National Library of Energy BETA

Sample records for initial production ip

  1. WP-07 IP Direct Testimony (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCase Initial

  2. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  3. August 1998Published for the Members of the IP Multicast Initiative. BROADCAST on page 6

    E-Print Network [OSTI]

    Touch, Joe

    and financial services, media and manufacturing, retail, energy, telecommunications, and more. Our services in the international business community, with offices in eight countries in North America, Asia, and Europe. Our-known aggregator of Internet audio sites, became America's best-ever initial publicoffering when its shares opened

  4. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  5. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  6. Biofuel Production Initiative at Claflin University Final Report

    SciTech Connect (OSTI)

    Chowdhury, Kamal

    2011-07-20

    For US transportation fuel independence or reduced dependence on foreign oil, the Federal Government has mandated that the country produce 36 billion gallons (bg) of renewable transportation fuel per year for its transportation fuel supply by 2022. This can be achieved only if development of efficient technology for second generation biofuel from ligno-cellulosic sources is feasible. To be successful in this area, development of a widely available, renewable, cost-effective ligno-cellulosic biomass feedstock that can be easily and efficiently converted biochemically by bacteria or other fast-growing organisms is required. Moreover, if the biofuel type is butanol, then the existing infrastructure to deliver fuel to the customer can be used without additional costs and retrofits. The Claflin Biofuel Initiative project is focused on helping the US meet the above-mentioned targets. With support from this grant, Claflin University (CU) scientists have created over 50 new strains of microorganisms that are producing butanol from complex carbohydrates and cellulosic compounds. Laboratory analysis shows that a number of these strains are producing higher percentages of butanol than other methods currently in use. All of these recombinant bacterial strains are producing relatively high concentrations of acetone and numerous other byproducts as well. Therefore, we are carrying out intense mutations in the selected strains to reduce undesirable byproducts and increase the desired butanol production to further maximize the yield of butanol. We are testing the proof of concept of producing pre-industrial large scale biobutanol production by utilizing modifications of currently commercially available fermentation technology and instrumentation. We have already developed an initial process flow diagram (PFD) and selected a site for a biobutanol pilot scale facility in Orangeburg, SC. With the recent success in engineering new strains of various biofuel producing bacteria at CU, it will soon be possible to provide other technical information for the development of process flow diagrams (PFD’s) and piping and instrumentation diagrams (P&ID’s). This information can be used for the equipment layout and general arrangement drawings for the proposed process and eventual plant. An efficient bio-butanol pilot plant to convert ligno-cellulosic biomass feedstock from bagasse and wood chips will create significant number of green jobs for the Orangeburg, SC community that will be environmentally-friendly and generate much-needed income for farmers in the area.

  7. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  8. The Komera Initiative : turning product design into public service

    E-Print Network [OSTI]

    Aust, Laura E

    2010-01-01

    Every mechanical engineering student at MIT takes the same courses: 2.009 being one of them. In our capstone product design course at MIT, most students glean an incredible amount from their teams, mentors, and projects, ...

  9. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  10. Clean Energy Manufacturing Initiative Industrial Efficiency and Energy Productivity

    SciTech Connect (OSTI)

    Selldorff, John; Atwell, Monte

    2014-09-23

    Industrial efficiency and low-cost energy resources are key components to increasing U.S. energy productivity and makes the U.S. manufacturing sector more competitive. Companies find a competitive advantage in implementing efficiency technologies and practices, and technologies developed and manufactured in the U.S. enable greater competitiveness economy-wide.

  11. Higgs Production by Gluon initiated Weak Boson Fusion

    E-Print Network [OSTI]

    M. M. Weber

    2007-09-17

    The gluon-gluon induced terms for Higgs production through weak-boson fusion are calculated. They form a finite and gauge-invariant subset of the NNLO corrections in the strong coupling constant. This is also the lowest order with sizeable t-channel colour exchange contributions, leading to additional hadronic activity between the outgoing jets.

  12. Clean Energy Manufacturing Initiative Industrial Efficiency and Energy Productivity

    ScienceCinema (OSTI)

    Selldorff, John; Atwell, Monte

    2014-12-03

    Industrial efficiency and low-cost energy resources are key components to increasing U.S. energy productivity and makes the U.S. manufacturing sector more competitive. Companies find a competitive advantage in implementing efficiency technologies and practices, and technologies developed and manufactured in the U.S. enable greater competitiveness economy-wide.

  13. Coiled tubing as initial production tubing: An overview of case histories

    SciTech Connect (OSTI)

    Nirider, H.L.; Snider, P.M.; Walsh, K.D.; Williams, J.D.; Cordera, J.R.

    1995-05-01

    From Jan. 1993 through Feb. 1995 Marathon Oil Co. completed 23 newly drilled gas wells with coiled tubing as the initial production string. This paper reviews operational aspects of representative jobs, summarizes areas where improvements in equipment and technique were implemented, and addresses cost and productivity benefits of rigless completions. A summary of lessons learned is also included.

  14. TEST RESULTS FOR INITIAL PRODUCTION OF LHC INSERTION REGION DIPOLE MAGNETS*

    E-Print Network [OSTI]

    Large Hadron Collider Program

    TEST RESULTS FOR INITIAL PRODUCTION OF LHC INSERTION REGION DIPOLE MAGNETS* J. F. Muratore , M at 7.56 TeV. The magnets will be tested at 4.5 K using either forced flow supercritical helium or liquid helium. This paper reports the results of tests of four D1 magnets, including spontaneous quench

  15. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  16. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  17. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  18. Pair production in a strong electric field: an initial value problem in quantum field theory

    E-Print Network [OSTI]

    Y. Kluger; J. M. Eisenberg; B. Svetitsky

    2003-11-23

    We review recent achievements in the solution of the initial-value problem for quantum back-reaction in scalar and spinor QED. The problem is formulated and solved in the semiclassical mean-field approximation for a homogeneous, time-dependent electric field. Our primary motivation in examining back-reaction has to do with applications to theoretical models of production of the quark-gluon plasma, though we here address practicable solutions for back-reaction in general. We review the application of the method of adiabatic regularization to the Klein-Gordon and Dirac fields in order to renormalize the expectation value of the current and derive a finite coupled set of ordinary differential equations for the time evolution of the system. Three time scales are involved in the problem and therefore caution is needed to achieve numerical stability for this system. Several physical features, like plasma oscillations and plateaus in the current, appear in the solution. From the plateau of the electric current one can estimate the number of pairs before the onset of plasma oscillations, while the plasma oscillations themselves yield the number of particles from the plasma frequency. We compare the field-theory solution to a simple model based on a relativistic Boltzmann-Vlasov equation, with a particle production source term inferred from the Schwinger particle creation rate and a Pauli-blocking (or Bose-enhancement) factor. This model reproduces very well the time behavior of the electric field and the creation rate of charged pairs of the semiclassical calculation. It therefore provides a simple intuitive understanding of the nature of the solution since nearly all the physical features can be expressed in terms of the classical distribution function.

  19. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Ĺ in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  20. Study of the Exclusive Initial State RadiationProduction of the D \\bar D System

    SciTech Connect (OSTI)

    Aubert, B.

    2006-09-07

    A study of exclusive production of the D{bar D} system through initial-state radiation is performed in a search for charmonium states, where D = D{sup 0} or D{sup +}. The D{sup 0} mesons are reconstructed in the D{sup 0} {yields} K{sup -}{pi}{sup +}, D{sup 0} {yields} K{sup -}{pi}{sup +}{pi}{sup 0}, and D{sup 0} {yields} K{sup -}{pi}{sup +}{pi}{sup +}{pi}{sup -} decay modes. The D{sup +} is reconstructed through the D{sup +} {yields} K{sup -}{pi}{sup +}{pi}{sup +} decay mode. The analysis makes use of an integrated luminosity of 288.5 fb{sup -1} collected by the BABAR experiment. The D{bar D} mass spectrum shows a clear {psi}(3770) signal. Further structures appear in the 3.9 and 4.1 GeV/c{sup 2} regions. No evidence is found for Y(4260) decays to D{bar D}, implying an upper limit {Beta}(Y(4260) {yields} D{bar D})/{Beta}(Y(4260) {yields} J/{psi}{pi}{sup +}{pi}{sup -}) < 7.6 (95% confidence level).

  1. Coiled tubing as initial production tubing: An overview of case histories

    SciTech Connect (OSTI)

    Nirider, H.L.; Snider, P.M.; Walsh, K.D.; Cordera, J.R.; Williams, J.

    1994-12-31

    From January, 1993 through July, 1994 Marathon Oil, Company completed ten newly drilled gas wells using coiled tubing as the initial production string. This paper reviews the operational aspects of each job and summarizes the areas where improvements in equipment and technique were implemented. The use of coiled tubing allows the tubing size to be closely matched to the performance of these relatively low rate wells, minimizing the tubular costs and improving the well`s ability to stay unloaded. The main areas of improvement from one job to the next involved the use of a pressurized, hydraulically operated access window, ensuring that all frac sand was cleaned out prior to landing the coiled tubing and employing a ``hot cut off`` system to make the final cut on the coil tubing. Lessons learned include keeping the coiled tubing size large enough to run smaller coiled tubing through it for clean out and slickline work, care in closing the BOP rams to avoid damaging the pipe and the use of wellhead equipment specifically designed for coiled tubing. This technique is especially suited to low pressure and water sensitive reservoirs where loss of fluid is of concern. An additional benefit is the cost savings from reducing the hole and casing sizes to match the reservoir potential. This completion technique is often quicker than using a conventional completion rig and jointed tubing.

  2. The U.S. Dry-Mill Ethanol Industry: Biobased Products and Bioenergy Initiative Success Stories

    SciTech Connect (OSTI)

    2009-10-28

    This fact sheet provides an overview of the history of ethanol production in the United States and describes innovations in dry-mill ethanol production.

  3. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  4. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ˇ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  5. Pigeonpea genomics initiative (PGI): an international effort to improve crop productivity of pigeonpea (Cajanus cajan L.)

    E-Print Network [OSTI]

    2010-01-01

    009-9327-2 Pigeonpea genomics initiative (PGI): anIndia R. K. Varshney (&) Genomics Towards Gene Discoverycrop legume’. To enable genomics-assisted breeding in this

  6. WP-07 IP Rebuttal Testimony (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCase

  7. WP-07 IP Studies & Documentation (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCaseStudies

  8. Positron and gamma-photon production and nuclear reactions in cascade processes initiated by a sub-terawatt femtosecond laser

    E-Print Network [OSTI]

    Kaplan, Alexander

    Positron and gamma-photon production and nuclear reactions in cascade processes initiated by a sub, through specially arranged cascade processes in optimal targets, substantial amounts of nuclear radiation-6951 97 02350-4 Numerous proposals to induce nuclear transformations by intense lasers see, e.g., Ref. 1

  9. Green-IT: Green Initiative for Energy Efficient, Eco-products in the Construction Industry 

    E-Print Network [OSTI]

    Bhar, R.

    2008-01-01

    GREEN-IT aims to introduce a product database [e2pilot] in the European building construction product sector and accelerate the EU market transformation towards regulated Energy Performance of Buildings....

  10. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  11. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  12. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  13. Breckinridge Project, initial effort. Report VII, Volume I. Introduction and background. [Storage losses of 28 products and by-products

    SciTech Connect (OSTI)

    none,

    1982-01-01

    The proposed plant site consists of 1594 acres along the Ohio River in Breckinridge County, Kentucky. An option to purchase the site has been secured on behalf of the Breckinridge Project by the Commonwealth of Kentucky Department of Energy. Figure 1 is an area map locating the site with respect to area cities and towns. The nearest communities to the site are the hamlet of Stephensport, Kentucky, about 3-1/2 miles northeast and Cloverport, Kentucky, which is 6 miles to the southwest. The nearest major cities are Owensboro, Kentucky, 45 road miles to the west and Louisville, Kentucky, 65 miles to the northeast. The Breckinridge facility will convert about 23,000 TPD of run-of-mine (ROM) coal into a nominal 50,000 BPD of hydrocarbon liquids including a significant quantity of transportation fuels. Major products refined for marketing include pipeline gas, propane, butane, 105 RONC gasoline reformate, middle distillate and heavy distillate. By-products include sulfur, anhydrous ammonia, and commercial-grade phenol. Care is being taken to minimize the impact of the facility operations on the environment. Water and wastewater treatment systems have been designed to achieve zero discharge. Waste solids will be disposed of in a carefully designed and well-monitored landfill operation. Also, special design features have been included to minimize air emissions.

  14. The Mississippi University Research Consortium for the Utilization of Biomass: Production of Alternative Fuels from Waste Biomass Initiative

    SciTech Connect (OSTI)

    Drs. Mark E. Zapp; Todd French; Lewis Brown; Clifford George; Rafael Hernandez; Marvin Salin; Drs. Huey-Min Hwang, Ken Lee, Yi Zhang; Maria Begonia; Drs. Clint Williford; Al Mikell; Drs. Robert Moore; Roger Hester .

    2009-03-31

    The Mississippi Consortium for the Utilization of Biomass was formed via funding from the US Department of Energy's EPSCoR Program, which is administered by the Office of Basic Science. Funding was approved in July of 1999 and received by participating Mississippi institutions by 2000. The project was funded via two 3-year phases of operation (the second phase was awarded based on the high merits observed from the first 3-year phase), with funding ending in 2007. The mission of the Consortium was to promote the utilization of biomass, both cultured and waste derived, for the production of commodity and specialty chemicals. These scientific efforts, although generally basic in nature, are key to the development of future industries within the Southeastern United States. In this proposal, the majority of the efforts performed under the DOE EPSCoR funding were focused primarily toward the production of ethanol from lignocellulosic feedstocks and biogas from waste products. However, some of the individual projects within this program investigated the production of other products from biomass feeds (i.e. acetic acid and biogas) along with materials to facilitate the more efficient production of chemicals from biomass. Mississippi is a leading state in terms of raw biomass production. Its top industries are timber, poultry production, and row crop agriculture. However, for all of its vast amounts of biomass produced on an annual basis, only a small percentage of the biomass is actually industrially produced into products, with the bulk of the biomass being wasted. This situation is actually quite representative of many Southeastern US states. The research and development efforts performed attempted to further develop promising chemical production techniques that use Mississippi biomass feedstocks. The three processes that were the primary areas of interest for ethanol production were syngas fermentation, acid hydrolysis followed by hydrolyzate fermentation, and enzymatic conversion. All three of these processes are of particular interest to states in the Southeastern US since the agricultural products produced in this region are highly variable in terms of actual crop, production quantity, and the ability of land areas to support a particular type of crop. This greatly differs from the Midwestern US where most of this region's agricultural land supports one to two primary crops, such as corn and soybean. Therefore, developing processes which are relatively flexible in terms of biomass feedstock is key to the southeastern region of the US if this area is going to be a 'player' in the developing biomass to chemicals arena. With regard to the fermentation of syngas, research was directed toward developing improved biocatalysts through organism discovery and optimization, improving ethanol/acetic acid separations, evaluating potential bacterial contaminants, and assessing the use of innovative fermentors that are better suited for supporting syngas fermentation. Acid hydrolysis research was directed toward improved conversion yields and rates, acid recovery using membranes, optimization of fermenting organisms, and hydrolyzate characterization with changing feedstocks. Additionally, a series of development efforts addressed novel separation techniques for the separation of key chemicals from fermentation activities. Biogas related research focused on key factors hindering the widespread use of digester technologies in non-traditional industries. The digestion of acetic acids and other fermentation wastewaters was studied and methods used to optimize the process were undertaken. Additionally, novel laboratory methods were designed along with improved methods of digester operation. A search for better performing digester consortia was initiated coupled with improved methods to initiate their activity within digester environments. The third activity of the consortium generally studied the production of 'other' chemicals from waste biomass materials found in Mississippi. The two primary examples of this activity are production of chem

  15. National Nanotechnology Initiative's Signature Initiative Sustainable...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    will include manufactured products based on: * Carbon-based nanomaterials * Optical metamaterials * Cellulosic nanomaterials National Nanotechnology Initiative Three requirements...

  16. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  17. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  18. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  19. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  20. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  1. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  2. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  3. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  4. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ˇ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  5. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  6. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  7. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  8. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  9. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  10. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  11. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  12. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  13. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  14. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  15. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  16. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  17. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  18. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  19. Product-level Bill of Material Development Methodology : process implementation

    E-Print Network [OSTI]

    Black, James William

    2010-01-01

    Cisco Systems maintains its leading position in the IP network equipment market through continual innovation and release of new products. In order to manage these new product introductions, the Product Operations group ...

  20. Assistance to Oil and Gas State Agencies and Industry through Continuation of Environmental and Production Data Management and a Water Regulatory Initiative

    SciTech Connect (OSTI)

    Grunewald, Ben; Arthur, Dan; Langhus, Bruce; Gillespie, Tom; Binder, Ben; Warner, Don; Roberts, Jim; Cox, D.O.

    2002-05-31

    This grant project was a major step toward completion of the Risk Based Data Management System (RBDMS) project. Additionally the project addresses the needs identified during the projects initial phases. By implementing this project, the following outcomes were sought: (1) State regulatory agencies implemented more formalized environmental risk management practices as they pertain to the production of oil and gas, and injection via Class II wells. (2) Enhancement of oil and gas production by implementing a management system supporting the saving of abandoned or idle wells located in areas with a relatively low environmental risk of endangering underground sources of drinking water (USDWs) in a particular state. (3) Verification that protection of USDWs is adequate and additional restrictions of requirements are not necessary in areas with a relatively low environmental risk. (4) Standardization of data and information maintained by state regulatory agencies and decrease the regulatory cost burden on producers operating in multiple states, and (5) Development of a system for electronic data transfer among operators and state regulatory agencies and reduction of overall operator reporting burdens.

  1. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  2. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  3. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  4. Progress in Initiator Modeling

    SciTech Connect (OSTI)

    Hrousis, C A; Christensen, J S

    2009-05-04

    There is great interest in applying magnetohydrodynamic (MHD) simulation techniques to the designs of electrical high explosive (HE) initiators, for the purpose of better understanding a design's sensitivities, optimizing its performance, and/or predicting its useful lifetime. Two MHD-capable LLNL codes, CALE and ALE3D, are being used to simulate the process of ohmic heating, vaporization, and plasma formation in the bridge of an initiator, be it an exploding bridgewire (EBW), exploding bridgefoil (EBF) or slapper type initiator. The initiation of the HE is simulated using Tarver Ignition & Growth reactive flow models. 1-D, 2-D and 3-D models have been constructed and studied. The models provide some intuitive explanation of the initiation process and are useful for evaluating the potential impact of identified aging mechanisms (such as the growth of intermetallic compounds or powder sintering). The end product of this work is a simulation capability for evaluating margin in proposed, modified or aged initiation system designs.

  5. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  6. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  7. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  8. Vermont Biofuels Initiative: Local Production for Local Use to Supply a Portion of Vermont�s Energy Needs

    SciTech Connect (OSTI)

    Scott Sawyer; Ellen Kahler

    2009-05-31

    The Vermont Biofuels initiative (VBI) is the Vermont Sustainable Jobs Fund�s (VSJF) biomass-to-biofuels market development program. Vermont is a small state with a large petroleum dependency for transportation (18th in per capita petroleum consumption) and home heating (55% of all households use petroleum for heating). The VBI marks the first strategic effort to reduce Vermont�s dependency on petroleum through the development of homegrown alternatives. As such, it supports the four key priorities of the U.S. Department of Energy�s Multi-year Biomass Plan: 1.) Dramatically reduce dependence on foreign oil; 2.) Promote the use of diverse, domestic and sustainable energy resources; 3.) Reduce carbon emissions from energy production and consumption; 4.) Establish a domestic bioindustry. In 2005 VSJF was awarded with a $496,000 Congressionally directed award from U.S. Senator Patrick Leahy. This award was administered through the U.S. Department of Energy (DE-FG36- 05GO85017, hereafter referred to as DOE FY05) with $396,000 to be used by VSJF for biodiesel development and $100,000 to be used by the Vermont Department of Public Service for methane biodigester projects. The intent and strategic focus of the VBI is similar to another DOE funded organization� the Biofuels Center of North Carolina�in that it is a nonprofit driven, statewide biofuels market development effort. DOE FY05 funds were expensed from 2006 through 2008 for seven projects: 1) a feedstock production, logistics, and biomass conversion research project conducted by the University of Vermont Extension; 2) technical assistance in the form of a safety review and engineering study of State Line Biofuels existing biodiesel production facility; 3) technical assistance in the form of a safety review and engineering study of Borderview Farm�s proposed biodiesel production facility; 4) technology and infrastructure purchases for capacity expansion at Green Technologies, LLC, a waste vegetable biodiesel producer; 5) technical assistance in the form of feasibility studies for AgNorth Biopower LLC�s proposed multi-feedstock biodigester; 6) technology and infrastructure purchases for the construction of a �Cow Power� biodigester at Gervais Family Farm; and 7) the education and outreach activities of the Vermont Biofuels Association. DOE FY05 funded research, technical assistance, and education and outreach activities have helped to provide Vermont farmers and entrepreneurs with important feedstock production, feedstock logistics, and biomass conversion information that did not exist prior as we work to develop an instate biodiesel sector. The efficacy of producing oilseed crops in New England is now established: Oilseed crops can grow well in Vermont, and good yields are achievable given improved harvesting equipment and techniques. DOE FY05 funds used for technology and infrastructure development have expanded Vermont�s pool of renewable electricity and liquid fuel generation. It is now clear that on-farm energy production provides an opportunity for Vermont farmers and entrepreneurs to reduce on-farm expenditures of feed and fuel while providing for their energy security. Meanwhile they are developing new value-added revenue sources (e.g., locally produced livestock meal), retaining more dollars in the local economy, and reducing greenhouse gas emissions.

  9. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  10. Clean Energy Manufacturing Initiative Industrial Efficiency and...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Industrial Efficiency and Energy Productivity Video Clean Energy Manufacturing Initiative Industrial Efficiency and Energy Productivity Video Addthis An error occurred. Try...

  11. SCB initiator

    DOE Patents [OSTI]

    Bickes Jr., Robert W.; Renlund, Anita M.; Stanton, Philip L.

    1994-11-01

    A detonator for high explosives initiated by mechanical impact includes a cylindrical barrel, a layer of flyer material mechanically covering the barrel at one end, and a semiconductor bridge ignitor including a pair of electrically conductive pads connected by a semiconductor bridge. The bridge is in operational contact with the layer, whereby ignition of said bridge forces a portion of the layer through the barrel to detonate the explosive. Input means are provided for igniting the semiconductor bridge ignitor.

  12. SCB initiator

    DOE Patents [OSTI]

    Bickes, Jr., Robert W. (Albuquerque, NM); Renlund, Anita M. (Albuquerque, NM); Stanton, Philip L. (Albuquerque, NM)

    1994-01-01

    A detonator for high explosives initiated by mechanical impact includes a cylindrical barrel, a layer of flyer material mechanically covering the barrel at one end, and a semiconductor bridge ignitor including a pair of electrically conductive pads connected by a semiconductor bridge. The bridge is in operational contact with the layer, whereby ignition of said bridge forces a portion of the layer through the barrel to detonate the explosive. Input means are provided for igniting the semiconductor bridge ignitor.

  13. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  14. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  15. Production

    Broader source: Energy.gov [DOE]

    Algae production R&D focuses on exploring resource use and availability, algal biomass development and improvements, characterizing algal biomass components, and the ecology and engineering of cultivation systems.

  16. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  17. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  18. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  19. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  20. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  1. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  2. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  3. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  4. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  5. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  6. Research Study - Global Enterprise VoIP Equipment Market Forecasts...

    Open Energy Info (EERE)

    we deeply analyzed the world's main region market conditions that including the product price, profit, capacity, production, capacity utilization, supply, demand and industry...

  7. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  8. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  9. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  10. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  11. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  12. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  13. Deep Vadose Zone Applied Field Research Initiative

    E-Print Network [OSTI]

    Deep Vadose Zone­ Applied Field Research Initiative Fiscal Year 2012 Annual Report #12;Prepared Tasks 25 References 25 Appendix: FY2012 Products for the Deep Vadose Zone­ Applied Field Research Initiative Contents #12;Message from the Deep Vadose Zone- Applied Field Research Initiative Project Manager

  14. BitPredator: A Discovery Algorithm for BitTorrent Initial Seeders and Peers

    SciTech Connect (OSTI)

    Borges, Raymond; Patton, Robert M; Kettani, Houssain; Masalmah, Yahya

    2011-01-01

    There is a large amount of illegal content being replicated through peer-to-peer (P2P) networks where BitTorrent is dominant; therefore, a framework to profile and police it is needed. The goal of this work is to explore the behavior of initial seeds and highly active peers to develop techniques to correctly identify them. We intend to establish a new methodology and software framework for profiling BitTorrent peers. This involves three steps: crawling torrent indexers for keywords in recently added torrents using Really Simple Syndication protocol (RSS), querying torrent trackers for peer list data and verifying Internet Protocol (IP) addresses from peer lists. We verify IPs using active monitoring methods. Peer behavior is evaluated and modeled using bitfield message responses. We also design a tool to profile worldwide file distribution by mapping IP-to-geolocation and linking to WHOIS server information in Google Earth.

  15. Innovation Program Student Initiated Project

    E-Print Network [OSTI]

    Bertini, Robert L.

    Innovation Program Student Initiated Project Proposal Guidelines Eligibility The team must include of the problem the innovation is meant to solve A clear description of the work to be done for the project Milestones for the project, as well as a projected 'end product' Background with enough detail

  16. MONTANA PALLADIUM RESEARCH INITIATIVE

    SciTech Connect (OSTI)

    Peters, John McCloskey, Jay Douglas, Trevor Young, Mark Snyder, Stuart Gurney, Brian

    2012-05-09

    Project Objective: The overarching objective of the Montana Palladium Research Initiative is to perform scientific research on the properties and uses of palladium in the context of the U.S. Department of Energy'Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?s Hydrogen, Fuel Cells and Infrastructure Technologies Program. The purpose of the research will be to explore possible palladium as an alternative to platinum in hydrogen-economy applications. To achieve this objective, the Initiatives activities will focus on several cutting-edge research approaches across a range of disciplines, including metallurgy, biomimetics, instrumentation development, and systems analysis. Background: Platinum-group elements (PGEs) play significant roles in processing hydrogen, an element that shows high potential to address this need in the U.S. and the world for inexpensive, reliable, clean energy. Platinum, however, is a very expensive component of current and planned systems, so less-expensive alternatives that have similar physical properties are being sought. To this end, several tasks have been defined under the rubric of the Montana Palladium Research Iniative. This broad swath of activities will allow progress on several fronts. The membrane-related activities of Task 1 employs state-of-the-art and leading-edge technologies to develop new, ceramic-substrate metallic membranes for the production of high-purity hydrogen, and develop techniques for the production of thin, defect-free platinum group element catalytic membranes for energy production and pollution control. The biomimetic work in Task 2 explores the use of substrate-attached hydrogen-producing enzymes and the encapsulation of palladium in virion-based protein coats to determine their utility for distributed hydrogen production. Task 3 work involves developing laser-induced breakdown spectroscopy (LIBS) as a real-time, in situ diagnostic technique to characterize PGEs nanoparticles for process monitoring and control. The systems engineering work in task 4 will determine how fuel cells Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?Ă?Â?taken as systems behave over periods of time that should show how their reformers and other subsystems deteriorate with time.

  17. Nuclear Energy Research Initiative Project No. 02 103 Innovative Low Cost Approaches to Automating QA/QC of Fuel Particle Production Using On Line Nondestructive Methods for Higher Reliability Final Project Report

    SciTech Connect (OSTI)

    Ahmed, Salahuddin; Batishko, Charles R.; Flake, Matthew; Good, Morris S.; Mathews, Royce; Morra, Marino; Panetta, Paul D.; Pardini, Allan F.; Sandness, Gerald A.; Tucker, Brian J.; Weier, Dennis R.; Hockey, Ronald L.; Gray, Joseph N.; Saurwein, John J.; Bond, Leonard J.; Lowden, Richard A.; Miller, James H.

    2006-02-28

    This Nuclear Energy Research Initiative (NERI) project was tasked with exploring, adapting, developing and demonstrating innovative nondestructive test methods to automate nuclear coated particle fuel inspection so as to provide the United States (US) with necessary improved and economical Quality Assurance and Control (QA/QC) that is needed for the fuels for several reactor concepts being proposed for both near term deployment [DOE NE & NERAC, 2001] and Generation IV nuclear systems. Replacing present day QA/QC methods, done manually and in many cases destructively, with higher speed automated nondestructive methods will make fuel production for advanced reactors economically feasible. For successful deployment of next generation reactors that employ particle fuels, or fuels in the form of pebbles based on particles, extremely large numbers of fuel particles will require inspection at throughput rates that do not significantly impact the proposed manufacturing processes. The focus of the project is nondestructive examination (NDE) technologies that can be automated for production speeds and make either: (I) On Process Measurements or (II) In Line Measurements. The inspection technologies selected will enable particle “quality” qualification as a particle or group of particles passes a sensor. A multiple attribute dependent signature will be measured and used for qualification or process control decisions. A primary task for achieving this objective is to establish standard signatures for both good/acceptable particles and the most problematic types of defects using several nondestructive methods.

