Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Any Refrig-  

U.S. Energy Information Administration (EIA) Indexed Site

5. Refrigeration Equipment, Number of Buildings for Non-Mall Buildings, 2003" 5. Refrigeration Equipment, Number of Buildings for Non-Mall Buildings, 2003" ,"Number of Buildings (thousand)" ,"All Buildings*","Buildings with Any Refrig- eration Equipment","Type of Equipment (more than one may apply)" ,,,"Commercial Refrigeration",,,,"Other Refrigeration " ,,,"Any","Walk-In Units","Open Cases or Cabinets","Closed Cases or Cabinets","Resid- ential- Type Units","Vending Machines" "All Buildings* ...............",4645,3176,1007,666,308,696,2370,996 "Building Floorspace" "(Square Feet)" "1,001 to 5,000 ...............",2552,1591,486,332,142,353,1159,268 "5,001 to 10,000 ..............",889,642,188,124,65,117,494,181

2

Any Refrig-  

U.S. Energy Information Administration (EIA) Indexed Site

6. Refrigeration Equipment, Floorspace for Non-Mall Buildings, 2003" 6. Refrigeration Equipment, Floorspace for Non-Mall Buildings, 2003" ,"Total Floorspace (million square feet)" ,"All Buildings*","Buildings with Any Refrig- eration Equipment","Type of Equipment (more than one may apply)" ,,,"Commercial Refrigeration",,,,"Other Refrigeration " ,,,"Any","Walk-In Units","Open Cases or Cabinets","Closed Cases or Cabinets","Resid- ential- Type Units","Vending Machines" "All Buildings* ...............",64783,52974,26768,20254,10425,17218,38884,35335 "Building Floorspace" "(Square Feet)" "1,001 to 5,000 ...............",6789,4333,1310,916,366,935,3174,830 "5,001 to 10,000 ..............",6585,4738,1406,909,497,894,3609,1407

3

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

4

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

5

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

6

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Intensity (thousand Btusquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

7

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

8

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

9

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

10

Table E1. Major Fuel Consumption (Btu) by End Use for Non-Mall ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

11

Table E6. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

12

Table E4. Electricity Consumption (Btu) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

13

Table E3A. Electricity Consumption (Btu) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

14

Table E4A. Electricity Consumption (Btu) Intensities by End ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

15

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

16

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Energy Intensity (kWhsquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

17

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Survey: Energy End-Use Consumption Tables Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

18

Table E5A. Electricity Consumption (kWh) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

19

Table E6A. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

20

SUBJECT: Statement of Clearance - Decontamination Op'erations;  

Office of Legacy Management (LM)

Statement of Clearance - Decontamination Op'erations; Statement of Clearance - Decontamination Op'erations; Raritan Arsenal TO: Comtnanding General U. S. Army Supply and Maintenance Command ,kTTN: iii-LSSM.-S" * 9T ;/ i-~'-~-.-y/"+,,y-- Washingto,n, D. C. 20315 ;l. Reference: ~Paragraph 5b, AR 405-90. : : 2. Forwarded for approval are a.Stateinent of Clearance afld supporting 'documents covering the decontamination of the Ammuhition Arca at Raritan Arsellal, Mctuchen, New Jersey. I I 3. Transl%ittal of the Statement of Clearance was deferred pend- iny, the removal of the scrap material from the Arsenal, referred to in pa'ragraph 6 of CMT 1 of the supporting documents. This action was completed 5 December 1963. i 4. The Statement-of Clearance and supporting documents 'Bre to be forwaided to District Engineer, New York District, 80 Lafayette Street,

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

S'fATEMEN'F OFCONSlI)ERATIONS  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

S'fATEMEN'F OFCONSlI)ERATIONS S'fATEMEN'F OFCONSlI)ERATIONS ADVANCE·CLASS WAfVER· ()F· pt\TEl'{r· RIGHTS FOR .'}'ECHNOLOGY DEVELOPED. UN DERT}IEFUNDrNG OPPORTUNITY ANNOUNCEMENT; "Rl~)COVERY ACT - GEO'l'HERMAL TECHNOLOG[ES PROGRAM: OROUNDSOURCE HEAT PUMPS," DE-FOA-OO()Ol16~ W(C}·2009-0 17 This advance class waiver will expeditdmplemclltalion oUhe American Recovery and Reinvestment Act of 2009f'Rec(}very Act") and is intended H>applytoimentiol1s of all current and future recipients. including subrccipients,awardedlmder the first and second topic areas ofthe Funding (}pportunity AntlOUncement (FOA), '"Re(,~(n'el:V Act - GeOlhermal Technologies Prognun:GrouJUIS()Upce Heal Pumps:' regardless of tier, except recipients eligible to obtajntitl~pur.suant. tdip,L, 96-517.. as amended, and

22

STATEMENT OF CONSID ERATIONS CLASS WAIVER OF THE GOVERNMENT'S DOMES'I'!C: AND FO  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CONSID CONSID ERATIONS CLASS WAIVER OF THE GOVERNMENT'S DOMES'I'!C: AND FO REIGN PATENT RIGHTS AND ALLOGATION OF DATA RIGHTS ARlSlNG FROM THE USE OF DOE FACI L!TI ES ANP FACILITY CON1'RACTORS BY OR FOR Tl !IRD-PARTY SPONSORS: DOE W A.IVER NO. W(C)-2011-009. Introduction The Deparlrnenr of Energy (and its predecessor agencies) (collectively. '·DOE'' or "Department") considers each of its DOE Facilities (i.e .. National Laboratori es, single-purpose research facilities, and other Department faci lities hereinafter referred to individually as '·Facility'' or collectively as "Facilities'') a unique and val uable national resource that should be made available to the extent feas ible fo r non- Federa l research and development activities and studies for third-party Sponsors.

23

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Buildings with Any Refrig- eration Equipment Type of Equipment (more than one may apply) Commercial Refrigeration Other Refrigeration Any Walk-In Units Open Cases or Cabinets...

24

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 ....................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ..................... 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ..................... 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ................... 405 16 57 65 7 158 2 29 6 18 45

25

STEM-ing the Tide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STEM-ing the Tide STEM-ing the Tide STEM-ing the Tide September 29, 2010 - 4:29pm Addthis Ali Zaidi Special Assistant to the Secretary of Energy Yesterday, the MacArthur Foundation rolled out its latest class of "geniuses" - 23 Americans who stand out because of their creativity and enterprise. Each recipient of the honor (and the $500,000 prize) has made an extraordinary contribution. One of those recipients is Amir Abo-Shaeer, an engineer in the aerospace and telecommunications industries who decided 10 years ago to go back to high school - this time as a teacher. At his alma mater, Dos Pueblos High School (in Santa Barbara, California), Amir created "a school within a school" built around a hands-on curriculum that helps students learn by connecting the ideas of physics, engineering and mathematics through

26

Personnel Change Notification ImagIng: GRSF/T  

E-Print Network (OSTI)

Personnel Change Notification OGS Form 3 ImagIng: GRSF/T Admit Year/Term: GS Web Front Desk: Office., reviewers, coordinators and chairs) Update: View all AIM Graduate Studies pages and enter decisions on GS02: Search for and view applicants; edit emails Connect: Add, search for and communicate with prospects

Hart, Gus

27

"Dark Web: Exploring and Min-ing the Dark Side of the Web"  

E-Print Network (OSTI)

Title: "Dark Web: Exploring and Min- ing the Dark Side of the Web" Speaker: Director, Prof will review the emerging research in Terrorism Informatics based on a web mining perspective. Recent progress in the internationally re- nowned Dark Web project will be reviewed, including: deep/dark web spider- ing (web sites

Michelsen, Claus

28

13:00 Begrung und Symposiumserffnung Prof. Dr.-Ing. Gerd Holbach  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Berlin,Technische Universität

29

Expeditious Data Center Sustainability, Flow, and Temperature Modeling: Life-Cycle Exergy Consumption Combined with a Potential Flow Based, Rankine Vortex Superposed, Predictive Method  

E-Print Network (OSTI)

strategy bypasses the vapor- compression cycle of the CRACis based on the same vapor-compression refrigeration cycle4.1, which shows the vapor-compression refrig- eration cycle

Lettieri, David

2012-01-01T23:59:59.000Z

30

"Cook"ing at Y-12 for 70 years | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

"Cook"ing at Y-12 ... "Cook"ing at Y-12 ... "Cook"ing at Y-12 for 70 years Posted: December 5, 2013 - 4:48pm At a Nov. 14 visit to Y-12, National Nuclear Security Administration's Deputy Administrator for Defense Don Cook shared his outlook on the future and his thanks to employees for continuing their 70-year tradition of making America safer. "There are three things to remember," Cook told a meeting of NNSA Production Office and Y-12 employees. "We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America." Cook also shared his thanks for preparing for the potential furlough in October because of the government shutdown and lack of appropriations. During what was the longest government shutdown to date, Cook said Y-12

31

TRANSPORTATION SYSTEMS are the build-ing blocks of modern society. Efficient and  

E-Print Network (OSTI)

TRANSPORTATION SYSTEMS are the build- ing blocks of modern society. Efficient and safe movement. How- ever, transportation systems by their very nature also affect the environment through operations, construction, and maintenance of transportation facilities, and through the travel behaviors they encourage

Wang, Yuhang

32

Water is used for many purposes, includ-ing growing crops, producing copper,  

E-Print Network (OSTI)

WATER USES Water is used for many purposes, includ- ing growing crops, producing copper, generating electricity, watering lawns, keeping clean, drinking and recreation. Bal- ancing the water budget comes down of the water budget. Reducing demand involves re- ducing how much water each person uses, lim- iting the number

33

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 1,043 49 141 128 26 393 7 112 20 46 122 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 115 6 13 5 3 28 2 40 2 3 11 5,001 to 10,000 ....................... 86 5 11 5 2 28 1 17 2 3 11 10,001 to 25,000 ..................... 142 8 16 15 4 54 1 17 3 6 19 25,001 to 50,000 ..................... 116 5 18 16 3 41 (*) 11 2 5 14 50,001 to 100,000 ................... 153 8 22 23 4 59 1 10 2 6 17

34

 

Gasoline and Diesel Fuel Update (EIA)

E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 3,559 167 481 436 88 1,340 24 381 69 156 418 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 392 19 44 18 11 96 7 138 8 12 39 5,001 to 10,000 ....................... 293 18 38 18 8 95 4 57 6 10 39 10,001 to 25,000 ..................... 485 26 55 52 14 184 3 57 10 20 63 25,001 to 50,000 ..................... 397 18 62 55 12 140 2 37 7 17 48 50,001 to 100,000 ................... 523 28 77 78 15 202 3 35 7 20 59

35

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 890 34 116 113 15 335 6 104 19 43 105 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 113 5 13 5 3 27 2 40 2 3 11 5,001 to 10,000 ....................... 77 4 10 5 2 24 1 16 2 3 10 10,001 to 25,000 ..................... 119 6 14 13 2 44 1 15 3 6 16 25,001 to 50,000 ..................... 103 4 16 15 3 35 (*) 10 2 5 12 50,001 to 100,000 ................... 119 5 17 19 2 46 1 9 2 5 13

36

 

Gasoline and Diesel Fuel Update (EIA)

. Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 5,820 2,203 431 384 448 1,143 167 354 64 148 478 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 672 207 45 18 48 93 48 137 8 12 55 5,001 to 10,000 ....................... 516 198 36 17 40 83 35 56 6 9 39 10,001 to 25,000 ..................... 776 324 47 44 43 151 25 53 9 19 62 25,001 to 50,000 ..................... 673 262 57 50 55 121 13 34 7 16 58 50,001 to 100,000 ................... 759 293 59 65 55 158 11 29 6 18 64

37

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................... 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 .......................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ........................ 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ........................ 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ...................... 405 16 57 65 7 158 2 29 6 18 45 100,001 to 200,000 .................... 483 16 62 80 5 195 1 24 Q 31 56 200,001 to 500,000 .................... 361 8 51 54 5 162 1 9 8 19 43 Over 500,000 ............................. 383 8 47 56 3 181 2 12 8 23 43 Principal Building Activity

38

 

Gasoline and Diesel Fuel Update (EIA)

A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 6,523 2,365 516 436 501 1,340 190 381 69 156 569 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 685 213 46 18 49 96 49 138 8 12 56 5,001 to 10,000 ....................... 563 212 39 18 43 95 37 57 6 10 46 10,001 to 25,000 ..................... 899 357 57 52 51 184 29 57 10 20 83 25,001 to 50,000 ..................... 742 281 63 55 60 140 16 37 7 17 66 50,001 to 100,000 ................... 913 325 79 78 67 202 17 35 7 20 83

39

ing system  

E-Print Network (OSTI)

Oct 29, 2002 ... GAs are search algorithms based on the mechanics of natural selection and natural genetics. They combine the concept of survival of the.

40

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

42

 

Gasoline and Diesel Fuel Update (EIA)

E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 50.7 2.4 6.9 6.2 1.3 19.1 0.3 5.4 1.0 2.2 6.0 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.6 2.9 6.8 2.8 1.7 14.8 1.1 21.2 1.2 1.8 6.0 5,001 to 10,000 ....................... 44.0 2.6 5.7 2.8 1.1 14.3 0.7 8.6 0.9 1.4 5.8 10,001 to 25,000 ..................... 38.8 2.1 4.4 4.1 1.1 14.7 0.2 4.5 0.8 1.6 5.1 25,001 to 50,000 ..................... 43.7 2.0 6.8 6.1 1.3 15.4 0.2 4.0 0.8 1.9 5.3

43

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (kWh/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 14.9 0.7 2.0 1.8 0.4 5.6 0.1 1.6 0.3 0.7 1.7 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 17.8 0.9 2.0 0.8 0.5 4.4 0.3 6.2 0.4 0.5 1.8 5,001 to 10,000 ....................... 12.9 0.8 1.7 0.8 0.3 4.2 0.2 2.5 0.3 0.4 1.7 10,001 to 25,000 ..................... 11.4 0.6 1.3 1.2 0.3 4.3 0.1 1.3 0.2 0.5 1.5 25,001 to 50,000 ..................... 12.8 0.6 2.0 1.8 0.4 4.5 0.1 1.2 0.2 0.6 1.5

44

 

Gasoline and Diesel Fuel Update (EIA)

E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 48.0 1.8 6.3 6.1 0.8 18.1 0.3 5.6 1.0 2.3 5.6 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.8 2.9 6.8 2.9 1.7 14.6 1.1 21.6 1.2 1.9 6.0 5,001 to 10,000 ....................... 42.2 2.0 5.6 2.8 0.9 13.3 0.7 9.0 0.9 1.5 5.7 10,001 to 25,000 ..................... 35.8 1.7 4.1 3.9 0.7 13.3 0.3 4.6 0.8 1.7 4.7 25,001 to 50,000 ..................... 41.8 1.8 6.6 6.0 1.0 14.4 0.2 4.1 0.8 1.9 5.0

45

Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

kinetic and sum frequency gen- eration vibrational spectroscopy study. Journal of the American Chemicalkinetic studies of their activity and stability against leach- ing. Journal of the American Chemical

Ewers, Trevor David

2012-01-01T23:59:59.000Z

46

Enum eration et g en eration al eatoire de cactus m-aires - CECM  

E-Print Network (OSTI)

de la formule de Good-Lagrange ont et e propos ees [12,6], toutes deux bas ees ... de couleurs ou de degr es x ee, a n sommets, en temps et espace O(n), bas e.

47

Material development in the SI sub 3 N sub 4 system using glass encapsulated Hip'ing  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP'ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

48

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

49

Material development in the SI{sub 3}N{sub 4} system using glass encapsulated Hip`ing. Final report, Phase 2: DOE/ORNL Ceramic Technology Project  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP`ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

50

Hydraulic fractur ing--also called hy  

E-Print Network (OSTI)

reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

Goodman, Robert M.

51

E(Race)ing gender: Stratified identities  

E-Print Network (OSTI)

In the discussion that follows, I will examine, on the broadest level, Hurston's complex negotiation of identity, as manifested in Their Eyes Were Watching God. Central to this investigation is an understanding of the strategies that women, specifically African American women, have adopted, under the auspices of marriage and the patronage system, to seek an equal place within a hegemonic culture. Most importantly, I want to address the cultural and social price exacted for accepting (as seen in the appropriation of white standards, and rejecting (as seen in Janie's trial for her husband's death) those institutions as the basis of one's identity. The cultural and social price that Janie pays, furthermore, challenges her adaptive capacity to stratify her racial and gender identity. Finally, it exacts a toll on the community as a whole, a fact Hurston repeatedly suggests by illustrating the extent to which the community has absorbed hegemonic standards of value and beauty with little or no inspection of or reflection on the effects to itself or to its individual members.

Nguyen, Le Thuy Thi

2000-01-01T23:59:59.000Z

52

IMPROVED GROOVING TOOL FOR TU ING  

te hnology readiness level: 6 a market deliverable has been demonstrated in relevant environments and is in final development . author: alexandra ...

