Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

STEM-ing the Tide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STEM-ing the Tide STEM-ing the Tide STEM-ing the Tide September 29, 2010 - 4:29pm Addthis Ali Zaidi Special Assistant to the Secretary of Energy Yesterday, the MacArthur Foundation rolled out its latest class of "geniuses" - 23 Americans who stand out because of their creativity and enterprise. Each recipient of the honor (and the $500,000 prize) has made an extraordinary contribution. One of those recipients is Amir Abo-Shaeer, an engineer in the aerospace and telecommunications industries who decided 10 years ago to go back to high school - this time as a teacher. At his alma mater, Dos Pueblos High School (in Santa Barbara, California), Amir created "a school within a school" built around a hands-on curriculum that helps students learn by connecting the ideas of physics, engineering and mathematics through

2

Personnel Change Notification ImagIng: GRSF/T  

E-Print Network (OSTI)

Personnel Change Notification OGS Form 3 ImagIng: GRSF/T Admit Year/Term: GS Web Front Desk: Office., reviewers, coordinators and chairs) Update: View all AIM Graduate Studies pages and enter decisions on GS02: Search for and view applicants; edit emails Connect: Add, search for and communicate with prospects

Hart, Gus

3

"Dark Web: Exploring and Min-ing the Dark Side of the Web"  

E-Print Network (OSTI)

Title: "Dark Web: Exploring and Min- ing the Dark Side of the Web" Speaker: Director, Prof will review the emerging research in Terrorism Informatics based on a web mining perspective. Recent progress in the internationally re- nowned Dark Web project will be reviewed, including: deep/dark web spider- ing (web sites

Michelsen, Claus

4

13:00 Begrung und Symposiumserffnung Prof. Dr.-Ing. Gerd Holbach  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Berlin,Technische Universität

5

"Cook"ing at Y-12 for 70 years | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

"Cook"ing at Y-12 ... "Cook"ing at Y-12 ... "Cook"ing at Y-12 for 70 years Posted: December 5, 2013 - 4:48pm At a Nov. 14 visit to Y-12, National Nuclear Security Administration's Deputy Administrator for Defense Don Cook shared his outlook on the future and his thanks to employees for continuing their 70-year tradition of making America safer. "There are three things to remember," Cook told a meeting of NNSA Production Office and Y-12 employees. "We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America." Cook also shared his thanks for preparing for the potential furlough in October because of the government shutdown and lack of appropriations. During what was the longest government shutdown to date, Cook said Y-12

6

TRANSPORTATION SYSTEMS are the build-ing blocks of modern society. Efficient and  

E-Print Network (OSTI)

TRANSPORTATION SYSTEMS are the build- ing blocks of modern society. Efficient and safe movement. How- ever, transportation systems by their very nature also affect the environment through operations, construction, and maintenance of transportation facilities, and through the travel behaviors they encourage

Wang, Yuhang

7

Water is used for many purposes, includ-ing growing crops, producing copper,  

E-Print Network (OSTI)

WATER USES Water is used for many purposes, includ- ing growing crops, producing copper, generating electricity, watering lawns, keeping clean, drinking and recreation. Bal- ancing the water budget comes down of the water budget. Reducing demand involves re- ducing how much water each person uses, lim- iting the number

8

ing system  

E-Print Network (OSTI)

Oct 29, 2002 ... GAs are search algorithms based on the mechanics of natural selection and natural genetics. They combine the concept of survival of the.

9

Material development in the SI sub 3 N sub 4 system using glass encapsulated Hip'ing  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP'ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

10

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

11

FEMP Outdoor Solid State Lighting Intiative: Resources for Outdoor...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fact Sheet - The Consortium shares technical information and experi- ences related to LED street and area light- ing demonstrations. The Consortium also serves as an objective...

12

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

DOE Green Energy (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} < 2.5 {mu}m: average 59.8 {mu}g m{sup -3}) were higher than coarse aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

13

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

Science Conference Proceedings (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

14

Material development in the SI{sub 3}N{sub 4} system using glass encapsulated Hip`ing. Final report, Phase 2: DOE/ORNL Ceramic Technology Project  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP`ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

15

Hydraulic fractur ing--also called hy  

E-Print Network (OSTI)

reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

Goodman, Robert M.

16

E(Race)ing gender: Stratified identities  

E-Print Network (OSTI)

In the discussion that follows, I will examine, on the broadest level, Hurston's complex negotiation of identity, as manifested in Their Eyes Were Watching God. Central to this investigation is an understanding of the strategies that women, specifically African American women, have adopted, under the auspices of marriage and the patronage system, to seek an equal place within a hegemonic culture. Most importantly, I want to address the cultural and social price exacted for accepting (as seen in the appropriation of white standards, and rejecting (as seen in Janie's trial for her husband's death) those institutions as the basis of one's identity. The cultural and social price that Janie pays, furthermore, challenges her adaptive capacity to stratify her racial and gender identity. Finally, it exacts a toll on the community as a whole, a fact Hurston repeatedly suggests by illustrating the extent to which the community has absorbed hegemonic standards of value and beauty with little or no inspection of or reflection on the effects to itself or to its individual members.

Nguyen, Le Thuy Thi

2000-01-01T23:59:59.000Z

17

IMPROVED GROOVING TOOL FOR TU ING  

te hnology readiness level: 6 a market deliverable has been demonstrated in relevant environments and is in final development . author: alexandra ...

18

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

19

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

20

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Intensity (thousand Btusquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

22

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

23

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

24

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

25

Go-ing for the prediction of protein folding mechanisms  

E-Print Network (OSTI)

of Chemistry, Faculty of Science, Kobe University, Kobe, 657-8501, Japan Protein folding has been a long-lived could be relatively simple. These three ingredients are linked together with an almost one-line free work (8, 9). The surprise of the three papers is that apparently one can have both simplicity and fair

Takada, Shoji

26

The physical function-ing of a city sometimes  

E-Print Network (OSTI)

insurance. It is recommended that parents carefully review their homeowners, auto and health insurance. Parents should check their homeowners policy to see whether it will cover a student's possessions while

27

Table E1. Major Fuel Consumption (Btu) by End Use for Non-Mall ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

28

Table E6. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

29

Table E4. Electricity Consumption (Btu) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

30

Table E3A. Electricity Consumption (Btu) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

31

Table E4A. Electricity Consumption (Btu) Intensities by End ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

32

Table E5A. Electricity Consumption (kWh) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

33

Table E6A. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

34

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

35

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Energy Intensity (kWhsquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

36

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Survey: Energy End-Use Consumption Tables Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

37

ing the distribution of those galaxies, the way they clump and spread out, scientists  

E-Print Network (OSTI)

illuminated realms as small as a single molecule and as large as a gamma ray burst. of the Year Agony ex- plosions in the universe: titanic blasts of en- ergy called gamma ray bursts (GRBs). Most notably of black holes and other phenomena in the gamma ray region of the spectrum. And the Wilkinson Microwave

Yildiz, Ahmet

38

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg130  

E-Print Network (OSTI)

. Journal of "Solar Energy Materials and Solar Cells". Proceedings of IEEE Photovoltaic Specialist Conferences. Proceedings of European Photovoltaic Solar Energy Conferences. #12;Module 2/Photovoltaics, Wiley, 1995. R.H.Bube, Photovoltaic Materials, Imperial College Press, 1998. Journal of "Solar Energy

39

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

U.S. Energy Information Administration (EIA) Indexed Site

MCKEESPORT MCKEESPORT COR AOPOLIS-MOON REDHAW ST. CLAIR SC ROGGSFIELD FRANKLIN -OAK FOREST RIMERSBURG RENNERD AL E GREENVILL E PAT MOS CRABTR EE BLAC K ASH ROYALT ON N BAKERSTOWN QUEEN ROU GH RUN LUCAS BLAC K H ILL CRESTON WAT TSVILLE WADSWORTH -NORT H OAKLAN D HOM EWORT H UNIT Y ESSELBRUN ALAMED A PAR K-CROOKED RU CHERRY GROVE FRENC HTOWN ST EWART RUN MILL C REEK GLENF IELD-MOU NT NEBO HICKORY E HARRISVILLE E LEST ER GRIGGS CORNERS EN GLAN D WEST VIL LE LAKE BAILEY LAKE OAKFORD BR UNSWICK N HOR ACE WALBORN RESERVOIR YOUN GSVILLE RPD-LORAIN -1 INGOMAR-GRUBBS BIG MEADOWS GARD EN ISLE TURT LE CREEK LEWIST ON E BR USH CR EEK FOOT VILLE BU LL CREEK BESSEMER EAGLEVILLE LIVER POOL E RIDGEVILLE E EVANS CIT Y GUIT ONVILLE WOLF S COR NERS WIN DFALL ABBEYVILLE ROC K CAMP LEATH ER WOOD AR COLA CR EEK MEC HANICST OWN NINE MILE RU N WALKCHALK RENFR EW-MCCALMONT BU FFALO N VALENCIA WELLIN GT ON

40

Spring'ing' Forward Into the Finals . . . Of A Competition Like...  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.11.13...

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

'March'ing Into The Finals . . . Of A Competition Like No Other  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.04.13...

42

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg102  

E-Print Network (OSTI)

when carbon dioxide is introduced into thermal conversion processes such as the gasification of coal to syngas, leaving behind only a carbonless char. Castaldi estimates that if the biomass were used

43

Kurzlebenslauf (CV) Stand September 2011 Dr.-Ing. Diplom-Physiker  

E-Print Network (OSTI)

:30 Panel: Erneuerbare Energien: Rentable Investitionen oder teure Experimente? Christof Stein (KfW Bank) Dr für Klima, Umwelt und Energie) Matthias Willenbacher (JuWi Holding) Moderation: Monika Seynsche

44

Power Electronics and Electrical Drives Prof. Dr.-Ing. Joachim Bcker  

E-Print Network (OSTI)

, e.g. Interior permanent magnet synchronous motors (IPMSM)Interior permanent magnet synchronous rings Permanent Magnet Synchronous Motor integrated into the rotor outlines Active magnetic bearing motors (IPMSM) Switched reluctance drives FPGA based control Self optimizing systems (Collaborative

Noé, Reinhold

45

Programme Coordination Professor Dr.-Ing. habil. Dr. h. c. Karl J. Thom-Kozmiensky  

E-Print Network (OSTI)

Waste Management · Recycling · Waste-to-Energy Recovery of Biowastes · Mechanical-Biological Treatment of the European Suppliers of Waste to Energy Technology (ESWET), Brussels, Belgium 10.30 Hrs. Waste Framework.V., Gent, Belgium 12.30 Hrs. Waste incineration in the 21st century ­ Energy-efficient and climate

Hone, James

46

Wolfram Hoefer, Dr.-Ing. Assistant Professor Department of Landscape Architecture  

E-Print Network (OSTI)

Landentwicklung. Gärtner im Garten- und Landschaftsbau. (State exam for professional degree as gardener, landscape Ltd. London 1984-86 Apprenticeship as landscape gardener with Hermann Kretz, Garten und Landschaftsbau

Goodman, Robert M.

47

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg 141  

E-Print Network (OSTI)

- onry is also crucial to their safe storage. Plutonium, an active ingredient in nuclear weap- ons, has to determine how the electrons within these materials will behave. "The plutonium in the weapons ages, and we have to be able to predict the proper- ties of plutonium under a variety of conditions," Chris

48

Protective interior wall and attach8ing means for a fusion reactor vacuum vessel  

DOE Patents (OSTI)

An array of connected plates mounted on the inside wall of the vacuum vessel of a magnetic confinement reactor in order to provide a protective surface for energy deposition inside the vessel. All fasteners are concealed and protected beneath the plates, while the plates themselves share common mounting points. The entire array is installed with torqued nuts on threaded studs; provision also exists for thermal expansion by mounting each plate with two of its four mounts captured in an oversize grooved spool. A spool-washer mounting hardware allows one edge of a protective plate to be torqued while the other side remains loose, by simply inverting the spool-washer hardware.

Phelps, Richard D. (Greeley, CO); Upham, Gerald A. (Valley Center, CA); Anderson, Paul M. (San Diego, CA)

1988-01-01T23:59:59.000Z

49

Pico-ing into the future of mobile projection and contexts  

Science Conference Proceedings (OSTI)

Ten years ago, we were on the verge of having cameras built into our mobile phones, but knew very little about what to expect or how they would be used. Now we are faced with the same unknowns with mobile projector phones. This research seeks to explore ... Keywords: Diary study, Experience sampling, Mobile, Pico-projectors

Max L. Wilson; Dan Craggs; Simon Robinson; Matt Jones; Kristian Brimble

2012-01-01T23:59:59.000Z

50

Koordination: Prof. Dr.-Ing. J. Seume Institut fr Turbomaschinen und Fluid-Dynamik  

E-Print Network (OSTI)

of installation of offshore wind farms (from Wiese 2008: Auswirkungen der Offshore-Windenergie auf den Betrieb von and offshore applications require appropriate planning and design. For most of them, statistics of extreme wind coastDat have been used in a large variety of coastal, offshore and terrestrial applications

51

Sandra Koch Dipl.-Ing. (FH) Telefon: 04921-807-1489  

E-Print Network (OSTI)

die Voraussetzung geschaffen, um die Stromerzeugung aus Windenergie Offshore langfristig erfolgreich geschaffen, um die Stromerzeugung aus Offshore Windenergie langfristig erfolgreich und effizient entwickeln-02 Bestimmung von Wärme- und Impulsfluss in der marinen atmosphärischen Grenzschicht für die Offshore

Damm, Werner

52

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

Annual Energy Outlook 2012 (EIA)

RURAL RID GE ROWSBUR G SH ERRETT MON AC A QUEEN JUN CTION YELLOW CR EEK SMELTZ ER CAT FISH R UN POLK E JEROMESVILLE N FLORENCE-FIVE POINTS ATEN CLARINGTON MILLERSBURG...

53

Following weeks of purging and organiz-ing, phase one of the School's reloca-  

E-Print Network (OSTI)

in August. The depart- ments of Consumer Science and Human Development and Family Studies, as well as UW from top: Gloria McCord, Human Ecology financial specialist, casts a spell at the punch-bowl cauldron

Sheridan, Jennifer

54

INFORMATION EXCELLENTIA CoLumbIA ENgINEErINg238  

E-Print Network (OSTI)

that bends and twists. "Computers, geometry, and physics are my ingredients. I mix them up in a bowl and what science as well. B.A.Sc., University of Toronto (Canada), 1997; M.S., California Institute of TechnologySPUn Associate Professor of Computer Science #12;

Hone, James

55

METHOD FOR REDU ING A KGROUND LUTTER IN A AMERA IMAGE  

... bulky and heavy, expensive, fragile, short-range, sensitive to vibration, and unreliable for outdoor use in bright sunlight conditions. The ...

56

SOLAR TRA ING SENSORS FOR MAXIMUM SOLAR ON ENTRATOR EFFI IEN Y  

POTENTIAL APPLI ATIONS Parabolic dish & trough solar concentrating collectors Solar energy and renewable energy Electric utility

57

whITe PaPer The ChaNgINg DYNaMICS OF  

E-Print Network (OSTI)

of the smart grid, which integrates AMI with distribution automation and other tech- nologies to connect consumers Network Automation And Analytics Smart Meters Distributed Generation Today: Centralized and One smart grid and advanced metering deployments. Bob Brnilovich, IBM www.UtilitiesProject.com/10803

58

Technical Report Documentation Page 1. Report No.  

E-Print Network (OSTI)

.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr

59

RADIATION RESEARCH 153, 220238 (2000) 0033-7587/00 $5.00  

E-Print Network (OSTI)

): the light water reactor [(LWR) in both pressurized and boil- ing versions]; heavy water (CANDU) reactor

60

Institutsleitung: Univ.-Prof. Dr.-Ing. Prof. E.h. Dr.-Ing. E.h. Dr. h.c. mult. Engelbert Westkmper Kontakt: Birgit Spaeth Presse-und ffentlichkeitsarbeit  

E-Print Network (OSTI)

Universitätsprofessor ernannt wird. Thomas Bauernhansl, 1969 im fränkischen Miltenberg geboren, hat Maschinenbau an der

Möbius, Bernd

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Tactical urbanism, public policy reform, and 'innovation spotting' by government : from Park(ing) Day to San Francisco's parklet program  

E-Print Network (OSTI)

This thesis examines the prospects and impacts of tactical urbanism (TU). While tactical urbanism remains primarily a subcultural movement, it is beginning to gain traction in popular culture in traditionally politically ...

Davidson, Mariko Mura

2013-01-01T23:59:59.000Z

62

The Burning Man festival is a unique happen-ing. For one week in September every year,  

E-Print Network (OSTI)

spaces, the city as it alters over the seven days and from year to year, exhibiting emergent properties- ance of oversized gas-guzzling camper vans, fossil-fuel-powered generators and gratuitous combustion, it is no Utopia. But the City's Alternative Energy Zone, with its huge bank of solar panels, multiple experiments

Bourne, Philip E.

63

Cultivat(ing) modernities : the Society for National Heritage, political propaganda and public architecture in twentieth-century Iran  

E-Print Network (OSTI)

Beginning in 1922, under the auspices of the Pahlavi dynasty of Iran, the tombs of selected historical figures were systematically destroyed to make way for modern mausoleums erected as metaphors for an "Aryan" nation in ...

Grigor, Talinn, 1972-

2005-01-01T23:59:59.000Z

64

58 UTS ANNUAL REPORT 2008 sUppoRtING oUR objEctIvEs  

E-Print Network (OSTI)

improvingenvironmentalsustainabilityin ourcampusoperations.Itisoverseenby asteeringcommitteeandsevenworking groups:waste,transport,energy into the atmosphere. The proposal from students Antony Henry and Kavit Pandya was to put this wasted energy through Energy-efficientlightinginmorethan> 60percentoftheUniversity Savingtheequivalentof45Olympic

University of Technology, Sydney

65

HOW ENVIRONMENTAL RISK FROM LEACH ING OF HEAVY METALS IN ASH RESIDUES FROM COMBUSTION OF MUNIC IPAL SOLID WASTE  

E-Print Network (OSTI)

Laboratories which led to the use of acid tests such as the EP and TCLP tests. [25] 13 #12;CONCLUSIONS and soluble metals in the ash from Waste-to Energy (WTE) facilities has led to a public concern about why has led to the requirement for continuous monitoring of oxygen , carbon monoxide (CO) , and acid gases

Columbia University

66

The Linac Coherent Light Source is  

NLE Websites -- All DOE Office Websites (Extended Search)

Coherent Light Source is Coherent Light Source is a revolution in x-ray science. Just as the invention of x-ray machines a century ago astonishingly revealed the inside of our bodies and began new sciences, the world's first x-ray laser will open up unprecedented opportunities. Pioneering experiments will advance our understand ing of everything from the hidden physics inside planets, to how proteins function as the engines of life, to building nanotechnology devices for the backbone of future industry and technology. The applications are legion: medicine, electronics, biology, solid-state physics, nanotechnology, energy production, industry and fields that do not yet exist. Linac Coherent Light Source New Tools Create New Science The LCLS is dramatically different from any x-ray

67

FEMP Outdoor Solid State Lighting Intiative: Resources for Outdoor SSL Applications  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Municipal Solid-State Street Lighting Municipal Solid-State Street Lighting Consortium Fact Sheet - The Consortium shares technical information and experi- ences related to LED street and area light- ing demonstrations. The Consortium also serves as an objective resource for evalu- ating new products on the market intended for street and area lighting applications. http://apps1.eere.energy.gov/buildings/ publications/pdfs/ssl/consortium_fs.pdf DOE SSL GATEWAY Demonstration Project Results - DOE GATEWAY dem- onstrations showcase high-performance LED products for general illumination in a variety of commercial and residential applications. Demonstration results pro- vide real-world experience and data on state-of-the-art SSL product performance and cost effectiveness. DOE CALiPER Test Results - The DOE

68

Clemson University Preservation master Plan Part III: ExIstIng CondItIons ChaPtEr Four FEbruary 2009 JMa, InC. 70  

E-Print Network (OSTI)

,337 CFDA # 15.922 - Native American Graves Protection and Repatriation Act Direct Federal Awards 16,227 525,830 - 4,830 Lawrence Berkeley Natl Lab RF HANFORD SEDM THOMP-6875736 48,614 2,965 45,649 Savannah River Nuclear Solutns RF RIVERBASIN GRUND-AC716760 132,105 9,248 122,857 Savannah River Nuclear Solutns RF SUP

Stuart, Steven J.

