Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

"Cook"ing at Y-12 for 70 years | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

"Cook"ing at Y-12 ... "Cook"ing at Y-12 ... "Cook"ing at Y-12 for 70 years Posted: December 5, 2013 - 4:48pm At a Nov. 14 visit to Y-12, National Nuclear Security Administration's Deputy Administrator for Defense Don Cook shared his outlook on the future and his thanks to employees for continuing their 70-year tradition of making America safer. "There are three things to remember," Cook told a meeting of NNSA Production Office and Y-12 employees. "We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America." Cook also shared his thanks for preparing for the potential furlough in October because of the government shutdown and lack of appropriations. During what was the longest government shutdown to date, Cook said Y-12

2

STEM-ing the Tide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STEM-ing the Tide STEM-ing the Tide STEM-ing the Tide September 29, 2010 - 4:29pm Addthis Ali Zaidi Special Assistant to the Secretary of Energy Yesterday, the MacArthur Foundation rolled out its latest class of "geniuses" - 23 Americans who stand out because of their creativity and enterprise. Each recipient of the honor (and the $500,000 prize) has made an extraordinary contribution. One of those recipients is Amir Abo-Shaeer, an engineer in the aerospace and telecommunications industries who decided 10 years ago to go back to high school - this time as a teacher. At his alma mater, Dos Pueblos High School (in Santa Barbara, California), Amir created "a school within a school" built around a hands-on curriculum that helps students learn by connecting the ideas of physics, engineering and mathematics through

3

Personnel Change Notification ImagIng: GRSF/T  

E-Print Network (OSTI)

Personnel Change Notification OGS Form 3 ImagIng: GRSF/T Admit Year/Term: GS Web Front Desk: Office., reviewers, coordinators and chairs) Update: View all AIM Graduate Studies pages and enter decisions on GS02: Search for and view applicants; edit emails Connect: Add, search for and communicate with prospects

Hart, Gus

4

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 222 194 17...

5

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,100...

6

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,928 1,316...

7

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Energy Consumption Survey: Energy End-Use Consumption Tables Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

8

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,870 1,276...

9

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,602 1,397...

10

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,037...

11

"Dark Web: Exploring and Min-ing the Dark Side of the Web"  

E-Print Network (OSTI)

Title: "Dark Web: Exploring and Min- ing the Dark Side of the Web" Speaker: Director, Prof will review the emerging research in Terrorism Informatics based on a web mining perspective. Recent progress in the internationally re- nowned Dark Web project will be reviewed, including: deep/dark web spider- ing (web sites

Michelsen, Claus

12

13:00 Begrung und Symposiumserffnung Prof. Dr.-Ing. Gerd Holbach  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Berlin,Technische Universität

13

TRANSPORTATION SYSTEMS are the build-ing blocks of modern society. Efficient and  

E-Print Network (OSTI)

TRANSPORTATION SYSTEMS are the build- ing blocks of modern society. Efficient and safe movement. How- ever, transportation systems by their very nature also affect the environment through operations, construction, and maintenance of transportation facilities, and through the travel behaviors they encourage

Wang, Yuhang

14

Water is used for many purposes, includ-ing growing crops, producing copper,  

E-Print Network (OSTI)

WATER USES Water is used for many purposes, includ- ing growing crops, producing copper, generating electricity, watering lawns, keeping clean, drinking and recreation. Bal- ancing the water budget comes down of the water budget. Reducing demand involves re- ducing how much water each person uses, lim- iting the number

15

ing system  

E-Print Network (OSTI)

Oct 29, 2002 ... GAs are search algorithms based on the mechanics of natural selection and natural genetics. They combine the concept of survival of the.

16

Material development in the SI sub 3 N sub 4 system using glass encapsulated Hip'ing  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP'ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

17

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

18

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

19

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

20

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Intensity (thousand Btusquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

22

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

23

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

24

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

25

Material development in the SI{sub 3}N{sub 4} system using glass encapsulated Hip`ing. Final report, Phase 2: DOE/ORNL Ceramic Technology Project  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP`ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

26

Hydraulic fractur ing--also called hy  

E-Print Network (OSTI)

reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

Goodman, Robert M.

27

E(Race)ing gender: Stratified identities  

E-Print Network (OSTI)

In the discussion that follows, I will examine, on the broadest level, Hurston's complex negotiation of identity, as manifested in Their Eyes Were Watching God. Central to this investigation is an understanding of the strategies that women, specifically African American women, have adopted, under the auspices of marriage and the patronage system, to seek an equal place within a hegemonic culture. Most importantly, I want to address the cultural and social price exacted for accepting (as seen in the appropriation of white standards, and rejecting (as seen in Janie's trial for her husband's death) those institutions as the basis of one's identity. The cultural and social price that Janie pays, furthermore, challenges her adaptive capacity to stratify her racial and gender identity. Finally, it exacts a toll on the community as a whole, a fact Hurston repeatedly suggests by illustrating the extent to which the community has absorbed hegemonic standards of value and beauty with little or no inspection of or reflection on the effects to itself or to its individual members.

Nguyen, Le Thuy Thi

2000-01-01T23:59:59.000Z

28

IMPROVED GROOVING TOOL FOR TU ING  

te hnology readiness level: 6 a market deliverable has been demonstrated in relevant environments and is in final development . author: alexandra ...