  18. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  19. Advanced Manufacturing Initiative Improves Turbine Blade Productivity...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Awards 1.8 Million to Develop Wind Turbine Blades to Access Better Wind Resources and Reduce Costs President Obama Awards 2.3 Billion for New Clean-Tech Manufacturing Jobs...

  20. Advanced Manufacturing Initiative Improves Turbine Blade Productivity |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A sCOLONY PROJECTRecord ForDepartment of Energy

  1. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  2. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  3. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  4. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  5. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  6. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  7. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  8. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  9. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  10. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  11. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  12. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  13. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  14. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  15. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  16. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ˘ˇ¤Ł¦Ą¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  17. Guam Initial Technical Assessment Report

    SciTech Connect (OSTI)

    Baring-Gould, I.; Conrad, M.; Haase, S.; Hotchkiss, E.; McNutt, P.

    2011-04-01

    Under an interagency agreement, funded by the Department of Interior's (DOI) Office of Insular Affairs (OIA), the National Renewable Energy Laboratory (NREL) was tasked to deliver technical assistance to the island of Guam by conducting an island initial technical assessment that would lay out energy consumption and production data and establish a baseline. This assessment will be used to conduct future analysis and studies by NREL that will estimate energy efficiency and renewable energy potential for the island of Guam.

  18. APEC Smart Grid Initiative

    SciTech Connect (OSTI)

    Bloyd, Cary N.

    2012-03-01

    This brief paper describes the activities of the Asia Pacific Economic Cooperation (APEC) Smart Grid Initiative (ASGI) which is being led by the U.S. and developed by the APEC Energy Working Group. In the paper, I describe the origin of the initiative and briefly mention the four major elements of the initiative along with existing APEC projects which support it.

  19. GLOBAL TAXONOMY INITIATIVE

    E-Print Network [OSTI]

    Grant, Taran

    #12;THE GLOBAL TAXONOMY INITIATIVE: Using Systematic Inventories to Meet Country and Regional Needs (COP) to the Convention on Biological Diversity (CBD) has endorsed a GlobalTaxonomy Initiative (GTI workshop, The Global Taxonomy Initiative: Shortening the Distance between Discovery and Delivery, made

  20. Initial Production Capacity Investments for Commercializing Pharmaceutical Products

    E-Print Network [OSTI]

    Yuen, Ming Kwan

    2012-01-01

    one-time-use disposable tanks and mixers for pharmaceuticalproduction, disposable tanks and mixers can be utilized that

  1. Initial Production Capacity Investments for Commercializing Pharmaceutical Products

    E-Print Network [OSTI]

    Yuen, Ming Kwan

    2012-01-01

    Hanan. 1982. Operations research and capacity expansionEngi- neering and Operations Research Department forstochastic demands. Operations Research 40 pp. S210–S216.

  2. Initial Production Capacity Investments for Commercializing Pharmaceutical Products

    E-Print Network [OSTI]

    Yuen, Ming Kwan

    2012-01-01

    Lenos. 1996. Real Options: Managerial Flexibility andour model and traditional real options analysis, a class ofinvestment projects. Real options analysis often uses

  3. Secretary Chu Announces Initiatives to Promote Clean Energy at...

    Energy Savers [EERE]

    appliances off the market. The program will initially focus on televisions and lighting - two globally-traded products that together account for about 15 percent of...

  4. About the Initiative

    SciTech Connect (OSTI)

    Not Available

    2007-06-01

    This factsheet gives an overview of the Solar America Initiative (SAI), including goals, research and development strategy, market transformation strategy, and benefits to nation.

  5. Strategic Growth Initiative (Michigan)

    Broader source: Energy.gov [DOE]

    A joint venture between Michigan Department of Agriculture and Rural Development (MDARD) and the Michigan Economic Development Corporation (MEDC), the Strategic Growth Initiative Grant Program was...

  6. Innovation Ecosystem Development Initiative

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ideas that address today's most urgent energy challenges. For More Information For more information about the Innovation Ecosystem Initiative, please visit eere.energy.gov...

  7. Salt Waste Processing Initiatives

    Office of Environmental Management (EM)

    Patricia Suggs Salt Processing Team Lead Assistant Manager for Waste Disposition Project Office of Environmental Management Savannah River Site Salt Waste Processing Initiatives 2...

  8. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  9. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  10. The initial microstructure of oxide fuel pellets can play a key role in their performance. At low burnups, the transport of fission products has a strong dependence on oxygen content, grain size distribution, porosity

    E-Print Network [OSTI]

    The initial microstructure of oxide fuel pellets can play a key role in their performance. At low of which, in turn, depend on processing conditions. These microstructural features also affect fuel that detailed studies of the initial microstructure of the fuel, could give insights on the in

  11. Florida Hydrogen Initiative

    SciTech Connect (OSTI)

    Block, David L

    2013-06-30

    The Florida Hydrogen Initiative (FHI) was a research, development and demonstration hydrogen and fuel cell program. The FHI program objectives were to develop Florida?s hydrogen and fuel cell infrastructure and to assist DOE in its hydrogen and fuel cell activities The FHI program funded 12 RD&D projects as follows: Hydrogen Refueling Infrastructure and Rental Car Strategies -- L. Lines, Rollins College This project analyzes strategies for Florida's early stage adaptation of hydrogen-powered public transportation. In particular, the report investigates urban and statewide network of refueling stations and the feasibility of establishing a hydrogen rental-car fleet based in Orlando. Methanol Fuel Cell Vehicle Charging Station at Florida Atlantic University ? M. Fuchs, EnerFuel, Inc. The project objectives were to design, and demonstrate a 10 kWnet proton exchange membrane fuel cell stationary power plant operating on methanol, to achieve an electrical energy efficiency of 32% and to demonstrate transient response time of less than 3 milliseconds. Assessment of Public Understanding of the Hydrogen Economy Through Science Center Exhibits, J. Newman, Orlando Science Center The project objective was to design and build an interactive Science Center exhibit called: ?H2Now: the Great Hydrogen Xchange?. On-site Reformation of Diesel Fuel for Hydrogen Fueling Station Applications ? A. Raissi, Florida Solar Energy Center This project developed an on-demand forecourt hydrogen production technology by catalytically converting high-sulfur hydrocarbon fuels to an essentially sulfur-free gas. The removal of sulfur from reformate is critical since most catalysts used for the steam reformation have limited sulfur tolerance. Chemochromic Hydrogen Leak Detectors for Safety Monitoring ? N. Mohajeri and N. Muradov, Florida Solar Energy Center This project developed and demonstrated a cost-effective and highly selective chemochromic (visual) hydrogen leak detector for safety monitoring at any facility engaged in transport, handling and use of hydrogen. Development of High Efficiency Low Cost Electrocatalysts for Hydrogen Production and PEM Fuel Cell Applications ? M. Rodgers, Florida Solar Energy Center The objective of this project was to decrease platinum usage in fuel cells by conducting experiments to improve catalyst activity while lowering platinum loading through pulse electrodeposition. Optimum values of several variables during electrodeposition were selected to achieve the highest electrode performance, which was related to catalyst morphology. Understanding Mechanical and Chemical Durability of Fuel Cell Membrane Electrode Assemblies ? D. Slattery, Florida Solar Energy Center The objective of this project was to increase the knowledge base of the degradation mechanisms for membranes used in proton exchange membrane fuel cells. The results show the addition of ceria (cerium oxide) has given durability improvements by reducing fluoride emissions by an order of magnitude during an accelerated durability test. Production of Low-Cost Hydrogen from Biowaste (HyBrTec?) ? R. Parker, SRT Group, Inc., Miami, FL This project developed a hydrogen bromide (HyBrTec?) process which produces hydrogen bromide from wet-cellulosic waste and co-produces carbon dioxide. Eelectrolysis dissociates hydrogen bromide producing recyclable bromine and hydrogen. A demonstration reactor and electrolysis vessel was designed, built and operated. Development of a Low-Cost and High-Efficiency 500 W Portable PEMFC System ? J. Zheng, Florida State University, H. Chen, Bing Energy, Inc. The objectives of this project were to develop a new catalyst structures comprised of highly conductive buckypaper and Pt catalyst nanoparticles coated on its surface and to demonstrate fuel cell efficiency improvement and durability and cell cost reductions in the buckypaper based electrodes. Development of an Interdisciplinary Hydrogen and Fuel Cell Technology Academic Program ? J. Politano, Florida Institute of Technology, Melbourne, FL This project developed a hydrogen and fuel cel

  12. Research Initiatives | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultiday Production of SOA in UrbanArcticResearch Initiatives

  13. Network support for system initiated checkpoints

    DOE Patents [OSTI]

    Chen, Dong; Heidelberger, Philip

    2013-01-29

    A system, method and computer program product for supporting system initiated checkpoints in parallel computing systems. The system and method generates selective control signals to perform checkpointing of system related data in presence of messaging activity associated with a user application running at the node. The checkpointing is initiated by the system such that checkpoint data of a plurality of network nodes may be obtained even in the presence of user applications running on highly parallel computers that include ongoing user messaging activity.

  14. Energy Transition Initiative

    Office of Energy Efficiency and Renewable Energy (EERE)

    Through the Energy Transition Initiative (ETI), the U.S. Department of Energy and its partners work with government entities and other stakeholders to establish a long-term energy vision and successfully implement energy efficiency and renewable energy solutions.

  15. Initiatives | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014 | Department ofInfrastructure andInitiatives Initiatives

  16. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  17. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  18. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  19. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  20. Green Initiatives and Contracting

    Broader source: Energy.gov (indexed) [DOE]

    acquisitions of sustainable products and services. * September 30, 2011, update FPDS-NG to allow the system to track sustainable contract actions based on PSC codes entered for...

  1. RCRA facility stabilization initiative

    SciTech Connect (OSTI)

    Not Available

    1995-02-01

    The RCRA Facility Stabilization Initiative was developed as a means of implementing the Corrective Action Program`s management goals recommended by the RIS for stabilizing actual or imminent releases from solid waste management units that threaten human health and the environment. The overall goal of stabilization is to, as situations warrant, control or abate threats to human health and/or the environment from releases at RCRA facilities, and/or to prevent or minimize the further spread of contamination while long-term remedies are pursued. The Stabilization initiative is a management philosophy and should not be confused with stabilization technologies.

  2. MPhil initiatives summary

    E-Print Network [OSTI]

    2009-07-13

    stream_source_info CMI MPhil Initiatives.doc.txt stream_content_type text/plain stream_size 3755 Content-Encoding UTF-8 stream_name CMI MPhil Initiatives.doc.txt Content-Type text/plain; charset=UTF-8 CMI Summary of MPhil... 2003) Sustainable development for large infrastructure projects (50% input from CU, 50% from MIT) Planning for sustainable development (MIT course tailored for CU) Sustainable energy (MIT course tailored for CU) Design for developing countries (MIT...

  3. Clean Coal Power Initiative

    SciTech Connect (OSTI)

    Doug Bartlett; Rob James; John McDermott; Neel Parikh; Sanjay Patnaik; Camilla Podowski

    2006-03-31

    This report is the fifth quarterly Technical Progress Report submitted by NeuCo, Incorporated, under Award Identification Number, DE-FC26-04NT41768. This award is part of the Clean Coal Power Initiative (''CCPI''), the ten-year, $2B initiative to demonstrate new clean coal technologies in the field. This report is one of the required reports listed in Attachment B Federal Assistance Reporting Checklist, part of the Cooperative Agreement. The report covers the award period January 1, 2006 - March 31, 2006 and NeuCo's efforts within design, development, and deployment of on-line optimization systems during that period.

  4. Initiatives | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR0987P UncertaintyInitiatives Initiatives Through

  5. Sustainability Initiative Executive Summary

    E-Print Network [OSTI]

    Sheridan, Jennifer

    UW­Madison Sustainability Initiative Executive Summary October 2010 #12;2 We are pleased to present the final report of the campus Sustainability Task Force. This report fulfills the charge we gave to sustainability for consideration by UW­Madison's leadership and campus community. There are many reasons why

  6. Initiative for Explosives Detection

    E-Print Network [OSTI]

    of electromagnetic radiation, or to detect with currently fielded technologies. Approaches to improving detectionInitiative for Explosives Detection Highly Concealed Bulk Explosives Detection This focus area emphasizes the detection of explosives or IEDs hidden in vehicles, buildings or various types of containers

  7. Monolithic exploding foil initiator

    DOE Patents [OSTI]

    Welle, Eric J; Vianco, Paul T; Headley, Paul S; Jarrell, Jason A; Garrity, J. Emmett; Shelton, Keegan P; Marley, Stephen K

    2012-10-23

    A monolithic exploding foil initiator (EFI) or slapper detonator and the method for making the monolithic EFI wherein the exploding bridge and the dielectric from which the flyer will be generated are integrated directly onto the header. In some embodiments, the barrel is directly integrated directly onto the header.

  8. Clean Energy Manufacturing Initiative

    SciTech Connect (OSTI)

    2013-04-01

    The initiative will strategically focus and rally EERE’s clean energy technology offices and Advanced Manufacturing Office around the urgent competitive opportunity for the United States to be the leader in the clean energy manufacturing industries and jobs of today and tomorrow.

  9. BRAZIL RESEARCH INITIATIVES

    E-Print Network [OSTI]

    Liu, Taosheng

    BRAZIL RESEARCH INITIATIVES Michigan State University (MSU) identifies Brazil as a global priority and challenges become increasingly part of the U.S.-Brazil agenda, MSU desires partnerships aimed at producing in the U.S. and one in Brazil, to share research strategies and explore joint projects in several research

  10. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  11. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  12. Advances in Modeling Exploding Bridgewire Initiation

    SciTech Connect (OSTI)

    Hrousis, C A; Christensen, J S

    2010-03-10

    There is great interest in applying magnetohydrodynamic (MHD) simulation techniques to the designs of electrical high explosive (HE) initiators, for the purpose of better understanding a design's sensitivities, optimizing its performance, and/or predicting its useful lifetime. Two MHD-capable LLNL codes, CALE and ALE3D, are being used to simulate the process of ohmic heating, vaporization, and plasma formation in exploding bridgewires (EBW). Initiation of the HE is simulated using Ignition & Growth reactive flow models. 1-D, 2-D and 3-D models have been constructed and studied. The models provide some intuitive explanation of the initiation process and are useful for evaluating the potential impact of identified aging mechanisms (such as the growth of intermetallic compounds or powder sintering). The end product of this work is a simulation capability for evaluating margin in proposed, modified or aged initiation system designs.

  13. Mississippi Clean Energy Initiative

    Broader source: Energy.gov [DOE]

    Eligible manufacturers are offered a 10-year exemption from state income and franchise taxes as well as a sales and use tax exemption to establish a plant or expand an existing production facility...

  14. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  15. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  16. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  17. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  18. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  19. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  20. Through bulkhead initiator studies

    SciTech Connect (OSTI)

    Begeal, D.R.

    1997-03-01

    This report describes recent work done to demonstrate feasibility of a fail-safe Through Bulkhead Initiator with minimum dimensions and suitable for use in cyclical thermal environments. Much of the ground work for a fail-safe TBI was previously done by A.C. Schwartz. This study is an expansion of Schwartz`s work to evaluate devices with bulkheads of 304 stainless steel and Inconel 718; explosive donors of PETN, BNCP, and a 0.005 inch thick steel flying plate donor traveling at 2.6 mm/{micro}s; and explosive acceptors of PETN and BNCP. Bulkhead thickness were evaluated in the range of 0.040 to 0.180 inch. The explosive acceptors initiated a small HMX pellet to drive a 0.005 inch thick steel flying plate, and VISAR histories of the HMX-driven flying plates were the measure of acceptable performance. A companion set of samples used a PMMA acceptor to measure the particle velocities at the bulkhead/PMMA interface with VISAR. These data were used to compute the input pressure to the acceptor explosives in an attempt to measure initiation threshold. Unfortunately, the range of bulkhead thicknesses tested did not give any failures, thus the threshold was not determined. It was found that either explosive or the flying plate would perform as a TBI in the bulkhead thickness range tested. The optimum TBI is about 0.060 inches thick, and steel bulkheads seem to be more structurally sound than those made of Inconel. That is, cross section views of the Inconel bulkheads showed it to be more prone to stress cracking than was the 304 stainless steel. Both PETN and BNCP showed good performance when tested at {minus}65 F following thermal cycling of {minus}65 F to +165 F. Analysis of the TBI function times showed that BNCP acceptor explosives were undergoing the classical deflagration to detonation process. The PETN acceptors were undergoing prompt detonation.

  1. Hanford tanks initiative plan

    SciTech Connect (OSTI)

    McKinney, K.E.

    1997-07-01

    Abstract: The Hanford Tanks Initiative (HTI) is a five-year project resulting from the technical and financial partnership of the U.S. Department of Energy`s Office of Waste Management (EM-30) and Office of Science and Technology Development (EM-50). The HTI project accelerates activities to gain key technical, cost performance, and regulatory information on two high-level waste tanks. The HTI will provide a basis for design and regulatory decisions affecting the remainder of the Tank Waste Remediation System`s tank waste retrieval Program.

  2. UNLV Nuclear Hydrogen Initiative

    SciTech Connect (OSTI)

    Hechanova, Anthony E.; Johnson, Allen; O'Toole, Brendan; Trabia, Mohamed; Peterson, Per

    2012-10-25

    Evaluation of the Crack growth rate (CGR) of Alloy 617 and Alloy 276 under constant K at ambient temperature has been completed. Creep deformation of Alloy 230 at different temperature range and load level has been completed and heat to heat variation has been noticed. Creep deformation study of Alloy 276 has been completed under an applied initial stress level of 10% of yield stress at 950şC. The grain size evaluation of the tested creep specimens of Alloy 276 has been completed.

  3. Feedback stabilization initiative

    SciTech Connect (OSTI)

    NONE

    1997-06-01

    Much progress has been made in attaining high confinement regimes in magnetic confinement devices. These operating modes tend to be transient, however, due to the onset of MHD instabilities, and their stabilization is critical for improved performance at steady state. This report describes the Feedback Stabilization Initiative (FSI), a broad-based, multi-institutional effort to develop and implement methods for raising the achievable plasma betas through active MHD feedback stabilization. A key element in this proposed effort is the Feedback Stabilization Experiment (FSX), a medium-sized, national facility that would be specifically dedicated to demonstrating beta improvement in reactor relevant plasmas by using a variety of MHD feedback stabilization schemes.

  4. 2006 Initial Allocation Awards

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopmentataboutScalablePhysicist:Possible6 Awards 2006 Initial

  5. Asset Revitalization Initiative ARI

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u tCorporationIt's Potential from Tidal StreamsInitiative (

  6. Administering an epoch initiated for remote memory access

    DOE Patents [OSTI]

    Blocksome, Michael A; Miller, Douglas R

    2014-03-18

    Methods, systems, and products are disclosed for administering an epoch initiated for remote memory access that include: initiating, by an origin application messaging module on an origin compute node, one or more data transfers to a target compute node for the epoch; initiating, by the origin application messaging module after initiating the data transfers, a closing stage for the epoch, including rejecting any new data transfers after initiating the closing stage for the epoch; determining, by the origin application messaging module, whether the data transfers have completed; and closing, by the origin application messaging module, the epoch if the data transfers have completed.

  7. Administering an epoch initiated for remote memory access

    DOE Patents [OSTI]

    Blocksome, Michael A; Miller, Douglas R

    2012-10-23

    Methods, systems, and products are disclosed for administering an epoch initiated for remote memory access that include: initiating, by an origin application messaging module on an origin compute node, one or more data transfers to a target compute node for the epoch; initiating, by the origin application messaging module after initiating the data transfers, a closing stage for the epoch, including rejecting any new data transfers after initiating the closing stage for the epoch; determining, by the origin application messaging module, whether the data transfers have completed; and closing, by the origin application messaging module, the epoch if the data transfers have completed.

  8. Administering an epoch initiated for remote memory access

    DOE Patents [OSTI]

    Blocksome, Michael A.; Miller, Douglas R.

    2013-01-01

    Methods, systems, and products are disclosed for administering an epoch initiated for remote memory access that include: initiating, by an origin application messaging module on an origin compute node, one or more data transfers to a target compute node for the epoch; initiating, by the origin application messaging module after initiating the data transfers, a closing stage for the epoch, including rejecting any new data transfers after initiating the closing stage for the epoch; determining, by the origin application messaging module, whether the data transfers have completed; and closing, by the origin application messaging module, the epoch if the data transfers have completed.

  9. Breckinridge Project, initial effort

    SciTech Connect (OSTI)

    none,

    1982-01-01

    Report V, Volume 1 provides descriptions, data, and drawings pertaining to Flare System (Plant 19), Tankage (Plant 20), Interconnecting Piping (Plant 21), River Facilities (Plant 22), Rail, Truck, Pipeline (Plant 23), and Electrical Distribution (Plant 30). Flare System (Plant 19) provides primary and auxiliary flare systems for safe collection and disposal of overpressure relief discharges, and operational and emergency venting of flammable vapors and liquids from the various processing plants and loading facilities. Tankage (Plant 20) provides storage for propane and heavier liquid hydrocarbon products, as well as for by-product ammonia, phenols, and liquid sulfur. Interconnecting Piping (Plant 21) includes the fuel gas blending and distribution system and the interconnecting process and utility piping between process plants and offsites. River Facilities (Plant 22) provides the loading of liquid products and by-products into barges for marine surface transportation, and the unloading of coal from barges. Rail, Truck, Pipeline (Plant 23) provides loading and unloading of products shipped by either rail or truck. Electrical Distribution (Plant 30) receives main utility power from the Big River Electric Corporation and distributes the power to the other plants. The following information is included for each of the six plants: a description of the plant's design, including the utility balance, catalysts and chemicals usage, and process flow diagrams, as applicable; an equipment list, including item numbers and descriptions; data sheets and sketches for major plant components; and pertinent engineering drawings. An appendix contains: an overall site plan showing the locations of all plants; and the symbols and legend for piping and instrument diagrams.

  10. Initiatives for proliferation prevention

    SciTech Connect (OSTI)

    1997-04-01

    Preventing the proliferation of weapons of mass destruction is a central part of US national security policy. A principal instrument of the Department of Energy`s (DOE`s) program for securing weapons of mass destruction technology and expertise and removing incentives for scientists, engineers and technicians in the newly independent states (NIS) of the former Soviet Union to go to rogue countries or assist terrorist groups is the Initiatives for Proliferation Prevention (IPP). IPP was initiated pursuant to the 1994 Foreign Operations Appropriations Act. IPP is a nonproliferation program with a commercialization strategy. IPP seeks to enhance US national security and to achieve nonproliferation objectives by engaging scientists, engineers and technicians from former NIS weapons institutes; redirecting their activities in cooperatively-developed, commercially viable non-weapons related projects. These projects lead to commercial and economic benefits for both the NIS and the US IPP projects are funded in Russian, Ukraine, Kazakhstan and Belarus. This booklet offers an overview of the IPP program as well as a sampling of some of the projects which are currently underway.

  11. Precision flyer initiator

    DOE Patents [OSTI]

    Frank, A.M.; Lee, R.S.

    1998-05-26

    A precision flyer initiator forms a substantially spherical detonation wave in a high explosive (HE) pellet. An explosive driver, such as a detonating cord, a wire bridge circuit or a small explosive, is detonated. A flyer material is sandwiched between the explosive driver and an end of a barrel that contains an inner channel. A projectile or ``flyer`` is sheared from the flyer material by the force of the explosive driver and projected through the inner channel. The flyer than strikes the HE pellet, which is supported above a second end of the barrel by a spacer ring. A gap or shock decoupling material delays the shock wave in the barrel from predetonating the HE pellet before the flyer. A spherical detonation wave is formed in the HE pellet. Thus, a shock wave traveling through the barrel fails to reach the HE pellet before the flyer strikes the HE pellet. The precision flyer initiator can be used in mining devices, well-drilling devices and anti-tank devices. 10 figs.

  12. Precision flyer initiator

    DOE Patents [OSTI]

    Frank, Alan M. (Livermore, CA); Lee, Ronald S. (Livermore, CA)

    1998-01-01

    A precision flyer initiator forms a substantially spherical detonation wave in a high explosive (HE) pellet. An explosive driver, such as a detonating cord, a wire bridge circuit or a small explosive, is detonated. A flyer material is sandwiched between the explosive driver and an end of a barrel that contains an inner channel. A projectile or "flyer" is sheared from the flyer material by the force of the explosive driver and projected through the inner channel. The flyer than strikes the HE pellet, which is supported above a second end of the barrel by a spacer ring. A gap or shock decoupling material delays the shock wave in the barrel from predetonating the HE pellet before the flyer. A spherical detonation wave is formed in the HE pellet. Thus, a shock wave traveling through the barrel fails to reach the HE pellet before the flyer strikes the HE pellet. The precision flyer initiator can be used in mining devices, well-drilling devices and anti-tank devices.

  13. Breckinridge Project, initial effort

    SciTech Connect (OSTI)

    none,

    1982-01-01

    Report IV, Volume 5, provides descriptions, data, and drawings pertaining to Cryogenic Hydrogen Purification (Plant 8), Sour Water Treating (Plant 9), and the Sulfur Plant (Plant 10). Cryogenic Hydrogen Purification (Plant 8) purifies the purge gas stream from the Gas Plant (Plant 7, described in Report IV, Volume 4) to a 93% purity hydrogen product. Sour Water Treating (Plant 9) removes free ammonia and acid gases from sour water and separates them to recover a high quality anhydrous ammonia product. The Sulfur Plant (Plant 10) recovers, as a saleable liquid product, approximately 95% of the sulfur in feed streams from the Gas Plant (Plant 7, described in Report IV, Volume 4), Sour Water Treating (Plant 9), Gasification and Purification (Plant 12, described in Report IV, Volume 6), and Stack Gas Scrubbing (Plant 35, described in Report V, Volume 3). The following information is included for each of the three plants described in this volume: a description of the plant's process design, including the utility balance, catalysts and chemicals usage, and a process flow diagram; an equipment list, including item numbers and descriptions; data sheets and sketches for major plant components; and pertinent engineering drawings. An appendix contains: an overall site plan showing the locations of all plants; and the symbols and legend for the piping and instrument diagrams included in this volume.

  14. Instrumented Pipeline Initiative

    SciTech Connect (OSTI)

    Thomas Piro; Michael Ream

    2010-07-31

    This report summarizes technical progress achieved during the cooperative agreement between Concurrent Technologies Corporation (CTC) and U.S. Department of Energy to address the need for a for low-cost monitoring and inspection sensor system as identified in the Department of Energy (DOE) National Gas Infrastructure Research & Development (R&D) Delivery Reliability Program Roadmap.. The Instrumented Pipeline Initiative (IPI) achieved the objective by researching technologies for the monitoring of pipeline delivery integrity, through a ubiquitous network of sensors and controllers to detect and diagnose incipient defects, leaks, and failures. This report is organized by tasks as detailed in the Statement of Project Objectives (SOPO). The sections all state the objective and approach before detailing results of work.

  15. Hanford Tanks Initiative quality assurance implementation plan

    SciTech Connect (OSTI)

    Huston, J.J.

    1998-06-23

    Hanford Tanks Initiative (HTI) Quality Assurance Implementation Plan for Nuclear Facilities defines the controls for the products and activities developed by HTI. Project Hanford Management Contract (PHMC) Quality Assurance Program Description (QAPD)(HNF-PRO599) is the document that defines the quality requirements for Nuclear Facilities. The QAPD provides direction for compliance to 10 CFR 830.120 Nuclear Safety Management, Quality Assurance Requirements. Hanford Tanks Initiative (HTI) is a five-year activity resulting from the technical and financial partnership of the US Department of Energy`s Office of Waste Management (EM-30), and Office of Science and Technology Development (EM-50). HTI will develop and demonstrate technologies and processes for characterization and retrieval of single shell tank waste. Activities and products associated with HTI consist of engineering, construction, procurement, closure, retrieval, characterization, and safety and licensing.

  16. Arc initiation in cathodic arc plasma sources

    DOE Patents [OSTI]

    Anders, Andre (Albany, CA)

    2002-01-01

    A "triggerless" arc initiation method and apparatus is based on simply switching the arc supply voltage to the electrodes (anode and cathode). Neither a mechanical trigger electrode nor a high voltage flashover from a trigger electrode is required. A conducting path between the anode and cathode is provided, which allows a hot spot to form at a location where the path connects to the cathode. While the conductive path is eroded by the cathode spot action, plasma deposition ensures the ongoing repair of the conducting path. Arc initiation is achieved by simply applying the relatively low voltage of the arc power supply, e.g. 500 V-1 kV, with the insulator between the anode and cathode coated with a conducting layer and the current at the layer-cathode interface concentrated at one or a few contact points. The local power density at these contact points is sufficient for plasma production and thus arc initiation. A conductive surface layer, such as graphite or the material being deposited, is formed on the surface of the insulator which separates the cathode from the anode. The mechanism of plasma production (and arc initiation) is based on explosive destruction of the layer-cathode interface caused by joule heating. The current flow between the thin insulator coating and cathode occurs at only a few contact points so the current density is high.