53

 

U.S. Energy Information Administration (EIA) Indexed Site

5. Refrigeration Equipment, Number of Buildings for Non-Mall Buildings, 2003 5. Refrigeration Equipment, Number of Buildings for Non-Mall Buildings, 2003 Number of Buildings (thousand) All Buildings* Buildings with Any Refrig- eration Equipment Type of Equipment (more than one may apply) Commercial Refrigeration Other Refrigeration Any Walk-In Units Open Cases or Cabinets Closed Cases or Cabinets Resid- ential- Type Units Vending Machines All Buildings* ............................... 4,645 3,176 1,007 666 308 696 2,370 996 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 2,552 1,591 486 332 142 353 1,159 268 5,001 to 10,000 .............................. 889 642 188 124 65 117 494 181 10,001 to 25,000 ............................ 738 548 138 75 40 103 427 250 25,001 to 50,000 ............................ 241 196 78 44 19 53 148 134

54

Go-ing for the prediction of protein folding mechanisms  

E-Print Network (OSTI)

of Chemistry, Faculty of Science, Kobe University, Kobe, 657-8501, Japan Protein folding has been a long-lived could be relatively simple. These three ingredients are linked together with an almost one-line free work (8, 9). The surprise of the three papers is that apparently one can have both simplicity and fair

Takada, Shoji

55

The physical function-ing of a city sometimes  

E-Print Network (OSTI)

insurance. It is recommended that parents carefully review their homeowners, auto and health insurance. Parents should check their homeowners policy to see whether it will cover a student's possessions while

56

 

U.S. Energy Information Administration (EIA) Indexed Site

6. Refrigeration Equipment, Floorspace for Non-Mall Buildings, 2003 6. Refrigeration Equipment, Floorspace for Non-Mall Buildings, 2003 Total Floorspace (million square feet) All Buildings* Buildings with Any Refrig- eration Equipment Type of Equipment (more than one may apply) Commercial Refrigeration Other Refrigeration Any Walk-In Units Open Cases or Cabinets Closed Cases or Cabinets Resid- ential- Type Units Vending Machines All Buildings* ............................... 64,783 52,974 26,768 20,254 10,425 17,218 38,884 35,335 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 6,789 4,333 1,310 916 366 935 3,174 830 5,001 to 10,000 .............................. 6,585 4,738 1,406 909 497 894 3,609 1,407 10,001 to 25,000 ............................ 11,535 8,646 2,230 1,188 614 1,665 6,725 4,072

57

ing the distribution of those galaxies, the way they clump and spread out, scientists  

E-Print Network (OSTI)

illuminated realms as small as a single molecule and as large as a gamma ray burst. of the Year Agony ex- plosions in the universe: titanic blasts of en- ergy called gamma ray bursts (GRBs). Most notably of black holes and other phenomena in the gamma ray region of the spectrum. And the Wilkinson Microwave

Yildiz, Ahmet

58

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg130  

E-Print Network (OSTI)

. Journal of "Solar Energy Materials and Solar Cells". Proceedings of IEEE Photovoltaic Specialist Conferences. Proceedings of European Photovoltaic Solar Energy Conferences. #12;Module 2/Photovoltaics, Wiley, 1995. R.H.Bube, Photovoltaic Materials, Imperial College Press, 1998. Journal of "Solar Energy

59

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

U.S. Energy Information Administration (EIA) Indexed Site

MCKEESPORT MCKEESPORT COR AOPOLIS-MOON REDHAW ST. CLAIR SC ROGGSFIELD FRANKLIN -OAK FOREST RIMERSBURG RENNERD AL E GREENVILL E PAT MOS CRABTR EE BLAC K ASH ROYALT ON N BAKERSTOWN QUEEN ROU GH RUN LUCAS BLAC K H ILL CRESTON WAT TSVILLE WADSWORTH -NORT H OAKLAN D HOM EWORT H UNIT Y ESSELBRUN ALAMED A PAR K-CROOKED RU CHERRY GROVE FRENC HTOWN ST EWART RUN MILL C REEK GLENF IELD-MOU NT NEBO HICKORY E HARRISVILLE E LEST ER GRIGGS CORNERS EN GLAN D WEST VIL LE LAKE BAILEY LAKE OAKFORD BR UNSWICK N HOR ACE WALBORN RESERVOIR YOUN GSVILLE RPD-LORAIN -1 INGOMAR-GRUBBS BIG MEADOWS GARD EN ISLE TURT LE CREEK LEWIST ON E BR USH CR EEK FOOT VILLE BU LL CREEK BESSEMER EAGLEVILLE LIVER POOL E RIDGEVILLE E EVANS CIT Y GUIT ONVILLE WOLF S COR NERS WIN DFALL ABBEYVILLE ROC K CAMP LEATH ER WOOD AR COLA CR EEK MEC HANICST OWN NINE MILE RU N WALKCHALK RENFR EW-MCCALMONT BU FFALO N VALENCIA WELLIN GT ON

60

Spring'ing' Forward Into the Finals . . . Of A Competition Like...  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.11.13...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

'March'ing Into The Finals . . . Of A Competition Like No Other  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.04.13...

62

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg102  

E-Print Network (OSTI)

when carbon dioxide is introduced into thermal conversion processes such as the gasification of coal to syngas, leaving behind only a carbonless char. Castaldi estimates that if the biomass were used

63

Kurzlebenslauf (CV) Stand September 2011 Dr.-Ing. Diplom-Physiker  

E-Print Network (OSTI)

:30 Panel: Erneuerbare Energien: Rentable Investitionen oder teure Experimente? Christof Stein (KfW Bank) Dr für Klima, Umwelt und Energie) Matthias Willenbacher (JuWi Holding) Moderation: Monika Seynsche

64

Power Electronics and Electrical Drives Prof. Dr.-Ing. Joachim Bcker  

E-Print Network (OSTI)

, e.g. Interior permanent magnet synchronous motors (IPMSM)Interior permanent magnet synchronous rings Permanent Magnet Synchronous Motor integrated into the rotor outlines Active magnetic bearing motors (IPMSM) Switched reluctance drives FPGA based control Self optimizing systems (Collaborative

Noé, Reinhold

65

Programme Coordination Professor Dr.-Ing. habil. Dr. h. c. Karl J. Thom-Kozmiensky  

E-Print Network (OSTI)

Waste Management · Recycling · Waste-to-Energy Recovery of Biowastes · Mechanical-Biological Treatment of the European Suppliers of Waste to Energy Technology (ESWET), Brussels, Belgium 10.30 Hrs. Waste Framework.V., Gent, Belgium 12.30 Hrs. Waste incineration in the 21st century ­ Energy-efficient and climate

Hone, James

66

Wolfram Hoefer, Dr.-Ing. Assistant Professor Department of Landscape Architecture  

E-Print Network (OSTI)

Landentwicklung. Gärtner im Garten- und Landschaftsbau. (State exam for professional degree as gardener, landscape Ltd. London 1984-86 Apprenticeship as landscape gardener with Hermann Kretz, Garten und Landschaftsbau

Goodman, Robert M.

67

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg 141  

E-Print Network (OSTI)

- onry is also crucial to their safe storage. Plutonium, an active ingredient in nuclear weap- ons, has to determine how the electrons within these materials will behave. "The plutonium in the weapons ages, and we have to be able to predict the proper- ties of plutonium under a variety of conditions," Chris

68

Protective interior wall and attach8ing means for a fusion reactor vacuum vessel  

DOE Patents (OSTI)

An array of connected plates mounted on the inside wall of the vacuum vessel of a magnetic confinement reactor in order to provide a protective surface for energy deposition inside the vessel. All fasteners are concealed and protected beneath the plates, while the plates themselves share common mounting points. The entire array is installed with torqued nuts on threaded studs; provision also exists for thermal expansion by mounting each plate with two of its four mounts captured in an oversize grooved spool. A spool-washer mounting hardware allows one edge of a protective plate to be torqued while the other side remains loose, by simply inverting the spool-washer hardware.

Phelps, Richard D. (Greeley, CO); Upham, Gerald A. (Valley Center, CA); Anderson, Paul M. (San Diego, CA)

1988-01-01T23:59:59.000Z

69

Pico-ing into the future of mobile projection and contexts  

Science Conference Proceedings (OSTI)

Ten years ago, we were on the verge of having cameras built into our mobile phones, but knew very little about what to expect or how they would be used. Now we are faced with the same unknowns with mobile projector phones. This research seeks to explore ... Keywords: Diary study, Experience sampling, Mobile, Pico-projectors

Max L. Wilson; Dan Craggs; Simon Robinson; Matt Jones; Kristian Brimble

2012-01-01T23:59:59.000Z

70

Koordination: Prof. Dr.-Ing. J. Seume Institut fr Turbomaschinen und Fluid-Dynamik  

E-Print Network (OSTI)

of installation of offshore wind farms (from Wiese 2008: Auswirkungen der Offshore-Windenergie auf den Betrieb von and offshore applications require appropriate planning and design. For most of them, statistics of extreme wind coastDat have been used in a large variety of coastal, offshore and terrestrial applications

71

Sandra Koch Dipl.-Ing. (FH) Telefon: 04921-807-1489  

E-Print Network (OSTI)

die Voraussetzung geschaffen, um die Stromerzeugung aus Windenergie Offshore langfristig erfolgreich geschaffen, um die Stromerzeugung aus Offshore Windenergie langfristig erfolgreich und effizient entwickeln-02 Bestimmung von Wärme- und Impulsfluss in der marinen atmosphärischen Grenzschicht für die Offshore

Damm, Werner

72

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

Annual Energy Outlook 2012 (EIA)

RURAL RID GE ROWSBUR G SH ERRETT MON AC A QUEEN JUN CTION YELLOW CR EEK SMELTZ ER CAT FISH R UN POLK E JEROMESVILLE N FLORENCE-FIVE POINTS ATEN CLARINGTON MILLERSBURG...

73

Following weeks of purging and organiz-ing, phase one of the School's reloca-  

E-Print Network (OSTI)

in August. The depart- ments of Consumer Science and Human Development and Family Studies, as well as UW from top: Gloria McCord, Human Ecology financial specialist, casts a spell at the punch-bowl cauldron

Sheridan, Jennifer

74

INFORMATION EXCELLENTIA CoLumbIA ENgINEErINg238  

E-Print Network (OSTI)

that bends and twists. "Computers, geometry, and physics are my ingredients. I mix them up in a bowl and what science as well. B.A.Sc., University of Toronto (Canada), 1997; M.S., California Institute of TechnologySPUn Associate Professor of Computer Science #12;

Hone, James

75

METHOD FOR REDU ING A KGROUND LUTTER IN A AMERA IMAGE  

... bulky and heavy, expensive, fragile, short-range, sensitive to vibration, and unreliable for outdoor use in bright sunlight conditions. The ...

76

SOLAR TRA ING SENSORS FOR MAXIMUM SOLAR ON ENTRATOR EFFI IEN Y  

POTENTIAL APPLI ATIONS Parabolic dish & trough solar concentrating collectors Solar energy and renewable energy Electric utility

77

whITe PaPer The ChaNgINg DYNaMICS OF  

E-Print Network (OSTI)

of the smart grid, which integrates AMI with distribution automation and other tech- nologies to connect consumers Network Automation And Analytics Smart Meters Distributed Generation Today: Centralized and One smart grid and advanced metering deployments. Bob Brnilovich, IBM www.UtilitiesProject.com/10803

78

Current Laboratory Assessment Plan for 1981 Accreditation ...  

Science Conference Proceedings (OSTI)

... and NVLAP accredited laboratories have appeared in the February issues of the Air Conditioning, Heating, and Refrig ... (Southern District of Indiana ...

2013-07-17T23:59:59.000Z

79

Dual stage active magnetic regenerator and method - Energy ...  

Industrial Technologies; Solar ... Al.sub.2 where x is selected to be greater than about 0.5 and less than 1 to provide significantly improved refrige ...

80

TWOZONE USERS MANUAL  

E-Print Network (OSTI)

to the Evaporative Cooling and Air Conditioning Branches .Branch Refrigerative Air Conditioning Branch II . BCDcooling only at night, air conditioning during the day. the

Gadgil, Ashok J.

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

TWOZONE USERS MANUAL  

E-Print Network (OSTI)

to the Evaporative Cooling and Air Conditioning Branches .Branch Refrigerative Air Conditioning Branch II . BCDcooling only at night, air conditioning during the day. the

Gadgil, Ashok J.

2010-01-01T23:59:59.000Z

82

Technical Report Documentation Page 1. Report No.  

E-Print Network (OSTI)

.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr

83

Mus(tidimensional autsresonant mode conversion L. Friedland  

E-Print Network (OSTI)

the gyroresonancecyclic accel- erator (GYRAC)6 and the spatial autoresonancecyclotron (SAC)7acceleratorarebasedon

Friedland, Lazar

84

Glossary * Appendix Two Glossary  

NLE Websites -- All DOE Office Websites (Extended Search)

Glossary * Appendix Two Glossary * Appendix Two Glossary Barrel (Oil): A unit of volume equal to 42 U.S. gallons. Barrels per Day (Operable Refinery Capacity): The maximum number of barrels of in- put that can be processed during a 24-hour period after making allowances for the following limitations: the capability of downstream facilities to absorb the output of crude oil process- ing facilities of a given refinery (no reduction is made when a planned distribution of inter- mediate streams through other than downstream facilities is part of a refinery's normal op- eration); the types and grades of inputs to be processed; the types and grades of products to be manufactured; the environmental constraints associated with refinery operations; the re- duction of capacity for scheduled downtime, such as routine inspection, mechanical prob-

85

Commissioning Plan RM  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Checkout, Testing, and Checkout, Testing, and Commissioning Plan Review Module March 2010 CD-0 O Ch 0 OFFICE OF heckout, T C CD-1 F ENVIRON Standard R Testing, a Revi Critical Decis CD-2 Ma NMENTAL Review Plan and Com iew Module sion (CD) Ap CD arch 2010 L MANAGE n (SRP) mmissioni e pplicability D-3 EMENT ing Plan CD-4 Post Ope eration Standard Review Plan, 2 nd Edition, March 2010 i FOREWORD The Standard Review Plan (SRP) 1 provides a consistent, predictable corporate review framework to ensure that issues and risks that could challenge the success of Office of Environmental Management (EM) projects are identified early and addressed proactively. The internal EM project review process encompasses key milestones established by DOE O 413.3A, Change 1, Program and Project Management for the Acquisition of Capital Assets, DOE-STD-1189-2008,

86

Institutsleitung: Univ.-Prof. Dr.-Ing. Prof. E.h. Dr.-Ing. E.h. Dr. h.c. mult. Engelbert Westkmper Kontakt: Birgit Spaeth Presse-und ffentlichkeitsarbeit  

E-Print Network (OSTI)

Universitätsprofessor ernannt wird. Thomas Bauernhansl, 1969 im fränkischen Miltenberg geboren, hat Maschinenbau an der

Möbius, Bernd

87

Tactical urbanism, public policy reform, and 'innovation spotting' by government : from Park(ing) Day to San Francisco's parklet program  

E-Print Network (OSTI)

This thesis examines the prospects and impacts of tactical urbanism (TU). While tactical urbanism remains primarily a subcultural movement, it is beginning to gain traction in popular culture in traditionally politically ...

Davidson, Mariko Mura

2013-01-01T23:59:59.000Z

88

The Burning Man festival is a unique happen-ing. For one week in September every year,  

E-Print Network (OSTI)

spaces, the city as it alters over the seven days and from year to year, exhibiting emergent properties- ance of oversized gas-guzzling camper vans, fossil-fuel-powered generators and gratuitous combustion, it is no Utopia. But the City's Alternative Energy Zone, with its huge bank of solar panels, multiple experiments

Bourne, Philip E.

89

Cultivat(ing) modernities : the Society for National Heritage, political propaganda and public architecture in twentieth-century Iran  

E-Print Network (OSTI)

Beginning in 1922, under the auspices of the Pahlavi dynasty of Iran, the tombs of selected historical figures were systematically destroyed to make way for modern mausoleums erected as metaphors for an "Aryan" nation in ...

Grigor, Talinn, 1972-

2005-01-01T23:59:59.000Z

90

58 UTS ANNUAL REPORT 2008 sUppoRtING oUR objEctIvEs  

E-Print Network (OSTI)

improvingenvironmentalsustainabilityin ourcampusoperations.Itisoverseenby asteeringcommitteeandsevenworking groups:waste,transport,energy into the atmosphere. The proposal from students Antony Henry and Kavit Pandya was to put this wasted energy through Energy-efficientlightinginmorethan> 60percentoftheUniversity Savingtheequivalentof45Olympic

University of Technology, Sydney

91

HOW ENVIRONMENTAL RISK FROM LEACH ING OF HEAVY METALS IN ASH RESIDUES FROM COMBUSTION OF MUNIC IPAL SOLID WASTE  

E-Print Network (OSTI)

Laboratories which led to the use of acid tests such as the EP and TCLP tests. [25] 13 #12;CONCLUSIONS and soluble metals in the ash from Waste-to Energy (WTE) facilities has led to a public concern about why has led to the requirement for continuous monitoring of oxygen , carbon monoxide (CO) , and acid gases

Columbia University

92

PROJECTS FROM FEDERAL REGION IX DEPARTMENT OF ENERGY APPROPRIATE ENERGY TECHNOLOGY PROGRAM PART II  

E-Print Network (OSTI)

hydroelectric system using a Pelton impulse wheel, generator,hydroelectric system" The logistics for op- erating a portable generator

Case, C.W.

2012-01-01T23:59:59.000Z

93

TROPIC: Transactional Resource Orchestration Platform In the Cloud Changbin Liu Yun Mao Xu Chen Mary F. Fernndez  

E-Print Network (OSTI)

of in gen- erating flow summaries. Compound and stateful signatures in Ju- niper's Netscreen-IDP suite [16

Pennsylvania, University of

94

Clemson University Preservation master Plan Part III: ExIstIng CondItIons ChaPtEr Four FEbruary 2009 JMa, InC. 70  

E-Print Network (OSTI)

,337 CFDA # 15.922 - Native American Graves Protection and Repatriation Act Direct Federal Awards 16,227 525,830 - 4,830 Lawrence Berkeley Natl Lab RF HANFORD SEDM THOMP-6875736 48,614 2,965 45,649 Savannah River Nuclear Solutns RF RIVERBASIN GRUND-AC716760 132,105 9,248 122,857 Savannah River Nuclear Solutns RF SUP

Stuart, Steven J.

95

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

from Smoldering Biomass Combustion. Atmos. Chem. Phys. , 10,aerosols emitted during biomass combustion [Robinson et al.burning samples. Combustion of biomass produces EC a and

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

96

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Tar Balls from Smoldering Biomass Combustion. Atmos. Chem.gases and particles from biomass burning in Brazil, J. Ge-for smoke from African biomass burning, J. Geophys. Res. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

97

Early and sustained interventions which strongly feature mentoring are essential in help-ing Native American and Latino students navigate an unfamiliar academic system that is  

E-Print Network (OSTI)

(Navajo) is the largest, with 170,000 members. Others include the Oglala Sioux, Cherokee Nation, Blackfeet

Benitez-Nelson, Claudia

98
99

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

DOE Green Energy (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} < 2.5 {mu}m: average 59.8 {mu}g m{sup -3}) were higher than coarse aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

100

MICRO-MACHINED THIN FILM HYDROGEN GAS SENSORS Frank DiMeo, Jr., Ing-Shin Chen, Philip Chen, Jeffrey Neuner  

E-Print Network (OSTI)

;Introduction The reputation of hydrogen as the next generation energy delivery agent, supplementing electricity of Electric Power Research Institute, in a recent The Industrial Physicist column, observed the multifaceted as a national security priority. While fuel cell cars often feature prominently in news media and are touted

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

2001. Kerminen, V. -M. , Makela, T. E. , Ojanen, C. H. ,Saarikoski, S. , Frey, A. , Mkel, T. , and Hillamo, R. :Acker, K. , Hillamo, R. , Mkel, T. : Intercomparison of

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

102

CS-03-02 A PIvotIng PRocEDuRE FoR A ClAss oF SEconD-oRDER ...  

E-Print Network (OSTI)

linear function over an intersection of an affine set and second-order cones. SOCP is a .... Note that the e q uality constraints of does not contain!7# .