69

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

from Smoldering Biomass Combustion. Atmos. Chem. Phys. , 10,aerosols emitted during biomass combustion [Robinson et al.burning samples. Combustion of biomass produces EC a and

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

70

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Tar Balls from Smoldering Biomass Combustion. Atmos. Chem.gases and particles from biomass burning in Brazil, J. Ge-for smoke from African biomass burning, J. Geophys. Res. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

71

Early and sustained interventions which strongly feature mentoring are essential in help-ing Native American and Latino students navigate an unfamiliar academic system that is  

E-Print Network (OSTI)

(Navajo) is the largest, with 170,000 members. Others include the Oglala Sioux, Cherokee Nation, Blackfeet

Benitez-Nelson, Claudia

72
73

MICRO-MACHINED THIN FILM HYDROGEN GAS SENSORS Frank DiMeo, Jr., Ing-Shin Chen, Philip Chen, Jeffrey Neuner  

E-Print Network (OSTI)

;Introduction The reputation of hydrogen as the next generation energy delivery agent, supplementing electricity of Electric Power Research Institute, in a recent The Industrial Physicist column, observed the multifaceted as a national security priority. While fuel cell cars often feature prominently in news media and are touted

74

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

2001. Kerminen, V. -M. , Makela, T. E. , Ojanen, C. H. ,Saarikoski, S. , Frey, A. , Mkel, T. , and Hillamo, R. :Acker, K. , Hillamo, R. , Mkel, T. : Intercomparison of

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

75

CS-03-02 A PIvotIng PRocEDuRE FoR A ClAss oF SEconD-oRDER ...  

E-Print Network (OSTI)

linear function over an intersection of an affine set and second-order cones. SOCP is a .... Note that the e q uality constraints of does not contain!7# .

76

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Crutzen, P. : Atmospheric Aerosols: Biogeochemical sourcesof optically active aerosol particles over the Amazonproperties of Amazonian aerosol particles: Rev. Geophys. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

77

Understanding the Effect of Baseline Modeling Implementation Choices on Analysis of Demand Response Performance  

E-Print Network (OSTI)

IEEE Transactions on Smart Grid, ings. Journal of Solaroperations. With continu- ing Smart Grid development, there

Addy, Nathan

2013-01-01T23:59:59.000Z

78

New Facility to Shed Light on Offshore Wind Resource (Fact Sheet), Highlights in Research & Development, NREL (National Renewable Energy Laboratory)  

NLE Websites -- All DOE Office Websites (Extended Search)

As a pre-existing structure in a location with As a pre-existing structure in a location with excellent offshore wind resources, the Chesapeake Light Tower provides a cost-effective alternative to building a new platform large enough to support an 80- to 100-meter-tall meteorological tower. Photo by Rick Driscoll, NREL 25660 Chesapeake Light Tower facility will gather key data for unlocking the nation's vast offshore wind resource. According to the National Offshore Wind Strategy published by the U.S. Department of Energy (DOE) in 2011, the nation's offshore wind resource could supply 54 gigawatts of generat- ing capacity by 2030. However, to tap into that potential, more data on the nature of offshore wind resources and the ocean environment is needed. An opportunity to address this need was cre-

79

Lighting.  

SciTech Connect

Since lighting accounts for about one-third of the energy used in commercial buildings, there is opportunity to conserve. There are two ways to reduce lighting energy use: modify lighting systems so that they used less electricity and/or reduce the number of hours the lights are used. This booklet presents a number of ways to do both. Topics covered include: reassessing lighting levels, reducing lighting levels, increasing bulb & fixture efficiency, using controls to regulate lighting, and taking advantage of daylight.

United States. Bonneville Power Administration.

1992-09-01T23:59:59.000Z

80

Lighting  

Energy.gov (U.S. Department of Energy (DOE))

There are many different types of artificial lights, all of which have different applications and uses.Types of lighting include:

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

U.S. energy intensity projected to continue its steady decline ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Light-duty vehicles are by far the largest energy consuming part of ...

82

Energy Star Building Upgrade Manual Introduction Chapter 1  

NLE Websites -- All DOE Office Websites (Extended Search)

offer- ings. The label now covers new homes, commercial and institutional buildings, residential heating and cooling equipment, major appliances, office equipment, lighting,...

83

CONTROL OF POPULATION DENSITIES SURROUNDING NUCLEAR POWER PLANTS. VOLUME 5 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

Commission. Office of Nuclear Reactor Licens- ing. StandardCommission. Office of Nuclear Reactor Regula- tion.Nuclear Regulatory Commission Standard Review Plan for Light Water Reactor

Nero, jA.V.

2010-01-01T23:59:59.000Z

84

Lighting  

SciTech Connect

The lighting section of ASHRAE standard 90.1 is discussed. It applies to all new buildings except low-rise residential, while excluding specialty lighting applications such as signage, art exhibits, theatrical productions, medical and dental tasks, and others. In addition, lighting for indoor plant growth is excluded if designed to operate only between 10 p.m. and 6 a.m. Lighting allowances for the interior of a building are determined by the use of the system performance path unless the space functions are not fully known, such as during the initial stages of design or for speculative buildings. In such cases, the prescriptive path is available. Lighting allowances for the exterior of all buildings are determined by a table of unit power allowances. A new addition the exterior lighting procedure is the inclusion of facade lighting. However, it is no longer possible to trade-off power allotted for the exterior with the interior of a building or vice versa. A significant change is the new emphasis on lighting controls.

McKay, H.N. (Hayden McKay Lighting Design, New York, NY (US))

1990-02-01T23:59:59.000Z

85

Automatic annotation of organellar genomes with DOGMA  

E-Print Network (OSTI)

for 98 chloroplast protein cod- ing genes (with two entriessimilarly to the protein cod- ing genes, except that

Wyman, Stacia; Jansen, Robert K.; Boore, Jeffrey L.

2004-01-01T23:59:59.000Z

86

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Mitarbeiter und Stipendiaten Dr. Olaf Adamczyk Dr.-Ing. Suhas Bhandare Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann Dr Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr.-Ing. Sunil Survaiya Dr.-Ing. Hongbin Zhang

Noé, Reinhold

87

Tel. +49-541-969 2872/2890 -Fax. +49-541-969 1221/2262 -Email. Junge@uni-osnabrueck.de 1 Prof. Dr.-Ing. Wolfgang Junge Gutenbergstrae 36, 49076 Osnabrck  

E-Print Network (OSTI)

for Biophysics, Osnabrück 1992 95th Conference of the Deutsche Bunsengesellschaft für Physikalische Chemie, Jena Chemie Deutsche Gesellschaft für Biophysik Deutsche Gesellschaft für Naturforscher und ?rzte Gesellschaft for Biophysics Chair 1984-1985 Section "Membranes" of Gesellschaft für Biologische Chemie, Board Member 1987

Junge, Wolfgang

88

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

jpg Electric light ing comprises 515,000,000 MWh or 20% of the nation's electricity consumption. Of this total, approximately 10-15% is used to light a building's perimeter zone...

89

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 ....................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ..................... 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ..................... 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ................... 405 16 57 65 7 158 2 29 6 18 45

90

Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc 401k 401k D PP PT2 Dental Pre-Paid PT 2 Misc Miscellaneous Deductions ROTH ROTH 401(k)  

E-Print Network (OSTI)

FICA Additional Medicare Tax ORP ING1 ORP Retirement ING 10% TCRS NF TCRS Retirement Non-Faculty AFLACSIC Aflac - Sickness Indemnity Foundat Foundation ORP ING2 ORP Retirement ING Two Split TCRS TCB Closed Teacher Class B Contrib AFLCIEET Aflac - Critical ILL-EE-Tobacco Foundat ETSU Foundation ORP ING3

Karsai, Istvan

91

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Bhandare M. Sc. Abas Ahmad Fauzi Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann M. Sc. Selwan K. Ibrahim Dr.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl

Noé, Reinhold

92

Production of Ultrashort FEL XUV Pulses via a Reverse Undulator Taper  

E-Print Network (OSTI)

1 (2004); also SLAC Rpt. LCLS-TN-04-3 [13] M. Xie, Nucl.Linac Coherent Light Source (LCLS) Conceptual Design Report,ing down to 12 nm and the LCLS facility [2] pro- jected to

Fawley, William M.

2007-01-01T23:59:59.000Z

93

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 222 194 17...

94

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,100...

95

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,928 1,316...

96

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Energy Consumption Survey: Energy End-Use Consumption Tables Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

97

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

cubic feet) Natural Gas Energy Intensity (cubic feetsquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

98

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,870 1,276...

99

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(trillion Btu) Fuel Oil Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

100

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(million gallons) Fuel Oil Energy Intensity (gallonssquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) District Heat Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

102

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) Natural Gas Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

103

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,602 1,397...

104

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,037...

105

Proceedings of the TOUGH Symposium 2009  

E-Print Network (OSTI)

and oil recovery by waterflood- ing, SPE ReservoirY. and N.R. Morrow, Waterflood performance by injection ofof low-salinity waterflood- ing, the exact mechanisms

Moridis, George J.

2010-01-01T23:59:59.000Z

106

Economic Contributions of the California Nursery Industry  

E-Print Network (OSTI)

energy and input costs, government regulation, chang- ing market structure, competition, information,

Carman, Hoy; Rodriguez, Ana Maria

2004-01-01T23:59:59.000Z

107

Chemical Education Today JChemEd.chem.wisc.edu Vol. 75 No. 5 May 1998 Journal of Chemical Education 537  

E-Print Network (OSTI)

esoteric than necessary. Chemistry is certainly a complicated subject, but shroud- ing it in esoteric

Rioux, Frank

108

Techniques for Maximizing Efficiency of Solar Energy Harvesting Systems (Invited Paper)  

E-Print Network (OSTI)

power point tracking, energy harvest- ing, solar panel, photovoltaic cell, supercapacitor, ultracapac

Shinozuka, Masanobu

109

Short-Term Energy Outlook - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

110

Arizona - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

111

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Wissenschaftliche Mitarbeiter und Stipen- diaten Dr. Olaf Adamczyk Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dr.-Ing. Sebastian Hoffmann Dipl.-Ing. Benjamin Koch Dr. rer. nat. Manfred Lichtinger Dr.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo

Noé, Reinhold

112

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

/2009 ­ 02/2010) Prof. Dr.-Ing. Reinhold Noé Personal Wissenschaftliche Mitarbeiter und Stipendiaten Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath Dr.-Ing. Timo Pfau Stip. M. EE. Kidsanapong Puntsri Dr.-Ing. David Sandel Dr.-Ing. Stephan Schulz Technische

Noé, Reinhold

113

News Briefs  

Science Conference Proceedings (OSTI)

... ing and cleanup, decontamination and decommissioning efforts, testing for ... the commercial radioactivity laboratories, nuclear power radiochemistry ...

1997-11-25T23:59:59.000Z

114

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

115

DOI: 10.1126/science.1184167 , 76 (2010);328Science  

E-Print Network (OSTI)

, includ- ing nanolubricants and components in micro- and nanoeletromechanical systems devices. References

Kim, Philip

116

About EIA - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Uranium fuel, nuclear reactors, ... Environment. Greenhouse gas data, voluntary report- ing, ... Office of Personnel Management;

117

Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

118

Event-Places in North America: City Meaning and Making [Research and Debate  

E-Print Network (OSTI)

events in the cityscape triggers both memories and anticipation, bridg- ing the gap between performances.

Frenchman, Dennis

2004-01-01T23:59:59.000Z

119

United States - Search - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

120

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Images in Neuroscience Carol A. Tamminga, M.D., Editor  

E-Print Network (OSTI)

is delivered to the brain region of interest using a fiberoptic-based system or a light-emitting diode (LED-sensitive, molecular, neu- ronal activity "switches." These "switches" are microbial, light- sensitive ion conductance-regulat- ing activity of these "switches" can be controlled externally with light pulses. ChR2 is a cation

Deisseroth, Karl

122

Ico-photonics-delphi2009.org Fibre-optic interferometric pressure sensor based on  

E-Print Network (OSTI)

is delivered to the brain region of interest using a fiberoptic-based system or a light-emitting diode (LED-sensitive, molecular, neu- ronal activity "switches." These "switches" are microbial, light- sensitive ion conductance-regulat- ing activity of these "switches" can be controlled externally with light pulses. ChR2 is a cation

Vlachos, Kyriakos G.

123

Light-Light Scattering  

E-Print Network (OSTI)

For a long time, it is believed that the light by light scattering is described properly by the Lagrangian density obtained by Heisenberg and Euler. Here, we present a new calculation which is based on the modern field theory technique. It is found that the light-light scattering is completely different from the old expression. The reason is basically due to the unphysical condition (gauge condition) which was employed by the QED calcualtion of Karplus and Neumann. The correct cross section of light-light scattering at low energy of $(\\frac{\\omega}{m} \\ll 1)$ can be written as $ \\displaystyle{\\frac{d\\sigma}{d\\Omega}=\\frac{1}{(6\\pi)^2}\\frac{\\alpha^4} {(2\\omega)^2}(3+2\\cos^2\\theta +\\cos^4\\theta)}$.

Kanda, Naohiro

2011-01-01T23:59:59.000Z

124

Light-Light Scattering  

E-Print Network (OSTI)

For a long time, it is believed that the light by light scattering is described properly by the Lagrangian density obtained by Heisenberg and Euler. Here, we present a new calculation which is based on the modern field theory technique. It is found that the light-light scattering is completely different from the old expression. The reason is basically due to the unphysical condition (gauge condition) which was employed by the QED calcualtion of Karplus and Neumann. The correct cross section of light-light scattering at low energy of $(\\frac{\\omega}{m} \\ll 1)$ can be written as $ \\displaystyle{\\frac{d\\sigma}{d\\Omega}=\\frac{1}{(6\\pi)^2}\\frac{\\alpha^4} {(2\\omega)^2}(3+2\\cos^2\\theta +\\cos^4\\theta)}$.

Naohiro Kanda

2011-06-03T23:59:59.000Z

125

LED Lighting  

Energy.gov (U.S. Department of Energy (DOE))

Light-emitting diodes (LEDs) are light sources that differ from more traditional sources of light in that they are semiconductor devices that produce light when an electrical current is applied....

126

Notes From the Chair 2 Council approves indicators to track 2  

E-Print Network (OSTI)

electronics, and street, park- ing, and exterior building lighting. The estimated achievable potential lights, batter- ies and other energy storage devices, the nation's electricity delivery and storage to participate in the research and development activities pertaining to these new technologies? Do you think

127

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 1,043 49 141 128 26 393 7 112 20 46 122 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 115 6 13 5 3 28 2 40 2 3 11 5,001 to 10,000 ....................... 86 5 11 5 2 28 1 17 2 3 11 10,001 to 25,000 ..................... 142 8 16 15 4 54 1 17 3 6 19 25,001 to 50,000 ..................... 116 5 18 16 3 41 (*) 11 2 5 14 50,001 to 100,000 ................... 153 8 22 23 4 59 1 10 2 6 17

128

 

Gasoline and Diesel Fuel Update (EIA)

E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 3,559 167 481 436 88 1,340 24 381 69 156 418 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 392 19 44 18 11 96 7 138 8 12 39 5,001 to 10,000 ....................... 293 18 38 18 8 95 4 57 6 10 39 10,001 to 25,000 ..................... 485 26 55 52 14 184 3 57 10 20 63 25,001 to 50,000 ..................... 397 18 62 55 12 140 2 37 7 17 48 50,001 to 100,000 ................... 523 28 77 78 15 202 3 35 7 20 59

129

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 890 34 116 113 15 335 6 104 19 43 105 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 113 5 13 5 3 27 2 40 2 3 11 5,001 to 10,000 ....................... 77 4 10 5 2 24 1 16 2 3 10 10,001 to 25,000 ..................... 119 6 14 13 2 44 1 15 3 6 16 25,001 to 50,000 ..................... 103 4 16 15 3 35 (*) 10 2 5 12 50,001 to 100,000 ................... 119 5 17 19 2 46 1 9 2 5 13

130

 

Gasoline and Diesel Fuel Update (EIA)

. Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 5,820 2,203 431 384 448 1,143 167 354 64 148 478 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 672 207 45 18 48 93 48 137 8 12 55 5,001 to 10,000 ....................... 516 198 36 17 40 83 35 56 6 9 39 10,001 to 25,000 ..................... 776 324 47 44 43 151 25 53 9 19 62 25,001 to 50,000 ..................... 673 262 57 50 55 121 13 34 7 16 58 50,001 to 100,000 ................... 759 293 59 65 55 158 11 29 6 18 64

131

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................... 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 .......................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ........................ 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ........................ 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ...................... 405 16 57 65 7 158 2 29 6 18 45 100,001 to 200,000 .................... 483 16 62 80 5 195 1 24 Q 31 56 200,001 to 500,000 .................... 361 8 51 54 5 162 1 9 8 19 43 Over 500,000 ............................. 383 8 47 56 3 181 2 12 8 23 43 Principal Building Activity

132

 

Gasoline and Diesel Fuel Update (EIA)

A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 6,523 2,365 516 436 501 1,340 190 381 69 156 569 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 685 213 46 18 49 96 49 138 8 12 56 5,001 to 10,000 ....................... 563 212 39 18 43 95 37 57 6 10 46 10,001 to 25,000 ..................... 899 357 57 52 51 184 29 57 10 20 83 25,001 to 50,000 ..................... 742 281 63 55 60 140 16 37 7 17 66 50,001 to 100,000 ................... 913 325 79 78 67 202 17 35 7 20 83

133

Lighting Techniques  

Science Conference Proceedings (OSTI)

...Lighting is very critical in photography. The specimen should be placed on a background which will not detract from the resolution of the fracture surface. For basic lighting, one spotlight is suggested. The light is then raised or lowered, and

134

Mansaa thai June is, 1989  

E-Print Network (OSTI)

.ing cell.ing cell.iving cell.ging cell.nnn ccccggggng cell.ggggg cng cell.eelg cell.eee l.lke up every

Kemner, Ken

135

he Romberg Tiburon Center in Marin County is not an easy place to find. While running late and driving too  

E-Print Network (OSTI)

is complete as yellow sun rays blend with the rust-colored towers of the iconic Golden Gate Bridge. Dur- ing originally built for offload- ing coal. Later, it was used to support the assembly of submarine nets

136

Network computing : limits and achievability  

E-Print Network (OSTI)

insufficiency of linear network cod- ing. 2009. [88] R.and K. Zeger. Network cod- ing for computing. In Allertonto target function f is C cod (N , f ) = sup k : ? (k, n)

Karamchandani, Nikhil

2011-01-01T23:59:59.000Z

137

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

In Proceed- ings of Thermal Energy Storage in Aquifers Work-Mathematical Modeling of Thermal Energy storage in Aquifers.In Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

138

Copyright 2008 No part of this presentation may be reproduced in any form without prior authorization.  