  17. Sustainable Forest Bioenergy Initiative

    SciTech Connect (OSTI)

    Breger, Dwayne; Rizzo, Rob

    2011-09-20

    In the state’s Electricity Restructuring Act of 1998, the Commonwealth of Massachusetts recognized the opportunity and strategic benefits to diversifying its electric generation capacity with renewable energy. Through this legislation, the Commonwealth established one of the nation’s first Renewable Energy Portfolio Standard (RPS) programs, mandating the increasing use of renewable resources in its energy mix. Bioenergy, meeting low emissions and advanced technology standards, was recognized as an eligible renewable energy technology. Stimulated by the state’s RPS program, several project development groups have been looking seriously at building large woody biomass generation units in western Massachusetts to utilize the woody biomass resource. As a direct result of this development, numerous stakeholders have raised concerns and have prompted the state to take a leadership position in pursuing a science based analysis of biomass impacts on forest and carbon emissions, and proceed through a rulemaking process to establish prudent policy to support biomass development which can contribute to the state’s carbon reduction commitments and maintain safeguards for forest sustainability. The Massachusetts Sustainable Forest Bioenergy Initiative (SFBI) was funded by the Department of Energy and started by the Department of Energy Resources before these contentious biomass issues were fully raised in the state, and continued throughout the substantive periods of this policy development. Thereby, while SFBI maintained its focus on the initially proposed Scope of Work, some aspects of this scope were expanded or realigned to meet the needs for groundbreaking research and policy development being advanced by DOER. SFBI provided DOER and the Commonwealth with a foundation of state specific information on biomass technology and the biomass industry and markets, the most comprehensive biomass fuel supply assessment for the region, the economic development impact associated with biomass usage, an understanding of forest management trends including harvesting and fuel processing methods, and the carbon profile of utilizing forest based woody biomass for the emerging biomass markets. Each of the tasks and subtasks have provided an increased level of understanding to support new directives, policies and adaptation of existing regulations within Massachusetts. The project has provided the essential information to allow state policymakers and regulators to address emerging markets, while ensuring forest sustainability and understanding the complex science on CO2 accounting and impacts as a result of biomass harvesting for power generation. The public at large and electricity ratepayers in Massachusetts will all benefit from the information garnered through this project. This is a result of the state’s interest to provide financial incentives to only biomass projects that demonstrate an acceptable carbon profile, an efficient use of the constrained supply of fuel, and the harvest of biomass to ensure forest sustainability. The goals of the Massachusetts Sustainable Forest Bioenergy Initiative as proposed in 2006 were identified as: increase the diversity of the Massachusetts energy mix through biomass; promote economic development in the rural economy through forest industry job creation; help fulfill the state’s energy and climate commitments under the Renewable Energy Portfolio Standard and Climate Protection Plan; assist the development of a biomass fuel supply infrastructure to support energy project demands; provide education and outreach to the public on the benefits and impacts of bioenergy; improve the theory and practice of sustainable forestry in the Commonwealth. Completed project activities summarized below will demonstrate the effectiveness of the project in meeting the above goals. In addition, as discussed above, Massachusetts DOER needed to make some modifications to its work plan and objectives during the term of this project due to changing public policy demands brought forth in the course of the public discours

  18. Digital Library Initiative Rice University

    E-Print Network [OSTI]

    Digital Library Initiative Rice University Project Management General guidelines for digital projects Contact: dli (at) rice (dot) edu October, 2007 #12;Digital Library Initiative, Rice University................................................................................................8 #12;Guidelines for managing digital projects Page 2 STATEMENT OF PURPOSE We recognized

  19. Oklahoma GSHP Initiative Jim Bullington

    E-Print Network [OSTI]

    10/1/2012 1 Oklahoma GSHP Initiative Jim Bullington Trade & Industrial Education Oklahoma the Oklahoma CareerTech GSHP Initiative Model · Provide my contact information for you to share with your and Technical Education · Encourage you to contact them to get an initiative rolling Who is Oklahoma Career

  20. Breckinridge Project, initial effort

    SciTech Connect (OSTI)

    1982-01-01

    Report IV, Volume 3, provides descriptions, data, and drawings pertaining to H-COAL Recycle Slurry Preparation (Plant 5), H-COAL Recycle Hydrogen Compression (Plant 6), and H-COAL Distillate Separation (Plant 17). H-COAL Recycle Slurry Preparation (Plant 5) receives a slurry stream from H-COAL Primary Separation (Plant 4), and then pumps the slurry through hydrocyclones, producing two slurry streams. One, dilute in solids is recycled back to the reactor. The other, concentrated in solids, is further processed to recover liquid products and is then transferred to Gasification and Purification (Plant 12). H-COAL Recycle Hydrogen Compression (Plant 6) compresses and recycles back to the reactor system hydrogen-rich vapor from H-COAL Primary Separation (Plant 4). This recycling maintains a hydrogen partial pressure and gas flow through the reactor vessel. H-COAL Distillate Separation (Plant 17) processes products from H-COAL Primary Separation (Plant 4) and H-COAL Recycle Slurry Preparation to produce light naphtha for the Gas Plant (Plant 7), middle and heavy distillates for tank farms, and heavy naphtha for Naphtha Hydrotreating and Reforming (Plant 18). The following information is included for each of the three plants: a description of the plant's process design, including the utility balance, heat and material balance (if applicable), and a process flow diagram; an equipment list, including item numbers and descriptions; data sheets and sketches for major plant components; and pertinent engineering drawings. An appendix contains: an overall site plan showing the locations of all plants; and the symbols and legend for the piping and instrument diagrams included in this volume.

  1. Initial Radionuclide Inventories

    SciTech Connect (OSTI)

    H. Miller

    2004-09-19

    The purpose of this analysis is to provide an initial radionuclide inventory (in grams per waste package) and associated uncertainty distributions for use in the Total System Performance Assessment for the License Application (TSPA-LA) in support of the license application for the repository at Yucca Mountain, Nevada. This document is intended for use in postclosure analysis only. Bounding waste stream information and data were collected that capture probable limits. For commercially generated waste, this analysis considers alternative waste stream projections to bound the characteristics of wastes likely to be encountered using arrival scenarios that potentially impact the commercial spent nuclear fuel (CSNF) waste stream. For TSPA-LA, this radionuclide inventory analysis considers U.S. Department of Energy (DOE) high-level radioactive waste (DHLW) glass and two types of spent nuclear fuel (SNF): CSNF and DOE-owned (DSNF). These wastes are placed in two groups of waste packages: the CSNF waste package and the codisposal waste package (CDSP), which are designated to contain DHLW glass and DSNF, or DHLW glass only. The radionuclide inventory for naval SNF is provided separately in the classified ''Naval Nuclear Propulsion Program Technical Support Document'' for the License Application. As noted previously, the radionuclide inventory data presented here is intended only for TSPA-LA postclosure calculations. It is not applicable to preclosure safety calculations. Safe storage, transportation, and ultimate disposal of these wastes require safety analyses to support the design and licensing of repository equipment and facilities. These analyses will require radionuclide inventories to represent the radioactive source term that must be accommodated during handling, storage and disposition of these wastes. This analysis uses the best available information to identify the radionuclide inventory that is expected at the last year of last emplacement, currently identified as 2030 and 2033, depending on the type of waste. TSPA-LA uses the results of this analysis to decay the inventory to the year of repository closure projected for the year of 2060.

  2. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  3. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  4. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  5. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  6. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  7. CALL FOR PAPERS The Sun Grant Initiative National Conference on

    E-Print Network [OSTI]

    Goodman, Robert M.

    on the "Science for Biomass Feedstock Production and Utilization". It will be held October 2-5, 2012 at the Hilton of best management practices for agricultural and forestry biomass feedstock production · Management CALL FOR PAPERS The Sun Grant Initiative National Conference on Science for Biomass

  8. Gulf Petro Initiative

    SciTech Connect (OSTI)

    Fathi Boukadi

    2011-02-05

    In this report, technologies for petroleum production and exploration enhancement in deepwater and mature fields are developed through basic and applied research by: (1) Designing new fluids to efficiently drill deepwater wells that can not be cost-effectively drilled with current technologies. The new fluids will be heavy liquid foams that have low-density at shallow dept to avoid formation breakdown and high density at drilling depth to control formation pressure. The goal of this project is to provide industry with formulations of new fluids for reducing casing programs and thus well construction cost in deepwater development. (2) Studying the effects of flue gas/CO{sub 2} huff n puff on incremental oil recovery in Louisiana oilfields bearing light oil. An artificial neural network (ANN) model will be developed and used to map recovery efficiencies for candidate reservoirs in Louisiana. (3) Arriving at a quantitative understanding for the three-dimensional controlled-source electromagnetic (CSEM) geophysical response of typical Gulf of Mexico hydrocarbon reservoirs. We will seek to make available tools for the qualitative, rapid interpretation of marine CSEM signatures, and tools for efficient, three-dimensional subsurface conductivity modeling.

  9. Manufacturing Initiative | Clean Energy | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    in the production of clean energy products (e.g., wind turbines, solar panels, energy efficient appliances, light bulbs, vehicles and automotive components) and across the...

  10. Breckinridge Project, initial effort

    SciTech Connect (OSTI)

    none,

    1982-01-01

    The project cogeneration plant supplies electric power, process steam and treated boiler feedwater for use by the project plants. The plant consists of multiple turbine generators and steam generators connected to a common main steam header. The major plant systems which are required to produce steam, electrical power and treated feedwater are discussed individually. The systems are: steam, steam generator, steam generator fuel, condensate and feedwater deaeration, condensate and blowdown collection, cooling water, boiler feedwater treatment, coal handling, ash handling (fly ash and bottom ash), electrical, and control system. The plant description is based on the Phase Zero design basis established for Plant 31 in July of 1980 and the steam/condensate balance as presented on Drawing 31-E-B-1. Updating of steam requirements as more refined process information becomes available has generated some changes in the steam balance. Boiler operation with these updated requirements is reflected on Drawing 31-D-B-1A. The major impact of updating has been that less 600 psig steam generated within the process units requires more extraction steam from the turbine generators to close the 600 psig steam balance. Since the 900 psig steam generation from the boilers was fixed at 1,200,000 lb/hr, the additional extraction steam required to close the 600 psig steam balance decreased the quantity of electrical power available from the turbine generators. In the next phase of engineering work, the production of 600 psig steam will be augmented by increasing convection bank steam generation in the Plant 3 fired heaters by 140,000 to 150,000 lb/hr. This modification will allow full rated power generation from the turbine generators.

  11. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  12. Executive Summary of Initiative Launching a Re-envisioning Initiative

    E-Print Network [OSTI]

    California at Berkeley, University of

    these public services 1 Message from the University Librarian about the SEL Chemistry Closure, http://blogs.library1 Executive Summary of Initiative Launching a Re-envisioning Initiative The UC Berkeley Library has embarked upon a process to re-envision library services that will result in a new service model

  13. Innovative Manufacturing Initiative Recognition Day

    Broader source: Energy.gov [DOE]

    The Innovative Manufacturing Initiative (IMI) Recognition Day (held in Washington, DC on June 20, 2012) showcased IMI projects selected by the Energy Department to help American manufacturers...

  14. Workplace Charging Program and Initiatives

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Program and Initiatives Evan Kolkos New York Power Authority Clean Energy Technology 2008 All Rights Reserved NYPA: Who We Are * Largest state public power organization in the...

  15. Facilities Initiatives | Department of Energy

    Office of Environmental Management (EM)

    emissions. CURRENT ENERGY REDUCTION INITIATIVES AT DOE HEADQUARTERS Germantown 370 KW Solar Array Forrestal Variable Air Volume HVAC Upgrade Forrestal Central Chiller Plant...

  16. Report: EM Energy Park Initiative

    Office of Environmental Management (EM)

    To further aid the Assistant Secretary in her efforts to implement the Energy Park Initiative, the EPI Subcommittee offers the following recommendations: Recommendation...

  17. Idaho National Laboratory (INL) Seismic Initiative | Department...

    Office of Environmental Management (EM)

    Initiative Idaho National Laboratory (INL) Seismic Initiative Presentation from the May 2015 Seismic Lessons-Learned Panel Meeting. INL Seismic Initiative More Documents &...

  18. Radiofrequency Initiation and Radiofrequency Sustainment of Laser Initiated Seeded High

    E-Print Network [OSTI]

    Scharer, John E.

    radiofrequency initiation of high pressure(l-70 Ton) inductive plasma discharges in argon, nitrogen, air, decontaminating environmental waste and gaseous pollution. The ap- plication of these plasma sources require

  19. New Energy Star Initiative Recognizes Cutting-Edge Products with...

    Energy Savers [EERE]

    are eager to make purchases that save them money on their utility bills and reduce the pollution in the air we breathe, and these labels will help them identify the best ways to...

  20. Georgia Power- Advanced Solar Initiative

    Broader source: Energy.gov [DOE]

    Note: According to Georgia Power's website, the Advanced Solar Initiative's final program guidelines are due to be published on June 25th and the bidding period for is expected to open on July 10,...

  1. Initial

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR0987P Uncertainty inInhibiting

  2. Research Initiative Will Demonstrate Low Temperature Geothermal...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Research Initiative Will Demonstrate Low Temperature Geothermal Electrical Power Generation Systems Using Oilfield Fluids Research Initiative Will Demonstrate Low Temperature...

  3. Southface Energy Institute: Advanced Commercial Buildings Initiative...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Southface Energy Institute: Advanced Commercial Buildings Initiative - 2015 Peer Review Southface Energy Institute: Advanced Commercial Buildings Initiative - 2015 Peer Review...

  4. OPSAID Initial Design and Testing Report.

    SciTech Connect (OSTI)

    Hurd, Steven A.; Stamp, Jason Edwin; Chavez, Adrian R.

    2007-11-01

    Process Control System (PCS) security is critical to our national security. Yet, there are a number of technological, economic, and educational impediments to PCS owners implementing effective security on their systems. OPSAID (Open PCS Security Architecture for Interoperable Design), a project sponsored by the US Department of Energy's Office of Electricity Delivery and Reliability, aims to address this issue through developing and testing an open source architecture for PCS security. Sandia National Laboratories, along with a team of PCS vendors and owners, have developed and tested this PCS security architecture. This report describes their progress to date.2 AcknowledgementsThe authors acknowledge and thank their colleagues for their assistance with the OPSAID project.Sandia National Laboratories: Alex Berry, Charles Perine, Regis Cassidy, Bryan Richardson, Laurence PhillipsTeumim Technical, LLC: Dave TeumimIn addition, the authors are greatly indebted to the invaluable help of the members of the OPSAID Core Team. Their assistance has been critical to the success and industry acceptance of the OPSAID project.Schweitzer Engineering Laboratory: Rhett Smith, Ryan Bradetich, Dennis GammelTelTone: Ori Artman Entergy: Dave Norton, Leonard Chamberlin, Mark AllenThe authors would like to acknowledge that the work that produced the results presented in this paper was funded by the U.S. Department of Energy/Office of Electricity Delivery and Energy Reliability (DOE/OE) as part of the National SCADA Test Bed (NSTB) Program. Executive SummaryProcess control systems (PCS) are very important for critical infrastructure and manufacturing operations, yet cyber security technology in PCS is generally poor. The OPSAID (Open PCS (Process Control System) Security Architecture for Interoperable Design) program is intended to address these security shortcomings by accelerating the availability and deployment of comprehensive security technology for PCS, both for existing PCS and inherently secure PCS in the future. All activities are closely linked to industry outreach and advisory efforts.Generally speaking, the OPSAID project is focused on providing comprehensive security functionality to PCS that communicate using IP. This is done through creating an interoperable PCS security architecture and developing a reference implementation, which is tested extensively for performance and reliability.This report first provides background on the PCS security problem and OPSAID, followed by goals and objectives of the project. The report also includes an overview of the results, including the OPSAID architecture and testing activities, along with results from industry outreach activities. Conclusion and recommendation sections follow. Finally, a series of appendices provide more detailed information regarding architecture and testing activities.Summarizing the project results, the OPSAID architecture was defined, which includes modular security functionality and corresponding component modules. The reference implementation, which includes the collection of component modules, was tested extensively and proved to provide more than acceptable performance in a variety of test scenarios. The primary challenge in implementation and testing was correcting initial configuration errors.OPSAID industry outreach efforts were very successful. A small group of industry partners were extensively involved in both the design and testing of OPSAID. Conference presentations resulted in creating a larger group of potential industry partners.Based upon experience implementing and testing OPSAID, as well as through collecting industry feedback, the OPSAID project has done well and is well received. Recommendations for future work include further development of advanced functionality, refinement of interoperability guidance, additional laboratory and field testing, and industry outreach that includes PCS owner education. 4 5 --This page intentionally left blank --

  5. The Clean Energy Manufacturing Initiative

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    by ensuring critical feedback from the production phase to invention and discovery. Additive manufacturing is just one of several technologies advanced by the Energy...

  6. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  7. AVAILABLE ONLINE AT: INITIATED BY:

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr INITIATED BY: INITIATED BY:

  8. AVAILABLE ONLINE AT: INITIATED BY:

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr INITIATED BY: INITIATED

  9. Patent Pending Introducing SCSI-To-IP Cache for Storage Area

    E-Print Network [OSTI]

    Yang, Qing "Ken"

    an essential role in today's fast-growing data-intensive network services. New standards and products emerge, data unit sizes, and design considerations that prevent fast and efficient deployment of SAN (Storage results using popular PostMark benchmark program and EMC's trace have shown dramatic performance gain over

  10. Keyed Side-Channel Based Hashing for IP Protection using Wavelets

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    signal feature extraction method, the wavelet transform, to form a keyed side-channel hash function industry, however, has virtually no opportunity to confirm a suspected plagiarism. Products on the market devices emit physically observ- able quantities, for instance the power consumption, electromagnetic

  11. Anode initiated surface flashover switch

    DOE Patents [OSTI]

    Brainard, John P. (Albuquerque, NM); Koss, Robert J. (Albuquerque, NM)

    2003-04-29

    A high voltage surface flashover switch has a pair of electrodes spaced by an insulator. A high voltage is applied to an anode, which is smaller than the opposing, grounded, cathode. When a controllable source of electrons near the cathode is energized, the electrons are attracted to the anode where they reflect to the insulator and initiate anode to cathode breakdown.

  12. Managing Critical Management Improvement Initiatives

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-10-01

    Provides requirements and responsibilities for planning, executing and assessing critical management improvement initiatives within DOE. DOE N 251.59, dated 9/27/2004, extends this Notice until 10/01/2005. Archived 11-8-10. Does not cancel other directives.

  13. Fayette County Better Buildings Initiative

    SciTech Connect (OSTI)

    Capella, Arthur

    2015-03-04

    The Fayette County Better Buildings Initiative represented a comprehensive and collaborative approach to promoting and implementing energy efficiency improvements. The initiative was designed to focus on implementing energy efficiency improvements in residential units, while simultaneously supporting general marketing of the benefits of implementing energy efficiency measures. The ultimate goal of Fayette County’s Better Buildings Initiative was to implement a total of 1,067 residential energy efficiency retrofits with a minimum 15% estimated energy efficiency savings per unit. Program partners included: United States Department of Energy, Allegheny Power, and Private Industry Council of Westmoreland-Fayette, Fayette County Redevelopment Authority, and various local partners. The program was open to any Fayette County residents who own their home and meet the prequalifying conditions. The level of assistance offered depended upon household income and commitment to undergo a BPI – Certified Audit and implement energy efficiency measures, which aimed to result in at least a 15% reduction in energy usage. The initiative was designed to focus on implementing energy efficiency improvements in residential units, while simultaneously supporting general marketing of the benefits of implementing energy efficiency measures. Additionally, the program had components that involved recruitment and training for employment of persons in the energy sector (green jobs), as well as marketing and implementation of a commercial or community facilities component. The residential component of Fayette County’s Better Buildings Initiative involved a comprehensive approach, providing assistance to low- moderate- and market-rate homeowners. The initiative will also coordinate activities with local utility providers to further incentivize energy efficiency improvements among qualifying homeowners. The commercial component of Fayette County’s Better Building Initiative involved grants and loans to assist up to $15,000 projects per commercial structure with a mixture of a grant and financing at 0% for up to three – (3) years. The maximum award can be a $5,000 grant and a $10,000 loan. For projects less than $15,000, the award will have a ratio of 1/3 grant and 2/3 loan.

  14. Initiation disruptor systems and methods of initiation disruption

    DOE Patents [OSTI]

    Baum, Dennis W

    2014-09-23

    A system that may be used as an initiation disruption system (IDS) according to one embodiment includes an explosive charge; a plurality of particles in a layer at least partially surrounding the explosive charge; and a fire suppressant adjacent the plurality of particles. A method for disabling an object according to one embodiment includes placing the system as recited above near an object; and causing the explosive charge to initiate, thereby applying mechanical loading to the object such that the object becomes disabled. Additional systems and methods are also presented. A device according to another embodiment includes a plurality of particles bound by a binder thereby defining a sidewall having an interior for receiving an explosive; and a fire suppressant adjacent the plurality of particles and binder. Additional systems and methods are also presented.

  15. Risk Management in Lean Product Development

    E-Print Network [OSTI]

    Oehmen, Josef

    This whitepaper summarizes 15 years of research conducted at MIT's Lean Advancement Initiative on the topic of risk management in product design and development. It discusses current challenges in risk management for product ...

  16. Delivered by ICEVirtualLibrary.com to: IP: 129.107.18.208

    E-Print Network [OSTI]

    Hu, Qinhong "Max"

    is the major source of water supply for Yangquan city, one of the most important bases of coal production-SO4-Ca-Mg type to the SO4-HCO3-Ca, Cl-SO4-HCO3-Ca, SO4-Ca or SO4-Cl-Ca type. Results from factor analysis indicate that abnormally high levels of SO4 22 and Naţ are from sources related to coal mining

  17. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  18. User cost in oil production

    E-Print Network [OSTI]

    Adelman, Morris Albert

    1990-01-01

    The assumption of an initial fixed mineral stock is superfluous and wrong. User cost (resource rent) in mineral production is the present value of expected increases in development cost. It can be measured as the difference ...

  19. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  20. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  1. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  2. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  3. Richmond Electric Vehicle Initiative Electric Vehicle Readiness...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Richmond Electric Vehicle Initiative Electric Vehicle Readiness Plan Richmond Electric Vehicle Initiative Electric Vehicle Readiness Plan The REVi plan addresses the electric...

  4. Energy Innovation: Green Button Initiative Empowering Americans...

    Energy Savers [EERE]

    Energy Innovation: Green Button Initiative Empowering Americans to Save Energy and Money Energy Innovation: Green Button Initiative Empowering Americans to Save Energy and Money...

  5. Clean Energy Manufacturing Initiative Southeast Regional Summit...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Clean Energy Manufacturing Initiative Southeast Regional Summit Clean Energy Manufacturing Initiative Southeast Regional Summit July 9, 2015 8:30AM to 6:00PM EDT Renaissance...

  6. California Low Carbon Fuels Infrastructure Investment Initiative...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Low Carbon Fuels Infrastructure Investment Initiative California Low Carbon Fuels Infrastructure Investment Initiative 2012 DOE Hydrogen and Fuel Cells Program and Vehicle...

  7. Innovative Corridors Initiative: Business Model Analysis

    E-Print Network [OSTI]

    Shaheen, Susan; Lingham, Viginia; Finson, Rachel S.

    2007-01-01

    Wenger, Joyce. Business Models for Vehicle InfrastructureCorridors Initiative: Business Model Analysis Rachel S.Corridors Initiative: Business Model Analysis Task Order

  8. AVAILABLE ONLINE AT: INITIATED BY:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsicloudden Documentation DataStreamsTotalproposals INITIATED BY:

  9. AVAILABLE ONLINE AT: INITIATED BY:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsicloudden Documentation DataStreamsTotalproposals INITIATED

  10. American Samoa Initial Technical Assessment Report

    SciTech Connect (OSTI)

    Busche, S.; Conrad, M.; Funk, K.; Kandt, A.; McNutt, P.

    2011-09-01

    This document is an initial energy assessment for American Samoa, the first of many steps in developing a comprehensive energy strategy. On March 1, 2010, Assistant Secretary of the Interior Tony Babauta invited governors and their staff from the Interior Insular Areas to meet with senior principals at the National Renewable Energy Laboratory (NREL). Meeting discussions focused on ways to improve energy efficiency and increase the deployment of renewable energy technologies in the U.S. Pacific Territories. In attendance were Governors Felix Camacho (Guam), Benigno Fitial (Commonwealth of the Northern Mariana Islands), and Togiola Tulafono, (American Samoa). This meeting brought together major stakeholders to learn and understand the importance of developing a comprehensive strategic plan for implementing energy efficiency measures and renewable energy technologies. For several decades, dependence on fossil fuels and the burden of high oil prices have been a major concern but never more at the forefront as today. With unstable oil prices, the volatility of fuel supply and the economic instability in American Samoa, energy issues are a high priority. In short, energy security is critical to American Samoa's future economic development and sustainability. Under an interagency agreement, funded by the Department of Interior's Office of Insular Affairs, NREL was tasked to deliver technical assistance to the islands of American Samoa. Technical assistance included conducting an initial technical assessment to define energy consumption and production data, establish an energy consumption baseline, and assist with the development of a strategic plan. The assessment and strategic plan will be used to assist with the transition to a cleaner energy economy. NREL provided an interdisciplinary team to cover each relevant technical area for the initial energy assessments. Experts in the following disciplines traveled to American Samoa for on-island site assessments: (1) Energy Efficiency and Building Technologies; (2) Integrated Wind-Diesel Generation; (3) Transmission and Distribution; (4) Solar Technologies; and (5) Biomass and Waste-to-Energy. In addition to these core disciplines, team capabilities also included expertise in program analysis, project financing, energy policy and energy planning. The intent of the technical assessment was to provide American Samoa with a baseline energy assessment. From the baseline, various scenarios and approaches for deploying cost effective energy efficiency and renewable energy technologies could be created to meet American Samoa's objectives. The information provided in this energy assessment will be used as input in the development of a draft strategic plan and the development of scenarios and strategies for deploying cost-effective energy efficiency and renewable products.

  11. Pottery Production

    E-Print Network [OSTI]

    Nicholson, Paul T.

    2009-01-01

    Paul T. Nicholson. ) Pottery Production, Nicholson, UEE 2009Short Citation: Nicholson 2009, Pottery Production. UEE.Paul T. , 2009, Pottery Production. In Willeke Wendrich (

  12. Cordage Production

    E-Print Network [OSTI]

    Veldmeijer, André J.

    2009-01-01

    294: fig. 15-3). Cordage Production, Veldmeijer, UEE 2009Short Citation: Veldmeijer, 2009, Cordage Production. UEE.André J. , 2009, Cordage Production. In Willeke Wendrich (

  13. Glass Production

    E-Print Network [OSTI]

    Shortland, Andrew

    2009-01-01

    40, pp. 162 - 186. Glass Production, Shortland, UEE 2009AINES Short Citation: Shortland 2009, Glass Production. UEE.Andrew, 2009, Glass Production. In Willeke Wendrich (ed. ),

  14. California Solar InitiativeCalifornia Solar Initiative Julie FitchJulie Fitch

    E-Print Network [OSTI]

    Transition Year: 2006 Funding for new Solar Initiative beginsFunding for new Solar Initiative begins;12/12/0512/12/05 77 Solar Initiative FundingSolar Initiative Funding 0 50 100 150 200 250 300 350 400 $millions 2006California Solar InitiativeCalifornia Solar Initiative Julie FitchJulie Fitch Director, Division

  15. Initial Decision and Risk Analysis

    SciTech Connect (OSTI)

    Engel, David W.

    2012-02-29

    Decision and Risk Analysis capabilities will be developed for industry consideration and possible adoption within Year 1. These tools will provide a methodology for merging qualitative ranking of technology maturity and acknowledged risk contributors with quantitative metrics that drive investment decision processes. Methods and tools will be initially introduced as applications to the A650.1 case study, but modular spreadsheets and analysis routines will be offered to industry collaborators as soon as possible to stimulate user feedback and co-development opportunities.

  16. AVAILABLE ONLINE AT: INITIATED BY:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsicloudden Documentation DataStreamsTotalproposals INITIATED Washington, D.C. Approved:

  17. AVAILABLE ONLINE AT: INITIATED BY:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsicloudden Documentation DataStreamsTotalproposals INITIATED Washington, D.C. Approved:

  18. AVAILABLE ONLINE AT: INITIATED BY:

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr INITIATED BY:

  19. AVAILABLE ONLINE AT: INITIATED BY:

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr INITIATED BY:

  20. AVAILABLE ONLINE AT: INITIATED BY:

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nuclear Securityhr INITIATED BY:hq.na.gov

  1. AVAILABLE ONLINE AT: INITIATED BY:

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u t y A s sconveyance of9,Septemeber 19, 2014INITIATED BY:

  2. Workplace Charging Program and Initiatives

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematics And Statistics » USAJobs SearchAMERICA'SEnergyofThe HartfordUnumXcelofProgram and Initiatives

  3. Transverse Energy Production at RHIC

    E-Print Network [OSTI]

    Qun Li; Yang Pang; Nu Xu

    1999-06-18

    We study the mechanism of transverse energy (E_T) production in Au+Au collisions at RHIC. The time evolution starting from the initial energy loss to the final E_T production is closely examined in transport models. The relationship between the experimentally measured E_T distribution and the maximum energy density achieved is discussed.