29

Table E1. Major Fuel Consumption (Btu) by End Use for Non-Mall ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

30

Table E6. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

31

Table E4. Electricity Consumption (Btu) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

32

Table E3A. Electricity Consumption (Btu) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

33

Table E4A. Electricity Consumption (Btu) Intensities by End ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

34

Table E5A. Electricity Consumption (kWh) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

35

Table E6A. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

36

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

37

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Energy Intensity (kWhsquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

38

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Survey: Energy End-Use Consumption Tables Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

39

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ............................. 2,037 1,378 338 159 163 42.0 28.4 7.0 3.3 3.4 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 249 156 35 41 18 78.6 49.1 11.0 12.9 5.6 5,001 to 10,000 .......................... 218 147 32 31 7 54.8 37.1 8.1 7.9 1.7 10,001 to 25,000 ........................ 343 265 34 25 18 43.8 33.9 4.4 3.2 2.3 25,001 to 50,000 ........................ 270 196 41 13 Q 40.9 29.7 6.3 2.0 2.9 50,001 to 100,000 ...................... 269 186 45 13 24 35.8 24.8 6.0 1.8 3.2 100,001 to 200,000 .................... 267 182 56 10 19 35.4 24.1 7.4 1.3 2.6 200,001 to 500,000 .................... 204 134 43 11 17 34.7 22.7 7.3 1.8 2.9 Over 500,000 .............................

40

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ........................... 1,870 1,276 322 138 133 43.0 29.4 7.4 3.2 3.1 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 243 151 34 40 18 78.7 48.9 11.1 13.0 5.7 5,001 to 10,000 .......................... 202 139 31 29 Q 54.8 37.6 8.5 7.9 Q 10,001 to 25,000 ........................ 300 240 31 21 7 42.5 34.1 4.4 3.0 1.1 25,001 to 50,000 ........................ 250 182 40 11 Q 41.5 30.2 6.6 1.9 Q 50,001 to 100,000 ...................... 236 169 41 8 19 35.4 25.2 6.2 1.2 2.8 100,001 to 200,000 .................... 241 165 54 7 16 36.3 24.8 8.1 1.0 2.4 200,001 to 500,000 .................... 199 130 42 11 16 35.0 22.8 7.5 1.9 2.8 Over 500,000 ............................. 198

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Go-ing for the prediction of protein folding mechanisms  

E-Print Network (OSTI)

of Chemistry, Faculty of Science, Kobe University, Kobe, 657-8501, Japan Protein folding has been a long-lived could be relatively simple. These three ingredients are linked together with an almost one-line free work (8, 9). The surprise of the three papers is that apparently one can have both simplicity and fair

Takada, Shoji

42

The physical function-ing of a city sometimes  

E-Print Network (OSTI)

insurance. It is recommended that parents carefully review their homeowners, auto and health insurance. Parents should check their homeowners policy to see whether it will cover a student's possessions while

43

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

cubic feet) Natural Gas Energy Intensity (cubic feetsquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

44

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(trillion Btu) Fuel Oil Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

45

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(million gallons) Fuel Oil Energy Intensity (gallonssquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

46

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) District Heat Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

47

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) Natural Gas Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

48

Gloria Cook  

Science Conference Proceedings (OSTI)

Senior Director Gloria Cook Contact Information contact contact us Gloria Cook Senior Director, Finance and Operations ...

49

Donald Cook  

Energy.gov (U.S. Department of Energy (DOE))

Dr. Donald L. Cook serves as the Deputy Administrator for Defense Programs at the National Nuclear Security Administration. Appointed to the position by President Barack Obama, Dr. Cook was sworn...

50

ing the distribution of those galaxies, the way they clump and spread out, scientists  

E-Print Network (OSTI)

illuminated realms as small as a single molecule and as large as a gamma ray burst. of the Year Agony ex- plosions in the universe: titanic blasts of en- ergy called gamma ray bursts (GRBs). Most notably of black holes and other phenomena in the gamma ray region of the spectrum. And the Wilkinson Microwave

Yildiz, Ahmet

51

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg130  

E-Print Network (OSTI)

. Journal of "Solar Energy Materials and Solar Cells". Proceedings of IEEE Photovoltaic Specialist Conferences. Proceedings of European Photovoltaic Solar Energy Conferences. #12;Module 2/Photovoltaics, Wiley, 1995. R.H.Bube, Photovoltaic Materials, Imperial College Press, 1998. Journal of "Solar Energy

