Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Venti | Open Energy Information  

Open Energy Info (EERE)

Venti Jump to: navigation, search Name Venti Place Brazil Sector Hydro, Wind energy Product Brazilian company which will act as a holding company for Impsa- an Argentine-based wind...

2

Venti Energy | Open Energy Information  

Open Energy Info (EERE)

Venti Energy Venti Energy Jump to: navigation, search Logo: Venti Energy Name Venti Energy Address 300 Beardsley Lane Place Austin, Texas Zip 78746 Sector Wind energy Product Renewable energy development focusing on community and utlity-scale wind and solar Website http://www.ventienergy.com/ Coordinates 30.313101°, -97.854118° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.313101,"lon":-97.854118,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

3

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

4

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

5

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

6

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Intensity (thousand Btusquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

7

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

8

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

9

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

10

Venti: a new approach to archival storage  

Science Conference Proceedings (OSTI)

This paper describes a network storage system, called Venti, intended for archival data. In this system, a unique hash of a block's contents acts as the block identifier for read and write operations. This approach enforces a write-once policy, preventing ...

Sean Quinlan; Sean Dorward

2002-01-01T23:59:59.000Z

11

Table E1. Major Fuel Consumption (Btu) by End Use for Non-Mall ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

12

Table E6. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

13

Table E4. Electricity Consumption (Btu) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

14

Table E3A. Electricity Consumption (Btu) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

15

Table E4A. Electricity Consumption (Btu) Intensities by End ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

16

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

17

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Energy Intensity (kWhsquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

18

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Survey: Energy End-Use Consumption Tables Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

19

Table E5A. Electricity Consumption (kWh) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

20

Table E6A. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Heat transfer pathways in underfloor air distribution (UFAD) systems  

E-Print Network (OSTI)

displacement venti- lation. ASHRAE Transactions 105(1):298309. ASHRAE Transactionsunderfloor air supply plenums. ASHRAE Trans- actions 112(2).

Bauman, F.; Jin, H.; Webster, T.

2006-01-01T23:59:59.000Z

22

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 ....................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ..................... 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ..................... 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ................... 405 16 57 65 7 158 2 29 6 18 45

23

STEM-ing the Tide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STEM-ing the Tide STEM-ing the Tide STEM-ing the Tide September 29, 2010 - 4:29pm Addthis Ali Zaidi Special Assistant to the Secretary of Energy Yesterday, the MacArthur Foundation rolled out its latest class of "geniuses" - 23 Americans who stand out because of their creativity and enterprise. Each recipient of the honor (and the $500,000 prize) has made an extraordinary contribution. One of those recipients is Amir Abo-Shaeer, an engineer in the aerospace and telecommunications industries who decided 10 years ago to go back to high school - this time as a teacher. At his alma mater, Dos Pueblos High School (in Santa Barbara, California), Amir created "a school within a school" built around a hands-on curriculum that helps students learn by connecting the ideas of physics, engineering and mathematics through

24

Personnel Change Notification ImagIng: GRSF/T  

E-Print Network (OSTI)

Personnel Change Notification OGS Form 3 ImagIng: GRSF/T Admit Year/Term: GS Web Front Desk: Office., reviewers, coordinators and chairs) Update: View all AIM Graduate Studies pages and enter decisions on GS02: Search for and view applicants; edit emails Connect: Add, search for and communicate with prospects

Hart, Gus

25

"Dark Web: Exploring and Min-ing the Dark Side of the Web"  

E-Print Network (OSTI)

Title: "Dark Web: Exploring and Min- ing the Dark Side of the Web" Speaker: Director, Prof will review the emerging research in Terrorism Informatics based on a web mining perspective. Recent progress in the internationally re- nowned Dark Web project will be reviewed, including: deep/dark web spider- ing (web sites

Michelsen, Claus

26

13:00 Begrung und Symposiumserffnung Prof. Dr.-Ing. Gerd Holbach  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Berlin,Technische Universität

27

"Cook"ing at Y-12 for 70 years | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

"Cook"ing at Y-12 ... "Cook"ing at Y-12 ... "Cook"ing at Y-12 for 70 years Posted: December 5, 2013 - 4:48pm At a Nov. 14 visit to Y-12, National Nuclear Security Administration's Deputy Administrator for Defense Don Cook shared his outlook on the future and his thanks to employees for continuing their 70-year tradition of making America safer. "There are three things to remember," Cook told a meeting of NNSA Production Office and Y-12 employees. "We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America." Cook also shared his thanks for preparing for the potential furlough in October because of the government shutdown and lack of appropriations. During what was the longest government shutdown to date, Cook said Y-12

28

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 1,043 49 141 128 26 393 7 112 20 46 122 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 115 6 13 5 3 28 2 40 2 3 11 5,001 to 10,000 ....................... 86 5 11 5 2 28 1 17 2 3 11 10,001 to 25,000 ..................... 142 8 16 15 4 54 1 17 3 6 19 25,001 to 50,000 ..................... 116 5 18 16 3 41 (*) 11 2 5 14 50,001 to 100,000 ................... 153 8 22 23 4 59 1 10 2 6 17

29

 

Gasoline and Diesel Fuel Update (EIA)

E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 3,559 167 481 436 88 1,340 24 381 69 156 418 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 392 19 44 18 11 96 7 138 8 12 39 5,001 to 10,000 ....................... 293 18 38 18 8 95 4 57 6 10 39 10,001 to 25,000 ..................... 485 26 55 52 14 184 3 57 10 20 63 25,001 to 50,000 ..................... 397 18 62 55 12 140 2 37 7 17 48 50,001 to 100,000 ................... 523 28 77 78 15 202 3 35 7 20 59

30

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 890 34 116 113 15 335 6 104 19 43 105 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 113 5 13 5 3 27 2 40 2 3 11 5,001 to 10,000 ....................... 77 4 10 5 2 24 1 16 2 3 10 10,001 to 25,000 ..................... 119 6 14 13 2 44 1 15 3 6 16 25,001 to 50,000 ..................... 103 4 16 15 3 35 (*) 10 2 5 12 50,001 to 100,000 ................... 119 5 17 19 2 46 1 9 2 5 13

31

 

Gasoline and Diesel Fuel Update (EIA)

. Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 5,820 2,203 431 384 448 1,143 167 354 64 148 478 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 672 207 45 18 48 93 48 137 8 12 55 5,001 to 10,000 ....................... 516 198 36 17 40 83 35 56 6 9 39 10,001 to 25,000 ..................... 776 324 47 44 43 151 25 53 9 19 62 25,001 to 50,000 ..................... 673 262 57 50 55 121 13 34 7 16 58 50,001 to 100,000 ................... 759 293 59 65 55 158 11 29 6 18 64

32

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................... 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 .......................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ........................ 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ........................ 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ...................... 405 16 57 65 7 158 2 29 6 18 45 100,001 to 200,000 .................... 483 16 62 80 5 195 1 24 Q 31 56 200,001 to 500,000 .................... 361 8 51 54 5 162 1 9 8 19 43 Over 500,000 ............................. 383 8 47 56 3 181 2 12 8 23 43 Principal Building Activity

33

 

Gasoline and Diesel Fuel Update (EIA)

A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 6,523 2,365 516 436 501 1,340 190 381 69 156 569 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 685 213 46 18 49 96 49 138 8 12 56 5,001 to 10,000 ....................... 563 212 39 18 43 95 37 57 6 10 46 10,001 to 25,000 ..................... 899 357 57 52 51 184 29 57 10 20 83 25,001 to 50,000 ..................... 742 281 63 55 60 140 16 37 7 17 66 50,001 to 100,000 ................... 913 325 79 78 67 202 17 35 7 20 83

34

TRANSPORTATION SYSTEMS are the build-ing blocks of modern society. Efficient and  

E-Print Network (OSTI)

TRANSPORTATION SYSTEMS are the build- ing blocks of modern society. Efficient and safe movement. How- ever, transportation systems by their very nature also affect the environment through operations, construction, and maintenance of transportation facilities, and through the travel behaviors they encourage

Wang, Yuhang

35

Water is used for many purposes, includ-ing growing crops, producing copper,  

E-Print Network (OSTI)

WATER USES Water is used for many purposes, includ- ing growing crops, producing copper, generating electricity, watering lawns, keeping clean, drinking and recreation. Bal- ancing the water budget comes down of the water budget. Reducing demand involves re- ducing how much water each person uses, lim- iting the number

36

ing system  

E-Print Network (OSTI)

Oct 29, 2002 ... GAs are search algorithms based on the mechanics of natural selection and natural genetics. They combine the concept of survival of the.

37

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

38

 

Gasoline and Diesel Fuel Update (EIA)

E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 48.0 1.8 6.3 6.1 0.8 18.1 0.3 5.6 1.0 2.3 5.6 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.8 2.9 6.8 2.9 1.7 14.6 1.1 21.6 1.2 1.9 6.0 5,001 to 10,000 ....................... 42.2 2.0 5.6 2.8 0.9 13.3 0.7 9.0 0.9 1.5 5.7 10,001 to 25,000 ..................... 35.8 1.7 4.1 3.9 0.7 13.3 0.3 4.6 0.8 1.7 4.7 25,001 to 50,000 ..................... 41.8 1.8 6.6 6.0 1.0 14.4 0.2 4.1 0.8 1.9 5.0

39

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

40

 

Gasoline and Diesel Fuel Update (EIA)

E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 50.7 2.4 6.9 6.2 1.3 19.1 0.3 5.4 1.0 2.2 6.0 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.6 2.9 6.8 2.8 1.7 14.8 1.1 21.2 1.2 1.8 6.0 5,001 to 10,000 ....................... 44.0 2.6 5.7 2.8 1.1 14.3 0.7 8.6 0.9 1.4 5.8 10,001 to 25,000 ..................... 38.8 2.1 4.4 4.1 1.1 14.7 0.2 4.5 0.8 1.6 5.1 25,001 to 50,000 ..................... 43.7 2.0 6.8 6.1 1.3 15.4 0.2 4.0 0.8 1.9 5.3

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (kWh/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 14.9 0.7 2.0 1.8 0.4 5.6 0.1 1.6 0.3 0.7 1.7 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 17.8 0.9 2.0 0.8 0.5 4.4 0.3 6.2 0.4 0.5 1.8 5,001 to 10,000 ....................... 12.9 0.8 1.7 0.8 0.3 4.2 0.2 2.5 0.3 0.4 1.7 10,001 to 25,000 ..................... 11.4 0.6 1.3 1.2 0.3 4.3 0.1 1.3 0.2 0.5 1.5 25,001 to 50,000 ..................... 12.8 0.6 2.0 1.8 0.4 4.5 0.1 1.2 0.2 0.6 1.5

42

Material development in the SI sub 3 N sub 4 system using glass encapsulated Hip'ing  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP'ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

43

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

44

Material development in the SI{sub 3}N{sub 4} system using glass encapsulated Hip`ing. Final report, Phase 2: DOE/ORNL Ceramic Technology Project  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP`ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

45

Hydraulic fractur ing--also called hy  

E-Print Network (OSTI)

reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

Goodman, Robert M.

46

E(Race)ing gender: Stratified identities  

E-Print Network (OSTI)

In the discussion that follows, I will examine, on the broadest level, Hurston's complex negotiation of identity, as manifested in Their Eyes Were Watching God. Central to this investigation is an understanding of the strategies that women, specifically African American women, have adopted, under the auspices of marriage and the patronage system, to seek an equal place within a hegemonic culture. Most importantly, I want to address the cultural and social price exacted for accepting (as seen in the appropriation of white standards, and rejecting (as seen in Janie's trial for her husband's death) those institutions as the basis of one's identity. The cultural and social price that Janie pays, furthermore, challenges her adaptive capacity to stratify her racial and gender identity. Finally, it exacts a toll on the community as a whole, a fact Hurston repeatedly suggests by illustrating the extent to which the community has absorbed hegemonic standards of value and beauty with little or no inspection of or reflection on the effects to itself or to its individual members.

Nguyen, Le Thuy Thi

2000-01-01T23:59:59.000Z

47

IMPROVED GROOVING TOOL FOR TU ING  

te hnology readiness level: 6 a market deliverable has been demonstrated in relevant environments and is in final development . author: alexandra ...

48

Go-ing for the prediction of protein folding mechanisms  

E-Print Network (OSTI)

of Chemistry, Faculty of Science, Kobe University, Kobe, 657-8501, Japan Protein folding has been a long-lived could be relatively simple. These three ingredients are linked together with an almost one-line free work (8, 9). The surprise of the three papers is that apparently one can have both simplicity and fair

Takada, Shoji

49

The physical function-ing of a city sometimes  

E-Print Network (OSTI)

insurance. It is recommended that parents carefully review their homeowners, auto and health insurance. Parents should check their homeowners policy to see whether it will cover a student's possessions while

50

ing the distribution of those galaxies, the way they clump and spread out, scientists  

E-Print Network (OSTI)

illuminated realms as small as a single molecule and as large as a gamma ray burst. of the Year Agony ex- plosions in the universe: titanic blasts of en- ergy called gamma ray bursts (GRBs). Most notably of black holes and other phenomena in the gamma ray region of the spectrum. And the Wilkinson Microwave

Yildiz, Ahmet

51

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg130  

E-Print Network (OSTI)

. Journal of "Solar Energy Materials and Solar Cells". Proceedings of IEEE Photovoltaic Specialist Conferences. Proceedings of European Photovoltaic Solar Energy Conferences. #12;Module 2/Photovoltaics, Wiley, 1995. R.H.Bube, Photovoltaic Materials, Imperial College Press, 1998. Journal of "Solar Energy

52

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

U.S. Energy Information Administration (EIA) Indexed Site

MCKEESPORT MCKEESPORT COR AOPOLIS-MOON REDHAW ST. CLAIR SC ROGGSFIELD FRANKLIN -OAK FOREST RIMERSBURG RENNERD AL E GREENVILL E PAT MOS CRABTR EE BLAC K ASH ROYALT ON N BAKERSTOWN QUEEN ROU GH RUN LUCAS BLAC K H ILL CRESTON WAT TSVILLE WADSWORTH -NORT H OAKLAN D HOM EWORT H UNIT Y ESSELBRUN ALAMED A PAR K-CROOKED RU CHERRY GROVE FRENC HTOWN ST EWART RUN MILL C REEK GLENF IELD-MOU NT NEBO HICKORY E HARRISVILLE E LEST ER GRIGGS CORNERS EN GLAN D WEST VIL LE LAKE BAILEY LAKE OAKFORD BR UNSWICK N HOR ACE WALBORN RESERVOIR YOUN GSVILLE RPD-LORAIN -1 INGOMAR-GRUBBS BIG MEADOWS GARD EN ISLE TURT LE CREEK LEWIST ON E BR USH CR EEK FOOT VILLE BU LL CREEK BESSEMER EAGLEVILLE LIVER POOL E RIDGEVILLE E EVANS CIT Y GUIT ONVILLE WOLF S COR NERS WIN DFALL ABBEYVILLE ROC K CAMP LEATH ER WOOD AR COLA CR EEK MEC HANICST OWN NINE MILE RU N WALKCHALK RENFR EW-MCCALMONT BU FFALO N VALENCIA WELLIN GT ON

53

Spring'ing' Forward Into the Finals . . . Of A Competition Like...  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.11.13...

54

'March'ing Into The Finals . . . Of A Competition Like No Other  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.04.13...

55

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg102  

E-Print Network (OSTI)

when carbon dioxide is introduced into thermal conversion processes such as the gasification of coal to syngas, leaving behind only a carbonless char. Castaldi estimates that if the biomass were used

56

Kurzlebenslauf (CV) Stand September 2011 Dr.-Ing. Diplom-Physiker  

E-Print Network (OSTI)

:30 Panel: Erneuerbare Energien: Rentable Investitionen oder teure Experimente? Christof Stein (KfW Bank) Dr für Klima, Umwelt und Energie) Matthias Willenbacher (JuWi Holding) Moderation: Monika Seynsche

57

Power Electronics and Electrical Drives Prof. Dr.-Ing. Joachim Bcker  

E-Print Network (OSTI)

, e.g. Interior permanent magnet synchronous motors (IPMSM)Interior permanent magnet synchronous rings Permanent Magnet Synchronous Motor integrated into the rotor outlines Active magnetic bearing motors (IPMSM) Switched reluctance drives FPGA based control Self optimizing systems (Collaborative

Noé, Reinhold

58

Programme Coordination Professor Dr.-Ing. habil. Dr. h. c. Karl J. Thom-Kozmiensky  

E-Print Network (OSTI)

Waste Management · Recycling · Waste-to-Energy Recovery of Biowastes · Mechanical-Biological Treatment of the European Suppliers of Waste to Energy Technology (ESWET), Brussels, Belgium 10.30 Hrs. Waste Framework.V., Gent, Belgium 12.30 Hrs. Waste incineration in the 21st century ­ Energy-efficient and climate

Hone, James

59

Wolfram Hoefer, Dr.-Ing. Assistant Professor Department of Landscape Architecture  

E-Print Network (OSTI)

Landentwicklung. Gärtner im Garten- und Landschaftsbau. (State exam for professional degree as gardener, landscape Ltd. London 1984-86 Apprenticeship as landscape gardener with Hermann Kretz, Garten und Landschaftsbau

Goodman, Robert M.