103

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Crutzen, P. : Atmospheric Aerosols: Biogeochemical sourcesof optically active aerosol particles over the Amazonproperties of Amazonian aerosol particles: Rev. Geophys. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

104

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

Science Conference Proceedings (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

105

Understanding the Effect of Baseline Modeling Implementation Choices on Analysis of Demand Response Performance  

E-Print Network (OSTI)

IEEE Transactions on Smart Grid, ings. Journal of Solaroperations. With continu- ing Smart Grid development, there

Addy, Nathan

2013-01-01T23:59:59.000Z

106

Genetics of motor neuron disease  

Science Conference Proceedings (OSTI)

The number of genes associated with motor neuron degen- eration has increased ... Motor neurons are affected in a large number of neurologic diseases

107

Catalysts for Oxidation of Mercury in Flue Gas  

sions in coal-burning power plants, incin-erators, oil-burning boilers and power plants, and refuse-derived fuel power plants They can adsorb ...

108

Summaries of Center for Fire Research Grants and In-House ...  

Science Conference Proceedings (OSTI)

... o restructuring the code in a way that ... erated environment in aircraft cabins was developed and ... ASME Symposium on Modeling at Environmental ...

2008-11-20T23:59:59.000Z

109

L This Issue:  

Science Conference Proceedings (OSTI)

... [7] PV Seances Com. ... Second, the accomplishment of op- erating spacecraft had provided the opportunity to pursue solar and astronomical studies ...

2010-04-08T23:59:59.000Z

110

Efficiency enhancement of luminescent solar concentrations for photovoltaic technologies  

E-Print Network (OSTI)

1.1 Solar Energy . . . . . . . . .on ?uorescent glass-?lms. Solar Energy Materials and SolarHo?mann. Photovoltaic Solar Energy Gen- eration. Optical

Wang, Chunhua

2011-01-01T23:59:59.000Z

111

ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978  

E-Print Network (OSTI)

refrigeration system (Cycle 2R chiller), the design of whichdesign of an advanced absorption cycle: The double-effect regen- erative absorption refrigeration

Cairns, E.L.

2011-01-01T23:59:59.000Z

112

SOLAR ENERGY PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT ANNUAL REPORT 1978  

E-Print Network (OSTI)

refrigeration system (Cycle 2R chil"ler), the design ofdesign of an advanced absorption cycle: The double-effect regen- erative absorption refrigeration

authors, Various

2011-01-01T23:59:59.000Z

113

Hydrogen and Fuel Cell Technologies Program: Fuel Cells Fact...  

NLE Websites -- All DOE Office Websites (Extended Search)

for backup power, power for remote loca- tions, distributed power generation, and cogeneration (in which excess heat released during electricity gen- eration is used for other...

114

Building and Fire Publications  

Science Conference Proceedings (OSTI)

... electricity rates. ERATES: A Computer Program for Calculating Time-of-Use, Block, and Demand Charges for Electricity Usage (Version 1.2). ...

115

[hal-00809847, v1] AI-Ckpt: Leveraging Memory Access Patterns...  

NLE Websites -- All DOE Office Websites (Extended Search)

asynchronous checkpointing gen- erate the same kind of interference as they did in past iter- ations. Based on this assumption, we propose novel asyn- chronous checkpointing...

116

Automatic annotation of organellar genomes with DOGMA  

E-Print Network (OSTI)

for 98 chloroplast protein cod- ing genes (with two entriessimilarly to the protein cod- ing genes, except that

Wyman, Stacia; Jansen, Robert K.; Boore, Jeffrey L.

2004-01-01T23:59:59.000Z

117

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Mitarbeiter und Stipendiaten Dr. Olaf Adamczyk Dr.-Ing. Suhas Bhandare Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann Dr Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr.-Ing. Sunil Survaiya Dr.-Ing. Hongbin Zhang

Noé, Reinhold

118

Summary Max Total Units  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Max Total Units Max Total Units *If All Splits, No Rack Units **If Only FW, AC Splits 1000 52 28 28 2000 87 59 35 3000 61 33 15 4000 61 33 15 Totals 261 153 93 ***Costs $1,957,500.00 $1,147,500.00 $697,500.00 Notes: added several refrigerants removed bins from analysis removed R-22 from list 1000lb, no Glycol, CO2 or ammonia Seawater R-404A only * includes seawater units ** no seawater units included *** Costs = (total units) X (estimate of $7500 per unit) 1000lb, air cooled split systems, fresh water Refrig Voltage Cond Unit IF-CU Combos 2 4 5 28 References Refrig Voltage C-U type Compressor HP R-404A 208/1/60 Hermetic SA 2.5 R-507 230/1/60 Hermetic MA 2.5 208/3/60 SemiHerm SA 1.5 230/3/60 SemiHerm MA 1.5 SemiHerm HA 1.5 1000lb, remote rack systems, fresh water Refrig/system Voltage Combos 12 2 24 References Refrig/system Voltage IF only

119

Electric equipment providing space conditioning, water heating, and refrigeration consumes 12.5% of the nation's  

E-Print Network (OSTI)

-acceptable refrigerants. Whether involving design of specific new products or refriger- ants to which the entire industryElectric equipment providing space conditioning, water heating, and refrigeration consumes 12 are the heart of air conditioners, heat pumps, chillers, supermarket refrigeration systems, and more. Global use

Oak Ridge National Laboratory

120

USHE TRANSFER ARTICULATION GUIDE 2012-2013 Course Course Footnotes  

E-Print Network (OSTI)

ACRT 1000 Survey of AC/Refrig 1 E ACRT 1110 Refrigeration I 10 E ACRT 1120 Special Refrigeration Math. 3 E ACRT 1210 Refrigeration II 9 E ACRT 1220 Basic Electr. & Motor Controls 5 E ACRT 1330 RESIDENTIAL HVAC ESTIMATING & DESIGN 2 E ACRT 2320 Motors, Controls, & Wiring Diagrams 5 E ACRT 2330 Sheet

van den Berg, Jur

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Tel. +49-541-969 2872/2890 -Fax. +49-541-969 1221/2262 -Email. Junge@uni-osnabrueck.de 1 Prof. Dr.-Ing. Wolfgang Junge Gutenbergstrae 36, 49076 Osnabrck  

E-Print Network (OSTI)

for Biophysics, Osnabrück 1992 95th Conference of the Deutsche Bunsengesellschaft für Physikalische Chemie, Jena Chemie Deutsche Gesellschaft für Biophysik Deutsche Gesellschaft für Naturforscher und ?rzte Gesellschaft for Biophysics Chair 1984-1985 Section "Membranes" of Gesellschaft für Biologische Chemie, Board Member 1987

Junge, Wolfgang

122

Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc 401k 401k D PP PT2 Dental Pre-Paid PT 2 Misc Miscellaneous Deductions ROTH ROTH 401(k)  

E-Print Network (OSTI)

FICA Additional Medicare Tax ORP ING1 ORP Retirement ING 10% TCRS NF TCRS Retirement Non-Faculty AFLACSIC Aflac - Sickness Indemnity Foundat Foundation ORP ING2 ORP Retirement ING Two Split TCRS TCB Closed Teacher Class B Contrib AFLCIEET Aflac - Critical ILL-EE-Tobacco Foundat ETSU Foundation ORP ING3

Karsai, Istvan

123

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Bhandare M. Sc. Abas Ahmad Fauzi Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann M. Sc. Selwan K. Ibrahim Dr.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl

Noé, Reinhold

124

Efficiency enhancement of luminescent solar concentrations for photovoltaic technologies  

E-Print Network (OSTI)

and V.U. Ho?mann. Photovoltaic Solar Energy Gen- eration.e?ciency for photovoltaic solar energy collections, reviewedenergy sources, the manufacturing of solar cells and photovoltaic

Wang, Chunhua

2011-01-01T23:59:59.000Z

125

Design and Transient Analysis of Passive Safety Cooling Systems for Advanced Nuclear Reactors  

E-Print Network (OSTI)

formula exponent C p heat capacity D diameter e emissivity Erates and the fluid heat capacity yield the effectiveness,their high volumetric heat capacity, low vapor pressure, low

Galvez, Cristhian

2011-01-01T23:59:59.000Z

126

COMMISSION REPORT PUBLIC INTEREST ENERGY  

E-Print Network (OSTI)

- eration technologies to meet peak needs or to provide energy independence and protect against outages in the event that either diablo canyon or San onofre has a prolonged or permanent outage and for the california

127

Building Scale DC Microgrids  

E-Print Network (OSTI)

and Generation," IEEE Smart- Grid Conf. , 978-1-4577-2159-and Op- eration of Smart Grids with Electric Vehiclemore on microgrids and smart grids as well as CHP, as an

Marnay, Chris

2013-01-01T23:59:59.000Z

128

HiggsPDG.dvi  

NLE Websites -- All DOE Office Websites (Extended Search)

HIGGS BOSON H 0 Revised October 2013 by M. Carena (Fermi National Accel- erator Laboratory and the University of Chicago), C. Gro- jean (ICREA at IFAE, Universitat Aut onoma de...

129

Surface Water Temperatures, Salinities and Densities At Shore Stations, United States West Coast 1991  

E-Print Network (OSTI)

off tlw rocks near the water intake for the laboratory. T hthat monitors the cooling intake water for the gen- erators.of hot water is outside the bay, the intake temperatures are

Scripps Institution of Oceanography

1992-01-01T23:59:59.000Z

130

Surface Water Temperatures, Salinities and Densities At Shore Stations, United States West Coast 1992  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. Thethat monitors the cooling intake water for the gen erators.of hot water is outside the bay, the intake temperatures are

Scripps Institution of Oceanography

1993-01-01T23:59:59.000Z

131

subspace accelerated matrix splitting algorithms for bound ...  

E-Print Network (OSTI)

Their algorithm uses a projected gradient search in the first phase ..... eration is generally superior to a projected gradient iteration in terms of identifying an optimal ..... Once the subspace step has been computed, we enter Step 3 and compute.

132

Publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Bongjin S. Mun Clear All Filters 2010 Braun, Artur, Bongjin S. Mun, Yun Sun, Z. Liu, Oliver Grning, R. Mder, Selma Erat, Xueyuan Zhang, Samuel S. Mao, Ekaterina Pomjakushina...

133

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 222 194 17...

134

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,100...

135

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,928 1,316...

136

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Energy Consumption Survey: Energy End-Use Consumption Tables Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

137

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

cubic feet) Natural Gas Energy Intensity (cubic feetsquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

138

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,870 1,276...

139

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(trillion Btu) Fuel Oil Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

140

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(million gallons) Fuel Oil Energy Intensity (gallonssquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) District Heat Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

142

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) Natural Gas Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

143

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,602 1,397...

144

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,037...

145

Proceedings of the TOUGH Symposium 2009  

E-Print Network (OSTI)

and oil recovery by waterflood- ing, SPE ReservoirY. and N.R. Morrow, Waterflood performance by injection ofof low-salinity waterflood- ing, the exact mechanisms

Moridis, George J.

2010-01-01T23:59:59.000Z

146

Economic Contributions of the California Nursery Industry  

E-Print Network (OSTI)

energy and input costs, government regulation, chang- ing market structure, competition, information,

Carman, Hoy; Rodriguez, Ana Maria

2004-01-01T23:59:59.000Z

147

Chemical Education Today JChemEd.chem.wisc.edu Vol. 75 No. 5 May 1998 Journal of Chemical Education 537  

E-Print Network (OSTI)

esoteric than necessary. Chemistry is certainly a complicated subject, but shroud- ing it in esoteric

Rioux, Frank

148

Techniques for Maximizing Efficiency of Solar Energy Harvesting Systems (Invited Paper)  

E-Print Network (OSTI)

power point tracking, energy harvest- ing, solar panel, photovoltaic cell, supercapacitor, ultracapac

Shinozuka, Masanobu

149

Short-Term Energy Outlook - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

150

Arizona - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

151

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Wissenschaftliche Mitarbeiter und Stipen- diaten Dr. Olaf Adamczyk Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dr.-Ing. Sebastian Hoffmann Dipl.-Ing. Benjamin Koch Dr. rer. nat. Manfred Lichtinger Dr.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo

Noé, Reinhold

152

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

/2009 ­ 02/2010) Prof. Dr.-Ing. Reinhold Noé Personal Wissenschaftliche Mitarbeiter und Stipendiaten Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath Dr.-Ing. Timo Pfau Stip. M. EE. Kidsanapong Puntsri Dr.-Ing. David Sandel Dr.-Ing. Stephan Schulz Technische

Noé, Reinhold

153

News Briefs  

Science Conference Proceedings (OSTI)

... ing and cleanup, decontamination and decommissioning efforts, testing for ... the commercial radioactivity laboratories, nuclear power radiochemistry ...

1997-11-25T23:59:59.000Z

154

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

155

RADIATION RESEARCH 153, 220238 (2000) 0033-7587/00 $5.00  

E-Print Network (OSTI)

): the light water reactor [(LWR) in both pressurized and boil- ing versions]; heavy water (CANDU) reactor

156

DOI: 10.1126/science.1184167 , 76 (2010);328Science  

E-Print Network (OSTI)

, includ- ing nanolubricants and components in micro- and nanoeletromechanical systems devices. References

Kim, Philip

157

About EIA - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Uranium fuel, nuclear reactors, ... Environment. Greenhouse gas data, voluntary report- ing, ... Office of Personnel Management;

158

Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

159

Event-Places in North America: City Meaning and Making [Research and Debate  

E-Print Network (OSTI)

events in the cityscape triggers both memories and anticipation, bridg- ing the gap between performances.

Frenchman, Dennis

2004-01-01T23:59:59.000Z

160

United States - Search - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

162

De la fixation de jauge consideree comme un des beaux arts et de la symetrie de Slavnov qui s'ensuit  

E-Print Network (OSTI)

La fixation de jauge est d\\'efinie comme l'op\\'eration permettant d'exprimer une int\\'egrale sur un espace d'orbite comme int\\'egrale sur le fibr\\'e principal correspondant. Quand la fibre est non compacte cette op\\'eration met en jeu une classe de cohomologie \\`a support compact -ou \\`a d\\'ecroissance rapide- de celle-ci. La sym\\'etrie de Slavnov est l'expression alg\\'ebrique de l'ambiguit\\'e de cette construction.

Raymond Stora

1996-11-15T23:59:59.000Z

163

 

U.S. Energy Information Administration (EIA) Indexed Site

*** PROGRAM TO CREATE FORMAT LIBRARY FOR THE 1986 NBECS DATA ***; *** PROGRAM TO CREATE FORMAT LIBRARY FOR THE 1986 NBECS DATA ***; PROC FORMAT LIBRARY=SASLIB; VALUE $ACTIVTY ' ' = 'Inapplicable' '01' = 'Vacant' '02' = 'Office' '03' = 'Mercantile/services' '04' = 'Assembly' '05' = 'Food sales' '06' = 'Public order/safety' '07' = 'Health care (outpatient)' '08' = 'Industrial' '09' = 'Agricultural' '10' = 'Laboratory' '11' = 'Warehouse (refrig)' '12' = 'Warehouse (nonrefrig)' '13' = 'Education' '14' = 'Food service' '15' = 'Health care (inpatient)' '16' = 'Skilled nursing' '17' = 'Lodging' '18' = 'Residential' '19' = 'Other'; VALUE $BILTYP ' ' = 'Inapplicable' '1' = 'One bill' '2' = 'More than one bill' '7' = 'Not billed' '8' = 'Don''t know' '9' = 'Missing'; VALUE $CENDIV '1' = 'New England' '2' = 'Middle Atlantic'

164

Microcomputer Software for Refrigerant Property and Cycle Analysis Calculations  

E-Print Network (OSTI)

A microcomputer program entitled REFRIG has been developed to determine the thermodynamic properties of common refrigerants and to analyze vapor-compression refrigeration cycles. This paper describes the theoretical basis for property determination and for the cycle analysis. Validation of property calculations is discussed. A number of features are described which have been incorporated into the program to enhance its usefulness to the engineer in analyzing system performance. Two example cases are presented to illustrate the application of the program to problems in design and operation of refrigeration systems.

Bierschenk, J. L.; Strohl, S. T.; Schmidt, P. S.

1985-05-01T23:59:59.000Z

165

Mansaa thai June is, 1989  

E-Print Network (OSTI)

.ing cell.ing cell.iving cell.ging cell.nnn ccccggggng cell.ggggg cng cell.eelg cell.eee l.lke up every

Kemner, Ken

166

he Romberg Tiburon Center in Marin County is not an easy place to find. While running late and driving too  

E-Print Network (OSTI)

is complete as yellow sun rays blend with the rust-colored towers of the iconic Golden Gate Bridge. Dur- ing originally built for offload- ing coal. Later, it was used to support the assembly of submarine nets

167

Network computing : limits and achievability  

E-Print Network (OSTI)

insufficiency of linear network cod- ing. 2009. [88] R.and K. Zeger. Network cod- ing for computing. In Allertonto target function f is C cod (N , f ) = sup k : ? (k, n)

Karamchandani, Nikhil

2011-01-01T23:59:59.000Z

168

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

In Proceed- ings of Thermal Energy Storage in Aquifers Work-Mathematical Modeling of Thermal Energy storage in Aquifers.In Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

169

Copyright 2008 No part of this presentation may be reproduced in any form without prior authorization.  

E-Print Network (OSTI)

demon- stration project for Xcel Energy, convert- ing a Ford Escape Hybrid PHEV vehicle to put power. Utilizing fully automated fast processing, the new technology will be capable of produc- ing one solar cell

Amin, S. Massoud

170

74 Scientific American, April 2011 Illustration by Tom Whalen Earthquake early-warning networks  

E-Print Network (OSTI)

, but it is enough to send shutdown warn- ings to power plants and rail networks, automatically open ele- vator doors comes in two parts: a fast- moving, sudden jolt and a slower-mov- ing wave that causes the great

Allen, Richard M.

171

Natural Gas Productive Capacity for the Lower 48 States 1986 ...  

U.S. Energy Information Administration (EIA)

con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy o r any other or - gani za tion. Preface

172

BUILDING CORRELATORS WITH MANY-CORE HARDWARE Rob V. van Nieuwpoort and John W. Romein  

E-Print Network (OSTI)

- ing techniques, but more on signal-processing techniques. For example, LOFAR [1], MeerKAT (Karoo Array International Conference on Supercomput- ing, New York, NY, June 2009, pp. 440­449. [11] "Karoo array telescope

Romein, John W.

173

OFFICE OF AUDITOR OF STATE STATE OF IOWA  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Daniels, Thomas E.

174

Public servants A key part of the  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Manapat, Michael

175

B U S I N E S SB U S I N E S S ROBERT H. SMITH SCHOOL OF BUSINESS UNIVERSITY OF MARYLAND SPRING 2011 VOL. 12 NO. 1  

E-Print Network (OSTI)

and cellphone products. Employees were asked daily over a period of 10 work- ing days to list any incidents

Milchberg, Howard

176

e3_Coyote Case Study2000/L&J  

Science Conference Proceedings (OSTI)

... graphic design technology; biotechnology; heat- ing, ventilating ... the local school districts and work ... HVAC Heating, Ventilating, and Air Conditioning ...