  4. Performance of Assisted History Matching Techniques When Utilizing Multiple Initial Geologic Models 

    E-Print Network [OSTI]

    Aggarwal, Akshay

    2011-11-15

    History matching is a process wherein changes are made to an initial geologic model of a reservoir, so that the predicted reservoir performance matches with the known production history. Changes are made to the model parameters which include rock...

  5. Direct laser initiation of PETN

    SciTech Connect (OSTI)

    Early, J. W. (James W.); Kennedy, J. E. (James E.)

    2001-01-01

    In the early 1970s Yang and Menichelli demonstrated that direct laser illumination of low-density secondary explosive prr:ssings through a transparent window could produce detonation. 'The energy requirement for threshold initiation of detonation was reduced when a thin metal coating of metal covered the side of the window against which the low-density explosive was pressed. We have obtained experimental results that are in general agreement with the results of Renllund, Stanton and Trott (1 989) and recent: work by Nagayama, hou and Nakahara (2001). We report exploration of the effects of laser beam diameter, PEiTN density and specific surface area, and thickness of a titanium coating on the window.

  6. QER- Comment of Environmental Initiative

    Office of Energy Efficiency and Renewable Energy (EERE)

    Dear Office of Energy Policy and Systems Analysis, I lead a series of annual environmental policy forums that target the leaders within the Minnesota environmental and energy policy community (http://www.environmental-initiative.org/projects/policy-forum-series), and our next forum (on Sept. 24th) will be focused on the risks and rewards associated with fuel transport to/through Minnesota, as well as what policy decisions and trade-offs we are facing as a state. I am looking for a speaker to open the four-hour forum who can provide broader context on the issue of fuel transport infrastructure, as well as speak to federal vs. state jurisdiction and both the big-picture/long-term and the immediate on-the-ground trade-offs.

  7. Plug-in Hybrid Initiative

    SciTech Connect (OSTI)

    Goodman, Angie; Moore, Ray; Rowden, Tim

    2013-09-27

    Our main project objective was to implement Plug-in Electric Vehicles (PEV) and charging infrastructure into our electric distribution service territory and help reduce barriers in the process. Our research demonstrated the desire for some to be early adopters of electric vehicles and the effects lack of education plays on others. The response of early adopters was tremendous: with the initial launch of our program we had nearly 60 residential customers interested in taking part in our program. However, our program only allowed for 15 residential participants. Our program provided assistance towards purchasing a PEV and installation of Electric Vehicle Supply Equipment (EVSE). The residential participants have all come to love their PEVs and are more than enthusiastic about promoting the many benefits of driving electric.

  8. Electrical initiation of an energetic nanolaminate film

    DOE Patents [OSTI]

    Tringe, Joseph W. (Walnut Creek, CA); Gash, Alexander E. (Brentwood, CA); Barbee, Jr., Troy W. (Palo Alto, CA)

    2010-03-30

    A heating apparatus comprising an energetic nanolaminate film that produces heat when initiated, a power source that provides an electric current, and a control that initiates the energetic nanolaminate film by directing the electric current to the energetic nanolaminate film and joule heating the energetic nanolaminate film to an initiation temperature. Also a method of heating comprising providing an energetic nanolaminate film that produces heat when initiated, and initiating the energetic nanolaminate film by directing an electric current to the energetic nanolaminate film and joule heating the energetic nanolaminate film to an initiation temperature.

  9. A New Fracture Function Approach to QCD Initial State Radiation

    E-Print Network [OSTI]

    Federico A. Ceccopieri; Luca Trentadue

    2007-05-16

    Ordinary fracture functions, describing hadrons production in the deep inelastic scattering target fragmentation region, are generalized to account for the production of hadrons in arbitrary number, thus offering a renewed framework for dealing with QCD initial state radiation. We also propose a new jet-like observable which measures beam remnants and low-$p_{\\perp}$ scattering fragments and derive its QCD evolution equations by using Jet Calculus. Possible implications for semi-inclusive deep inelastic scattering and hadron-hadron reactions are shortly discussed.

  10. The Materials Genome Initiative September 25, 2013

    E-Print Network [OSTI]

    Nair, Sankar

    The Materials Genome Initiative September 25, 2013 Dr. Cyrus Wadia Assistant Director, Clean Energy're launching what we call the Materials Genome Initiative. The invention of silicon circuits and lithium ion

  11. SUBCHAPTER All INITIAL STATEMENT OF REASONS

    E-Print Network [OSTI]

    , Boilers and Water Heaters, January 20, 2012 NR SOLAR AND WATER HEATING Memo to Boiler CASE Initiative "Solar Ready Homes and Solar Oriented Development", September 2011 RES SOLAR & WATER Initiative "Nonresidential Solarready Buildings", September 2011 NR SOLAR & WATER HEATING CASE

  12. DelftResearchInitiatives Medical technology for

    E-Print Network [OSTI]

    van Vliet, Lucas J.

    technology is creating a wave of innovation in healthcare, improving quality and efficiency while keepingDelftResearchInitiatives Medical technology for the future of healthcare Delft Health Initiative,affordablegreenenergy,acleanandsafelivingenvironment andcommutingandtransportationwithnotailbacks.Health,energy,environment, infrastructuresandmobilityaretoday

  13. Geothermal initiatives in Central America

    SciTech Connect (OSTI)

    Hanold, R.J.; Loose, V.W.; Laughlin, A.W.; Wade, P.E.

    1986-01-01

    The US Agency for International Development is supporting a new project in energy and resources exploitation for Central America. One of the largest components of the project involves exploration and reservoir development investigations directed at enhancing the production of electricity from the region's geothermal resources. An assessment of the geothermal resources of Honduras is in progress, and interesting geothermal regions in the Guanacaste Province of Costa Rica are being explored. Well-logging activities are in progress in the production wells at the Miravalles geothermal field in Costa Rica, and preparations are being made for logging critical wells at Ahuachapan in El Salvador. A self-contained logging truck, complete with high-temperature logging cable and logging tools designed for geothermal service, is being fabricated and will be made available for dedicated use throughout Central America. Geochemical and isotopic analyses of water samples collected in Panama are being evaluated to select a high-priority geothermal site in that country. Application of low- and medium-enthalpy geothermal fluids for industrial and agricultural processes is being investigated in Guatemala.

  14. Interconnection-Wide Transmission Planning Initiative - Meeting...

    Energy Savers [EERE]

    Recovery Act Interconnection Transmission Planning Interconnection-Wide Transmission Planning Initiative - Meeting Calendars Interconnection-Wide Transmission Planning...

  15. Initial data for rotating cosmologies

    E-Print Network [OSTI]

    Piotr Bizo?; Stefan Pletka; Walter Simon

    2015-08-28

    We revisit the construction of maximal initial data on compact manifolds in vacuum with positive cosmological constant via the conformal method. We discuss, extend and apply recent results of Hebey et al. [19] and Premoselli [31] which yield existence, non-existence, (non-)uniqueness and (linearisation-) stability of solutions of the Lichnerowicz equation, depending on its coefficients. We then focus on so-called $(t,\\phi)$-symmetric data as "seed manifolds", and in particular on Bowen-York data on the round hypertorus $\\mathbb{S}^2 \\times \\mathbb{S}$ (a slice of Nariai) and on Kerr-deSitter. In the former case, we clarify the bifurcation structure of the axially symmetric solutions of the Lichnerowicz equation in terms of the angular momentum as bifurcation parameter, using a combination of analytical and numerical techniques. As to the latter example, we show how dynamical data can be constructed in a natural way via conformal rescalings of Kerr-deSitter data.

  16. Initial data for rotating cosmologies

    E-Print Network [OSTI]

    Piotr Bizo?; Stefan Pletka; Walter Simon

    2015-06-09

    We revisit the construction of maximal initial data on compact manifolds in vacuum with positive cosmological constant via the conformal method. We discuss, extend and apply recent results of Hebey et al. [19] and Premoselli [31] which yield existence, non-existence, (non-)uniqueness and (linearisation-) stability of solutions of the Lichnerowicz equation, depending on its coefficients. We then focus on so-called $(t,\\phi)$-symmetric data as "seed manifolds", and in particular on Bowen-York data on the round hypertorus $\\mathbb{S}^2 \\times \\mathbb{S}$ (a slice of Nariai) and on Kerr-deSitter. In the former case, we clarify the bifurcation structure of the axially symmetric solutions of the Lichnerowicz equation in terms of the angular momentum as bifurcation parameter, using a combination of analytical and numerical techniques. As to the latter example, we show how dynamical data can be constructed in a natural way via conformal rescalings of Kerr-deSitter data.

  17. Materials Genome Initiative for Global Competitiveness

    E-Print Network [OSTI]

    Chandy, John A.

    Materials Genome Initiative for Global Competitiveness June 2011 #12;2 Materials Genome Initiative information visit www.ostp.gov. #12;3Materials Genome Initiative for Global Competitiveness EXECUTIVE OFFICE, the development of advanced materials will fuel many of the emerging industries that will address challenges

  18. Low-Resolution STELab IPS 3D Reconstructions of the Whole Heliosphere Interval and Comparison with in-Ecliptic Solar Wind Measurements from STEREO and Wind Instrumentation

    E-Print Network [OSTI]

    Bisi, M. M.; Jackson, B. V.; Buffington, A.; Clover, J. M.; Hick, P. P.; Tokumaru, M.

    2009-01-01

    structure of the fast solar wind. J. Geophys. Res. 112,observations of the solar wind. Proc. SPIE 6689, 668911-1.W.A. , Maagoe, S. : 1972, Solar wind velocity from ips

  19. Reprogramming peripheral blood mononuclear cells using an efficient feeder-free, non-integration method to generate iPS cells and the effect of immunophenotype and epigenetic state on HSPC fate 

    E-Print Network [OSTI]

    Liu, Jing

    2014-11-28

    Background and objectives In 2006 Shinya Yamanaka successfully reprogrammed mouse fibroblasts back to an embryonic stem cell-like state (called induced pluripotent cells, iPS cells) using retrovirus to introduce four ...

  20. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  1. Shock Initiation of Damaged Explosives

    SciTech Connect (OSTI)

    Chidester, S K; Vandersall, K S; Tarver, C M

    2009-10-22

    Explosive and propellant charges are subjected to various mechanical and thermal insults that can increase their sensitivity over the course of their lifetimes. To quantify this effect, shock initiation experiments were performed on mechanically and thermally damaged LX-04 (85% HMX, 15% Viton by weight) and PBX 9502 (95% TATB, 5% Kel-F by weight) to obtain in-situ manganin pressure gauge data and run distances to detonation at various shock pressures. We report the behavior of the HMX-based explosive LX-04 that was damaged mechanically by applying a compressive load of 600 psi for 20,000 cycles, thus creating many small narrow cracks, or by cutting wedge shaped parts that were then loosely reassembled, thus creating a few large cracks. The thermally damaged LX-04 charges were heated to 190 C for long enough for the beta to delta solid - solid phase transition to occur, and then cooled to ambient temperature. Mechanically damaged LX-04 exhibited only slightly increased shock sensitivity, while thermally damaged LX-04 was much more shock sensitive. Similarly, the insensitive explosive PBX 9502 was mechanically damaged using the same two techniques. Since PBX 9502 does not undergo a solid - solid phase transition but does undergo irreversible or 'rachet' growth when thermally cycled, thermal damage to PBX 9502 was induced by this procedure. As for LX-04, the thermally damaged PBX 9502 demonstrated a greater shock sensitivity than mechanically damaged PBX 9502. The Ignition and Growth reactive flow model calculated the increased sensitivities by igniting more damaged LX-04 and PBX 9502 near the shock front based on the measured densities (porosities) of the damaged charges.

  2. Comment on the $?^+$-production at high energy

    E-Print Network [OSTI]

    A. I. Titov; A. Hosaka; S. Date'; Y. Ohashi

    2004-09-15

    We show that the cross sections of the $\\Theta^+$-pentaquark production in different processes decrease with energy faster than the cross sections of production of the conventional three-quark hyperons. Therefore, the threshold region with the initial energy of a few GeV or less seemsto be more favorable for the production and experimental study of $\\Theta^+$-pentaquark.

  3. STEP PRODUCT INFORMATION MODELS IN AGILE MANUFACTURING

    E-Print Network [OSTI]

    Nagi, Rakesh

    of converting product design data from Initial Graphic Exchange Specification (IGES) format into Standard to the development of the STandard for the Exchange of Product model data (STEP) standard (ISO 10303). STEP aims exchange, over the various phases of the product life cycle. Development of a new standard has introduced

  4. Roadmap for Bioenergy and Biobased Products in the United States

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    7 Roadmap for Bioenergy and Biobased Products in the United States Biomass Research and Development Technical Advisory Committee Biomass Research and Development Initiative October...

  5. Manufacturers of Noncompliant Products Agree to Civil Penalties...

    Energy Savers [EERE]

    Energy has settled civil penalty actions it initiated against nine companies for the manufacture and sale in the United States of products that fail to meet federal energy...

  6. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  7. Clean Energy Infrastructure Educational Initiative

    SciTech Connect (OSTI)

    Hallinan, Kevin; Menart, James; Gilbert, Robert

    2012-08-31

    The Clean Energy Infrastructure Educational Initiative represents a collaborative effort by the University of Dayton, Wright State University and Sinclair Community College. This effort above all aimed to establish energy related programs at each of the universities while also providing outreach to the local, state-wide, and national communities. At the University of Dayton, the grant has aimed at: solidfying a newly created Masterâ??s program in Renewable and Clean Energy; helping to establish and staff a regional sustainability organization for SW Ohio. As well, as the prime grantee, the University of Dayton was responsible for insuring curricular sharing between WSU and the University of Dayton. Finally, the grant, through its support of graduate students, and through cooperation with the largest utilities in SW Ohio enabled a region-wide evaluation of over 10,000 commercial building buildings in order to identify the priority buildings in the region for energy reduction. In each, the grant has achieved success. The main focus of Wright State was to continue the development of graduate education in renewable and clean energy. Wright State has done this in a number of ways. First and foremost this was done by continuing the development of the new Renewable and Clean Energy Masterâ??s Degree program at Wright State . Development tasks included: continuing development of courses for the Renewable and Clean Energy Masterâ??s Degree, increasing the student enrollment, and increasing renewable and clean energy research work. The grant has enabled development and/or improvement of 7 courses. Collectively, the University of Dayton and WSU offer perhaps the most comprehensive list of courses in the renewable and clean energy area in the country. Because of this development, enrollment at WSU has increased from 4 students to 23. Secondly, the grant has helped to support student research aimed in the renewable and clean energy program. The grant helped to solidify new research in the renewable and clean energy area. The educational outreach provided as a result of the grant included activities to introduce renewable and clean energy design projects into the Mechanical and Materials Engineering senior design class, the development of a geothermal energy demonstration unit, and the development of renewable energy learning modules for high school students. Finally, this grant supported curriculum development by Sinclair Community College for seven new courses and acquisition of necessary related instrumentation and laboratory equipment. These new courses, EGV 1201 Weatherization Training, EGV 1251 Introduction to Energy Management Principles, EGV 2301 Commercial and Industrial Assessment, EGV 2351 LEED Green Associate Exam Preparation, EGV 2251 Energy Control Strategies, EGV Solar Photovoltaic Design and Installation, and EGV Solar Thermal Systems, enable Sinclair to offer complete Energy Technology Certificate and an Energy Management Degree programs. To date, 151 students have completed or are currently registered in one of the seven courses developed through this grant. With the increasing interest in the Energy Management Degree program, Sinclair has begun the procedure to have the program approved by the Ohio Board of Regents.

  8. On the initial state and consistency relations

    SciTech Connect (OSTI)

    Berezhiani, Lasha; Khoury, Justin E-mail: jkhoury@sas.upenn.edu

    2014-09-01

    We study the effect of the initial state on the consistency conditions for adiabatic perturbations. In order to be consistent with the constraints of General Relativity, the initial state must be diffeomorphism invariant. As a result, we show that initial wavefunctional/density matrix has to satisfy a Slavnov-Taylor identity similar to that of the action. We then investigate the precise ways in which modified initial states can lead to violations of the consistency relations. We find two independent sources of violations: i) the state can include initial non-Gaussianities; ii) even if the initial state is Gaussian, such as a Bogoliubov state, the modified 2-point function can modify the q-vector ? 0 analyticity properties of the vertex functional and result in violations of the consistency relations.

  9. STUDENT AGREEMENT Student should initial, indicating agreement

    E-Print Network [OSTI]

    Meyers, Steven D.

    STUDENT AGREEMENT Student should initial, indicating agreement: ____ I have met with my graduate dates: Master's Degree: Total Hours Master's Degree: Completion Date Instructions: Once the final

  10. Interconnection-Wide Transmission Planning Initiative: Topic...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    State Agency Input Regarding Electric Resource and Transmission Planning in the Texas Interconnection Interconnection-Wide Transmission Planning Initiative: Topic B, State Agency...

  11. Interconnection-Wide Transmission Planning Initiative: Topic...

    Office of Environmental Management (EM)

    A, Interconnection-Level Analysis and Planning Interconnection-Wide Transmission Planning Initiative: Topic A, Interconnection-Level Analysis and Planning A description of the...

  12. Interconnection-Wide Transmission Planning Initiative: Topic...

    Office of Environmental Management (EM)

    Interconnection on Electric Resource Planning and Priorities Interconnection-Wide Transmission Planning Initiative: Topic B, Cooperation Among States in the Eastern...

  13. Interconnection-Wide Transmission Planning Initiative: Topic...

    Broader source: Energy.gov (indexed) [DOE]

    Western Interconnection under the Interconnection-Wide Transmission Planning Initiative, part of the American Recovery and Reinvestment Act. The fundamental purpose of the awards...

  14. Voluntary Initiative: Partnering to Enhance Program Capacity...

    Energy Savers [EERE]

    Peer Exchange Call Series: Voluntary Initiative: Partnering to Enhance Program Capacity, Call Slides and Summary, May 8, 2014. Call Slides and Summary More Documents &...

  15. commercial buildings initiative | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    across the commercial building sector by developing, demonstrating and deploying cost-effective solutions. Commercial Buildings Initiative: http:www1.eere.energy.gov...

  16. The Department of Energy Launches Cybersecurity Initiative |...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Initiative February 1, 2011 - 12:00pm Addthis Collaborative effort will develop a risk management process guideline WASHINGTON, DC - The Department of Energy is launching...

  17. Innovative Manufacturing Initiative Recognition Day, Advanced...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Publications Innovative Manufacturing Initiative Recognition Day Advanced Manufacturing Office Overview Unlocking the Potential of Additive Manufacturing in the Fuel Cells Industry...

  18. Green Manufacturing Initiative Annual Report 2010

    E-Print Network [OSTI]

    de Doncker, Elise

    Green Manufacturing Initiative Annual Report 2010 Dr. John Patten Dr. David Meade May 3, 2011 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Energy . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Herman Miller Energy Center . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2

  19. Energy Efficient Schools Initiative - Grants | Department of...

    Broader source: Energy.gov (indexed) [DOE]

    Maximum Rebate Varies by school district Program Info Sector Name State Administrator Energy Efficient Schools Initiative Website http:www.tn.goveesifinanceinc.shtml...

  20. International Nuclear Energy Research Initiative, Fiscal Year...

    Broader source: Energy.gov (indexed) [DOE]

    Area: Reactor Concepts RD&D Project Start Date: January 2011 Project End Date: December 2013 38 | International Nuclear Energy Research Initiative (I-NERI) Fiscal Year 2011...

  1. Strategic Initiatives for Hydrogen Delivery Workshop | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Initiatives for Hydrogen Delivery Workshop The U.S. Department of Energy's Hydrogen Pipeline Working Group Workshop included more than 45 researchers and industry experts. The...

  2. U.S. Forest Products Annual Market Review and Prospects,

    E-Print Network [OSTI]

    . Abstract This paper describes the current state of the U.S. economy and provides general and statistical Market Trends....................2 Timber Products Production, Trade, and Consumption.....3 Statistics ................................3 Energy Policy Initiatives....................................................9 Wood Energy

  3. Forest Products Road Manual: A Handbook for Municipal Officials

    E-Print Network [OSTI]

    New Hampshire, University of

    Forest Products Road Manual: A Handbook for Municipal Officials and The Forest Products Industry: University of New Hampshire Cooperative Extension with support from: Sustainable Forestry Initiative N............................................................................................................................2 Road Access

  4. Hydrogen Production Technical Team Roadmap

    SciTech Connect (OSTI)

    2013-06-01

    The Hydrogen Production Technical Team Roadmap identifies research pathways leading to hydrogen production technologies that produce near-zero net greenhouse gas (GHG) emissions from highly efficient and diverse renewable energy sources. This roadmap focuses on initial development of the technologies, identifies their gaps and barriers, and describes activities by various U.S. Department of Energy (DOE) offices to address the key issues and challenges.

  5. Energy Initiatives at Virginia Tech presented to

    E-Print Network [OSTI]

    Crawford, T. Daniel

    Energy Initiatives at Virginia Tech ­ A Snapshot presented to COE Administrative Committee Satish V and new initiatives · What are the missing pieces? · Benchmarking #12;US energy flow in 2009 #12;Important findings of the DOE Quadrennial Technology Review (QTR) #12;The 3Ms of energy technologies #12;The QTR has

  6. THE NORTH CAROLINA FOOD PROCESSING INITIATIVE

    E-Print Network [OSTI]

    Buckel, Jeffrey A.

    THE NORTH CAROLINA FOOD PROCESSING INITIATIVE Manufacturing jobs for North Carolina Bringing manufacturing back to N.C. In 2014, the North Carolina General Assembly funded this initiative to diversify development in communities across North Carolina and the globe. We will grow jobs From innovations that can

  7. NANOTECHNOLOGY INITIATIVE Annual Report FY 20092010

    E-Print Network [OSTI]

    NC STATE NANOTECHNOLOGY INITIATIVE Annual Report FY 20092010 In This Report: · Raleigh named top AS AN EMERGING LEADER IN THE FIELD OF NANOTECHNOLOGY." Dr. Gregory Parsons, NC State Nanotechnology Initiative was a period of tremendous growth for nanotechnology activitiesThis past year was a period of tremendous growth

  8. Cornell's Urban Sustainability Initiatives ACSF Lunch Summary

    E-Print Network [OSTI]

    Walter, M.Todd

    Cornell's Urban Sustainability Initiatives ACSF Lunch Summary Compiled by Marianne Krasny (NTRES was to outline steps that Cornell could take to define an urban sustainability initiative in collaboration of our student body, it is important for Cornell to more broadly address urban sustainability issues. Our

  9. FUTURE POWER GRID INITIATIVE Intelligent Networked Sensors

    E-Print Network [OSTI]

    FUTURE POWER GRID INITIATIVE Intelligent Networked Sensors Capable of Autonomous, Adaptive from the rest of the power grid and reconnect and synchronize without loss of functionality FOCUS AREA Power Grid Initiative (FPGI) will deliver next-generation concepts and tools for grid operation

  10. FUTURE POWER GRID INITIATIVE Next Generation Network

    E-Print Network [OSTI]

    FUTURE POWER GRID INITIATIVE Next Generation Network Simulations for Power System Applications resources. To operate the future power grids, these will need to take into account: » the integration (509) 372-6575 jason.fuller@pnnl.gov ABOUT FPGI The Future Power Grid Initiative (FPGI) will deliver

  11. FUTURE POWER GRID INITIATIVE GridOPTICSTM

    E-Print Network [OSTI]

    FUTURE POWER GRID INITIATIVE GridOPTICSTM : A Software Framework for Power System Operations technologies needed to support the operations and planning of the future power grid » provide a framework to the GridPACK numerical library that is being developed in the Future Power Grid Initiative APPROACH

  12. THE PRECISION MEDICINE INITIATIVE WHAT IS IT?

    E-Print Network [OSTI]

    Bandettini, Peter A.

    THE PRECISION MEDICINE INITIATIVE WHAT IS IT? Precision medicine is an emerging approach, environment, and lifestyle. The Precision Medicine Initiative will generate the scientific evidence needed to move the concept of precision medicine into clinical practice. WHY NOW? The time is right because of

  13. Public engagement initiative on food and drink

    E-Print Network [OSTI]

    Rambaut, Andrew

    .g. Gut flora E.g. Minimising food waste Global Context Growing, farming and Harvesting ProcessingPublic engagement initiative on food and drink #12;The Wellcome Trust is a global charitable initiative on food and drink 2 #12;We support the brightest minds in biomedical research and the medical

  14. Renewable Energy Transmission Initiative Phase 1A

    E-Print Network [OSTI]

    Renewable Energy Transmission Initiative Phase 1A DRAFT REPORT MARCH 2008 RETI-1000-2008-001-D #12;RETI Stakeholder Steering Committee Renewable Energy Transmission Initiative Phase 1A DRAFT REPORT B are registered trademarks of Black & Veatch Holding Company #12;RETI Stakeholder Steering Committee Renewable

  15. NCGIA Initiative 13 "User Interfaces for

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    NCGIA Initiative 13 "User Interfaces for Geographic Information Systems" Closing Report David M. Mark Abstract This report describes the results of NCGIA Research Initiative 13 "User Interfaces on User Interfaces for Geographic Information Systems was adopted by the NCGIA in December 1989

  16. Clean Energy and Bond Finance Initiative

    Broader source: Energy.gov [DOE]

    Provides information on Clean Energy and Bond Finance Initiative (CE+BFI). CE+BFI brings together public infrastructure finance agencies, clean energy public fund managers and institutional investors across the country to explore how to raise capital at scale for clean energy development through bond financing. Author: Clean Energy and Bond Finance Initiative

  17. Hawaii Clean Energy Initiative (HCEI) | Department of Energy

    Office of Environmental Management (EM)

    Hawaii Clean Energy Initiative (HCEI) Hawaii Clean Energy Initiative (HCEI) The Hawaii Clean Energy Initiative (HCEI) is an unprecedented effort to transform the entire Hawaii...

  18. 2014 SunShot Initiative Portfolio Book: Tackling Challenges in...

    Energy Savers [EERE]

    & Publications Download the SunShot Initiative 2014 Portfolio 2014 SunShot Initiative Portfolio Book: Photovoltaics 2014 SunShot Initiative Portfolio Book: Systems Integration...

  19. Modern Grid Initiative Distribution Taxonomy Final Report

    SciTech Connect (OSTI)

    Schneider, Kevin P.; Chen, Yousu; Chassin, David P.; Pratt, Robert G.; Engel, David W.; Thompson, Sandra E.

    2008-11-01

    This is the final report for the development of a toxonomy of prototypical electrical distribution feeders. Two of the primary goals of the Department of Energy's (DOE) Modern Grid Initiative (MGI) are 'to accelerate the modernization of our nation's electricity grid' and to 'support demonstrations of systems of key technologies that can serve as the foundation for an integrated, modern power grid'. A key component to the realization of these goals is the effective implementation of new, as well as existing, 'smart grid technologies'. Possibly the largest barrier that has been identified in the deployment of smart grid technologies is the inability to evaluate how their deployment will affect the electricity infrastructure, both locally and on a regional scale. The inability to evaluate the impacts of these technologies is primarily due to the lack of detailed electrical distribution feeder information. While detailed distribution feeder information does reside with the various distribution utilities, there is no central repository of information that can be openly accessed. The role of Pacific Northwest National Laboratory (PNNL) in the MGI for FY08 was to collect distribution feeder models, in the SynerGEE{reg_sign} format, from electric utilities around the nation so that they could be analyzed to identify regional differences in feeder design and operation. Based on this analysis PNNL developed a taxonomy of 24 prototypical feeder models in the GridLAB-D simulations environment that contain the fundamental characteristics of non-urban core, radial distribution feeders from the various regions of the U.S. Weighting factors for these feeders are also presented so that they can be used to generate a representative sample for various regions within the United States. The final product presented in this report is a toolset that enables the evaluation of new smart grid technologies, with the ability to aggregate their effects to regional and national levels. The distribution feeder models presented in this report are based on actual utility models but do not contain any proprietary or system specific information. As a result, the models discussed in this report can be openly distributed to industry, academia, or any interested entity, in order to facilitate the ability to evaluate smart grid technologies.

  20. Low-melting elemental metal or fusible alloy encapsulated polymerization initiator for delayed initiation

    DOE Patents [OSTI]

    Hermes, Robert E.

    2015-12-22

    An encapsulated composition for polymerization includes an initiator composition for initiating a polymerization reaction, and a capsule prepared from an elemental metal or fusible alloy having a melting temperature from about 20.degree. C. to about 200.degree. C. A fluid for polymerization includes the encapsulated composition and a monomer. When the capsule melts or breaks open, the initiator is released.

  1. Solar America Initiative (Across America Map)

    SciTech Connect (OSTI)

    Not Available

    2007-06-01

    This factsheet gives an overview of the Solar America Initiative (SAI) using a map to show locations of the Solar America Cities, Solar America Showcases and other market transformation and research and development projects.