52

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

U.S. Energy Information Administration (EIA) Indexed Site

MCKEESPORT MCKEESPORT COR AOPOLIS-MOON REDHAW ST. CLAIR SC ROGGSFIELD FRANKLIN -OAK FOREST RIMERSBURG RENNERD AL E GREENVILL E PAT MOS CRABTR EE BLAC K ASH ROYALT ON N BAKERSTOWN QUEEN ROU GH RUN LUCAS BLAC K H ILL CRESTON WAT TSVILLE WADSWORTH -NORT H OAKLAN D HOM EWORT H UNIT Y ESSELBRUN ALAMED A PAR K-CROOKED RU CHERRY GROVE FRENC HTOWN ST EWART RUN MILL C REEK GLENF IELD-MOU NT NEBO HICKORY E HARRISVILLE E LEST ER GRIGGS CORNERS EN GLAN D WEST VIL LE LAKE BAILEY LAKE OAKFORD BR UNSWICK N HOR ACE WALBORN RESERVOIR YOUN GSVILLE RPD-LORAIN -1 INGOMAR-GRUBBS BIG MEADOWS GARD EN ISLE TURT LE CREEK LEWIST ON E BR USH CR EEK FOOT VILLE BU LL CREEK BESSEMER EAGLEVILLE LIVER POOL E RIDGEVILLE E EVANS CIT Y GUIT ONVILLE WOLF S COR NERS WIN DFALL ABBEYVILLE ROC K CAMP LEATH ER WOOD AR COLA CR EEK MEC HANICST OWN NINE MILE RU N WALKCHALK RENFR EW-MCCALMONT BU FFALO N VALENCIA WELLIN GT ON

53

Spring'ing' Forward Into the Finals . . . Of A Competition Like...  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.11.13...

54

'March'ing Into The Finals . . . Of A Competition Like No Other  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.04.13...

55

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg102  

E-Print Network (OSTI)

when carbon dioxide is introduced into thermal conversion processes such as the gasification of coal to syngas, leaving behind only a carbonless char. Castaldi estimates that if the biomass were used

56

Kurzlebenslauf (CV) Stand September 2011 Dr.-Ing. Diplom-Physiker  

E-Print Network (OSTI)

:30 Panel: Erneuerbare Energien: Rentable Investitionen oder teure Experimente? Christof Stein (KfW Bank) Dr für Klima, Umwelt und Energie) Matthias Willenbacher (JuWi Holding) Moderation: Monika Seynsche

57

Power Electronics and Electrical Drives Prof. Dr.-Ing. Joachim Bcker  

E-Print Network (OSTI)

, e.g. Interior permanent magnet synchronous motors (IPMSM)Interior permanent magnet synchronous rings Permanent Magnet Synchronous Motor integrated into the rotor outlines Active magnetic bearing motors (IPMSM) Switched reluctance drives FPGA based control Self optimizing systems (Collaborative

Noé, Reinhold

58

Programme Coordination Professor Dr.-Ing. habil. Dr. h. c. Karl J. Thom-Kozmiensky  

E-Print Network (OSTI)

Waste Management · Recycling · Waste-to-Energy Recovery of Biowastes · Mechanical-Biological Treatment of the European Suppliers of Waste to Energy Technology (ESWET), Brussels, Belgium 10.30 Hrs. Waste Framework.V., Gent, Belgium 12.30 Hrs. Waste incineration in the 21st century ­ Energy-efficient and climate

Hone, James

59

Wolfram Hoefer, Dr.-Ing. Assistant Professor Department of Landscape Architecture  

E-Print Network (OSTI)

Landentwicklung. Gärtner im Garten- und Landschaftsbau. (State exam for professional degree as gardener, landscape Ltd. London 1984-86 Apprenticeship as landscape gardener with Hermann Kretz, Garten und Landschaftsbau

Goodman, Robert M.

60

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg 141  

E-Print Network (OSTI)

- onry is also crucial to their safe storage. Plutonium, an active ingredient in nuclear weap- ons, has to determine how the electrons within these materials will behave. "The plutonium in the weapons ages, and we have to be able to predict the proper- ties of plutonium under a variety of conditions," Chris

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Protective interior wall and attach8ing means for a fusion reactor vacuum vessel  

DOE Patents (OSTI)

An array of connected plates mounted on the inside wall of the vacuum vessel of a magnetic confinement reactor in order to provide a protective surface for energy deposition inside the vessel. All fasteners are concealed and protected beneath the plates, while the plates themselves share common mounting points. The entire array is installed with torqued nuts on threaded studs; provision also exists for thermal expansion by mounting each plate with two of its four mounts captured in an oversize grooved spool. A spool-washer mounting hardware allows one edge of a protective plate to be torqued while the other side remains loose, by simply inverting the spool-washer hardware.

Phelps, Richard D. (Greeley, CO); Upham, Gerald A. (Valley Center, CA); Anderson, Paul M. (San Diego, CA)

1988-01-01T23:59:59.000Z

62

Pico-ing into the future of mobile projection and contexts  

Science Conference Proceedings (OSTI)

Ten years ago, we were on the verge of having cameras built into our mobile phones, but knew very little about what to expect or how they would be used. Now we are faced with the same unknowns with mobile projector phones. This research seeks to explore ... Keywords: Diary study, Experience sampling, Mobile, Pico-projectors

Max L. Wilson; Dan Craggs; Simon Robinson; Matt Jones; Kristian Brimble

2012-01-01T23:59:59.000Z

63

Koordination: Prof. Dr.-Ing. J. Seume Institut fr Turbomaschinen und Fluid-Dynamik  

E-Print Network (OSTI)

of installation of offshore wind farms (from Wiese 2008: Auswirkungen der Offshore-Windenergie auf den Betrieb von and offshore applications require appropriate planning and design. For most of them, statistics of extreme wind coastDat have been used in a large variety of coastal, offshore and terrestrial applications

