.

  9. 2007 Annual Report Summer Research Institute Interfacial and Condensed Phase Chemical Physics

    SciTech Connect (OSTI)

    Beck, Kenneth M.

    2007-10-31T23:59:59.000Z

    The Pacific Northwest National Laboratory (PNNL) hosted its fourth annual Summer Research Institute in Interfacial and Condensed Phase Chemical Physics from April through September 2007. During this time, 21 PNNL scientists hosted 23 participants from 20 different universities. Of the 23 participants, 20 were graduate students, 1 was a postdoctoral fellow, and 2 were university faculty members. This report covers the essense of the program and the research the participants performed.

  10. Core Values Based Brand Building: Institutional Stakeholder's Attitudes towards the Texas A&M University Brand

    E-Print Network [OSTI]

    Hutchinson, Michael Daniel

    2011-10-21T23:59:59.000Z

    OF PHILOSOPHY Approved by: Chair of Committee, Gregg Bennett Committee Members, John N. Singer Paul J. Batista William M. Pride Head of Department, Richard Kreider August 2010 Major Subject: Kinesiology iii ABSTRACT... Core Values Based Brand Building: Institutional Stakeholder?s Attitudes towards the Texas A&M University Brand. (August 2010) Michael Daniel Hutchinson, B.S., Mississippi College; M.S., Texas A&M University Chair of Advisory Committee: Dr. Gregg...

  11. PEBB Benefits Open Enrollment September 1 October 31, 2013

    E-Print Network [OSTI]

    Oregon, University of

    will be required if you enroll in or make changes to life insurance or long term care insurance. 2 #12;* 3 #12 copay · Kaiser · Substance abuse treatment covered in full, no cost to member · Bariatric surgery. · Dependent Care FSA ­ use State pre-tax dollars to pay for out-of-pocket child care expenses for a domestic

  12. The Institutes of Technology [as amended by Institutes of Technology,] (Amendment, Act, 1963.

    E-Print Network [OSTI]

    Sivalingam, Krishna M.

    The Institutes of Technology Act, 1961 [as amended by Institutes of Technology,] (Amendment, Act, 1963.] Indian Institute of Technology, Powai, Bombay ­ 400 076 #12;THE INSTITUTES OF TECHNOLOGY ACT. THE SCHEDULE #12;THE INSTITUTES OF TECHNOLOGY, ACT, 1961 No. 59 of 1961 [as amended by Institutes of Technology

  13. DOE - Office of Legacy Management -- Massachusetts Institute...

    Office of Legacy Management (LM)

    Massachusetts Institute of Technology Hood Building - MA 01 FUSRAP Considered Sites Site: MASSACHUSETTS INSTITUTE OF TECHNOLOGY, HOOD BUILDING (MA.01 ) Eliminated from further...

  14. Shaoxing Jinggong Mechanical and Electrical Research Institute...

    Open Energy Info (EERE)

    Shaoxing Jinggong Mechanical and Electrical Research Institute Company SJMERI Jump to: navigation, search Name: Shaoxing Jinggong Mechanical and Electrical Research Institute...

  15. Institut fr Medizinische Mikrobiologie, Virologie und Hygiene

    E-Print Network [OSTI]

    Lübeck, Universität zu

    Institut für Medizinische Mikrobiologie, Virologie und Hygiene Forschungsgruppe Virologie Das Institut für Medizinische Mikrobiologie, Virologie und Hygiene an den Universitätskliniken Hamburg

  16. Climate Change Science Institute | Clean Energy | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Climate Change Science Institute SHARE Climate Change Science Institute To advance understanding of the Earth system, describe the consequences of climate change, and evaluate and...