E-Print Network (OSTI)

demon- stration project for Xcel Energy, convert- ing a Ford Escape Hybrid PHEV vehicle to put power. Utilizing fully automated fast processing, the new technology will be capable of produc- ing one solar cell

Amin, S. Massoud

139

74 Scientific American, April 2011 Illustration by Tom Whalen Earthquake early-warning networks  

E-Print Network (OSTI)

, but it is enough to send shutdown warn- ings to power plants and rail networks, automatically open ele- vator doors comes in two parts: a fast- moving, sudden jolt and a slower-mov- ing wave that causes the great

Allen, Richard M.

140

Natural Gas Productive Capacity for the Lower 48 States 1986 ...  

U.S. Energy Information Administration (EIA)

con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy o r any other or - gani za tion. Preface

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

BUILDING CORRELATORS WITH MANY-CORE HARDWARE Rob V. van Nieuwpoort and John W. Romein  

E-Print Network (OSTI)

- ing techniques, but more on signal-processing techniques. For example, LOFAR [1], MeerKAT (Karoo Array International Conference on Supercomput- ing, New York, NY, June 2009, pp. 440­449. [11] "Karoo array telescope

Romein, John W.

142

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

Production Readiness Production Readiness Weprogressed towardmarketadoptionby developing, build- ing and testing prototype systems using numerical simula- tion tools andfield tests,by working with industry andmanu- facturing partners, and by demonstrating the technologies in full-scalecommercialbuildings. Thisprovidedabroad,highly defensible record of documented performance. Prototypeswere developed in cooperationwith industrypart- ners to speed commercializationand to work out market bar- riers to full-scaleadoption.Industrypartners in glazing, win- dow systems, shading systems, controls hardware and light- ing were solicited to participate. Feedback through trade as- sociations, conferences and industry associations helped to identify potential obstaclessuch asdifficulties with cross-dis-

143

OFFICE OF AUDITOR OF STATE STATE OF IOWA  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Daniels, Thomas E.

144

Public servants A key part of the  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Manapat, Michael

145

B U S I N E S SB U S I N E S S ROBERT H. SMITH SCHOOL OF BUSINESS UNIVERSITY OF MARYLAND SPRING 2011 VOL. 12 NO. 1  

E-Print Network (OSTI)

and cellphone products. Employees were asked daily over a period of 10 work- ing days to list any incidents

Milchberg, Howard

146

e3_Coyote Case Study2000/L&J  

Science Conference Proceedings (OSTI)

... graphic design technology; biotechnology; heat- ing, ventilating ... the local school districts and work ... HVAC Heating, Ventilating, and Air Conditioning ...

2013-06-04T23:59:59.000Z

147

Cross-market relationships strengthened in the third quarter of ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... The correlation between prompt-month West Texas Intermediate ...

148

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... What is shale gas and why is it important? ...

149

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

150

More recycling raises average energy content of waste used to ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

151

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

152

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

153

Annual Energy Outlook 2013 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

154

State-Level Energy-Related Carbon Dioxide Emissions, 2000-2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

155

Cross State Air Pollution Rule requires emissions reductions from ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

156

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

157

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

158

Does EIA have maps or information on the location of natural gas ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

159

The geology of natural gas resources - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

160

UNIVERSITE DE NICE-SOPHIA ANTIPOLIS -UFR SCIENCES Ecole Doctorale Sciences et Technologies de l'Information et de la Communication  

E-Print Network (OSTI)

- ing the properties of such a ladder in this poorly explored regime. Acknowledgements The work at ORNL

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... CBECS enters the final phase of questionnaire design.

162

Paycheck Deduction Codes 01/10 Deduct Code Description  

E-Print Network (OSTI)

Garnishment GFNOPROV GF Mand Ret-No Providor Chosen GFTSAING GF - TSA ING GFTSALINC GF - TSA Lincoln GFTSASEC

Peterson, Blake R.

163

Electricity use by machine drives varies significantly by ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Fossil fuels may be used to drive turbines, reciprocating engines, ...

164

Fermi and the ergodic problem Giovanni Gallavotti  

E-Print Network (OSTI)

the esoteric (quasi) ergodic problem. Consider- ing a `{degrees of freedom system, ` > 2, with Hamilto- nian H

Roma "La Sapienza", Università di

165

Reference List 1751-2000  

Science Conference Proceedings (OSTI)

... 1934. Wurmb-Schwark, N. v, Michaela Harbeck, Urs Wiesbrock, Inge Schroeder, Stefanie Ritz-Timme, and Manfred Oehmichen. ...

2003-12-18T23:59:59.000Z

166

ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980  

E-Print Network (OSTI)

storm and double-pane windows, insulat- ing shutters, caulking and weatherstripping, fur- nace retrofits, and active and passive solar

Authors, Various

2010-01-01T23:59:59.000Z

167

Underwater 3D Mapping: Experiences and Lessons learned  

E-Print Network (OSTI)

in Okinawa in 1998[5]. Monitoring the health of coral reefs is a difficult and time consum- ing task

Jenkin, Michael R. M.

168

Mid-Atlantic electricity market reacts to Tuesday's earthquake ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... after the event. ...

169

Selected publications, with commentary William Bialek February 11, 2004  

E-Print Network (OSTI)

synergistic cod- ing, and this synergy is a significant component of the high coding efficiency seen in [66

170

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

171

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

172

Electric Power Monthly - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

173

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel, nuclear reactors, generation, spent fuel. ... Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

174

Markov decision process (MDP) framework for software power optimization using call profiles on mobile phones  

E-Print Network (OSTI)

Duke researchers [21] extend this approach to the system level by formulat- ing a general framework to manage energy

Jung, Eric; Maker, Frank; Cheung, Tang Lung; Liu, Xin; Akella, Venkatesh

2010-01-01T23:59:59.000Z

175

View / Download  

Science Conference Proceedings (OSTI)

developing fields of technology, mak- ing major advancements in traditional fields of engineering, or developing/ implementing innovative approaches.

176

THE CORROSION OF SILICATE MATERIALS BY HYDROGEN GAS AND HYDROFLUORIC ACID SOLUTION  

E-Print Network (OSTI)

occurring in the coal gasifier and then find- ing a methodmaterial for the coal gasifier applica- tion. The corrosion

Tso, Stephen T.

2011-01-01T23:59:59.000Z

177

Fuel economy standards have affected vehicle efficiency - Today in ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Notes: Combined means both foreign and domestic vehicles.

178

Second-Generation Nickel-Base Single Crystal Superalloy  

Science Conference Proceedings (OSTI)

creased, the demands placed on turbine airfoils have escalated dramatically. ... The demand- ing goals established ..... (maximum tensile strain at minimum...

179

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, biomass and ethanol. ... Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights

180

ICAL: A Tool for Analyzing Imperfect Comparison Algorithms Wee-Chong Oon and Martin Henz  

E-Print Network (OSTI)

[7] that was based on temporal difference learn- ing, and the checkers program Anaconda [1, 2] based

Henz, Martin

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

SOLAR ENERGY PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT ANNUAL REPORT 1978  

E-Print Network (OSTI)

of develop- ing a photovoltaic cell, based on a catalyst (has been shown that a photovoltaic cell can be constructed

authors, Various

2011-01-01T23:59:59.000Z

182

Assessing regional evapotranspiration and water balance across a Mediterranean montane climate gradient  

E-Print Network (OSTI)

topography and calculated solar radiation. Hydrol. Process.al. (2011). Incom- ing solar radiation was derived from the

Anderson, Ray G.; Jin, Yufang; Goulden, Michael L.

2012-01-01T23:59:59.000Z

183

Puerto Rico - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico Energy Affairs Administration, Administracin de Asuntos Energticos;

184

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico* Saint Kitts and Nevis Saint Lucia Saint Vincent ...

185

Markov Random field edge-centric image/video processing  

E-Print Network (OSTI)

using adaptive fast B-spline ?lter- ing, IEEE Internationalimage resizing using modi?ed B-splines, IEEE International

Li, Min

2007-01-01T23:59:59.000Z

186

How is electricity used in U.S. homes? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... heating elements, and motors not listed above. Learn more:

187

U.S. total motor gasoline exports down slightly from last year but ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Total motor gasoline = finished motor gasoline + motor gasoline blending components.

188

COMBINING MAGNETIC SHIELDING AND CRYOPUMPING FOR A NEUTRAL BEAM SOURCE  

E-Print Network (OSTI)

generated by the fusion reactor while the cold surface willfor the Toka. -nak Fusion Test Reactor", in Proceed ings of

Tanabe, J.

2010-01-01T23:59:59.000Z

189

Integrating Rhetorical-Semantic Relation Models for Query ...  

Science Conference Proceedings (OSTI)

... In Galia Angelova, Kalina Bontcheva, Ruslan Mitkov, Nicolas Nicolov, and Nikolai Nikolov, editors, Proceed- ings of the International Conference ...

2006-10-03T23:59:59.000Z

190

Common coastal foraging areas for loggerheads in the Gulf of Mexico: Opportunities for marine conservation  

E-Print Network (OSTI)

and its find- ings validated. On the other hand, to confirm the validity of the new tag tracking method

Florida, University of

191

Illinois coal production pushes Illinois Basin production above ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... based on the Mine Safety and Health Administration (MSHA).

192

Alkylation is an important source for octane in gasoline - Today ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (like temperature and pressure) along with different safety considerations.

193

Eastern Mediterranean natural gas exploration focused on the ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Gaza Marine: 1: unknown: Sources: EIA estimates, IHS, ...

194

Error-reducing corrections for the method of regularized Stokeslet for fluid-membrane interactions  

E-Print Network (OSTI)

for SDS [1], and sec- ond, we investigate the summarisation of XML documents by tak- ing into account

Ullmer, Brygg

195

Applied and Computational Mathematics Division Applied and ...  

Science Conference Proceedings (OSTI)

... ing, materials science, chemistry, bioscience, engineering, fire ... mathematics are fundamental tools enabling ... The NIST Handbook of Mathematical ...

2013-05-08T23:59:59.000Z

196

Arizona - Rankings - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Markets & Finance. Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ...

197

EXPERIMENTAL ANALYSIS OF HEURISTICS FOR THE ...  

E-Print Network (OSTI)

order from inaccurate adjacency information [19], medical image process- ing [2] ...... salesman problem, Research Report, Department of Computer Science,...

198

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Greenhouse gas data, voluntary report- ing, electric power plant ...

199

Kazakhstan - Analysis - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power ... by the Kazakhstan's Electricity Grid Operating ... regional electricity distribution .. ...

200

Lighting Research Center Lighting Products  

Science Conference Proceedings (OSTI)

... 12) Solid State Lighting Luminaires - Color Characteristic Measurements. [22/S04] IES LM-16:1993 Practical Guide to Colorimetry of Light Sources. ...

2013-07-26T23:59:59.000Z

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Lighting Group: Light Distribution Systems  

NLE Websites -- All DOE Office Websites (Extended Search)

Retrofit Alternatives to Incandescent Downlights Hotel and Institutional Bathroom Lighting Portable Office Lighting Systems Low Glare Outdoor Retrofit Luminaire LED Luminaires...

202

Outlaw lighting  

SciTech Connect

Demand-side management programs by utilities and the federal government`s Green Lights program have made significant inroads in promoting energy-efficient lighting. But the Energy Policy Act now prohibits certain types of lighting. This article provides analysis to help architects determine new lamp performance compared with older lighting products.

Bryan, H.

1994-12-01T23:59:59.000Z

203

THE POLYTECHNIC REPORTER Bloomberg Chosen to Head  

E-Print Network (OSTI)

. Eventually, the state gave the city an $86,000 grant to add more traffic lights and better signage to improve of the benefits of joining NSBE? · A support system for academic success · An opportunity for community NSBE Club systems, shorten- ing street blocks, adding side- walks, improving sidewalk networks, planting more street

Gupta, Nikhil

204

Airport sustainability encompasses a wide variety of airport management and  

E-Print Network (OSTI)

of these measures are replac- ing an old or inefficient water heater or replacing incandescent light bulbs of existing buildings and ground vehicles to collecting water and managing waste. Assessing the sustainability is to consider renewable energies. Solar photovoltaic (PV), which uses panels to absorb solar energy, is prob

Blanchette, Robert A.

205

www.sciencemag.org SCIENCE VOL 325 14 AUGUST 2009 821 PERSPECTIVES  

E-Print Network (OSTI)

to the shortage of raw material (10), at the same time produc- ing the specialized, light, and efficient tools. Vandiver, J. R. Druzik, G. A. Wheeler, I. C. Freestone, Eds. (Materials Research Society Symposium Proc Street, New York, NY 10027, USA. E-mail: jules@ astro.columbia.edu J1836+5925 J2032+4127 J1958+2846 J0218

California at Santa Cruz, University of

206

24 SEPTEMBER 2009 GEORGIA MAGAZINE 25GEORGIA MAGAZINE SEPTEMBER 2009 by Allyson Mann (MA '92)  

E-Print Network (OSTI)

lunch. Red candles, representing the light of Buddha's teaching, burn in front of a Bud- dhist shrine that she'd tested negative for H1N1. The Chinese doctor walked them to the street and hailed a cab. Soon the genetics students spent two weeks do- ing research. Yi's father took the class on a walk through

Arnold, Jonathan

207

VOL.12/NO.2SPRING2005 Inside this issue  

E-Print Network (OSTI)

of an intersection with signal lights, drivers from all intersect- ing streets yield to traffic in the round- about are applying the results of their ISE capstone project. Based on their research for the project and their own Gorder, assistant city engineer for the city of Eagan, found researching roundabouts a good fit. "I have

Amin, S. Massoud

208

A Novel Shape Complementarity Scoring Function for Protein-Protein Docking  

E-Print Network (OSTI)

been a wealth of research on protein-protein docking, described in several reviews.13­19 Predictive: Zhiping Weng, Dept. of Biomedical Engineer- ing, Boston University, 44 Cummington Street, Boston, MA 02215 are composed of the same number of receptor atoms (top; dark disks) and ligand atoms (bottom; light disks

Weng, Zhiping

209

Eos, Vol. 89, No. 20, 13 May 2008 Fiber-optic distributed temperature sens-  

E-Print Network (OSTI)

Eos, Vol. 89, No. 20, 13 May 2008 Fiber-optic distributed temperature sens- ing (DTS) is emerging instillations allow for the precise observation of temperature at each meter of fiber-optic cables, with a precision of up to 0.01ºC. The temperature is computed from the light backscattered following an intense

Dever, Edward P.

210

Undergraduate Symposium 2011 Celebrating Research, Creative Endeavor and Service-Learning  

E-Print Network (OSTI)

" (Bakken & Haeren, Chapter 11: 127). The NDM movement has contributed to the work of numer- ous types of the gravity of their decisions, professionals in these occupations do not take intu- ition lightly (Bakken & Haerem, Chapter 11: 123). In contrast with a sequential view of decision-mak- ing, the authors

Wisconsin at Madison, University of

211

18 WAAC Newsletter Volume 35 Number 2 May 2013 The Role of Exhibition Cases  

E-Print Network (OSTI)

protect- ing them from accidental damage, theft, vandalism, dust, ultraviolet light, environmental in 1973 (Oddy 1973, 27-28), places coupons of silver, copper, and lead inside airtight glass jars tarnished by sulfur and carbonyl sulfides off-gassed from wood, and copper coupons are susceptible

Mathis, Wayne N.

212

INTER-NOISE 2006 3-6 DECEMBER 2006  

E-Print Network (OSTI)

, with LTF buildings there is a concern over poor sound insulation between neighbour- ing rooms that share building designs that optimize sound insulation. Figure 1 shows a cutaway drawing of a typical floor-tenancy floor with impact sound insulation perfor- mance at least as good as a concrete slab. Typical light

Fox, Colin

213

Lighting Controls  

NLE Websites -- All DOE Office Websites (Extended Search)

corridors. The overall range of savings was six to 80 percent. The Advanced Lighting Guidelines On-Line Edition New Buildings Institute 2011 presents a table of lighting energy...

214

Shape the light, light the shape - lighting installation in performance.  

E-Print Network (OSTI)

??This thesis investigates the lighting design theory Light Inside Out, which is the technique of shaping light toward a creation of lighting installation in performance (more)

Yu, Lih-Hwa, 1972-

2010-01-01T23:59:59.000Z

215

Lighting Systems  

NLE Websites -- All DOE Office Websites (Extended Search)

Purple LED lamp Purple LED lamp Lighting Systems Lighting research is aimed at improving the energy efficiency of lighting systems in buildings and homes across the nation. The goal is to reduce lighting energy consumption by 50% over twenty years by improving the efficiency of light sources, and controlling and delivering illumination so that it is available, where and when needed, and at the required intensity. Research falls into four main areas: Sources and Ballasts, Light Distribution Systems, Controls and Communications, and Human Factors. Contacts Francis Rubinstein FMRubinstein@lbl.gov (510) 486-4096 Links Lighting Research Group Batteries and Fuel Cells Buildings Energy Efficiency Applications Commercial Buildings Cool Roofs and Heat Islands Demand Response Energy Efficiency Program and Market Trends

216

Commercial Lighting and LED Lighting Incentives  

Energy.gov (U.S. Department of Energy (DOE))

Incentives for energy efficient commercial lighting equipment as well as commercial LED lighting equipment are available to businesses under the Efficiency Vermont Lighting and LED Lighting...

217

1992 CBECS BC  

U.S. Energy Information Administration (EIA) Indexed Site

7. Energy Conservation Features, Number of Buildings 7. Energy Conservation Features, Number of Buildings and Floorspace, 1992 Building Characteristics RSE Column Factor: Number of Buildings (thousand) Total Floorspace (million square feet) RSE Row Factor All Buildings Any Conser- vation Features Build- ing Shell HVAC Light- ing Other All Buildings Any Conser- vation Features Build- ing Shell HVAC Light- ing Other 0.8 0.8 0.8 0.9 1.0 1.9 0.8 0.9 0.9 0.9 1.2 1.7 All Buildings ................................... 4,806 4,357 4,223 2,604 1,178 264 67,876 64,403 62,056 50,281 29,453 5,952 4.7 Building Floorspace (square feet) 1,001 to 5,000 ................................ 2,681 2,376 2,305 1,194 452 102 7,327 6,575 6,375 3,370 1,302 291 7.4 5,001 to 10,000 .............................. 975 887 864 569 275 62 7,199 6,566 6,405 4,221 2,066 467 5.6 10,001 to 25,000

218

Northern Lights  

NLE Websites -- All DOE Office Websites (Extended Search)

Northern Lights Northern Lights Nature Bulletin No. 178-A February 6, 1965 Forest Preserve District of Cook County Seymour Simon, President Roland F. Eisenbeis, Supt. of Conservation NORTHERN LIGHTS To a person seeing the Aurora Borealis or "northern lights" for the first time, it is an uncanny awe-inspiring spectacle. Sometimes it begins as a glow of red on the northern horizon, ominously suggesting a great fire, gradually changing to a curtain of violet-white, or greenish-yellow light extending from east to west. Some times this may be transformed to appear as fold upon fold of luminous draperies that march majestically across the sky; sometimes as a vast multitude of gigantic flaming swords furiously slashing at the heavens; sometimes as a flowing crown with long undulating colored streamers fanning downward and outward.

219

Light Organizing/Organizing Light [Light in Place  

E-Print Network (OSTI)

a street through alter nating areas of dark and light, welandscapes, streets and squares. Light summons our spiritfor changing light, both outside rooms (such as streets and

Schwartz, Martin

1992-01-01T23:59:59.000Z

220

Solid-State Lighting: LED Lighting Facts  

NLE Websites -- All DOE Office Websites (Extended Search)

Market-Based Programs Printable Version Share this resource Send a link to Solid-State Lighting: LED Lighting Facts to someone by E-mail Share Solid-State Lighting: LED Lighting Facts on Facebook Tweet about Solid-State Lighting: LED Lighting Facts on Twitter Bookmark Solid-State Lighting: LED Lighting Facts on Google Bookmark Solid-State Lighting: LED Lighting Facts on Delicious Rank Solid-State Lighting: LED Lighting Facts on Digg Find More places to share Solid-State Lighting: LED Lighting Facts on AddThis.com... LED Lighting Facts CALiPER Program Standards Development Technical Information Network Gateway Demonstrations Municipal Consortium Design Competitions LED Lighting Facts LED lighting facts - A Program of the U.S. DOE DOE's LED Lighting Facts® program showcases LED products for general

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Light Computing  

E-Print Network (OSTI)

A configuration of light pulses is generated, together with emitters and receptors, that allows computing. The computing is extraordinarily high in number of flops per second, exceeding the capability of a quantum computer for a given size and coherence region. The emitters and receptors are based on the quantum diode, which can emit and detect individual photons with high accuracy.