64

Sandra Koch Dipl.-Ing. (FH) Telefon: 04921-807-1489  

E-Print Network (OSTI)

die Voraussetzung geschaffen, um die Stromerzeugung aus Windenergie Offshore langfristig erfolgreich geschaffen, um die Stromerzeugung aus Offshore Windenergie langfristig erfolgreich und effizient entwickeln-02 Bestimmung von Wärme- und Impulsfluss in der marinen atmosphärischen Grenzschicht für die Offshore

Damm, Werner

65

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

Annual Energy Outlook 2012 (EIA)

RURAL RID GE ROWSBUR G SH ERRETT MON AC A QUEEN JUN CTION YELLOW CR EEK SMELTZ ER CAT FISH R UN POLK E JEROMESVILLE N FLORENCE-FIVE POINTS ATEN CLARINGTON MILLERSBURG...

66

Following weeks of purging and organiz-ing, phase one of the School's reloca-  

E-Print Network (OSTI)

in August. The depart- ments of Consumer Science and Human Development and Family Studies, as well as UW from top: Gloria McCord, Human Ecology financial specialist, casts a spell at the punch-bowl cauldron

Sheridan, Jennifer

67

INFORMATION EXCELLENTIA CoLumbIA ENgINEErINg238  

E-Print Network (OSTI)

that bends and twists. "Computers, geometry, and physics are my ingredients. I mix them up in a bowl and what science as well. B.A.Sc., University of Toronto (Canada), 1997; M.S., California Institute of TechnologySPUn Associate Professor of Computer Science #12;

Hone, James

68

METHOD FOR REDU ING A KGROUND LUTTER IN A AMERA IMAGE  

... bulky and heavy, expensive, fragile, short-range, sensitive to vibration, and unreliable for outdoor use in bright sunlight conditions. The ...

69

SOLAR TRA ING SENSORS FOR MAXIMUM SOLAR ON ENTRATOR EFFI IEN Y  

POTENTIAL APPLI ATIONS Parabolic dish & trough solar concentrating collectors Solar energy and renewable energy Electric utility

70

whITe PaPer The ChaNgINg DYNaMICS OF  

E-Print Network (OSTI)

of the smart grid, which integrates AMI with distribution automation and other tech- nologies to connect consumers Network Automation And Analytics Smart Meters Distributed Generation Today: Centralized and One smart grid and advanced metering deployments. Bob Brnilovich, IBM www.UtilitiesProject.com/10803

71

From prehistoric times when firewood was used for cook-  

E-Print Network (OSTI)

(Zheng et al. 2001). In addition to excessive harvesting that out- stripped regeneration, natural of wood-based panels, pri- marily in construction and manufacturing of furni- ture and flooring, reached- sets this gap by timber imports (Fig. 2), plantations, and by manufactur- ing wood-based and non

72

Technical Report Documentation Page 1. Report No.  

E-Print Network (OSTI)

.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr

73

Institutsleitung: Univ.-Prof. Dr.-Ing. Prof. E.h. Dr.-Ing. E.h. Dr. h.c. mult. Engelbert Westkmper Kontakt: Birgit Spaeth Presse-und ffentlichkeitsarbeit  

E-Print Network (OSTI)

Universitätsprofessor ernannt wird. Thomas Bauernhansl, 1969 im fränkischen Miltenberg geboren, hat Maschinenbau an der

Möbius, Bernd

74

Tactical urbanism, public policy reform, and 'innovation spotting' by government : from Park(ing) Day to San Francisco's parklet program  

E-Print Network (OSTI)

This thesis examines the prospects and impacts of tactical urbanism (TU). While tactical urbanism remains primarily a subcultural movement, it is beginning to gain traction in popular culture in traditionally politically ...

Davidson, Mariko Mura

2013-01-01T23:59:59.000Z

75

The Burning Man festival is a unique happen-ing. For one week in September every year,  

E-Print Network (OSTI)

spaces, the city as it alters over the seven days and from year to year, exhibiting emergent properties- ance of oversized gas-guzzling camper vans, fossil-fuel-powered generators and gratuitous combustion, it is no Utopia. But the City's Alternative Energy Zone, with its huge bank of solar panels, multiple experiments

Bourne, Philip E.

76

Cultivat(ing) modernities : the Society for National Heritage, political propaganda and public architecture in twentieth-century Iran  

E-Print Network (OSTI)

Beginning in 1922, under the auspices of the Pahlavi dynasty of Iran, the tombs of selected historical figures were systematically destroyed to make way for modern mausoleums erected as metaphors for an "Aryan" nation in ...