60

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg 141  

E-Print Network (OSTI)

- onry is also crucial to their safe storage. Plutonium, an active ingredient in nuclear weap- ons, has to determine how the electrons within these materials will behave. "The plutonium in the weapons ages, and we have to be able to predict the proper- ties of plutonium under a variety of conditions," Chris

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Protective interior wall and attach8ing means for a fusion reactor vacuum vessel  

DOE Patents (OSTI)

An array of connected plates mounted on the inside wall of the vacuum vessel of a magnetic confinement reactor in order to provide a protective surface for energy deposition inside the vessel. All fasteners are concealed and protected beneath the plates, while the plates themselves share common mounting points. The entire array is installed with torqued nuts on threaded studs; provision also exists for thermal expansion by mounting each plate with two of its four mounts captured in an oversize grooved spool. A spool-washer mounting hardware allows one edge of a protective plate to be torqued while the other side remains loose, by simply inverting the spool-washer hardware.

Phelps, Richard D. (Greeley, CO); Upham, Gerald A. (Valley Center, CA); Anderson, Paul M. (San Diego, CA)

1988-01-01T23:59:59.000Z

62

Pico-ing into the future of mobile projection and contexts  

Science Conference Proceedings (OSTI)

Ten years ago, we were on the verge of having cameras built into our mobile phones, but knew very little about what to expect or how they would be used. Now we are faced with the same unknowns with mobile projector phones. This research seeks to explore ... Keywords: Diary study, Experience sampling, Mobile, Pico-projectors

Max L. Wilson; Dan Craggs; Simon Robinson; Matt Jones; Kristian Brimble

2012-01-01T23:59:59.000Z

63

Koordination: Prof. Dr.-Ing. J. Seume Institut fr Turbomaschinen und Fluid-Dynamik  

E-Print Network (OSTI)

of installation of offshore wind farms (from Wiese 2008: Auswirkungen der Offshore-Windenergie auf den Betrieb von and offshore applications require appropriate planning and design. For most of them, statistics of extreme wind coastDat have been used in a large variety of coastal, offshore and terrestrial applications

64

Sandra Koch Dipl.-Ing. (FH) Telefon: 04921-807-1489  

E-Print Network (OSTI)

die Voraussetzung geschaffen, um die Stromerzeugung aus Windenergie Offshore langfristig erfolgreich geschaffen, um die Stromerzeugung aus Offshore Windenergie langfristig erfolgreich und effizient entwickeln-02 Bestimmung von Wärme- und Impulsfluss in der marinen atmosphärischen Grenzschicht für die Offshore

Damm, Werner

65

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

Annual Energy Outlook 2012 (EIA)

RURAL RID GE ROWSBUR G SH ERRETT MON AC A QUEEN JUN CTION YELLOW CR EEK SMELTZ ER CAT FISH R UN POLK E JEROMESVILLE N FLORENCE-FIVE POINTS ATEN CLARINGTON MILLERSBURG...

66

Following weeks of purging and organiz-ing, phase one of the School's reloca-  

E-Print Network (OSTI)

in August. The depart- ments of Consumer Science and Human Development and Family Studies, as well as UW from top: Gloria McCord, Human Ecology financial specialist, casts a spell at the punch-bowl cauldron

Sheridan, Jennifer

67

INFORMATION EXCELLENTIA CoLumbIA ENgINEErINg238  

E-Print Network (OSTI)

that bends and twists. "Computers, geometry, and physics are my ingredients. I mix them up in a bowl and what science as well. B.A.Sc., University of Toronto (Canada), 1997; M.S., California Institute of TechnologySPUn Associate Professor of Computer Science #12;

Hone, James

68

METHOD FOR REDU ING A KGROUND LUTTER IN A AMERA IMAGE  

... bulky and heavy, expensive, fragile, short-range, sensitive to vibration, and unreliable for outdoor use in bright sunlight conditions. The ...

69

SOLAR TRA ING SENSORS FOR MAXIMUM SOLAR ON ENTRATOR EFFI IEN Y  

POTENTIAL APPLI ATIONS Parabolic dish & trough solar concentrating collectors Solar energy and renewable energy Electric utility

70

whITe PaPer The ChaNgINg DYNaMICS OF  

E-Print Network (OSTI)

of the smart grid, which integrates AMI with distribution automation and other tech- nologies to connect consumers Network Automation And Analytics Smart Meters Distributed Generation Today: Centralized and One smart grid and advanced metering deployments. Bob Brnilovich, IBM www.UtilitiesProject.com/10803

71

Operable windows, personal control and occupant comfort.  

E-Print Network (OSTI)

ASHRAEs permission. Operable Windows, Personal Control, andcontrol of operable windows in naturally-ventilated officeences on the operation of windows in a naturally venti-

Brager, Gail; Paliaga, Gwelen; de Dear, Richard

2004-01-01T23:59:59.000Z

72

Technical Report Documentation Page 1. Report No.  

E-Print Network (OSTI)

.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr

73

Institutsleitung: Univ.-Prof. Dr.-Ing. Prof. E.h. Dr.-Ing. E.h. Dr. h.c. mult. Engelbert Westkmper Kontakt: Birgit Spaeth Presse-und ffentlichkeitsarbeit  

E-Print Network (OSTI)

Universitätsprofessor ernannt wird. Thomas Bauernhansl, 1969 im fränkischen Miltenberg geboren, hat Maschinenbau an der

Möbius, Bernd

74

Tactical urbanism, public policy reform, and 'innovation spotting' by government : from Park(ing) Day to San Francisco's parklet program  

E-Print Network (OSTI)

This thesis examines the prospects and impacts of tactical urbanism (TU). While tactical urbanism remains primarily a subcultural movement, it is beginning to gain traction in popular culture in traditionally politically ...

Davidson, Mariko Mura

2013-01-01T23:59:59.000Z

75

The Burning Man festival is a unique happen-ing. For one week in September every year,  

E-Print Network (OSTI)

spaces, the city as it alters over the seven days and from year to year, exhibiting emergent properties- ance of oversized gas-guzzling camper vans, fossil-fuel-powered generators and gratuitous combustion, it is no Utopia. But the City's Alternative Energy Zone, with its huge bank of solar panels, multiple experiments

Bourne, Philip E.

76

Cultivat(ing) modernities : the Society for National Heritage, political propaganda and public architecture in twentieth-century Iran  

E-Print Network (OSTI)

Beginning in 1922, under the auspices of the Pahlavi dynasty of Iran, the tombs of selected historical figures were systematically destroyed to make way for modern mausoleums erected as metaphors for an "Aryan" nation in ...

Grigor, Talinn, 1972-

2005-01-01T23:59:59.000Z

77

58 UTS ANNUAL REPORT 2008 sUppoRtING oUR objEctIvEs  

E-Print Network (OSTI)

improvingenvironmentalsustainabilityin ourcampusoperations.Itisoverseenby asteeringcommitteeandsevenworking groups:waste,transport,energy into the atmosphere. The proposal from students Antony Henry and Kavit Pandya was to put this wasted energy through Energy-efficientlightinginmorethan> 60percentoftheUniversity Savingtheequivalentof45Olympic

University of Technology, Sydney

78

HOW ENVIRONMENTAL RISK FROM LEACH ING OF HEAVY METALS IN ASH RESIDUES FROM COMBUSTION OF MUNIC IPAL SOLID WASTE  

E-Print Network (OSTI)

Laboratories which led to the use of acid tests such as the EP and TCLP tests. [25] 13 #12;CONCLUSIONS and soluble metals in the ash from Waste-to Energy (WTE) facilities has led to a public concern about why has led to the requirement for continuous monitoring of oxygen , carbon monoxide (CO) , and acid gases

Columbia University

79

Clemson University Preservation master Plan Part III: ExIstIng CondItIons ChaPtEr Four FEbruary 2009 JMa, InC. 70  

E-Print Network (OSTI)

,337 CFDA # 15.922 - Native American Graves Protection and Repatriation Act Direct Federal Awards 16,227 525,830 - 4,830 Lawrence Berkeley Natl Lab RF HANFORD SEDM THOMP-6875736 48,614 2,965 45,649 Savannah River Nuclear Solutns RF RIVERBASIN GRUND-AC716760 132,105 9,248 122,857 Savannah River Nuclear Solutns RF SUP

Stuart, Steven J.

80

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

from Smoldering Biomass Combustion. Atmos. Chem. Phys. , 10,aerosols emitted during biomass combustion [Robinson et al.burning samples. Combustion of biomass produces EC a and

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Tar Balls from Smoldering Biomass Combustion. Atmos. Chem.gases and particles from biomass burning in Brazil, J. Ge-for smoke from African biomass burning, J. Geophys. Res. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

82

Early and sustained interventions which strongly feature mentoring are essential in help-ing Native American and Latino students navigate an unfamiliar academic system that is  

E-Print Network (OSTI)

(Navajo) is the largest, with 170,000 members. Others include the Oglala Sioux, Cherokee Nation, Blackfeet

Benitez-Nelson, Claudia

83
84

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

DOE Green Energy (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} < 2.5 {mu}m: average 59.8 {mu}g m{sup -3}) were higher than coarse aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

85

MICRO-MACHINED THIN FILM HYDROGEN GAS SENSORS Frank DiMeo, Jr., Ing-Shin Chen, Philip Chen, Jeffrey Neuner  

E-Print Network (OSTI)

;Introduction The reputation of hydrogen as the next generation energy delivery agent, supplementing electricity of Electric Power Research Institute, in a recent The Industrial Physicist column, observed the multifaceted as a national security priority. While fuel cell cars often feature prominently in news media and are touted

86

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

2001. Kerminen, V. -M. , Makela, T. E. , Ojanen, C. H. ,Saarikoski, S. , Frey, A. , Mkel, T. , and Hillamo, R. :Acker, K. , Hillamo, R. , Mkel, T. : Intercomparison of

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

87

CS-03-02 A PIvotIng PRocEDuRE FoR A ClAss oF SEconD-oRDER ...  

E-Print Network (OSTI)

linear function over an intersection of an affine set and second-order cones. SOCP is a .... Note that the e q uality constraints of does not contain!7# .

88

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Crutzen, P. : Atmospheric Aerosols: Biogeochemical sourcesof optically active aerosol particles over the Amazonproperties of Amazonian aerosol particles: Rev. Geophys. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

89

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

Science Conference Proceedings (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

90

Understanding the Effect of Baseline Modeling Implementation Choices on Analysis of Demand Response Performance  

E-Print Network (OSTI)

IEEE Transactions on Smart Grid, ings. Journal of Solaroperations. With continu- ing Smart Grid development, there

Addy, Nathan

2013-01-01T23:59:59.000Z

91

Statistical Alignment Models for . . .  

E-Print Network (OSTI)

The ever-increasing amount of parallel data opens a rich resource to multilingual natural language processing, enabling models to work on various translational aspects like detailed human annotations, syntax and semantics. With efficient statistical models, many cross-language applications have seen significant progresses in recent years, such as statistical machine trans-lation, speech-to-speech translation, cross-lingual information retrieval and bilingual lexicog-raphy. However, the current state-of-the-art statistical translation models rely heavily on the word-level mixture models a bottleneck, which fails to represent the rich varieties and depen-dencies in translations. In contrast to word-based translations, phrase-based models are more robust in capturing various translation phenomena than the word-level (e.g., local word reordering), and less susceptive to the errors from preprocessing such as word segmentations and tok-enizations. Leveraging phrase level knowledge in translation models is challenging yet reward-ing: it also brings significant improvements on translation qualities. Above the phrase-level are

Bing Zhao

2007-01-01T23:59:59.000Z

92

On the Computational Power of Photosynthesis  

E-Print Network (OSTI)

e nd ant p hase tak e s p lac e in the thy lak oid m e m b rane s of the chlorop last. NADP+ NADPH O 2H+ H O Electron Chain I E.C. II Light Energy Light Energy 2 electrons 2 electrons Photosystem II Photosystem I F igu re 1: T he light d e p e nd ant p hase of p hotosy nthe sis show ing non-c y c lic p hotop hosp ory lation 2.1.1 Photosystem II Light energy is absorbed by chlorophyll which becomes oxidised by losing two electrons. H 2 O is split by an enzyme to provide electrons to reduce the oxidised chlorophyll. Four H ions and an O 2 molecule are released for every two H 2 O molecules. The electrons are passed to photosystem I via an electron transport chain. As the electrons move down the chain they are used to pull a H ion across the thylakoid membrane. This creates a "proton gradient" which will cause a H ion to exit the thylakoid membrane via ATP synthase. This is called a "proton pump". ATP synthase combines a phosphate and adenosine diphosphate (

Niall Murphy; Damien Woods; Thomas J. Naughton; Electron Chain I; Photosystem I

2005-01-01T23:59:59.000Z

93

Market versus Non-Market Assignment of Initial Ownership  

E-Print Network (OSTI)

Each According To? Markets, Tournaments, and the MatchingIntervention on Housing Markets in Korea, mimeo, Sogang1993), Moving toward a Market for Spectrum, Regu- lation,

Che, Yeon-Koo; Gale, Ian

2007-01-01T23:59:59.000Z

94

Co-simulation for performance prediction of integrated building and HVAC systems - An analysis of solution characteristics using a two-body system  

E-Print Network (OSTI)

of innovative integrated HVAC systems in buildings, infor building envelope and HVAC systems simu- lation - WillIntegrated simulation for HVAC performance prediction: State

Trcka, Marija

2010-01-01T23:59:59.000Z

95

The adaptive model of thermal comfort and energy conservation in the built environment  

E-Print Network (OSTI)

occupancy pattern and climate zone. A recent researchin many moderate climate zones of the world. Keywordsbuilding types, all climate zones, and all popu- lations (

de Dear, Richard; Brager, Gail

2001-01-01T23:59:59.000Z

96

The Challenges that Aluminum Faces as Material of Choice  

Science Conference Proceedings (OSTI)

Substitution of factors or production if driven by prices .... i i5 REGULATION LEGI5LATION I MARKET: . Cum-um: Design for X '. _ Cost. PERFORMANCE.

97

Cap-and-Trade Modeling and Analysis: Congested Electricity Market Equilibrium  

E-Print Network (OSTI)

Concerning Cap and Trade Programs in Electricity: the CaseCap and Trade Regulation on Congested Electricity Marketcap and trade regu- lation on congested electricity market

Limpaitoon, Tanachai

2012-01-01T23:59:59.000Z

98

Unifying Design and Runtime Software Adaptation Using Aspect Models  

E-Print Network (OSTI)

guides de la CIBSE (CIBSE, 2005 et CIBSE, 2006). 1.2.1.2 Corrélation de Phaff et De Gids Phaff et De Gids

Paris-Sud XI, Université de

99

Symbolic-numeric Sparse Interpolation of Multivariate ... - CECM  

E-Print Network (OSTI)

lation problem by reducing large variations in magnitude implied by evaluating ... system of at least the same number of equations in order to determine these...

100

untitled  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

power advocates have argued that the atomic-bomb cancer data were insignificant to nuclear reactor regu- lations and irrelevant to nuclear reactor risk assessmentsnot just...

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Automatic annotation of organellar genomes with DOGMA  

E-Print Network (OSTI)

for 98 chloroplast protein cod- ing genes (with two entriessimilarly to the protein cod- ing genes, except that

Wyman, Stacia; Jansen, Robert K.; Boore, Jeffrey L.

2004-01-01T23:59:59.000Z

102

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Mitarbeiter und Stipendiaten Dr. Olaf Adamczyk Dr.-Ing. Suhas Bhandare Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann Dr Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr.-Ing. Sunil Survaiya Dr.-Ing. Hongbin Zhang

Noé, Reinhold

103

40 CFR Ch. I (7101 Edition) 61.20 coverage by a standard that applies  

E-Print Network (OSTI)

] Subpart B--National Emission Standards for Radon Emissions From Underground Uranium Mines SOURCE: 54 FR of this subpart are ap- plicable to the owner or operator of an active underground uranium mine which: (a) Has the following specific meanings: (a) Active mine means an underground uranium mine which is being venti- lated

104

Tel. +49-541-969 2872/2890 -Fax. +49-541-969 1221/2262 -Email. Junge@uni-osnabrueck.de 1 Prof. Dr.-Ing. Wolfgang Junge Gutenbergstrae 36, 49076 Osnabrck  

E-Print Network (OSTI)

for Biophysics, Osnabrück 1992 95th Conference of the Deutsche Bunsengesellschaft für Physikalische Chemie, Jena Chemie Deutsche Gesellschaft für Biophysik Deutsche Gesellschaft für Naturforscher und ?rzte Gesellschaft for Biophysics Chair 1984-1985 Section "Membranes" of Gesellschaft für Biologische Chemie, Board Member 1987

Junge, Wolfgang

105

Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc 401k 401k D PP PT2 Dental Pre-Paid PT 2 Misc Miscellaneous Deductions ROTH ROTH 401(k)  

E-Print Network (OSTI)

FICA Additional Medicare Tax ORP ING1 ORP Retirement ING 10% TCRS NF TCRS Retirement Non-Faculty AFLACSIC Aflac - Sickness Indemnity Foundat Foundation ORP ING2 ORP Retirement ING Two Split TCRS TCB Closed Teacher Class B Contrib AFLCIEET Aflac - Critical ILL-EE-Tobacco Foundat ETSU Foundation ORP ING3

Karsai, Istvan

106

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Bhandare M. Sc. Abas Ahmad Fauzi Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann M. Sc. Selwan K. Ibrahim Dr.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl

Noé, Reinhold

107

Hourglass Effects for Asymmetric Colliders  

E-Print Network (OSTI)

simu- lation results for the SLAC/LBL/LLNL B factory whenSardinia, 1985. [7] P. Chen, SLAC-PUB-4822, December 1988,numerical application to the SLAC/LBL/LLNL B fac- tory shows

Furman, M.A.