  2. Digest of Global Initiatives (June 16, 2011)

    E-Print Network [OSTI]

    Pittendrigh, Barry

    it comes to clean energy, energy security, environmental stabilitDigest of Global Initiatives (June 16, 2011) Active or Pending: Active Title: Eco, and practical protocols for the best solutions for global energy, climate, and environmental problems. More than

  3. Advanced Drop-In Biofuels Initiative Agenda

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Roundtable - USDADOEDONDOT-FAA Advanced Drop-In Biofuels Initiative Agenda May 18, 2012 8:00 a.m. - 5:00 p.m. Jefferson Auditorium U.S. Department of Agriculture South Building...

  4. SunShot Initiative | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    More News The DOE SunShot Initiative is a national collaborative effort to make solar energy cost-competitive with other forms of electricity by the end of the decade....

  5. Hybrid black-hole binary initial data

    E-Print Network [OSTI]

    Bruno C. Mundim; Bernard J. Kelly; Yosef Zlochower; Hiroyuki Nakano; Manuela Campanelli

    2010-12-04

    Traditional black-hole binary puncture initial data is conformally flat. This unphysical assumption is coupled with a lack of radiation signature from the binary's past life. As a result, waveforms extracted from evolutions of this data display an abrupt jump. In Kelly et al. [Class.Quant.Grav.27:114005,2010], a new binary black-hole initial data with radiation contents derived in the post-Newtonian (PN) calculation was adapted to puncture evolutions in numerical relativity. This data satisfies the constraint equations to the 2.5PN order, and contains a transverse-traceless "wavy" metric contribution, violating the standard assumption of conformal flatness. Although the evolution contained less spurious radiation, there were undesired features; the unphysical horizon mass loss and the large initial orbital eccentricity. Introducing a hybrid approach to the initial data evaluation, we significantly reduce these undesired features.

  6. United Nations Human Space Technology Initiative (HSTI)

    E-Print Network [OSTI]

    Ochiai, M; Steffens, H; Balogh, W; Haubold, H J; Othman, M; Doi, T

    2015-01-01

    The Human Space Technology Initiative was launched in 2010 within the framework of the United Nations Programme on Space Applications implemented by the Office for Outer Space Affairs of the United Nations. It aims to involve more countries in activities related to human spaceflight and space exploration and to increase the benefits from the outcome of such activities through international cooperation, to make space exploration a truly international effort. The role of the Initiative in these efforts is to provide a platform to exchange information, foster collaboration between partners from spacefaring and non-spacefaring countries, and encourage emerging and developing countries to take part in space research and benefit from space applications. The Initiative organizes expert meetings and workshops annually to raise awareness of the current status of space exploration activities as well as of the benefits of utilizing human space technology and its applications. The Initiative is also carrying out primary ...

  7. Innovative Manufacturing Initiatives Recognition Day Agenda

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Innovative Manufacturing Initiatives Recognition Day June 20, 2012 The Embassy Row Hotel - 2015 Massachusetts Ave, NW 9:00-9:05am Welcome - Dr. Leo Christodoulou, DOE AMO Program...

  8. Webinar December 2: Materials Genome Initiative

    Broader source: Energy.gov [DOE]

    The Energy Department will present a live webinar entitled "Materials Genome Initiative" on Tuesday, December 2, from 12:00 to 1:00 p.m. Eastern Standard Time.

  9. Alaska Village Initiatives Rural Business Conference

    Broader source: Energy.gov [DOE]

    Hosted by the Alaska Village Initiative, the 24th Annual Rural Small Business Conference brings together rural businesses and leaders to provide them with networking opportunities, training, and technical information.

  10. Hawaii Clean Energy Initiative Scenario Analysis

    Office of Energy Efficiency and Renewable Energy (EERE)

    Analysis of potential policy options to help the state reach the 70% Hawaii Clean Energy Initiative (HCEI) goal, including possible pathways to attain the goal based on currently available technology.

  11. SunShot Initiative 2013 Fact Sheet

    Broader source: Energy.gov [DOE]

    This fact sheet provides an overview of the Energy Department's SunShot Initiative. SunShot aims to make solar energy fully cost-competitive with traditional energy sources by 2020 without subsidies.

  12. Celgard US Manufacturing Facilities Initiative for Lithium-ion...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Celgard US Manufacturing Facilities Initiative for Lithium-ion Battery Separator Celgard US Manufacturing Facilities Initiative for...

  13. Initial Stress Symmetry and Applications in Elasticity

    E-Print Network [OSTI]

    Artur L. Gower; Pasquale Ciarletta; Michel Destrade

    2015-06-16

    An initial stress within a solid can arise to support external loads or from processes such as thermal expansion in inert matter or growth and remodelling in living materials. For this reason it is useful to develop a mechanical framework of initially stressed solids irrespective of how this stress formed. An ideal way to do this is to write the free energy density $\\Psi= \\Psi(\\boldsymbol F, \\boldsymbol {\\tau})$ in terms of initial stress $\\boldsymbol \\tau$ and the elastic deformation gradient $\\boldsymbol F$. In this paper we present a new constitutive condition for initially stressed materials, which we call the initial stress symmetry (ISS). We focus on two consequences of this symmetry. First we examine how ISS restricts the free energy density $\\Psi = \\Psi (\\boldsymbol F, \\boldsymbol \\tau) $ and present two examples of $\\Psi (\\boldsymbol F, \\boldsymbol \\tau)$ that satisfy ISS. Second we show that the initial stress can be derived from the Cauchy stress and the elastic deformation gradient. To illustrate we take an example from biomechanics and calculate the optimal Cauchy stress within an artery subjected to internal pressure. We then use ISS to derive the optimal target residual stress for the material to achieve after remodelling.

  14. Pre-swing deficits in forward propulsion, swing initiation and power generation by individual muscles during hemiparetic walking

    E-Print Network [OSTI]

    Pre-swing deficits in forward propulsion, swing initiation and power generation by individual to quantify individual muscle contributions to forward propulsion, swing initiation and power generation.e., power delivered to the swing leg) and power generation (i.e., production or absorption of mechanical

  15. The solid state lighting initiative: An industry/DOE collaborativeeffort

    SciTech Connect (OSTI)

    Johnson, Steve

    2000-10-01

    A new era of technology is emerging in lighting. It is being propelled by the dramatic improvements in performance of solid state light sources. These sources offer an entirely new array of design aspects not achievable with current light sources. At the same time, their performance characteristics continue to improve and are expected to eclipse those of the most common light sources within the near future. High efficiency is one of these performance attributes motivating the Department of Energy (DOE) to work with the manufacturers of this new technology to create a program plan sufficiently comprehensive to support an industry-driven Solid State Lighting Initiative before Congress. The purpose of the initiative is to educate Congress about the potential of this technology to reduce the electric lighting load within the United States and, consequently, to realize the associated environmental benefits. The initiative will solicit congressional support to accelerate the development of solid state technology through investment in the research and development necessary to overcome the technical barriers that currently limit the products to niche markets. While there are multiple technologies being developed as solid state light sources, the two technologies which hold the most promise for application to general illumination are Light Emitting Diodes (LEDs) and Organic Light Emitting Diodes (OLEDs). The form of these sources can be quite different from current sources, allowing exciting new design uses for the products. Being diffuse sources, OLEDs are much lower in intensity per unit area than LEDs. The manufacturing process for OLEDs lends itself to shapes that can be formed to different geometries, making possible luminous panels or flexible luminous materials. Conversely, LEDs are very intense point sources which can be integrated into a small space to create an intense source or used separately for less focused applications. Both OLED and LED sources are expected to be thinner than other comparable sources; this thinness offers additional design opportunities.

  16. Hydrogen Production

    SciTech Connect (OSTI)

    2014-09-01

    This 2-page fact sheet provides a brief introduction to hydrogen production technologies. Intended for a non-technical audience, it explains how different resources and processes can be used to produce hydrogen. It includes an overview of research goals as well as “quick facts” about hydrogen energy resources and production technologies.

  17. Investigations of initiation spot size effects

    SciTech Connect (OSTI)

    Clarke, Steven A; Akinci, Adrian A; Leichty, Gary; Schaffer, Timothy; Murphy, Michael J; Munger, Alan; Thomas, Keith A

    2010-01-01

    As explosive components become smaller, a greater understanding of the effect of initiation spot size on detonation becomes increasingly critical. A series of tests of the effect of initiation spot size will be described. A series of DOI (direct optical initiation) detonators with initiation spots sizes from {approx}50 um to 1000um have been tested to determine laser parameters for threshold firing of low density PETN pressings. Results will be compared with theoretical predictions. Outputs of the initiation source (DOI ablation) have been characterized by a suite of diagnostics including PDV and schlieren imaging. Outputs of complete detonators have been characterized using PDV, streak, and/or schlieren imaging. At present, we have not found the expected change in the threshold energy to spot size relationship for DOI type detonators found in similar earlier for projectiles, slappers and EBWs. New detonators designs (Type C) are currently being tested that will allow the determination of the threshold for spot sizes from 250 um to 105um, where we hope to see change in the threshold vs. spot size relationship. Also, one test of an extremely small diameter spot size (50um) has resulted in preliminary NoGo only results even at energy densities as much as 8 times the energy density of the threshold results presented here. This gives preliminary evidence that 50um spot may be beyond the critical initiation diameter. The constant threshold energy to spot size relationship in the data to date does however still give some insight into the initiation mechanism of DOI detonators. If the DOI initiation mechanism were a 1D mechanism similar to a slapper or a flyer impact, the expected inflection point in the graph would have been between 300um and 500um diameter spot size, within the range of the data presented here. The lack of that inflection point indicates that the DOI initiation mechanism is more likely a 2D mechanism similar to a sphere or rod projectile. We expect to see a three region response as the results from the smaller spot size Type C detonators are completed.

  18. DOE Initiates Enforcement Proceedings against Westinghouse and...

    Broader source: Energy.gov (indexed) [DOE]

    Civil Penalty to Westinghouse Lighting Corporation and Mitsubishi Electric & Electronics USA, Inc. for failing to certify that certain of their products meet the applicable...

  19. International Nuclear Energy Research Initiative: 2013 Annual...

    Broader source: Energy.gov (indexed) [DOE]

    electricity generated and over 60 percent of our low-carbon production. Worldwide, nuclear power generates 14 percent of global electricity. Continually increasing demand for...

  20. Upcoming Clean Energy Manufacturing Initiative (CEMI) Southeast...

    Energy Savers [EERE]

    FCTO Home About the Fuel Cell Technologies Office Hydrogen Production Hydrogen Delivery Hydrogen Storage Fuel Cells Technology Validation Manufacturing Safety, Codes & Standards...

  1. Basic Research for the Hydrogen Fuel Initiative

    Broader source: Energy.gov (indexed) [DOE]

    PEM Fuel Cells Carnegie Mellon University Rapid Ab Initio Screening of Ternary Alloys for Hydrogen Production Rensselaer Polytechnic Institute Sol-Gel Based Polybenzimidazole...

  2. Particle production in quantum transport theories

    E-Print Network [OSTI]

    P. Bozek

    1997-04-05

    The particle production in the intermediate energy heavy ion collisions is discussed in the framework of the nonequilibrium Green's functions formalism. The evolution equations of the Green's functions for fermions allows for the discussion of the off-shell fermion propagator and of the large momentum component in the initial state. For the case of a homogeneous system numerical calculations of the meson production rate are performed and compared with the semiclassical production rate.

  3. Modeling shock initiation in Composition B

    SciTech Connect (OSTI)

    Murphy, M.J.; Lee, E.L.; Weston, A.M.; Williams, A.E.

    1993-05-01

    A hydrodynamic modeling study of the shock initiation behavior of Composition B explosive was performed using the {open_quotes}Ignition and Growth of Reaction in High Explosive{close_quotes} model developed at the Lawrence Livermore National Laboratory. The HE (heterogeneous explosives) responses were computed using the CALE and DYNA2D hydrocodes and then compared to experimental results. The data from several standard shock initiation and HE performance experiments was used to determine the parameters required for the model. Simulations of the wedge tests (pop plots) and failure diameter tests were found to be sufficient for defining the ignition and growth parameters used in the two term version of the computational model. These coefficients were then applied in the response analysis of several Composition B impact initiation experiments. A description of the methodology used to determine the coefficients and the resulting range of useful application of the ignition and growth of reaction model is described.

  4. Integrated Renewable Energy and Campus Sustainability Initiative

    SciTech Connect (OSTI)

    Uthoff, Jay; Jensen, Jon; Bailey, Andrew

    2013-09-25

    Renewable energy, energy conservation, and other sustainability initiatives have long been a central focus of Luther College. The DOE funded Integrated Renewable Energy and Campus Sustainability Initiative project has helped accelerate the College’s progress toward carbon neutrality. DOE funds, in conjunction with institutional matching funds, were used to fund energy conservation projects, a renewable energy project, and an energy and waste education program aimed at all campus constituents. The energy and waste education program provides Luther students with ideas about sustainability and conservation guidelines that they carry with them into their future communities.

  5. Modular initiator with integrated optical diagnostic

    DOE Patents [OSTI]

    Alam, M. Kathleen (Cedar Crest, NM); Schmitt, Randal L. (Tijeras, NM); Welle, Eric J. (Niceville, FL); Madden, Sean P. (Arlington, MA)

    2011-05-17

    A slapper detonator which integrally incorporates an optical wavequide structure for determining whether there has been degradation of the explosive in the explosive device that is to be initiated by the detonator. Embodiments of this invention take advantage of the barrel-like character of a typical slapper detonator design. The barrel assembly, being in direct contact with the energetic material, incorporates an optical diagnostic device into the barrel assembly whereby one can monitor the state of the explosive material. Such monitoring can be beneficial because the chemical degradation of the explosive plays an important in achieving proper functioning of a detonator/initiator device.

  6. Clean Energy Manufacturing Initiative Southeast Regional Summit

    Broader source: Energy.gov [DOE]

    Registration is now open for the Clean Energy Manufacturing Initiative’s (CEMI) Southeast Regional Summit! The all-day conference, hosted by the U.S. Department of Energy (DOE), will take place on July 9 in Atlanta, Georgia, at the Renaissance Atlanta Midtown Hotel. The Southeast Regional Summit will bring together leaders from industry, academia, and government to focus on competitiveness and innovation in clean energy manufacturing throughout the southeastern United States. The Summit is the third in a series organized around the country, and will convene key stakeholders to:

  7. Productization and Manufacturing Scaling of High-Efficiency Solar Cell and Module Products Based on a Disruptive Low-Cost, Mono-Crystalline Technology: Final Technical Progress Report, April 1, 2009 - December 30, 2010

    SciTech Connect (OSTI)

    Fatemi, H.

    2012-07-01

    Final report for PV incubator subcontract with Solexel, Inc. The purpose of this project was to develop Solexel's Unique IP, productize it, and transfer it to manufacturing. Silicon constitutes a significant fraction of the total solar cell cost, resulting in an industry-wide drive to lower silicon usage. Solexel's disruptive Solar cell structure got around these challenges and promised superior light trapping, efficiency and mechanical strength, despite being significantly thinner than commercially available cells. Solexel's successful participation in this incubator project became evident as the company is now moving into commercial production and position itself to be competitive for the next Technology Pathway Partnerships (TPP) funding opportunity.

  8. Hydrogen Production

    Fuel Cell Technologies Publication and Product Library (EERE)

    This 2-page fact sheet provides a brief introduction to hydrogen production technologies. Intended for a non-technical audience, it explains how different resources and processes can be used to produ

  9. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  10. Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too: Understanding action representation in left aIPS. Neuropsychologia (2010), doi:10.1016/j.neuropsychologia.2010.04.028

    E-Print Network [OSTI]

    Hamilton, Antonia

    2010-01-01

    Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too communication Triangles have goals too: Understanding action representation in left aIPS Richard Ramsey of animacy Corresponding author. E-mail address: richard.ramsey@nottingham.ac.uk (R. Ramsey). and brain

  11. Mobile Learning Initiative Summary of Accomplishments October 15, 2011-February 1, 2012

    E-Print Network [OSTI]

    Barrash, Warren

    who are focused on the assessment of the use of mobile learning. 2. With Mobile Learning Initiative://mobilelearning.boisestate.edu) expanded. 7. Expanded list of productivity and learning apps for 24 Library iPads for student checkout Exploration of Mobile Strategies to Increase Student Learning in an Academic Program" completed. (see http

  12. TOPOLOGICAL RAMSEY SPACES FROM FRAISSE CLASSES, RAMSEY-CLASSIFICATION THEOREMS, AND INITIAL STRUCTURES IN THE

    E-Print Network [OSTI]

    Dobrinen, Natasha

    TOPOLOGICAL RAMSEY SPACES FROM FRA¨ISS´E CLASSES, RAMSEY-CLASSIFICATION THEOREMS, AND INITIAL for constructing a new class of topological Ramsey spaces. Mem- bers of such spaces are infinite sequences of products of Fra¨iss´e classes of finite relational structures satisfying the Ramsey property. We extend

  13. Sustainability Initiative Task Force Final Report

    E-Print Network [OSTI]

    Sheridan, Jennifer

    UW­Madison Sustainability Initiative Task Force Final Report October 2010 #12;We are pleased to present the final report of the campus Sustainability Task Force. This report fulfills the charge we gave to sustainability for consideration by UW­Madison's leadership and campus community. There are many reasons why

  14. SunShot Initiative Portfolio Book 2014

    SciTech Connect (OSTI)

    Solar Energy Technologies Office

    2014-05-01

    The 2014 SunShot Initiative Portfolio Book outlines the progress towards the goals outlined in the SunShot Vision Study. Contents include overviews of each of SunShot’s five subprogram areas, as well as a description of every active project in the SunShot’s project portfolio as of May 2014.

  15. Fusion Energy An Industry-Led Initiative

    E-Print Network [OSTI]

    business not big science InternationalCompetitivenessissue - $26T/yr energy market with $300B/yr futureFusion Energy An Industry-Led Initiative September 10,1993 ATeam Effort TRW General Dynamics;Energy Supply and Needs Global per capita energy usage Global Per Capita energy usage will increase even

  16. THE NORTH CAROLINA PLANT SCIENCES INITIATIVE

    E-Print Network [OSTI]

    Buckel, Jeffrey A.

    . THE NORTH CAROLINA PLANT SCIENCES INITIATIVE A proposal to establish North Carolina as the world to exceed $100 billion before 2020. North Carolina is the nation's third most diverse agricultural state approach. North Carolina's agriculture and biosciences assets, concentrated in a new world

  17. Chemical Imaging Initiative Delivering New Capabilities for

    E-Print Network [OSTI]

    or with light-source capabilities to image materials of importance to the nation's energy and environmentalChemical Imaging Initiative Delivering New Capabilities for In Situ, Molecular-Scale Imaging A complete, precise and realistic view of chemical, materials and biochemical processes and an understanding

  18. Analysis of the Climate Change Technology Initiative

    Reports and Publications (EIA)

    1999-01-01

    Analysis of the impact of specific policies on the reduction of carbon emissions and their impact on U.S. energy use and prices in the 2008-2012 time frame. Also, analyzes the impact of the President's Climate Change Technology Initiative, as defined for the 2000 budget, on reducing carbon emissions from the levels forecast in the Annual Energy Outlook 1999 reference case.

  19. Energy Transition Initiative: Islands Playbook (Book)

    SciTech Connect (OSTI)

    Not Available

    2015-01-01

    The Island Energy Playbook (the Playbook) provides an action-oriented guide to successfully initiating, planning, and completing a transition to an energy system that primarily relies on local resources to eliminate a dependence on one or two imported fuels. It is intended to serve as a readily available framework that any community can adapt to organize its own energy transition effort.

  20. Michigan Biomaterials Initiative Steering Committee Meeting

    E-Print Network [OSTI]

    1 Michigan Biomaterials Initiative Steering Committee Meeting March 28-29, 2014, Houghton, MI.A., and Abbotts, H.H. Organized by the Main Themes that came out under the Topical Areas for Michigan Biomaterials and future of biomaterial markets Priority Issues and Areas of Concern · Michigan has a $14 billion industry

  1. NTID Health Care Initiatives October 1, 2011

    E-Print Network [OSTI]

    Salvaggio, Carl

    NTID Health Care Initiatives October 1, 2011 (Based on Interim Report, Task Force on Health Care Careers for the Deaf and Hard-of-Hearing Community, June, 2011) "Building Pathways to Health Care Careers for the Deaf and Hard-of- Hearing Community: Interim Report" submitted by the Task Force on Health Care Careers

  2. Geoffrey R Weller Library Digital Initiatives Librarian

    E-Print Network [OSTI]

    Northern British Columbia, University of

    Geoffrey R Weller Library Digital Initiatives Librarian (Two Year Term Position) The Geoffrey R information technology as well as to manage, maintain, and develop the library's digital infrastructure in Libraryand Information Studies. Experience with the delivery of digital library services is required

  3. INITIATIVE ENROLLMENT MARKETING STRATEGY Description and details about the program or initiative that is being proposed

    E-Print Network [OSTI]

    Saldin, Dilano

    INITIATIVE ­ ENROLLMENT MARKETING STRATEGY Description and details about the program or initiative that is being proposed New Enrollment Marketing Strategy 1. The more collaborative approach to enrollment marketing involves a deeper level of collaboration between the Enrollment Management Office and University

  4. 2013-2014 WEP Initiatives -OVERVIEW WEP Pre-College Initiatives

    E-Print Network [OSTI]

    Texas at Austin, University of

    and fourth year engineering women Women In their Second year of Engineering (WISE) Over 80 second year women and 24 MS and PhD engineering students WEP Leadership Seminar 60 second, third and fourth year student volunteers WEP Retention and Academic Success Initiatives First Year Initiative (FYI) 300+ first

  5. Stroke Belt Initiative 1National Heart, Lung, and Blood Institute Stroke Belt Initiative

    E-Print Network [OSTI]

    Shen, Jun

    Stroke Belt Initiative 1National Heart, Lung, and Blood Institute Stroke Belt Initiative NATIONAL HEART, LUNG, AND BLOOD INSTITUTE Project Accomplishments and Lessons Learned Overview Cerebrovascular to those living in other regions of the country. The National Heart, Lung, and Blood Institute (NHLBI

  6. Production expansion continues to accelerate

    SciTech Connect (OSTI)

    Not Available

    1992-08-01

    This paper reports that Saudi Arabian Oil Co. (Saudi Aramco) is continuing its accelerated Crude Oil Expansion Program initiated in 1989 that aims at achieving a 10 million bpd productive capacity by 1995. In addition to major engineering, construction and renovation work related to production expansion, Saudi Aramco drilling and workover operations have been markedly expanded. Since January 1991, rig activity has doubled. As an indication of aging of Saudi production, projects include modernizing current injection water treatment facilities, installing a new seawater injection plant on the Persian Gulf, installing dewatering facilities in a number of locations and installing a pilot gas lift project. In addition, equipment orders indicate the new discoveries south of Riyadh may also need the assistance of water injection from inception of production.

  7. Productive Energy of Some Feeds and Foods as Measured by Gains of Energy by Growing Chickens. 

    E-Print Network [OSTI]

    Fraps, G. S. (George Stronach); Carlyle, E. C. (Elmer Cardinal)

    1942-01-01

    STATION A B. CONNER, DIRECTOR, College Station, Texas BULLETIN NO. 625 DECEMBER 1942 PRODUCTIVE ENERGY OF SOME FEEDS AND FOODS AS MEASURED BY GAINS OF ENERGY BY GROWING CHICKENS G. S. FRAPS AND E. C. CARLYLE Division of Chemistry -* LIBRA RY... Aflculfural&~eetv~! ~~i\\~~~~~~~ - 601i~p7 ~faf>~ T kJ;:~: AGRICULTURAL AND MECHANICAL COLLEGE OF' TEXAS T. 0. WALTON, President B-28-1242-6M-L180 - IC- - [Blank Page in Original Bulletin] The value of 62 feeds and foods for furnishing energy for growing...

  8. Farm organization and cotton production costs in Comandante Fernandez, Chaco, Argentina 

    E-Print Network [OSTI]

    Stagno, Horacio Hugo

    1970-01-01

    , Argentina, 1968 50 il ] 1U. 'p'n ' j C' 1 / ~', t. 'ant' -, 1', . '-. '1)iP !'e:n~r. c;:. , Cii-, , i?' e s$ ~ ~ z!l. ' x e2'Vi. '~ '- ' ~ J' . '! ". ~':. -. C ' "1 ~ C: ' ~ '. & c!i D j 6A 13 , . &n-. r'q ih g, &, j, ;g~ lQ jq . , ' '; ri 7..."arms in the Sample 22 2. Climatic legions of the Chaco and Pormosa & cological Sub-depions of' the Chaco 4. colopical Sub- 'egions li and '/I in Comandante f"e rnonde z 27 INTRu. &UCT Ii, ! ) ~ ottnn production in Ar) "ntina is in c cori. od...

  9. Analysis of laboratory nucleosynthesis products

    E-Print Network [OSTI]

    S. V. Adamenko; A. S. Adamenko

    2003-07-11

    We present the results of the experimental study on synthesis of a wide range of isotopes in a superdense plasma. The initial conditions necessary for plasma bunch formation were provided by specially organized coherent impact on a solid target with a total energy up to 1 kJ. More than 4000 shots were performed with various targets made of light, medium, and heavy elements. Subsequent analysis of the products of the target explosion reveals the presence of a wide range of elements absent in the initial materials. Elements with nuclei three and more times heavier than the nucleus of the target main element are detected in the products. The isotopic composition of the produced elements significantly differs from the natural one. The presence of unknown superheavy elements at the border of the periodic table and beyond it was detected by several different spectroscopic methods of elemental and isotopic analyzes.

  10. Initiate test loop irradiations of ALSEP process solvent

    SciTech Connect (OSTI)

    Peterman, Dean R. [Idaho National Lab. (INL), Idaho Falls, ID (United States); Olson, Lonnie G. [Idaho National Lab. (INL), Idaho Falls, ID (United States); McDowell, Rocklan G. [Idaho National Lab. (INL), Idaho Falls, ID (United States)

    2014-09-01

    This report describes the initial results of the study of the impacts of gamma radiolysis upon the efficacy of the ALSEP process and is written in completion of milestone M3FT-14IN030202. Initial irradiations, up to 100 kGy absorbed dose, of the extraction section of the ALSEP process have been completed. The organic solvent used for these experiments contained 0.05 M TODGA and 0.75 M HEH[EHP] dissolved in n-dodecane. The ALSEP solvent was irradiated while in contact with 3 M nitric acid and the solutions were sparged with compressed air in order to maintain aerated conditions. The irradiated phases were used for the determination of americium and europium distribution ratios as a function of absorbed dose for the extraction and stripping conditions. Analysis of the irradiated phases in order to determine solvent composition as a function of absorbed dose is ongoing. Unfortunately, the failure of analytical equipment necessary for the analysis of the irradiated samples has made the consistent interpretation of the analytical results difficult. Continuing work will include study of the impacts of gamma radiolysis upon the extraction of actinides and lanthanides by the ALSEP solvent and the stripping of the extracted metals from the loaded solvent. The irradiated aqueous and organic phases will be analyzed in order to determine the variation in concentration of solvent components with absorbed gamma dose. Where possible, radiolysis degradation product will be identified.

  11. Planning and scheduling of PPG glass production, model and implementation.

    E-Print Network [OSTI]

    Grossmann, Ignacio E.

    (order of days) x High transition costs x Complex recycle structure for cullet consumption and production, and maximum inventory levels x production and consumption rates x compatibility matrix between colors x Cullet x initial, minimum, and maximum inventory levels x production and consumption rates x

  12. Damage detection in initially nonlinear systems

    SciTech Connect (OSTI)

    Bornn, Luke [Los Alamos National Laboratory; Farrar, Charles [Los Alamos National Laboratory; Park, Gyuhae [Los Alamos National Laboratory

    2009-01-01

    The primary goal of Structural Health Monitoring (SHM) is to detect structural anomalies before they reach a critical level. Because of the potential life-safety and economic benefits, SHM has been widely studied over the past decade. In recent years there has been an effort to provide solid mathematical and physical underpinnings for these methods; however, most focus on systems that behave linearly in their undamaged state - a condition that often does not hold in complex 'real world' systems and systems for which monitoring begins mid-lifecycle. In this work, we highlight the inadequacy of linear-based methodology in handling initially nonlinear systems. We then show how the recently developed autoregressive support vector machine (AR-SVM) approach to time series modeling can be used for detecting damage in a system that exhibits initially nonlinear response. This process is applied to data acquired from a structure with induced nonlinearity tested in a laboratory environment.

  13. Initial Aging Studies of Unfilled VCE

    SciTech Connect (OSTI)

    Letant, S E; Herberg, J L; Wilson, T S; Alviso, C T; Chinn, S C; Maxwell, R S

    2008-10-09

    This report presents initial data on the effects of temperature, oxygen, and radiation on the chemical and structural properties of newly formulated, unfilled VCE. This initial effort focused on a pristine sample, and a replicate sample irradiated in air at a dose of 25MR. Thermal degradation was investigated by performing Thermogravimetric Analysis (TGA), and radiation-induced degradation was investigated using Differential Scanning Calorimetry (DSC), X-ray Diffraction (XRD), Solid Phase MicroExtraction--Gas Chromatography/Mass Spectrometry (SPME-GC/MS), as well as various Nuclear Magnetic Resonance (NMR) techniques including: {sup 13}C, {sup 13}C {sup 1}H cross polarization (CP), and {sup 1}H magic angle spinning (MAS) NMR.