Grigor, Talinn, 1972-

2005-01-01T23:59:59.000Z

77

58 UTS ANNUAL REPORT 2008 sUppoRtING oUR objEctIvEs  

E-Print Network (OSTI)

improvingenvironmentalsustainabilityin ourcampusoperations.Itisoverseenby asteeringcommitteeandsevenworking groups:waste,transport,energy into the atmosphere. The proposal from students Antony Henry and Kavit Pandya was to put this wasted energy through Energy-efficientlightinginmorethan> 60percentoftheUniversity Savingtheequivalentof45Olympic

University of Technology, Sydney

78

HOW ENVIRONMENTAL RISK FROM LEACH ING OF HEAVY METALS IN ASH RESIDUES FROM COMBUSTION OF MUNIC IPAL SOLID WASTE  

E-Print Network (OSTI)

Laboratories which led to the use of acid tests such as the EP and TCLP tests. [25] 13 #12;CONCLUSIONS and soluble metals in the ash from Waste-to Energy (WTE) facilities has led to a public concern about why has led to the requirement for continuous monitoring of oxygen , carbon monoxide (CO) , and acid gases

Columbia University

79

--No Title--  

Annual Energy Outlook 2012 (EIA)

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

80

Coyotes in Cook County  

NLE Websites -- All DOE Office Websites (Extended Search)

Coyotes in Cook County Coyotes in Cook County Nature Bulletin No. 2 Forest Preserve District of Cook County -- July 31, 1969 George W. Dunne, President Roland F. Eisenbeis, Superintendent of Conversation COYOTES IN COOK COUNTY One winter night, a Forest Preserve Ranger heard the yapping howl of some animal that made his hair stand on end. A few days later, a farmer in the Sag valley saw what appeared to be a wolf lope across a road. Finally, the ranger, concealed within sight of a faint path apparently used by wild dogs or foxes, shot a coyote. The little bunch of black bristles at the base of its tail, covering a scent gland beneath the skin identified it as being of the wolf family. The animal was sent to the Illinois Natural History Survey, at Urbana, where it was pronounced to be a prairie wolf (also known as the "brush" wolf). In the west it is generally known by its Spanish name: coyote.

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Employee Worksheet Cooking Healthy Tips  

E-Print Network (OSTI)

, strawberries, or pineapple to low fat chicken salad. s Mix it up! Mix 1/2 cup nonfat sour cream (or unflavored - reprint by permission only Cook Healthy... All the flavor without the fat Delicious taste without the salt cook Five "How To" Cooking Tips 1. Use lower fat ingredients. 2. Trim and skim fat. 3. Reduce fat

Burke, Peter

82

Clemson University Preservation master Plan Part III: ExIstIng CondItIons ChaPtEr Four FEbruary 2009 JMa, InC. 70  

E-Print Network (OSTI)

,337 CFDA # 15.922 - Native American Graves Protection and Repatriation Act Direct Federal Awards 16,227 525,830 - 4,830 Lawrence Berkeley Natl Lab RF HANFORD SEDM THOMP-6875736 48,614 2,965 45,649 Savannah River Nuclear Solutns RF RIVERBASIN GRUND-AC716760 132,105 9,248 122,857 Savannah River Nuclear Solutns RF SUP

Stuart, Steven J.

83

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

from Smoldering Biomass Combustion. Atmos. Chem. Phys. , 10,aerosols emitted during biomass combustion [Robinson et al.burning samples. Combustion of biomass produces EC a and

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

84

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Tar Balls from Smoldering Biomass Combustion. Atmos. Chem.gases and particles from biomass burning in Brazil, J. Ge-for smoke from African biomass burning, J. Geophys. Res. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

85

Early and sustained interventions which strongly feature mentoring are essential in help-ing Native American and Latino students navigate an unfamiliar academic system that is  

E-Print Network (OSTI)

(Navajo) is the largest, with 170,000 members. Others include the Oglala Sioux, Cherokee Nation, Blackfeet

Benitez-Nelson, Claudia

86
87

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

DOE Green Energy (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} < 2.5 {mu}m: average 59.8 {mu}g m{sup -3}) were higher than coarse aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

88

MICRO-MACHINED THIN FILM HYDROGEN GAS SENSORS Frank DiMeo, Jr., Ing-Shin Chen, Philip Chen, Jeffrey Neuner  

E-Print Network (OSTI)

;Introduction The reputation of hydrogen as the next generation energy delivery agent, supplementing electricity of Electric Power Research Institute, in a recent The Industrial Physicist column, observed the multifaceted as a national security priority. While fuel cell cars often feature prominently in news media and are touted

89

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

2001. Kerminen, V. -M. , Makela, T. E. , Ojanen, C. H. ,Saarikoski, S. , Frey, A. , Mkel, T. , and Hillamo, R. :Acker, K. , Hillamo, R. , Mkel, T. : Intercomparison of

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

90

CS-03-02 A PIvotIng PRocEDuRE FoR A ClAss oF SEconD-oRDER ...  

E-Print Network (OSTI)

linear function over an intersection of an affine set and second-order cones. SOCP is a .... Note that the e q uality constraints of does not contain!7# .

91

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Crutzen, P. : Atmospheric Aerosols: Biogeochemical sourcesof optically active aerosol particles over the Amazonproperties of Amazonian aerosol particles: Rev. Geophys. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

92

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

Science Conference Proceedings (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

93

Understanding the Effect of Baseline Modeling Implementation Choices on Analysis of Demand Response Performance  

E-Print Network (OSTI)

IEEE Transactions on Smart Grid, ings. Journal of Solaroperations. With continu- ing Smart Grid development, there

Addy, Nathan

2013-01-01T23:59:59.000Z

94

Portable solar cooking apparatus  

Science Conference Proceedings (OSTI)

A portable solar cooking apparatus is described which consists of: at least first and second reflector panels, the first reflector panel having a shaped surface configuration for reflecting solar radiation generally toward a focal point, the second reflector panel also having a shaped surface configuration for reflecting solar radiation toward the focal point, the surface configuration of the first panel interfitting with the surface configuration of the second panel when the panels are placed face-to-face so that the first and second panels mutually support each other and occupy less thickness than without interfitting; and means for supporting material to be heated adjacent the focal point.