2011-01-01T23:59:59.000Z

108

Boreal forest CO2 exchange and evapotranspiration predicted by nine ecosystem process models: Intermodel comparisons and relationships to field measurements  

E-Print Network (OSTI)

White, and S. W. Running, BIOME-BGC simu- lations of stand2.2. Biogeochemical Cycles (BIOME-BGC) [Kimball et al. ,Biogeochemical Cycles (BIOME-BGC) is a daily time step,

2001-01-01T23:59:59.000Z

109

Electron-cloud simulation results for the PSR and SNS  

E-Print Network (OSTI)

Cloud in the PSR and SNS these proceedings. DISCLAIMER ThisRESULTS FOR THE PSR AND SNS. ? M. Pivi and M. A. Furman, Spal- lation Neutron Source (SNS) at Oak Ridge, and updated

Pivi, M.; Furman, M.A.

2002-01-01T23:59:59.000Z

110

Analysis of slice transverse emittance evolutioin in a photocathode RF gun  

E-Print Network (OSTI)

Limborg for discussions on the LCLS injector simu- lations,evolution at 1 nC for the LCLS gun including the solenoidevolution at 1 nC for the LCLS gun including the solenoid

Huang, Zhirong

2009-01-01T23:59:59.000Z

111

The Effects of Inorganic Solid Particles on Water and Crude Oil Emulsion Stability  

E-Print Network (OSTI)

with extensive bacterial activity was selected for the simulation study. The primary production and waterflood in to end May 2001), and daily during the waterflood portion of the simu- lation (start June 2001 until

Kilpatrick, Peter K.

112

Table of ConTenTs The UAA........................................... 2  

E-Print Network (OSTI)

. Lopez-Hermandez and M. Betancor, "DUSTIN: Algorithm for calcu- lation of impulse response on IR wireless Multi- media Commun. (WPCS'00), 2000, pp. 609­614. [15] F. J. Lopez-Hernandez, R. Perez-Jimenez, and A

113

Posters Mesoscale Simulations of Convective Systems with Data...  

NLE Websites -- All DOE Office Websites (Extended Search)

to simulate this period on a 60-km domain with 20- and 6.67-km nests centered on Lamont, Oklahoma. Simu- lations are being run with data assimilated by the nudging technique (Kuo...

114

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 222 194 17...

115

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,100...

116

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,928 1,316...

117

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Energy Consumption Survey: Energy End-Use Consumption Tables Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

118

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

cubic feet) Natural Gas Energy Intensity (cubic feetsquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

119

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,870 1,276...

120

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(trillion Btu) Fuel Oil Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(million gallons) Fuel Oil Energy Intensity (gallonssquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

122

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) District Heat Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

123

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) Natural Gas Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

124

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,602 1,397...

125

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,037...

126

Proceedings of the TOUGH Symposium 2009  

E-Print Network (OSTI)

and oil recovery by waterflood- ing, SPE ReservoirY. and N.R. Morrow, Waterflood performance by injection ofof low-salinity waterflood- ing, the exact mechanisms

Moridis, George J.

2010-01-01T23:59:59.000Z

127

Economic Contributions of the California Nursery Industry  

E-Print Network (OSTI)

energy and input costs, government regulation, chang- ing market structure, competition, information,

Carman, Hoy; Rodriguez, Ana Maria

2004-01-01T23:59:59.000Z

128

Chemical Education Today JChemEd.chem.wisc.edu Vol. 75 No. 5 May 1998 Journal of Chemical Education 537  

E-Print Network (OSTI)

esoteric than necessary. Chemistry is certainly a complicated subject, but shroud- ing it in esoteric

Rioux, Frank

129

Techniques for Maximizing Efficiency of Solar Energy Harvesting Systems (Invited Paper)  

E-Print Network (OSTI)

power point tracking, energy harvest- ing, solar panel, photovoltaic cell, supercapacitor, ultracapac

Shinozuka, Masanobu

130

Short-Term Energy Outlook - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

131

Arizona - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

132

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Wissenschaftliche Mitarbeiter und Stipen- diaten Dr. Olaf Adamczyk Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dr.-Ing. Sebastian Hoffmann Dipl.-Ing. Benjamin Koch Dr. rer. nat. Manfred Lichtinger Dr.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo

Noé, Reinhold

133

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

/2009 ­ 02/2010) Prof. Dr.-Ing. Reinhold Noé Personal Wissenschaftliche Mitarbeiter und Stipendiaten Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath Dr.-Ing. Timo Pfau Stip. M. EE. Kidsanapong Puntsri Dr.-Ing. David Sandel Dr.-Ing. Stephan Schulz Technische

Noé, Reinhold

134

News Briefs  

Science Conference Proceedings (OSTI)

... ing and cleanup, decontamination and decommissioning efforts, testing for ... the commercial radioactivity laboratories, nuclear power radiochemistry ...

1997-11-25T23:59:59.000Z

135

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

136

RADIATION RESEARCH 153, 220238 (2000) 0033-7587/00 $5.00  

E-Print Network (OSTI)

): the light water reactor [(LWR) in both pressurized and boil- ing versions]; heavy water (CANDU) reactor

137

DOI: 10.1126/science.1184167 , 76 (2010);328Science  

E-Print Network (OSTI)

, includ- ing nanolubricants and components in micro- and nanoeletromechanical systems devices. References

Kim, Philip

138

About EIA - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Uranium fuel, nuclear reactors, ... Environment. Greenhouse gas data, voluntary report- ing, ... Office of Personnel Management;

139

Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

140

Event-Places in North America: City Meaning and Making [Research and Debate  

E-Print Network (OSTI)

events in the cityscape triggers both memories and anticipation, bridg- ing the gap between performances.

Frenchman, Dennis

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

United States - Search - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

142

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

143

Mansaa thai June is, 1989  

E-Print Network (OSTI)

.ing cell.ing cell.iving cell.ging cell.nnn ccccggggng cell.ggggg cng cell.eelg cell.eee l.lke up every

Kemner, Ken

144

he Romberg Tiburon Center in Marin County is not an easy place to find. While running late and driving too  

E-Print Network (OSTI)

is complete as yellow sun rays blend with the rust-colored towers of the iconic Golden Gate Bridge. Dur- ing originally built for offload- ing coal. Later, it was used to support the assembly of submarine nets

145

Network computing : limits and achievability  

E-Print Network (OSTI)

insufficiency of linear network cod- ing. 2009. [88] R.and K. Zeger. Network cod- ing for computing. In Allertonto target function f is C cod (N , f ) = sup k : ? (k, n)

Karamchandani, Nikhil

2011-01-01T23:59:59.000Z

146

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

In Proceed- ings of Thermal Energy Storage in Aquifers Work-Mathematical Modeling of Thermal Energy storage in Aquifers.In Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

147

Copyright 2008 No part of this presentation may be reproduced in any form without prior authorization.  

E-Print Network (OSTI)

demon- stration project for Xcel Energy, convert- ing a Ford Escape Hybrid PHEV vehicle to put power. Utilizing fully automated fast processing, the new technology will be capable of produc- ing one solar cell

Amin, S. Massoud

148

74 Scientific American, April 2011 Illustration by Tom Whalen Earthquake early-warning networks  

E-Print Network (OSTI)

, but it is enough to send shutdown warn- ings to power plants and rail networks, automatically open ele- vator doors comes in two parts: a fast- moving, sudden jolt and a slower-mov- ing wave that causes the great

Allen, Richard M.

149

Natural Gas Productive Capacity for the Lower 48 States 1986 ...  

U.S. Energy Information Administration (EIA)

con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy o r any other or - gani za tion. Preface

150

BUILDING CORRELATORS WITH MANY-CORE HARDWARE Rob V. van Nieuwpoort and John W. Romein  

E-Print Network (OSTI)

- ing techniques, but more on signal-processing techniques. For example, LOFAR [1], MeerKAT (Karoo Array International Conference on Supercomput- ing, New York, NY, June 2009, pp. 440­449. [11] "Karoo array telescope

Romein, John W.

151

OFFICE OF AUDITOR OF STATE STATE OF IOWA  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Daniels, Thomas E.

152

Public servants A key part of the  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Manapat, Michael

153

B U S I N E S SB U S I N E S S ROBERT H. SMITH SCHOOL OF BUSINESS UNIVERSITY OF MARYLAND SPRING 2011 VOL. 12 NO. 1  

E-Print Network (OSTI)

and cellphone products. Employees were asked daily over a period of 10 work- ing days to list any incidents

Milchberg, Howard

154

e3_Coyote Case Study2000/L&J  

Science Conference Proceedings (OSTI)

... graphic design technology; biotechnology; heat- ing, ventilating ... the local school districts and work ... HVAC Heating, Ventilating, and Air Conditioning ...

2013-06-04T23:59:59.000Z

155

Cross-market relationships strengthened in the third quarter of ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... The correlation between prompt-month West Texas Intermediate ...

156

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... What is shale gas and why is it important? ...

157

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

158

More recycling raises average energy content of waste used to ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

159

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

160

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Annual Energy Outlook 2013 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

162

State-Level Energy-Related Carbon Dioxide Emissions, 2000-2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

163

Cross State Air Pollution Rule requires emissions reductions from ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

164

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

165

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

166

Does EIA have maps or information on the location of natural gas ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

167

The geology of natural gas resources - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

168

UNIVERSITE DE NICE-SOPHIA ANTIPOLIS -UFR SCIENCES Ecole Doctorale Sciences et Technologies de l'Information et de la Communication  

E-Print Network (OSTI)

- ing the properties of such a ladder in this poorly explored regime. Acknowledgements The work at ORNL

Paris-Sud XI, Université de

169

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... CBECS enters the final phase of questionnaire design.

170

Paycheck Deduction Codes 01/10 Deduct Code Description  

E-Print Network (OSTI)

Garnishment GFNOPROV GF Mand Ret-No Providor Chosen GFTSAING GF - TSA ING GFTSALINC GF - TSA Lincoln GFTSASEC

Peterson, Blake R.

171

Electricity use by machine drives varies significantly by ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Fossil fuels may be used to drive turbines, reciprocating engines, ...

172

Fermi and the ergodic problem Giovanni Gallavotti  

E-Print Network (OSTI)

the esoteric (quasi) ergodic problem. Consider- ing a `{degrees of freedom system, ` > 2, with Hamilto- nian H

Roma "La Sapienza", Università di

173

Reference List 1751-2000  

Science Conference Proceedings (OSTI)

... 1934. Wurmb-Schwark, N. v, Michaela Harbeck, Urs Wiesbrock, Inge Schroeder, Stefanie Ritz-Timme, and Manfred Oehmichen. ...

2003-12-18T23:59:59.000Z

174

ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980  

E-Print Network (OSTI)

storm and double-pane windows, insulat- ing shutters, caulking and weatherstripping, fur- nace retrofits, and active and passive solar

Authors, Various

2010-01-01T23:59:59.000Z

175

Underwater 3D Mapping: Experiences and Lessons learned  

E-Print Network (OSTI)

in Okinawa in 1998[5]. Monitoring the health of coral reefs is a difficult and time consum- ing task

Jenkin, Michael R. M.

176

Mid-Atlantic electricity market reacts to Tuesday's earthquake ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... after the event. ...

177

Selected publications, with commentary William Bialek February 11, 2004  

E-Print Network (OSTI)

synergistic cod- ing, and this synergy is a significant component of the high coding efficiency seen in [66

178

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

179

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

180

Electric Power Monthly - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel, nuclear reactors, generation, spent fuel. ... Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

182

Markov decision process (MDP) framework for software power optimization using call profiles on mobile phones  

E-Print Network (OSTI)

Duke researchers [21] extend this approach to the system level by formulat- ing a general framework to manage energy

Jung, Eric; Maker, Frank; Cheung, Tang Lung; Liu, Xin; Akella, Venkatesh

2010-01-01T23:59:59.000Z

183

View / Download  

Science Conference Proceedings (OSTI)

developing fields of technology, mak- ing major advancements in traditional fields of engineering, or developing/ implementing innovative approaches.

184

THE CORROSION OF SILICATE MATERIALS BY HYDROGEN GAS AND HYDROFLUORIC ACID SOLUTION  

E-Print Network (OSTI)

occurring in the coal gasifier and then find- ing a methodmaterial for the coal gasifier applica- tion. The corrosion

Tso, Stephen T.

2011-01-01T23:59:59.000Z

185

Fuel economy standards have affected vehicle efficiency - Today in ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Notes: Combined means both foreign and domestic vehicles.

186

Second-Generation Nickel-Base Single Crystal Superalloy  

Science Conference Proceedings (OSTI)

creased, the demands placed on turbine airfoils have escalated dramatically. ... The demand- ing goals established ..... (maximum tensile strain at minimum...

187

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, biomass and ethanol. ... Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights

188

ICAL: A Tool for Analyzing Imperfect Comparison Algorithms Wee-Chong Oon and Martin Henz  

E-Print Network (OSTI)

[7] that was based on temporal difference learn- ing, and the checkers program Anaconda [1, 2] based

Henz, Martin

189

SOLAR ENERGY PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT ANNUAL REPORT 1978  

E-Print Network (OSTI)

of develop- ing a photovoltaic cell, based on a catalyst (has been shown that a photovoltaic cell can be constructed

authors, Various

2011-01-01T23:59:59.000Z

190

Assessing regional evapotranspiration and water balance across a Mediterranean montane climate gradient  

E-Print Network (OSTI)

topography and calculated solar radiation. Hydrol. Process.al. (2011). Incom- ing solar radiation was derived from the

Anderson, Ray G.; Jin, Yufang; Goulden, Michael L.

2012-01-01T23:59:59.000Z

191

Puerto Rico - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico Energy Affairs Administration, Administracin de Asuntos Energticos;

192

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico* Saint Kitts and Nevis Saint Lucia Saint Vincent ...

193

Markov Random field edge-centric image/video processing  

E-Print Network (OSTI)

using adaptive fast B-spline ?lter- ing, IEEE Internationalimage resizing using modi?ed B-splines, IEEE International

Li, Min

2007-01-01T23:59:59.000Z

194

How is electricity used in U.S. homes? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... heating elements, and motors not listed above. Learn more:

195

U.S. total motor gasoline exports down slightly from last year but ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Total motor gasoline = finished motor gasoline + motor gasoline blending components.

196

COMBINING MAGNETIC SHIELDING AND CRYOPUMPING FOR A NEUTRAL BEAM SOURCE  

E-Print Network (OSTI)

generated by the fusion reactor while the cold surface willfor the Toka. -nak Fusion Test Reactor", in Proceed ings of

Tanabe, J.

2010-01-01T23:59:59.000Z

197

Integrating Rhetorical-Semantic Relation Models for Query ...  

Science Conference Proceedings (OSTI)

... In Galia Angelova, Kalina Bontcheva, Ruslan Mitkov, Nicolas Nicolov, and Nikolai Nikolov, editors, Proceed- ings of the International Conference ...

2006-10-03T23:59:59.000Z

198

Common coastal foraging areas for loggerheads in the Gulf of Mexico: Opportunities for marine conservation  

E-Print Network (OSTI)

and its find- ings validated. On the other hand, to confirm the validity of the new tag tracking method

Florida, University of

199

Illinois coal production pushes Illinois Basin production above ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... based on the Mine Safety and Health Administration (MSHA).

200

Alkylation is an important source for octane in gasoline - Today ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (like temperature and pressure) along with different safety considerations.

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Eastern Mediterranean natural gas exploration focused on the ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Gaza Marine: 1: unknown: Sources: EIA estimates, IHS, ...

202

Error-reducing corrections for the method of regularized Stokeslet for fluid-membrane interactions  

E-Print Network (OSTI)

for SDS [1], and sec- ond, we investigate the summarisation of XML documents by tak- ing into account

Ullmer, Brygg

203

Applied and Computational Mathematics Division Applied and ...  

Science Conference Proceedings (OSTI)

... ing, materials science, chemistry, bioscience, engineering, fire ... mathematics are fundamental tools enabling ... The NIST Handbook of Mathematical ...

2013-05-08T23:59:59.000Z

204

Arizona - Rankings - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Markets & Finance. Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ...

205

EXPERIMENTAL ANALYSIS OF HEURISTICS FOR THE ...  

E-Print Network (OSTI)

order from inaccurate adjacency information [19], medical image process- ing [2] ...... salesman problem, Research Report, Department of Computer Science,...

206

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Greenhouse gas data, voluntary report- ing, electric power plant ...

207

Kazakhstan - Analysis - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power ... by the Kazakhstan's Electricity Grid Operating ... regional electricity distribution .. ...

208

Saha and Purkait: Investigation of Polarization and Depolarization144 Investigation of Polarization and Depolarization Current  

E-Print Network (OSTI)

of oilrrrrrpaper insu- lation system of power transformer. Moisture measurement in oil sample generally gives, depolarization current. 1 INTRODUCTION ARGE numbers of power transformers around Lthe world are approaching and Depolarization Current Measurements for the Assessment of Oil-paper Insulation of Aged Transformers T. K. Saha

Saha, Tapan Kumar

209

4500. Nasch, P.M., M.H. Manghnani, and R.A. Secco, 1997, Anomalous behavior of sound velocity and attenuation in liquid Fe-Ni-S, Science, 277, 219-221.  