  17. 3DEP in Oregon by the Numbers Expected annual benefits

    E-Print Network [OSTI]

    Torgersen, Christian

    total cost (quality level 2) $32.41 million Payback 0.7 years Quality level 1 buy-up estimate $203DEP in Oregon by the Numbers Expected annual benefits (quality level 2) $45.73 million Estimated resource management; forest resources management; water supply and quality; infrastructure and construction

  18. Benefits of Windows Small Business Server Code Name "Aurora"

    E-Print Network [OSTI]

    Hunt, Galen

    Benefits of Windows Small Business Server Code Name "Aurora" includes: Daily automatic backups Business Server Code Name "Aurora" provides an easy-to-use solution ideal for first server small businesses with up to 25 users, Windows Small Business Server Code Name "Aurora" provides a cost-effective and easy

  19. Blue Choice New EnglandSM Summary of Benefits

    E-Print Network [OSTI]

    Aalberts, Daniel P.

    Blue Choice New EnglandSM Summary of Benefits Williams College An Association of Independent Blue Cross and Blue Shield Plans This health plan meets Minimum Creditable Coverage Standards Reform Law. #12;Your Care Your Primary Care Provider. When you enroll in Blue Choice New England, you

  20. Benefits of Location-Based Access Control: A Literature Study

    E-Print Network [OSTI]

    Wieringa, Roel

    Benefits of Location-Based Access Control: A Literature Study Andr´e van Cleeff, Wolter Pieters.pieters, r.j.wieringa}@utwente.nl Abstract--Location-based access control (LBAC) has been suggested-based, physical and logical access control, (ii) improving the transparency of LBAC decision making, and (iii

  1. Benefits of Multiple TX Powers Robustness to Beacon Node Failure

    E-Print Network [OSTI]

    Chen, Yiling

    the partial failure of the infrastructure. Our system, called MoteTrack, is based on low-power radios coupledAccuracy Benefits of Multiple TX Powers Robustness to Beacon Node Failure Introduction to a wide range of applications. For some, the location tracking system must continue to operate despite

  2. Biomass DHP/ CHP benefits at local and regional level

    E-Print Network [OSTI]

    Biomass DHP/ CHP ­ benefits at local and regional level Krzysztof Gierulski EC Baltic RenewableEnergy Workshop, Brussels 01.07.2002 http://www.managenergy.net/conference/ren0702/gierulski.pdf #12;Biomass DHP of conversion to biomass CHP at larger sites in PL", OPET) n Technical assistance (,,Feasibility

  3. Biomass DHP/ CHP benefits at local and regional level

    E-Print Network [OSTI]

    Biomass DHP/ CHP ­ benefits at local and regional level Krzysztof Gierulski EC Baltic RenewableEnergy Workshop, Brussels 01.07.2002 #12;Biomass DHP/ CHP in Poland n Plan of the presentation n Promotion and dissemination of best practices (,,Promotion of conversion to biomass CHP at larger sites in PL", OPET) n

  4. Providing better indoor environmental quality brings economic benefits

    E-Print Network [OSTI]

    Fisk, William; Seppanen, Olli

    2007-01-01T23:59:59.000Z

    to operate fans cost 0.10 € per kWh, the daily energy costdata, and energy costs of 0.04 € per kWh for heat and 0.1 €0.05 and 0.15 € per kWh, the benefit-cost ratios are 80 and

  5. Enhancing the Benefits of Geospatial Data NNeebbrraasskkaaMMAAPP

    E-Print Network [OSTI]

    Nebraska-Lincoln, University of

    Enhancing the Benefits of Geospatial Data NNeebbrraasskkaaMMAAPP http://www.NebraskaMAP.gov Improving Access to Geospatial Data for Nebraskans More than 80% of the decisions made in government and the private sector are based on analyses of geospatial data. Such decisions involve property valuation

  6. results and benefits... Birmingham Cutting your CO2

    E-Print Network [OSTI]

    Everest, Graham R

    results and benefits... Birmingham Cutting your CO2 Birmingham City Council July 2007 c a s e s t u of the BirminghamCutting CO2 campaign, news items, display materials etc. · Advising on pledge gathering materials system was launched in July 2007 as part of the `Birmingham Cutting Your CO2' campaign. By the end

  7. Potential Materials Science Benefits from a Burning Plasma

    E-Print Network [OSTI]

    Potential Materials Science Benefits from a Burning Plasma Science Experiment S.J. Zinkle Oak Ridge;Introduction · The main materials science advances from a BPSX would occur during the R&D phase prior to construction ­e.g., CIT/BPX, ITER · Materials science opportunities during operation of a BPSX would likely

  8. ANIMAL TRACING: BENEFITS IN CATTLE INDUSTRY AND PRIVATE INCENTIVES

    E-Print Network [OSTI]

    McCarl, Bruce A.