Ciambella, B.C.; Ciambella, D.P.; Ciambella, P.A.

1986-04-22T23:59:59.000Z

95

Definition: Solar Cooking | Open Energy Information  

Open Energy Info (EERE)

Cooking Jump to: navigation, search Dictionary.png Solar Cooking A solar cooker, or solar oven, is a device which uses the energy of sunlight to heat food or drink to cook it or...

96

Soalr cooking in developing countries  

SciTech Connect

Solar cooking must overcome a number of obstacles to realize its potential to improve the lives of women in developing countries. Unlike historical interest in solar cooking, current interest derives from vital environmental and human needs. Deforestation and reliance on wood for cooking lead to many hardships, especially for women, and women in developing countries need access to technology and funding. If the woman builds the oven herself, it notonly makes her more willing to use it but the process empower her with new knowledge and kills. The physical design of the oven must be adapted to local conditions and materials for the oven should be inexpensive and locally available.

Stone, L.

1994-11-01T23:59:59.000Z

97

Definition: Biomass Cook Stove | Open Energy Information  

Open Energy Info (EERE)

Definition Definition Edit with form History Facebook icon Twitter icon » Definition: Biomass Cook Stove Jump to: navigation, search Dictionary.png Biomass Cook Stove A Stove that is heated by burning wood, charcoal, animal dung or crop residue. Cook stoves are the most common way of cooking and heating food in developing countries.[1] View on Wikipedia Wikipedia Definition "Cooking stove" redirects here. For a kitchen cooker, stove, range, oven, or stove top, see Kitchen stove. In cooking, a cook stove is heated by burning wood, charcoal, animal dung or crop residue. Cook stoves are commonly used for cooking and heating food in developing countries. Developing countries consume little energy compared to developed nations; however, over 50% of the energy that they do use goes into cooking food.

98

J. M. Cook  

NLE Websites -- All DOE Office Websites (Extended Search)

-130 -130 J. M. Cook September 1988 .,.... THE GEOMERY OF COHESIVE MAGNET-cOIL WINDING Sumary - Duin the winding of a magnet-coil, the wire is pulled tightly across the surface of the iner part that has already been wound. If the ;w.ire is not a geodesic in the surface, it will tend to slip lateraly. Classical. dierential geometry is applied to the problem of widing the coil so as to minze this tendency. subject to the constraint that a prescribed mag- netic field be produced. NOTATION D subset of euclidean space x point (x1.xz.xs) in D r cure inD s arc-length parameterization of r Tex) tanent to r at x N(x) pricipal norma to r at x B(x) binorma to r at x ;(x) torsion of r at x K curature of r 6(x) Darboli vector ot r at x J(x) current density (vector) at x L layerin fu~tion (scalar) on D

99

SOLAR COOKING DISSEMINATION APPROACHES AND  

E-Print Network (OSTI)

To teach, disseminate, and promote solar cooking (and solar water pasteurization and drying) in Nepal, then in Mongolia and Peru. To provide solar technologies research and technology transfer. To initiate new programs. To overcome cultural barriers to solar cooking. My work started in 1992, when I retired from Hewlett Packard Comp where I was engineering manager. This allowed me to follow my dream to disseminate solar cooking in Nepal (and more recently in other developing countries). I choose Nepal because my frequent visits and solo-treks there during the past 21 years have sensitized me to the environmental deterioration, affecting the Himalayan region. Rapid growth in population and tourism has increased demands on a very delicate environment. Scarce natural resources such as fuelwood, which provides almost all of Nepal's energy needs, are being depleted rapidly. Smokey fires cause lung and eye problems. Solar cooking can significantly help decrease the very critical health and environmental problems of the country. In 1992 solar cooking and solar water pasteurization was not being practiced. My objective was to build a sustainable solar cooking program and search for a local organization that would be interested to champion this cause. I follow up each year for three months to insure success and start new initiatives.

Allart Ligtenberg

2000-01-01T23:59:59.000Z

100

Heart Healthy Home Cooking African American Style  

E-Print Network (OSTI)

Heart Healthy Home Cooking African American Style With Every Heartbeat Is Life #12;#12;Heart Recipe Substitutions for Heart Healthy Cooking at the heart of African American family life and special celebrations. This recipe book brings together many

Bandettini, Peter A.