Gordon Chalmers

2006-10-13T23:59:59.000Z

222

EK101 Engineering Light Smart Lighting  

E-Print Network (OSTI)

extensively in concert lighting and are finding increased usage in dance lighting because refers to the upstage back curtain (is white or a light color), which can be us for lighting or special Mixer #12;Monitor House speaker Lighting System Control Board: Similar to the sound board, the light

Bifano, Thomas

223

Texas Electric Lighting Report  

NLE Websites -- All DOE Office Websites (Extended Search)

electric lighting electric lighting The SNAP House's lighting design aims for elegant simplicity in concept, use, and maintenance. Throughout the house, soft, ambient light is juxtaposed with bright, direct task lighting. All ambient and most task lighting is integrated directly into the architectural design of the house. An accent light wall between the bedroom and bathroom provides a glowing light for nighttime navigation.

224

Light Emitting Diode (LED) Lighting and Systems  

Science Conference Proceedings (OSTI)

This EPRI Technical Update addresses the most promising and unique energy efficient light source light emitting diode (LED) lighting. Business and technical market factors (Chapter 2) explain the upcoming growth of the LED and LED lighting market. Future technical improvements to LEDs and systems are also emphasized. Discussion of the importance of utility involvement in helping their customers make the switch from traditional lighting to LED lighting is provided. LED lighting technologies are covered in...

2007-12-21T23:59:59.000Z

225

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

226

 

Gasoline and Diesel Fuel Update (EIA)

E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 48.0 1.8 6.3 6.1 0.8 18.1 0.3 5.6 1.0 2.3 5.6 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.8 2.9 6.8 2.9 1.7 14.6 1.1 21.6 1.2 1.9 6.0 5,001 to 10,000 ....................... 42.2 2.0 5.6 2.8 0.9 13.3 0.7 9.0 0.9 1.5 5.7 10,001 to 25,000 ..................... 35.8 1.7 4.1 3.9 0.7 13.3 0.3 4.6 0.8 1.7 4.7 25,001 to 50,000 ..................... 41.8 1.8 6.6 6.0 1.0 14.4 0.2 4.1 0.8 1.9 5.0

227

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

228

 

Gasoline and Diesel Fuel Update (EIA)

E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 50.7 2.4 6.9 6.2 1.3 19.1 0.3 5.4 1.0 2.2 6.0 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.6 2.9 6.8 2.8 1.7 14.8 1.1 21.2 1.2 1.8 6.0 5,001 to 10,000 ....................... 44.0 2.6 5.7 2.8 1.1 14.3 0.7 8.6 0.9 1.4 5.8 10,001 to 25,000 ..................... 38.8 2.1 4.4 4.1 1.1 14.7 0.2 4.5 0.8 1.6 5.1 25,001 to 50,000 ..................... 43.7 2.0 6.8 6.1 1.3 15.4 0.2 4.0 0.8 1.9 5.3

229

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (kWh/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 14.9 0.7 2.0 1.8 0.4 5.6 0.1 1.6 0.3 0.7 1.7 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 17.8 0.9 2.0 0.8 0.5 4.4 0.3 6.2 0.4 0.5 1.8 5,001 to 10,000 ....................... 12.9 0.8 1.7 0.8 0.3 4.2 0.2 2.5 0.3 0.4 1.7 10,001 to 25,000 ..................... 11.4 0.6 1.3 1.2 0.3 4.3 0.1 1.3 0.2 0.5 1.5 25,001 to 50,000 ..................... 12.8 0.6 2.0 1.8 0.4 4.5 0.1 1.2 0.2 0.6 1.5

230

Energy and lighting design  

SciTech Connect

A detailed examination of the current energy conservation practices for lighting systems is presented. This first part of a two-part presentation covers the following: energy and lighting design; lighting and energy standards; lighting efficiency factors; light control and photometrics; lighting and the architectural interior; luminaire impact on the environment; basic design techniques; the lighting power budget; and conservation through control.

Helms, R.N.

1979-11-01T23:59:59.000Z

231

Light Emitting Diodes and General Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Light Emitting Diodes and General Lighting Speaker(s): Martin Moeck Date: August 6, 2009 - 12:00pm Location: 90-3122 We give a short overview on high-power light emitting diodes,...

232

Evaluation of Lighting and Lighting Control Technologies  

Science Conference Proceedings (OSTI)

Energy efficient lighting and lighting controls have been a means to significant energy savings for many facilities around the world. Advances in lighting sources often allow for the conservation of quality of light while providing more flexibility in the control of light. Additionally, advances in core technologies within the lighting marketplace regularly lead to the introduction of new lamps, fixtures and controls. With the rapid introduction of new products and designs, it is important to ...

2013-11-15T23:59:59.000Z

233

Lighting Group: Controls: PIER Lighting Projects  

NLE Websites -- All DOE Office Websites (Extended Search)

PIER Lighting Projects CEC Public Interest Energy Research (PIER) Projects Objective Lighting controls are often expensive, complex, hard to commission properly and difficult to...

234

Architectural Lighting Analysis in Virtual Lighting Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Architectural Lighting Analysis in Virtual Lighting Laboratory NOTICE Due to the current lapse of federal funding, Berkeley Lab websites are accessible, but may not be updated...

235

Next Generation Light Source  

Next Generation Light Source Super Thin Light Bulb, Energy Efficient, Long Life, Dimmable, and Uniform Illumination High Entry Barrier 71 ...

236

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

jpg IMAGE imgs/esl337.jpg jpg IMAGE imgs/esl337.jpg IMAGE imgs/esl338.jpg IMAGE imgs/esl339.jpg ering the solar heat gain coefficient to reduce cooling while maintaining the visual transmission of the glass to capture daylight savings. However, harnessing daylight in a build- ing poses asignificanttechnicalchallenge because ofthe great variability in daylight intensity. Achieving higher energy savings under these conditions requires looking beyond static systemstodynamic systemsthatrespond tochanging climatic or occupant conditions. By linking a dimmableelectric light- ing system with daylighting controls to a fenestrationsystem that can automatically modify the transmission of daylight, we can get real-time control of the cooling and lighting en- ergy balance while addressing glare and thermal comfort.

237

First Light  

E-Print Network (OSTI)

The first dwarf galaxies, which constitute the building blocks of the collapsed objects we find today in the Universe, had formed hundreds of millions of years after the big bang. This pedagogical review describes the early growth of their small-amplitude seed fluctuations from the epoch of inflation through dark matter decoupling and matter-radiation equality, to the final collapse and fragmentation of the dark matter on all mass scales above \\~10^{-4} solar masses. The condensation of baryons into halos in the mass range of ~10^5-10^{10} solar masses led to the formation of the first stars and the re-ionization of the cold hydrogen gas, left over from the big bang. The production of heavy elements by the first stars started the metal enrichment process that eventually led to the formation of rocky planets and life. A wide variety of instruments currently under design [including large-aperture infrared telescopes on the ground or in space (JWST), and low-frequency arrays for the detection of redshifted 21cm radiation], will establish better understanding of the first sources of light during an epoch in cosmic history that was largely unexplored so far. Numerical simulations of reionization are computationally challenging, as they require radiative transfer across large cosmological volumes as well as sufficently high resolution to identify the sources of the ionizing radiation. The technological challenges for observations and the computational challenges for numerical simulations, will motivate intense work in this field over the coming decade.

Abraham Loeb

2006-03-14T23:59:59.000Z

238

Lighting | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lighting Lighting Lighting When you're shopping for lightbulbs, compare lumens and use the Lighting Facts label to be sure you're getting the amount of light, or level of brightness, you want. You can save money and energy while lighting your home and still maintaining good light quantity and quality. Consider energy-efficient lighting options to use the same amount of light for less money. Learn strategies for comparing and buying lighting products and using them efficiently. Featured Lighting Choices to Save You Money Light your home for less money while using the same amount of light. How Energy-Efficient Light Bulbs Compare with Traditional Incandescents Energy-efficient light bulbs are available today and could save you about $50 per year in energy costs when you replace 15 traditional incandescent bulbs in your home.

239

Boiler Upgrades and Decentralizing Steam Systems Save Water and Energy at Naval Air Station Oceana  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Location at NAS Oceana. Location at NAS Oceana. by these changes, including bachelor housing, hangers, the galley, office buildings, the chapel, and maintenance facilities. This ESPC also included installing ground source heat pumps in three buildings, adding digital control systems to increase heating, ventilation and air conditioning (HVAC) efficiency, efficient lighting retrofits, and other water conservation measures. These other water conservation measures include over 5,000 water efficient domestic fixtures, includ- ing faucets, showerheads, and toilets

240

Boiler Upgrades and Decentralizing Steam Systems Save Water and Energy at Naval Air Station Oceana  

NLE Websites -- All DOE Office Websites (Extended Search)

Location at NAS Oceana. Location at NAS Oceana. by these changes, including bachelor housing, hangers, the galley, office buildings, the chapel, and maintenance facilities. This ESPC also included installing ground source heat pumps in three buildings, adding digital control systems to increase heating, ventilation and air conditioning (HVAC) efficiency, efficient lighting retrofits, and other water conservation measures. These other water conservation measures include over 5,000 water efficient domestic fixtures, includ- ing faucets, showerheads, and toilets

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Architectural Lighting Analysis in Virtual Lighting Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Architectural Lighting Analysis in Virtual Lighting Laboratory Architectural Lighting Analysis in Virtual Lighting Laboratory Speaker(s): Mehlika Inanici Date: July 7, 2003 - 12:00pm Location: Bldg. 90 Seminar Host/Point of Contact: Satkartar K. Kinney Virtual Lighting Laboratory is a Radiance-based lighting analysis tool and methodology that proposes transformations in the utilization of computer visualization in lighting analysis and design decision-making. It is a computer environment, where the user has been provided with matrices of illuminance and luminance values extracted from high dynamic range images. The principal idea is to provide the laboratory to the designer and researcher to explore various lighting analysis techniques instead of imposing limited number of predetermined metrics. In addition, it introduces an analysis approach for temporal and spatial lighting

242

New Light Sources for Tomorrow's Lighting Designs  

E-Print Network (OSTI)

The lighting industry is driven to provide light sources and lighting systems that, when properly applied, will produce a suitable luminous environment in which to perform a specified task. Tasks may include everything from office work, manufacturing and inspection to viewing priceless art objects, selecting the right chair for your living room, and deciding which produce item to select for tonight's dinner. While energy efficiency is a major consideration in any new lighting system design, the sacrifice of lighting quality may cost more in terms of lost productivity and user dissatisfaction than can ever be saved on that monthly energy bill. During the past several years, many new light sources have been developed and introduced. These product introductions have not been limited to anyone lamp type, but instead may be found in filament, fluorescent and high intensity discharge lamp families. Manufacturers of light sources have two basic goals for new product development. These goals are high efficiency lighting and improved color rendering properties. High efficiency lighting may take the form of either increasing lamp efficiency (lumens of light delivered per watt of power consumed) or decreasing lamp size, thus making a more easily controlled light source that places light where it is needed. The manufacturer's second goal is to produce lamps that render colors accurately while maintaining high efficiency. This paper will discuss new introductions in light sources and lighting systems and how they may impact the design of luminous environments of the future.

Krailo, D. A.

1986-06-01T23:59:59.000Z

243

NIST CENTER FOR NEUTRON RESEARCH LAYOUT  

Science Conference Proceedings (OSTI)

... 17 18 19 13 13 Spin Echo Spectrometer offer- ing neV energy resolution, based upon Jlich design, sponsored by NIST, Jlich, and ExxonMobil. ...

2001-02-27T23:59:59.000Z

244

COMPARISON OF PROPORTIONAL AND ON/OFF COLLECTOR LOOP CONTROL STRATEGIES USING A DYNAMIC COLLECTOR MODEL  

E-Print Network (OSTI)

Department of Energy. "Solar heating and Cooling ProjectProgram." ings of the Solar Heating and Operational Resultsin the Control of Solar Heating and Cooling Systems."

Schiller, Steven R.

2013-01-01T23:59:59.000Z

245

Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

kinetic and sum frequency gen- eration vibrational spectroscopy study. Journal of the American Chemicalkinetic studies of their activity and stability against leach- ing. Journal of the American Chemical

Ewers, Trevor David

2012-01-01T23:59:59.000Z

246

China Energy Databook - Rev. 4  

E-Print Network (OSTI)

com- mercial energy source, petroleum began contribut- ing aFrom British Petroleum. Source: China Energy StatisticalSource: United Nations, 1994; World Energy Council, 1992; British Petroleum,

Sinton Editor, J.E.

2010-01-01T23:59:59.000Z

247

An Attractor-Repeller Approach to Floorplanning  

E-Print Network (OSTI)

ing the optimal positions for a given set of modules of fixed area (but perhaps ...... 51. This problem has 10 mobile modules. (departments) and, in contrast with...

248

Markets expect Marcellus growth to drive Appalachian natural gas ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

249

Why Sandia?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia? Sandia was doing cyber before the term cyberspace existed. Today, with cybersecurity a daunting - and rapidly grow- ing - national security problem, Sandia is applying...

250

Three Public Neighborhoods [EDRA / Places Awards -- Research  

E-Print Network (OSTI)

Enhanced maintenance and management performance. Improvedbetter maintenance, stricter management and increasedand management of the importance of their collective contribution to redevelopment and ongo- ing maintenance.

Nesmith, Barbara Stabin

2001-01-01T23:59:59.000Z

251

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... CAFE standards August 3, 2012 Fuel economy standards have affected vehicle efficiency.

252

Recently, S&P 500 Index and WTI crude oil futures price movements ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... One notable exception to this recent price correlation came on August 9.

253

STATE OF GREEN bUSINESS 2012  

Science Conference Proceedings (OSTI)

... Cool technologies are start- ing to make home energy efficiency more com ... years, hundreds of millions of households and businesses worldwide will ...

2013-07-29T23:59:59.000Z

254

Member News_Dec 2011_7M.indd - TMS  

Science Conference Proceedings (OSTI)

The nomination form and support- ing documentsincluding ... bridge University's science program, and then just to see ... a pipe organ construction business in.

255

METAHEURISTIC HYBRIDIZATION WITH GRASP 1. Introduction ...  

E-Print Network (OSTI)

Apr 14, 2008 ... ing, scheduling, inventory and production planning, and facility location. ..... that the size of the neighborhood be such that its exploration can.

256

Secretaries Chu and Salazar to Convene Meeting on Strengthening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commandant for Operations, United States Coast Guard Andrew Inglis, Chief Executive of Exploration & Production, BP Rex W. Tillerson, Chairman& CEO, ExxonMobil Hon. Don Winter,...

257

Shot boundary detection using the moving query window  

Science Conference Proceedings (OSTI)

... and after it will usually be near- symmetrical. ... while using only the luminance component of the ... Proceed- ings of the SPIE; Visualization and Optimi ...

2002-11-08T23:59:59.000Z

258

Georgia - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Georgia's power grid was previously part of an integrated South Caucasus network.

259

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

260

FLAMMABILITY OF HFC/HCFC -AIR MIXTURES AT ...  

Science Conference Proceedings (OSTI)

... a hatch for inspection and cleaning, sockets for installation of pressure transducers, thermocouples and an igniter and a jacket for thermostat- ing. ...

2011-10-13T23:59:59.000Z

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

View / Download - TMS  

Science Conference Proceedings (OSTI)

neer at EWI, Columbus, Ohio. Work- ing in the materials group, he provides expertise on ceramics and fundamen- tal materials science to clients in such.

262

Assessment of Hybrid Geothermal Heat Pump Systems - Technology...  

NLE Websites -- All DOE Office Websites (Extended Search)

cool- ing needs of the building and offers general guidelines Assessment of Hybrid Geothermal Heat Pump Systems Geothermal heat pumps offer attractive choice for space...

263

February 2010 TOC.indd  

Science Conference Proceedings (OSTI)

Feb 2, 2010 ... and geothermal power is available. Ad- ditional sources of hydro power are be- ing developed in China and Brazil and this trend is expected to...

264

Estimation of Hurricane Wind Speed Probabilities: Application ...  

Science Conference Proceedings (OSTI)

... of experienc- ing nonlinear behavior under exceptionally strong windstorm events, or for the design of Liquid Natural Gas (LNG) facilities, required ...

2013-07-26T23:59:59.000Z

265

Sandia Labs Accomplishments 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

THz transceiver. Engineering sciences The first large-scale liquefied natural gas (LNG) fire test in the Phoenix series was successfully conducted. The result- ing fire was...

266

DISTRIBUTED SENSOR PROCESSING OVER AN AD HOC ...  

Science Conference Proceedings (OSTI)

... ing mechanisms that consider the remaining battery life of a node? ... The Linked Cluster algorithm (LCA) [1] was used to self-organize the network ...

2009-02-03T23:59:59.000Z

267

Impact of Ground-level Aviation Emissions on Air Quality in the Western United States.  

E-Print Network (OSTI)

??The aviation industry has experienced sustained growth since its inception result- ing in an increase in air pollutant emissions. Exposure to particulate matter less than (more)

Clark, Eric Edward

2010-01-01T23:59:59.000Z

268

View / Download  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames

269

COMMUNICATIONS OF THE ACM January 2002/Vol. 45, No. 1 43 ameBots [1] is a virtual reality  

E-Print Network (OSTI)

is available in Tcl/Tk, Java, C/C++, and more. Tools for visualiz- ing the terrain in which agents interact

Kaminka, Gal A.

270

SHA-3 Conference, August 2010, CubeHash  

Science Conference Proceedings (OSTI)

... he analysis! ... were the easy issues. issues, most interesting arty analyses of CubeHash: ingly sophisticated ntial attacks. ... No Limited RAM size? ...

2012-05-30T23:59:59.000Z

271

Health and Rights at the Margins  

E-Print Network (OSTI)

City, on the China-Myanmar line, the flow of drugs, people,in China when a study found that 146 inject- ing drug users

Shih, Elena

2012-01-01T23:59:59.000Z

272

A NONSTANDARD SIMPLEX ALGORITHM FOR LINEAR ...  

E-Print Network (OSTI)

standard simplex algorithm. 2. Pivoting operations. In the next section, we describe column and row pivot- ing operations. This topic is closely related to the ...

273

eTuner: tuning schema matching software using synthetic scenarios  

Science Conference Proceedings (OSTI)

ranked list of answers to the human user. In such sce- narios ... manually, largely by trial and error a time consum- ing, frustrating, and error prone process.

274

OP - SFNET - Volume 15, Number 2 March 15, 2008  

Science Conference Proceedings (OSTI)

... ing WAVE - WAVElets S - Signal processing People interested in attending the workshop and/or the banquet can register using the website http ...

2008-06-30T23:59:59.000Z

275

Gender and Modernity in Colonial Korea  

E-Print Network (OSTI)

by Jennifer J. Jung-Kim Gender & Modernity in Colonial Koreathe ongo- ing reformulation of gender identities. First, Iupdate he reconstruction of gender identities My findings

Jung-Kim, Jennifer J.

2006-01-01T23:59:59.000Z

276

Table 5.13d Petroleum Consumption Estimates: Electric ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, ... For 1949-1979, data are for gas turbine and internal combustion plant use of petroleum. For 1980-2000, ...