    AND PRIVATE INCENTIVES The economic implications of foreign animal diseases and their mitigation options haveANIMAL TRACING: BENEFITS IN CATTLE INDUSTRY AND PRIVATE INCENTIVES LEVAN ELBAKIDZE Assistant Research Professor Department of Agricultural Economics Texas A&M University College Station, TX, 77843

  9. The Composition of Compensation Policy: From Cash to Fringe Benefits

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    in the design of incentives by employers. However, this issue has been surprisingly left aside of economic composition of the compensation policy with both monetary and nonmonetary incentives. We characterize over monetary and nonmonetary benefits is common knowledge to both parties, nonmonetary incentives

  10. New Jersey State Health Benefits Monthly Group Dental Rates

    E-Print Network [OSTI]

    New Jersey State Health Benefits Monthly Group Dental Rates Effective January 1, 2013 to December.68 305 CIGNA Dental Health, Inc www.cigna.com/stateofnj 800-367-1037 All of New Jersey (Except Cape May County); Eastern Pennsylvania $11.28 $19.63 $32.10 $23.79 307 Healthplex (International Heath Care

  11. Who benefits from the US withdrawal of the Kyoto protocol?

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    gases. This convention, called the United Nations Framework Convention on Climate Change (UNFCCC and that Japan and Russia benefited from the United States withdrawal (in term of a priori decisional power). Key-made) interference with the climate system". The UNFCCC is the governing body for international negotiations

  12. Eat your way to better health Quality health plans & benefits

    E-Print Network [OSTI]

    Acton, Scott

    Eat your way to better health Quality health plans & benefits Healthier living Financial well-being Intelligent solutions Good food is the key to good health If we ate a variety of healthy foods and didn't eat oils. Or those found in olive, canola and peanut oils. They can help improve your health when you use

  13. Operational benefits of relaxed axial power distribution control limits

    SciTech Connect (OSTI)

    Kitlan, M.S. Jr.; Miller, R.W.

    1987-01-01T23:59:59.000Z

    Constant axial offset control (CAOC) was developed in the early 1970s in response to lower loss-of-coolant accident-based peaking factor limits. Th CAOC requires control of the axial power distribution within a specified band, typically +/- 5% or +3, -12% axial flux difference (AFD), about a measured target value of AFD. Operational outside of the CAOC limits results in the accumulation of penalty time. One hour of penalty time in any 24-h period is permitted. Although CAOC is sufficient to ensure peaking factor limits are satisfied, operation outside of CAOC limits is beneficial under certain conditions. Allowing a relaxation in CAOC restrictions can be used both to enhance the load follow capability of the plant by allowing control strategies that minimize the boron system duty or increase the return to power capability and to greatly increase the ability to return to power after a plant trip or shutdown. To achieve these benefits, relaxed axial offset control (RAOC) was developed. Other benefits of RAOC include a simplified technical specification and the ability to perform in-core/ex-core calibrations at higher powers. Duke Power Company has benefited in many of these ways by changing from CAOC power distribution limits to RAOC power distribution limits at the McGuire Nuclear Station. One of the chief benefits has been the ability to achieve full power much more quickly following shutdowns of short duration and reactor trips during the last half of the cycle lifetime.