2013-06-04T23:59:59.000Z

177

Cross-market relationships strengthened in the third quarter of ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... The correlation between prompt-month West Texas Intermediate ...

178

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... What is shale gas and why is it important? ...

179

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

180

More recycling raises average energy content of waste used to ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

182

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

183

Annual Energy Outlook 2013 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

184

State-Level Energy-Related Carbon Dioxide Emissions, 2000-2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

185

Cross State Air Pollution Rule requires emissions reductions from ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

186

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

187

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

188

Does EIA have maps or information on the location of natural gas ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

189

The geology of natural gas resources - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

190

UNIVERSITE DE NICE-SOPHIA ANTIPOLIS -UFR SCIENCES Ecole Doctorale Sciences et Technologies de l'Information et de la Communication  

E-Print Network (OSTI)

- ing the properties of such a ladder in this poorly explored regime. Acknowledgements The work at ORNL

Paris-Sud XI, Université de

191

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... CBECS enters the final phase of questionnaire design.

192

Paycheck Deduction Codes 01/10 Deduct Code Description  

E-Print Network (OSTI)

Garnishment GFNOPROV GF Mand Ret-No Providor Chosen GFTSAING GF - TSA ING GFTSALINC GF - TSA Lincoln GFTSASEC

Peterson, Blake R.

193

Electricity use by machine drives varies significantly by ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Fossil fuels may be used to drive turbines, reciprocating engines, ...

194

Fermi and the ergodic problem Giovanni Gallavotti  

E-Print Network (OSTI)

the esoteric (quasi) ergodic problem. Consider- ing a `{degrees of freedom system, ` > 2, with Hamilto- nian H

Roma "La Sapienza", Università di

195

Reference List 1751-2000  

Science Conference Proceedings (OSTI)

... 1934. Wurmb-Schwark, N. v, Michaela Harbeck, Urs Wiesbrock, Inge Schroeder, Stefanie Ritz-Timme, and Manfred Oehmichen. ...

2003-12-18T23:59:59.000Z

196

ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980  

E-Print Network (OSTI)

storm and double-pane windows, insulat- ing shutters, caulking and weatherstripping, fur- nace retrofits, and active and passive solar

Authors, Various

2010-01-01T23:59:59.000Z

197

Underwater 3D Mapping: Experiences and Lessons learned  

E-Print Network (OSTI)

in Okinawa in 1998[5]. Monitoring the health of coral reefs is a difficult and time consum- ing task

Jenkin, Michael R. M.

198

Mid-Atlantic electricity market reacts to Tuesday's earthquake ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... after the event. ...

199

Selected publications, with commentary William Bialek February 11, 2004  

E-Print Network (OSTI)

synergistic cod- ing, and this synergy is a significant component of the high coding efficiency seen in [66

200

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

202

Electric Power Monthly - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

203

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel, nuclear reactors, generation, spent fuel. ... Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

204

Markov decision process (MDP) framework for software power optimization using call profiles on mobile phones  

E-Print Network (OSTI)

Duke researchers [21] extend this approach to the system level by formulat- ing a general framework to manage energy

Jung, Eric; Maker, Frank; Cheung, Tang Lung; Liu, Xin; Akella, Venkatesh

2010-01-01T23:59:59.000Z

205

View / Download  

Science Conference Proceedings (OSTI)

developing fields of technology, mak- ing major advancements in traditional fields of engineering, or developing/ implementing innovative approaches.

206

THE CORROSION OF SILICATE MATERIALS BY HYDROGEN GAS AND HYDROFLUORIC ACID SOLUTION  

E-Print Network (OSTI)

occurring in the coal gasifier and then find- ing a methodmaterial for the coal gasifier applica- tion. The corrosion

Tso, Stephen T.

2011-01-01T23:59:59.000Z

207

Fuel economy standards have affected vehicle efficiency - Today in ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Notes: Combined means both foreign and domestic vehicles.

208

Second-Generation Nickel-Base Single Crystal Superalloy  

Science Conference Proceedings (OSTI)

creased, the demands placed on turbine airfoils have escalated dramatically. ... The demand- ing goals established ..... (maximum tensile strain at minimum...

209

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, biomass and ethanol. ... Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights

210

ICAL: A Tool for Analyzing Imperfect Comparison Algorithms Wee-Chong Oon and Martin Henz  

E-Print Network (OSTI)

[7] that was based on temporal difference learn- ing, and the checkers program Anaconda [1, 2] based

Henz, Martin

211

SOLAR ENERGY PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT ANNUAL REPORT 1978  

E-Print Network (OSTI)

of develop- ing a photovoltaic cell, based on a catalyst (has been shown that a photovoltaic cell can be constructed

authors, Various

2011-01-01T23:59:59.000Z

212

Assessing regional evapotranspiration and water balance across a Mediterranean montane climate gradient  

E-Print Network (OSTI)

topography and calculated solar radiation. Hydrol. Process.al. (2011). Incom- ing solar radiation was derived from the

Anderson, Ray G.; Jin, Yufang; Goulden, Michael L.

2012-01-01T23:59:59.000Z

213

Puerto Rico - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico Energy Affairs Administration, Administracin de Asuntos Energticos;

214

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico* Saint Kitts and Nevis Saint Lucia Saint Vincent ...

215

Markov Random field edge-centric image/video processing  

E-Print Network (OSTI)

using adaptive fast B-spline ?lter- ing, IEEE Internationalimage resizing using modi?ed B-splines, IEEE International

Li, Min

2007-01-01T23:59:59.000Z

216

How is electricity used in U.S. homes? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... heating elements, and motors not listed above. Learn more:

217

U.S. total motor gasoline exports down slightly from last year but ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Total motor gasoline = finished motor gasoline + motor gasoline blending components.

218

COMBINING MAGNETIC SHIELDING AND CRYOPUMPING FOR A NEUTRAL BEAM SOURCE  

E-Print Network (OSTI)

generated by the fusion reactor while the cold surface willfor the Toka. -nak Fusion Test Reactor", in Proceed ings of

Tanabe, J.

2010-01-01T23:59:59.000Z

219

Integrating Rhetorical-Semantic Relation Models for Query ...  

Science Conference Proceedings (OSTI)

... In Galia Angelova, Kalina Bontcheva, Ruslan Mitkov, Nicolas Nicolov, and Nikolai Nikolov, editors, Proceed- ings of the International Conference ...

2006-10-03T23:59:59.000Z

220

Common coastal foraging areas for loggerheads in the Gulf of Mexico: Opportunities for marine conservation  

E-Print Network (OSTI)

and its find- ings validated. On the other hand, to confirm the validity of the new tag tracking method

Florida, University of

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Illinois coal production pushes Illinois Basin production above ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... based on the Mine Safety and Health Administration (MSHA).

222

Alkylation is an important source for octane in gasoline - Today ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (like temperature and pressure) along with different safety considerations.

223

Eastern Mediterranean natural gas exploration focused on the ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Gaza Marine: 1: unknown: Sources: EIA estimates, IHS, ...

224

Error-reducing corrections for the method of regularized Stokeslet for fluid-membrane interactions  

E-Print Network (OSTI)

for SDS [1], and sec- ond, we investigate the summarisation of XML documents by tak- ing into account

Ullmer, Brygg

225

Applied and Computational Mathematics Division Applied and ...  

Science Conference Proceedings (OSTI)

... ing, materials science, chemistry, bioscience, engineering, fire ... mathematics are fundamental tools enabling ... The NIST Handbook of Mathematical ...

2013-05-08T23:59:59.000Z

226

Arizona - Rankings - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Markets & Finance. Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ...

227

EXPERIMENTAL ANALYSIS OF HEURISTICS FOR THE ...  

E-Print Network (OSTI)

order from inaccurate adjacency information [19], medical image process- ing [2] ...... salesman problem, Research Report, Department of Computer Science,...

228

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Greenhouse gas data, voluntary report- ing, electric power plant ...

229

Kazakhstan - Analysis - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power ... by the Kazakhstan's Electricity Grid Operating ... regional electricity distribution .. ...

230

modelling microstructural transformations of nickel base superalloy ...  

Science Conference Proceedings (OSTI)

456. 78. 3. 2. (b). Final. - top. Time. Scheil Fraction. 0.0. 0.2. 0.4. 0.6. 0.8. 1.0. Average Grain Size (. m). 5. 10. 15. 20. 25. 30. (c). Final. - top. (d). Final op eration,.

231

On the expressiveness of CSP A.W. Roscoe  

E-Print Network (OSTI)

On the expressiveness of CSP A.W. Roscoe February 16, 2011 Abstract We define "CSP express every operator of Hoare's CSP. Furthermore we show that every op- erator with CSP-like operational semantics can be simulated in CSP with the addition of an exception-throwing operator P A Q in which any

Oxford, University of

232

Efficient implementation of inter-regional transactions Yong T. Yoon Ken K. Collison Marija D. Ili6  

E-Print Network (OSTI)

and planning of the interconnected electric power network while ensuring reliability. Keywords-- open access and the transformer as described in [13]. We first describe the advantages and disadvantages of having the sharing of 10S and the cost savings in gen- eration. Consider the 5-bus electric power network as shown

Ilic, Marija D.

233

Catalysis Today 59 (2000) 4760 A critical evaluation of NavierStokes, boundary-layer,  

E-Print Network (OSTI)

for conditions that are typical of the catalytic combustion of natural gas. In developing simulation capabilities ultra-low emission of NOx in applications like gas turbines for electric-power gen- eration [1-value problem for the axial variation of the mean species composition. An intermediate alternative is to base

Raja, Laxminarayan L.

234

SpyFeet: An Exercise RPG Aaron A. Reed, Ben Samuel, Anne Sullivan, Ricky Grant, April Grow, Justin Lazaro,  

E-Print Network (OSTI)

--Language gen- eration General Terms Design, Experimentation, Human Factors, Theory 1. INTRODUCTION Meaningful- search showing that physical activity declines precipitously in adolescence, particularly in girls. SpyFeet's story invites players to enter a hid- den world where their special powers allow them to com

California at Santa Cruz, University of

235

A Critical Look at Design, Veri cation, and Validation of Large Scale Simulations  

E-Print Network (OSTI)

presented two papers on the Department of Energy's Accel- erated Scienti c Computing Initiative or ASCI: Jan 28, 2003. This just in. From Makkah, Saudi Arabia. An FA-18 ghter carrying a tac- tical nuclear, the weapon detonated. US experts cannot explain how this explosion could have occurred. The city was lled

Hallstrom, Jason

236

ccsd00001714, Nonlinear dynamics of electromagnetic pulses in cold relativistic plasmas  

E-Print Network (OSTI)

ccsd­00001714, version 2 ­ 19 Oct 2004 Nonlinear dynamics of electromagnetic pulses in cold particle and photon accel- eration, nonlinear optics, laser fusion, and others [1{6]. Intense of coupled electromagnetic and electrostatic modes in cold relativistic electron-ion plas- mas to conclude

237

MECHANICAL DRAFT FANS FOR THE MODERN INCINERATOR  

E-Print Network (OSTI)

design and modiftcation. Spe cial blading and fan construction for use under corrosive conditions this will be kept fairly constant by air or water cooling during noral op eration. Since the fan will be designed. Volume control on a single inlet fan can be accomplished with a variable inlet #12;vane, designed

Columbia University

238

Fireside Corrosion in Municipal Incinerators Versus PVC Content of the Refuse  

E-Print Network (OSTI)

in the Miami County, Ohio, incinerator. The results show that the corrosion rate of low-alloy steels No. R-800055, from the Solid Waste Management Office. The contents do not necessarily reflect Waste Management Office of EPA, the mechanism and extent of fireside metal wastage by incin eration

Columbia University

239

Adaptive Linear Prediction of Radiation Belt Electrons Using the Kalman Filter  

E-Print Network (OSTI)

development Employment of solar cells and modules for hydrogen gen- eration Analysis of pv. Movable sample table of the solar simulator developed by ISFH. Abb. 5: Ministerialrat Dr. Hans Schroeder and Nuclear Safety on the features of the solar simulator SUSI I. Abb. 7: Bürgermeister Rolf Bremeyer bei der

240

SIAM J. APPL. MATH. c 2006 Society for Industrial and Applied Mathematics Vol. 66, No. 6, pp. 20852106  

E-Print Network (OSTI)

the computational cost by several orders of magni- tude with respect to the global energy-norm-based hp.1137/050631732 1. Introduction. A plethora of energy-norm-based algorithms intended to gen- erate optimal grids) to accurately solve a large class of engineering prob- lems. However, the energy-norm is a quantity of limited

Torres-Verdín, Carlos

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

RF CONTROL REQUIREMENTS FOR THE CEBAF ENERGY UPGRADE C. Hovater, J. Delayen, L. Merminga, T. Powers, C. Reece, Jefferson Lab, Newport News, VA  

E-Print Network (OSTI)

arXiv:physics/000908727Sep2000 MEASURING AND CONTROLLING ENERGY SPREAD IN CEBAF G. A. Krafft, J spread from a CEBAF-type machine to be relatively small; the measured energy spread from CEBAF at 4 Ge, the various subsystems contributing to the energy spread of a CEBAF-type accel- erator are reviewed, as well

242

IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 55, NO. 10, OCTOBER 2007 2043 Power Supply Rejection for RF Amplifiers  

E-Print Network (OSTI)

from noise or voltage ripple on the power supply. As demonstrated in Fig. 1, spectral energy injected the interaction of supply noise with RF amplifier components for successful design of the system. In the context noted, the op- erator is not fully symmetric in this representation because the supply noise and RF

Sanders, Seth

243

Theory of Quantum Transport in Mesoscopic Devices and its Potential for  

E-Print Network (OSTI)

Junction-Tandem - Solarcells: Ideal: For each Wave length a Semiconductor with optimised Energygap: · no Photons are lost 30 40 50 60 70 80 90 100 Real SC Carnot Ideal Tandem SC SC 3. Gen- eration (?) Plants 2-Band SC Year into electrical power) 2. Use Temperature gradients in Solar Cells to increase total efficiency 3. What

244

A New Approach of Performance Improvement for Server Selection in Reliable Server Pooling Systems  

E-Print Network (OSTI)

. The Server Selection by PR and PU be acknowledged by the PE within a given timeout) and propagates the service of a pool given by its PH, a PU requests a PE selection from an arbitrary PR of the op- eration the list of PE identities selected by the PR into its local cache (denoted as PU-side cache). From

Dreibholz, Thomas

245

IEEE JOURNAL OF QUANTUM ELECTRONICS, VOL. 45, NO. 11, NOVEMBER 2009 1465 Cerenkov-Type Second-Harmonic Generation in  

E-Print Network (OSTI)

IEEE JOURNAL OF QUANTUM ELECTRONICS, VOL. 45, NO. 11, NOVEMBER 2009 1465 Cerenkov-Type Second the Cerenkov-type second-harmonic gen- eration in several different two-dimensional nonlinear photonic observe either single or double Cerenkov-like second-harmonic rings. We discuss the properties

Arie, Ady

246

Environmental Compliance 2-1 2. Environmental Compliance  

E-Print Network (OSTI)

operate under leasing arrangements at the ETTP under the DOE Rein- dustrialization Program. LesseesEnvironmental Compliance 2-1 2. Environmental Compliance It is DOE-ORO and National Nuclear, executive orders, DOE orders (as incorporated into the op- erating contracts), and best management practices

Pennycook, Steve

247

Extending the Photon Mapping Method for Realistic Rendering of Hot Gaseous Fluids  

E-Print Network (OSTI)

fluid dynamics have proved very successful. As a result, diverse physically based fluid animation fluids. In addition to the generation of ap- pealing motions of gaseous fluids, several inter- esting, they are gen- erated within the gaseous fluid, but an energy value is assigned to each one according to the to

Texas at Austin, University of

248

Lecture Notes Week 3 1 Reversal Distances (continued) - CECM  

E-Print Network (OSTI)

Jun 18, 2010 ... Real world data does exist that is commuting and .... However, the price to pay for being able to model all of these op- erations in a single .... However, this time our picture is slightly different due to the presence of telomeres.

249

Molecular Cell Noncooperative Interactions between Transcription  

E-Print Network (OSTI)

the definition of anatomical boundaries during development. Here we show that NF-kB, a TF controlling noncoop- eratively. We observed that increasing concentra- tions of NF-kB are translated into gradual by combining quantitative measurements and a minimal physical model of an NF-kB-dependent promoter. We

Bulyk, Martha L.

250

Sustainable Urban Water Management James P. Heaney, Len Wright, and David Sample  

E-Print Network (OSTI)

ORIGINAL ARTICLE The structure of the bacterial and archaeal community in a biogas digester. Anaerobic fermentation of waste biomass not only gen- erates biogas fuel for cooking, lighting and heating biogas digesters at different scales and for different applications for treating rural wastes is well

Pitt, Robert E.

251

Fusion Engineering and Design 88 (2013) 317326 Contents lists available at SciVerse ScienceDirect  

E-Print Network (OSTI)

- eration is the production of large amounts of mud-like, gray-color impurities in the form of a surface be setup in the loop components to be cleaned up. If the amount of solid residuals is large, the cleaning and the flow passage is similar to that normally used, except for the setup of two large diameter cylinders

Abdou, Mohamed

252

PHYSICAL REVIEW A VOLUME 46, NUMBER 1 1 JULY 1992 Optically excited Zeeman coherences in atomic ground states: Nuclear-spin effects  

E-Print Network (OSTI)

=+ in Na, I =$ in Cs). The 46- J =+ electronic ground state consists then of two degen- erate substates ground states: Nuclear-spin effects Dieter Suter Instituteof are usually interpreted in terms of the J=1/2 ground state, treating the electronic ground state

Suter, Dieter

253

Macroelectronics: Perspectives on Technology and Applications  

E-Print Network (OSTI)

Alam are with the School of Electrical and Computer Engineering, Purdue University, West Lafayette conditions such as impact, loading abrasion, op- erator abuse, or neglect. These factors can have serious that they might ultimately lead to an earthquake forecasting capability [2], [3]. These SAR systems will provide

Rogers, John A.