E-Print Network (OSTI)

537 Hrdlicka's Aleutian Population-Replace- ment Hypothesis A Radiometric Evaluation Joan Brenner individuals indicate that Paleo-Aleuts were the oldest popu- lation in the Aleutians, with a time depth of ca of the Aleutian Islands was best characterized as a relatively unbroken, uniform adaptation to a rich marine

210

Water flows, energy demand, and market analysis of the informal water sector in Kisumu, Kenya  

E-Print Network (OSTI)

Analysis Water flows, energy demand, and market analysis of the informal water sector in Kisumu Available online xxxx Keywords: Informal water sector Water flows Developing countries Water market analysis to cope with popu- lation growth. Informal water businesses fulfill unmet water supply needs, yet little

Elimelech, Menachem

211

Framingham Stroke Risk Profile and poor cognitive function: a population-based study  

E-Print Network (OSTI)

, Wolf PA: Framingham stroke risk profile and lowered cognitive performance. Stroke; a journal of cerebral circu- lation 2004, 35(2):404-409. 13. Goldstein LB, Adams R, Alberts MJ, Appel LJ, Brass LM, Bushnell CD, Culebras A, Degraba TJ, Gorelick PB...

Llewellyn, David J; Lang, Iain A; Xie, Jing; Huppert, Felicia A; Melzer, David; Langa, Kenneth M

2008-04-22T23:59:59.000Z

212

Ris-M-2804 THE BWR CORE SIMULATOR COSIMA WITH 2 GROUP  

E-Print Network (OSTI)

), as well as calculations on the Quad Cities reactor for verification of the programme (2). It was found the control rod has been in, and so are the nuclear properties of the assembly. An exact simu- lation assumes that as to the dependence of burn upr the nuclear p

213

Distribution et association des inversions chromosomiques dans trois populations naturelles  

E-Print Network (OSTI)

, one on each of the major autosome arms, are cosmopolitan. The Tunisian popu- lation shows the greatest distribution of cosmopolitan inversions between individuals of the French population is observed in the Tunisian lines. Linkage disequilibrium exists between pair of cosmopolitan inversions of the #12;second

Recanati, Catherine

214

Human Diversity: Our Genes Tell Where we Live  

E-Print Network (OSTI)

Human Diversity: Our Genes Tell Where we Live Dispatch Laurent Excoffier A detailed genetic. The novelty of the recent work of Rosenberg et al. [7] is precisely that they have checked the validity of the analysis of a cell-line panel of 52 worldwide popu- lations [9] managed by the French Center for the Study

Rosenberg, Noah

215

PALAIOS, 2009, v. 24, p. 809817 Research Article  

E-Print Network (OSTI)

in terms of energy usage. Compared to foraging at the surface, greater amounts of energy are used during structures. Accumu- lations .30 cm thick typically exceed the ability of invertebrates to escape upward for digging and are able to dig in harder substrates (Lessa and Thaeler, 1989). Geomys bursarius is typically

Loope, David B.

216

Inside this report 1...........................Letter from the Co-Directors  

E-Print Network (OSTI)

solar power, IE houses the new UA Renewable Energy Network, designed to stimulate the adoption, Pale rings, Solar energy, North American Monsoon, Sonoran Desert, Mojave Dese #12;lational a leadership role in preparing the Southwest and other regions for a sustainable and vibrant future. IE has

Wong, Pak Kin

217

Water clusters: Untangling the mysteries of the liquid, one molecule at a time  

E-Print Network (OSTI)

and solid phases of water, including an accurate universal force field. The quest to achieve an accurate of the surfaces of either ice or liquid water (3), nor do we understand the origin of the intriguing anomalies difficult to accurately parameterize these interactions from ab initio calcu- lations. Moreover, the ab

Cohen, Ronald C.

218

Matthew R. Norman Scientific Computing Group  

E-Print Network (OSTI)

-present, Porting the Community Atmosphere Model - Spectral Element (CAM-SE) to ORNL's Titan Supercomputer National Laboratory PO BOX 2008 MS6016 Oak Ridge, TN 37831, USA normanmr@ornl.gov (865) 576-1757 Education-scale atmospheric simu- lation code, to run on Oak Ridge Leadership Computing Facility's (OLCF's) Titan super

219

Matt Charette has been pulling off the floorboards in Earth's basement to reveal a hidden plumbing system that pumps  

E-Print Network (OSTI)

at the coasts. But there's a lot of uncertainty in that kind of calculation. What was the breakthrough? Charette to agricultural fields, golf courses, and lawns, and from septic tanks. These sources combine to create pretty, inert gas. Or it can be bad. We did research in Falmouth [Mass.], where we found a big accumu- lation

Buesseler, Ken

220

International Journal of Computer Mathematics Vol. 00, No. 00, February 2008, 135  

E-Print Network (OSTI)

of significant physical values such as the electrical consumption, the heating load, or use statistical tools such as the heating and cooling degree-days and their corre- lations with the electrical load. In the same way to the electrical consumption prediction Table 5. Index x real signal y forecasted signal s standard deviation n

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Bending Burning Matches and Crumpling Burning Paper Texas A&M University  

E-Print Network (OSTI)

Bending Burning Matches and Crumpling Burning Paper Zeki Melek Texas A&M University Department burning. Specifically, we can simulate the bending of burning matches, and the folding of burning paper interactively. 1 Introduction We present a simple method to increase the realism of the simu- lation of burning

Keyser, John

222

This article was downloaded by: [Stanford University] On: 03 July 2012, At: 14:31  

E-Print Network (OSTI)

://www.tandfonline.com/loi/hbas20 Context-Dependent Emotion Regulation: Suppression and Reappraisal at the Burning Man Festival;Context-Dependent Emotion Regulation: Suppression and Reappraisal at the Burning Man Festival Kateri Mc regu- lation use at a temporary annual art festival (Burning Man). We assessed two common emotion

Gross, James J.

223

1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chapter 4.2, Public R,~lations Contracts is a new chapter replacing Acquisition Letter 2002-03. Chapter 4.2, Public R,~lations Contracts is a new chapter replacing Acquisition Letter 2002-03. It requires coordination with the Office of Public Affairs, DOE or National Nuclear Security Administration (NNSA), prior to contracting for public relations or communication services requirements. Chapter 38.1, Federal Supply Schedule Contracting is an update of the Strategic Acquisition Transactions Guide oj~ 2002, in response to Policy Flash 2004-23, "Proper Use of Other Agencies Contracts", It clarifies and improves procedures to be followed when placing awards under other Agency contracts, such as Federal Supply Schedules (FSS) and Government-wide Agency Contracts (GW ACs), as well as ordering procedures under Multiple Award Contracts. It provides that the Con1racting Officer placing an order on another agency's behalf is responsible

224

Experimental Evaluation of Ventilation Systems in a Single-Family Dwelling  

E-Print Network (OSTI)

The French regulation on residential building ventilation relies on an overall and continuous air renewal. The fresh air should enter the building through the "habitable rooms" while the polluted air is extracted in the service rooms. In this way, internal air is drained from the lowest polluted rooms to the highest polluted ones. However, internal pressure equilibrium and air movements in buildings result from the combined effects ventilation system and parameters such as wind, temperature difference or doors opening. This paper aims to analyse the influence of these parameters on pollutant transfer within buildings. In so doing, experiments are carried out using tracer gas release for representing pollution sources in an experimental house. Mechanical exhaust, balanced and natural ventilation systems are thus tested. Results show the followings: - For all cases, internal doors' opening causes the most important pollutant spread. - When doors are closed, the best performances are obtained with balanced venti...

Koffi, Juslin; Akoua, Jean-Jacques

2010-01-01T23:59:59.000Z

225

Cost-effectiveness of multidisciplinary management of Tinnitus at a specialized Tinnitus centre  

E-Print Network (OSTI)

) will be quantified using the cost-effectiveness acceptability curve. Sensitivity analyses will be used to show the impact of variation in non-stochastic input parameters on the incremental cost- utility ratio, such as discount rate, unit prices, and design issues... using integral cost calcu- lations. Costs from productivity loss will be quantified using the friction cost method, as recommended in the Netherlands [28]. Ethical considerations Patients will be informed verbally and in written format about the research...

Cima, Rilana; Joore, Manuela; Maes, Iris; Scheyen, Dyon; El Refaie, Amr El; Baguley, David M; Vlaeyen, Johan W S; Anteunis, Lucien

2009-02-11T23:59:59.000Z

226

Proceedings from the University of Washington School of Oceanography Undergraduate Senior Thesis  

E-Print Network (OSTI)

time series for the period 1995­2002 for Hardinge (QERS2/G) and for Bahadurabad (QERS2/B), as well QERS2/G and QERS2/B every 35 days for 1995­2003, also show overall good agreement in the timing. For Hardinge, QERS2/G compared to QG gives a correlation of 0.85 (n = 59). For Bahadurabad, the corre- lation

Hickey, Barbara

227

Ogmios 31  

E-Print Network (OSTI)

, and proceeded to make ourselves at home with the other guests, including the bandar log. The Conference, on Vital Voices: Endangered languages and Multilingualism, started with a Keynote address by L. M. Khubchandani: this attempted to capture the scene of oral... can be typed using any English key board of a computer. He is interested in studies on lan- guage endangerment, ethnolinguistics, trans- lations (though he knows only six Indian languages - Tamil, Malayalam, Kurux, Car Nicobarese, Kannada & Hindi - he...

Ostler, Nicholas D M

2007-01-01T23:59:59.000Z

228

Scalar dissipation rate based flamelet modelling of turbulent premixed flames  

E-Print Network (OSTI)

closures . . . . . . . . . . . . . . . 98 7.2 RANS of planar onedimensional flames . . . . . . . . . . . . . . 99 7.2.1 Computational details . . . . . . . . . . . . . . . . . . . . 99 7.2.2 Results and discussion... ). . . . . . . . . . . . . . . . . . . . . . 129 7.21 The contour plot of temperature (K) from the Bunsen flame calcu- lations for case F3. The plot for the entire computational domain (top) and the region close to the nozzle exit (bottom) are shown. 130 7.22 The mean progress variable, c, using...

Kolla, Hemanth

2010-03-16T23:59:59.000Z

229

NIST CENTER FOR NEUTRON RESEARCH LAYOUT  

Science Conference Proceedings (OSTI)

... 17 18 19 13 13 Spin Echo Spectrometer offer- ing neV energy resolution, based upon Jlich design, sponsored by NIST, Jlich, and ExxonMobil. ...

2001-02-27T23:59:59.000Z

230

COMPARISON OF PROPORTIONAL AND ON/OFF COLLECTOR LOOP CONTROL STRATEGIES USING A DYNAMIC COLLECTOR MODEL  

E-Print Network (OSTI)

Department of Energy. "Solar heating and Cooling ProjectProgram." ings of the Solar Heating and Operational Resultsin the Control of Solar Heating and Cooling Systems."

Schiller, Steven R.

2013-01-01T23:59:59.000Z

231

Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

kinetic and sum frequency gen- eration vibrational spectroscopy study. Journal of the American Chemicalkinetic studies of their activity and stability against leach- ing. Journal of the American Chemical

Ewers, Trevor David

2012-01-01T23:59:59.000Z

232

China Energy Databook - Rev. 4  

E-Print Network (OSTI)

com- mercial energy source, petroleum began contribut- ing aFrom British Petroleum. Source: China Energy StatisticalSource: United Nations, 1994; World Energy Council, 1992; British Petroleum,

Sinton Editor, J.E.

2010-01-01T23:59:59.000Z

233

An Attractor-Repeller Approach to Floorplanning  

E-Print Network (OSTI)

ing the optimal positions for a given set of modules of fixed area (but perhaps ...... 51. This problem has 10 mobile modules. (departments) and, in contrast with...

234

Markets expect Marcellus growth to drive Appalachian natural gas ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

235

Why Sandia?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia? Sandia was doing cyber before the term cyberspace existed. Today, with cybersecurity a daunting - and rapidly grow- ing - national security problem, Sandia is applying...

236

FEMP Outdoor Solid State Lighting Intiative: Resources for Outdoor...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fact Sheet - The Consortium shares technical information and experi- ences related to LED street and area light- ing demonstrations. The Consortium also serves as an objective...

237

Three Public Neighborhoods [EDRA / Places Awards -- Research  

E-Print Network (OSTI)

Enhanced maintenance and management performance. Improvedbetter maintenance, stricter management and increasedand management of the importance of their collective contribution to redevelopment and ongo- ing maintenance.

Nesmith, Barbara Stabin

2001-01-01T23:59:59.000Z

238

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... CAFE standards August 3, 2012 Fuel economy standards have affected vehicle efficiency.

239

Recently, S&P 500 Index and WTI crude oil futures price movements ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... One notable exception to this recent price correlation came on August 9.

240

STATE OF GREEN bUSINESS 2012  

Science Conference Proceedings (OSTI)

... Cool technologies are start- ing to make home energy efficiency more com ... years, hundreds of millions of households and businesses worldwide will ...

2013-07-29T23:59:59.000Z

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Member News_Dec 2011_7M.indd - TMS  

Science Conference Proceedings (OSTI)

The nomination form and support- ing documentsincluding ... bridge University's science program, and then just to see ... a pipe organ construction business in.

242

METAHEURISTIC HYBRIDIZATION WITH GRASP 1. Introduction ...  

E-Print Network (OSTI)

Apr 14, 2008 ... ing, scheduling, inventory and production planning, and facility location. ..... that the size of the neighborhood be such that its exploration can.

243

Secretaries Chu and Salazar to Convene Meeting on Strengthening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commandant for Operations, United States Coast Guard Andrew Inglis, Chief Executive of Exploration & Production, BP Rex W. Tillerson, Chairman& CEO, ExxonMobil Hon. Don Winter,...

244

Shot boundary detection using the moving query window  

Science Conference Proceedings (OSTI)

... and after it will usually be near- symmetrical. ... while using only the luminance component of the ... Proceed- ings of the SPIE; Visualization and Optimi ...

2002-11-08T23:59:59.000Z

245

Georgia - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Georgia's power grid was previously part of an integrated South Caucasus network.

246

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

247

FLAMMABILITY OF HFC/HCFC -AIR MIXTURES AT ...  

Science Conference Proceedings (OSTI)

... a hatch for inspection and cleaning, sockets for installation of pressure transducers, thermocouples and an igniter and a jacket for thermostat- ing. ...

2011-10-13T23:59:59.000Z

248

View / Download - TMS  

Science Conference Proceedings (OSTI)

neer at EWI, Columbus, Ohio. Work- ing in the materials group, he provides expertise on ceramics and fundamen- tal materials science to clients in such.

249

Assessment of Hybrid Geothermal Heat Pump Systems - Technology...  

NLE Websites -- All DOE Office Websites (Extended Search)

cool- ing needs of the building and offers general guidelines Assessment of Hybrid Geothermal Heat Pump Systems Geothermal heat pumps offer attractive choice for space...

250

February 2010 TOC.indd  

Science Conference Proceedings (OSTI)

Feb 2, 2010 ... and geothermal power is available. Ad- ditional sources of hydro power are be- ing developed in China and Brazil and this trend is expected to...

251

Estimation of Hurricane Wind Speed Probabilities: Application ...  

Science Conference Proceedings (OSTI)

... of experienc- ing nonlinear behavior under exceptionally strong windstorm events, or for the design of Liquid Natural Gas (LNG) facilities, required ...

2013-07-26T23:59:59.000Z

252

Sandia Labs Accomplishments 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

THz transceiver. Engineering sciences The first large-scale liquefied natural gas (LNG) fire test in the Phoenix series was successfully conducted. The result- ing fire was...

253

DISTRIBUTED SENSOR PROCESSING OVER AN AD HOC ...  

Science Conference Proceedings (OSTI)

... ing mechanisms that consider the remaining battery life of a node? ... The Linked Cluster algorithm (LCA) [1] was used to self-organize the network ...

2009-02-03T23:59:59.000Z

254

Impact of Ground-level Aviation Emissions on Air Quality in the Western United States.  

E-Print Network (OSTI)

??The aviation industry has experienced sustained growth since its inception result- ing in an increase in air pollutant emissions. Exposure to particulate matter less than (more)

Clark, Eric Edward

2010-01-01T23:59:59.000Z

255

View / Download  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames

256

COMMUNICATIONS OF THE ACM January 2002/Vol. 45, No. 1 43 ameBots [1] is a virtual reality  

E-Print Network (OSTI)

is available in Tcl/Tk, Java, C/C++, and more. Tools for visualiz- ing the terrain in which agents interact

Kaminka, Gal A.

257

SHA-3 Conference, August 2010, CubeHash  

Science Conference Proceedings (OSTI)

... he analysis! ... were the easy issues. issues, most interesting arty analyses of CubeHash: ingly sophisticated ntial attacks. ... No Limited RAM size? ...

2012-05-30T23:59:59.000Z

258

Health and Rights at the Margins  

E-Print Network (OSTI)

City, on the China-Myanmar line, the flow of drugs, people,in China when a study found that 146 inject- ing drug users

Shih, Elena

2012-01-01T23:59:59.000Z

259

A NONSTANDARD SIMPLEX ALGORITHM FOR LINEAR ...  

E-Print Network (OSTI)

standard simplex algorithm. 2. Pivoting operations. In the next section, we describe column and row pivot- ing operations. This topic is closely related to the ...

260

eTuner: tuning schema matching software using synthetic scenarios  

Science Conference Proceedings (OSTI)

ranked list of answers to the human user. In such sce- narios ... manually, largely by trial and error a time consum- ing, frustrating, and error prone process.