  14. Stakeholders and their respective costs-benefits in IR evaluation

    E-Print Network [OSTI]

    Thomas, Paul

    on investment, and productivity). Delone and McLean (1992) attempted to consolidate the work on evaluation that both benefits and costs have to be taken into account to decide on the success of an information system. In this position paper, we advocate a consumers' guide to systems that aim at supporting information seeking tasks

  15. From: DON Benefits Officer To: All Civilian employees

    E-Print Network [OSTI]

    of the application. By applying early for retirement you allow the CBC sufficient time to resolve any issues which7/30/2010 From: DON Benefits Officer To: All Civilian employees Subj: Selecting Your Retirement Date 1. Retiring from your career as a Federal civilian employee is a major life event and deciding

  16. DESIGNING BENEFIT RULES FOR FLEXIBLE RETIREMENT: WELFARE VS. REDISTRIBUTION*

    E-Print Network [OSTI]

    Tóth, János

    these incentives are dysfunctional: they hardly sanction early retirement and they hardly support late retirementDESIGNING BENEFIT RULES FOR FLEXIBLE RETIREMENT: WELFARE VS. REDISTRIBUTION* P. ESÕ ­ A. SIMONOVITS) With flexible (variable) retirement every individual determines his optimal retirement age, depend- ing

  17. Participant Benefit Booklet July 1, 2010 -June 30, 2011

    E-Print Network [OSTI]

    New Mexico, University of

    of the University of New Mexico for its Public Operation known as University of New Mexico (UNM) #12;PHP Customer Benefit Booklet PPO Plan Plan Code: HWP10016 EFFECTIVE: July 1, 2010 Offered by University of New Mexico.................................................................... 19 Utilization Management Procedures

  18. Participant Benefit Booklet July 1, 2011 -June 30, 2012

    E-Print Network [OSTI]

    New Mexico, University of

    of the University of New Mexico for its Public Operation known as University of New Mexico (UNM) #12;Presbyterian Participant Benefit Booklet PPO Plan Plan Code: HWP10016 EFFECTIVE: July 1, 2011 Offered by University of New.................................................................... 18 Utilization Management Procedures

  19. Participant Benefit Booklet July 1, 2012 -June 30, 2013

    E-Print Network [OSTI]

    New Mexico, University of

    of the University of New Mexico for its Public Operation known as University of New Mexico (UNM) #12;Presbyterian Participant Benefit Booklet PPO Plan Plan Code: HWP10016 EFFECTIVE: July 1, 2012 Offered by University of New.................................................................... 18 Utilization Management Procedures

  20. The Benefits of Planar Magnetics in OF Power Conversion

    E-Print Network [OSTI]

    is increased, are related to the magnetic components: transformers and inductors. Unless the copper and coreThe Benefits of Planar Magnetics in OF Power Conversion Planar Magnetics (PM): The Technology that Meets the Challenges of HF Switch and Resonant Mode Power Conversion Professor Sam Ben-Yaakov Department

  1. The Benefits of Student Research in Information Systems Security Education

    E-Print Network [OSTI]

    Irvine, Cynthia E.

    to batteries. At the age of eight, I learned the difference between series and parallel circuits and how benefitted from that choice. Mrs. Demerec's classroom was like no other. Housed in the old cafeteria for the younger students. For example, in fourth grade I painted some cardboard boxes to look like houses

  2. benefit description Mit student/Affiliate Medical plan

    E-Print Network [OSTI]

    Polz, Martin

    that includes a variety of health care benefits. The MIT Student Health Plan is designed to fulfill the state is the Mit student Medical plan. It provides you with primary care, outpatient mental health care, and a wide hospitalization, inpatient mental health and substance abuse treatment, surgical procedures, and prescription

  3. The Impacts and Benefits Yielded from the Sport of Quidditch

    E-Print Network [OSTI]

    Cohen, Adam

    2013-08-06T23:59:59.000Z

    grounded theory approach and examined the impact and benefits for volunteers who chose to work for the IQA. Findings suggested the unique atmosphere of quidditch was able to produce an environment that yielded positive impact on the volunteers. It was found...