  14. Sunshot Initiative High Penetration Solar Portal

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The DOE SunShot Initiative is a collaborative national initiative to make solar energy cost-competitive with other forms of energy by the end of the decade. Reducing the installed cost of solar energy systems by about 75% will drive widespread large-scale adoption of this renewable energy and restore U.S. leadership in the global clean energy race. The High Penetration Solar Portal was created as a resource to aggregate the most relevant and timely information related to high penetration solar scenarios and integrating solar into the grid. The site is designed so that utilities, grant awardees, regulators, researchers, and other solar professionals can easily share data, case studies, lessons learned, and demonstration project findings. [from https://solarhighpen.energy.gov/about_the_high_penetration_solar_portal

  15. Secretary Chu Discusses Troops to Energy Jobs Initiative at the...

    Office of Environmental Management (EM)

    Secretary Chu Discusses Troops to Energy Jobs Initiative at the National Press Club Secretary Chu Discusses Troops to Energy Jobs Initiative at the National Press Club July 11,...

  16. Department of Energy Launches Major Initiative to Increase Energy...

    Energy Savers [EERE]

    Department of Energy Launches Major Initiative to Increase Energy Savings Across the Nationwide DOE Complex by 30 Percent Department of Energy Launches Major Initiative to Increase...

  17. Celgard US Manufacturing Facilities Initiative for Lithium-ion...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    More Documents & Publications Celgard US Manufacturing Facilities Initiative for Lithium-ion Battery Separator Celgard US Manufacturing Facilities Initiative for Lithium-ion...

  18. Countries Launch Initiative to Drive Energy Efficiency in the...

    Office of Environmental Management (EM)

    Countries Launch Initiative to Drive Energy Efficiency in the Commercial and Industrial Sectors Countries Launch Initiative to Drive Energy Efficiency in the Commercial and...

  19. Midwest/Mountain Alternative Fuel Initiative | Department of...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    MidwestMountain Alternative Fuel Initiative MidwestMountain Alternative Fuel Initiative Presentation from the U.S. DOE Office of Vehicle Technologies "Mega" Merit Review 2008 on...

  20. 2014 SunShot Initiative Portfolio Book: Concentrating Solar Power...

    Energy Savers [EERE]

    Concentrating Solar Power 2014 SunShot Initiative Portfolio Book: Concentrating Solar Power The 2014 SunShot Initiative Portfolio Book outlines the progress towards the goals...

  1. Reports on Initial Results of Smart Grid Investment Grant Projects...

    Energy Savers [EERE]

    Reports on Initial Results of Smart Grid Investment Grant Projects (December 2012) Reports on Initial Results of Smart Grid Investment Grant Projects (December 2012) DOE is...

  2. 2014 SunShot Initiative Portfolio Book: Tackling Challenges in...

    Broader source: Energy.gov (indexed) [DOE]

    & Publications Download the SunShot Initiative 2014 Portfolio 2014 SunShot Initiative Portfolio Book: Photovoltaics Revitalizing American Competitiveness in Solar Technologies...

  3. State Energy Risk Assessment Initiative - State Energy Risk Profiles...

    Energy Savers [EERE]

    Mission Energy Infrastructure Modeling and Analysis State Energy Risk Assessment Initiative - State Energy Risk Profiles State Energy Risk Assessment Initiative - State...

  4. Energy Department Launches Public-Private Initiative to Help...

    Energy Savers [EERE]

    Launches Public-Private Initiative to Help Oil and Natural Gas Industry Strengthen Its Cybersecurity Capabilities Energy Department Launches Public-Private Initiative to Help Oil...

  5. EBRD-Sustainable Energy Initiative: Scaling Up Finance for Climate...

    Open Energy Info (EERE)

    EBRD-Sustainable Energy Initiative: Scaling Up Finance for Climate Change Mitigation Jump to: navigation, search Tool Summary LAUNCH TOOL Name: EBRD-Sustainable Energy Initiative:...

  6. 2014 SunShot Initiative Systems Integration Subprogram Overview...

    Energy Savers [EERE]

    Systems Integration Subprogram Overview 2014 SunShot Initiative Systems Integration Subprogram Overview These slides correspond to a presentation given by SunShot Initiative...

  7. 2014 SunShot Initiative Technology to Market Subprogram Overview...

    Energy Savers [EERE]

    Technology to Market Subprogram Overview 2014 SunShot Initiative Technology to Market Subprogram Overview These slides correspond to a presentation given by SunShot Initiative...

  8. Ultrafast Laser Diagnostics to Investigate Initiation in Energetic...

    Office of Scientific and Technical Information (OSTI)

    Ultrafast Laser Diagnostics to Investigate Initiation in Energetic Materials. Citation Details In-Document Search Title: Ultrafast Laser Diagnostics to Investigate Initiation in...

  9. Factsheet: An Initiative to Help Modernize Natural Gas Transmission...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Factsheet: An Initiative to Help Modernize Natural Gas Transmission and Distribution Infrastructure Factsheet: An Initiative to Help Modernize Natural Gas Transmission and...

  10. Secretary Bodman Highlights President Bush's Solar America Initiative...

    Office of Environmental Management (EM)

    President Bush's Solar America Initiative in Merrimack , NH Secretary Bodman Highlights President Bush's Solar America Initiative in Merrimack , NH February 23, 2006 - 12:14pm...

  11. President Obama Announces Major Initiative to Spur Biofuels Industry...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    President Obama Announces Major Initiative to Spur Biofuels Industry and Enhance America's Energy Security President Obama Announces Major Initiative to Spur Biofuels Industry and...

  12. State Energy Risk Assessment Initiative | Department of Energy

    Energy Savers [EERE]

    Mission Energy Infrastructure Modeling and Analysis State Energy Risk Assessment Initiative State Energy Risk Assessment Initiative OE is leading a State Energy Risk...

  13. City of Pittsburgh Implementation Model: Green Initiatives Trust...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Model: Green Initiatives Trust Fund City of Pittsburgh implementation model, Green initiatives trust fund. Author: U. S. Department of Energy City of Pittsburgh...

  14. Energy Department Launches New Data-Driven Initiative to Help...

    Energy Savers [EERE]

    Launches New Data-Driven Initiative to Help Cities, States Advance Building Efficiency Energy Department Launches New Data-Driven Initiative to Help Cities, States Advance Building...

  15. Microsoft Word - Alcoa Extended Initial Period ROD - 2010-10...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Extended Initial Period... 6 b. Benefits to BPA will equal or exceed costs for the Extended Initial Period of the Block Contract. ......

  16. Nuclear Safety Workshop Agenda - Post Fukushima Initiatives and...

    Broader source: Energy.gov (indexed) [DOE]

    Agenda Post Fukushima Initiatives and Results In response to the March 2011 accident at the Fukushima Daiichi nuclear power plant, Secretary Chu initiated a series of actions to...

  17. Energy Department Announces New Mapping Initiative to Advance...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Department Announces New Mapping Initiative to Advance North American Carbon Storage Efforts Energy Department Announces New Mapping Initiative to Advance North American Carbon...

  18. Energy Department Announces $180 Million for Ambitious New Initiative...

    Energy Savers [EERE]

    Energy Department Announces 180 Million for Ambitious New Initiative to Deploy U.S. Offshore Wind Projects Energy Department Announces 180 Million for Ambitious New Initiative to...

  19. Energy Department Announces New Mapping Initiative to Advance...

    Energy Savers [EERE]

    Energy Department Announces New Mapping Initiative to Advance North American Carbon Storage Efforts Energy Department Announces New Mapping Initiative to Advance North American...

  20. Energy Department Announces Up to $31 Million for Initial Phases...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Up to 31 Million for Initial Phases of Enhanced Geothermal Systems Field Observatory Energy Department Announces Up to 31 Million for Initial Phases of Enhanced Geothermal...

  1. Better Buildings Neighborhood Initiative Upgrades 100,000 Buildings...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Buildings Neighborhood Initiative Upgrades 100,000 Buildings, Saves 730 Million on Energy Bills Better Buildings Neighborhood Initiative Upgrades 100,000 Buildings, Saves...

  2. Recovery Act: Clean Coal Power Initiative | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    A report detailling the Clean Coal Power initiative funded under the American Recovery and Renewal Act of 2009. Recovery Act: Clean Coal Power Initiative More Documents &...

  3. Naked singularities and admissibility of initial conditions

    E-Print Network [OSTI]

    H. M. Antia

    1997-01-11

    Gravitational collapse of a spherically symmetric cloud has been extensively studied to investigate the nature of resulting singularity. However, there has been considerable debate about the admissibility of certain initial density distributions. Using the Newtonian limit of the equations governing collapse of a fluid with an equation of state $p=p(\\rho)$ it is shown that the density distribution has to be even function of r in a spherically symmetric situation provided $dp/d\\rho\

  4. Wind Powering America Initiative (Fact Sheet)

    SciTech Connect (OSTI)

    Not Available

    2011-01-01

    The U.S. Department of Energy's Wind Powering America initiative engages in technology market acceptance, barrier reduction, and technology deployment support activities. This fact sheet outlines ways in which the Wind Powering America team works to reduce barriers to appropriate wind energy deployment, primarily by focusing on six program areas: workforce development, communications and outreach, stakeholder analysis and resource assessment, wind technology technical support, wind power for Native Americans, and federal sector support and collaboration.

  5. Clean Energy Manufacturing Initiative Southeast Regional Summit

    Broader source: Energy.gov [DOE]

    As part of the Clean Energy Manufacturing Initiative (CEMI), the U.S. Department of Energy (DOE) organizes regional summits around the country to expand its partnerships, share resources and successes, and refine its strategy to boost U.S. competitiveness in clean energy manufacturing. The CEMI Southeast Regional Summit, which will be held on July 9, 2015 at the Renaissance Atlanta Midtown Hotel in Atlanta, Georgia, is the third in this series.

  6. EM Partnering Initiative | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based|DepartmentStatementof Energy LaboratoryApril 4,Partnering Initiative

  7. Florida Hydrogen Initiative | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12, 2015Executive Order14,EnergyFinancingWIPPFixedFlorida Hydrogen Initiative

  8. Initiatives and Projects Contacts | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeVehicle Replacement U.S.Job& Projects » Initiatives and

  9. Initiatives and Projects | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeVehicle Replacement U.S.Job& Projects » Initiatives andand

  10. Initiation Pressure Thresholds from Three Sources

    SciTech Connect (OSTI)

    Souers, P C; Vitello, P

    2007-02-28

    Pressure thresholds are minimum pressures needed to start explosive initiation that ends in detonation. We obtain pressure thresholds from three sources. Run-to-detonation times are the poorest source but the fitting of a function gives rough results. Flyer-induced initiation gives the best results because the initial conditions are the best known. However, very thick flyers are needed to give the lowest, asymptotic pressure thresholds used in modern models and this kind of data is rarely available. Gap test data is in much larger supply but the various test sizes and materials are confusing. We find that explosive pressures are almost the same if the distance in the gap test spacers are in units of donor explosive radius. Calculated half-width time pulses in the spacers may be used to create a pressure-time curve similar to that of the flyers. The very-large Eglin gap tests give asymptotic thresholds comparable to extrapolated flyer results. The three sources are assembled into a much-expanded set of near-asymptotic pressure thresholds. These thresholds vary greatly with density: for TATB/LX-17/PBX 9502, we find values of 4.9 and 8.7 GPa at 1.80 and 1.90 g/cm{sup 3}, respectively.

  11. J/psi Production in Quark-Gluon Plasma

    E-Print Network [OSTI]

    Li Yan; Pengfei Zhuang; Nu Xu

    2006-11-05

    We study J/psi production at RHIC and LHC energies with both initial production and regeneration. We solve the coupled set of transport equation for the J/psi distribution in phase space and the hydrodynamic equation for evolution of quark-gluon plasma. At RHIC, continuous regeneration is crucial for the J/psi momentum distribution while the elliptic flow is still dominated by initial production. At LHC energy, almost all the initially created J\\psis are dissociated in the medium and regeneration dominates the J/psi properties.

  12. SN 2005ip: A luminous type IIn supernova emerging from a dense circumstellar medium as revealed by X-ray observations

    SciTech Connect (OSTI)

    Katsuda, Satoru [RIKEN (The Institute of Physical and Chemical Research) Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Maeda, Keiichi [Department of Astronomy, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Nozawa, Takaya [Kavli Institute for the Physics and Mathematics of the Universe (WPI), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Pooley, David [Department of Physics, Sam Houston State University, Huntsville, TX 77341-2267 (United States); Immler, Stefan [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 2077 (United States)

    2014-01-10

    We report on the X-ray spectral evolution of the nearby Type IIn supernova (SN) 2005ip based on Chandra and Swift observations covering ?1-6 yr after explosion. X-ray spectra in all epochs are well fitted by a thermal emission model with kT ? 7 keV. The somewhat high temperature suggests that the X-ray emission mainly arises from the circumstellar medium (CSM) heated by the forward shock. We find that the spectra taken two to three years after the explosion are heavily absorbed (N {sub H} ? 5 × 10{sup 22} cm{sup –2}), but the absorption gradually decreases to the level of the Galactic absorption (N {sub H} ? 4 × 10{sup 20} cm{sup –2}) at the final epoch. This indicates that the SN went off in a dense CSM and that the forward shock has overtaken it. The intrinsic X-ray luminosity stays constant until the final epoch, when it drops by a factor of ?2. The intrinsic 0.2-10 keV luminosity during the plateau phase is measured to be ?1.5 × 10{sup 41} erg s{sup –1}, ranking SN 2005ip as one of the brightest X-ray SNe. Based on the column density, we derive a lower limit of a mass-loss rate to be M-dot ?1.5×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, which roughly agrees with that inferred from the X-ray luminosity, M-dot ?2×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, where V{sub w} is the circumstellar wind speed. Such a high mass-loss rate suggests that the progenitor star had eruptive mass ejections similar to a luminous blue variable star. The total mass ejected in the eruptive period is estimated to be ?15 M {sub ?}, indicating that the progenitor mass is ? 25 M {sub ?}.

  13. The domestic natural gas and oil initiative. Energy leadership in the world economy

    SciTech Connect (OSTI)

    Not Available

    1993-12-01

    Two key overarching goals of this Initiative are enhancing the efficiency and competitiveness of U.S. industry and reducing the trends toward higher imports. These goals take into account new Federal policies that reflect economic needs, including economic growth, deficit reduction, job creation and security, and global competitiveness, as well as the need to preserve the environment, improve energy efficiency, and provide for national security. The success of this Initiative clearly requires coordinated strategies that range far beyond policies primarily directed at natural gas and oil supplies. Therefore, this Initiative proposes three major strategic activities: Strategic Activity 1 -- increase domestic natural gas and oil production and environmental protection by advancing and disseminating new exploration, production, and refining technologies; Strategic Activity 2 -- stimulate markets for natural gas and natural-gas-derived products, including their use as substitutes for imported oil where feasible; and Strategic Activity 3 -- ensure cost-effective environmental protection by streamlining and improving government communication, decision making, and regulation. Finally, the Initiative will reexamine the costs and benefits of increase oil imports through a broad new Department of Energy study. This study will form the basis for additional actions found to be warranted under the study.

  14. SunShot Initiative Fact Sheet

    SciTech Connect (OSTI)

    DOE Solar Energy Technologies Office

    2015-04-01

    The U.S. Department of Energy (DOE) SunShot Initiative is a collaborative national effort launched in 2011 that aggressively drives innovation to make solar energy fully cost competitive with traditional energy sources before the end of the decade. The SunShot fact sheet outlines goals and successes of the program as it works with private companies, universities, non-profit organizations, state and local governments, and national laboratories to drive down the cost of solar electricity to $0.06 per kilowatt-hour, without incentives, by the year 2020.

  15. Demand Response Initiatives at CPS Energy 

    E-Print Network [OSTI]

    Luna, R.

    2013-01-01

    stream_source_info ESL-KT-13-12-53.pdf.txt stream_content_type text/plain stream_size 4780 Content-Encoding UTF-8 stream_name ESL-KT-13-12-53.pdf.txt Content-Type text/plain; charset=UTF-8 Demand Response Initiatives... and Toyota combined. • Schools & Universities contributed 6 MW’s of Demand Response in 2013. 2013 DR Participants Trinity University - $5,654 Fort Sam ISD - $18,860 Judson ISD - $45,540 Alamo Colleges - $98,222 UTSA - $168,572 ESL-KT-13-12-53 CATEE 2013...

  16. SunShot Initiative Fact Sheet

    Broader source: Energy.gov [DOE]

    The U.S. Department of Energy (DOE) SunShot Initiative is a collaborative national effort launched in 2011 that aggressively drives innovation to make solar energy fully cost competitive with traditional energy sources before the end of the decade. The SunShot fact sheet outlines goals and successes of the program as it works with private companies, universities, non-profit organizations, state and local governments, and national laboratories to drive down the cost of solar electricity to $0.06 per kilowatt-hour, without incentives, by the year 2020.

  17. Energy Data Initiative | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH JumpEllenville, NewLtd EILEnergy Data Initiative Jump to: navigation,

  18. Postdoctoral Initial Discussion Form | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeeding access|Post-PolymerizationRequirementsEligibilityFellowshipInitial

  19. National Laboratory Impact Initiative: Success Stories

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOEDepartment ofProgram |(Upstate New York)Impact Initiative The

  20. commercial buildings initiative | netl.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLos AlamosSimulation Initiative7 Boundary Layer

  1. The Murmansk Initiative - RF: Acceptance Testing

    SciTech Connect (OSTI)

    Czajkowski, C.; Wester, D. W.; Dyer, R. S.; Soerlie, A. A.; Moller, B.; Barnes, E.

    2002-02-26

    The Murmansk Initiative-RF (MI) was conceived to provide the Russian Federation (RF) with the capacity to manage low-level liquid radioactive waste (LLRW) and comply with the requirements of the London Convention that prohibit ocean dumping. The trilateral project among Norway, the RF, and the United States of America (U.S.) began in 1994 and was the first to utilize exclusively Russian subcontractors to upgrade and expand an existing LLRW treatment plant on the premises of RTP Atomflot in Murmansk, Russia. The project moved quickly through the design phase. Progress during the construction phase was somewhat slower because of difficulties with acquisition of hardware, inexperience with automated instrumentation and control equipment, and unexpected design changes in the cementation unit. The project advanced into the test-operation phase, which is currently underway, in June 2001. Initial runs with liquid waste have revealed that procedures for unloading spent ion-exchange sorbents could be improved and that sludges formed during removal of alkaline-earth metals should be compacted in order for the facility to operate at its full potential. Resolution of these issues is expected within the next few months.

  2. Boron-10 ABUNCL Prototype Initial Testing

    SciTech Connect (OSTI)

    Kouzes, Richard T.; Ely, James H.; Lintereur, Azaree T.; Siciliano, Edward R.

    2012-12-01

    The Department of Energy Office of Nuclear Safeguards and Security (NA-241) is supporting the project Coincidence Counting With Boron-Based Alternative Neutron Detection Technology at Pacific Northwest National Laboratory (PNNL) for the development of a 3He proportional counter alternative neutron coincidence counter. The goal of this project is to design, build and demonstrate a system based upon 10B-lined proportional tubes in a configuration typical for 3He-based coincidence counter applications. This report provides results of initial testing of an Alternative Boron-Based Uranium Neutron Coincidence Collar (ABUNCL) design built by General Electric Reuter-Stokes. Several configurations of the ABUNCL models, which use 10B-lined proportional counters in place of 3He proportional counters for the neutron detection elements, were previously reported. The ABUNCL tested is of a different design than previously modeled. Initial experimental testing of the as-delivered passive ABUNCL was performed, and modeling will be conducted. Testing of the system reconfigured for active testing will be performed in the near future, followed by testing with nuclear fuel.

  3. A lightweight method for improving coordination in distributed, high-variability product companies

    E-Print Network [OSTI]

    Hendrickson, Brian S. (Brian Scott)

    2012-01-01

    Product companies face new challenges as they continue to expand their international footprints. Whereas globalization initially sought savings by outsourcing production to low-cost regions, emerging markets now present ...

  4. On the Relationships of Substrate Orientation, Hydrogen Abstraction, and Product Stereochemistry in Single and

    E-Print Network [OSTI]

    Ronquist, Fredrik

    On the Relationships of Substrate Orientation, Hydrogen Abstraction, and Product Stereochemistry) catalysis with a conserved active site alanine for S configuration hydroperoxide products for this stereocontrol we compared the stereoselec- tivity of the initiating hydrogen abstraction in soybean LOX-1

  5. Iron production maintenance effectiveness system

    SciTech Connect (OSTI)

    Augstman, J.J. [Dofasco Inc., Hamilton, Ontario (Canada)

    1996-12-31

    In 1989, an internal study in the Coke and Iron Maintenance Department identified the opportunities available to increase production, by decreasing unscheduled maintenance delays from 4.6%. A five year front loaded plan was developed, and presented to the company president. The plan required an initial investment of $1.4 million and a conservative break-even point was calculated to be 2.5 years. Due to budget restraints, it would have to be self-funded, i.e., generate additional production or savings, to pay for the program. The program began in 1991 at number 2 coke plant and the blast furnaces. This paper will describe the Iron Production Maintenance Effectiveness System (ME), which began with the mechanical and pipefitting trades.

  6. Multidisciplinary design problem solving on product development teams

    E-Print Network [OSTI]

    Bernstein, Joshua I. (Joshua Ian), 1974-

    2001-01-01

    This investigation, conducted under the auspices of the Lean Aerospace Initiative (LAI), studied how engineers from different specialties interpret and communicate about technical design problems while working on product ...

  7. Products of the Benzene + O(3P) Reaction

    E-Print Network [OSTI]

    Osborn, David L.

    2010-01-01

    Chemistry Products of the Benzene + O( 3 P) Reaction CraigThe gas-phase reaction of benzene with O( 3 P) is ofthe addition of the O atom to benzene, forming an initial

  8. A Realistic Technology and Engineering Assessment of Algae Biofuel Production

    E-Print Network [OSTI]

    Quinn, Nigel

    microalgae biofuel technologies for both oil and biogas production, provides an initial assessment of the US or wastewater treatment, (2) biofuel outputs--either biogas only or biogas plus oil, and (3) farm size

  9. ? Production in Heavy Ion Collisions at LHC

    E-Print Network [OSTI]

    Kai Zhou; Nu Xu; Pengfei Zhuang

    2014-08-19

    We investigate the {\\Upsilon} production in heavy ion collisions at LHC energy in the frame of a dynamical transport approach. Both the initial production and in-medium regeneration and both the cold and hot nuclear matter effects are included in the calculations. In comparison with the ground state {\\Upsilon}(1s), the excited state {\\Upsilon}(2s) is much more sensitive to the heavy quark potential at finite temperature.

  10. Hydrogen Production

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum12,ExecutiveFinancingR Walls -Hydro-Pac Inc.,1 DOE HydrogenProduction Hydrogen is

  11. Relating horsepower to drilling productivity

    SciTech Connect (OSTI)

    Givens, R.; Williams, G.; Wingfield, B.

    1996-12-31

    Many technological advancements have been made in explosive products and applications over the last 15 years resulting in productivity and cost gains. However, the application of total energy (engine horsepower) in the majority of rotary drilling technology, has remained virtually unchanged over that period. While advancements have been made in components, efficiency, and types of hydraulic systems used on drills, the application of current hydraulic technology to improve drilling productivity has not been interactive with end users. This paper will investigate how traditional design assumptions, regarding typical application of horsepower in current rotary drill systems, can actually limit productivity. It will be demonstrated by numeric analysis how changing the partitioning of available hydraulic energy can optimize rotary drill productivity in certain conditions. Through cooperative design ventures with drill manufacturers, increased penetration rates ranging from 20% to 100% have been achieved. Productivity was increased initially on some rigs by careful selection of optional hydraulic equipment. Additional gains were made in drilling rates by designing the rotary hydraulic circuit to meet the drilling energies predicted by computer modeling.

  12. RNA Extraction and Labeling 1. To IP pellet (~ 25 l vol), add 175 l of: 10 mM HEPES-NaOH, pH 7.5

    E-Print Network [OSTI]

    Aris, John P.

    85 RNA Extraction and Labeling 1. To IP pellet (~ 25 µl vol), add 175 µl of: 10 mM HEPES-NaOH, pH 7 Speed-Vac. 7. Labeling 3' ends. To each pellet, add 10 µl containing: 1 X NEB RNA Ligase buffer 10% DMSO precipitate. Use DEPC-treated 3M NaOAc, pH 5. Wash with 75% EtOH and dry. 12. Resuspend pellet completely in 5

  13. Final Report: Multi-State Sharing Initiative

    SciTech Connect (OSTI)

    Begoli, Edmon; Boehmann, Brant; DeNap, Frank A

    2012-04-01

    In 2003 a joint effort between the U.S. Department of Homeland Security (DHS) and the U.S. Department of Justice created state and metropolitan intelligence fusion centers. These fusion centers were an effort to share law enforcement, disaster, and terrorism related information and intelligence between state and local jurisdictions and to share terrorism related intelligence between state and local law enforcement agencies and various federal entities. In 2006, DHS commissioned the Oak Ridge National Laboratory to establish and manage a groundbreaking program to assist local, state, and tribal leaders in developing the tools and methods required to anticipate and forestall terrorist events and to enhance disaster response. This program, called the Southeast Region Research Initiative (SERRI), combines science and technology with validated operational approaches to address regionally unique requirements and suggest regional solutions with the potential for national application. In 2009, SERRI sponsored the Multistate Sharing Initiative (MSSI) to assist state and metropolitan intelligence fusion centers with sharing information related to a wider variety of state interests than just terrorism. While these fusion centers have been effective at sharing data across organizations within their respective jurisdictions, their organizational structure makes bilateral communication with federal entities convenient and also allows information to be further disbursed to other local entities when appropriate. The MSSI-developed Suspicious Activity Report (SAR) sharing system allows state-to-state sharing of non-terrorism-related law enforcement and disaster information. Currently, the MSSI SAR system is deployed in Alabama, Kentucky, Tennessee, and South Carolina. About 1 year after implementation, cognizant fusion center personnel from each state were contacted to ascertain the status of their MSSI SAR systems. The overwhelming response from these individuals was that the MSSI SAR system was an outstanding success and contributed greatly to the security and resiliency of their states. At least one state commented that SERRI's implementation of the MSSI SAR actually 'jump started' and accelerated deployment and acceptance of the Nationwide Suspicious Activity Reporting Initiative (NSI). While all states were enthusiastic about their systems, South Carolina and Tennessee appeared to be the heaviest users of their respective systems. With NSI taking the load of sharing SARs with other states, Tennessee has redeployed the MSSI SAR system within Tennessee to allow SAR sharing between state and local organizations including Tennessee's three Homeland Security Regions, eleven Homeland Security Districts, and more than 500 police and sheriff offices, as well as with other states. In one success story from South Carolina, the Economy SAR System was used to compile similar SARs from throughout the state which were then forwarded to field liaison officers, emergency management personnel, and law enforcement officers for action.

  14. Initial Helioseismic Observations by Hinode/SOT

    E-Print Network [OSTI]

    Takashi Sekii; Alexander G. Kosovichev; Junwei Zhao; Saku Tsuneta; Hiromoto Shibahashi; Thomas E. Berger; Kiyoshi Ichimoto; Yukio Katsukawa; Bruce W. Lites; Shin'ichi Nagata; Toshifumi Shimizu; Richard A. Shine; Yoshinori Suematsu; Theodore D. Tarbell; Alan M. Title

    2007-09-12

    Results from initial helioseismic observations by Solar Optical Telescope onboard Hinode are reported. It has been demonstrated that intensity oscillation data from Broadband Filter Imager can be used for various helioseismic analyses. The k-omega power spectra, as well as corresponding time-distance cross-correlation function that promises high-resolution time-distance analysis below 6-Mm travelling distance, were obtained for G-band and CaII-H data. Subsurface supergranular patterns have been observed from our first time-distance analysis. The results show that the solar oscillation spectrum is extended to much higher frequencies and wavenumbers, and the time-distance diagram is extended to much shorter travel distances and times than they were observed before, thus revealing great potential for high-resolution helioseismic observations from Hinode.

  15. City of Tallahassee Innovative Energy Initiatives

    SciTech Connect (OSTI)

    Wilder, Todd; Moragne, Corliss L.

    2014-06-25

    The City of Tallahassee's Innovative Energy Initiatives program sought, first, to evaluate customer response and acceptance to in-home Smart Meter-enabled technologies that allow customers intelligent control of their energy usage. Additionally, this project is in furtherance of the City of Tallahassee's ongoing efforts to expand and enhance the City's Smart Grid capacity and give consumers more tools with which to effectively manage their energy consumption. This enhancement would become possible by establishing an "operations or command center" environment that would be designed as a dual use facility for the City's employees - field and network staff - and systems responsible for a Smart Grid network. A command center would also support the City's Office of Electric Delivery and Energy Reliability's objective to overcome barriers to the deployment of new technologies that will ensure a truly modern and robust grid capable of meeting the demands of the 2151 century.