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

OP - SFNET - Volume 15, Number 2 March 15, 2008  

Science Conference Proceedings (OSTI)

... ing WAVE - WAVElets S - Signal processing People interested in attending the workshop and/or the banquet can register using the website http ...

2008-06-30T23:59:59.000Z

262

Gender and Modernity in Colonial Korea  

E-Print Network (OSTI)

by Jennifer J. Jung-Kim Gender & Modernity in Colonial Koreathe ongo- ing reformulation of gender identities. First, Iupdate he reconstruction of gender identities My findings

Jung-Kim, Jennifer J.

2006-01-01T23:59:59.000Z

263

Table 5.13d Petroleum Consumption Estimates: Electric ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, ... For 1949-1979, data are for gas turbine and internal combustion plant use of petroleum. For 1980-2000, ...

264

MEASUREMENT SCIENCE AND TECHNOLOGY FOR THE ...  

Science Conference Proceedings (OSTI)

... To boost fuel efficiency, the US auto industry is striv- ing to manufacture cars from lightweight ... for evaluating how parts of a hydro- gen pipeline ...

2012-11-14T23:59:59.000Z

265

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

Department of Energy, Energy Storage Division through thegeneration and energy storage, Presented at Frontiers ofIn Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

266

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

aquifers for thermal energy storage. Problems outlined aboveModeling of Thermal Energy Storage in Aquifers," Proceed-ings of Aquifer Thermal Energy Storage Workshop, Lawrence

Tsang, C.-F.

2011-01-01T23:59:59.000Z

267

Exhibition Directory  

Science Conference Proceedings (OSTI)

Feb 7, 2008 ... Fundamentals ..... ing ASM Handbooks Online, ASM Alloy Center and the Al- ..... sales engineers to answer any questions you may have.

268

Automated extraction and classification of thunderstorm and ...  

Science Conference Proceedings (OSTI)

... found that thunder- storms dominated the wind climate in West Texas. ... may be unrealistically long, suggest- ing that intermediate beginning and ...

2013-01-17T23:59:59.000Z

269

Total Energy - Data - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

270

Press Room - Press Releases - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

271

The Ethics of Industry Experimentation Using Employees: The Case of Taste-Testing Pesticide-Treated Tobacco  

E-Print Network (OSTI)

RJ, Barbeau EM. Tobacco industry documents: com- paring theRE, Balbach ED. Tobacco industry documents: treasure trovecombined meet- ing of the Industry Technical Committee and

McDaniel, Patricia A; Solomon, Gina; Malone, Ruth E

2006-01-01T23:59:59.000Z

272

Ctontents  

Science Conference Proceedings (OSTI)

... "Time that material started flaming where ... a 4D shift from left to right, and start- ing with ... by repeating the length change calcula- tions starting at the ...

2003-10-14T23:59:59.000Z

273

A new lower bound for one-machine earliness-tardiness scheduling  

E-Print Network (OSTI)

the 50-job instances remain unsolved within a large time limit. ..... Our heuristic is based on the analysis of the pseudo-schedule correspond- ing to the optimum...

274

The NIST Length Scale Interferometer  

Science Conference Proceedings (OSTI)

... This approach to measurements was pioneered by Churchill ... as part of this study of systematic effects but ... the stand- ing wave train between the ...

2013-10-22T23:59:59.000Z

275

International Carbon Dioxide Emissions and Carbon Intensity  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

276

Angola - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... but in the short-term access to power will remain a challenge.

277

Few transportation fuels surpass the energy densities of gasoline ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

278

Fast dimensional inspection of deformable parts from partial views Andres Jaramillo a  

E-Print Network (OSTI)

Nacional de Colombia, Cra 27 No. 64-60 Manizales, Caldas, Colombia b Depto. Ing. Meca´nica y Mecatro

Alberta, University of

279

Qatar - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, ... voluntary report- ing, ... Qatar's Oryx GTL project is in operation and the Pearl GTL project is expected to begin ...

280

Invariant semidefinite programs - Optimization Online  

E-Print Network (OSTI)

V.I. Levenshtein, Universal bounds for codes and designs, in Handbook of Cod- ing Theory, eds V. Pless and W. C. Huffmann, Amsterdam: Elsevier, 1998,.

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Structural Changes During Thermal Fatigue of Two Nickel-Based ...  

Science Conference Proceedings (OSTI)

greatly affect the thermal endurance of these heat-resisting alloys. I?. ... factors govern- ing the thermal fatigue behavior of a number of commercial nickel-.

282

Netherlands - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (BkWh) of electricity in 2011, mostly from conventional thermal power plants.

283

--No Title--  

Annual Energy Outlook 2012 (EIA)

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

284

at Clemson University Department of Forest Resources  

E-Print Network (OSTI)

prediction. For. Sci. 54(5):553­566. ZHANG, L., J.A. MOORE, AND J.D. NEWBERRY. 1993. Disaggregat- ing stand

Bolding, M. Chad

285

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

286

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

using aquifers for thermal energy storage. Problems outlinedmatical Modeling of Thermal Energy Storage in Aquifers,"Proceed- ings of Aquifer Thermal Energy Storage Workshop,

Tsang, C.-F.

2011-01-01T23:59:59.000Z

287

U.S. energy intensity projected to continue its steady decline ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Light-duty vehicles are by far the largest energy consuming part of ...

288

Homeward Bound: Food-Related Transportation Strategies in Low Income and Transit Dependent Communities  

E-Print Network (OSTI)

s Ad Hoc Food Security ing Home the Broccoli: Innovativeor administrative home for food security planning, includingtheir goods home. broadly, food security approaches. The

Gottlieb, Robert; Fisher, Andrew; Dohan, Marc; O'Connor, Linda; Parks, Virginia

1996-01-01T23:59:59.000Z

289

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... A report of historical annual energy statistics. For many series, ...

290

View / Download - TMS  

Science Conference Proceedings (OSTI)

neering at the University of Leeds,. United Kingdom. She received the award for research on bioengineer- ing, in particular on the tribology of hip replacements.

291

Die emanzipierte Emanzipationsgegnerin: Caroline Pichlers theoretische Schriften  

E-Print Network (OSTI)

Lit- eraturwissenschaft. Hrsg. Inge Stephan und SigridVon Brgern und ihren Frauen. Hrsg. Mar- gret Friedrich undEin Bonner Symposium. Hrsg. Karl Konrad Polheim. Bonn:

Laukov, Lucia

2011-01-01T23:59:59.000Z

292

NANOSTRUCTURED CATALYTIC MEMBRANES - Argonne National Laboratory  

different sources, including coal, natural gas, or biomass such as corn. NCMs also can be used for selective ... ing production costs, and improving ...

293

A Provably Secure Operating System  

Science Conference Proceedings (OSTI)

... ing availability of desired facilities, correctness of ... hierarchical structure and the doctrine of invisibility of ... An on-line facility for interactive editing of ...

2013-04-15T23:59:59.000Z

294

Passive Cooling of a Micromechanical Oscillator with a ...  

Science Conference Proceedings (OSTI)

... Closely related passive cooling has been reported in [9,20 ... Although rather modest cooling is obtained here ... eventually provide ground state cool- ing ...

2007-09-26T23:59:59.000Z

295

Section 4.1.3 Natural Ventilation: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

in and through build- ings. These airflows may be used both for ventilation air and for passive cooling strategies. Natural ventila- tion is often strongly preferred by building...

296

Cooperative motions in supercooled liquids and glasses  

E-Print Network (OSTI)

method[167, 168, 169] (WHAM). The resulting free energy pro?in ?gure 5.4a. Us- ing WHAM and the library construction

Stevenson, Jacob D.

2009-01-01T23:59:59.000Z

297

How much tax do we pay on a gallon of gasoline and diesel fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

298

Does EIA publish off-road diesel fuel prices? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

299

Laser Plasma Particle Accelerators: Large Fields for Smaller Facility Sources  

E-Print Network (OSTI)

Scientific Comput- ing (NERSC) Center Analytics Team, usingsimulations on Seaborg at NERSC, made possible by an INCITEand ongoing work on Franklin at NERSC and Atlas at Lawrence

Geddes, Cameron G.R.

2010-01-01T23:59:59.000Z

300

What do you prefer? Using Preferences to Enhance Learning Technology  

E-Print Network (OSTI)

-based courses to self-organized home-based learning mak- ing use of on-line material. These courses might target

Olmedilla, Daniel

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Basing Transport Planning on Principles of Social Justice  

E-Print Network (OSTI)

M. Frost, et al. (2000). Transport and Social Exclusion inG. Willumsen. (1994). Modelling Transport. Chichester: JohnG. Willumsen. (2001). Modelling Transport. Chichester: John

Martens, Karel

2006-01-01T23:59:59.000Z

302

A GENETIC ALGORITHM FOR THE WEIGHT SETTING PROBLEM ...  

E-Print Network (OSTI)

Oct 9, 2001 ... versity of Michigan, 1971. [16] Internet Engineering Task Force. Ospf version 2. Technical Report RFC 1583, Network Work- ing Group, 1994.

303

GROWTH OF PACIFIC SAUR~ COWLABlS SAlRA, IN THE NORTHEASTERN AND NORTHWESTERN PACIFIC OCEANI  

E-Print Network (OSTI)

on the embryonic development of killifish rpnnl"t.p.1i hv Arm"trona "nli r.h;]n il QAI'\\ {)h".,.r,,_ ing

304

Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

305

MOST Multiple Objective Spanning Trees Repository Project  

E-Print Network (OSTI)

VLSI layout, electricity, water, telecommunication or traffic networks. (Sack and ... a set of trade-off compromises between all concurring weights, result- ing in a...

306

Vehicle use varies across U.S. regions - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Reliance on vehicles can vary significantly across the United States.

307

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, ...

308

Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, 1949-2010:

309

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... flexible fuel vehicles October 10, 2013 New-vehicle fuel economy continues to increase.

310

Essays on Foreign Direct Investment, Growth and the Environment  

E-Print Network (OSTI)

high levels of capital intensity. The principal limitationof labor at current capital intensity using the base-periodlabor at base-period capital intensity us- ing the current

Gu, Waner

2011-01-01T23:59:59.000Z

311

Energy Star Building Upgrade Manual Introduction Chapter 1  

NLE Websites -- All DOE Office Websites (Extended Search)

offer- ings. The label now covers new homes, commercial and institutional buildings, residential heating and cooling equipment, major appliances, office equipment, lighting,...

312

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

313

Legal Metrology Devices Program  

Science Conference Proceedings (OSTI)

... such as retail motor-fuel dispensers or gas pumps, vehicle mounted meters for delivering home heating oil, and liquefied petroleum gas liquid-ing ...

2013-07-31T23:59:59.000Z

314

Planning Water Use in California  

E-Print Network (OSTI)

the University of Maryland Water Policy Collaborative, 2006.FURTH ER READ ING California Department of Water Resources.California Water Plan Update 2005: A Framework for Action.

Eisenstein, William; Kondolf, G. Mathias

2008-01-01T23:59:59.000Z

315

Using seafloor geodesy to monitor volcanic collapse on the south flank of Kilauea Volcano, Hawaii  

E-Print Network (OSTI)

accommodat- ing subsidence in the summit caldera (Lipman etshow the amount of subsidence (in meters) measured theremagnitude seaward slip and subsidence on the south ?ank as

Phillips, Kathleen A.

2006-01-01T23:59:59.000Z

316

Domestic Violence and Risk Factors among Korean Immigrant ...  

Science Conference Proceedings (OSTI)

Mar 23, 2007 ... ing laundry (Wife), driving the car (Husband), shopping for groceries (Wife), paying bills (Both), taking care of the chil- dren (Wife), disciplining...

317

Review of Literature Related to Residential Ventilation Requirements  

E-Print Network (OSTI)

Refrigerating, and Air -Conditioning Engineers, Atlanta, GRefrigerat ing, and Air-Conditioning Engineers, Atlanta, Gof Ventilation and Air Conditioning: Is C E R N up to Date

McWilliams, Jennifer; Sherman, Max

2005-01-01T23:59:59.000Z

318

China consumes nearly as much coal as the rest of the world ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

319

Ohio - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... Ohio Energy Resources Division;

320

X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

evacuations. Following the storm-related interruptions to production, refin- xii Energy Information AdministrationPetroleum Marketing Annual 2002 ing, and delivery...

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Blanchard Cr JohnsonGulch  

E-Print Network (OSTI)

Whale Cr Tepee Cr Thoma Cr KintlaCr Logg ing Cr Anaconda Cr Bo wmanCr Kintla Cr Cam a s Cr A naco nda

322

Next generation solutions for the energy services industry  

E-Print Network (OSTI)

to target cost-effective energy efficiency upgrades. and analyze energy efficiency cost and performance data canEnergy Efficiency Services to Large Commercial Firms: Operat- ing Cost

Kumar, Satish; Kromer, Steve

2006-01-01T23:59:59.000Z

323

South Carolina - State Energy Profile Analysis - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

324

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

325

U.S. States - Maps - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

326

Georgia - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

327

Rhode Island - State Energy Profile Overview - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

328

United States - Rankings - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

329

Delaware - Compare - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

330

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

331

Statistical Analysis of Dross Data for Hydro Aluminium Casthouses  

Science Conference Proceedings (OSTI)

Presentation Title, Statistical Analysis of Dross Data for Hydro Aluminium Casthouses. Author(s), Christian Rosenkilde, Inge Johansen, Amanda Bowles. On-Site...

332

Land Use Planning to Promote Marine Conservation of Coral reef Ecosystems in Moorea, French Polynesia  

E-Print Network (OSTI)

material, creat- ing rich compost that can be used forcrops. Manage Solids Compost: Pig waste and carcasses can bematerials such as mats. Compost Solid waste from the solid

Timothy Duane

2006-01-01T23:59:59.000Z

333

The Cultivar newsletter, Spring/Summer 2005  

E-Print Network (OSTI)

to disease; and incorporating compost to enhance biologicalways to adjust fertilizer and compost levels and applicationSUMMER 2005 ing pre-plant compost applications, especially

Brown, Martha

2005-01-01T23:59:59.000Z

334

The Riemann Hypothesis Peter Borwein - CECM  

E-Print Network (OSTI)

The distribution of such prime numbers among all natural numbers does ... ing the distribution of prime numbers. ... inent mathematician of his generation, raised .

335

The Influence of VIM Crucible Composition, Vacuum Arc Remelting ...  

Science Conference Proceedings (OSTI)

ing a weight of 23 kilograms. (50 pounds). The as-cast ingot surface was maintained on all ingots. VIM Ingot Cleanliness. Evaluation. The cleanliness evaluation.

336

Research Article A Comprehensive Evaluation of Indoor ...  

Science Conference Proceedings (OSTI)

... fixed-length sliding window originat- ing at the beginning of the impulse response ... ments with range below 10 m to protect it from over- load and also ...

2007-12-10T23:59:59.000Z

337

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

338

Highlights Year in Review - 2004 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Highlights Year in Review - 2004 International crude oil prices rose considerably dur-ing 2004. While many issues contributed to higher prices, perhaps the most ...

339

Meso-machining  

NLE Websites -- All DOE Office Websites (Extended Search)

following meso-machin- ing technologies: * Focused ion beam (FIB) machining, * Micro-milling and -turning, * Femto-second laser machining * Micro-Electro Discharge Machining...

340

View / Download  

Science Conference Proceedings (OSTI)

director of the Quad Cities Manufac- turing Laboratory, a nonprofit research and development company in the Rock. Island ArsenalJoint Manufactur- ing and...

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

View / Download - TMS  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames ...

342

CONTROL OF POPULATION DENSITIES SURROUNDING NUCLEAR POWER PLANTS. VOLUME 5 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

Commission. Office of Nuclear Reactor Licens- ing. StandardCommission. Office of Nuclear Reactor Regula- tion.Nuclear Regulatory Commission Standard Review Plan for Light Water Reactor

Nero, jA.V.

2010-01-01T23:59:59.000Z

343

Advanced Modeling and Evaluation of the Response of Base-Isolated Nuclear Facility Structures to Vertical Earthquake Excitation  

E-Print Network (OSTI)

II Offshore Platforms. environmentalprotection.com.retrofit of Chirag 1 offshore platform, Proceed- ings, Int.have been used for offshore oil platforms including the

Keldrauk, Eric Scott

2012-01-01T23:59:59.000Z

344

Evince Technology | Open Energy Information  

Open Energy Info (EERE)

Evince Technology Jump to: navigation, search Name Evince Technology Place United Kingdom Sector Efficiency, Wind energy Product String representation "Evince has pion ... ing...

345

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

346

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

347

Berkeley Lab Computing Sciences: Accelerating Scientific Discovery  

E-Print Network (OSTI)

facilities NERSC and ESnet and by conduct- ing appliedCOMPUTATIONAL SCIENCE ESnet is a reliable, high- bandwidthdevelopment. NERSC and ESnet staff participate in advanced

Hules, John A

2009-01-01T23:59:59.000Z

348

Quinine, an old anti-malarial drug in a modern world: role in the treatment of malaria  

E-Print Network (OSTI)

versus quinine-doxycycline in the Western Amazon region ofof quinine plus doxycycline, tetracycline or clindamycin astreated with quinine+doxycycline [46]. Consider- ing the

2011-01-01T23:59:59.000Z

349

Application of a simple and sensitive GCMS method for ...  

Science Conference Proceedings (OSTI)

ing with isopropanol, deionized water, and isopropanol, dried at room ... several months after the last intake, because they enter the hair roots from the...