  4. Using Strokes as Command Shortcuts: Cognitive Benefits and Toolkit Support

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Using Strokes as Command Shortcuts: Cognitive Benefits and Toolkit Support Caroline Appert1,2 2 LRI in com- parison to keyboard shortcuts when there is no mnemonic link between the shortcut and the command stroke shortcuts to Java Swing applications with just a few lines of code. ACM Classification Keywords H

  5. WE -ADKWindows Embedded Automotive Development Kit Benefits to the developer

    E-Print Network [OSTI]

    Narasayya, Vivek

    WE -ADKWindows Embedded Automotive Development Kit Benefits to the developer: The Official-ADK, Microsoft Auto 4.1 installs on top of Windows® Embedded CE 6.0 R3 and adds automotive -specific an Automotive Infotainment Solution with Microsoft Auto 4.1 and Qualnetics WE

  6. A METHODOLOGY TO ASSESS THE BENEFITS OF SMART ORDER ROUTING

    E-Print Network [OSTI]

    Boyer, Edmond

    ' services. Keywords: Electronic Markets, Process Optimisation, Smart Order Router. 1 INTRODUCTION European states. Thus, nearly all trading activity in a security was conducted in its home market [1A METHODOLOGY TO ASSESS THE BENEFITS OF SMART ORDER ROUTING Bartholomäus Ende, Peter Gomber, Marco

  7. Crafting Platform Strategy based on Anticipated Benefits and Costs1

    E-Print Network [OSTI]

    de Weck, Olivier L.

    Chapter 2 Crafting Platform Strategy based on Anticipated Benefits and Costs1 Bruce G. Cameron, with a view to creating long-term competitive advantage for the firm. 2.1 Introduction Platforming industrial products. Example include Volkswagen's MQB platform (including VW Golf, Audi A3, and Seat Octavia

  8. An abrupt stochastic damage function to analyse climate policy benefits

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , such as the quantification of impacts at the local level, the effects of adaptation and mitigation activities, the definition-efficiency analysis to stochastic cost-benefit analysis. Early assessments highlighted that if the atmospheric carbon dioxide (CO2) con- centration is to be stabilised at a level of 450 ppmv or below, economically optim

  9. COLUMBIA UNIVERSITY Departmental Accident Report Form for Worker's Compensation Benefits

    E-Print Network [OSTI]

    Jia, Songtao

    COLUMBIA UNIVERSITY Departmental Accident Report Form for Worker's Compensation Benefits EMPLOYEE___________ ACCIDENT DATA (to be completed by employee) Date of Injury_____/_____/____ Time of Injury the employee How did the injury or illness occur? (Describe fully the events that caused the accident) Describe

  10. ENVIRONMENTAL ENRICHMENT REDUCES THE MNEMONIC AND NEURAL BENEFITS OF ESTROGEN

    E-Print Network [OSTI]

    Frick, Karyn M.

    ENVIRONMENTAL ENRICHMENT REDUCES THE MNEMONIC AND NEURAL BENEFITS OF ESTROGEN J. E. GRESACKa AND K response to estrogen. Female mice were raised in standard (SC) or enriched (EC) condi- tions from weaning protein synaptophysin and of brain- derived neurotrophic factor (BDNF) were measured. Enrich- ment effects

  11. August 15, 2013 Bargaining Update 7: UC, Nurses' Union discuss benefits, workplace safety

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    . · Revised eligibility rules for retiree health care Even with these changes, UC's retirement benefits organizations do not offer a pension plan and very few offer retiree health benefits. #12; These reforms key issues such as health benefits and post-employment benefits. In addition to providing employees

  12. Demonstration of Security Benefits of Renewable Generation at FE Warren Air Force Base

    SciTech Connect (OSTI)

    Warwick, William M.; Myers, Kurt; Seifert, Gary

    2010-12-31T23:59:59.000Z

    Report detailing field demonstration of security benefits of renewable generation at FE Warren Air Force Base.

  13. Clean Cities Offers Fleets New Tool to Evaluate Benefits of Alternative Fuel Vehicles

    Broader source: Energy.gov [DOE]

    The AFLEET Tool allows fleets to calculate payback periods and emissions benefits of alternative fuel vehicles.