277

MEASUREMENT SCIENCE AND TECHNOLOGY FOR THE ...  

Science Conference Proceedings (OSTI)

... To boost fuel efficiency, the US auto industry is striv- ing to manufacture cars from lightweight ... for evaluating how parts of a hydro- gen pipeline ...

2012-11-14T23:59:59.000Z

278

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

Department of Energy, Energy Storage Division through thegeneration and energy storage, Presented at Frontiers ofIn Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

279

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

aquifers for thermal energy storage. Problems outlined aboveModeling of Thermal Energy Storage in Aquifers," Proceed-ings of Aquifer Thermal Energy Storage Workshop, Lawrence

Tsang, C.-F.

2011-01-01T23:59:59.000Z

280

Exhibition Directory  

Science Conference Proceedings (OSTI)

Feb 7, 2008 ... Fundamentals ..... ing ASM Handbooks Online, ASM Alloy Center and the Al- ..... sales engineers to answer any questions you may have.

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Automated extraction and classification of thunderstorm and ...  

Science Conference Proceedings (OSTI)

... found that thunder- storms dominated the wind climate in West Texas. ... may be unrealistically long, suggest- ing that intermediate beginning and ...

2013-01-17T23:59:59.000Z

282

Total Energy - Data - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

283

Press Room - Press Releases - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

284

The Ethics of Industry Experimentation Using Employees: The Case of Taste-Testing Pesticide-Treated Tobacco  

E-Print Network (OSTI)

RJ, Barbeau EM. Tobacco industry documents: com- paring theRE, Balbach ED. Tobacco industry documents: treasure trovecombined meet- ing of the Industry Technical Committee and

McDaniel, Patricia A; Solomon, Gina; Malone, Ruth E

2006-01-01T23:59:59.000Z

285

Ctontents  

Science Conference Proceedings (OSTI)

... "Time that material started flaming where ... a 4D shift from left to right, and start- ing with ... by repeating the length change calcula- tions starting at the ...

2003-10-14T23:59:59.000Z

286

A new lower bound for one-machine earliness-tardiness scheduling  

E-Print Network (OSTI)

the 50-job instances remain unsolved within a large time limit. ..... Our heuristic is based on the analysis of the pseudo-schedule correspond- ing to the optimum...

287

The NIST Length Scale Interferometer  

Science Conference Proceedings (OSTI)

... This approach to measurements was pioneered by Churchill ... as part of this study of systematic effects but ... the stand- ing wave train between the ...

2013-10-22T23:59:59.000Z

288

International Carbon Dioxide Emissions and Carbon Intensity  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

289

Angola - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... but in the short-term access to power will remain a challenge.

290

Few transportation fuels surpass the energy densities of gasoline ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

291

Fast dimensional inspection of deformable parts from partial views Andres Jaramillo a  

E-Print Network (OSTI)

Nacional de Colombia, Cra 27 No. 64-60 Manizales, Caldas, Colombia b Depto. Ing. Meca´nica y Mecatro

Alberta, University of

292

Qatar - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, ... voluntary report- ing, ... Qatar's Oryx GTL project is in operation and the Pearl GTL project is expected to begin ...

293

Invariant semidefinite programs - Optimization Online  

E-Print Network (OSTI)

V.I. Levenshtein, Universal bounds for codes and designs, in Handbook of Cod- ing Theory, eds V. Pless and W. C. Huffmann, Amsterdam: Elsevier, 1998,.

294

Structural Changes During Thermal Fatigue of Two Nickel-Based ...  

Science Conference Proceedings (OSTI)

greatly affect the thermal endurance of these heat-resisting alloys. I?. ... factors govern- ing the thermal fatigue behavior of a number of commercial nickel-.

295

Netherlands - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (BkWh) of electricity in 2011, mostly from conventional thermal power plants.

296

--No Title--  

Annual Energy Outlook 2012 (EIA)

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

297

at Clemson University Department of Forest Resources  

E-Print Network (OSTI)

prediction. For. Sci. 54(5):553­566. ZHANG, L., J.A. MOORE, AND J.D. NEWBERRY. 1993. Disaggregat- ing stand

Bolding, M. Chad

298

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

299

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

using aquifers for thermal energy storage. Problems outlinedmatical Modeling of Thermal Energy Storage in Aquifers,"Proceed- ings of Aquifer Thermal Energy Storage Workshop,

Tsang, C.-F.

2011-01-01T23:59:59.000Z

300

Homeward Bound: Food-Related Transportation Strategies in Low Income and Transit Dependent Communities  

E-Print Network (OSTI)

s Ad Hoc Food Security ing Home the Broccoli: Innovativeor administrative home for food security planning, includingtheir goods home. broadly, food security approaches. The

Gottlieb, Robert; Fisher, Andrew; Dohan, Marc; O'Connor, Linda; Parks, Virginia

1996-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... A report of historical annual energy statistics. For many series, ...

302

View / Download - TMS  

Science Conference Proceedings (OSTI)

neering at the University of Leeds,. United Kingdom. She received the award for research on bioengineer- ing, in particular on the tribology of hip replacements.

303

Die emanzipierte Emanzipationsgegnerin: Caroline Pichlers theoretische Schriften  

E-Print Network (OSTI)

Lit- eraturwissenschaft. Hrsg. Inge Stephan und SigridVon Brgern und ihren Frauen. Hrsg. Mar- gret Friedrich undEin Bonner Symposium. Hrsg. Karl Konrad Polheim. Bonn:

Laukov, Lucia

2011-01-01T23:59:59.000Z

304

NANOSTRUCTURED CATALYTIC MEMBRANES - Argonne National Laboratory  

different sources, including coal, natural gas, or biomass such as corn. NCMs also can be used for selective ... ing production costs, and improving ...

305

A Provably Secure Operating System  

Science Conference Proceedings (OSTI)

... ing availability of desired facilities, correctness of ... hierarchical structure and the doctrine of invisibility of ... An on-line facility for interactive editing of ...

2013-04-15T23:59:59.000Z

306

Passive Cooling of a Micromechanical Oscillator with a ...  

Science Conference Proceedings (OSTI)

... Closely related passive cooling has been reported in [9,20 ... Although rather modest cooling is obtained here ... eventually provide ground state cool- ing ...

2007-09-26T23:59:59.000Z

307

Section 4.1.3 Natural Ventilation: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

in and through build- ings. These airflows may be used both for ventilation air and for passive cooling strategies. Natural ventila- tion is often strongly preferred by building...

308

Cooperative motions in supercooled liquids and glasses  

E-Print Network (OSTI)

method[167, 168, 169] (WHAM). The resulting free energy pro?in ?gure 5.4a. Us- ing WHAM and the library construction

Stevenson, Jacob D.

2009-01-01T23:59:59.000Z

309

How much tax do we pay on a gallon of gasoline and diesel fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

310

Does EIA publish off-road diesel fuel prices? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

311

Laser Plasma Particle Accelerators: Large Fields for Smaller Facility Sources  

E-Print Network (OSTI)

Scientific Comput- ing (NERSC) Center Analytics Team, usingsimulations on Seaborg at NERSC, made possible by an INCITEand ongoing work on Franklin at NERSC and Atlas at Lawrence

Geddes, Cameron G.R.

2010-01-01T23:59:59.000Z

312

What do you prefer? Using Preferences to Enhance Learning Technology  

E-Print Network (OSTI)

-based courses to self-organized home-based learning mak- ing use of on-line material. These courses might target

Olmedilla, Daniel

313

Basing Transport Planning on Principles of Social Justice  

E-Print Network (OSTI)

M. Frost, et al. (2000). Transport and Social Exclusion inG. Willumsen. (1994). Modelling Transport. Chichester: JohnG. Willumsen. (2001). Modelling Transport. Chichester: John

Martens, Karel

2006-01-01T23:59:59.000Z

314

A GENETIC ALGORITHM FOR THE WEIGHT SETTING PROBLEM ...  

E-Print Network (OSTI)

Oct 9, 2001 ... versity of Michigan, 1971. [16] Internet Engineering Task Force. Ospf version 2. Technical Report RFC 1583, Network Work- ing Group, 1994.

315

GROWTH OF PACIFIC SAUR~ COWLABlS SAlRA, IN THE NORTHEASTERN AND NORTHWESTERN PACIFIC OCEANI  

E-Print Network (OSTI)

on the embryonic development of killifish rpnnl"t.p.1i hv Arm"trona "nli r.h;]n il QAI'\\ {)h".,.r,,_ ing

316

Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

317

MOST Multiple Objective Spanning Trees Repository Project  

E-Print Network (OSTI)

VLSI layout, electricity, water, telecommunication or traffic networks. (Sack and ... a set of trade-off compromises between all concurring weights, result- ing in a...

318

Vehicle use varies across U.S. regions - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Reliance on vehicles can vary significantly across the United States.

319

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, ...

320

Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, 1949-2010:

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... flexible fuel vehicles October 10, 2013 New-vehicle fuel economy continues to increase.

322

Essays on Foreign Direct Investment, Growth and the Environment  

E-Print Network (OSTI)

high levels of capital intensity. The principal limitationof labor at current capital intensity using the base-periodlabor at base-period capital intensity us- ing the current

Gu, Waner

2011-01-01T23:59:59.000Z

323

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

324

Legal Metrology Devices Program  

Science Conference Proceedings (OSTI)

... such as retail motor-fuel dispensers or gas pumps, vehicle mounted meters for delivering home heating oil, and liquefied petroleum gas liquid-ing ...

2013-07-31T23:59:59.000Z

325

Planning Water Use in California  

E-Print Network (OSTI)

the University of Maryland Water Policy Collaborative, 2006.FURTH ER READ ING California Department of Water Resources.California Water Plan Update 2005: A Framework for Action.

Eisenstein, William; Kondolf, G. Mathias

2008-01-01T23:59:59.000Z

326

Using seafloor geodesy to monitor volcanic collapse on the south flank of Kilauea Volcano, Hawaii  

E-Print Network (OSTI)

accommodat- ing subsidence in the summit caldera (Lipman etshow the amount of subsidence (in meters) measured theremagnitude seaward slip and subsidence on the south ?ank as

Phillips, Kathleen A.

2006-01-01T23:59:59.000Z

327

Domestic Violence and Risk Factors among Korean Immigrant ...  

Science Conference Proceedings (OSTI)

Mar 23, 2007 ... ing laundry (Wife), driving the car (Husband), shopping for groceries (Wife), paying bills (Both), taking care of the chil- dren (Wife), disciplining...

328

Review of Literature Related to Residential Ventilation Requirements  

E-Print Network (OSTI)

Refrigerating, and Air -Conditioning Engineers, Atlanta, GRefrigerat ing, and Air-Conditioning Engineers, Atlanta, Gof Ventilation and Air Conditioning: Is C E R N up to Date

McWilliams, Jennifer; Sherman, Max

2005-01-01T23:59:59.000Z

329

China consumes nearly as much coal as the rest of the world ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

330

Ohio - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... Ohio Energy Resources Division;

331

X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

evacuations. Following the storm-related interruptions to production, refin- xii Energy Information AdministrationPetroleum Marketing Annual 2002 ing, and delivery...

332

Blanchard Cr JohnsonGulch  

E-Print Network (OSTI)

Whale Cr Tepee Cr Thoma Cr KintlaCr Logg ing Cr Anaconda Cr Bo wmanCr Kintla Cr Cam a s Cr A naco nda

333

Next generation solutions for the energy services industry  

E-Print Network (OSTI)

to target cost-effective energy efficiency upgrades. and analyze energy efficiency cost and performance data canEnergy Efficiency Services to Large Commercial Firms: Operat- ing Cost

Kumar, Satish; Kromer, Steve

2006-01-01T23:59:59.000Z

334

South Carolina - State Energy Profile Analysis - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

335

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

336

U.S. States - Maps - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

337

Georgia - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

338

Rhode Island - State Energy Profile Overview - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

339

United States - Rankings - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

340

Delaware - Compare - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

342

Statistical Analysis of Dross Data for Hydro Aluminium Casthouses  

Science Conference Proceedings (OSTI)

Presentation Title, Statistical Analysis of Dross Data for Hydro Aluminium Casthouses. Author(s), Christian Rosenkilde, Inge Johansen, Amanda Bowles. On-Site...

343

Land Use Planning to Promote Marine Conservation of Coral reef Ecosystems in Moorea, French Polynesia  

E-Print Network (OSTI)

material, creat- ing rich compost that can be used forcrops. Manage Solids Compost: Pig waste and carcasses can bematerials such as mats. Compost Solid waste from the solid

Timothy Duane

2006-01-01T23:59:59.000Z

344

The Cultivar newsletter, Spring/Summer 2005  

E-Print Network (OSTI)

to disease; and incorporating compost to enhance biologicalways to adjust fertilizer and compost levels and applicationSUMMER 2005 ing pre-plant compost applications, especially

Brown, Martha

2005-01-01T23:59:59.000Z

345

The Riemann Hypothesis Peter Borwein - CECM  

E-Print Network (OSTI)

The distribution of such prime numbers among all natural numbers does ... ing the distribution of prime numbers. ... inent mathematician of his generation, raised .

346

The Influence of VIM Crucible Composition, Vacuum Arc Remelting ...  

Science Conference Proceedings (OSTI)

ing a weight of 23 kilograms. (50 pounds). The as-cast ingot surface was maintained on all ingots. VIM Ingot Cleanliness. Evaluation. The cleanliness evaluation.

347

Research Article A Comprehensive Evaluation of Indoor ...  

Science Conference Proceedings (OSTI)

... fixed-length sliding window originat- ing at the beginning of the impulse response ... ments with range below 10 m to protect it from over- load and also ...

2007-12-10T23:59:59.000Z

348

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

349

Highlights Year in Review - 2004 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Highlights Year in Review - 2004 International crude oil prices rose considerably dur-ing 2004. While many issues contributed to higher prices, perhaps the most ...

350

Meso-machining  

NLE Websites -- All DOE Office Websites (Extended Search)

following meso-machin- ing technologies: * Focused ion beam (FIB) machining, * Micro-milling and -turning, * Femto-second laser machining * Micro-Electro Discharge Machining...

351

View / Download  

Science Conference Proceedings (OSTI)

director of the Quad Cities Manufac- turing Laboratory, a nonprofit research and development company in the Rock. Island ArsenalJoint Manufactur- ing and...

352

View / Download - TMS  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames ...

353

Advanced Modeling and Evaluation of the Response of Base-Isolated Nuclear Facility Structures to Vertical Earthquake Excitation  

E-Print Network (OSTI)

II Offshore Platforms. environmentalprotection.com.retrofit of Chirag 1 offshore platform, Proceed- ings, Int.have been used for offshore oil platforms including the

Keldrauk, Eric Scott

2012-01-01T23:59:59.000Z

354

Evince Technology | Open Energy Information  

Open Energy Info (EERE)

Evince Technology Jump to: navigation, search Name Evince Technology Place United Kingdom Sector Efficiency, Wind energy Product String representation "Evince has pion ... ing...

355

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

356

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

357

Berkeley Lab Computing Sciences: Accelerating Scientific Discovery  

E-Print Network (OSTI)

facilities NERSC and ESnet and by conduct- ing appliedCOMPUTATIONAL SCIENCE ESnet is a reliable, high- bandwidthdevelopment. NERSC and ESnet staff participate in advanced

Hules, John A

2009-01-01T23:59:59.000Z

358

Quinine, an old anti-malarial drug in a modern world: role in the treatment of malaria  

E-Print Network (OSTI)

versus quinine-doxycycline in the Western Amazon region ofof quinine plus doxycycline, tetracycline or clindamycin astreated with quinine+doxycycline [46]. Consider- ing the

2011-01-01T23:59:59.000Z

359

Application of a simple and sensitive GCMS method for ...  

Science Conference Proceedings (OSTI)

ing with isopropanol, deionized water, and isopropanol, dried at room ... several months after the last intake, because they enter the hair roots from the...

360

Meshless Deformable Models for LV Motion Analysis Xiaoxu Wang Dimitis Metaxas  

E-Print Network (OSTI)

-Assisted Intervention, pages 469­476, 2007. 6 [3] T. Chen, S. Chung, and L. Axel. Automated tag tracking us- ing gabor

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Physical Similitude in Hierarchical Engineered Systems  

E-Print Network (OSTI)

scal- ing methodology for severe accident technical issuein the case of severe accidents, bismuth alloys have beenexperiments investigating severe accident phenomenology are

Blandford, Edward David

2010-01-01T23:59:59.000Z

362

1471-2164-10-34.fm  

NLE Websites -- All DOE Office Websites (Extended Search)

of Z. mobilis for bio-ethanol fermentation from the lignocellulosic res- idues such as corn stover 9. Z. mobilis ferments glucose, fructose, and sucrose produc- ing ethanol...

363

Can feedstock production for biofuels be sustainable in California?  

E-Print Network (OSTI)

gallons annually of corn ethanol, 1 bil- lion gallons oflocations) and corn for ethanol, and oil palm, soybean andinvestment in corn-grain-based ethanol manufactur- ing in

Kaffka, Stephen R.

2009-01-01T23:59:59.000Z

364

High-rate chemical vapor deposition of nanocrystalline silicon carbide films by radio frequency thermal plasma  

E-Print Network (OSTI)

by liquid spray injection of disilanes into an argon­hydrogen RF plasma operat- ing at 20­40 kPa [4]. Here

Zachariah, Michael R.

365

RADIOLOGICAL HEALTH AND RELATED STANDARDS FOR NUCLEAR POWER PLANTS. VOLUME 2 OF HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

On the ather hand, ather radionuclides, such as I and Sr,The remain- ing radionuclides cantributed much less to thedoses Important radionuclides for background exposures and

Nero, A.V.

2010-01-01T23:59:59.000Z

366

Section 9.7 Employee Incentive Programs: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Management Awards are presented by DOE in conjunction with the Federal Interagency Energy Policy Committee (the "656" Committee). The program recognizes outstand- ing...

367

Coal - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Electric power sector consumption of coal by census region, 2010

368

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network (OSTI)

of iron de?ciency on photosynthesis Aimee M. Terauchi rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

369

DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

are potential raw materials for production of biofuels. TheRaw plant material, or dedicated bioenergy crops, can provide the starting point for mak- ing biofuels.

Gilbert, David

2009-01-01T23:59:59.000Z

370

STATEMENT OF CONSIDERATIONS CLASS WAIVER OF U.S. AND FOREIGN...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

model ing and simulation. This approach will harness the power of systems biology to overcome bioma ss recalcitrance. The BESC currently has eighteen members...

371

Synthesis of D-Glucose-1-C14 and D-Mannose-1-C14  

Science Conference Proceedings (OSTI)

... The product weighed 470 mg, rep- resenting a ... ing formation of esters, condensation products, and the ... The alco- holic liquors were neutralized with ...

2006-03-29T23:59:59.000Z

372

Distributed Energy Harvesting for Energy Neutral Sensor Networks  

E-Print Network (OSTI)

to exploit to develop piezoelectric energy harvesters. Manyenergy. Current piezoelectric energy harvest- ing researchwill improve piezoelectric energy harvesting technologys

Kansal, Aman; Srivastava, Mani B.

2005-01-01T23:59:59.000Z

373

Quantifying Changes in Building Electricity Use, with Application to Demand Response  

E-Print Network (OSTI)

build- ings, Journal of Solar Energy Engineering, vol. 120,buildings, Journal of Solar Energy Engineering, vol. 120,modeling, Journal of Solar Energy Engineering, vol. 120, p.

Mathieu, Johanna L.