350

Meshless Deformable Models for LV Motion Analysis Xiaoxu Wang Dimitis Metaxas  

E-Print Network (OSTI)

-Assisted Intervention, pages 469­476, 2007. 6 [3] T. Chen, S. Chung, and L. Axel. Automated tag tracking us- ing gabor

351

Physical Similitude in Hierarchical Engineered Systems  

E-Print Network (OSTI)

scal- ing methodology for severe accident technical issuein the case of severe accidents, bismuth alloys have beenexperiments investigating severe accident phenomenology are

Blandford, Edward David

2010-01-01T23:59:59.000Z

352

1471-2164-10-34.fm  

NLE Websites -- All DOE Office Websites (Extended Search)

of Z. mobilis for bio-ethanol fermentation from the lignocellulosic res- idues such as corn stover 9. Z. mobilis ferments glucose, fructose, and sucrose produc- ing ethanol...

353

Can feedstock production for biofuels be sustainable in California?  

E-Print Network (OSTI)

gallons annually of corn ethanol, 1 bil- lion gallons oflocations) and corn for ethanol, and oil palm, soybean andinvestment in corn-grain-based ethanol manufactur- ing in

Kaffka, Stephen R.

2009-01-01T23:59:59.000Z

354

High-rate chemical vapor deposition of nanocrystalline silicon carbide films by radio frequency thermal plasma  

E-Print Network (OSTI)

by liquid spray injection of disilanes into an argon­hydrogen RF plasma operat- ing at 20­40 kPa [4]. Here

Zachariah, Michael R.

355

RADIOLOGICAL HEALTH AND RELATED STANDARDS FOR NUCLEAR POWER PLANTS. VOLUME 2 OF HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

On the ather hand, ather radionuclides, such as I and Sr,The remain- ing radionuclides cantributed much less to thedoses Important radionuclides for background exposures and

Nero, A.V.

2010-01-01T23:59:59.000Z

356

Section 9.7 Employee Incentive Programs: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Management Awards are presented by DOE in conjunction with the Federal Interagency Energy Policy Committee (the "656" Committee). The program recognizes outstand- ing...

357

Coal - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Electric power sector consumption of coal by census region, 2010

358

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network (OSTI)

of iron de?ciency on photosynthesis Aimee M. Terauchi rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

359

DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

are potential raw materials for production of biofuels. TheRaw plant material, or dedicated bioenergy crops, can provide the starting point for mak- ing biofuels.

Gilbert, David

2009-01-01T23:59:59.000Z

360

STATEMENT OF CONSIDERATIONS CLASS WAIVER OF U.S. AND FOREIGN...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

model ing and simulation. This approach will harness the power of systems biology to overcome bioma ss recalcitrance. The BESC currently has eighteen members...

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Synthesis of D-Glucose-1-C14 and D-Mannose-1-C14  

Science Conference Proceedings (OSTI)

... The product weighed 470 mg, rep- resenting a ... ing formation of esters, condensation products, and the ... The alco- holic liquors were neutralized with ...

2006-03-29T23:59:59.000Z

362

Distributed Energy Harvesting for Energy Neutral Sensor Networks  

E-Print Network (OSTI)

to exploit to develop piezoelectric energy harvesters. Manyenergy. Current piezoelectric energy harvest- ing researchwill improve piezoelectric energy harvesting technologys

Kansal, Aman; Srivastava, Mani B.

2005-01-01T23:59:59.000Z

363

Quantifying Changes in Building Electricity Use, with Application to Demand Response  

E-Print Network (OSTI)

build- ings, Journal of Solar Energy Engineering, vol. 120,buildings, Journal of Solar Energy Engineering, vol. 120,modeling, Journal of Solar Energy Engineering, vol. 120, p.

Mathieu, Johanna L.

2012-01-01T23:59:59.000Z

364

The TREC-2001 Video Track Report  

Science Conference Proceedings (OSTI)

... Marchionini, 2001), the NIST Digital Video Library (Over, 2001 ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

365

The TREC-2002 Video Track Report  

Science Conference Proceedings (OSTI)

... on Project RDD/G/235 to the British Library Research and ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

366

Blueberry research launches exciting new California specialty crop  

E-Print Network (OSTI)

2. Estimated highbush blueberry crop, 2004 State Growers whoin spearhead- ing specialty crops research and efforts tonew California specialty crop Manuel Jimenez Francis

Jimenez, Manuel; Carpenter, Francis; Molinar, Richard H.; Wright, Kathryn; Day, Kevin R.

2005-01-01T23:59:59.000Z

367

A Statistical Profile of Horticultural Crop Farm Industries in California  

E-Print Network (OSTI)

Profile of Horticultural Crop Farm Industries in Californiaproject funded by the Federal Crop Insurance Corporation,Williams. Model- ing Farm-Level Crop Insurance Demand with

Lee, Hyunok; Blank, Steven C.

2004-01-01T23:59:59.000Z

368

License Application Guidelines  

6. A review of the competition currently existing or expected to develop follow-ing introduction of the product. 7. A comparison of this product to ...

369

Instructions for use Phenomenology of supersymmetry SU5 GUT with neutrinophilic Higgs boson  

E-Print Network (OSTI)

of the primary goals of LHC is the search for the Higgs boson, the last miss- ing ingredient of the Standard

Tsunogai, Urumu

370

timeline_PNNL_PRINT.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

1997 PNNL developed a highly sensitive sampleranalyzer that can be used to prevent proliferation of nuclear weapons by remotely detect- ing trace quantities of materials...

371

BFRL98Annual Cvrs 1-4  

Science Conference Proceedings (OSTI)

... In addition to the programs of the individual ... of roof solar reflectance on the annual heat- ing ... BFRL's Thermal Analysis Research Program (TARP) for ...

2000-03-16T23:59:59.000Z

372

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

373

Technology Transfer Division - Los Alamos National Lab: National ...  

administer commercial, noncommercial, ... As one of the U.S. Department of Energys multiprogram, ... ing 47 technical areas with 8 million square feet under roof.

374

Monitoring Power Quality  

Science Conference Proceedings (OSTI)

... or without filter), isola- tion transformer, voltage regulator ... reality before expensive line condition- ing equipment is ... if any line conditioning is required. ...

2013-05-17T23:59:59.000Z

375

southeastern geographer, 44(1) 2004: pp. 814 Rethinking the Region  

E-Print Network (OSTI)

-runners, allow- ing for the sale of cotton to European mar- kets and the purchase of all-important guns and steel

Gamble, Douglas W.

376

48 CRO MAR/APR 2008 Climate Change  

E-Print Network (OSTI)

regulations that limit tobacco sales and public smoking. Similarly,therewillbenoscientificsmok- ing gun Companies looking for smoking gun should skip the science,looktotheeco

Hoffman, Andrew J.

377

Petroleum & Other Liquids - Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Projects published on Beta are not final and may not include up-to-date data.

378

Modeling and Reasoning about Everyday Events Dustin Arthur Smith  

E-Print Network (OSTI)

that is inexpensive (and what price is "expensive"?).For example, the way one travels to an event (e.g., taxi, foot already filled in, or searching for alternative restaurants in the expected neigh- borhood and price range- ing context aware assistance, us- ing information from the calen- dar program and the cellphone (e

379

Port Lions, Alaska 26 January 2006  

E-Print Network (OSTI)

to the benefits it produces, when you consider that high school and college baseball is played during the time- ing the season. Maintain Pitcher's Mound and Home Plate A few minutes each day repairing the pitcher's mound and home plate area keeps them in good play- ing condition. Sweep the mound with a stiff broom

US Army Corps of Engineers

380

Annual Report of ADVANCE Program for University of Wisconsin-Madison  

E-Print Network (OSTI)

in Natural Language Process- ing, pages 620­627, Vancouver, British Columbia, Canada, October. Gabriele of the Ninth International Workshop on Pars- ing Technology, pages 83­92, Vancouver, British Columbia, October of syntactic and semantic representations is a viable alter- native to approaches based on a pipeline of local

Sheridan, Jennifer

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Kansas Board of Regents Mandatory Retirement Plan Enrollment Information  

E-Print Network (OSTI)

Plan Providers: ING and TIAA-CREF. For additional information about the Plan, see the KU HR website://www.ingretirementplans.com/custom/KansasBOREnrollmentServices/. For additional ING information, visit http://www6.ingretirementplans.com/SponsorExtranet/KansasBOR/. TIAA-CREF: To enroll and to find fund lineup information, see the TIAA-CREF microsite http://www.tiaa

Peterson, Blake R.

382

A Novel Process for Demulsification of Water-in-Crude Oil Emulsions by Dense Carbon Dioxide  

E-Print Network (OSTI)

using a wide variety of equipments such as centrifuges, rotary vacuum filters, belt presses, and filter concentrations behave as a liquid, with Newtonian flow characteristics. Centrifugal dewater- ing is possible obtained, which was considered acceptable since a dry- ing system followed centrifugation. Pressure filters

Kilpatrick, Peter K.

383

REcuRsiVE TRust-REGion MEthoDs FoR MuLtiLEVEL NonLinEAR ...  

E-Print Network (OSTI)

Aug 11, 2004 ... the minimie ing se& uence at level6s 1.`r f%n&s 1b&t belongs to this minimie ing se uence,Hg e use the notation n55 Pt...

384

Pour diffusion immdiate En pleine refonte du rgime forestier,  

E-Print Network (OSTI)

en 2010 pour répondre aux nouveaux défis Robert Beauregard, doyen de la Faculté de foresterie, de donner des entrevues. Porte-parole Fonctions Sujets Robert Beauregard, ing., ing.f, Ph.D. Doyen de la

Laval, Université

385

Biannual Report Department of Mathematics  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Kohlenbach, Ulrich

386

Abrahamse, W., L. Steg, et al. (2005). "A review of intervention studies aimed at household energy conservation." Journal of Environmental Psychology 25(3): 273-291.  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

387

(S11lSC) sruals,(5lueure8euey4les?qete6l's:olndruoc leuosred Jo uoqcnportur eqt reu? perylldurs  

E-Print Network (OSTI)

of Tsunami Deposits . . . . . . . . . . . . . . . 17 3.5 Search Methods Research (NCTR) was established to conduct re- search and development in support of the NOAA mission was a result of search- ing the tsunami runup database by state with no other conditions and divid- ing

Hack, Robert

388

Note: Does The Graphemic Buffer Play A Role In Reading?  

E-Print Network (OSTI)

this paper, we investigate the read ing performance of a patient previously reported as hav ing an impairment at the level of the graphem ic buffer (Kay & Hanley , 1994). Desp ite his spelling problems, this patient is good at read ing fam iliar words, at reading nonwords, and at written lexical decision. This pattern of performance is d iscussed w ith respect to Caramazza, Capasso, and Miceli's (1996) recent claim that damage to the graphem ic buffer leads to a problem in reading that w ill be obvious especially when the patient is asked to read nonwords

J. Richard Hanley; Janice Kay

1998-01-01T23:59:59.000Z

389

Statistical Inference for Big Data Problems in Molecular Biophysics  

SciTech Connect

We highlight the role of statistical inference techniques in providing biological insights from analyzing long time-scale molecular simulation data. Technologi- cal and algorithmic improvements in computation have brought molecular simu- lations to the forefront of techniques applied to investigating the basis of living systems. While these longer simulations, increasingly complex reaching petabyte scales presently, promise a detailed view into microscopic behavior, teasing out the important information has now become a true challenge on its own. Mining this data for important patterns is critical to automating therapeutic intervention discovery, improving protein design, and fundamentally understanding the mech- anistic basis of cellular homeostasis.

Ramanathan, Arvind [ORNL; Savol, Andrej [University of Pittsburgh School of Medicine, Pittsburgh PA; Burger, Virginia [University of Pittsburgh School of Medicine, Pittsburgh PA; Quinn, Shannon [University of Pittsburgh School of Medicine, Pittsburgh PA; Agarwal, Pratul K [ORNL; Chennubhotla, Chakra [University of Pittsburgh School of Medicine, Pittsburgh PA

2012-01-01T23:59:59.000Z

390

BWXTymes, A newsletter for the employees and friends of the Y...  

NLE Websites -- All DOE Office Websites (Extended Search)

cameras and sniper detection, Y-12 is forc- ing adversaries to abandon use of armored vehicles or face engagement before they are ready. Thus, offi cers are able to...

391

Role of Surface Proteins in the Deposition Kinetics of Cryptosporidium parvum Oocysts  

E-Print Network (OSTI)

strengths where DLVO theory predicts the absence of an electrostatic energy barrier. An "electrosteric.Additionally,treatmentofsurface watersbynaturalfiltrationthroughalluvialvalleyaquifer sedimentssa process known as bank filtrationsis emerg- ing as a feasible method for the removal

Elimelech, Menachem

392

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

jpg Electric light ing comprises 515,000,000 MWh or 20% of the nation's electricity consumption. Of this total, approximately 10-15% is used to light a building's perimeter zone...

393

Section 7.1.3 Wood Products: Greening Federal Facilities; Second...  

NLE Websites -- All DOE Office Websites (Extended Search)

wood is being used in a building, there is an opportunity to advance good forest management by specifying certified wood products. When wood is be- ing used for framing-more...

394

Member News August 2012_8S.indd  

Science Conference Proceedings (OSTI)

dering GPS system that has directed them into more than a few tight spots. But for Belt, this ... ing gas money. The Belts plan to eventually settle on a permanent...

395

Lab Tests Demonstrate Effectiveness of Advanced Power Strips...  

NLE Websites -- All DOE Office Websites (Extended Search)

choose the right one for their plug loads. Many consumer electronics devices waste energy even after they are turned off via "vampire" loads, mean- ing they continue to draw...

396

How to Start Your Own Business  

enough money to get going. In this ar-ticle, the sixth in our Business Engineer-ing series, Ill try to answer some of your questions about raising money for

397

FACT: A Framework for the Application of Throughput and Power Optimizing Transformations to Control-flow Intensive Behavioral Descriptions  

E-Print Network (OSTI)

Inthispaper,wepresentanalgorithmfortheapplicationofa generalclassoftransformationstocontrol-flowintensivebehavioraldescriptions. Ouralgorithmisbasedontheobservationthat incorporationofschedulinginformationcanhelpguidetheselectionandapplicationofcandidatetransformations, andsignificantly enhancethequalityofthesynthesizedsolution.Theefficacyofthe selectedthroughputandpoweroptimizingtransformationsisenhancedbytheabilityofouralgorithmtotranscendbasicblocksin thebehavioraldescription.Thisabilityisimpartedtoouralgorithm byageneraltechniquewehavedevised.Oursystemcurrentlysupportsassociativity, commutativity,distributivity,constantpropagation, codemotion,andloopunrolling.Itisintegratedwithaschedulerwhichperformsimplicitloopunrollingandfunctionalpipelin - ing,andhastheabilitytoparallelizetheexecutionofindependent iterativeconstructswhosebodiescanshareresources.Othertransformationscaneasilybeincorporatedwithintheframework. We demonstratetheefficacyofouralgorithmbyapplyingittoseveral commonlyavai...

Ganesh Lakshminarayana; Niraj K. Jha; Ganeshlakshminarayana Andnirajk Jha

1998-01-01T23:59:59.000Z

398

A 6.4 TESLA DIPOLE MAGNET FOR THE SSC  

E-Print Network (OSTI)

Engineering, Volume 31 A 6.4 TESLA DIPOLE MAGNET FOR THE SSCR. SCANLAN SSC-MAG A 6.4 TESLA DIPOLE MAGiET FOR THE SSC* C.increa.ing up to . 28 tesla . - The resultins systematic

Taylor, C.E.

2010-01-01T23:59:59.000Z

399

System level design of power distribution network for mobile computing platforms  

E-Print Network (OSTI)

to meet the system voltage noise requirements. Introductiondifferent voltage level specs due to V cc min requirement ofvoltage and frequency scaling (DVFS), Dynamic Power Gat- ing (DPM), and area/performance requirements

Shayan Arani, Amirali

2011-01-01T23:59:59.000Z

400

scripps institution of oceanography, university of california, san diego Cecil H. & Ida M. Green Institute of Geophysics & Planetary Physics  

E-Print Network (OSTI)

- ing Philippine Sea Experiment Over the past year I have been partipating in an ocean acoustic in the Philippine Sea starting in 2009 and ending in 2011. This location is in a chal- lenging and dynamic part

Constable, Steve

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

1. executive committee bylaws  

Science Conference Proceedings (OSTI)

teer requests uthorized. and execute nonvoting, all ng). Technical Div ng and organ recommenda ficant action in ors. m time-to-tim ing non-inclu nd the procedu.

402

Parimutuel Betting on Permutations  

E-Print Network (OSTI)

||?g(Y )||2 ? ng(Y ) ?. ? n||?g(Y )||2. Proof. See the appendix. Now, we can obtain an approximate separat- ing oracle for the ellipsoid method. Lemma 5.6.

403

231.ps  

E-Print Network (OSTI)

Vn := f1;:::;ng, En := fij j 1 ing, and dn := jEnj = n. 2 . Let Sn denote the. set of n n symmetric matrices. For X 2Sn, X 0 means that X is positive semide nite.

404

Released: June 2006  

U.S. Energy Information Administration (EIA) Indexed Site

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" 2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" ,"Number of Buildings (thousand)",,,,,"Total Floorspace (million square feet)" ,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment",,,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment" ,,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems",,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems" "All Buildings* ...............",4645,3472,2513,785,175,64783,56478,34671,11540,10267

405

Doing Well by Doing Good? Green Office Buildings  

E-Print Network (OSTI)

we obtained the data on energy usage reported to theWe also discuss the energy usage data made available to usengineer- ing studies of energy usage. There seems to be a

Eichholtz, Piet; Kok, Nils; Quigley, John M.