  16. Boston Architectural College Urban Sustainability Initiative

    SciTech Connect (OSTI)

    Byers, Arthur C.

    2013-07-31

    The Boston Architectural College's Urban Sustainability initiative is a demonstration project as defined by the National Energy Technology Laboratory. BAC's proposed project with the U.S. Department of Energy - NETL, is a large part of that overall initiative. The BAC's Urban Sustainability Initiative is a multi-part project with several important goals and objectives that will have a significant impact on the surrounding neighborhood including: energy conservation, reduction of storm water runoff, generation of power through alternative energy sources, elimination/reduction of BAC carbon footprint, and to create a vehicle for ongoing public outreach and education. Education and outreach opportunities will serve to add to the already comprehensive Sustainability Design courses offered at BAC relative to energy savings, performance and conservation in building design. At the finish of these essential capital projects there will be technical materials created for the education of the design, sustainability, engineering, community development and historic preservation communities, to inform a new generation of environmentally-minded designers and practitioners, the city of Boston and the general public. The purpose of the initiative, through our green renovations program, is to develop our green alley projects and energy saving renovations to the BAC physical plant, to serve as a working model for energy efficient design in enclosed 19th century and 20th century urban sites and as an educational laboratory for teaching ecological and sustainable technologies to students and the public while creating jobs. The scope of our project as it relates to the BAC and the U.S. Department of Energy- NETL combined efforts includes: Task I of the project is Phase II (Green Alley). Task I encompasses various renovation activities that will demonstrate the effectiveness of permeable paving and ground water recharge systems. It will aid in the reduction of storm water runoff into the Charles River Basin in one of its most significantly polluted sections and, will provide a green renovation mechanism for the redirected storm water of a public alley way. This activity is designed to improve the quality of water recharging the ground water and protecting the vulnerable wood pilings under many of the historic masonry buildings in Boston's Back Bay. Sustainable design research and system monitoring opportunities will also be incorporated, providing ongoing tools for public outreach and education through innovative signage and "virtual tour" technology. The monitoring will include a "building performance dash board" that reflects real time operating conditions and improvements in environmental and economic performance to be prominently displayed on the face of our 320 Newbury Street building (approximately 1.5 million people walk by annually). The project site and demonstration area is located at the rear of 951 Boylston Street, Boston, MA 02115 and the parking area adjacent to Public Alley #444 in Boston's historic Back Bay. Task II of the project is Geothermal Solution. This task involves the installation of approximately seven Geothermal wells which will tap into the earth's constant underground temperatures to provide air-conditioning and heating for BAC facilities. The environmentally friendly geothermal system uses no fossil fuel, produces no emissions and runs silently, providing a sustainable model for commercial and residential buildings throughout Boston. Ultimately the combination of this project and other projects will assist in making the BAC "carbon-neutral", and could generate enough additional energy to provide free power to the Engine 33 and Ladder 15 Firehouse located at 941 Boylston Street. The project is located at the rear of 951 Boylston Street, Boston, MA 02115 and the parking area adjacent to Public Alley #444 in Boston's historic Back Bay. Task III of the project is the Sustainability Design Curriculum at the BAC. The BAC is the nation’s largest independent, multi-disciplinary college of spatial design, and a leader in

  17. e-Science initiatives in Venezuela

    E-Print Network [OSTI]

    Chaves, J L; Hamar, V; Isea, R; Rojas, F; Ruiz, N; Torrens, R; Uzcategui, M; Florez-Lopez, J; Hoeger, H; Mendoza, C; Núńez, L A

    2007-01-01

    Within the context of the nascent e-Science infrastructure in Venezuela, we describe several web-based scientific applications developed at the Centro Nacional de Calculo Cientifico Universidad de Los Andes (CeCalCULA), Merida, and at the Instituto Venezolano de Investigaciones Cientificas (IVIC), Caracas. The different strategies that have been followed for implementing quantum chemistry and atomic physics applications are presented. We also briefly discuss a damage portal based on dynamic, nonlinear, finite elements of lumped damage mechanics and a biomedical portal developed within the framework of the \\textit{E-Infrastructure shared between Europe and Latin America} (EELA) initiative for searching common sequences and inferring their functions in parasitic diseases such as leishmaniasis, chagas and malaria.

  18. Walk the Talk. Integrated Sustainability Initiative

    SciTech Connect (OSTI)

    Sagebiel, John

    2014-09-30

    The overall objective of this project was to demonstrate, through a series of real-world applications of existing technology, the benefits to the University of Nevada, Reno and the community, of various sustainability efforts. The project was very successful and has stimulated the Campus to take on more projects after seeing the successes of those initial ones funded through this project. The three areas of this work could broadly be described as energy efficiency, renewable energy and recycling. Under the first project, the campus did several projects replacing or changing heating and cooling systems, using state funding. The DOE funding initially funded the replacement of lights in one campus parking garage with LED lights. Subsequently, the campus facilities group recognized how effective this was and leveraged funds to do the other two garages. Similarly with the renewable energy project, once the first system was installed and working well, the campus committed funds to more than double that system. Lastly, the recycling efforts expanded the use and awareness on campus and led the campus to begin using a single-stream recycling program once it became available in this area, hopefully leading to more participation by the campus community. Thus, overall the project areas each did what they were intended to do, which was to demonstrate the usefulness of these sustainability programs and thus encourage the campus to do more. All this great work helps the campus’ goals overall, but without additional effort would not reach beyond the campus. This was the objective of the education and outreach effort. The combination of events, websites, and videos enabled us to reach many key decision makers and at the same time provide a long-term presence on the web that we can use to further educate people. The overall goals were met or exceeded and will continue to pay dividends into the future.

  19. GAUDINO INITIATIVE: DANGEROUS COURSES AFR 320(S) Dangerous Bodies: Black Womanhood, Sexuality and Popular Culture (Same as AMST 320 and WGSS 402)

    E-Print Network [OSTI]

    Aalberts, Daniel P.

    299 GAUDINO INITIATIVE: DANGEROUS COURSES AFR 320(S) Dangerous Bodies: Black Womanhood, Sexuality. This course is part of the Gaudino Danger Initiative. Format: seminar. Requirements: evaluation will be based Respond to Dangerous Times (Same as AMST 101) (D) This introductory video production course focuses on how

  20. The OH-Initiated Oxidation of 1,3-Butadiene in the Presence of O2 and NO: A Photolytic Route To Study Isomeric Selective Reactivity

    E-Print Network [OSTI]

    North, Simon W.

    The OH-Initiated Oxidation of 1,3-Butadiene in the Presence of O2 and NO: A Photolytic Route, 2005 We report the study of the isomeric selective OH-initiated oxidation of 1,3-butadiene provides only one of the possible OD-butadiene adducts, the minor addition channel product, simplifying

  1. The Product Flow Model Gio Wiederhold

    E-Print Network [OSTI]

    Wiederhold, Gio

    (IT) operations for software then little overall lifetime cost reduction has been achieved by reduced Boehm has demonstrated, a modest initial investment, say 20% over the most economical cost of deliveringThe Product Flow Model Gio Wiederhold Stanford University 14 May 2003 Abstract We observed a new

  2. Estimated Costs of Pasture and Hay Production

    E-Print Network [OSTI]

    Duffy, Michael D.

    Estimated Costs of Pasture and Hay Production This report summarizes estimated costs of improving pasture by five different systems. For each system, both the initial cost per acre and the annual maintenance cost per acre are presented. In addition, costs of establishing alfalfa or alfalfagrass hay

  3. Estimated Costs of Pasture and Hay Production

    E-Print Network [OSTI]

    Duffy, Michael D.

    Estimated Costs of Pasture and Hay Production This report summarizes estimated costs of improving pasture by five different systems. For each system, both the initial cost per acre and the annual maintenance cost per acre are presented. In addition, costs of establishing alfalfa or alfalfa-grass hay

  4. The role of the Federal Relighting Initiative in emission controls

    SciTech Connect (OSTI)

    Nicholls, A.K.; Purcell, C.W.; Friedman, J.R.

    1992-10-01

    The Department of Energy`s (DOE) Federal Relighting Initiative (FRI), under the Federal Energy Management Program (FEMP), has developed a comprehensive process to assist federal agencies in meeting the nation`s energy mandate. This mandate states that federal facilities must use 20% less energy by the year 2000, based on 1985 consumption levels. Because lighting accounts for about 40% of total federal electricity consumption, the FRI was conceived to help reduce energy use in this important area while improving lighting quality and increasing productivity through relighting. Selected federal rules and regulations provide guidance on the types of energy efficiency techniques required, life-cycle costing methods and lighting levels that should be employed to achieve the federal mandate. Although the central focus of this paper is on the environment, this paper takes the perspective that the energy efficiency gains achieved through the FRI would produce both environmental and economic benefits for the United States. For example, improvements in energy efficiency would reduce electricity demand, and would consequently reduce the emissions associated with fossil fuel combustion for power production. These reduced emissions include carbon dioxide, which is associated with the potential for global climate change, and heavy metals, which pose a potential health threat to humans and aquatic ecosystems. Economic benefits of the FRI would include reduced federal expenditures on energy or, possibly, avoiding new power plant construction.This paper begins with a brief overview of the FRI process. Next, current lighting energy use in federal buildings is evaluated and the potential future energy savings achievable through full implementation of the FRI are estimated. The paper then translates these energy savings into avoided emissions of carbon dioxide and heavy metals and into avoided fuel expenditures.

  5. The role of the Federal Relighting Initiative in emission controls

    SciTech Connect (OSTI)

    Nicholls, A.K.; Purcell, C.W.; Friedman, J.R.

    1992-10-01

    The Department of Energy's (DOE) Federal Relighting Initiative (FRI), under the Federal Energy Management Program (FEMP), has developed a comprehensive process to assist federal agencies in meeting the nation's energy mandate. This mandate states that federal facilities must use 20% less energy by the year 2000, based on 1985 consumption levels. Because lighting accounts for about 40% of total federal electricity consumption, the FRI was conceived to help reduce energy use in this important area while improving lighting quality and increasing productivity through relighting. Selected federal rules and regulations provide guidance on the types of energy efficiency techniques required, life-cycle costing methods and lighting levels that should be employed to achieve the federal mandate. Although the central focus of this paper is on the environment, this paper takes the perspective that the energy efficiency gains achieved through the FRI would produce both environmental and economic benefits for the United States. For example, improvements in energy efficiency would reduce electricity demand, and would consequently reduce the emissions associated with fossil fuel combustion for power production. These reduced emissions include carbon dioxide, which is associated with the potential for global climate change, and heavy metals, which pose a potential health threat to humans and aquatic ecosystems. Economic benefits of the FRI would include reduced federal expenditures on energy or, possibly, avoiding new power plant construction.This paper begins with a brief overview of the FRI process. Next, current lighting energy use in federal buildings is evaluated and the potential future energy savings achievable through full implementation of the FRI are estimated. The paper then translates these energy savings into avoided emissions of carbon dioxide and heavy metals and into avoided fuel expenditures.

  6. Research and development for the declassification productivity initiative. Quarterly report, January 1997--August 1997

    SciTech Connect (OSTI)

    Bessonet, C.G. de

    1997-03-05

    The highlight for the first quarter was the presentation of research progress and findings at the DPI Symposium on March 5, 1997. Since that presentation, additional progress was slowed down due to the decreased budget funding for year two, and consequently, the decrease in time-effort of the principal investigators. This report summarizes the progress in each of the topical areas to date. A research article has been prepared for publication for the Optical Character Recognition project; two progress reports are included for the Logical Analysis project; and two progress reports for the Knowledge Representation project. Research activities for the Tipster Technology project will resume this fall.

  7. AN INITIAL ASSESSMENT OF POTENTIAL PRODUCTION TECHNOLOGIES FOR EPSILON-METAL WASTE FORMS

    SciTech Connect (OSTI)

    Rohatgi, Aashish; Strachan, Denis M.

    2011-03-01

    This report examines and ranks a total of seven materials processing techniques that may be potentially utilized to consolidate the undissolved solids from nuclear fuel reprocessing into a low-surface area form. Commercial vendors of processing equipment were contacted and literature researched to gather information for this report. Typical equipment and their operation, corresponding to each of the seven techniques, are described in the report based upon the discussions and information provided by the vendors. Although the report does not purport to describe all the capabilities and issues of various consolidation techniques, it is anticipated that this report will serve as a guide by highlighting the key advantages and disadvantages of these techniques. The processing techniques described in this report were broadly classified into those that employed melting and solidification, and those in which the consolidation takes place in the solid-state. Four additional techniques were examined that were deemed impractical, but were included for completeness. The techniques were ranked based on criteria such as flexibility in accepting wide-variety of feed-stock (chemistry, form, and quantity), ease of long-term maintenance, hot cell space requirements, generation of additional waste streams, cost, and any special considerations. Based on the assumption of ~2.5 L of waste to be consolidated per day, sintering based techniques, namely, microwave sintering, spark plasma sintering and hot isostatic pressing, were ranked as the top-3 choices, respectively. Melting and solidification based techniques were ranked lower on account of generation of volatile phases and difficulties associated with reactivity and containment of the molten metal.

  8. New Energy Star Initiative Recognizes Cutting-Edge Products with Highest

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy AEnergy Managing SwimmingMicrosoftPolicy, onThermalFacilitiesFYEnergyEnergy

  9. Towards the understanding of PETN initiation by a fast, high...

    Office of Scientific and Technical Information (OSTI)

    Towards the understanding of PETN initiation by a fast, high power arc source Citation Details In-Document Search Title: Towards the understanding of PETN initiation by a fast,...

  10. Initiated chemical vapor deposition of functional polyacrylic thin films

    E-Print Network [OSTI]

    Mao, Yu, 1975-

    2005-01-01

    Initiated chemical vapor deposition (iCVD) was explored as a novel method for synthesis of functional polyacrylic thin films. The process introduces a peroxide initiator, which can be decomposed at low temperatures (<200?C) ...

  11. Energy Department Unveils 3D-Printed Building; New Initiatives...

    Office of Environmental Management (EM)

    Unveils 3D-Printed Building; New Initiatives During Industry Day Energy Department Unveils 3D-Printed Building; New Initiatives During Industry Day October 1, 2015 - 12:25pm...

  12. DOE Announces New Wind Vision Initiative at AWEA WINDPOWER Conference...

    Office of Environmental Management (EM)

    Announces New Wind Vision Initiative at AWEA WINDPOWER Conference DOE Announces New Wind Vision Initiative at AWEA WINDPOWER Conference August 1, 2013 - 2:40pm Addthis This is an...

  13. How cohesive is matter? Multijet production in neutral current deep inelastic scattering at HERA

    E-Print Network [OSTI]

    #erent from the initial particles. These particles move as one stream, called a jet, in the direction of the initial parton. The study of jet production and jet rates is therefore a very powerful tool to examine QCD, since the parameters of the jet can be associated with the characteristics of the initial partons

  14. Heavy flavor production from photons and hadrons

    SciTech Connect (OSTI)

    Heusch, C.A.

    1982-01-01

    The present state of the production and observation of hadrons containing heavy quarks or antiquarks as valence constituents, in reactions initiated by real and (space-like) virtual photon or by hadron beams is discussed. Heavy flavor production in e/sup +/e/sup -/ annihilation, which is well covered in a number of recent review papers is not discussed, and similarly, neutrino production is omitted due to the different (flavor-changing) mechanisms that are involved in those reactions. Heavy flavors from spacelike photons, heavy flavors from real photons, and heavy flavors from hadron-hadron collisions are discussed. (WHK)

  15. 4. Wrzburger Workshop ,,IP Netzmanagement, IP Netzplanung und Optimierung"

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    Protocol (ICMP, ,,ping" and ,,traceroute" Funktionen) - Simple Network Management Protocol (SNMP) - DNSRessourcenmanagement Architektur R R R R R R S R R R S S QoS Architektur Harte und weiche QoS Garantien DiffServ Netz mit

  16. Innovative Manufacturing Initiative Recognition Day- Final Participant Listing

    Broader source: Energy.gov [DOE]

    Participant listing for Innovative Manufacturing Initiative Recognition Day held in Washington, D.C. on June 20, 2012

  17. Track 7: Environmental Protection, Environmental Management System (EMS), "Greening Initiatives"

    Broader source: Energy.gov [DOE]

    ISM Workshop Presentations Knoxville Convention Center, Knoxville, TN August 2009 Track 7: Environmental Protection, Environmental Management System (EMS), "Greening Initiatives"

  18. Initial Risk Analysis and Decision Making Framework

    SciTech Connect (OSTI)

    Engel, David W.

    2012-02-01

    Commercialization of new carbon capture simulation initiative (CCSI) technology will include two key elements of risk management, namely, technical risk (will process and plant performance be effective, safe, and reliable) and enterprise risk (can project losses and costs be controlled within the constraints of market demand to maintain profitability and investor confidence). Both of these elements of risk are incorporated into the risk analysis subtask of Task 7. Thus far, this subtask has developed a prototype demonstration tool that quantifies risk based on the expected profitability of expenditures when retrofitting carbon capture technology on a stylized 650 MW pulverized coal electric power generator. The prototype is based on the selection of specific technical and financial factors believed to be important determinants of the expected profitability of carbon capture, subject to uncertainty. The uncertainty surrounding the technical performance and financial variables selected thus far is propagated in a model that calculates the expected profitability of investments in carbon capture and measures risk in terms of variability in expected net returns from these investments. Given the preliminary nature of the results of this prototype, additional work is required to expand the scope of the model to include additional risk factors, additional information on extant and proposed risk factors, the results of a qualitative risk factor elicitation process, and feedback from utilities and other interested parties involved in the carbon capture project. Additional information on proposed distributions of these risk factors will be integrated into a commercial implementation framework for the purpose of a comparative technology investment analysis.

  19. CASL Validation Data: An Initial Review

    SciTech Connect (OSTI)

    Nam Dinh

    2011-01-01

    The study aims to establish a comprehensive view of “data” needed for supporting implementation of the Consortium of Advanced Simulation of LWRs (CASL). Insights from this review (and its continual refinement), together with other elements developed in CASL, should provide the foundation for developing the CASL Validation Data Plan (VDP). VDP is instrumental to the development and assessment of CASL simulation tools as predictive capability. Most importantly, to be useful for CASL, the VDP must be devised (and agreed upon by all participating stakeholders) with appropriate account for nature of nuclear engineering applications, the availability, types and quality of CASL-related data, and novelty of CASL goals and its approach to the selected challenge problems. The initial review (summarized on the January 2011 report version) discusses a broad range of methodological issues in data review and Validation Data Plan. Such a top-down emphasis in data review is both needed to see a big picture on CASL data and appropriate when the actual data are not available for detailed scrutiny. As the data become available later in 2011, a revision of data review (and regular update) should be performed. It is expected that the basic framework for review laid out in this report will help streamline the CASL data review in a way that most pertinent to CASL VDP.

  20. Safeguards First Principle Initiative (SFPI) Cost Model

    SciTech Connect (OSTI)

    Mary Alice Price

    2010-07-11

    The Nevada Test Site (NTS) began operating Material Control and Accountability (MC&A) under the Safeguards First Principle Initiative (SFPI), a risk-based and cost-effective program, in December 2006. The NTS SFPI Comprehensive Assessment of Safeguards Systems (COMPASS) Model is made up of specific elements (MC&A plan, graded safeguards, accounting systems, measurements, containment, surveillance, physical inventories, shipper/receiver differences, assessments/performance tests) and various sub-elements, which are each assigned effectiveness and contribution factors that when weighted and rated reflect the health of the MC&A program. The MC&A Cost Model, using an Excel workbook, calculates budget and/or actual costs using these same elements/sub-elements resulting in total costs and effectiveness costs per element/sub-element. These calculations allow management to identify how costs are distributed for each element/sub-element. The Cost Model, as part of the SFPI program review process, enables management to determine if spending is appropriate for each element/sub-element.

  1. Multiple shock initiation of LX-17

    SciTech Connect (OSTI)

    Tarver, C.M.; Cook, T.M.; Urtiew, P.A.; Tao, W.C.

    1993-07-01

    The response of the insensitive TATB-based high explosive LX-17 to multiple shock impacts is studied experimentally in a four inch gas gun using embedded manganin gauges and numerically using the ignition and growth reactive flow model of shock initiation and detonation. Pressure histories are reported for LX-17 cylinders which are subjected to sustained shock pulses followed by secondary compressions from shocks reflected from metal discs attached to the backs of the explosive targets. These measured and calculated pressure histories show that the threshold for hot spot growth in LX-17 is 7 GPa, that LX-17 can be dead pressed at slightly lower pressures, and that the reaction rates behind reflected shocks increase greatly as the impedance of the metal increases. A study of the response of LX-17 to the collision of two reacting, diverging shocks forming a Mach stem wave inside the LX-17 charge demonstrated that this interaction can result in a high pressure region of sufficient size and strength to cause detonation under certain conditions.

  2. SOLUBLE POLYMER-SUPPORTED CATALYSTS AND INITIATORS A Dissertation Presented

    E-Print Network [OSTI]

    Venkataraman, Dhandapani "DV"

    SOLUBLE POLYMER-SUPPORTED CATALYSTS AND INITIATORS A Dissertation Presented by UCHE K. ANYANWU. Anyanwu 2005 All Rights Reserved #12;SOLUBLE POLYMER-SUPPORTED CATALYSTS AND INITIATORS A Dissertation it without you guys. Yes Oooh! #12;vi ABSTRACT SOLUBLE POLYMER-SUPPORTED CATALYSTS AND INITIATORS MAY 2005

  3. Summer Curriculum Development Initiatives Summer Curriculum Development Initiatives provide support for faculty to engage in significant and extraordinary curriculum

    E-Print Network [OSTI]

    Olszewski Jr., Edward A.

    Summer Curriculum Development Initiatives A. Purpose Summer Curriculum Development Initiatives provide support for faculty to engage in significant and extraordinary curriculum development on behalf of June, are awarded annually to support concentrated curriculum development projects conducted during

  4. The cosmic production of Helium

    E-Print Network [OSTI]

    Raul Jimenez; Chris Flynn; James MacDonald; Brad K. Gibson

    2003-03-07

    We estimate the cosmic production rate of helium relative to metals ($\\Delta Y/\\Delta Z$) using K dwarf stars in the Hipparcos catalog with accurate spectroscopic metallicities. The best fitting value is $\\Delta Y/\\Delta Z=2.1 \\pm 0.4$ at the 68% confidence level. Our derived value agrees with determinations from HII regions and with theoretical predictions from stellar yields with standard assumptions for the initial mass function. The amount of helium in stars determines how long they live and therefore how fast they will enrich the insterstellar medium with fresh material.

  5. Language Production General Points about Speech Production

    E-Print Network [OSTI]

    Coulson, Seana

    Language Production #12;General Points about Speech Production 15 speech sounds per second => 2, shall I say `t' or `d'' (Levelt) Production side has gotten less attention in Psycholinguistics than the comprehension side. Evidence for speech production behaviour has until recently relied heavily on speech errors

  6. Constraint effects observed in crack initiation stretch

    SciTech Connect (OSTI)

    Lambert, D.M.; Ernst, H.A.

    1995-12-31

    The current paper characterizes constraint in fracture: J-modified resistance (Jr) curves were developed for two tough structural materials, 6061-T651 (aluminum) and IN718-STA1 (nickel-base superalloy). A wide variety of configurations was tested to consider load configurations from bending to tension including three specimen types (compact tension, center-crack tension, and single-edge notched tension), and a range of ligament lengths and thicknesses, as well as side-grooved and smooth-sided ligaments. The Jr curves exhibited an inflection point after some crack extension, and the data were excluded beyond the inflection. Qualified Jr curves for the two materials showed similar behavior, but R-curves were identical for equal ligament length-to-thickness ratio (RL), for the aluminum alloy, with increasing slope for increasing RL, while for the nickel, the resistance curves aligned for equal ligament thickness, B, and the slope increased for decreasing B. Displacements at the original crack tip (CToD) were recorded throughout the test for several specimens. CToD-versus-crack extension curves were developed, and data were excluded beyond the inflection point (as with the Jr curves). The data collapsed into two distinct curves, thought to represent the surface, plane stress effect and the central, plane strain effect. This was observed for both materials. A technique called profiling is presented for the aluminum alloy only, where the crack face displacements are recorded at the final point of the test as a function of the position throughout the crack cavity, along with an effort to extract the observations in a usable form. Displacements were consistent throughout the cross-section at and behind the original crack tip. In the region where the crack grew, this displacement was developed by a combination of stretch and crack growth. The stretch required to initiate crack extension was a function of the depth beneath the surface into the cross-section.

  7. Dynaically Responsive IP Window Coatings

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pacific Northwest National Laboratory Dynamically Responsive IR Window Coatings 2014 Building Technologies Office Peer Review 2 Project Summary Timeline: Start date:...

  8. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of a publication or guarantee its technical correctness. Title: Northern New Mexico Climate, Water Year 2012 at Los Alamos National Laboratory, Poster, Individual Permit for...

  9. IP Awareness Seminar Presented by

    E-Print Network [OSTI]

    Yang, Eui-Hyeok

    /Patent Process at Stevens Inventor Idea Issued Patent 2 ­ 4 Years US PTO Inventor Incentives Inventor OIE: Details, Details, 1. "First-Inventor-to-File" system ­ Effective Date: March 16, 2013. 3. Post requirement that an individual inventor be listed as the applicant. Effective Date: Applies to applications

  10. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch88 Sign In About | Careers |

  11. On the strict positivity of entropy production Vojkan Jaksic1

    E-Print Network [OSTI]

    is sometimes called non-equi- librium steady state (NESS) of the locally perturbed quantum dynamical system (O production observable V = (V ), is well defined for all V Aself. The entropy production of the NESS + V of its NESS is strictly positive. Suppose that the unperturbed system is initially in thermal equilibrium

  12. Modeling the Potential Effects of New Tobacco Products and Policies: A Dynamic Population Model for Multiple Product Use and Harm

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Vugrin, Eric D.; Rostron, Brian L.; Verzi, Stephen J.; Brodsky, Nancy S.; Brown, Theresa J.; Choiniere, Conrad J.; Coleman, Blair N.; Paredes, Antonio; Apelberg, Benjamin J.

    2015-03-27

    Background Recent declines in US cigarette smoking prevalence have coincided with increases in use of other tobacco products. Multiple product tobacco models can help assess the population health impacts associated with use of a wide range of tobacco products. Methods and Findings We present a multi-state, dynamical systems population structure model that can be used to assess the effects of tobacco product use behaviors on population health. The model incorporates transition behaviors, such as initiation, cessation, switching, and dual use, related to the use of multiple products. The model tracks product use prevalence and mortality attributable to tobacco use formore »the overall population and by sex and age group. The model can also be used to estimate differences in these outcomes between scenarios by varying input parameter values. We demonstrate model capabilities by projecting future cigarette smoking prevalence and smoking-attributable mortality and then simulating the effects of introduction of a hypothetical new lower-risk tobacco product under a variety of assumptions about product use. Sensitivity analyses were conducted to examine the range of population impacts that could occur due to differences in input values for product use and risk. We demonstrate that potential benefits from cigarette smokers switching to the lower-risk product can be offset over time through increased initiation of this product. Model results show that population health benefits are particularly sensitive to product risks and initiation, switching, and dual use behaviors. Conclusion Our model incorporates the variety of tobacco use behaviors and risks that occur with multiple products. As such, it can evaluate the population health impacts associated with the introduction of new tobacco products or policies that may result in product switching or dual use. Further model development will include refinement of data inputs for non-cigarette tobacco products and inclusion of health outcomes such as morbidity and disability.« less

  13. Energy Technologies Research and Education Initiative

    SciTech Connect (OSTI)

    Ghassemi, Abbas; Ranade, Satish

    2014-12-31

    For this project, the intended goal of the microgrid component was to investigate issues in policy and technology that would drive higher penetration of renewable energy, and to demonstrate implementation in a utility system. The work accomplished on modeling the dynamics of photovoltaic (PV) penetration can be expanded for practical application. Using such a tool those involved in public policy can examine what the effect of a particular policy initiative, e.g., renewable portfolio standards (RPS) requirements, might be in terms of the desired targets. The work in the area of microgrid design, protection, and operation is fundamental to the development of microgrids. In particular the “Energy Delivery” paradigm provides new opportunities and business models for utilities. Ultimately, Energy Delivery could accrue significant benefits in terms of costs and resiliency. The experimental microgrid will support continued research and allow the demonstration of technology for better integration of renewables. The algal biofuels component of the project was developed to enhance the test facility and to investigate the technical and economic feasibility of a commercial-scale geothermal algal biofuels operation for replication elsewhere in the arid Southwest. The project was housed at New Mexico State University’s (NMSU’s) Geothermal Aquaculture Facility (GAF) and a design for the inoculation train and algae grow-out process was developed. The facility was upgraded with modifications to existing electrical, plumbing and structural components on the GAF and surrounding grounds. The research work was conducted on biomass-processing, harvesting, dewatering, and extraction. Additionally, research was conducted to determine viability of using low-cost, wastewater from municipal treatment plants in the cultivation units as make-up water and as a source of nutrients, including nitrogen and soluble phosphorus. Data was collected on inputs and outputs, growth evaluation and chemical composition of algal biomass feedstock. Also, research was completed on evaluating inoculation train, algae grow-out units, indoor cultivation units and the algal biomass dewatering units to identify opportunities for recapturing waste energy, water and biomass in the individual units or any combination of these units. A preliminary economic analysis was conducted.