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Tag: Naval Reactors  

NLE Websites -- All DOE Office Websites (Extended Search)

9/all en "Cook"ing at Y-12 for 70 9/all en "Cook"ing at Y-12 for 70 years http://www.y12.doe.gov/employees-retirees/y-12-times/cooking-y-12-70-years

We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America.
102

Andrew R. Cook Publication List, BNL  

NLE Websites -- All DOE Office Websites (Extended Search)

R. Cook R. Cook Publications "Oxidation of Aqueous Polyselenide Solutions. A Mechanistic Pulse Radiolysis Study" A. Goldbach, M-L. Saboungi, J.A. Johnson, A.R. Cook, D. Meisel, J. Phys. Chem. A, 104(17), 4011 (2000). "Spur Decay of the Solvated Electron in Picosecond Radiolysis Measured with Time-Correlated Absorption Spectroscopy" D.M. Bartels, A.R. Cook, M. Mudaliar, C.D. Jonah, J. Phys. Chem. A., 104(8), 1686 (2000). "Capture of Charge Carriers at the Silica Nanoparticle / Water Interface" T. Schatz, A.R. Cook, D. Meisel, J. Phys. Chem. B., 103(46), 10209 (1999). "Charge Carrier Transfer Across the Silica Nanoparticle / Water Interface" T. Schatz, A.R. Cook, D. Meisel, J. Phys. Chem. B., 102(37), 7225 (1998). "Fluorescence of the 1,4-Benzoquinone Radical Anion" A.R. Cook, L.A. Curtiss, J.R. Miller, J. Am. Chem. Soc., 119(24), 5729 (1997).

103

Diacylglycerol Oil, 2nd EditionChapter 19 Cooking Oil: Cooking Properties and Sensory Evaluation  

Science Conference Proceedings (OSTI)

Diacylglycerol Oil, 2nd Edition Chapter 19 Cooking Oil: Cooking Properties and Sensory Evaluation Food Science Health Nutrition Biochemistry eChapters Food Science & Technology Health - Nutrition - Biochemistry BDC39521BD1565B3519D1C1

104

Michigan Nuclear Profile - Donald C Cook  

U.S. Energy Information Administration (EIA) Indexed Site

Donald C Cook" "Unit","Summer capacity (mw)","Net generation (thousand mwh)","Summer capacity factor (percent)","Type","Commercial operation date","License expiration date"...

105

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 ....................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ..................... 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ..................... 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ................... 405 16 57 65 7 158 2 29 6 18 45

106

Automatic annotation of organellar genomes with DOGMA  

E-Print Network (OSTI)

for 98 chloroplast protein cod- ing genes (with two entriessimilarly to the protein cod- ing genes, except that

Wyman, Stacia; Jansen, Robert K.; Boore, Jeffrey L.

2004-01-01T23:59:59.000Z

107

Cooking Trends from 1993 to 2001 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Household Size Still Affects Frequency of Cooking. Household size is another factor that relates to the frequency of meal-cooking at home.

108

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Mitarbeiter und Stipendiaten Dr. Olaf Adamczyk Dr.-Ing. Suhas Bhandare Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann Dr Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr.-Ing. Sunil Survaiya Dr.-Ing. Hongbin Zhang

Noé, Reinhold

109

Cooking Trends from 1993 to 2001  

Gasoline and Diesel Fuel Update (EIA)

Home Page U.S. Energy Information Administration's Residential Buildings Site, Cooking Trends from 1993 to 2001. If you need assistance viewing this page, call 202-586-8800. Energy Information Adiministration Homepage Home Page U.S. Energy Information Administration's Residential Buildings Site, Cooking Trends from 1993 to 2001. If you need assistance viewing this page, call 202-586-8800. Energy Information Adiministration Homepage Home > Residential > Residential Home Page > Cooking Trends from 1993 to 2001 Cooking Trends in the United States : Are We Really Becoming a Fast Food Country? Graphic of vegetables A popular perception is that Americans now spend less time in the kitchen than in the past. Has there been an identifiable trend toward cooking less in the 1990s, or have cooking habits remained relatively constant over that period? And what characteristics of American households can be seen to influence their cooking patterns? The Residential Energy Consumption Survey (RECS) collects data on household characteristics as well as on residential energy consumption. The first RECS was conducted in 1978 and the eleventh and most recent survey was conducted in 2001. This report will refer to data collected in the 1993 and 2001 RECS.

110

A chinese cooking robot for elderly and disabled people  

Science Conference Proceedings (OSTI)

Cooking themselves is very important and difficult for elderly and disabled people in daily life. This paper presents a cooking robot for those people who are confined to wheelchairs. The robot can automatically load ingredients, cook Chinese dishes, ... Keywords: Barrier-free design, Chinese dishes, Cooking robot, Elderly and disabled people

Wen-tao Ma; Wei-xin Yan; Zhuang Fu; Yan-zheng Zhao

2011-10-01T23:59:59.000Z

111

Performance of Installed Cooking Exhaust Devices  

NLE Websites -- All DOE Office Websites (Extended Search)

Performance of Installed Cooking Exhaust Devices Performance of Installed Cooking Exhaust Devices Brett C. Singer, William W. Delp, Michael G. Apte, Philip N. Price Environmental Energy Technologies Division Lawrence Berkeley National Laboratory Berkeley, California, 94720 November 2011 Direct funding for this research was provided by the California Energy Commission through Contracts 500-05-026 and 500-08-061. Institutional support is provided to LBNL by the U.S. Department of Energy, Office of Science under Contract DE-AC02-05CH11231. LBNL-5265E-r1(3) Singer et al., Performance of Installed Cooking Exhaust Devices LBNL-5265E-r1(3) Performance of Installed Cooking Exhaust Devices Brett C. Singer 1

112

Cook County- LEED Requirements for County Buildings  

Energy.gov (U.S. Department of Energy (DOE))

In 2002, Cook County enacted an ordinance requiring all new county buildings and all retrofitted county buildings to be built to LEED standards. Specifically, all newly constructed buildings and...