254

2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 3357 www.advmat.de  

E-Print Network (OSTI)

and Engineering Pennsylvania State University University Park, PA 16802, USA DOI: 10.1002/adma.201300757 Complex to their unique physical properties and new possibilities for next-gen- eration electronic devices.[1- onstrated by scanning probe techniques.[10­12] Several possible mechanisms have been proposed to explain

Chen, Long-Qing

255

National Aeronautics and Space Administration April 2012  

E-Print Network (OSTI)

titanium-H2 O Loop Heat Pipe system (interdependency with TA14), complete verification plan for 200k PPUCFM & XFER Adv Heat Rejection Beamed Energy Orbital (microsat) Beamed Energy Suborbital Fusion Thrust systems that op- erate through chemical reactions to heat and ex- pand a propellant (or use a fluid

256

National Aeronautics and Space Administration November 2010  

E-Print Network (OSTI)

titanium-H2 O Loop Heat Pipe system (interdependency with TA14), complete verification plan for 200k PPUCFM & XFER Adv Heat Rejection Beamed Energy Orbital (microsat) Beamed Energy Suborbital Fusion Thrust systems that op- erate through chemical reactions to heat and ex- pand a propellant (or use a fluid

257

Advanced titania nanostructures and composites for lithium ion battery  

E-Print Network (OSTI)

in hybrid electric vehicles (HEVs), plug-in hybrid electric vehicles (PHEVs), and other electric utilities gen- eration of energy storage technologies applied in hybrid electric vehicles (HEVs) [2], plug-in hybrid electric vehicles (PHEVs) [3, 4], and storage systems for renew- able and intermittent energy

Guo, John Zhanhu

258

View  

Science Conference Proceedings (OSTI)

Feb 16, 1998 ... temperatures and quenched by injecting helium gas. All processes ..... retrofitted with mushroom shaped TiB2-G cathode elements and op- erated for ..... same time improving the formability of alloys and reducing the natural aging rate. .... of many magnesium die castings in production vehicles. In order for...

259

NIST CENTER FOR NEUTRON RESEARCH LAYOUT  

Science Conference Proceedings (OSTI)

... 17 18 19 13 13 Spin Echo Spectrometer offer- ing neV energy resolution, based upon Jlich design, sponsored by NIST, Jlich, and ExxonMobil. ...

2001-02-27T23:59:59.000Z

260

COMPARISON OF PROPORTIONAL AND ON/OFF COLLECTOR LOOP CONTROL STRATEGIES USING A DYNAMIC COLLECTOR MODEL  

E-Print Network (OSTI)

Department of Energy. "Solar heating and Cooling ProjectProgram." ings of the Solar Heating and Operational Resultsin the Control of Solar Heating and Cooling Systems."

Schiller, Steven R.

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

China Energy Databook - Rev. 4  

E-Print Network (OSTI)

com- mercial energy source, petroleum began contribut- ing aFrom British Petroleum. Source: China Energy StatisticalSource: United Nations, 1994; World Energy Council, 1992; British Petroleum,

Sinton Editor, J.E.

2010-01-01T23:59:59.000Z

262

An Attractor-Repeller Approach to Floorplanning  

E-Print Network (OSTI)

ing the optimal positions for a given set of modules of fixed area (but perhaps ...... 51. This problem has 10 mobile modules. (departments) and, in contrast with...

263

Markets expect Marcellus growth to drive Appalachian natural gas ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

264

Why Sandia?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia? Sandia was doing cyber before the term cyberspace existed. Today, with cybersecurity a daunting - and rapidly grow- ing - national security problem, Sandia is applying...

265

FEMP Outdoor Solid State Lighting Intiative: Resources for Outdoor...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fact Sheet - The Consortium shares technical information and experi- ences related to LED street and area light- ing demonstrations. The Consortium also serves as an objective...

266

Three Public Neighborhoods [EDRA / Places Awards -- Research  

E-Print Network (OSTI)

Enhanced maintenance and management performance. Improvedbetter maintenance, stricter management and increasedand management of the importance of their collective contribution to redevelopment and ongo- ing maintenance.

Nesmith, Barbara Stabin

2001-01-01T23:59:59.000Z

267

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... CAFE standards August 3, 2012 Fuel economy standards have affected vehicle efficiency.

268

Recently, S&P 500 Index and WTI crude oil futures price movements ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... One notable exception to this recent price correlation came on August 9.

269

STATE OF GREEN bUSINESS 2012  

Science Conference Proceedings (OSTI)

... Cool technologies are start- ing to make home energy efficiency more com ... years, hundreds of millions of households and businesses worldwide will ...

2013-07-29T23:59:59.000Z

270

Member News_Dec 2011_7M.indd - TMS  

Science Conference Proceedings (OSTI)

The nomination form and support- ing documentsincluding ... bridge University's science program, and then just to see ... a pipe organ construction business in.

271

METAHEURISTIC HYBRIDIZATION WITH GRASP 1. Introduction ...  

E-Print Network (OSTI)

Apr 14, 2008 ... ing, scheduling, inventory and production planning, and facility location. ..... that the size of the neighborhood be such that its exploration can.

272

Secretaries Chu and Salazar to Convene Meeting on Strengthening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commandant for Operations, United States Coast Guard Andrew Inglis, Chief Executive of Exploration & Production, BP Rex W. Tillerson, Chairman& CEO, ExxonMobil Hon. Don Winter,...

273

Shot boundary detection using the moving query window  

Science Conference Proceedings (OSTI)

... and after it will usually be near- symmetrical. ... while using only the luminance component of the ... Proceed- ings of the SPIE; Visualization and Optimi ...

2002-11-08T23:59:59.000Z

274

Georgia - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Georgia's power grid was previously part of an integrated South Caucasus network.

275

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

276

FLAMMABILITY OF HFC/HCFC -AIR MIXTURES AT ...  

Science Conference Proceedings (OSTI)

... a hatch for inspection and cleaning, sockets for installation of pressure transducers, thermocouples and an igniter and a jacket for thermostat- ing. ...

2011-10-13T23:59:59.000Z

277

View / Download - TMS  

Science Conference Proceedings (OSTI)

neer at EWI, Columbus, Ohio. Work- ing in the materials group, he provides expertise on ceramics and fundamen- tal materials science to clients in such.

278

Assessment of Hybrid Geothermal Heat Pump Systems - Technology...  

NLE Websites -- All DOE Office Websites (Extended Search)

cool- ing needs of the building and offers general guidelines Assessment of Hybrid Geothermal Heat Pump Systems Geothermal heat pumps offer attractive choice for space...

279

February 2010 TOC.indd  

Science Conference Proceedings (OSTI)

Feb 2, 2010 ... and geothermal power is available. Ad- ditional sources of hydro power are be- ing developed in China and Brazil and this trend is expected to...

280

Estimation of Hurricane Wind Speed Probabilities: Application ...  

Science Conference Proceedings (OSTI)

... of experienc- ing nonlinear behavior under exceptionally strong windstorm events, or for the design of Liquid Natural Gas (LNG) facilities, required ...

2013-07-26T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Sandia Labs Accomplishments 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

THz transceiver. Engineering sciences The first large-scale liquefied natural gas (LNG) fire test in the Phoenix series was successfully conducted. The result- ing fire was...

282

DISTRIBUTED SENSOR PROCESSING OVER AN AD HOC ...  

Science Conference Proceedings (OSTI)

... ing mechanisms that consider the remaining battery life of a node? ... The Linked Cluster algorithm (LCA) [1] was used to self-organize the network ...

2009-02-03T23:59:59.000Z

283

Impact of Ground-level Aviation Emissions on Air Quality in the Western United States.  

E-Print Network (OSTI)

??The aviation industry has experienced sustained growth since its inception result- ing in an increase in air pollutant emissions. Exposure to particulate matter less than (more)

Clark, Eric Edward

2010-01-01T23:59:59.000Z

284

View / Download  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames

285

COMMUNICATIONS OF THE ACM January 2002/Vol. 45, No. 1 43 ameBots [1] is a virtual reality  

E-Print Network (OSTI)

is available in Tcl/Tk, Java, C/C++, and more. Tools for visualiz- ing the terrain in which agents interact

Kaminka, Gal A.

286

SHA-3 Conference, August 2010, CubeHash  

Science Conference Proceedings (OSTI)

... he analysis! ... were the easy issues. issues, most interesting arty analyses of CubeHash: ingly sophisticated ntial attacks. ... No Limited RAM size? ...

2012-05-30T23:59:59.000Z

287

Health and Rights at the Margins  

E-Print Network (OSTI)

City, on the China-Myanmar line, the flow of drugs, people,in China when a study found that 146 inject- ing drug users

Shih, Elena

2012-01-01T23:59:59.000Z

288

A NONSTANDARD SIMPLEX ALGORITHM FOR LINEAR ...  

E-Print Network (OSTI)

standard simplex algorithm. 2. Pivoting operations. In the next section, we describe column and row pivot- ing operations. This topic is closely related to the ...

289

eTuner: tuning schema matching software using synthetic scenarios  

Science Conference Proceedings (OSTI)

ranked list of answers to the human user. In such sce- narios ... manually, largely by trial and error a time consum- ing, frustrating, and error prone process.

290

OP - SFNET - Volume 15, Number 2 March 15, 2008  

Science Conference Proceedings (OSTI)

... ing WAVE - WAVElets S - Signal processing People interested in attending the workshop and/or the banquet can register using the website http ...

2008-06-30T23:59:59.000Z

291

Gender and Modernity in Colonial Korea  

E-Print Network (OSTI)

by Jennifer J. Jung-Kim Gender & Modernity in Colonial Koreathe ongo- ing reformulation of gender identities. First, Iupdate he reconstruction of gender identities My findings

Jung-Kim, Jennifer J.

2006-01-01T23:59:59.000Z

292

Table 5.13d Petroleum Consumption Estimates: Electric ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, ... For 1949-1979, data are for gas turbine and internal combustion plant use of petroleum. For 1980-2000, ...

293

MEASUREMENT SCIENCE AND TECHNOLOGY FOR THE ...  

Science Conference Proceedings (OSTI)

... To boost fuel efficiency, the US auto industry is striv- ing to manufacture cars from lightweight ... for evaluating how parts of a hydro- gen pipeline ...

2012-11-14T23:59:59.000Z

294

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

Department of Energy, Energy Storage Division through thegeneration and energy storage, Presented at Frontiers ofIn Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

295

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

aquifers for thermal energy storage. Problems outlined aboveModeling of Thermal Energy Storage in Aquifers," Proceed-ings of Aquifer Thermal Energy Storage Workshop, Lawrence

Tsang, C.-F.

2011-01-01T23:59:59.000Z

296

Exhibition Directory  

Science Conference Proceedings (OSTI)

Feb 7, 2008 ... Fundamentals ..... ing ASM Handbooks Online, ASM Alloy Center and the Al- ..... sales engineers to answer any questions you may have.

297

Automated extraction and classification of thunderstorm and ...  

Science Conference Proceedings (OSTI)

... found that thunder- storms dominated the wind climate in West Texas. ... may be unrealistically long, suggest- ing that intermediate beginning and ...

2013-01-17T23:59:59.000Z

298

Total Energy - Data - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

299

Press Room - Press Releases - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

300

The Ethics of Industry Experimentation Using Employees: The Case of Taste-Testing Pesticide-Treated Tobacco  

E-Print Network (OSTI)

RJ, Barbeau EM. Tobacco industry documents: com- paring theRE, Balbach ED. Tobacco industry documents: treasure trovecombined meet- ing of the Industry Technical Committee and

McDaniel, Patricia A; Solomon, Gina; Malone, Ruth E

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Ctontents  

Science Conference Proceedings (OSTI)

... "Time that material started flaming where ... a 4D shift from left to right, and start- ing with ... by repeating the length change calcula- tions starting at the ...

2003-10-14T23:59:59.000Z

302

A new lower bound for one-machine earliness-tardiness scheduling  

E-Print Network (OSTI)

the 50-job instances remain unsolved within a large time limit. ..... Our heuristic is based on the analysis of the pseudo-schedule correspond- ing to the optimum...

303

The NIST Length Scale Interferometer  

Science Conference Proceedings (OSTI)

... This approach to measurements was pioneered by Churchill ... as part of this study of systematic effects but ... the stand- ing wave train between the ...

2013-10-22T23:59:59.000Z

304

International Carbon Dioxide Emissions and Carbon Intensity  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

305

Angola - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... but in the short-term access to power will remain a challenge.

306

Few transportation fuels surpass the energy densities of gasoline ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

307

Fast dimensional inspection of deformable parts from partial views Andres Jaramillo a  

E-Print Network (OSTI)

Nacional de Colombia, Cra 27 No. 64-60 Manizales, Caldas, Colombia b Depto. Ing. Meca´nica y Mecatro

Alberta, University of

308

Qatar - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, ... voluntary report- ing, ... Qatar's Oryx GTL project is in operation and the Pearl GTL project is expected to begin ...

309

Invariant semidefinite programs - Optimization Online  

E-Print Network (OSTI)

V.I. Levenshtein, Universal bounds for codes and designs, in Handbook of Cod- ing Theory, eds V. Pless and W. C. Huffmann, Amsterdam: Elsevier, 1998,.

310

Structural Changes During Thermal Fatigue of Two Nickel-Based ...  

Science Conference Proceedings (OSTI)

greatly affect the thermal endurance of these heat-resisting alloys. I?. ... factors govern- ing the thermal fatigue behavior of a number of commercial nickel-.

311

Netherlands - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (BkWh) of electricity in 2011, mostly from conventional thermal power plants.

312

--No Title--  

Annual Energy Outlook 2012 (EIA)

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

313

at Clemson University Department of Forest Resources  

E-Print Network (OSTI)

prediction. For. Sci. 54(5):553­566. ZHANG, L., J.A. MOORE, AND J.D. NEWBERRY. 1993. Disaggregat- ing stand

Bolding, M. Chad

314

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

315

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

using aquifers for thermal energy storage. Problems outlinedmatical Modeling of Thermal Energy Storage in Aquifers,"Proceed- ings of Aquifer Thermal Energy Storage Workshop,

Tsang, C.-F.

2011-01-01T23:59:59.000Z

316

U.S. energy intensity projected to continue its steady decline ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Light-duty vehicles are by far the largest energy consuming part of ...

317

Homeward Bound: Food-Related Transportation Strategies in Low Income and Transit Dependent Communities  

E-Print Network (OSTI)

s Ad Hoc Food Security ing Home the Broccoli: Innovativeor administrative home for food security planning, includingtheir goods home. broadly, food security approaches. The

Gottlieb, Robert; Fisher, Andrew; Dohan, Marc; O'Connor, Linda; Parks, Virginia

1996-01-01T23:59:59.000Z

318

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... A report of historical annual energy statistics. For many series, ...

319

View / Download - TMS  

Science Conference Proceedings (OSTI)

neering at the University of Leeds,. United Kingdom. She received the award for research on bioengineer- ing, in particular on the tribology of hip replacements.

320

Die emanzipierte Emanzipationsgegnerin: Caroline Pichlers theoretische Schriften  

E-Print Network (OSTI)

Lit- eraturwissenschaft. Hrsg. Inge Stephan und SigridVon Brgern und ihren Frauen. Hrsg. Mar- gret Friedrich undEin Bonner Symposium. Hrsg. Karl Konrad Polheim. Bonn:

Laukov, Lucia

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

NANOSTRUCTURED CATALYTIC MEMBRANES - Argonne National Laboratory  

different sources, including coal, natural gas, or biomass such as corn. NCMs also can be used for selective ... ing production costs, and improving ...

322

A Provably Secure Operating System  

Science Conference Proceedings (OSTI)

... ing availability of desired facilities, correctness of ... hierarchical structure and the doctrine of invisibility of ... An on-line facility for interactive editing of ...

2013-04-15T23:59:59.000Z

323

Passive Cooling of a Micromechanical Oscillator with a ...  

Science Conference Proceedings (OSTI)

... Closely related passive cooling has been reported in [9,20 ... Although rather modest cooling is obtained here ... eventually provide ground state cool- ing ...

2007-09-26T23:59:59.000Z

324

Section 4.1.3 Natural Ventilation: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

in and through build- ings. These airflows may be used both for ventilation air and for passive cooling strategies. Natural ventila- tion is often strongly preferred by building...

325

Cooperative motions in supercooled liquids and glasses  

E-Print Network (OSTI)

method[167, 168, 169] (WHAM). The resulting free energy pro?in ?gure 5.4a. Us- ing WHAM and the library construction

Stevenson, Jacob D.

2009-01-01T23:59:59.000Z

326

How much tax do we pay on a gallon of gasoline and diesel fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

327

Does EIA publish off-road diesel fuel prices? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

328

Laser Plasma Particle Accelerators: Large Fields for Smaller Facility Sources  

E-Print Network (OSTI)

Scientific Comput- ing (NERSC) Center Analytics Team, usingsimulations on Seaborg at NERSC, made possible by an INCITEand ongoing work on Franklin at NERSC and Atlas at Lawrence

Geddes, Cameron G.R.

2010-01-01T23:59:59.000Z

329

What do you prefer? Using Preferences to Enhance Learning Technology  

E-Print Network (OSTI)

-based courses to self-organized home-based learning mak- ing use of on-line material. These courses might target

Olmedilla, Daniel

330

Basing Transport Planning on Principles of Social Justice  

E-Print Network (OSTI)

M. Frost, et al. (2000). Transport and Social Exclusion inG. Willumsen. (1994). Modelling Transport. Chichester: JohnG. Willumsen. (2001). Modelling Transport. Chichester: John

Martens, Karel

2006-01-01T23:59:59.000Z

331

A GENETIC ALGORITHM FOR THE WEIGHT SETTING PROBLEM ...  

E-Print Network (OSTI)

Oct 9, 2001 ... versity of Michigan, 1971. [16] Internet Engineering Task Force. Ospf version 2. Technical Report RFC 1583, Network Work- ing Group, 1994.

332

GROWTH OF PACIFIC SAUR~ COWLABlS SAlRA, IN THE NORTHEASTERN AND NORTHWESTERN PACIFIC OCEANI  

E-Print Network (OSTI)

on the embryonic development of killifish rpnnl"t.p.1i hv Arm"trona "nli r.h;]n il QAI'\\ {)h".,.r,,_ ing

333

Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

334

MOST Multiple Objective Spanning Trees Repository Project  

E-Print Network (OSTI)

VLSI layout, electricity, water, telecommunication or traffic networks. (Sack and ... a set of trade-off compromises between all concurring weights, result- ing in a...

335

Vehicle use varies across U.S. regions - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Reliance on vehicles can vary significantly across the United States.

336

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, ...

337

Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, 1949-2010:

338

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... flexible fuel vehicles October 10, 2013 New-vehicle fuel economy continues to increase.

339

Essays on Foreign Direct Investment, Growth and the Environment  

E-Print Network (OSTI)

high levels of capital intensity. The principal limitationof labor at current capital intensity using the base-periodlabor at base-period capital intensity us- ing the current

Gu, Waner

2011-01-01T23:59:59.000Z

340

Energy Star Building Upgrade Manual Introduction Chapter 1  

NLE Websites -- All DOE Office Websites (Extended Search)

offer- ings. The label now covers new homes, commercial and institutional buildings, residential heating and cooling equipment, major appliances, office equipment, lighting,...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

342

Legal Metrology Devices Program  

Science Conference Proceedings (OSTI)

... such as retail motor-fuel dispensers or gas pumps, vehicle mounted meters for delivering home heating oil, and liquefied petroleum gas liquid-ing ...

2013-07-31T23:59:59.000Z

343

Planning Water Use in California  

E-Print Network (OSTI)

the University of Maryland Water Policy Collaborative, 2006.FURTH ER READ ING California Department of Water Resources.California Water Plan Update 2005: A Framework for Action.