  14. ENERGY DEMAND AND CONSERVATION IN KENYA: INITIAL APPRAISAL

    E-Print Network [OSTI]

    Schipper, Lee

    2013-01-01

    and commercial uses" of oil products as given by the 1978as net i.mports of oil products. Electric power productionfrom Kenya is refined oil products, energy for which is

  15. Ohmic Flux Consumption During Initial Operation of the NSTX Spherical Torus

    E-Print Network [OSTI]

    been achieved on NSTX, while faster ramps generate significant MHD activity. Discharges with IP will rely on OH current drive to generate target plasmas suitable for strong auxiliary heating to test.5, vacuum toroidal field B T = 0.3 Tesla at R 0 , plasma current I P

  16. Rapidity Dependence of $J/?$ Production at RHIC and LHC

    E-Print Network [OSTI]

    Yunpeng Liu; Zhen Qu; Nu Xu; Pengfei Zhuang

    2009-07-16

    The motion of charmonium in heavy ion collisions is described by a three dimensional transport equation with initial production and continuous regeneration in hot medium. The observation of apparently stronger $J/\\psi$ suppression at forward rapidity compared to that at midrapidity, so called $J/\\psi$ puzzle at RHIC, can well be explained by the competition between the two production mechanisms. At LHC, however, the rapidity dependence of the $J/\\psi$ production is dominated by the regeneration process.

  17. State and Regional Hydrogen Initiatives Meeting, Challenges for State and Regional Hydrogen Initiatives

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy BillsNo.Hydrogen4EnergySolidof2StandardFOA2-002Chris Wagner,Initiatives

  18. GaN Initiative for Grid Applications (GIGA)

    SciTech Connect (OSTI)

    Turner, George

    2015-07-03

    For nearly 4 ˝ years, MIT Lincoln Laboratory (MIT/LL) led a very successful, DoE-funded team effort to develop GaN-on-Si materials and devices, targeting high-voltage (>1 kV), high-power, cost-effective electronics for grid applications. This effort, called the GaN Initiative for Grid Applications (GIGA) program, was initially made up of MIT/LL, the MIT campus group of Prof. Tomas Palacios (MIT), and the industrial partner M/A Com Technology Solutions (MTS). Later in the program a 4th team member was added (IQE MA) to provide commercial-scale GaN-on-Si epitaxial materials. A basic premise of the GIGA program was that power electronics, for ubiquitous utilization -even for grid applications - should be closer in cost structure to more conventional Si-based power electronics. For a number of reasons, more established GaN-on-SiC or even SiC-based power electronics are not likely to reach theses cost structures, even in higher manufacturing volumes. An additional premise of the GIGA program was that the technical focus would be on materials and devices suitable for operating at voltages > 1 kV, even though there is also significant commercial interest in developing lower voltage (< 1 kV), cost effective GaN-on-Si devices for higher volume applications, like consumer products. Remarkable technical progress was made during the course of this program. Advances in materials included the growth of high-quality, crack-free epitaxial GaN layers on large-diameter Si substrates with thicknesses up to ~5 ?m, overcoming significant challenges in lattice mismatch and thermal expansion differences between Si and GaN in the actual epitaxial growth process. Such thick epilayers are crucial for high voltage operation of lateral geometry devices such as Schottky barrier (SB) diodes and high electron mobility transistors (HEMTs). New “Normally-Off” device architectures were demonstrated – for safe operation of power electronics circuits. The trade-offs between lateral and vertical devices were explored, with the conclusion that lateral devices are superior for fundamental thermal reasons, as well as for the demonstration of future generations of monolithic power circuits. As part of the materials and device investigations breakdown mechanisms in GaN-on-Si structures were fully characterized and effective electric field engineering was recognized as critical for achieving even higher voltage operation. Improved device contact technology was demonstrated, including the first gold-free metallizations (to enable processing in CMOS foundries) while maintaining low specific contact resistance needed for high-power operation and 5-order-of magnitude improvement in device leakage currents (essential for high power operation). In addition, initial GaN-on-Si epitaxial growth was performed on 8”/200 mm Si starting substrates.

  19. Economical Production of Pu-238

    SciTech Connect (OSTI)

    Steven D. Howe; Douglas Crawford; Jorge Navarro; Terry Ring

    2013-02-01

    All space exploration missions traveling beyond Jupiter must use radioisotopic power sources for electrical power. The best isotope to power these sources is plutonium-238. The US supply of Pu-238 is almost exhausted and will be gone within the next decade. The Department of Energy has initiated a production program with a $10M allocation from NASA but the cost is estimated at over $100 M to get to production levels. The Center for Space Nuclear Research has conceived of a potentially better process to produce Pu-238 earlier and for significantly less cost. The new process will also produce dramatically less waste. Potentially, the front end costs could be provided by private industry such that the government only had to pay for the product produced. Under a NASA Phase I NIAC grant, the CSNR has evaluated the feasibility of using a low power, commercially available nuclear reactor to produce at least 1.5 kg of Pu-238 per year. The impact on the neutronics of the reactor have been assessed, the amount of Neptunium target material estimated, and the production rates calculated. In addition, the size of the post-irradiation processing facility has been established. In addition, a new method for fabricating the Pu-238 product into the form used for power sources has been identified to reduce the cost of the final product. In short, the concept appears to be viable, can produce the amount of Pu-238 needed to support the NASA missions, can be available within a few years, and will cost significantly less than the current DOE program.

  20. Annual Report: Carbon Capture Simulation Initiative (CCSI) (30 September 2012)

    SciTech Connect (OSTI)

    Miller, David C.; Syamlal, Madhava; Cottrell, Roger; Kress, Joel D.; Sun, Xin; Sundaresan, S.; Sahinidis, Nikolaos V.; Zitney, Stephen E.; Bhattacharyya, D.; Agarwal, Deb; Tong, Charles; Lin, Guang; Dale, Crystal; Engel, Dave; Calafiura, Paolo; Beattie, Keith; Shinn, John

    2012-09-30

    The Carbon Capture Simulation Initiative (CCSI) is a partnership among national laboratories, industry and academic institutions that is developing and deploying state-of-the-art computational modeling and simulation tools to accelerate the commercialization of carbon capture technologies from discovery to development, demonstration, and ultimately the widespread deployment to hundreds of power plants. The CCSI Toolset will provide end users in industry with a comprehensive, integrated suite of scientifically validated models, with uncertainty quantification (UQ), optimization, risk analysis and decision making capabilities. The CCSI Toolset incorporates commercial and open-source software currently in use by industry and is also developing new software tools as necessary to fill technology gaps identified during execution of the project. Ultimately, the CCSI Toolset will (1) enable promising concepts to be more quickly identified through rapid computational screening of devices and processes; (2) reduce the time to design and troubleshoot new devices and processes; (3) quantify the technical risk in taking technology from laboratory-scale to commercial-scale; and (4) stabilize deployment costs more quickly by replacing some of the physical operational tests with virtual power plant simulations. CCSI is organized into 8 technical elements that fall under two focus areas. The first focus area (Physicochemical Models and Data) addresses the steps necessary to model and simulate the various technologies and processes needed to bring a new Carbon Capture and Storage (CCS) technology into production. The second focus area (Analysis & Software) is developing the software infrastructure to integrate the various components and implement the tools that are needed to make quantifiable decisions regarding the viability of new CCS technologies. CCSI also has an Industry Advisory Board (IAB). By working closely with industry from the inception of the project to identify industrial challenge problems, CCSI ensures that the simulation tools are developed for the carbon capture technologies of most relevance to industry. CCSI is led by the National Energy Technology Laboratory (NETL) and leverages the Department of Energy (DOE) national laboratories' core strengths in modeling and simulation, bringing together the best capabilities at NETL, Los Alamos National Laboratory (LANL), Lawrence Berkeley National Laboratory (LBNL), Lawrence Livermore National Laboratory (LLNL), and Pacific Northwest National Laboratory (PNNL). The CCSI's industrial partners provide representation from the power generation industry, equipment manufacturers, technology providers and engineering and construction firms. The CCSI's academic participants (Carnegie Mellon University, Princeton University, West Virginia University, and Boston University) bring unparalleled expertise in multiphase flow reactors, combustion, process synthesis and optimization, planning and scheduling, and process control techniques for energy processes. During Fiscal Year (FY) 12, CCSI released its first set of computational tools and models. This pre-release, a year ahead of the originally planned first release, is the result of intense industry interest in getting early access to the tools and the phenomenal progress of the CCSI technical team. These initial components of the CCSI Toolset provide new models and computational capabilities that will accelerate the commercial development of carbon capture technologies as well as related technologies, such as those found in the power, refining, chemicals, and gas production industries. The release consists of new tools for process synthesis and optimization to help identify promising concepts more quickly, new physics-based models of potential capture equipment and processes that will reduce the time to design and troubleshoot new systems, a framework to quantify the uncertainty of model predictions, and various enabling tools that provide new capabilities such as creating reduced order models (ROMs) from reacting multiphase flow simul

  1. Objectives, Strategies, and Challenges for the Advanced Fuel Cycle Initiative

    SciTech Connect (OSTI)

    Steven Piet; Brent Dixon; David Shropshire; Robert Hill; Roald Wigeland; Erich Schneider; J. D. Smith

    2005-04-01

    This paper will summarize the objectives, strategies, and key chemical separation challenges for the Advanced Fuel Cycle Initiative (AFCI). The major objectives are as follows: Waste management - defer the need for a second geologic repository for a century or more, Proliferation resistance - be more resistant than the existing PUREX separation technology or uranium enrichment, Energy sustainability - turn waste management liabilities into energy source assets to ensure that uranium ore resources do not become a constraint on nuclear power, and Systematic, safe, and economic management of the entire fuel cycle. There are four major strategies for the disposal of civilian spent fuel: Once-through - direct disposal of all discharged nuclear fuel, Limited recycle - recycle transuranic elements once and then direct disposal, Continuous recycle - recycle transuranic elements repeatedly, and Sustained recycle - same as continuous except previously discarded depleted uranium is also recycled. The key chemical separation challenges stem from the fact that the components of spent nuclear fuel vary greatly in their influence on achieving program objectives. Most options separate uranium to reduce the weight and volume of waste and the number and cost of waste packages that require geologic disposal. Separated uranium can also be used as reactor fuel. Most options provide means to recycle transuranic (TRU) elements - plutonium (Pu), neptunium (Np), americium (Am), curium (Cm). Plutonium must be recycled to obtain repository, proliferation, and energy recovery benefits. U.S. non-proliferation policy forbids separation of plutonium by itself; therefore, one or more of the other transuranic elements must be kept with the plutonium; neptunium is considered the easiest option. Recycling neptunium also provides repository benefits. Americium recycling is also required to obtain repository benefits. At the present time, curium recycle provides relatively little benefit; indeed, recycling curium in thermal reactors would significantly increase the hazard (hence cost) of the resulting fuel. Most options separate short-lived fission products cesium and strontium to allow them to decay in separate storage facilities tailored to that need, rather than complicate long-term geologic disposal. This can also reduce the number and cost of waste packages requiring geologic disposal. These savings are balanced by costs for separation and recycle systems. Several long-lived fission products, such as technetium-99 and iodine-129 go to geologic disposal in improved waste forms, recognizing that transmutation of these isotopes would be a slow process; however, the program has not precluded their transmutation as a future alternative.

  2. Basin-Scale Opportunity Assessment Initiative Background Literature Review

    SciTech Connect (OSTI)

    Saulsbury, Bo; Geerlofs, Simon H.; Cada, Glenn F; Bevelhimer, Mark S

    2010-10-01

    As called for in the March 24, 2010, Memorandum of Understanding (MOU) for Hydropower, the U.S. Department of Energy (DOE), the U.S. Department of the Interior (DOI), the U.S. Army Corps of Engineers (USACE), environmental stakeholders, and the hydropower industry are collaborating to identify opportunities to simultaneously increase electricity generation and improve environmental services in river basins of the United States. New analytical tools provide an improved ability to understand, model, and visualize environmental and hydropower systems. Efficiencies and opportunities that might not be apparent in site-by-site analyses can be revealed through assessments at the river-basin scale. Information from basin-scale assessments could lead to better coordination of existing hydropower projects, or to inform siting decisions (e.g., balancing the removal of some dams with the construction of others), in order to meet renewable energy production and environmental goals. Basin-scale opportunity assessments would inform energy and environmental planning and address the cumulative effects of hydropower development and operations on river basin environmental quality in a way that quantifies energy-environment tradeoffs. Opportunity assessments would create information products, develop scenarios, and identify specific actions that agencies, developers, and stakeholders can take to locate new sustainable hydropower projects, increase the efficiency and environmental performance of existing projects, and restore and protect environmental quality in our nation's river basins. Government agencies and non-governmental organizations (NGO) have done significant work to understand and assess opportunities for both hydropower and environmental protection at the basin scale. Some initiatives have been successful, others less so, and there is a need to better understand the legacy of work on which this current project can build. This background literature review is intended to promote that understanding. The literature review begins with a discussion in Section 2.0 of the Federal regulatory processes and mission areas pertaining to hydropower siting and licensing at the basin scale. This discussion of regulatory processes and mission areas sets the context for the next topic in Section 3.0, past and ongoing basin-scale hydropower planning and assessment activities. The final sections of the literature review provide some conclusions about past and ongoing basin-scale activities and their relevance to the current basin-scale opportunity assessment (Section 4.0), and a bibliography of existing planning and assessment documents (Section 5.0).

  3. Mechanistic aspects of [Rh(nbd)CI][sub 2]initiated oligomerization of new acetylenic monomers

    SciTech Connect (OSTI)

    Densmore, C.G. (Crystal G); Rasmussen, P.G. (Paul G.)

    2004-01-01

    Although a number of papers report the use of rhodium-based initiators, very little has been said about the mechanism of acetylene polymerizations. Kishimoto and coworkers recently proposed an insertion mechanism for the rhodium-initiated polymerization of phenylacetylenes. The initiator consisted of the tetracoordinate rhodium complex, Rh(C{triple_bond}CC{sub 6}H{sub 5})(nbd)(PPh{sub 3}) with 4-(dimethylamino)-pyidine. The product was found to be stereoregular poly(phenylacety1ene) with a cis-transoidal backbone microstructure. Gorman and coworkers found palladium and nickel-based catalysts to be successful in the polymerization of cyanoacetylene. Zhan and Yang addressed the polymerization mechanism of acetylenes using palladium and nickel acetylide catalysts. They propose that the initial activation step, and also the rate-determining step, involve coordination of a nickel or palladium acetylide catalyst with an acetylene. Based on NMR and elemental analysis, we propose a more complete mechanistic picture of acetylene polymerizations, especially those with electron-withdrawing substituents.

  4. Biological production of products from waste gases

    DOE Patents [OSTI]

    Gaddy, James L. (Fayetteville, AR)

    2002-01-22

    A method and apparatus are designed for converting waste gases from industrial processes such as oil refining, and carbon black, coke, ammonia, and methanol production, into useful products. The method includes introducing the waste gases into a bioreactor where they are fermented to various products, such as organic acids, alcohols, hydrogen, single cell protein, and salts of organic acids by anaerobic bacteria within the bioreactor. These valuable end products are then recovered, separated and purified.

  5. First Responder Initial Response Procedure | Department of Energy

    Office of Environmental Management (EM)

    Procedure First Responder Initial Response Procedure The purpose of this response flow chart is to provide first responders with guidance for response to a transportation...

  6. Initial Results of IEC 62804 Draft Round Robin Testing (Presentation)

    SciTech Connect (OSTI)

    Hacke, P.; Terwilliger, K.; Koch, S.; Weber, T.; Berghold, J.; Hoffmann, S.; Ambrosi, H.; Koehl, M.; Dietrich, S.; Ebert, M.; Mathiak, G.

    2013-05-01

    This presentation discusses the Initial round robin results of the IEC 62804 system voltage durability qualification test for crystalline silicon modules.

  7. DOE Initiates Enforcement Actions Against 4 Showerhead Manufacturers...

    Energy Savers [EERE]

    Against 4 Showerhead Manufacturers (Notice of Proposed Civil Penalty and Requests for Test Data Issued) DOE Initiates Enforcement Actions Against 4 Showerhead Manufacturers...

  8. Hawaii Clean Energy Initiative Certificate of Public Convenience...

    Open Energy Info (EERE)

    Hawaii Clean Energy Initiative Certificate of Public Convenience and Necessity Permit Packet Jump to: navigation, search OpenEI Reference LibraryAdd to library Permitting...

  9. North American SynchroPhasor Initiative (NASPI) Technical Report...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Phasor Tools Visualization North American SynchroPhasor Initiative (NASPI) Technical Report - Phasor Tools Visualization This technical report was developed by the North American...

  10. optimal initial conditions for coupling ice sheet models to earth...

    Office of Scientific and Technical Information (OSTI)

    optimal initial conditions for coupling ice sheet models to earth system models Perego, Mauro Sandia National Laboratories Sandia National Laboratories; Price, Stephen F. Dr...

  11. Call for Proposals: NERSC Initiative for Scientific Exploration...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    2011 by Francesca Verdier (0 Comments) NERSC allocates 10% of the total MPP hours on our computational systems through the NERSC Initiative for Scientific Exploration (NISE)...

  12. Asset Revitalization Initiative Guide for Sustainable Asset Management...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    G 430.1-8, Asset Revitalization Initiative Guide for Sustainable Asset Management and Reuse by Website Administrator The Guide is intended to assist sites in sustainable planning,...

  13. The Greenhouse Gas Protocol Initiative: GHG Emissions from Refrigerati...

    Open Energy Info (EERE)

    The Greenhouse Gas Protocol Initiative: GHG Emissions from Refrigeration and Air Conditioning Jump to: navigation, search Tool Summary LAUNCH TOOL Name: The Greenhouse Gas Protocol...

  14. 2014 SunShot Initiative Concentrating Solar Power Subprogram...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Concentrating Solar Power Subprogram Overview 2014 SunShot Initiative Concentrating Solar Power Subprogram Overview These slides correspond to a presentation given by SunShot...

  15. 2014 SunShot Initiative Portfolio Book: Systems Integration ...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Book: Systems Integration The 2014 SunShot Initiative Portfolio Book outlines the progress towards the goals outlined in the SunShot Vision Study. Contents include...

  16. Department of Energy Launches Initiative with Industry to Better...

    Energy Savers [EERE]

    protect the electrical grid from cyber attacks. The "Electric Sector Cybersecurity Risk Management Maturity" project, a White House initiative led by the Department of...

  17. Department of Energy Launches Initiative with Industry to Better...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Administration's efforts to enhance the security and reliability of the nation's electrical grid, U.S. Energy Secretary Steven Chu today announced an initiative to further...

  18. Completion of NDCX-II Facility and Initial Tests

    E-Print Network [OSTI]

    Kwan, Joe

    2012-01-01

    HIFAN 1832 Completion of NDCX-II Facility and Initial TestsSorting Category: 2.1.1 (E) Completion of NDCX-II Facility

  19. NNSA's Global Threat Reduction Initiative Removes More Than One...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Global Threat Reduction Initiative Removes More Than One Ton of Food | National Nuclear Security Administration Facebook Twitter Youtube Flickr RSS People Mission Managing the...

  20. Join Us for the Clean Energy Manufacturing Initiative's Western...

    Office of Environmental Management (EM)

    Energy Manufacturing Initiative's Western Regional Summit March 25, 2014 - 1:45pm Addthis Additive manufacturing is just one of several technologies that are being advanced by the...

  1. Analysis of the Climate Change Technology Initiative: Fiscal Year 2001

    Reports and Publications (EIA)

    2000-01-01

    Analysis of the potential impacts of Climate Change Technology Initiative, relative to the baseline energy projections in the Annual Energy Outlook 2000 (AEO2000).

  2. State Energy Risk Assessment Initiative - State and Regional...

    Broader source: Energy.gov (indexed) [DOE]

    OE is leading a State Energy Risk Assessment Initiative to help States better understand risks to their energy infrastructure so they can be better prepared to make informed...

  3. Commonwealth of Northern Mariana Islands Initial Technical Assessment

    SciTech Connect (OSTI)

    Baring-Gould, I.; Hunsberger, R.; Visser, C.; Voss, P.

    2011-07-01

    This document is an initial energy assessment for the Commonwealth of the Northern Mariana Islands (CNMI), the first of many steps in developing a comprehensive energy strategy.

  4. Rural Development Multi-Family Housing Energy Efficiency Initiative...

    Broader source: Energy.gov (indexed) [DOE]

    rural America for the next century, the USDA Rural Development Multi-Family Housing Energy Efficiency Initiative enables applicants to several USDA housing programs to...

  5. Hanford tanks initiative (HTI) work breakdown structure (WBS)dictionary

    SciTech Connect (OSTI)

    Mckinney, K.E.

    1997-03-31

    This dictionary lists the scope, deliverables, and interfaces for the various work elements of the Hanford Tanks Initiative. Cost detail is included for information only.

  6. Innovative Corridors Initiative: Call for Submission Process and Evaluation

    E-Print Network [OSTI]

    Finson, Rachel S.; McCormick, Cynthia

    2007-01-01

    Corridors Initiative: Business Model Analysis. Californiarepresents an innovative business model for public agenciesand Successes, and Business Model Analysis. CFS Process and

  7. DOE Announces Webinars on Geothermal FORGE Initiative, National...

    Broader source: Energy.gov (indexed) [DOE]

    initial phases of a field laboratory dedicated to cutting-edge research on enhanced geothermal systems (EGS). As part of the webinar, the Energy Department will provide potential...

  8. PARTNERSHIPS INITIATIVES Partnerships Launches New Web Page with...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    INITIATIVES Partnerships Launches New Web Page with Innovative Technology Search Engine The ORNL Partnerships Directorate seeks to foster economic development and the growth of...

  9. Green Racing Initiative: Accelerating the Use of Advanced Technologies...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Renewable Fuels Green Racing Initiative: Accelerating the Use of Advanced Technologies & Renewable Fuels 2011 DOE Hydrogen and Fuel Cells Program, and Vehicle Technologies Program...

  10. Obama Administration Announces 14 Initial Partners in the Better...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Buildings Challenge Obama Administration Announces 14 Initial Partners in the Better Buildings Challenge June 30, 2011 - 12:00am Addthis WASHINGTON, D.C. - Secretary of Energy...

  11. Better Buildings Neighborhood Initiative Upgrades 100,000 Buildings...

    Broader source: Energy.gov (indexed) [DOE]

    Building on President Obama's Climate Action Plan and the Administration's Better Buildings Initiative, the Energy Department announced today that the Department's Better...

  12. President Obama Announces Major Initiative to Spur Biofuels Industry...

    Energy Savers [EERE]

    years in partnership with the private sector to produce advanced drop-in aviation and marine biofuels to power military and commercial transportation. The initiative responds to a...

  13. Covered Product Category: Cool Roof Products

    Broader source: Energy.gov [DOE]

    FEMP provides acquisition guidance across a variety of product categories, including cool roof products, which are an ENERGY STAR®-qualified product category. Federal laws and requirements mandate that agencies meet these efficiency requirements in all procurement and acquisition actions that are not specifically exempted by law.

  14. Azole energetic materials: Initial mechanisms for the energy release from electronical excited nitropyrazoles

    SciTech Connect (OSTI)

    Yuan, Bing; Yu, Zijun; Bernstein, Elliot R., E-mail: erb@lamar.Colostate.edu [Department of Chemistry, Colorado State University, Fort Collins, Colorado 80523-1872 (United States)

    2014-01-21

    Decomposition of energetic material 3,4-dinitropyrazole (DNP) and two model molecules 4-nitropyrazole and 1-nitropyrazole is investigated both theoretically and experimentally. The initial decomposition mechanisms for these three nitropyrazoles are explored with complete active space self-consistent field (CASSCF) level. The NO molecule is observed as an initial decomposition product from all three materials subsequent to UV excitation. Observed NO products are rotationally cold (<50 K) for all three systems. The vibrational temperature of the NO product from DNP is (3850 ± 50) K, 1350 K hotter than that of the two model species. Potential energy surface calculations at the CASSCF(12,8)/6-31+G(d) level illustrate that conical intersections plays an essential role in the decomposition mechanism. Electronically excited S{sub 2} nitropyraozles can nonradiatively relax to lower electronic states through (S{sub 2}/S{sub 1}){sub CI} and (S{sub 1}/S{sub 0}){sub CI} conical intersection and undergo a nitro-nitrite isomerization to generate NO product either in the S{sub 1} state or S{sub 0} state. In model systems, NO is generated in the S{sub 1} state, while in the energetic material DNP, NO is produced on the ground state surface, as the S{sub 1} decomposition pathway is energetically unavailable. The theoretically predicted mechanism is consistent with the experimental results, as DNP decomposes in a lower electronic state than do the model systems and thus the vibrational energy in the NO product from DNP should be hotter than from the model systems. The observed rotational energy distributions for NO are consistent with the final structures of the respective transition states for each molecule.

  15. INITIAL CHEMICAL AND RESERVOIR CONDITIONS AT LOS AZUFRES WELLHEAD POWER PLANT STARTUP

    SciTech Connect (OSTI)

    Kruger, P.; Semprini, L.; Verma, S.; Barragan, R.; Molinar, R.; Aragon, A.; Ortiz, J.; Miranda, C.

    1985-01-22

    One of the major concerns of electric utilities in installing geothermal power plants is not only the longevity of the steam supply, but also the potential for changes in thermodynamic properties of the resource that might reduce the conversion efficiency of the design plant equipment. Production was initiated at Los Azufres geothermal field with wellhead generators not only to obtain electric energy at a relatively early date, but also to acquire needed information about the resource so that plans for large central power plants could be finalized. Commercial electric energy production started at Los Azufres during the summer of 1982 with five 5-MWe wellhead turbine-generator units. The wells associated with these units had undergone extensive testing and have since been essentially in constant production. The Los Azufres geothermal reservoir is a complex structural and thermodynamic system, intersected by at least 4 major parallel faults and producing geothermal fluids from almost all water to all steam. The five wellhead generators are associated with wells of about 30%, 60%, and 100% steam fraction. A study to compile existing data on the chemical and reservoir conditions during the first two years of operation has been completed. Data have been compiled on mean values of wellhead and separator pressures, steam and liquid flowrates, steam fraction, enthalpy, and pertinent chemical components. The compilation serves both as a database of conditions during the start-up period and as an initial point to observe changes with continued and increased production. Current plans are to add additional wellhead generators in about two years followed by central power plants when the data have been sufficiently evaluated for optimum plant design. During the next two years, the data acquired at the five 5-MWe wellhead generator units can be compared to this database to observe any significant changes in reservoir behavior at constant production.

  16. Radioactive Materials Product Stewardship

    E-Print Network [OSTI]

    Radioactive Materials Product Stewardship ABackground Report for the National Dialogue...................................................................................................26 Low Level Waste (LLW) Disposal Regulations on Radioactive Materials Product Stewardship Prepared by the: Product Stewardship Institute University

  17. Marine microbial intact polar diacylglycerolipids and their application in the study of nutrient stress and bacterial production

    E-Print Network [OSTI]

    Popendorf, Kimberly J. (Kimberly Julia)

    2013-01-01

    Intact polar diacylglycerolipids (IP-DAGs) were used to study microbial dynamics in the surface ocean. IP-DAGs from surface ocean seawater were quantified using high performance liquid chromatography-mass spectrometry ...

  18. Initial sequencing and comparative analysis of the mouse genome

    E-Print Network [OSTI]

    Eddy, Sean

    Initial sequencing and comparative analysis of the mouse genome Mouse Genome Sequencing Consortium ........................................................................................................................................................................................................................... The sequence of the mouse genome is a key informational tool for understanding the contents of the human genome collaboration to produce a high-quality draft sequence of the mouse genome. We also present an initial

  19. Deep Vadose Zone Applied Field Research Initiative (DVZ AFRI) - Overview

    SciTech Connect (OSTI)

    2011-02-01

    The Deep Vadoze Zone Applied Field Research Initiative (DVZ AFRI) was established to protect water resources and to address the challenge of preventing contamination in the deep vadose zone from reaching groundwater. This factsheet provides an overview of the initiative and the approach to integrate basic science and needs-driven applied research activities with cleanup operations.

  20. The PICO-NARE Station Project Description and Initial Observations

    E-Print Network [OSTI]

    Honrath, Richard E.

    that air qual- ity measurements at Pico are needed, and Section 3 de- scribes the station itself. Initial.S. National Oceanic and Atmospheric Administration Portugal Foundation for Science and Technology U.S. Air was developed to study the impacts that air pollutant emissions from the surrounding continents have