2012-01-01T23:59:59.000Z

374

The TREC-2001 Video Track Report  

Science Conference Proceedings (OSTI)

... Marchionini, 2001), the NIST Digital Video Library (Over, 2001 ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

375

The TREC-2002 Video Track Report  

Science Conference Proceedings (OSTI)

... on Project RDD/G/235 to the British Library Research and ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

376

Blueberry research launches exciting new California specialty crop  

E-Print Network (OSTI)

2. Estimated highbush blueberry crop, 2004 State Growers whoin spearhead- ing specialty crops research and efforts tonew California specialty crop Manuel Jimenez Francis

Jimenez, Manuel; Carpenter, Francis; Molinar, Richard H.; Wright, Kathryn; Day, Kevin R.

2005-01-01T23:59:59.000Z

377

A Statistical Profile of Horticultural Crop Farm Industries in California  

E-Print Network (OSTI)

Profile of Horticultural Crop Farm Industries in Californiaproject funded by the Federal Crop Insurance Corporation,Williams. Model- ing Farm-Level Crop Insurance Demand with

Lee, Hyunok; Blank, Steven C.

2004-01-01T23:59:59.000Z

378

License Application Guidelines  

6. A review of the competition currently existing or expected to develop follow-ing introduction of the product. 7. A comparison of this product to ...

379

Instructions for use Phenomenology of supersymmetry SU5 GUT with neutrinophilic Higgs boson  

E-Print Network (OSTI)

of the primary goals of LHC is the search for the Higgs boson, the last miss- ing ingredient of the Standard

Tsunogai, Urumu

380

timeline_PNNL_PRINT.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

1997 PNNL developed a highly sensitive sampleranalyzer that can be used to prevent proliferation of nuclear weapons by remotely detect- ing trace quantities of materials...

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

BFRL98Annual Cvrs 1-4  

Science Conference Proceedings (OSTI)

... In addition to the programs of the individual ... of roof solar reflectance on the annual heat- ing ... BFRL's Thermal Analysis Research Program (TARP) for ...

2000-03-16T23:59:59.000Z

382

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

383

Technology Transfer Division - Los Alamos National Lab: National ...  

administer commercial, noncommercial, ... As one of the U.S. Department of Energys multiprogram, ... ing 47 technical areas with 8 million square feet under roof.

384

Monitoring Power Quality  

Science Conference Proceedings (OSTI)

... or without filter), isola- tion transformer, voltage regulator ... reality before expensive line condition- ing equipment is ... if any line conditioning is required. ...

2013-05-17T23:59:59.000Z

385

southeastern geographer, 44(1) 2004: pp. 814 Rethinking the Region  

E-Print Network (OSTI)

-runners, allow- ing for the sale of cotton to European mar- kets and the purchase of all-important guns and steel

Gamble, Douglas W.

386

48 CRO MAR/APR 2008 Climate Change  

E-Print Network (OSTI)

regulations that limit tobacco sales and public smoking. Similarly,therewillbenoscientificsmok- ing gun Companies looking for smoking gun should skip the science,looktotheeco

Hoffman, Andrew J.

387

Petroleum & Other Liquids - Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Projects published on Beta are not final and may not include up-to-date data.

388

Lighting Options for Homes.  

SciTech Connect

This report covers many aspects of various lighting options for homes. Types of light sources described include natural light, artificial light, incandescent lamps, fluorescent lamps, and high intensity discharge lamps. A light source selection guide gives the physical characteristics of these, design considerations, and common applications. Color, strategies for efficient lighting, and types of lighting are discussed. There is one section giving tips for various situations in specific rooms. Rooms and types of fixtures are shown on a matrix with watts saved by using the recommended type lighting for that room and room location. A major emphasis of this report is saving energy by utilizing the most suitable, recommended lighting option. (BN)

Baker, W.S.

1991-04-01T23:59:59.000Z

389

Mobile lighting apparatus  

DOE Patents (OSTI)

A mobile lighting apparatus includes a portable frame such as a moveable trailer or skid having a light tower thereon. The light tower is moveable from a stowed position to a deployed position. A hydrogen-powered fuel cell is located on the portable frame to provide electrical power to an array of the energy efficient lights located on the light tower.

Roe, George Michael; Klebanoff, Leonard Elliott; Rea, Gerald W; Drake, Robert A; Johnson, Terry A; Wingert, Steven John; Damberger, Thomas A; Skradski, Thomas J; Radley, Christopher James; Oros, James M; Schuttinger, Paul G; Grupp, David J; Prey, Stephen Carl

2013-05-14T23:59:59.000Z

390

Energy_Savings_Light_Emitting_Diodes_Niche_Lighting_Apps.pdf...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EnergySavingsLightEmittingDiodesNicheLightingApps.pdf EnergySavingsLightEmittingDiodesNicheLightingApps.pdf EnergySavingsLightEmittingDiodesNicheLightingApps.p...

391

Geometry-dependent lighting  

E-Print Network (OSTI)

Abstract In this paper we introduce geometrydependent lighting that allows lighting parameters to be defined independently and possibly discrepantly over an object or scene based on the local geometry. We present and discuss Light Collages, a lighting design system with geometry-dependent lights for effective feature-enhanced visualization. Our algorithm segments the objects into local surface patches and places lights that are locally consistent but globally discrepant to enhance the perception of shape. We use spherical harmonics for efficiently storing and computing light placement and assignment. We also outline a method to find the minimal number of light sources sufficient to illuminate an object well with our globally discrepant lighting approach. Index Terms Lighting design, scientific illustration, discrepant lighting, light placement, silhouette enhancement, proximity shadows, spherical harmonics I.

Chang Ha Lee; Xuejun Hao; Amitabh Varshney

2005-01-01T23:59:59.000Z

392

Lighting Group: What's New  

NLE Websites -- All DOE Office Websites (Extended Search)

What's New What's New in the Lighting Group For more information on what's new in the Lighting Group, please contact: Francis Rubinstein Lighting Group Leader (510) 486-4096...

393

Light in the city  

E-Print Network (OSTI)

This thesis focuses on enhancing the awareness of light for the pedestrian,and using light as a way of revealing the structure of the city and its relation to the cosmos. It proposes that aesthetic qualities of light inform ...

Srinivasan, Kavita, 1976-

2002-01-01T23:59:59.000Z

394

Specific light in sculpture  

E-Print Network (OSTI)

Specific light is defined as light from artificial or altered natural sources. The use and manipulation of light in three dimensional sculptural work is discussed in an historic and contemporary context. The author's work ...

Powell, John William

1989-01-01T23:59:59.000Z

395

Prospects for LED lighting.  

SciTech Connect

Solid-state lighting using light-emitting diodes (LEDs) has the potential to reduce energy consumption for lighting by 50% while revolutionizing the way we illuminate our homes, work places, and public spaces. Nevertheless, substantial technical challenges remain in order for solid-state lighting to significantly displace the well-developed conventional lighting technologies. We review the potential of LED solid-state lighting to meet the long-term cost goals.

Tsao, Jeffrey Yeenien; Gee, James Martin; Simmons, Jerry Alvon

2003-08-01T23:59:59.000Z

396

Lighting Control Systems  

Science Conference Proceedings (OSTI)

The demand for lighting control systems in residential, commercial, and industrial facilities is on the rise with the demand for increased energy savings. With lighting accounting for almost 23% of grid load, there is significant opportunity to reduce lighting load while improving the quality of light for customers. Lighting control systems are becoming more intelligent as the need for them to interface with building control systems and demand response systems also increases. Lighting control systems use...

2009-12-17T23:59:59.000Z

397

Composite Lighting Simulations with Lighting Networks  

E-Print Network (OSTI)

A whole variety of different techniques for simulating global illumination in virtual environments have been developed over recent years. Each technique, including Radiosity, Monte-Carlo ray- or photon tracing, and directional-dependent Radiance computations, is best suited for simulating only some special case environments. None of these techniques is currently able to efficiently simulate all important lighting effects in non-trivial scenes. In this paper, we describe a new approach for efficiently combining different global illumination algorithms to yield a composite lighting simulation: Lighting Networks. Lighting Networks can exploit the advantages of each algorithm and can combine them in such a way as to simulate lighting effects that could only be computed at great costs by any single algorithm. Furthermore, this approach allows a user to configure the Lighting Network to compute only specific lighting effects that are important for a given task, while avoiding a costly simulation of the full global illumination in a scene. We show how the light paths computed by a Lighting Network can be described using regular expressions. This mapping allows us to analyze the composite lighting simulation and ensure completeness and redundant-free computations. Several examples demonstrate the advantages and unique lighting effects that can be obtained using this technique. 1

Philipp Slusallek; Marc Stamminger; Wolfgang Heidrich; Jan-Christian Popp; Hans-peter Seidel

1998-01-01T23:59:59.000Z

398

Lighting Group: Links  

NLE Websites -- All DOE Office Websites (Extended Search)

Links Links Links Organizations Illuminating Engineering Society of North America (IESNA) International Commission on Illumination (CIE) International Association of Lighting Designers (IALD) International Association of Energy-Efficient Lighting Lightfair International Energy Agency - Task 21: Daylight in Buildings: Design Tools and Performance Analysis International Energy Agency - Task 31: Daylighting Buildings in 21st Century National Association on Qualifications for the Lighting Professions (NCQLP) National Association of Independent Lighting Distributors (NAILD) International Association of Lighting Management Companies (NALMCO) Research Centers California Lighting Technology Center Lighting Research Center Lighting Research at Canada Institute for Research in Construction

399

Advanced Demand Responsive Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Demand Demand Responsive Lighting Host: Francis Rubinstein Demand Response Research Center Technical Advisory Group Meeting August 31, 2007 10:30 AM - Noon Meeting Agenda * Introductions (10 minutes) * Main Presentation (~ 1 hour) * Questions, comments from panel (15 minutes) Project History * Lighting Scoping Study (completed January 2007) - Identified potential for energy and demand savings using demand responsive lighting systems - Importance of dimming - New wireless controls technologies * Advanced Demand Responsive Lighting (commenced March 2007) Objectives * Provide up-to-date information on the reliability, predictability of dimmable lighting as a demand resource under realistic operating load conditions * Identify potential negative impacts of DR lighting on lighting quality Potential of Demand Responsive Lighting Control

400

Light Laboratory, Inc.  

Science Conference Proceedings (OSTI)

... 12) Solid State Lighting Luminaires - Color Characteristic Measurements. [22/S04] IES LM-16:1993 Practical Guide to Colorimetry of Light Sources. ...

2013-07-26T23:59:59.000Z

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Hubbell Lighting Photometric Laboratory  

Science Conference Proceedings (OSTI)

... 12) Solid State Lighting Luminaires - Color Characteristic Measurements. [22/S04] IES LM-16:1993 Practical Guide to Colorimetry of Light Sources. ...

2013-07-26T23:59:59.000Z

402

Energy Efficient Lighting Products  

Science Conference Proceedings (OSTI)

... Road Vista, San Diego, CA [200823- 0] Light Laboratory, Inc ... GA. CSA Group, Alpharetta, GA [200732- 0] Cooper Lighting Photometric Laboratory ...

2013-07-26T23:59:59.000Z

403

Light Metals 2010  

Science Conference Proceedings (OSTI)

Feb 1, 2010 ... Softcover book: Light Metals 2008 Volume 2: Aluminum Reduction. Hardcover book and CD-ROM: Light Metals 2009...

404

Plant and Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

publicationshouseplantligh t.html Sincerely, Anthony R. Brach "Artificial" light comes from many kinds of bulbs that emit different wavelengths of light; Many plants...

405

National Synchrotron Light Source  

NLE Websites -- All DOE Office Websites (Extended Search)

Angle Limit," Phys. Rev. Lett., 99: 134801 (2007). 33 Researchers Produce Firsts with Bursts of Light BNL researchers have generated extremely short pulses of light that are the...

406

Lighting and Daylighting Basics  

Energy.gov (U.S. Department of Energy (DOE))

Buildings can be lit in two ways: by using artificial lighting, or by using daylighting, or the process of using natural sunlight, windows, and skylights to provide lighting.

407

Lighting | Open Energy Information  

Open Energy Info (EERE)

Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon Lighting Jump to: navigation, search TODO: Add description List of Lighting Incentives...

408

Lighting Systems Test Facilities  

NLE Websites -- All DOE Office Websites (Extended Search)

Measurement equipment with light beam Lighting Systems Test Facilities NOTICE Due to the current lapse of federal funding, Berkeley Lab websites are accessible, but may not be...

409

Lighting and Daylighting  

Energy.gov (U.S. Department of Energy (DOE))

Buildings can be lit in two ways: by using artificial lighting, or by using daylighting, or the process of using natural sunlight, windows, and skylights to provide lighting.

410

Looking For Light.  

E-Print Network (OSTI)

??In my search for the way light can dictate the overall expression of an image, I have found that light is the means that activates (more)

Lindholm, Kevin R.

2010-01-01T23:59:59.000Z

411

LBNL Lighting Research Group  

NLE Websites -- All DOE Office Websites (Extended Search)

LED and ballast berkeley lamp workstation light switch Overview | What's New | Publications | Software | Facilities | People | Contact Us | Links Sources and Ballasts | Light...

412

Properties of Light  

Science Conference Proceedings (OSTI)

... Scattering of Light. Exploration: Sunset in a glass. ... How would you design a camera that could see through a sand storm? Invisible Light. ...

2012-03-23T23:59:59.000Z

413

Cree LED Lighting Solutions Formerly LED Lighting Fixtures LLF...  

Open Energy Info (EERE)

Cree LED Lighting Solutions Formerly LED Lighting Fixtures LLF Jump to: navigation, search Name Cree LED Lighting Solutions (Formerly LED Lighting Fixtures (LLF)) Place...

414

Incandescent Lighting | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Incandescent Lighting Incandescent Lighting August 16, 2013 - 10:00am Addthis Incandescent lighting is the most common type of lighting used in homes. Incandescent lamps operate...

415

Solid-State Lighting: Registration  

NLE Websites -- All DOE Office Websites (Extended Search)

Lighting: Registration on Twitter Bookmark Solid-State Lighting: Registration on Google Bookmark Solid-State Lighting: Registration on Delicious Rank Solid-State Lighting:...

416

Solid-State Lighting: Postings  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-State Lighting: Postings on Twitter Bookmark Solid-State Lighting: Postings on Google Bookmark Solid-State Lighting: Postings on Delicious Rank Solid-State Lighting:...

417

Lighting Research Group  

NLE Websites -- All DOE Office Websites (Extended Search)

Lighting Research Group overview what's new publications software facilities people contact us links...

418

Energy and lighting decisions  

SciTech Connect

This report reviews the fundamental principles of lighting and uses them to evaluate energy-conserving lighting equipment and techniques. The selection of the proper lighting components and systems is complex, requiring a knowledge of the characteristics of light sources and their interactions with the auxiliary equipment and the environment. Furthermore, there are subjective aspects of lighting that are difficult to quantify. We address the simplistic way in which lighting is commonly approached, then present an argument as to the critical nature of the lighting decision. In the final sections we discuss and evaluate lighting equipment in terms of its applications and characteristics. Familiarity with the fundamental characteristics of the elements of lighting equipment will also permit more judicious appraisal and use of lighting concepts that may be introduced in the future. 6 figs., 9 tabs.

Verderber, R.R.

1986-06-01T23:59:59.000Z

419

Lighting Inventory Lighting Theatre and Drama  

E-Print Network (OSTI)

Strand Basic Palette 400 channel 800 attrib. 1 Strand Lighting 200 Series 24/48 1 1 MicroVision 2 HORIZON

Indiana University

420

Lighting Retrofit Study  

SciTech Connect

The Lighting Retrofit Study was an effort to determine the most cost-effective methods of retrofitting several configurations of lighting systems at Lawrence Berkeley Laboratory (LBL) and Lawrence Livermore National Laboratory (LLNL). We developed a test protocol to compare a variety of lighting technologies for their applicability in labs and offices and designed and constructed a novel lighting contrast potential meter to allow for comparison of lighting quality as well as quantity.

Kromer, S.; Morse, O.; Siminovitch, M.

1991-09-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

EK101 Engineering Light Smart Lighting  

E-Print Network (OSTI)

represents high usage of an engine and the violet end represents low usage. A light blue coloring represents from red to light blue), and slowly increase their usage of engine A. The seventh row show a patternModeling Long-Term Search Engine Usage Ryen W. White, Ashish Kapoor, and Susan T. Dumais Microsoft

Bifano, Thomas

422

Spectrally Enhanced Lighting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 2007 November 2007 AfterImage + s p a c e 1 Spectrally Enhanced Lighting Spectrally Enhanced Lighting Brian Liebel, PE, LC Brian Liebel, PE, LC November 29, 2007 November 29, 2007 Federal Utilities Partnership Working Group Federal Utilities Partnership Working Group November 29, 2007 November 29, 2007 29 November 2007 AfterImage + s p a c e 2 Spectrally Enhanced Lighting Spectrally Enhanced Lighting Spectrally Enhanced Lighting Spectrally Enhanced Lighting This is not a technology; just a This is not a technology; just a different way to quantify light based on different way to quantify light based on well established scientific findings well established scientific findings Can be used in conjunction with ANY Can be used in conjunction with ANY type of lighting design to gain

423

LED Lighting | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LED Lighting LED Lighting August 16, 2013 - 10:07am Addthis Light-emitting diodes (LEDs) are light sources that differ from more traditional sources of light in that they are...

424

Natural lighting and skylights  

E-Print Network (OSTI)

There are many physiological and psychological factors which enter into the proper design of space for human occupancy. One of these elements is light. Both natural light and manufactured light are basic tools with which any designer must work. However, they are only two of the many, many elements which must be considered; and they, therefore, must be considered, always, in relation to the other elements. The achievement of good lighting depends on a reasonable understanding of three primary factors: one, the visual response to lighting; two, the availability and types of lighting; and three, methods for controlling light. This thesis is intended to supply enough information to provide a working knowledge of each of these facets. The human visual response is discussed in "Goals For Good Lighting." The availability and types of lighting are dealt with in the section on available light. The remainder of the thesis concerns methods for controlling light. The use of scale models for studying the natural lighting characteristics of buildings due to the building geometry, the fenestration details and the interior reflectance has been well established as pointed out in the earlier part of this thesis. With the completion of the work outlined herein, the feasibility of using scale models for studying skylights is also an established fact. The method of analysis by models can be a valuable tool to any designer who is concerned about day-lighting.

Evans, Benjamin Hampton

1961-01-01T23:59:59.000Z

425

Lighting Group: Overview  

NLE Websites -- All DOE Office Websites (Extended Search)

Overview Overview Overview of the Lighting Research Group The Lighting Research Group at Lawrence Berkeley National Laboratory performs research aimed at improving the energy efficiency of lighting systems in buildings and homes, throughout the State of California and across the Nation. The goal is to reduce lighting energy consumption by 50% over twenty years by improving the efficiency of light sources, and controlling and delivering illumination so that it is available, where and when needed, and at the required intensity. Research in the Lighting Group falls into three main areas: Sources and Ballasts, Light Distribution Systems and Controls and Communications. Click on a link below for more information about each of these research areas. Sources and Ballasts investigates next generation light sources, such as

426

Madrid Electric Lighting Report  

NLE Websites -- All DOE Office Websites (Extended Search)

Electric Lighting Quality Page 1 of 2 ELECTRIC LIGHTING QUALITY MAGIC BOX is a versatile home. Its design allows to change the room size by opening and closing the movable walls...

427

Automatic lighting controls demonstration  

SciTech Connect

The purpose of this work was to demonstrate, in a real building situation, the energy and peak demand reduction capabilities of an electronically ballasted lighting control system that can utilize all types of control strategies to efficiently manage lighting. The project has demonstrated that a state-of-the-art electronically ballasted dimmable lighting system can reduce energy and lighting demand by as least 50% using various combinations of control strategies. By reducing light levels over circulation areas (tuning) and reducing after hours light levels to accommodate the less stringent lighting demands of the cleaning crew (scheduling), lighting energy consumption on weekdays was reduced an average of 54% relative to the initial condition. 10 refs., 14 figs., 3 tabs.