Eisenstein, William; Kondolf, G. Mathias

2008-01-01T23:59:59.000Z

344

Using seafloor geodesy to monitor volcanic collapse on the south flank of Kilauea Volcano, Hawaii  

E-Print Network (OSTI)

accommodat- ing subsidence in the summit caldera (Lipman etshow the amount of subsidence (in meters) measured theremagnitude seaward slip and subsidence on the south ?ank as

Phillips, Kathleen A.

2006-01-01T23:59:59.000Z

345

Domestic Violence and Risk Factors among Korean Immigrant ...  

Science Conference Proceedings (OSTI)

Mar 23, 2007 ... ing laundry (Wife), driving the car (Husband), shopping for groceries (Wife), paying bills (Both), taking care of the chil- dren (Wife), disciplining...

346

Review of Literature Related to Residential Ventilation Requirements  

E-Print Network (OSTI)

Refrigerating, and Air -Conditioning Engineers, Atlanta, GRefrigerat ing, and Air-Conditioning Engineers, Atlanta, Gof Ventilation and Air Conditioning: Is C E R N up to Date

McWilliams, Jennifer; Sherman, Max

2005-01-01T23:59:59.000Z

347

China consumes nearly as much coal as the rest of the world ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

348

Ohio - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... Ohio Energy Resources Division;

349

X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

evacuations. Following the storm-related interruptions to production, refin- xii Energy Information AdministrationPetroleum Marketing Annual 2002 ing, and delivery...

350

Blanchard Cr JohnsonGulch  

E-Print Network (OSTI)

Whale Cr Tepee Cr Thoma Cr KintlaCr Logg ing Cr Anaconda Cr Bo wmanCr Kintla Cr Cam a s Cr A naco nda

351

Next generation solutions for the energy services industry  

E-Print Network (OSTI)

to target cost-effective energy efficiency upgrades. and analyze energy efficiency cost and performance data canEnergy Efficiency Services to Large Commercial Firms: Operat- ing Cost

Kumar, Satish; Kromer, Steve

2006-01-01T23:59:59.000Z

352

South Carolina - State Energy Profile Analysis - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

353

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

354

U.S. States - Maps - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

355

Georgia - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

356

Rhode Island - State Energy Profile Overview - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

357

United States - Rankings - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

358

Delaware - Compare - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

359

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

360

Statistical Analysis of Dross Data for Hydro Aluminium Casthouses  

Science Conference Proceedings (OSTI)

Presentation Title, Statistical Analysis of Dross Data for Hydro Aluminium Casthouses. Author(s), Christian Rosenkilde, Inge Johansen, Amanda Bowles. On-Site...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Land Use Planning to Promote Marine Conservation of Coral reef Ecosystems in Moorea, French Polynesia  

E-Print Network (OSTI)

material, creat- ing rich compost that can be used forcrops. Manage Solids Compost: Pig waste and carcasses can bematerials such as mats. Compost Solid waste from the solid

Timothy Duane

2006-01-01T23:59:59.000Z

362

The Cultivar newsletter, Spring/Summer 2005  

E-Print Network (OSTI)

to disease; and incorporating compost to enhance biologicalways to adjust fertilizer and compost levels and applicationSUMMER 2005 ing pre-plant compost applications, especially

Brown, Martha

2005-01-01T23:59:59.000Z

363

The Riemann Hypothesis Peter Borwein - CECM  

E-Print Network (OSTI)

The distribution of such prime numbers among all natural numbers does ... ing the distribution of prime numbers. ... inent mathematician of his generation, raised .

364

The Influence of VIM Crucible Composition, Vacuum Arc Remelting ...  

Science Conference Proceedings (OSTI)

ing a weight of 23 kilograms. (50 pounds). The as-cast ingot surface was maintained on all ingots. VIM Ingot Cleanliness. Evaluation. The cleanliness evaluation.

365

Research Article A Comprehensive Evaluation of Indoor ...  

Science Conference Proceedings (OSTI)

... fixed-length sliding window originat- ing at the beginning of the impulse response ... ments with range below 10 m to protect it from over- load and also ...

2007-12-10T23:59:59.000Z

366

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

367

Highlights Year in Review - 2004 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Highlights Year in Review - 2004 International crude oil prices rose considerably dur-ing 2004. While many issues contributed to higher prices, perhaps the most ...

368

Meso-machining  

NLE Websites -- All DOE Office Websites (Extended Search)

following meso-machin- ing technologies: * Focused ion beam (FIB) machining, * Micro-milling and -turning, * Femto-second laser machining * Micro-Electro Discharge Machining...

369

View / Download  

Science Conference Proceedings (OSTI)

director of the Quad Cities Manufac- turing Laboratory, a nonprofit research and development company in the Rock. Island ArsenalJoint Manufactur- ing and...

370

View / Download - TMS  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames ...

371

CONTROL OF POPULATION DENSITIES SURROUNDING NUCLEAR POWER PLANTS. VOLUME 5 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

Commission. Office of Nuclear Reactor Licens- ing. StandardCommission. Office of Nuclear Reactor Regula- tion.Nuclear Regulatory Commission Standard Review Plan for Light Water Reactor

Nero, jA.V.

2010-01-01T23:59:59.000Z

372

Advanced Modeling and Evaluation of the Response of Base-Isolated Nuclear Facility Structures to Vertical Earthquake Excitation  

E-Print Network (OSTI)

II Offshore Platforms. environmentalprotection.com.retrofit of Chirag 1 offshore platform, Proceed- ings, Int.have been used for offshore oil platforms including the

Keldrauk, Eric Scott

2012-01-01T23:59:59.000Z

373

Evince Technology | Open Energy Information  

Open Energy Info (EERE)

Evince Technology Jump to: navigation, search Name Evince Technology Place United Kingdom Sector Efficiency, Wind energy Product String representation "Evince has pion ... ing...

374

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

375

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

376

Berkeley Lab Computing Sciences: Accelerating Scientific Discovery  

E-Print Network (OSTI)

facilities NERSC and ESnet and by conduct- ing appliedCOMPUTATIONAL SCIENCE ESnet is a reliable, high- bandwidthdevelopment. NERSC and ESnet staff participate in advanced

Hules, John A

2009-01-01T23:59:59.000Z

377

Quinine, an old anti-malarial drug in a modern world: role in the treatment of malaria  

E-Print Network (OSTI)

versus quinine-doxycycline in the Western Amazon region ofof quinine plus doxycycline, tetracycline or clindamycin astreated with quinine+doxycycline [46]. Consider- ing the

2011-01-01T23:59:59.000Z

378

Application of a simple and sensitive GCMS method for ...  

Science Conference Proceedings (OSTI)

ing with isopropanol, deionized water, and isopropanol, dried at room ... several months after the last intake, because they enter the hair roots from the...

379

Meshless Deformable Models for LV Motion Analysis Xiaoxu Wang Dimitis Metaxas  

E-Print Network (OSTI)

-Assisted Intervention, pages 469­476, 2007. 6 [3] T. Chen, S. Chung, and L. Axel. Automated tag tracking us- ing gabor

380

Physical Similitude in Hierarchical Engineered Systems  

E-Print Network (OSTI)

scal- ing methodology for severe accident technical issuein the case of severe accidents, bismuth alloys have beenexperiments investigating severe accident phenomenology are

Blandford, Edward David

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

1471-2164-10-34.fm  

NLE Websites -- All DOE Office Websites (Extended Search)

of Z. mobilis for bio-ethanol fermentation from the lignocellulosic res- idues such as corn stover 9. Z. mobilis ferments glucose, fructose, and sucrose produc- ing ethanol...

382

Can feedstock production for biofuels be sustainable in California?  

E-Print Network (OSTI)

gallons annually of corn ethanol, 1 bil- lion gallons oflocations) and corn for ethanol, and oil palm, soybean andinvestment in corn-grain-based ethanol manufactur- ing in

Kaffka, Stephen R.

2009-01-01T23:59:59.000Z

383

High-rate chemical vapor deposition of nanocrystalline silicon carbide films by radio frequency thermal plasma  

E-Print Network (OSTI)

by liquid spray injection of disilanes into an argon­hydrogen RF plasma operat- ing at 20­40 kPa [4]. Here

Zachariah, Michael R.

384

RADIOLOGICAL HEALTH AND RELATED STANDARDS FOR NUCLEAR POWER PLANTS. VOLUME 2 OF HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

On the ather hand, ather radionuclides, such as I and Sr,The remain- ing radionuclides cantributed much less to thedoses Important radionuclides for background exposures and

Nero, A.V.

2010-01-01T23:59:59.000Z

385

Section 9.7 Employee Incentive Programs: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Management Awards are presented by DOE in conjunction with the Federal Interagency Energy Policy Committee (the "656" Committee). The program recognizes outstand- ing...

386

Coal - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Electric power sector consumption of coal by census region, 2010

387

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network (OSTI)

of iron de?ciency on photosynthesis Aimee M. Terauchi rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

388

DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

are potential raw materials for production of biofuels. TheRaw plant material, or dedicated bioenergy crops, can provide the starting point for mak- ing biofuels.

Gilbert, David

2009-01-01T23:59:59.000Z

389

STATEMENT OF CONSIDERATIONS CLASS WAIVER OF U.S. AND FOREIGN...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

model ing and simulation. This approach will harness the power of systems biology to overcome bioma ss recalcitrance. The BESC currently has eighteen members...

390

Synthesis of D-Glucose-1-C14 and D-Mannose-1-C14  

Science Conference Proceedings (OSTI)

... The product weighed 470 mg, rep- resenting a ... ing formation of esters, condensation products, and the ... The alco- holic liquors were neutralized with ...

2006-03-29T23:59:59.000Z

391

Distributed Energy Harvesting for Energy Neutral Sensor Networks  

E-Print Network (OSTI)

to exploit to develop piezoelectric energy harvesters. Manyenergy. Current piezoelectric energy harvest- ing researchwill improve piezoelectric energy harvesting technologys

Kansal, Aman; Srivastava, Mani B.

2005-01-01T23:59:59.000Z

392

Quantifying Changes in Building Electricity Use, with Application to Demand Response  

E-Print Network (OSTI)

build- ings, Journal of Solar Energy Engineering, vol. 120,buildings, Journal of Solar Energy Engineering, vol. 120,modeling, Journal of Solar Energy Engineering, vol. 120, p.

Mathieu, Johanna L.

2012-01-01T23:59:59.000Z

393

The TREC-2001 Video Track Report  

Science Conference Proceedings (OSTI)

... Marchionini, 2001), the NIST Digital Video Library (Over, 2001 ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

394

The TREC-2002 Video Track Report  

Science Conference Proceedings (OSTI)

... on Project RDD/G/235 to the British Library Research and ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

395

Blueberry research launches exciting new California specialty crop  

E-Print Network (OSTI)

2. Estimated highbush blueberry crop, 2004 State Growers whoin spearhead- ing specialty crops research and efforts tonew California specialty crop Manuel Jimenez Francis

Jimenez, Manuel; Carpenter, Francis; Molinar, Richard H.; Wright, Kathryn; Day, Kevin R.

2005-01-01T23:59:59.000Z

396

A Statistical Profile of Horticultural Crop Farm Industries in California  

E-Print Network (OSTI)

Profile of Horticultural Crop Farm Industries in Californiaproject funded by the Federal Crop Insurance Corporation,Williams. Model- ing Farm-Level Crop Insurance Demand with

Lee, Hyunok; Blank, Steven C.

2004-01-01T23:59:59.000Z

397

License Application Guidelines  

6. A review of the competition currently existing or expected to develop follow-ing introduction of the product. 7. A comparison of this product to ...

398

Instructions for use Phenomenology of supersymmetry SU5 GUT with neutrinophilic Higgs boson  

E-Print Network (OSTI)

of the primary goals of LHC is the search for the Higgs boson, the last miss- ing ingredient of the Standard

Tsunogai, Urumu

399

timeline_PNNL_PRINT.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

1997 PNNL developed a highly sensitive sampleranalyzer that can be used to prevent proliferation of nuclear weapons by remotely detect- ing trace quantities of materials...

400

BFRL98Annual Cvrs 1-4  

Science Conference Proceedings (OSTI)

... In addition to the programs of the individual ... of roof solar reflectance on the annual heat- ing ... BFRL's Thermal Analysis Research Program (TARP) for ...

2000-03-16T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

402

Technology Transfer Division - Los Alamos National Lab: National ...  

administer commercial, noncommercial, ... As one of the U.S. Department of Energys multiprogram, ... ing 47 technical areas with 8 million square feet under roof.

403

Monitoring Power Quality  

Science Conference Proceedings (OSTI)

... or without filter), isola- tion transformer, voltage regulator ... reality before expensive line condition- ing equipment is ... if any line conditioning is required. ...

2013-05-17T23:59:59.000Z

404

southeastern geographer, 44(1) 2004: pp. 814 Rethinking the Region  

E-Print Network (OSTI)

-runners, allow- ing for the sale of cotton to European mar- kets and the purchase of all-important guns and steel

Gamble, Douglas W.

405

48 CRO MAR/APR 2008 Climate Change  

E-Print Network (OSTI)

regulations that limit tobacco sales and public smoking. Similarly,therewillbenoscientificsmok- ing gun Companies looking for smoking gun should skip the science,looktotheeco

Hoffman, Andrew J.

406

Petroleum & Other Liquids - Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Projects published on Beta are not final and may not include up-to-date data.

407

Organization of IGCC processes with reduced order CFD models  

SciTech Connect

Integrated gasificationcombinedcycle(IGCC)plantshavesignificantadvantagesforefficientpowergen- eration withcarboncapture.Moreover,withthedevelopmentofaccurateCFDmodelsforgasificationand combined cyclecombustion,keyunitsoftheseprocessescannowbemodeledmoreaccurately.However, the integrationofCFDmodelswithinsteady-stateprocesssimulators,andsubsequentoptimizationof the integratedsystem,stillpresentssignificantchallenges.Thisstudydescribesthedevelopmentand demonstration ofareducedordermodeling(ROM)frameworkforthesetasks.Theapproachbuildson the conceptsofco-simulationandROMdevelopmentforprocessunitsdescribedinearlierstudies.Here we showhowtheROMsderivedfrombothgasificationandcombustionunitscanbeintegratedwithin an equation-orientedsimulationenvironmentfortheoveralloptimizationofanIGCCprocess.Inaddi- tion toasystematicapproachtoROMdevelopment,theapproachincludesvalidationtasksfortheCFD model aswellasclosed-looptestsfortheintegratedflowsheet.Thisapproachallowstheapplicationof equation-based nonlinearprogrammingalgorithmsandleadstofastoptimizationofCFD-basedprocess flowsheets. TheapproachisillustratedontwoflowsheetsbasedonIGCCtechnology.

Lang, Y.; Zitney, S.; Biegler, L.

2011-01-01T23:59:59.000Z

408

Distributed Generation Study/SUNY Buffalo | Open Energy Information  

Open Energy Info (EERE)

Distributed Generation Study/SUNY Buffalo Distributed Generation Study/SUNY Buffalo < Distributed Generation Study Jump to: navigation, search Study Location Buffalo, New York Site Description Institutional-School/University Study Type Long-term Monitoring Technology Microturbine Prime Mover Capstone C60 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Gerster Trane System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability None Power Rating 120 kW0.12 MW 120,000 W 120,000,000 mW 1.2e-4 GW 1.2e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 600000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2002/12/11 Monitoring Termination Date 2004/08/11

409

Distributed Generation Study/10 West 66th Street Corp | Open Energy  

Open Energy Info (EERE)

10 West 66th Street Corp 10 West 66th Street Corp < Distributed Generation Study Jump to: navigation, search Study Location New York, New York Site Description Residential-Multifamily-Single Building Study Type Long-term Monitoring Technology Microturbine Prime Mover Ingersoll Rand I-R PowerWorks 70 Heat Recovery Systems Built-in Fuel Natural Gas System Installer DSM Engineering System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 70 kW0.07 MW 70,000 W 70,000,000 mW 7.0e-5 GW 7.0e-8 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 300000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2005/11/17 Monitoring Termination Date 1969/12/31

410

Distributed Generation Study/Arrow Linen | Open Energy Information  

Open Energy Info (EERE)

Study/Arrow Linen Study/Arrow Linen < Distributed Generation Study Jump to: navigation, search Study Location Brooklyn, New York Site Description Commercial-Other Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Coast Intelligen 150-IC with ECS Heat Recovery Systems Built-in Fuel Natural Gas System Installer Energy Concepts System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability None Power Rating 300 kW0.3 MW 300,000 W 300,000,000 mW 3.0e-4 GW 3.0e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 3000000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2005/03/01 Monitoring Termination Date 1969/12/31

411

Distributed Generation Study/Elgin Community College | Open Energy  

Open Energy Info (EERE)

Elgin Community College Elgin Community College < Distributed Generation Study Jump to: navigation, search Study Location Elgin, Illinois Site Description Institutional-School/University Study Type Case Study Technology Internal Combustion Engine Prime Mover Waukesha VHP5108GL Heat Recovery Systems Beaird Maxim Model TRP-12 Fuel Natural Gas System Installer Morse Electric Company System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 4 Stand-alone Capability Manual Power Rating 3220 kW3.22 MW 3,220,000 W 3,220,000,000 mW 0.00322 GW 3.22e-6 TW Nominal Voltage (V) 4160 Heat Recovery Rating (BTU/hr) 11200000 Cooling Capacity (Refrig/Tons) 550 Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 1997/05/01

412

Distributed Generation Study/Wyoming County Community Hospital | Open  

Open Energy Info (EERE)

Wyoming County Community Hospital Wyoming County Community Hospital < Distributed Generation Study Jump to: navigation, search Study Location Warsaw, New York Site Description Institutional-Hospital/Health Care Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Waukesha VGF L36GSID Heat Recovery Systems Built-in Fuel Natural Gas System Installer Gerster Trane System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability Seamless Power Rating 560 kW0.56 MW 560,000 W 560,000,000 mW 5.6e-4 GW 5.6e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 1000000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2001/09/26

413

 

U.S. Energy Information Administration (EIA) Indexed Site

PROGRAM TO CREATE FORMAT LIBRARY FOR THE 1989 CBECS DATA PROGRAM TO CREATE FORMAT LIBRARY FOR THE 1989 CBECS DATA PROC FORMAT LIBRARY=SASLIB; VALUE $ACTIVTY ' ' = 'Inapplicable' '01' = 'Vacant' '02' = 'Office' '03' = 'Mercantile/services' '04' = 'Assembly' '05' = 'Food sales' '06' = 'Public order/safety' '07' = 'Health care (outpatient)' '08' = 'Industrial' '09' = 'Agricultural' '10' = 'Laboratory' '11' = 'Warehouse (refrig.)' '12' = 'Warehouse (nonrefrig.)' '13' = 'Education' '14' = 'Food service' '15' = 'Health care (inpatient)' '16' = 'Skilled nursing' '17' = 'Lodging' '18' = 'Residential' '19' = 'Parking garage' '20' = 'Other' '98' = 'Don''t know' '99' = 'Not ascertained'; VALUE $BILTYP ' ' = 'Inapplicable' '1' = 'One bill' '2' = 'More than one bill' '7' = 'Not billed' '8' = 'Don''t know' '9' = 'Missing'; VALUE $BLDGCL ' ' = 'Inapplicable'