  14. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are beingZealand Jump to: navigation, search OpenEIHesperia,IDGWPIndiantown,Innoferm GmbH JumpInstitute forInstitution

  15. Institution Name Institution Name Address Place Zip Notes Website Region

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving Energy.gov You are now leaving Energy.gov You are being directedAnnual SiteofEvaluatingGroup | OpenHunan RunhuaInner Mongolia FengweiCSU Institute for theInstitute

  16. Sun Life Financial (Sun Life) Benefit Adjudication Effective December 1, 2008, Sun Life became the health and dental benefits carrier for active

    E-Print Network [OSTI]

    Sun Life Financial (Sun Life) Benefit Adjudication Effective December 1, 2008, Sun Life became to maintain the level of benefits coverage with Sun Life. Sun Life has identified a number of GWL practices not been processed by Sun Life The Pension & Benefits office was advised by GWL that they would process all

  17. Costs and benefits of railway urban logistics: a prospective social cost benefit analysis Jesus Gonzalez-Feliu

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    - economic cost benefit analysis. Firstly, we propose an overview on the basic notions of CBA and SCBA researchers and practitioners and incite them to develop such practices (usage of SCBA in urban logistics of this paper is to propose a SCBA-based analysis framework for strategic scenario assessment in the context

  18. Economy: Clean Energy and the Assessing the Many Benefits of State and Local Clean Energy Initiatives Multiple Benefits of Clean Energy Initiatives

    E-Print Network [OSTI]

    unknown authors

    Reducing energy demand and increasing renewable energy generation from state and local clean energy initiatives—such as goals, standards, codes, funds, and programs—generate many benefits including: ••Security, diversity, and overall reliability improvements for the electric system. ••Improved environmental quality, human health, and quality of life. ••Increased economic prosperity. This brochure is part of a series and focuses on economic benefits. What are the economic benefits of clean energy? Clean energy initiatives, including those that advance energy efficiency, renewable energy and clean distributed generation can: ?Lower ? energy costs. ?Increase ? personal disposable income. ?Increase ? revenue for businesses. ?Increase ? income, employment, and output. ?Reduce ? fuel costs and new electric power plant construction costs. ?Reduce ? health care costs as a result of better air quality and public health. How do clean energy initiatives benefit the economy? ?Direct ? Economic Benefits: Companies that provide the equipment, technologies, and services needed to implement an initiative benefit from increased demand, which increases their revenue and their ability to hire more people. In the case of energy efficiency, consumers and companies both benefit by spending less money on electricity. ?Indirect ? Economic Benefits: Suppliers to clean energy equipment and service providers benefit as demand for their inputs and revenues increase. With higher demand, these suppliers may also hire more workers. ?Induced ? Economic Benefits: Income generated from the direct and indirect effects is spent in the regional economy, such as when employees use their paychecks to buy groceries, eat out, and entertain themselves, all of which support jobs in those sectors. What’s Inside: • Why assess the economic benefits of clean energy? • How can policy makers estimate the macroeconomic benefits of clean energy? • A Benefits Flash with quantitative examples of how clean energy initiatives result in economic, air quality, and public health benefits. • Where to go for more information. Direct economic benefits of a wind initiative could increase: • Sales of wind turbines. • Revenue of local turbine manufacturers.

  19. Multimodal Vessel Visualization of Mouse Aorta PET/CT Scans Timo Ropinski, Member, IEEE, Sven Hermann, Rainer Reich, Michael Schafers, and Klaus Hinrichs, Member, IEEE

    E-Print Network [OSTI]

    Hinrichs, Klaus

    Multimodal Vessel Visualization of Mouse Aorta PET/CT Scans Timo Ropinski, Member, IEEE, Sven present a visualization system for the visual analysis of PET/CT scans of aortic arches of mice

  20. Institutes and Centers.DIS 1 Weizmann Institute of Science

    E-Print Network [OSTI]

    Shapiro, Ehud

    Center for the Biology of Aging Prof Head, The Carl and Micaela Einhorn-Dominic Center for Brain Research and Immunological Disorders Prof Head, The Murray H. & Meyer Grodetsky Center for Research of High Brain Functions Center for Brain Imaging Prof Head, The Willner Family Center for Vascular Biology Prof #12;Institutes