Rubinstein, F.; Verderber, R.

1990-03-01T23:59:59.000Z

428

Lighting energy audit workbook  

SciTech Connect

A simple test to determine the need for a lighting energy audit is followed by how-to information on conducting the audit, identifying savings opportunities, and developing an energy management plan for lighting.

1984-01-01T23:59:59.000Z

429

Inverse Lighting for Photography  

E-Print Network (OSTI)

We introduce a technique for improving photographs using inverse lighting, a new process based on algorithms developed in computer graphics for computing the reflection of light in 3D space. From a photograph and a 3D surface model for the object pictured, inverse lighting estimates the directional distribution of the incident light. We then use this information to process the photograph digitally to alter the lighting on the object. Inverse lighting is a specific example of the general idea of inverse rendering. This refers to the practice of using the methods of computer graphics, which normally are used to render images from scene information, to infer scene information from images. Our system uses physically based rendering technology to construct a linear least squares system that we solve to find the lighting. As an application, the results are then used to simulate a change in the incident light in the photograph. An implementation is described that uses 3D models from a laser...

Stephen R. Marschner; Donald P. Greenberg

1997-01-01T23:59:59.000Z

430

Fast Light, Fast Neutrinos?  

E-Print Network (OSTI)

Light has been observed with group velocities both faster and slower than the speed of light. The recent report from OPERA of superluminal 17 GeV neutrinos may describe a similar phenomenon.

Cahill, Kevin

2011-01-01T23:59:59.000Z

431

Light Wavelength and Plants  

NLE Websites -- All DOE Office Websites (Extended Search)

Light Wavelength and Plants Name: John Location: NA Country: NA Date: NA Question: I just was wandering whether plants grow better in artificial light or in sunlight. I am...

432

Germinating and Light  

NLE Websites -- All DOE Office Websites (Extended Search)

Germinating and Light Name: Chris Location: NA Country: NA Date: NA Question: Can you tell me how plants determine where the light is once they are out of the soil and not a...

433

PFP Emergency Lighting Study  

SciTech Connect

NFPA 101, section 5-9 mandates that, where required by building classification, all designated emergency egress routes be provided with adequate emergency lighting in the event of a normal lighting outage. Emergency lighting is to be arranged so that egress routes are illuminated to an average of 1.0 footcandle with a minimum at any point of 0.1 footcandle, as measured at floor level. These levels are permitted to drop to 60% of their original value over the required 90 minute emergency lighting duration after a power outage. The Plutonium Finishing Plant (PFP) has two designations for battery powered egress lights ''Emergency Lights'' are those battery powered lights required by NFPA 101 to provide lighting along officially designated egress routes in those buildings meeting the correct occupancy requirements. Emergency Lights are maintained on a monthly basis by procedure ZSR-12N-001. ''Backup Lights'' are battery powered lights not required by NFPA, but installed in areas where additional light may be needed. The Backup Light locations were identified by PFP Safety and Engineering based on several factors. (1) General occupancy and type of work in the area. Areas occupied briefly during a shiftly surveillance do not require backup lighting while a room occupied fairly frequently or for significant lengths of time will need one or two Backup lights to provide general illumination of the egress points. (2) Complexity of the egress routes. Office spaces with a standard hallway/room configuration will not require Backup Lights while a large room with several subdivisions or irregularly placed rooms, doors, and equipment will require Backup Lights to make egress safer. (3) Reasonable balance between the safety benefits of additional lighting and the man-hours/exposure required for periodic light maintenance. In some plant areas such as building 236-Z, the additional maintenance time and risk of contamination do not warrant having Backup Lights installed in all rooms. Sufficient light for egress is provided by existing lights located in the hallways.

BUSCH, M.S.

2000-02-02T23:59:59.000Z

434

Solid-State Lighting: Solid-State Lighting  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solid-State Lighting Search Solid-State Lighting Search Search Help Solid-State Lighting HOME ABOUT THE PROGRAM R&D PROJECTS MARKET-BASED PROGRAMS SSL BASICS INFORMATION RESOURCES FINANCIAL OPPORTUNITIES EERE » Building Technologies Office » Solid-State Lighting Printable Version Share this resource Send a link to Solid-State Lighting: Solid-State Lighting to someone by E-mail Share Solid-State Lighting: Solid-State Lighting on Facebook Tweet about Solid-State Lighting: Solid-State Lighting on Twitter Bookmark Solid-State Lighting: Solid-State Lighting on Google Bookmark Solid-State Lighting: Solid-State Lighting on Delicious Rank Solid-State Lighting: Solid-State Lighting on Digg Find More places to share Solid-State Lighting: Solid-State Lighting on AddThis.com... Pause/Resume Photo of a large room with people standing around poster boards.

435

TMS Light Metals Publication  

Science Conference Proceedings (OSTI)

The following instructions should be used when submitting a manuscript for any TMS Light Metals proceedings volume. INTRODUCTION. Orientation to...

436

Lighting management casebook  

SciTech Connect

Fifteen examples illustrate how lighting system projects can save energy as well as improve productivity and safety. The case histories include the use of programmable lighting, fiber optics, skylights, voltage reduction, ultrasonic and infrared sensors, and other strategies for improving lighting efficiency. Each case history includes the management approach, site information, and applications. (DCK)

1982-06-01T23:59:59.000Z

437

Advanced Lighting Guidelines  

Science Conference Proceedings (OSTI)

Information about energy-effective lighting technologies is required to be updated as old technologies become obsolete and new technologies begin to make important market impacts. Providing a comprehensive, state-of-the-art update of lighting technology application and information is necessary to ensure that lighting decision-makers have the best possible information available at all times.

2001-10-22T23:59:59.000Z

438

Energy and lighting design  

SciTech Connect

Energy conserving practices in providing lighting for today's buildings are examined in this second of a two-part presentation. Discussion on light source characteristics, ballast characteristics for gaseous discharge lamps, quality and the cost of lighting, and equivalent sphere illumination are included.

Helms, R.N.

1979-12-01T23:59:59.000Z

439

Modeling and Reasoning about Everyday Events Dustin Arthur Smith  

E-Print Network (OSTI)

that is inexpensive (and what price is "expensive"?).For example, the way one travels to an event (e.g., taxi, foot already filled in, or searching for alternative restaurants in the expected neigh- borhood and price range- ing context aware assistance, us- ing information from the calen- dar program and the cellphone (e

440

Port Lions, Alaska 26 January 2006  

E-Print Network (OSTI)

to the benefits it produces, when you consider that high school and college baseball is played during the time- ing the season. Maintain Pitcher's Mound and Home Plate A few minutes each day repairing the pitcher's mound and home plate area keeps them in good play- ing condition. Sweep the mound with a stiff broom

US Army Corps of Engineers

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Annual Report of ADVANCE Program for University of Wisconsin-Madison  

E-Print Network (OSTI)

in Natural Language Process- ing, pages 620­627, Vancouver, British Columbia, Canada, October. Gabriele of the Ninth International Workshop on Pars- ing Technology, pages 83­92, Vancouver, British Columbia, October of syntactic and semantic representations is a viable alter- native to approaches based on a pipeline of local

Sheridan, Jennifer

442

Kansas Board of Regents Mandatory Retirement Plan Enrollment Information  

E-Print Network (OSTI)

Plan Providers: ING and TIAA-CREF. For additional information about the Plan, see the KU HR website://www.ingretirementplans.com/custom/KansasBOREnrollmentServices/. For additional ING information, visit http://www6.ingretirementplans.com/SponsorExtranet/KansasBOR/. TIAA-CREF: To enroll and to find fund lineup information, see the TIAA-CREF microsite http://www.tiaa

Peterson, Blake R.

443

A Novel Process for Demulsification of Water-in-Crude Oil Emulsions by Dense Carbon Dioxide  

E-Print Network (OSTI)

using a wide variety of equipments such as centrifuges, rotary vacuum filters, belt presses, and filter concentrations behave as a liquid, with Newtonian flow characteristics. Centrifugal dewater- ing is possible obtained, which was considered acceptable since a dry- ing system followed centrifugation. Pressure filters

Kilpatrick, Peter K.

444

REcuRsiVE TRust-REGion MEthoDs FoR MuLtiLEVEL NonLinEAR ...  

E-Print Network (OSTI)

Aug 11, 2004 ... the minimie ing se& uence at level6s 1.`r f%n&s 1b&t belongs to this minimie ing se uence,Hg e use the notation n55 Pt...

445

Pour diffusion immdiate En pleine refonte du rgime forestier,  

E-Print Network (OSTI)

en 2010 pour répondre aux nouveaux défis Robert Beauregard, doyen de la Faculté de foresterie, de donner des entrevues. Porte-parole Fonctions Sujets Robert Beauregard, ing., ing.f, Ph.D. Doyen de la

Laval, Université

446

Biannual Report Department of Mathematics  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Kohlenbach, Ulrich

447

Abrahamse, W., L. Steg, et al. (2005). "A review of intervention studies aimed at household energy conservation." Journal of Environmental Psychology 25(3): 273-291.  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

448

(S11lSC) sruals,(5lueure8euey4les?qete6l's:olndruoc leuosred Jo uoqcnportur eqt reu? perylldurs  

E-Print Network (OSTI)

of Tsunami Deposits . . . . . . . . . . . . . . . 17 3.5 Search Methods Research (NCTR) was established to conduct re- search and development in support of the NOAA mission was a result of search- ing the tsunami runup database by state with no other conditions and divid- ing

Hack, Robert

449

Resonant energy transfer in light harvesting and light emitting applications.  

E-Print Network (OSTI)

??The performance of light emitting and light harvesting devices is improved by utilising resonant energy transfer. In lighting applications, the emission energy of a semiconductor (more)

Chanyawadee, Soontorn

2009-01-01T23:59:59.000Z

450

LIGHT FORCE: An Exploration of Light through Design.  

E-Print Network (OSTI)

??What falls into the realm of light and what it means to design and the human experience? Can light be material? How does light change (more)

Chen, Tzu

2007-01-01T23:59:59.000Z

451

Solid-State Lighting: Webcast: Evaluating LED Street Lighting...  

NLE Websites -- All DOE Office Websites (Extended Search)

Webcast: Evaluating LED Street Lighting Solutions to someone by E-mail Share Solid-State Lighting: Webcast: Evaluating LED Street Lighting Solutions on Facebook Tweet about...

452

Lighting Group: Sources and Ballasts: LED Task Light  

NLE Websites -- All DOE Office Websites (Extended Search)

light The goal of this project is to accelerate the use of energy efficient light emitting diode (LED) technology for general lighting applications by developing a task lamp...

453

Solid-State Lighting: Adaptive Street Lighting Controls  

NLE Websites -- All DOE Office Websites (Extended Search)

Adaptive Street Lighting Adaptive Street Lighting Controls to someone by E-mail Share Solid-State Lighting: Adaptive Street Lighting Controls on Facebook Tweet about Solid-State Lighting: Adaptive Street Lighting Controls on Twitter Bookmark Solid-State Lighting: Adaptive Street Lighting Controls on Google Bookmark Solid-State Lighting: Adaptive Street Lighting Controls on Delicious Rank Solid-State Lighting: Adaptive Street Lighting Controls on Digg Find More places to share Solid-State Lighting: Adaptive Street Lighting Controls on AddThis.com... Conferences & Meetings Presentations Publications Webcasts Videos Tools Adaptive Street Lighting Controls This two-part DOE Municipal Solid-State Street Lighting Consortium webinar focused on LED street lighting equipped with adaptive control components.

454

Solid-State Lighting: Solid-State Lighting Videos  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-State Lighting Videos to Solid-State Lighting Videos to someone by E-mail Share Solid-State Lighting: Solid-State Lighting Videos on Facebook Tweet about Solid-State Lighting: Solid-State Lighting Videos on Twitter Bookmark Solid-State Lighting: Solid-State Lighting Videos on Google Bookmark Solid-State Lighting: Solid-State Lighting Videos on Delicious Rank Solid-State Lighting: Solid-State Lighting Videos on Digg Find More places to share Solid-State Lighting: Solid-State Lighting Videos on AddThis.com... Conferences & Meetings Presentations Publications Webcasts Videos Tools Solid-State Lighting Videos On this page you can access DOE Solid-State Lighting (SSL) Program videos. Photo of a museum art gallery with LED lights in track fixtures overhead. The City of Los Angeles LED Streetlight Program

455

Solid-State Lighting: Solid-State Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Lighting Lighting Printable Version Share this resource Send a link to Solid-State Lighting: Solid-State Lighting to someone by E-mail Share Solid-State Lighting: Solid-State Lighting on Facebook Tweet about Solid-State Lighting: Solid-State Lighting on Twitter Bookmark Solid-State Lighting: Solid-State Lighting on Google Bookmark Solid-State Lighting: Solid-State Lighting on Delicious Rank Solid-State Lighting: Solid-State Lighting on Digg Find More places to share Solid-State Lighting: Solid-State Lighting on AddThis.com... Pause/Resume Photo of a large room with people standing around poster boards. Register Now for DOE's 11th Annual SSL R&D Workshop January 28-30, join other SSL R&D professionals from industry, government, and academia to learn, share, and shape the future of lighting.

456

Solid-State Lighting: Solid-State Lighting Contacts  

NLE Websites -- All DOE Office Websites (Extended Search)

About the About the Program Printable Version Share this resource Send a link to Solid-State Lighting: Solid-State Lighting Contacts to someone by E-mail Share Solid-State Lighting: Solid-State Lighting Contacts on Facebook Tweet about Solid-State Lighting: Solid-State Lighting Contacts on Twitter Bookmark Solid-State Lighting: Solid-State Lighting Contacts on Google Bookmark Solid-State Lighting: Solid-State Lighting Contacts on Delicious Rank Solid-State Lighting: Solid-State Lighting Contacts on Digg Find More places to share Solid-State Lighting: Solid-State Lighting Contacts on AddThis.com... Contacts Partnerships Solid-State Lighting Contacts For information about Solid-State Lighting, contact James Brodrick Lighting Program Manager Building Technologies Office U.S. Department of Energy

457

Emerging Lighting Technology  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Emerging Lighting Technology Emerging Lighting Technology Bruce Kinzey Pacific Northwest National Laboratory FUPWG - Portland, OR April 20, 2011 www.ssl.energy.gov 2 | Solid-State Lighting Program GATEWAY Demonstration Program * Purpose: demonstrate new SSL products in real-world applications that save energy, match or improve illumination, and are cost- effective * Demos generate critical field experience providing: - Feedback to manufacturers - Data for utility incentives - Market readiness of specific applications to users - Advancement in lighting knowledge Central Park, NY Photo: Ryan Pyle Smithsonian American Art Museum, Washington, D.C. Photo: Scott Rosenfeld www.ssl.energy.gov 3 | Solid-State Lighting Program LED Product Explosion www.ssl.energy.gov 4 | Solid-State Lighting Program LEDs are Not a Universal Lighting

458

Industrial lighting handbook  

SciTech Connect

Technological advances in industrial lighting system components now make it possible to reduce lighting system consumption by up to 50% or more without loss of the benefits inherent in good quality electric illumination. Management involvement in decisions about industrial lighting is essential, however, and this document provides generalized information in lay terms to help decision-makers become familiar with the concerns that affect industrial environment and the financial well-being of their companies. The five sections (1) discuss the benefits of good lighting, (2) review certain major lighting issues and terms, (3) identify procedures for developing a lighting energy management plan, (4) identify lighting energy management options (LEMOs), and (5) discuss sources of assistance. 19 figures, 8 tables.

1985-01-01T23:59:59.000Z

459

Photonic crystal light source  

DOE Patents (OSTI)

A light source is provided by a photonic crystal having an enhanced photonic density-of-states over a band of frequencies and wherein at least one of the dielectric materials of the photonic crystal has a complex dielectric constant, thereby producing enhanced light emission at the band of frequencies when the photonic crystal is heated. The dielectric material can be a metal, such as tungsten. The spectral properties of the light source can be easily tuned by modification of the photonic crystal structure and materials. The photonic crystal light source can be heated electrically or other heating means. The light source can further include additional photonic crystals that exhibit enhanced light emission at a different band of frequencies to provide for color mixing. The photonic crystal light source may have applications in optical telecommunications, information displays, energy conversion, sensors, and other optical applications.

Fleming, James G. (Albuquerque, NM); Lin, Shawn-Yu (Albuquerque, NM); Bur, James A. (Corrales, NM)

2004-07-27T23:59:59.000Z

460

Advances in Lighting  

E-Print Network (OSTI)

Increasing electricity costs have made a significant impact on lighting. The Illuminating Engineering society (I.E.S.) and the lighting industry are producing new standards, procedures and products to make lighting more appropriate and energy efficient. This paper will describe the factors which affect the performance of lighting systems, introduce the new I.E.S. procedures for selecting illuminance values and lighting power limits, and illustrate some of the recent developments in the lighting industry. The importance of efficient lighting may be measured by the potential reduction in the electrical demand, and energy consumed. Since it also represents a visible use (or misuse) of energy, it may also reflect on other aspects of a company's energy management program.

Tumber, A. J.

1981-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Evolution in lighting  

SciTech Connect

Lights consume 20-25% of the nation's electricity, establishing strong incentives to develop more efficient lighting strategies. Attention is turning to where, when, and how we light our environment, and the potential savings add up to half the lighting load nationwide. Some types of lamp are more efficient than others, but characteristics other than energy consumption may dictate where they can be used. Current lighting strategies consider task requirements, light quality, and the potential for daylighting. Energy management systems that control the timing and intensity of light and new types of energy-efficient bulbs and fixtures are increasingly attractive to consumers. The effort will require continued research and the awareness of decision makers. 4 references, 8 figures.

Lihach, N.; Pertusiello, S.

1984-06-01T23:59:59.000Z

462

Lighting in Commercial Buildings, 1986  

Gasoline and Diesel Fuel Update (EIA)

6 Lighting in Commercial Buildings Lighting in Commercial Buildings --1986 Overview Full Report and Tables Detailed analysis of energy consumption for lighting for U.S. commercial...

463

Energy Basics: Lighting and Daylighting  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Lighting Daylighting Passive Solar Design Space Heating & Cooling Water Heating Lighting and Daylighting Buildings can be lit in two ways: by using artificial lighting, or by...

464

Lighting Group: Sources and Ballasts  

NLE Websites -- All DOE Office Websites (Extended Search)

incorporating LEDs into tomorrows task lights, to reducing light entrapment within the LED, to fundamental research into how Organic Lighting Emitting Diodes operate. LED and...

465

Energy Basics: Lighting and Daylighting  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

by using artificial lighting, or by using daylighting, or the process of using natural sunlight, windows, and skylights to provide lighting. Learn more about: Lighting Daylighting...

466

Solid-State Lighting: Solid-State Lighting Manufacturing Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-State Lighting Solid-State Lighting Manufacturing Workshop to someone by E-mail Share Solid-State Lighting: Solid-State Lighting Manufacturing Workshop on Facebook Tweet about Solid-State Lighting: Solid-State Lighting Manufacturing Workshop on Twitter Bookmark Solid-State Lighting: Solid-State Lighting Manufacturing Workshop on Google Bookmark Solid-State Lighting: Solid-State Lighting Manufacturing Workshop on Delicious Rank Solid-State Lighting: Solid-State Lighting Manufacturing Workshop on Digg Find More places to share Solid-State Lighting: Solid-State Lighting Manufacturing Workshop on AddThis.com... Conferences & Meetings Past Conferences Presentations Publications Webcasts Videos Tools Solid-State Lighting Manufacturing Workshop Nearly 200 lighting industry leaders, chip makers, fixture and component

467

Lighting the Way with Compact Fluorescent Lighting | Department...  