2009-01-01T23:59:59.000Z

406

ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978  

E-Print Network (OSTI)

Characteristics of Medieval Brasses H. V. Michel, F. Asaro,and the tarnish- ing of brass fixtures and silver. In vapor-Characteristics of Medieval Brasses* H. V. Michel, F. Asaro

Cairns, E.L.

2011-01-01T23:59:59.000Z

407

Computational Aesthetics in Graphics, Visualization and Imaging (2005) L. Neumann, M. Sbert, B. Gooch, W. Purgathofer (Editors)  

E-Print Network (OSTI)

finishes. The software makes use of a reflection model for car paint that is based on industry standards- ture, the glaze of a ceramic vase, or the color of an oil paint- ing are all important aesthetic

Meyer, Gary

408

285.ps  

E-Print Network (OSTI)

Feb 23, 2001 ... ing strategy makes extensive use of dual information associated ...... The total potential energy, expressed in terms of the coe cients of the approximating ...... population and have di erential costs of production and marketing.

409

Sample Size Calculation for Method Validation Using Linear Regression  

E-Print Network (OSTI)

, J. L. O. Miranda Departament of Statistics, Federal University of Minas Gerais, 31270-901 - Belo. Compared to a traditional method and us- ing Monte Carlo simulations, encouraging results attest

Cruz, Frederico

410

References - Energy Information Administration  

U.S. Energy Information Administration (EIA)

References 1.En ergy In for ma tion Ad min istra tion. Natu ral Gas Pro - duc tive Ca pac ity for the Lower 48 States 1980 through 1991 . DOE/EIA- 0542 (Wash ing ton ...

411

Baseline information development for energy smart schools -- applied research, field testing and technology integration  

E-Print Network (OSTI)

swimm ing pools and climate zones. Th e major findings aresound statements. The way the climate zones are divided waswhich aggregated CEC 16 climate zones into four regions by

Xu, Tengfang; Piette, Mary Ann

2004-01-01T23:59:59.000Z

412

330.ps.Z - Optimization Online  

E-Print Network (OSTI)

May 24, 2001 ... tion of ow through a pipe is modeled by a disjunction. ...... ing, S.T., Klepeis, J.L., Meyer, C.A. and Schweiger, C.A. Handbook of Test Problems.

413

M I C R O D E S I G N R E S O U R C E S J A N U A R Y 2 6 , 1 9 9 8 M I C R O P R O C E S S O R R E P O R T by Peter Song  

E-Print Network (OSTI)

units and registers, greatly simplify- ing hardware without unduly degrading the processor's throughput the effective address as a result, reducing the overhead of hoisting speculative loads above earlier stores

Skadron, Kevin

414

Enhancing the Teaching of Statistics: Portfolio Theory, an Application of Statistics in Finance  

E-Print Network (OSTI)

obtained for the stocks IBM, EXXON-MOBIL, and BOE- ING (theyClosing prices of IBM, Exxon-Mobil, Boeing, January 2000 -December 2005. IBM EXXON-MOBIIL BOEING Mean Q 1 Median Q 3

Nicolas Christou

2011-01-01T23:59:59.000Z

415

Enhancing the Teaching of Statistics: Portfolio Theory, an Application of Statistics in Finance  

E-Print Network (OSTI)

obtained for the stocks IBM, EXXON-MOBIL, and BOE- ING (theyClosing prices of IBM, Exxon-Mobil, Boeing, January 2000 -December 2005. IBM EXXON-MOBIIL BOEING Mean Q 1 Median Q 3

Christou, Nicolas

2007-01-01T23:59:59.000Z

416

AN EXPERTISE BASED ENERGY INFORMATION SYSTEM  

E-Print Network (OSTI)

overseas supplier of crude oil decreases supplies to the U,supplies of gas and heating oil are sufficient. Ignoring forsimple no tic~ ing. A model of oil flow in the United States

Rosenberg, S.

2013-01-01T23:59:59.000Z

417

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ing-grid-getting-more-out-america-s-energy-0 Article EM Occupational Injury and Illness Rates Continued to Decline in Fiscal Year 2011 WASHINGTON, D.C. - The EM Office of Safety...

418

THERMAL ENERGY STORAGE IN AQUIFERS WORKSHOP  

E-Print Network (OSTI)

government in their regulation of natural gas prices. ThatRegulation of energy sup- ply activites, chiefly electric and natural gasregulation requ1red householders to give up burn- ing coal in favor of natural gas

Authors, Various

2011-01-01T23:59:59.000Z

419

fall2009_web.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

structures. Dur- ing this portion of the project, ESRI's 3-D Technical Services Group web conferenced into a few classes to provide training and support in the art of 3-D...

420

5.2 e-Facilitating networking in distance co-operation ... - Springer  

Science Conference Proceedings (OSTI)

sophisticated systems based on the theory of the six degrees of separation, whose main concept is .... ing process the initial design and appropriate set-up of the virtual learning .... how instructional activities (if there are any) are sequenced

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

TIME SERIES MODELING  

Science Conference Proceedings (OSTI)

does involve some knowledge of hydrodynamics (especially when decid- ing the formula for ... 109120. Munk, W.H., and Cartwright, D.E., 1966. Tidal spectroscopy and pre- diction. ..... Principles of Forecasting: A Handbook for. Researchers...

422

Faculty of Fine, Applied and Performing Arts Annual Report 2012  

E-Print Network (OSTI)

(Jeppson 1976). A method of finding an approximat- 7 #12;ing function by converting to logarithmic compared to the Colebrook and White equation (Jeppson 1976), the maximum error of this approximation is 6

Harding, Karin

423

The landscape of RNA polymerase II transcription initiation in C. elegans reveals a novel enhancer architecture  

E-Print Network (OSTI)

- gated. We characterized the global landscape of RNA Pol II transcription initiation, identifying 73,500 distinct clus- ters of initiation, many of which are bidirectional. We assign transcription initiation sites to 7691 protein-cod- ing genes and find...

Chen, Ron; Down, Thomas; Ahringer, Julie

2013-03-18T23:59:59.000Z

424

Network coding for function computation  

E-Print Network (OSTI)

K. Zeger. Unachievability of Network Cod- ing Capacity. IEEEto target function f is C cod (N , f ) = sup k : ? (k, n)target function f , then C cod (N , f ) ? min-cut(N , f ).

Appuswamy, Rathinakumar

2011-01-01T23:59:59.000Z

425

EPRI Journal: Summer 2007  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

operation because of its inability to withdraw a suffi- cient amount of water to meet its thermal discharge permit. According to John Maulbetsch, a cool- ing systems expert and...

426

2012 Immediate Science Ecology 1 7 Immediate Science Ecology 1: 711, 2012  

E-Print Network (OSTI)

regime where the frog occurs can result in breeding site desiccation during the long dry summer, solar radiation pro- duced mid-day shallow-water temperatures approach- ing 30°C. These preliminary data

427

Proceedings of ACL-08: HLT, pages 335343, Columbus, Ohio, USA, June 2008. c 2008 Association for Computational Linguistics  

E-Print Network (OSTI)

: · (crude oil) prices ­ left-branching · world (oil prices) ­ right-branching Lauer (1995) presents two. We then run a number of parsing experiments us- ing our new version of the CCGbank corpus

428

Tools for transparent synchronous collaborative environments  

Science Conference Proceedings (OSTI)

Nov 30, 2006 ... server checks if the client is a latecomer for this application. ...... However, other participants think that they need technical support for not only training but .... He received the Ing. Dipl. degree in Electrical Engineering from.

429

Northwest National Laboratory's Chemical Imaging Initiative is...  

NLE Websites -- All DOE Office Websites (Extended Search)

generated. CHEMICAL IMAgINg Main particle Pt (110) Pt (111) Pt (pores) g-Al 2 O 3 pores gamma-alumina particles contain pores and have a corrugated surface according to a chemical...

430

On the Mean Iteration - CECM  

E-Print Network (OSTI)

These logarithmic asymptotes also lead to two very clean quadratically converg- ing product expansions: (N = 3) let. 1~~~~~~~~~~~~~~~ zo := 9 and x. L [1 + V/(...

431

INFORMATIKK Nr. 08 15 mai 2009  

E-Print Network (OSTI)

(datasikkerhet, II-råd, MN-styre, UiB-styre) Vacation, technical support, office hours Utlysning av u.stip/ medarbeidere i nye roller Anne-Kristin Stavrum, stip. bioinformatikk Svein Harald Soleim, avd. ing

Fomin, Fedor V.

432

Quaero at TRECVID 2011: Semantic Indexing and Multimedi Event Detection (draft)  

E-Print Network (OSTI)

of interest points descriptors (SIFT, color SIFT, SURF, STIP), local edge patterns, saliency moments, percepts information. We will also integrate to the actual system other interest- ing descriptors like STIP

433

Companies plugged in: A study of the motivations of companies to introduce electric vehicles in their organisation:.  

E-Print Network (OSTI)

??Electric driving is currently a hot item in the Netherlands. Yet, it is surrounded by uncertainty result-ing in companies adopting a wait-and-see attitude regarding the (more)

Verouden, C.T.A.F.

2013-01-01T23:59:59.000Z

434

Endowed Chairs and Professorships Academic Village Undergraduate Scholarships Graduate Fellowships  

E-Print Network (OSTI)

Saturdays dur- ing the fall semester. Funding from Xcel Energy Foundation enables the University to offer Controls Group Xcel Energy Xilinx, Inc. Gifts on Behalf Ayres Associates Inc. Binder & Associates

435

Moisture Control in Insulated Raised Floor Systems in Southern Louisiana  

E-Print Network (OSTI)

polyisocyanurate foam, open-cell sprayed polyurethane foams of vary- ing vapor permeance, closed-cell sprayed in guidance for insulating raised floors in the hot and humid climate of the Gulf Houses with pier foundations

436

Introduction Epidemiology - Springer  

Science Conference Proceedings (OSTI)

are trauma victims, and early care does not deviate from Advanced Trauma. Life Support ... ing safety procedures. The type of ... This is a progressive process and the ..... All patients should be transferred with appropriately trained escort staff.

437

INFRASTRUCTURE PRELIMINARIES  

E-Print Network (OSTI)

, 300 rpm), centrifuged (2,000?g, 5 min), and supernatants collected and frozen. Differences from a rotating biological contactor treat- ing ammonium-rich leachate. Arch Microbiol 175: 198­207 8

438

An Evaluation of the Market Potential for Transit-Oriented Development Using Visual Simulation Techniques  

E-Print Network (OSTI)

to support frequent rail services. Research findings byresearch methodology itself as well as the general conceptof promoting denser housingdevelopment railresearch suggeststhere is aa untapped marketpotential for moderately dense hous- ing projects near rail

Cervero, Robert; Bosselmann, Peter

1994-01-01T23:59:59.000Z

439

careInlorlladon Infrastructure:  

Science Conference Proceedings (OSTI)

... BrInging HeaithcG1eOnline: Th~ Rot. of infotmotIon Technologiu, OTA-rrc-624, USGovernment PrInting Office. Washington. Dc.1995.) ...

2012-11-26T23:59:59.000Z

440

Studies of the front end of a neutrino factory  

E-Print Network (OSTI)

determining the needed volt-seconds (and thus core material)decreases the accelerat- ing volt-sec needed for ? 0 ? ? Lmagnitude of the decelerating volt-sec which must be applied

Fawley, William; Penn, Gregory; Sessler, Andrew; Wurtele, Jonathan

2001-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ings-bonneville-power Page EA-0531: Proposed Natural Gas Protection Program for Naval Oil Shale Reserves Nos. 1 and 3, Garfield County, Colorado This EA evaluates the environmental...

442

Newsletter (May 2009).pub  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tive Action Request (CAR) is provided. The contractor is responsible for respond- ing in a timely and com- plete manner through its Corrective Action Plan (CAP). The Federal Pro-...

443

http://magnets.rhic.bnl.gov/Sta.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

(BNL) is build- ing a number of magnets for the insertion regions of the Large Hadron Collider (LHC). This paper presents the magnetic de- sign and the expected field...

444

Non-invasive MR imaging of inflammation in a patient with both asymptomatic carotid atheroma and an abdominal aortic aneurysm: a case report  

E-Print Network (OSTI)

- ticipated in the design of the study and edited the manuscript. ZYL helped in editing the manuscript and cre- ating the Figure. SRW was involved with manuscript edit- ing, patient care and helped perform the operation. MEG edited the manuscript...

Howarth, Simon P S; Tang, Tjun Y; Graves, Martin J; U-King-Im, Jean-Marie; Li, Zhi-Yong; Walsh, Stewart R; Gaunt, Michael E; Gillard, Jonathan H

2007-02-21T23:59:59.000Z

445

Gone with the Wind - The Potential Tragedy of the Common Wind  

E-Print Network (OSTI)

42 In fact, the price of wind energy is decreas- ing at aprice of wind en- ergy is competitive with other forms of energyother energy production technologies: 43 the price for wind

Lifshitz-Goldberg, Yaei

2010-01-01T23:59:59.000Z

446

WS WEBIN Structu AR: F ural Da FEMA amage A E-74 R s ...  

Science Conference Proceedings (OSTI)

... es are limited o view the web es so many ot f the presenta nts. A record a FEMA.gov. N: ... binar/ re, please test ing here: p/en/support/m 36 ...

2013-01-29T23:59:59.000Z

447

Linearly Scaling 3D Fragment Method for Large-Scale Electronic Structure Calculations  

E-Print Network (OSTI)

Comput- ing Facility (ALCF). R EFERENCES [1] A. Luque and A.BlueGene/P system (Intrepid) at the ALCF at Argonne NationalBlueGene/P system in the ALCF facility at Argonne National

Wang, Lin-Wang

2008-01-01T23:59:59.000Z

448

A class of DantzigWolfe type decomposition methods for variational ...  

E-Print Network (OSTI)

CEPEL, Electric Energy Research Center. On leave from INRIA ..... ing variational equilibria of game-theoretical models of electricity markets are presented in. Section 4. ...... approximations, which incorporate more information. The situation is...

449

The Role of U.S. Insurance Regulators in Responding to Climate Change  

E-Print Network (OSTI)

note 23. 25. John Brownstein, Lyme Disease: Implications ofNile Virus to ticks carry- ing Lyme Disease 25 to rodentsWNV in North America. Lyme disease is the most widespread

Mills, Evan

2008-01-01T23:59:59.000Z

450

From the Dean Leadership Changes  

E-Print Network (OSTI)

`maiz'ing potential page 4 Biomass Gas Cleanup CH2M HILL Foundation Gift Classified staff recognized Clemson is designed to create a regional knowledge-based cluster attracting high-tech, high- paying jobs. Clemson

Duchowski, Andrew T.

451

Recovery Act Funding Leads to Record Year for Transuranic Waste...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

With the help of Ameri- can Recovery and Reinvestment Act fund- ing, the Waste Isolation Pilot Plant (WIPP) received the most transuranic waste ship- ments in a single year since...

452

POWER PLANT RELIABILITY-AVAILABILITY AND STATE REGULATION. VOLUME 7 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

generate steam to drive a steam turbine, giving rise to theValves and Pi~ing STEAM TURBINE COMPONENT OUTAGE CAUSESbasically of a steam-driven turbine, an electric generator

Nero, A.V.

2010-01-01T23:59:59.000Z

453

Monitoring soil carbon will prepare growers for a carbon trading system  

E-Print Network (OSTI)

waste orchard bio- mass and compost applications: (1) 1 tonorchard waste prun- ings added with compost, (2) 3 tons ofwalnut shells added with compost and (3) cover crop and

Suddick, Emma C; Ngugi, Moffatt K; Paustian, Keith; Six, Johan

2013-01-01T23:59:59.000Z

454

A Strategy for the Abandonment of Modified In-Situ Oil Shale Retorts  

E-Print Network (OSTI)

Effects of steam on oil shale ing: a preliminary laboratoryInstitute to Rio Blanco Oil Shale Project, May 1977. 1~Cement, pozzolan and oil shale chemistry The chemistry of

Fox, J.P.; Persoff, P.; Moody, M.M.; Sisemore, C.J.

1978-01-01T23:59:59.000Z

455

PARTITIONING OF MAJOR, MINOR, AND TRACE ELEMENTS DURING SIMULATED IN SITU OIL SHALE RETORTING IN A CONTROLLED-STATE RETORT  

E-Print Network (OSTI)

or by refin- ing and using shale Oil Mass balances and oil.shale retorting produces shale oil, mobility factors wereand retort operating shale, shale oil, retorting (LETC) con-

Fox, J. P.

2011-01-01T23:59:59.000Z

456

Natural vs. mechanical ventilation and cooling.  

E-Print Network (OSTI)

cant and well-docu- mented. ASHRAE Standard 55 prescribes aless comfortable. ASHRAE Standard 55-2004 includes an adap-and standards, includ- ing ASHRAE Standard 90.1. Mechanical

Brager, Gail; Alspach, Peter; Nall, Daniel H.

2011-01-01T23:59:59.000Z

457

Experimental Mathematics - CECM  

E-Print Network (OSTI)

ing or even re-correcting them. he. "fallibilism" of mathematics is brilliantly. argued in Lakatos'x roofs an efr ta. tions. uYu. x eere are i ? erent versions of proof.