414

Distributed Generation Study/Patterson Farms CHP System Using Renewable  

Open Energy Info (EERE)

Farms CHP System Using Renewable Farms CHP System Using Renewable Biogas < Distributed Generation Study Jump to: navigation, search Study Location Auburn, New York Site Description Agricultural Study Type Field Test Technology Internal Combustion Engine Prime Mover Caterpillar G379 Heat Recovery Systems Built-in Fuel Biogas System Installer Martin Machinery System Enclosure Dedicated Shelter System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 200 kW0.2 MW 200,000 W 200,000,000 mW 2.0e-4 GW 2.0e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 1366072 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Custom Made Component Integration Customer Assembled Start Date 2007/05/02 Monitoring Termination Date 2007/05/26

415

Distributed Generation Study/Sea Rise 2 | Open Energy Information  

Open Energy Info (EERE)

Distributed Generation Study Distributed Generation Study Jump to: navigation, search Study Location Brooklyn, New York Site Description Residential-Multifamily-Single Building Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Coast Intelligen CI60 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Grenadier Realty System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability None Power Rating 120 kW0.12 MW 120,000 W 120,000,000 mW 1.2e-4 GW 1.2e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 1300000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2006/08/30 Monitoring Termination Date 1969/12/31

416

Distributed Generation Study/Tudor Gardens | Open Energy Information  

Open Energy Info (EERE)

Tudor Gardens Tudor Gardens < Distributed Generation Study Jump to: navigation, search Study Location New York, New York Site Description Residential-Multifamily-Single Building Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Tecogen CM-75 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Aegis Energy System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability None Power Rating 150 kW0.15 MW 150,000 W 150,000,000 mW 1.5e-4 GW 1.5e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 980000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2005/07/01 Monitoring Termination Date 1969/12/31

417

Distributed Generation Study/Patterson Farms | Open Energy Information  

Open Energy Info (EERE)

Farms Farms < Distributed Generation Study Jump to: navigation, search Study Location Auburn, New York Site Description Agricultural Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Caterpillar G3508 Heat Recovery Systems Built-in Fuel Biogas System Installer RCM Digesters System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability Seamless Power Rating 180 kW0.18 MW 180,000 W 180,000,000 mW 1.8e-4 GW 1.8e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 2000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2006/03/10 Monitoring Termination Date 1969/12/31 Primary Power Application Based Load

418

Distributed Generation Study/Oakwood Health Care Center | Open Energy  

Open Energy Info (EERE)

Oakwood Health Care Center Oakwood Health Care Center < Distributed Generation Study Jump to: navigation, search Study Location Williamsville, New York Site Description Institutional-Hospital/Health Care Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Waukesha VGF 18GLD Heat Recovery Systems Built-in Fuel Natural Gas System Installer Gerster Trane System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability Seamless Power Rating 600 kW0.6 MW 600,000 W 600,000,000 mW 6.0e-4 GW 6.0e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 2800000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2001/12/20 Monitoring Termination Date 2003/01/03

419

Distributed Generation Study/Sea Rise 1 | Open Energy Information  

Open Energy Info (EERE)

Distributed Generation Study Distributed Generation Study Jump to: navigation, search Study Location Brooklyn, New York Site Description Residential-Multifamily-Single Building Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Coast Intelligen CI60 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Grenadier Realty System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability None Power Rating 120 kW0.12 MW 120,000 W 120,000,000 mW 1.2e-4 GW 1.2e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 1300000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2006/08/30 Monitoring Termination Date 1969/12/31

420

Distributed Generation Study/Matlink Farm | Open Energy Information  

Open Energy Info (EERE)

Matlink Farm Matlink Farm < Distributed Generation Study Jump to: navigation, search Study Location Clymers, New York Site Description Agricultural Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Waukesha 145 Heat Recovery Systems Built-in Fuel Biogas System Installer Martin Machine System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 145 kW0.145 MW 145,000 W 145,000,000 mW 1.45e-4 GW 1.45e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 1500000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2004/10/28 Monitoring Termination Date 2005/07/16 Primary Power Application Based Load

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Distributed Generation Study/Modern Landfill | Open Energy Information  

Open Energy Info (EERE)

Landfill Landfill < Distributed Generation Study Jump to: navigation, search Study Location Model City, New York Site Description Other Utility Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Caterpillar G3516 Heat Recovery Systems Built-in Fuel Biogas System Installer Innovative Energy Systems System Enclosure Dedicated Shelter System Application Combined Heat and Power Number of Prime Movers 7 Stand-alone Capability Seamless Power Rating 5600 kW5.6 MW 5,600,000 W 5,600,000,000 mW 0.0056 GW 5.6e-6 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 28000000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Off-the-Shelf Component Integration Customer Assembled Start Date 2004/12/31 Monitoring Termination Date 1969/12/31

422

Distributed Generation Study/VIP Country Club | Open Energy Information  

Open Energy Info (EERE)

VIP Country Club VIP Country Club < Distributed Generation Study Jump to: navigation, search Study Location New Rochelle, New York Site Description Commercial-Other Study Type Long-term Monitoring Technology Microturbine Prime Mover Capstone C60 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Advanced Power Systems System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 3 Stand-alone Capability Seamless Power Rating 180 kW0.18 MW 180,000 W 180,000,000 mW 1.8e-4 GW 1.8e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 750000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2006/01/24 Monitoring Termination Date 1969/12/31 Primary Power Application Based Load

423

Distributed Generation Study/Waldbaums Supermarket | Open Energy  

Open Energy Info (EERE)

Waldbaums Supermarket Waldbaums Supermarket < Distributed Generation Study Jump to: navigation, search Study Location Hauppauge, New York Site Description Commercial-Supermarket Study Type Long-term Monitoring Technology Microturbine Prime Mover Capstone C60 Heat Recovery Systems Unifin HX Fuel Natural Gas System Installer CDH Energy Corp. System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 60 kW0.06 MW 60,000 W 60,000,000 mW 6.0e-5 GW 6.0e-8 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 500000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2002/08/02 Monitoring Termination Date 2006/07/21 Primary Power Application Based Load

424

Distributed Generation Study/Dakota Station (Minnegasco) | Open Energy  

Open Energy Info (EERE)

Station (Minnegasco) Station (Minnegasco) < Distributed Generation Study Jump to: navigation, search Study Location Burnsville, Minnesota Site Description Other Utility Study Type Case Study Technology Microturbine Prime Mover Capstone C30 Heat Recovery Systems Unifin Fuel Natural Gas System Installer Capstone Turbine Corp System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 30 kW0.03 MW 30,000 W 30,000,000 mW 3.0e-5 GW 3.0e-8 TW Nominal Voltage (V) 0 Heat Recovery Rating (BTU/hr) 290000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Customer Assembled Start Date 2000/03/13 Monitoring Termination Date 2002/03/31 Primary Power Application Based Load

425

Distributed Generation Study/Emerling Farm | Open Energy Information  

Open Energy Info (EERE)

Emerling Farm Emerling Farm < Distributed Generation Study Jump to: navigation, search Study Location Perry, New York Site Description Agricultural Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Caterpillar G379 Heat Recovery Systems Built-in Fuel Biogas System Installer RCM Digesters System Enclosure Dedicated Shelter System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability Seamless Power Rating 200 kW0.2 MW 200,000 W 200,000,000 mW 2.0e-4 GW 2.0e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 2000000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2006/06/07 Monitoring Termination Date 1969/12/31 Primary Power Application Based Load

426

Distributed Generation Study/Hudson Valley Community College | Open Energy  

Open Energy Info (EERE)

Valley Community College Valley Community College < Distributed Generation Study Jump to: navigation, search Study Location Troy, New York Site Description Institutional-School/University Study Type Long-term Monitoring Technology Internal Combustion Engine Prime Mover Caterpillar G3516, Caterpillar DM5498, Caterpillar DM7915 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Siemens Building Technologies System Enclosure Dedicated Shelter System Application Combined Heat and Power Number of Prime Movers 6 Stand-alone Capability Seamless Power Rating 7845 kW7.845 MW 7,845,000 W 7,845,000,000 mW 0.00785 GW 7.845e-6 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 32500000 Cooling Capacity (Refrig/Tons) Origin of Controller 3rd Party Custom Made Component Integration Factory Integrated

427

Distributed Generation Study/Floyd Bennett | Open Energy Information  

Open Energy Info (EERE)

Bennett Bennett < Distributed Generation Study Jump to: navigation, search Study Location Brooklyn, New York Site Description Other Study Type Long-term Monitoring Technology Microturbine Prime Mover Capstone C60 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Montreal Construction System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 2 Stand-alone Capability Seamless Power Rating 120 kW0.12 MW 120,000 W 120,000,000 mW 1.2e-4 GW 1.2e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 230000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2005/07/21 Monitoring Termination Date 1969/12/31 Primary Power Application Based Load

428

Distributed Generation Study/Harbec Plastics | Open Energy Information  

Open Energy Info (EERE)

< Distributed Generation Study < Distributed Generation Study Jump to: navigation, search Study Location Ontario, New York Site Description Industrial-Plastics Processing Study Type Long-term Monitoring Technology Microturbine Prime Mover Capstone C30 Heat Recovery Systems Built-in Fuel Natural Gas System Installer Northern Development System Enclosure Indoor System Application Combined Heat and Power Number of Prime Movers 25 Stand-alone Capability None Power Rating 750 kW0.75 MW 750,000 W 750,000,000 mW 7.5e-4 GW 7.5e-7 TW Nominal Voltage (V) 480 Heat Recovery Rating (BTU/hr) 3750000 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Factory Integrated Start Date 2005/10/06 Monitoring Termination Date 1969/12/31 Primary Power Application Based Load

429

Distributed Generation Study/Aisin Seiki G60 at Hooligans Bar and Grille |  

Open Energy Info (EERE)

Aisin Seiki G60 at Hooligans Bar and Grille Aisin Seiki G60 at Hooligans Bar and Grille < Distributed Generation Study Jump to: navigation, search Study Location Liverpool, New York Site Description Commercial-Restaurant Study Type Field Test Technology Internal Combustion Engine Prime Mover Aisin Seiki G60 Heat Recovery Systems Built-in Fuel Natural Gas System Installer ECO Technical Solutions System Enclosure Outdoor System Application Combined Heat and Power Number of Prime Movers 1 Stand-alone Capability None Power Rating 6 kW0.006 MW 6,000 W 6,000,000 mW 6.0e-6 GW 6.0e-9 TW Nominal Voltage (V) 240 Heat Recovery Rating (BTU/hr) 46105 Cooling Capacity (Refrig/Tons) Origin of Controller Manufacturer-Integrated Component Integration Customer Assembled Start Date 2005/07/10 Monitoring Termination Date 2005/07/21

430

Modeling and Reasoning about Everyday Events Dustin Arthur Smith  

E-Print Network (OSTI)

that is inexpensive (and what price is "expensive"?).For example, the way one travels to an event (e.g., taxi, foot already filled in, or searching for alternative restaurants in the expected neigh- borhood and price range- ing context aware assistance, us- ing information from the calen- dar program and the cellphone (e

431

Port Lions, Alaska 26 January 2006  

E-Print Network (OSTI)

to the benefits it produces, when you consider that high school and college baseball is played during the time- ing the season. Maintain Pitcher's Mound and Home Plate A few minutes each day repairing the pitcher's mound and home plate area keeps them in good play- ing condition. Sweep the mound with a stiff broom

US Army Corps of Engineers

432

Annual Report of ADVANCE Program for University of Wisconsin-Madison  

E-Print Network (OSTI)

in Natural Language Process- ing, pages 620­627, Vancouver, British Columbia, Canada, October. Gabriele of the Ninth International Workshop on Pars- ing Technology, pages 83­92, Vancouver, British Columbia, October of syntactic and semantic representations is a viable alter- native to approaches based on a pipeline of local

Sheridan, Jennifer

433

Kansas Board of Regents Mandatory Retirement Plan Enrollment Information  

E-Print Network (OSTI)

Plan Providers: ING and TIAA-CREF. For additional information about the Plan, see the KU HR website://www.ingretirementplans.com/custom/KansasBOREnrollmentServices/. For additional ING information, visit http://www6.ingretirementplans.com/SponsorExtranet/KansasBOR/. TIAA-CREF: To enroll and to find fund lineup information, see the TIAA-CREF microsite http://www.tiaa

Peterson, Blake R.

434

A Novel Process for Demulsification of Water-in-Crude Oil Emulsions by Dense Carbon Dioxide  

E-Print Network (OSTI)

using a wide variety of equipments such as centrifuges, rotary vacuum filters, belt presses, and filter concentrations behave as a liquid, with Newtonian flow characteristics. Centrifugal dewater- ing is possible obtained, which was considered acceptable since a dry- ing system followed centrifugation. Pressure filters

Kilpatrick, Peter K.

435

REcuRsiVE TRust-REGion MEthoDs FoR MuLtiLEVEL NonLinEAR ...  

E-Print Network (OSTI)

Aug 11, 2004 ... the minimie ing se& uence at level6s 1.`r f%n&s 1b&t belongs to this minimie ing se uence,Hg e use the notation n55 Pt...

436

Pour diffusion immdiate En pleine refonte du rgime forestier,  

E-Print Network (OSTI)

en 2010 pour répondre aux nouveaux défis Robert Beauregard, doyen de la Faculté de foresterie, de donner des entrevues. Porte-parole Fonctions Sujets Robert Beauregard, ing., ing.f, Ph.D. Doyen de la

Laval, Université

437

Biannual Report Department of Mathematics  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Kohlenbach, Ulrich

438

Abrahamse, W., L. Steg, et al. (2005). "A review of intervention studies aimed at household energy conservation." Journal of Environmental Psychology 25(3): 273-291.  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

439

(S11lSC) sruals,(5lueure8euey4les?qete6l's:olndruoc leuosred Jo uoqcnportur eqt reu? perylldurs  

E-Print Network (OSTI)

of Tsunami Deposits . . . . . . . . . . . . . . . 17 3.5 Search Methods Research (NCTR) was established to conduct re- search and development in support of the NOAA mission was a result of search- ing the tsunami runup database by state with no other conditions and divid- ing

Hack, Robert

440

Note: Does The Graphemic Buffer Play A Role In Reading?  

E-Print Network (OSTI)

this paper, we investigate the read ing performance of a patient previously reported as hav ing an impairment at the level of the graphem ic buffer (Kay & Hanley , 1994). Desp ite his spelling problems, this patient is good at read ing fam iliar words, at reading nonwords, and at written lexical decision. This pattern of performance is d iscussed w ith respect to Caramazza, Capasso, and Miceli's (1996) recent claim that damage to the graphem ic buffer leads to a problem in reading that w ill be obvious especially when the patient is asked to read nonwords

J. Richard Hanley; Janice Kay

1998-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Astrophysique L2 (Phys210) Universite Pierre et Marie Curie 2007-2008, S1  

E-Print Network (OSTI)

-m^eme en un temps typique (dit "de chute libre") de tcl 1/ G. (b) Application num´erique: calculer le orbitant autour du Soleil. 4- (a) Acc´el´eration g GM/R2 , tcl (R/g), M/R3 , d'o`u tcl 1/ G (b) n · mp 2 ? 10-21 kg m-3 . D'o`u tcl 3 ? 1015 sec 108 ans. (c) = M/(4/3R3 ) 3 ? 109 kg m-3 , soit tcl

Sicardy, Bruno

442

Chondrocyte outgrowth into a gelatin scaffold in a single impact load model of damage/repair - effect of BMP-2  

E-Print Network (OSTI)

,11,12]. Each disc, with the articular surface facing down was impacted from a height of 2.5 cm using a weight of 500 g. The approximate impact energy applied to each disc was 0.175 J, impacted at a velocity of approx- imately 0.7 m/s. To ensure constant... , Bessho K, Fujimura K, Okubo Y, Segami N, Iizuka T: Regen- eration of defects in the articular cartilage in rabbit tempo- romandibular joints by bone morphogenetic protein-2. British Journal of Oral and Maxillofacial Surgery 2002, 40:201-206. 11. Bowe EA...

Henson, Frances M D; Vincent, Thea A

2007-12-05T23:59:59.000Z

443

Complete genome sequence of the halophilic and highly halotolerant Chromohalobacter salexigens type strain (1H11T)  

SciTech Connect

Chromohalobacter salexigens is one of nine currently known species of the genus Chromoha- lobacter in the family Halomonadaceae. It is the most halotolerant of the so-called mod- erately halophilic bacteria currently known and, due to its strong euryhaline phenotype, it is an established model organism for prokaryotic osmoadaptation. C. salexigens strain 1H11T and Halomonas elongata are the first and the second members of the family Halomonada- ceae with a completely sequenced genome. The 3,696,649 bp long chromosome with a total of 3,319 protein-coding and 93 RNA genes was sequenced as part of the DOE Joint Genome Institute Program DOEM 2004.

Copeland, A [U.S. Department of Energy, Joint Genome Institute; O'Connor, Kathleen [Purdue University; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Berry, Kerrie W. [United States Department of Energy Joint Genome Institute; Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Glavina Del Rio, Tijana [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Dalin, Eileen [U.S. Department of Energy, Joint Genome Institute; Tice, Hope [U.S. Department of Energy, Joint Genome Institute; Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Bruce, David [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Tapia, Roxanne [Los Alamos National Laboratory (LANL); Saunders, Elizabeth H [Los Alamos National Laboratory (LANL); Schmutz, Jeremy [Stanford University; Brettin, Thomas S [ORNL; Larimer, Frank W [ORNL; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Vargas, Carmen [University of Seville; Nieto, Joaquin J. [University of Seville; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Csonka, Laszlo N. [Purdue University; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute

2011-01-01T23:59:59.000Z

444

Experimental investigation of the impact, spreading, and drying of picolitre droplets onto substrates with a broad range of wettabilities  

E-Print Network (OSTI)

- erated using a Microfab nozzle (Horizon Instruments) with a piezoelectric driver. The diameter of the nozzle orifice is 53m. Side-view images of drying droplets are taken using a high-speed camera (Photron APX RS) coupled to a long working distance... at the Fuel Cell Research Centre at Queens University in Kingston, ON, Canada, before joining Durham University, UK, in 2010 as a post-doctoral fellow. His interests include sustainable energy systems (thermoacoustic devices, fuel cells), the development...