NLE Websites -- All DOE Office Websites (Extended Search)

and compact fluorescent lights. And I've already purchased a few of the new light emitting diode (LED) solid-state lighting lights-but that's the topic of a future blog. Stay...

468

LightBox -Exploring Interaction Modalities with Colored Light  

E-Print Network (OSTI)

-bright multi- colored light-emitting diodes (LEDs) of our system can generate any visible lighting color

469

Lighting the Night: Technology, Urban Life and the Evolution of Street Lighting [Light in Place  

E-Print Network (OSTI)

May 1912), 783. 8. "New Street Lights Increase Trade 3 5 Perlight, including street light, became part of America'sBeautiful-inspired street lights graced wealthy residen

Holden, Alfred

1992-01-01T23:59:59.000Z

470

Lighting the Night: Technology, Urban Life and the Evolution of Street Lighting [Light in Place  

E-Print Network (OSTI)

Electrical 16. "Highway Lighting by So dium Vapor Lamps,"Possibilities of Street: Lighting Improve ments," TheLaunches Broad Street Lighting Promotion Campaign," The

Holden, Alfred

1992-01-01T23:59:59.000Z

471

High-Intensity Discharge Lighting  

Energy.gov (U.S. Department of Energy (DOE))

High-intensity discharge (HID) lighting provides the highest efficacy and longest service life of any lighting type. It can save 75%-90% of lighting energy when it replaces incandescent lighting.

472

Arnold Schwarzenegger LIGHTING RESEARCH PROGRAM  

E-Print Network (OSTI)

Project Summaries ELEMENT 2: ADVANCE LIGHTING TECHNOLOGIES PROJECT 2.1 LIGHT EMITTING DIODE (LED light emitting diodes (LED) technology for general lighting applications by developing a task lamp

473

Solid-State Lighting: Tools  

NLE Websites -- All DOE Office Websites (Extended Search)

about Solid-State Lighting: Tools on Twitter Bookmark Solid-State Lighting: Tools on Google Bookmark Solid-State Lighting: Tools on Delicious Rank Solid-State Lighting: Tools on...

474

Solid-State Lighting: News  

NLE Websites -- All DOE Office Websites (Extended Search)

about Solid-State Lighting: News on Twitter Bookmark Solid-State Lighting: News on Google Bookmark Solid-State Lighting: News on Delicious Rank Solid-State Lighting: News on...

475

Lighting Research Group: Facilities  

NLE Websites -- All DOE Office Websites (Extended Search)

Facilities Facilities Lighting Research Facilities at LBNL gonio-photometer Gonio-photometer We use this device to measure the intensity and direction of the light from a lamp or fixture. integrating sphere Integrating sphere This instrument allows us to get a fast and accurate measurement of the total light output of a lamp. We are not able to determine the direction of the light, only the intensity. power analyzer Power analyzer We use our power analyzer with the lamps in the gonio-photometer to measure input power, harmonic distortion, power factor, and many other signals that tell us how well a lamp is performing. spectro-radiometer Spectro-radiometer This device measures not only the intensity of a light source but also the intensity of the light at each wavelength.

476

Lighting Group: Software  

NLE Websites -- All DOE Office Websites (Extended Search)

Software Software Lighting Software The Lighting Group has developed several computer programs in the course of conducting research on energy efficient lighting. Several of these programs have proven useful outside the research environment. One of the most popular programs for advanced lighting applications is Radiance. For more information on this program and its availability, click on the link below. RADIANCE Radiance is a suite of programs for the analysis and visualization of lighting in design. The primary advantage of Radiance over simpler lighting calculation and rendering tools is that there are no limitations on the geometry or the materials that may be simulated. Radiance is used by architects and engineers to predict illumination, visual quality and appearance of innovative design spaces, and by researchers to evaluate new

477

Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Pedestrian-Friendly Nighttime Pedestrian-Friendly Nighttime Lighting to someone by E-mail Share Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting on Facebook Tweet about Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting on Twitter Bookmark Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting on Google Bookmark Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting on Delicious Rank Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting on Digg Find More places to share Solid-State Lighting: Pedestrian-Friendly Nighttime Lighting on AddThis.com... Conferences & Meetings Presentations Publications Webcasts Videos Tools Pedestrian-Friendly Nighttime Lighting This November 19, 2013 webinar presented issues and considerations related to pedestrian-friendly nighttime lighting, such as color rendering, safety,

478

Advanced Light Sources  

Science Conference Proceedings (OSTI)

In the generation of artificial light using electric lamps, photometric and color performance have been paramount in lamp design, manufacturing, measurement, lighting design, and visual perception. Many designers and researchers have strived to understand how light and color are generated, related, and to improve them. This has stemmed from the development of incandescent lamps, halogen lamps, linear fluorescent lamps, high-intensity discharge (HID) lamps, and compact fluorescent lamps (CFLs) among other...

2008-03-31T23:59:59.000Z

479

Advanced Lighting Technologies  

Science Conference Proceedings (OSTI)

This report continues the technical assessment of advanced lighting technologies in the following product areasdimmable light-emitting diode (LED) screw-in replacement lamp, hybrid compact fluorescent lamp/halogen screw-in replacement lamp, replacement recessed can LED downlight, organic LED (OLED) disc, replacement mini high-intensity discharge (HID) lamp and ballast system, and solid-state plasma lighting (miniature HID technology) high-bay fixture. The research in this project helps to demonstrate how...

2011-12-21T23:59:59.000Z

480

Total Light Management  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Light Management Light Management Why is saving Energy Important World Electricity Consumption (2007) Top 20 Countries 0 500 1000 1500 2000 2500 3000 3500 4000 4500 U n i t e d S t a t e s C h i n a J a p a n R u s s i a I n d i a G e r m a n y C a n a d a A f r i c a F r a n c e B r a z i l K o r e a , S o u t h U n i t e d K i n g d o m I t a l y S p a i n A u s t r a l i a T a i w a n S o u t h A f r i c a M e x i c o S a u d i A r a b i a I r a n Billion kWh Source: US DOE Energy Information Administration Lighting Control Strategies 4 5 6 Occupancy/Vacancy Sensing * The greatest energy savings achieved with any lighting fixture is when the lights are shut off * Minimize wasted light by providing occupancy sensing or vacancy sensing 7 8 Daylight Harvesting * Most commercial space has enough natural light flowing into it, and the amount of artificial light being generated can be unnecessary * Cut back on the production of artificial lighting by

Note: This page contains sample records for the topic "ing light ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Light truck forecasts  

SciTech Connect

The recent dramatic increase in the number of light trucks (109% between 1963 and 1974) has prompted concern about the energy consequences of the growing popularity of the light truck. An estimate of the future number of light trucks is considered to be a reasonable first step in assessing the energy impact of these vehicles. The monograph contains forecasts based on two models and six scenarios. The coefficients for the models have been derived by ordinary least squares regression of national level time series data. The first model is a two stage model. The first stage estimates the number of light trucks and cars (together), and the second stage applies a share's submodel to determine the number of light trucks. The second model is a simultaneous equation model. The two models track one another remarkably well, within about 2%. The scenarios were chosen to be consistent with those used in the Lindsey-Kaufman study Projection of Light Truck Population to Year 2025. Except in the case of the most dismal economic scenario, the number of light trucks is expected to increase from the 1974 level of 0.09 light truck per person to about 0.12 light truck per person in 1995.

Liepins, G.E.

1979-09-01T23:59:59.000Z

482

SITE LIGHTING FOUNDATIONS  

SciTech Connect

The purpose of this analysis is to design structural foundations for the Site Lighting. This analysis is in support of design drawing BABBDF000-01717-2100-23016.

M. Gomez

1995-01-17T23:59:59.000Z

483

Advanced Demand Responsive Lighting  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Efficiency Program and Market Trends High Technology and Industrial Buildings Lighting Systems Residential Buildings Simulation Tools Sustainable Federal Operations Windows...

484

Photovoltaic lighting system performance  

DOE Green Energy (OSTI)

The performance of 21 PV-powered low pressure sodium lighting systems on a multi-use has been documented in this paper. Specific areas for evaluation include the vandal resistant PV modules, constant voltage and on/off PV charge controllers, flooded deep-cycle lead-antimony and valve regulated lead-acid (VLRA) gel batteries, and low pressure sodium ballasts and lights. The PV lighting system maintenance intervals and lessons learned have been documented over the past 2.5 years. The above performance data has shown that with careful hardware selection, installation, and maintenance intervals the PV lighting systems will operate reliably.

Harrington, S.R.; Hund, T.D.

1996-06-01T23:59:59.000Z

485

Faster Than Light?  

E-Print Network (OSTI)

It is argued that special relativity remains a viable physical theory even when there is permitted signals traveling faster than light.

Robert Geroch

2010-05-10T23:59:59.000Z

486

Energy Basics: Fluorescent Lighting  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

& Cooling Water Heating Fluorescent Lighting Fluorescent lamps use 25%-35% of the energy used by incandescent lamps to provide the same amount of illumination (efficacy of...

487

NIST Stray light correction  

Science Conference Proceedings (OSTI)

... A correction, which can be done in real time, can reduce errors due to stray light by more than one order of magnitude. ...

2012-10-02T23:59:59.000Z

488

Lakeview Light and Power - Commercial Lighting Rebate Program | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lakeview Light and Power - Commercial Lighting Rebate Program Lakeview Light and Power - Commercial Lighting Rebate Program Lakeview Light and Power - Commercial Lighting Rebate Program < Back Eligibility Commercial Fed. Government Local Government Nonprofit State Government Savings Category Appliances & Electronics Commercial Lighting Lighting Program Info Funding Source Funded by Bonneville Power Administration Expiration Date 9/1/2013 State District of Columbia Program Type Utility Rebate Program Rebate Amount Commercial Lighting Installation: Up to 70% of cost Provider Lakeview Light and Power Lakeview Light and Power offers a commercial lighting rebate program. Rebates apply to the installation of energy efficient lighting retrofits in non-residential buildings. The rebate program is funded by BPA and ends in September of 2010 or earlier if the funding is exhausted. Lakeview Light

489

Explosively pumped laser light  

DOE Patents (OSTI)

A single shot laser pumped by detonation of an explosive in a shell casing. The shock wave from detonation of the explosive causes a rare gas to luminesce. The high intensity light from the gas enters a lasing medium, which thereafter outputs a pulse of laser light to disable optical sensors and personnel.

Piltch, Martin S. (Los Alamos, NM); Michelotti, Roy A. (Los Alamos, NM)

1991-01-01T23:59:59.000Z

490

The gravity of light  

E-Print Network (OSTI)

A solution of the old problem raised by Tolman, Ehrenfest, Podolsky and Wheeler, concerning the lack of attraction of two light pencils "moving parallel", is proposed, considering that the light can be source of nonlinear gravitational waves corresponding (in the would be quantum theory of gravity) to spin-1 massless particles.

G. Sparano; G. Vilasi; S. Vilasi

2010-09-12T23:59:59.000Z

491

Developing architectural lighting representations  

Science Conference Proceedings (OSTI)

This paper reports on the development of a visualization system for architectural lighting designers. It starts by motivating the problem as both complex in its physics and social organization. Three iterations of prototypes for displaying time and space ... Keywords: architectural lighting design, energy efficiency, ethnographic fieldwork, information visualization, qualitative analysis

Daniel C. Glaser; Roger Tan; John Canny; Ellen Yi-Luen Do

2003-10-01T23:59:59.000Z

492

Light intensity compressor  

DOE Patents (OSTI)

In a system for recording images having vastly differing light intensities over the face of the image, a light intensity compressor is provided that utilizes the properties of twisted nematic liquid crystals to compress the image intensity. A photoconductor or photodiode material that is responsive to the wavelength of radiation being recorded is placed adjacent a layer of twisted nematic liquid crystal material. An electric potential applied to a pair of electrodes that are disposed outside of the liquid crystal/photoconductor arrangement to provide an electric field in the vicinity of the liquid crystal material. The electrodes are substantially transparent to the form of radiation being recorded. A pair of crossed polarizers are provided on opposite sides of the liquid crystal. The front polarizer linearly polarizes the light, while the back polarizer cooperates with the front polarizer and the liquid crystal material to compress the intensity of a viewed scene. Light incident upon the intensity compressor activates the photoconductor in proportion to the intensity of the light, thereby varying the field applied to the liquid crystal. The increased field causes the liquid crystal to have less of a twisting effect on the incident linearly polarized light, which will cause an increased percentage of the light to be absorbed by the back polarizer. The intensity of an image may be compressed by forming an image on the light intensity compressor.

Rushford, Michael C. (Livermore, CA)

1990-01-01T23:59:59.000Z

493

Hybrid lighting: Illuminating our future  

SciTech Connect

Hybrid lighting is a combination of natural and artificial illumination to be used indoors for all lighting needs. Ideally, hybrid lighting is effectively indistinguishable from standard artificial lighting except in quality and cost, where it will likely be an improvement. Hybrid lighting systems are produced by a combination of four technologies: collecting natural light, generating artificial light, transporting and distributing light to where it is needed, and controlling the amounts of both natural and artificial light continuously during usage. Lighting demands a large fraction of our energy needs. If we can control or decrease this demand, we are able to accommodate societal growth without energy demand growth.

Cates, M.R.

1996-12-31T23:59:59.000Z

494

Exploring Lighting Spaces  

E-Print Network (OSTI)

We present a simple system for interactively specifying lighting parameters, including position, for high-quality image synthesis. Unlikeinverse approaches to the lighting-design problem, we do not require the user to indicate a priori the desired illuminative characteristics of an image. In our approach the computer proposes, culls, and organizes a set of candidate lights automatically, using an elementary measure of image similarityasthe basis for both culling and organization. The user then browses the set of candidate-light images, selects which lights to include, and combines them as desired. This work is a particular instance of a general strategy --- sampling a design space broadly and intelligently and organizing the results for rapid browsing by the user --- that may be applicable to many other design problems in computer graphics.

T. Kang; J. Seims; J. Marks; S. Shieber

1996-01-01T23:59:59.000Z

495

Columbia Water and Light - HVAC and Lighting Efficiency Rebates |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Columbia Water and Light - HVAC and Lighting Efficiency Rebates Columbia Water and Light - HVAC and Lighting Efficiency Rebates Columbia Water and Light - HVAC and Lighting Efficiency Rebates < Back Eligibility Commercial Industrial Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Heat Pumps Appliances & Electronics Commercial Lighting Lighting Maximum Rebate Lighting: 50% of invoiced cost up to $22,500 Program Info State Missouri Program Type Utility Rebate Program Rebate Amount HVAC Replacements: $570 - $3,770 Lighting: $300/kW reduction or half of project cost Provider Columbia Water and Light Columbia Water and Light (CWL) offers rebates to its commercial and industrial customers for the purchase of high efficiency HVAC installations and efficient lighting. Incentives for certain measures are based upon the

496

Induction Lighting: An Old Lighting Technology Made New Again | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Induction Lighting: An Old Lighting Technology Made New Again Induction Lighting: An Old Lighting Technology Made New Again Induction Lighting: An Old Lighting Technology Made New Again July 27, 2009 - 5:00am Addthis John Lippert Induction lighting is one of the best kept secrets in energy-efficient lighting. Simply stated, induction lighting is essentially a fluorescent light without electrodes or filaments, the items that frequently cause other bulbs to burn out quickly. Thus, many induction lighting units have an extremely long life of up to 100,000 hours. To put this in perspective, an induction lighting system lasting 100,000 hours will last more than 11 years in continuous 24/7 operation, and 25 years if operated 10 hours a day. The technology, however, is far from new. Nikola Tesla demonstrated induction lighting in the late 1890s around the same time that his rival,

497

Reading Municipal Light Department - Business Lighting Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reading Municipal Light Department - Business Lighting Rebate Reading Municipal Light Department - Business Lighting Rebate Program Reading Municipal Light Department - Business Lighting Rebate Program < Back Eligibility Agricultural Commercial Fed. Government Industrial Institutional Local Government Nonprofit Schools State Government Savings Category Appliances & Electronics Commercial Lighting Lighting Maximum Rebate Commercial Customers: $10,000 per calendar year Municipal Customers: $15,000 per calendar year Program Info State Massachusetts Program Type Utility Rebate Program Rebate Amount T-8/T-5 Lamp with Electronic Ballasts: $11 - $35/fixture Interior High Output Lamp with Electronic Ballasts: $100/fixture De-lamping: $4 - $9/lamp Lighting Sensors: $20/sensor LED Exit Signs: $20/fixture Provider Incentive Programs

498

Light and Bread Mold  

NLE Websites -- All DOE Office Websites (Extended Search)

Light and Bread Mold Light and Bread Mold Name: CHASE Location: N/A Country: N/A Date: N/A Question: HOW CAN I EFICTIVELY TEST THE EFFECTS OF LIGHT ON BREAD MOLD? Replies: Hello Chase, In order to test the effects of light on bread mould you need to set up an experiment. There are two things you need to have in your experiment to make it a good experiment: 1. A 'control'. 2. Replicates 1. The 'control' Obviously in order to test the effects of light on bread mold you will need to actually shine some light on some bread mold and see what happens. This is your 'treatment'. However, it is vitally important that you know what would have happened without the treatment (in this case added light). Let's pretend that you do a test a you find that the bread mold under the light actually dies. How do you know if your bread mold died because light was added or because at that time of year all bread mold would die naturally or because by adding light you caused the temperature to rise and that killed the bread mold? The answer is that you do not know unless you have taken the trouble to find out with anouther test called the 'control'. The 'control' is a piece of bread mold, identical to the 'treatment' bread mold, which is placed in identical conditions to the 'treatment' piece of bread mold except that light is removed. Your 'control' piece of bread mold will need to be (to the best of your abillity) at the same temperature, in the same area, at similar humidity, etc. Part of the skill of designing a scientific experiment is being able think of all the possible things which might be affecting the bread mold and keeping them the same in both the 'treatment' and the 'control' (except, of course, for the presence of light) so that when you find a difference between the 'treatment' and the 'control' you are sure that it is the result of the light rather than something else.

499

Lighting fundamentals handbook: Lighting fundamentals and principles for utility personnel  

SciTech Connect

Lighting accounts for approximately 30% of overall electricity use and demand in commercial buildings. This handbook for utility personnel provides a source of basic information on lighting principles, lighting equipment, and other considerations related to lighting design. The handbook is divided into three parts. Part One, Physics of Light, has chapters on light, vision, optics, and photometry. Part Two, Lighting Equipment and Technology, focuses on lamps, luminaires, and lighting controls. Part Three, Lighting Design Decisions, deals with the manner in which lighting design decisions are made and reviews relevant methods and issues. These include the quantity and quality of light needed for visual tasks, calculation methods for verifying that lighting needs are satisfied, lighting economics and methods for evaluating investments in efficient lighting systems, and miscellaneous design issues including energy codes, power quality, photobiology, and disposal of lighting equipment. The handbook contains a discussion of the role of the utility in promoting the use of energy-efficient lighting. The handbook also includes a lighting glossary and a list of references for additional information. This convenient and comprehensive handbook is designed to enable utility lighting personnel to assist their customers in developing high-quality, energy-efficient lighting systems. The handbook is not intended to be an up-to-date reference on lighting products and equipment.

Eley, C.; Tolen, T. (Eley (Charles) Associates, San Francisco, CA (United States)); Benya, J.R. (Luminae Souter Lighting Design, San Francisco, CA (United States))

1992-12-01T23:59:59.000Z

500

EK101 Engineering Light Project: Evaluate Residential Lighting  

E-Print Network (OSTI)

the same level of performance in the LED Lighting product solution (retrofit light bulb, ceiling lighting minute of networking ­ refreshments will be served) Thinking Differently about LED Lighting Dr. Matthew A, LEDs have emerged as the next "filament" for the lighting industry. While LEDs are not new

Bifano, Thomas