458

A Strategy for the Abandonment of Modified In-Situ Oil Shale Retorts  

E-Print Network (OSTI)

Effects of steam on oil shale ing: a preliminary laboratoryInstitute to Rio Blanco Oil Shale Project, May 1977. 1~OF MODIFIED IN-SITU OIL SHALE RETORTS J. P. Fox and P.

Fox, J.P.; Persoff, P.; Moody, M.M.; Sisemore, C.J.

1978-01-01T23:59:59.000Z

459

Quasi-experimental trial of diabetes Self-Management Automated and Real-Time Telephonic Support (SMARTSteps) in a Medicaid managed care plan: study protocol  

E-Print Network (OSTI)

recommended health services, including laboratory test- ing,Health Services Research 2012, 12:22 http://www.biomedcentral.com/1472-6963/12/22 delivery processes: proportion receiving blood pressure checks, laboratory

2012-01-01T23:59:59.000Z

460

Atmos. Chem. Phys., 7, 37713781, 2007 www.atmos-chem-phys.net/7/3771/2007/  

E-Print Network (OSTI)

of homogeneous and heterogeneous freez- ing processes, ice particle growth and fallout, and mesoscale vertical, and the initial increased (see Eq. 1). 2) As Reff decreased, fallout timescales (fallout [s]) and cloud lifetimes

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Industry  

E-Print Network (OSTI)

milling industry: An ENERGY STAR Guide for Energy and Plantcement mak- ing - An ENERGY STAR Guide for Energy and Plantre- fineries - An ENERGY STAR Guide for Energy and Plant

Bernstein, Lenny

2008-01-01T23:59:59.000Z

462

Universitt Stuttgart Auslandsorientierter Studiengang  

E-Print Network (OSTI)

. Benner for guiding and explaining the applied projects in the Ruhr basin, Prof. Dr.-Ing. Rainer Helmig Problem and Control . . . . . . . . . . . . . . . . . 3 1.4 Co-generation Power Plants

Cirpka, Olaf Arie

463

CARNEGIE MELLON UNIVERSITY Automatic Graceful Degradation  

E-Print Network (OSTI)

identifies a heretofore-unknown problem in the system syn- thesis research space and explores solution love of learning into a roar- ing fire -- or at least gave me enough fuel to make it blaze

Koopman, Philip

464

SOLAR NEUTRINOS REVIEW Revised December  

NLE Websites -- All DOE Office Websites (Extended Search)

+ + 2 e . (1) Positrons annihilate with electrons. Therefore, when consider- ing the solar thermal energy generation, a relevant expression is 4p + 2e - 4 He + 2 e + 26.73...

465

Molecular surface-free continuum model for electrodiffusion processes  

E-Print Network (OSTI)

Molecular surface-free continuum model for electrod-of introduc- ing a molecular surface and the painful task ofreaction kinet- ics, and molecular surface de?ned as an

Lu, Benzhuo; McCammon, J. Andrew

2008-01-01T23:59:59.000Z

466

Production of Ultrashort FEL XUV Pulses via a Reverse Undulator Taper  

E-Print Network (OSTI)

1 (2004); also SLAC Rpt. LCLS-TN-04-3 [13] M. Xie, Nucl.Linac Coherent Light Source (LCLS) Conceptual Design Report,ing down to 12 nm and the LCLS facility [2] pro- jected to

Fawley, William M.

2007-01-01T23:59:59.000Z

467

Calls to Action -- Seattle 2220: Our Ancestors' Planning Legacy  

E-Print Network (OSTI)

worlds remain- ing coal-fired power plants pumped out morechange. The use of coal-fired power plants worldwide willfive-hundred-megawatt coal-fired power plants. 2 The ice on

Matthews, David J.

2008-01-01T23:59:59.000Z

468

Surface Water Temperatures At Shore Stations, United States West Coast 1984  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. MonoStation Off rocks near water intake for laboratory Trinidadthat monitors the cool- ing intake water for the generators.

Scripps Institution of Oceanography

1985-01-01T23:59:59.000Z

469

Surface Water Temperatures At Shore Stations, United States West Coast 1986  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. MonoStation Off rocks near water intake for laboratory Farallnthat monitors the cool ing intake water for the generators.

Scripps Institution of Oceanography

1987-01-01T23:59:59.000Z

470

Surface Water Temperatures At Shore Stations, United States West Coast 1983  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. MonoStation Off rocks near water intake for laboratory Granitethat monitors the cool ing intake water for the generators.

Scripps Institution of Oceanography

1984-01-01T23:59:59.000Z

471

Surface Water Temperatures At Shore Stations, United States West Coast 1985  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory.Station Off rocks near water intake for laboratory Farallnthat monitors the cool ing intake water for the generators.

Scripps Institution of Oceanography

1986-01-01T23:59:59.000Z

472

Operating Experience Summary, 2011-07  

NLE Websites -- All DOE Office Websites (Extended Search)

individuals. These concerns resulted in the DOE Office of Health, Safety and Security (HSS) conduct- ing an inspection of the site-wide CBDPP. The inspection was download this...

473

Large Neighborhood Search for LNG Inventory Routing  

E-Print Network (OSTI)

Natural gas is expected to be the world's fastest growing fossil fuel with consumption increas- ing at an average rate of 1.6% per year from 2008 to 2035 [

474

LINX Test Facility at SLAC  

NLE Websites -- All DOE Office Websites (Extended Search)

LINX LINear collider X-ing Linear Collider Interaction Region Engineering Test Facility at SLAC The NLC collaboration is proposing to create the LINX test facility at SLAC to...

475

DIABETES CARE, VOLUME 24, NUMBER 1, JANUARY 2001 117 n November 1999, the National Insti-  

E-Print Network (OSTI)

differences in the macroenviron- ment. Evidence indicating the importance of the environment is seen to change the macroenvironment and thereby change eat- ing behavior and physical activity. Prior research

Meagher, Mary

476

A-1 2012 SITE ENVIRONMENTAL REPORT APPENDIX A: GLOSSARY  

E-Print Network (OSTI)

that cross contamination has not occurred. blowdown ­ Water discharged from either a boiler or cool- ing procedure SPCC Spill Prevention Control and Countermeasures SPDES* State Pollutant Discharge Elimination Compliance Assurance Process TCE* trichloroethylene TCLP toxicity characteristic leaching procedure TEAM

477

A Strategy for the Abandonment of Modified In-Situ Oil Shale Retorts  

E-Print Network (OSTI)

Effects of steam on oil shale ing: a preliminary laboratoryJr. , "Disposal J. spent shale ash in "in situ" retortedInstitute to Rio Blanco Oil Shale Project, May 1977. 1~

Fox, J.P.; Persoff, P.; Moody, M.M.; Sisemore, C.J.

1978-01-01T23:59:59.000Z

478

Black and Korean: Racialized Development and the Korean American Subject in Korean/American Fiction  

E-Print Network (OSTI)

say that bars and clubs for black GIs are often smaller andshows the hierarchy of white over black. See Saundra Pollockare racialized as white or black depend[ing] on with whom

Lim, Jeehyun

2013-01-01T23:59:59.000Z

479

MSU Extension Publication Archive Archive copy of publication, do not use for current recommendations. Up-to-date  

E-Print Network (OSTI)

of flooding is essential in planning recre- ational facilities. #12;The degree of the limitation of the soils roads and intensively used areas, and install- ing sanitary facilities and utility lines. Camp areas

480

FREE TRIAL WEEK! We will offer many of our classes free of charge from Monday, September 19 Sunday, Sep-  

E-Print Network (OSTI)

FREE TRIAL WEEK! We will offer many of our classes free of charge from Monday, September 19 ­Sunday intensity style program us- ing free weights, resistance and body weight. RISE AND SHINE INTERVAL

Note: This page contains sample records for the topic "ing venti lation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Flame suppression by aerosols derived from aqueous ...  

Science Conference Proceedings (OSTI)

... Plug flow boundary conditions at the nozzle exit are ... DMMP and H2O, as a function of dopant loading. ... Load- ings are given as the mole fraction of ...

2012-06-10T23:59:59.000Z

482

The IceCube Collaboration:contributions to the 30 th International Cosmic Ray Conference (ICRC 2007),  

E-Print Network (OSTI)

total of 5 neutrino event triggers were initiated by AMANDA-in deep IceCube. Events that trigger both the surface arraya common run control, trigger- ing, event building and

Ackermann, M.; IceCube Collaboration

2008-01-01T23:59:59.000Z

483

untitled  

Gasoline and Diesel Fuel Update (EIA)

moved within a 47-per-barrel range. Spot market prices for regular gasoline and No. 2 heating oil at New York Harbor were also less volatile, mov- ing at less than half the...

484

VarPetrRef 1 VARIETY AND THE EVOLUTION OF REFINERY PROCESSING  

E-Print Network (OSTI)

. Catalytic reforming followed as a means of upgrading the octane of gasoline range materials principally): Catalytic reforming, Isomerization, Alkylation, Catalytic polymerization, MTBE and Hydrotreating. The last Distillation Visbreaking Hydrotreating Hydrocracking Thermal Reforming Alkylation MTBE Catalytic Reform ing

Paris-Sud XI, Université de

485

Large-magnitude geomagnetic disturbances in the North Sea region: Statistics, causes, and forecasting  

E-Print Network (OSTI)

Large-magnitude geomagnetic disturbances in the North Sea region: Statistics, causes require an undisturbed geomagnetic field. The Danish Meteorological Institute cur- rently offers real- ing project aiming at the development of geomagnetic forecast services, we have investigated

Gleisner, Hans

486

The Electron-Pair Origin of Antiaromaticity  

E-Print Network (OSTI)

the result- ing forbiddingness of an electric dipole electronic w xtransition between the two twins 5. In spite of their widespread usage, the concepts of aromaticity and antiaromaticity have escaped a precise

Haas, Yehuda

487

Weather-based yield forecasts developed for 12 California crops  

E-Print Network (OSTI)

precipitation on California crop yields. Climatic Change. InG. 1999. Understanding crop statis- tics. www.usda.gov/nass/developed for 12 California crops by David B. Lobell,

Lobell, David; Cahill, Kimberly Nicholas; Field, Christopher

2006-01-01T23:59:59.000Z

488

Flow Reconstruction for Data-Driven Traffic Animation David Wilkie  

E-Print Network (OSTI)

on a GIS-derived domain and overlaid on a public domain aerial image from the U.S. Geological Survey improved sensing technologies, real-time render- ing, and procedural modeling. For example, aerial imagery

North Carolina at Chapel Hill, University of

489

Search for antideuterons and strangelets in cosmic rays with AMS-01  

E-Print Network (OSTI)

AMS (the Alpha Magnetic Spectrometer) is a high-energy particle detector in space. An engineer- ing version of AMS, AMS-01, flew on the space shuttle Discovery for ten days in June 1998 and collected 108 cosmic ray events. ...

Henning, Reyco, 1975-

2004-01-01T23:59:59.000Z

490

Online Energy Generation Scheduling for Microgrids with  

E-Print Network (OSTI)

Online Energy Generation Scheduling for Microgrids with Intermittent Energy Sources and Co entitled: Online Energy Generation Scheduling for Microgrids with Intermittent Energy Sources and Co schedul- ing. However, accurate prediction cannot be guaranteed due to the small scale of microgrids

Zhang, Junshan

491

A CD19/Fc fusion protein for detection of anti-CD19 chimeric antigen receptors  

E-Print Network (OSTI)

Oliveira et al. : A CD19/Fc fusion protein for detection ofof the CD19-IgG 1 Fc fusion was performed under denatur- ingOpen Access A CD19/Fc fusion protein for detection of anti-

De Oliveira, Satiro N; Wang, Jiexin; Ryan, Christine; Morrison, Sherie L; Kohn, Donald B; Hollis, Roger P

2013-01-01T23:59:59.000Z

492

Loss mechanisms in turbine tip clearance flows  

E-Print Network (OSTI)

Numerical simulations of tip clearance ow have been carried out to dene the loss generation mechanisms associated with tip leakage in unshrouded axial turbines. Mix- ing loss between the leakage, which takes the form of a ...

Huang, Arthur (Arthur C.)

2011-01-01T23:59:59.000Z

493

1 Introduction ``It is a well-known phenomenon that we do not notice anything happening in our surround-  

E-Print Network (OSTI)

surround- ings while being absorbed in the inspection of something; focusing our attention on a certain demonstrations of the importance of attention in perception (see Neisser 1979 for an overview). In these studies

Chabris, Christopher F.

494

Ir I L  

Office of Legacy Management (LM)

*- -I ..' -I I... "- II .- (1 "^ 1 6 7 8 9 10 11 LIST O F FIGURES General location of the Granite City Steel Facility , Granite City , Illinois . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 View of the betatron building, look ing south . . . . . . . . . . . . . . . . . . . 10 View of the betatron building, look ing west . . . . . . . . . . . . . . . . . . . . . 11 Diagram of the ground floor of the betatron building . . . . . . . . . . . . . . 12 Photo showing the larger of the two betatrons (no. 1, Fig. 4) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 View of transformer s torage area ins ide the betatron building . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

495

nemsoverview_928.vp  

Gasoline and Diesel Fuel Update (EIA)

9) 9) The Na tional En ergy Mod el ing Sys tem: An Over view 2009 October 2009 En ergy In for ma tion Ad min is tra tion Of fice of In te grated Anal y sis and Fore cast ing U.S. De part ment of En ergy Wash ing ton, DC 20585 This re port was pre pared by the En ergy In for ma tion Ad min is tra tion, the in de pend ent sta tis ti cal and an a lyt i cal agency within the U.S. De part ment of En ergy. The in for ma tion con tained herein should be at trib uted to the En ergy In for ma tion Ad min is tra tion and should not be con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy or any other or ga ni za tion. This pub li ca tion is on the WEB at: www.eia.doe.gov/oiaf/aeo/over view/ The Na tional En ergy Mod el ing Sys tem: An Over view 2009 pro vides a sum mary de scrip tion of the Na tional En ergy

496

LANL: MST e-News April 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

MST e-News-Newsletter of the Materials Science and Technology Division MST e-News-Newsletter of the Materials Science and Technology Division April 2012 I N S I D E 2 From mark's Desk 3 In sItu monItorIng oF DynamIc phenomena DurIng solIDIFIcatIon 4 comparIson oF In sItu 3D ImageD Foams In compressIon wIth moDelIng 5 John carpenter to receIve tms young leaDer proFessIonal Development awarD scIentIFIc Journal publIshes specIal Issue In honor oF carlos tomé 6 three sprIng meetIngs on raDIatIon eFFects The world-record highest non- destructive magnetic field achieved last month at the National High Magnetic Field Laboratory-Pulsed Field Facility will be just one technical achievement featured during the 2012 Materials Capability Review.

497

EPIC Muon Cooling Simulations using COSY INFINITY  

SciTech Connect

Next generation magnet systems needed for cooling channels in both neutrino factories and muon colliders will be innovative and complicated. Designing, simulating and optimizing these systems is a challenge. Using COSY INFINITY, a differential algebra-based code, to simulate complicated elements can allow the computation and correction of a variety of higher order effects, such as spherical and chromatic aberrations, that are difficult to address with other simulation tools. As an example, a helical dipole magnet has been implemented and simulated, and the performance of an epicyclic parametric ionization cooling system for muons is studied and compared to simulations made using G4Beamline, a GEANT4 toolkit.

J.A. Maloney, B. Erdelyi, A. Afanasev, R.P. Johnson, S.A. Bogacz, Y.S. Derbenev, V.S. Morozov

2011-03-01T23:59:59.000Z

498

10993_Primer_v2i3  

NLE Websites -- All DOE Office Websites (Extended Search)

rich coast-due to the large quantities rich coast-due to the large quantities of gold "found" among the indigenous As the number of sequenced micro- bial genomes has been steadily increas- ing over the past few years, the finish- ing process has become a constriction point. A discussion of ways to increase productivity and improve work efficiency was the motivation behind a two-day meeting held on June 29th and 30th at the JGI-PGF in Walnut Creek. The meet- ing, convened by finishing coordinator Patrick Chain from LLNL, marked the first face-to-face meeting of personnel from all institutions at all levels. Until this meeting, each of the insti- tutions had been generating their own approaches and protocols needed to handle the load. However, many of the steps involved in microbial finishing can

499

Tag: Naval Reactors  

NLE Websites -- All DOE Office Websites (Extended Search)

9/all en "Cook"ing at Y-12 for 70 9/all en "Cook"ing at Y-12 for 70 years http://www.y12.doe.gov/employees-retirees/y-12-times/cooking-y-12-70-years

We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America.

U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Municipal Conservation Municipal Conservation Program or Field Office: EERE RW EECBG Location(s) (City/County/State): North Providence, RJ Proposed Action Description: North Providence proposes to replace the Town Hall HVAC system with an energy efficient system. Categorical Exclusionfs) Applied: 85.1 - Actions to conserve energy or water For the oomplete DOE National Environmental Policy Act regu lations regardi ng categorical exclusions. including the full text of each categorical exclusion, see Subpart 0 of 10 eFR Part 1021 . Regulatory Requirements in 10 eFR I021.410(b): (See full text in regulation) [{)The proposal fils within a class of actions that is listed in Appendix A or B to 10 CFR Part 1021, Subpart D. To fit within the classes of actions listed in 10 CFR Part 1021, Subpart D, Appendix B, a proposal must be one that would not: (1) threaten