Berson, A

2011-10-02T23:59:59.000Z

445

BWXTymes, A newsletter for the employees and friends of the Y...  

NLE Websites -- All DOE Office Websites (Extended Search)

cameras and sniper detection, Y-12 is forc- ing adversaries to abandon use of armored vehicles or face engagement before they are ready. Thus, offi cers are able to...

446

Role of Surface Proteins in the Deposition Kinetics of Cryptosporidium parvum Oocysts  

E-Print Network (OSTI)

strengths where DLVO theory predicts the absence of an electrostatic energy barrier. An "electrosteric.Additionally,treatmentofsurface watersbynaturalfiltrationthroughalluvialvalleyaquifer sedimentssa process known as bank filtrationsis emerg- ing as a feasible method for the removal

Elimelech, Menachem

447

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

jpg Electric light ing comprises 515,000,000 MWh or 20% of the nation's electricity consumption. Of this total, approximately 10-15% is used to light a building's perimeter zone...

448

Section 7.1.3 Wood Products: Greening Federal Facilities; Second...  

NLE Websites -- All DOE Office Websites (Extended Search)

wood is being used in a building, there is an opportunity to advance good forest management by specifying certified wood products. When wood is be- ing used for framing-more...

449

Member News August 2012_8S.indd  

Science Conference Proceedings (OSTI)

dering GPS system that has directed them into more than a few tight spots. But for Belt, this ... ing gas money. The Belts plan to eventually settle on a permanent...

450

Lab Tests Demonstrate Effectiveness of Advanced Power Strips...  

NLE Websites -- All DOE Office Websites (Extended Search)

choose the right one for their plug loads. Many consumer electronics devices waste energy even after they are turned off via "vampire" loads, mean- ing they continue to draw...

451

How to Start Your Own Business  

enough money to get going. In this ar-ticle, the sixth in our Business Engineer-ing series, Ill try to answer some of your questions about raising money for

452

FACT: A Framework for the Application of Throughput and Power Optimizing Transformations to Control-flow Intensive Behavioral Descriptions  

E-Print Network (OSTI)

Inthispaper,wepresentanalgorithmfortheapplicationofa generalclassoftransformationstocontrol-flowintensivebehavioraldescriptions. Ouralgorithmisbasedontheobservationthat incorporationofschedulinginformationcanhelpguidetheselectionandapplicationofcandidatetransformations, andsignificantly enhancethequalityofthesynthesizedsolution.Theefficacyofthe selectedthroughputandpoweroptimizingtransformationsisenhancedbytheabilityofouralgorithmtotranscendbasicblocksin thebehavioraldescription.Thisabilityisimpartedtoouralgorithm byageneraltechniquewehavedevised.Oursystemcurrentlysupportsassociativity, commutativity,distributivity,constantpropagation, codemotion,andloopunrolling.Itisintegratedwithaschedulerwhichperformsimplicitloopunrollingandfunctionalpipelin - ing,andhastheabilitytoparallelizetheexecutionofindependent iterativeconstructswhosebodiescanshareresources.Othertransformationscaneasilybeincorporatedwithintheframework. We demonstratetheefficacyofouralgorithmbyapplyingittoseveral commonlyavai...

Ganesh Lakshminarayana; Niraj K. Jha; Ganeshlakshminarayana Andnirajk Jha

1998-01-01T23:59:59.000Z

453

A 6.4 TESLA DIPOLE MAGNET FOR THE SSC  

E-Print Network (OSTI)

Engineering, Volume 31 A 6.4 TESLA DIPOLE MAGNET FOR THE SSCR. SCANLAN SSC-MAG A 6.4 TESLA DIPOLE MAGiET FOR THE SSC* C.increa.ing up to . 28 tesla . - The resultins systematic

Taylor, C.E.

2010-01-01T23:59:59.000Z

454

System level design of power distribution network for mobile computing platforms  

E-Print Network (OSTI)

to meet the system voltage noise requirements. Introductiondifferent voltage level specs due to V cc min requirement ofvoltage and frequency scaling (DVFS), Dynamic Power Gat- ing (DPM), and area/performance requirements

Shayan Arani, Amirali

2011-01-01T23:59:59.000Z

455

scripps institution of oceanography, university of california, san diego Cecil H. & Ida M. Green Institute of Geophysics & Planetary Physics  

E-Print Network (OSTI)

- ing Philippine Sea Experiment Over the past year I have been partipating in an ocean acoustic in the Philippine Sea starting in 2009 and ending in 2011. This location is in a chal- lenging and dynamic part

Constable, Steve

456

1. executive committee bylaws  

Science Conference Proceedings (OSTI)

teer requests uthorized. and execute nonvoting, all ng). Technical Div ng and organ recommenda ficant action in ors. m time-to-tim ing non-inclu nd the procedu.

457

Parimutuel Betting on Permutations  

E-Print Network (OSTI)

||?g(Y )||2 ? ng(Y ) ?. ? n||?g(Y )||2. Proof. See the appendix. Now, we can obtain an approximate separat- ing oracle for the ellipsoid method. Lemma 5.6.

458

231.ps  

E-Print Network (OSTI)

Vn := f1;:::;ng, En := fij j 1 ing, and dn := jEnj = n. 2 . Let Sn denote the. set of n n symmetric matrices. For X 2Sn, X 0 means that X is positive semide nite.

459

Released: June 2006  

U.S. Energy Information Administration (EIA) Indexed Site

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" 2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" ,"Number of Buildings (thousand)",,,,,"Total Floorspace (million square feet)" ,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment",,,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment" ,,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems",,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems" "All Buildings* ...............",4645,3472,2513,785,175,64783,56478,34671,11540,10267

460

Doing Well by Doing Good? Green Office Buildings  

E-Print Network (OSTI)

we obtained the data on energy usage reported to theWe also discuss the energy usage data made available to usengineer- ing studies of energy usage. There seems to be a

Eichholtz, Piet; Kok, Nils; Quigley, John M.

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978  

E-Print Network (OSTI)

Characteristics of Medieval Brasses H. V. Michel, F. Asaro,and the tarnish- ing of brass fixtures and silver. In vapor-Characteristics of Medieval Brasses* H. V. Michel, F. Asaro

Cairns, E.L.

2011-01-01T23:59:59.000Z

462

Computational Aesthetics in Graphics, Visualization and Imaging (2005) L. Neumann, M. Sbert, B. Gooch, W. Purgathofer (Editors)  

E-Print Network (OSTI)

finishes. The software makes use of a reflection model for car paint that is based on industry standards- ture, the glaze of a ceramic vase, or the color of an oil paint- ing are all important aesthetic

Meyer, Gary

463

285.ps  

E-Print Network (OSTI)

Feb 23, 2001 ... ing strategy makes extensive use of dual information associated ...... The total potential energy, expressed in terms of the coe cients of the approximating ...... population and have di erential costs of production and marketing.

464

Sample Size Calculation for Method Validation Using Linear Regression  

E-Print Network (OSTI)

, J. L. O. Miranda Departament of Statistics, Federal University of Minas Gerais, 31270-901 - Belo. Compared to a traditional method and us- ing Monte Carlo simulations, encouraging results attest

Cruz, Frederico

465

References - Energy Information Administration  

U.S. Energy Information Administration (EIA)

References 1.En ergy In for ma tion Ad min istra tion. Natu ral Gas Pro - duc tive Ca pac ity for the Lower 48 States 1980 through 1991 . DOE/EIA- 0542 (Wash ing ton ...

466

Baseline information development for energy smart schools -- applied research, field testing and technology integration  

E-Print Network (OSTI)

swimm ing pools and climate zones. Th e major findings aresound statements. The way the climate zones are divided waswhich aggregated CEC 16 climate zones into four regions by

Xu, Tengfang; Piette, Mary Ann

2004-01-01T23:59:59.000Z

467

330.ps.Z - Optimization Online  

E-Print Network (OSTI)

May 24, 2001 ... tion of ow through a pipe is modeled by a disjunction. ...... ing, S.T., Klepeis, J.L., Meyer, C.A. and Schweiger, C.A. Handbook of Test Problems.

468

M I C R O D E S I G N R E S O U R C E S J A N U A R Y 2 6 , 1 9 9 8 M I C R O P R O C E S S O R R E P O R T by Peter Song  

E-Print Network (OSTI)

units and registers, greatly simplify- ing hardware without unduly degrading the processor's throughput the effective address as a result, reducing the overhead of hoisting speculative loads above earlier stores

Skadron, Kevin

469

Enhancing the Teaching of Statistics: Portfolio Theory, an Application of Statistics in Finance  

E-Print Network (OSTI)

obtained for the stocks IBM, EXXON-MOBIL, and BOE- ING (theyClosing prices of IBM, Exxon-Mobil, Boeing, January 2000 -December 2005. IBM EXXON-MOBIIL BOEING Mean Q 1 Median Q 3

Nicolas Christou

2011-01-01T23:59:59.000Z

470

Enhancing the Teaching of Statistics: Portfolio Theory, an Application of Statistics in Finance  

E-Print Network (OSTI)

obtained for the stocks IBM, EXXON-MOBIL, and BOE- ING (theyClosing prices of IBM, Exxon-Mobil, Boeing, January 2000 -December 2005. IBM EXXON-MOBIIL BOEING Mean Q 1 Median Q 3

Christou, Nicolas

2007-01-01T23:59:59.000Z

471

AN EXPERTISE BASED ENERGY INFORMATION SYSTEM  

E-Print Network (OSTI)

overseas supplier of crude oil decreases supplies to the U,supplies of gas and heating oil are sufficient. Ignoring forsimple no tic~ ing. A model of oil flow in the United States

Rosenberg, S.

2013-01-01T23:59:59.000Z

472

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ing-grid-getting-more-out-america-s-energy-0 Article EM Occupational Injury and Illness Rates Continued to Decline in Fiscal Year 2011 WASHINGTON, D.C. - The EM Office of Safety...

473

THERMAL ENERGY STORAGE IN AQUIFERS WORKSHOP  

E-Print Network (OSTI)

government in their regulation of natural gas prices. ThatRegulation of energy sup- ply activites, chiefly electric and natural gasregulation requ1red householders to give up burn- ing coal in favor of natural gas

Authors, Various

2011-01-01T23:59:59.000Z

474

fall2009_web.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

structures. Dur- ing this portion of the project, ESRI's 3-D Technical Services Group web conferenced into a few classes to provide training and support in the art of 3-D...

475

5.2 e-Facilitating networking in distance co-operation ... - Springer  

Science Conference Proceedings (OSTI)

sophisticated systems based on the theory of the six degrees of separation, whose main concept is .... ing process the initial design and appropriate set-up of the virtual learning .... how instructional activities (if there are any) are sequenced

476

TIME SERIES MODELING  

Science Conference Proceedings (OSTI)

does involve some knowledge of hydrodynamics (especially when decid- ing the formula for ... 109120. Munk, W.H., and Cartwright, D.E., 1966. Tidal spectroscopy and pre- diction. ..... Principles of Forecasting: A Handbook for. Researchers...

477

Faculty of Fine, Applied and Performing Arts Annual Report 2012  

E-Print Network (OSTI)

(Jeppson 1976). A method of finding an approximat- 7 #12;ing function by converting to logarithmic compared to the Colebrook and White equation (Jeppson 1976), the maximum error of this approximation is 6

Harding, Karin

478

The landscape of RNA polymerase II transcription initiation in C. elegans reveals a novel enhancer architecture  

E-Print Network (OSTI)

- gated. We characterized the global landscape of RNA Pol II transcription initiation, identifying 73,500 distinct clus- ters of initiation, many of which are bidirectional. We assign transcription initiation sites to 7691 protein-cod- ing genes and find...

Chen, Ron; Down, Thomas; Ahringer, Julie

2013-03-18T23:59:59.000Z

479

Network coding for function computation  

E-Print Network (OSTI)

K. Zeger. Unachievability of Network Cod- ing Capacity. IEEEto target function f is C cod (N , f ) = sup k : ? (k, n)target function f , then C cod (N , f ) ? min-cut(N , f ).

Appuswamy, Rathinakumar

2011-01-01T23:59:59.000Z

480

EPRI Journal: Summer 2007  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

operation because of its inability to withdraw a suffi- cient amount of water to meet its thermal discharge permit. According to John Maulbetsch, a cool- ing systems expert and...

Note: This page contains sample records for the topic "ing refrig eration" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

2012 Immediate Science Ecology 1 7 Immediate Science Ecology 1: 711, 2012  

E-Print Network (OSTI)

regime where the frog occurs can result in breeding site desiccation during the long dry summer, solar radiation pro- duced mid-day shallow-water temperatures approach- ing 30°C. These preliminary data

482

Proceedings of ACL-08: HLT, pages 335343, Columbus, Ohio, USA, June 2008. c 2008 Association for Computational Linguistics  

E-Print Network (OSTI)

: · (crude oil) prices ­ left-branching · world (oil prices) ­ right-branching Lauer (1995) presents two. We then run a number of parsing experiments us- ing our new version of the CCGbank corpus

483

Tools for transparent synchronous collaborative environments  

Science Conference Proceedings (OSTI)

Nov 30, 2006 ... server checks if the client is a latecomer for this application. ...... However, other participants think that they need technical support for not only training but .... He received the Ing. Dipl. degree in Electrical Engineering from.

484

Northwest National Laboratory's Chemical Imaging Initiative is...  

NLE Websites -- All DOE Office Websites (Extended Search)

generated. CHEMICAL IMAgINg Main particle Pt (110) Pt (111) Pt (pores) g-Al 2 O 3 pores gamma-alumina particles contain pores and have a corrugated surface according to a chemical...

485

On the Mean Iteration - CECM  

E-Print Network (OSTI)

These logarithmic asymptotes also lead to two very clean quadratically converg- ing product expansions: (N = 3) let. 1~~~~~~~~~~~~~~~ zo := 9 and x. L [1 + V/(...

486

INFORMATIKK Nr. 08 15 mai 2009  

E-Print Network (OSTI)

(datasikkerhet, II-råd, MN-styre, UiB-styre) Vacation, technical support, office hours Utlysning av u.stip/ medarbeidere i nye roller Anne-Kristin Stavrum, stip. bioinformatikk Svein Harald Soleim, avd. ing

Fomin, Fedor V.

487

Quaero at TRECVID 2011: Semantic Indexing and Multimedi Event Detection (draft)  

E-Print Network (OSTI)

of interest points descriptors (SIFT, color SIFT, SURF, STIP), local edge patterns, saliency moments, percepts information. We will also integrate to the actual system other interest- ing descriptors like STIP

488

Companies plugged in: A study of the motivations of companies to introduce electric vehicles in their organisation:.  

E-Print Network (OSTI)

??Electric driving is currently a hot item in the Netherlands. Yet, it is surrounded by uncertainty result-ing in companies adopting a wait-and-see attitude regarding the (more)

Verouden, C.T.A.F.

2013-01-01T23:59:59.000Z

489

Endowed Chairs and Professorships Academic Village Undergraduate Scholarships Graduate Fellowships  

E-Print Network (OSTI)

Saturdays dur- ing the fall semester. Funding from Xcel Energy Foundation enables the University to offer Controls Group Xcel Energy Xilinx, Inc. Gifts on Behalf Ayres Associates Inc. Binder & Associates

490

Moisture Control in Insulated Raised Floor Systems in Southern Louisiana  

E-Print Network (OSTI)

polyisocyanurate foam, open-cell sprayed polyurethane foams of vary- ing vapor permeance, closed-cell sprayed in guidance for insulating raised floors in the hot and humid climate of the Gulf Houses with pier foundations

491

Introduction Epidemiology - Springer  

Science Conference Proceedings (OSTI)

are trauma victims, and early care does not deviate from Advanced Trauma. Life Support ... ing safety procedures. The type of ... This is a progressive process and the ..... All patients should be transferred with appropriately trained escort staff.

492

INFRASTRUCTURE PRELIMINARIES  

E-Print Network (OSTI)

, 300 rpm), centrifuged (2,000?g, 5 min), and supernatants collected and frozen. Differences from a rotating biological contactor treat- ing ammonium-rich leachate. Arch Microbiol 175: 198­207 8

493

An Evaluation of the Market Potential for Transit-Oriented Development Using Visual Simulation Techniques  

E-Print Network (OSTI)

to support frequent rail services. Research findings byresearch methodology itself as well as the general conceptof promoting denser housingdevelopment railresearch suggeststhere is aa untapped marketpotential for moderately dense hous- ing projects near rail

Cervero, Robert; Bosselmann, Peter

1994-01-01T23:59:59.000Z

494

careInlorlladon Infrastructure:  

Science Conference Proceedings (OSTI)

... BrInging HeaithcG1eOnline: Th~ Rot. of infotmotIon Technologiu, OTA-rrc-624, USGovernment PrInting Office. Washington. Dc.1995.) ...

2012-11-26T23:59:59.000Z

495

Studies of the front end of a neutrino factory  

E-Print Network (OSTI)

determining the needed volt-seconds (and thus core material)decreases the accelerat- ing volt-sec needed for ? 0 ? ? Lmagnitude of the decelerating volt-sec which must be applied

Fawley, William; Penn, Gregory; Sessler, Andrew; Wurtele, Jonathan

2001-01-01T23:59:59.000Z

496

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ings-bonneville-power Page EA-0531: Proposed Natural Gas Protection Program for Naval Oil Shale Reserves Nos. 1 and 3, Garfield County, Colorado This EA evaluates the environmental...

497

Newsletter (May 2009).pub  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tive Action Request (CAR) is provided. The contractor is responsible for respond- ing in a timely and com- plete manner through its Corrective Action Plan (CAP). The Federal Pro-...

498

http://magnets.rhic.bnl.gov/Sta.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

(BNL) is build- ing a number of magnets for the insertion regions of the Large Hadron Collider (LHC). This paper presents the magnetic de- sign and the expected field...

499

Non-invasive MR imaging of inflammation in a patient with both asymptomatic carotid atheroma and an abdominal aortic aneurysm: a case report  

E-Print Network (OSTI)

- ticipated in the design of the study and edited the manuscript. ZYL helped in editing the manuscript and cre- ating the Figure. SRW was involved with manuscript edit- ing, patient care and helped perform the operation. MEG edited the manuscript...

Howarth, Simon P S; Tang, Tjun Y; Graves, Martin J; U-King-Im, Jean-Marie; Li, Zhi-Yong; Walsh, Stewart R; Gaunt, Michael E; Gillard, Jonathan H

2007-02-21T23:59:59.000Z

500

Gone with the Wind - The Potential Tragedy of the Common Wind  

E-Print Network (OSTI)

42 In fact, the price of wind energy is decreas- ing at aprice of wind en- ergy is competitive with other forms of energyother energy production technologies: 43 the price for wind

Lifshitz-Goldberg, Yaei

2010-01-01T23:59:59.000Z