113

Robert Cook, Environmental Data Science & Systems Staff  

NLE Websites -- All DOE Office Websites (Extended Search)

Environmental Toxicology and Chemistry 18: 581 - 588. Cook, R.B., J.D. Joslin, S.M. McLaughlin, C. Egar, J. Knoepp, and C. Trettin. 1998. Effects of Acid Deposition on Forests....

114

Tel. +49-541-969 2872/2890 -Fax. +49-541-969 1221/2262 -Email. Junge@uni-osnabrueck.de 1 Prof. Dr.-Ing. Wolfgang Junge Gutenbergstrae 36, 49076 Osnabrck  

E-Print Network (OSTI)

for Biophysics, Osnabrück 1992 95th Conference of the Deutsche Bunsengesellschaft für Physikalische Chemie, Jena Chemie Deutsche Gesellschaft für Biophysik Deutsche Gesellschaft für Naturforscher und ?rzte Gesellschaft for Biophysics Chair 1984-1985 Section "Membranes" of Gesellschaft für Biologische Chemie, Board Member 1987

Junge, Wolfgang

115

Advances in solar cooking: Proceedings of the first world conference on solar cooking  

SciTech Connect

Population growth and resource depletion have led to a need for new sources of cooking fuel in developing countries. Many poor villagers spend half of their time, or half of their income obtaining cooking fuel. Solar cooking can meet the needs of many of these people. People from eighteen countries met at this world conference to share experiences with design and performance of cookers, food, nutrition and health issues, and information dissemination strategies. A total of 27 individual papers were indexed separately for the data base.

Pejack, E. [ed.

1992-12-31T23:59:59.000Z

116

Don Cook Speaks at the 2011 LDRD Symposium | National Nuclear...  

National Nuclear Security Administration (NNSA)

Cook Speaks at the 2011 LDRD Symposium Dr. Cook opens up the 2011 LDRD Conference held in Washington, DC. From: NNSANews Views: 306 1 ratings Time: 11:34 More in Science &...

117

Pantex firefighters cook it up | National Nuclear Security Administrat...  

National Nuclear Security Administration (NNSA)

Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Pantex firefighters cook it up Pantex firefighters cook it up Posted By Office of Public...

118

Solar cooking : the development of a thermal battery  

E-Print Network (OSTI)

There are many rural area in the world where cooking fuel is very scarce. One solution to this problem is to use solar energy to cook food. However most people around the world like to cook large meals at night, when the ...

Cutting, Alexander Chatfield

2007-01-01T23:59:59.000Z

119

 

U.S. Energy Information Administration (EIA) Indexed Site

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings* Build- ings with Cooking Cooking Energy Sources (more than one may apply) All Build- ings* Build- ings with Cooking Cooking Energy Sources (more than one may apply) Elec- tricity Natural Gas Propane Elec- tricity Natural Gas Propane All Buildings* ............................... 4,645 801 410 457 108 64,783 22,237 13,161 15,438 1,460 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 2,552 354 170 183 63 6,789 997 493 549 165 5,001 to 10,000 .............................. 889 155 82 88 Q 6,585 1,136 621 641 Q 10,001 to 25,000 ............................ 738 127 59 75 Q 11,535 1,954 961 1,115 Q

120

Christine Anderson-Cook: An outstanding New Mexico woman  

NLE Websites -- All DOE Office Websites (Extended Search)

Christine Anderson-Cook: An outstanding New Mexico woman Christine Anderson-Cook: An outstanding New Mexico woman Christine Anderson-Cook: an outstanding New Mexico woman Cook recognized for her technical leadership in statistics, extensive professional service at the national level, and mentorship of nearly 70 students. April 14, 2011 Christine Anderson-Cook Christine Anderson-Cook Contact Fred deSousa Communicatons Office (505) 665-3430 Email LOS ALAMOS, New Mexico, April 14, 2011-The New Mexico Commission on the Status of Women selected Los Alamos National Laboratory research statistician Christine Anderson-Cook as one of 20 women to receive the 26th Annual Governor's Award for Outstanding New Mexico Women. An awards banquet is scheduled for May 6 at the Hotel Albuquerque in Albuquerque. "We are extremely proud of Christine's accomplishments, both as an

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Cook, Minnesota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cook, Minnesota: Energy Resources Cook, Minnesota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 47.8524181°, -92.6896184° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.8524181,"lon":-92.6896184,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

122

Cook Islands: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Cook Islands: Energy Resources Cook Islands: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-22.26876,"lon":-158.20312,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

123

Early Cook County Roads -- Part Two  

NLE Websites -- All DOE Office Websites (Extended Search)

Two Two Nature Bulletin No. 739 January 18, 1964 Forest Preserve District of Cook County Seymour Simon, President Roberts Mann, Conservation Editor EARLY COOK COUNTY ROADS -- PART TWO -- THE PLANK ROAD ERA For ten years after Chicago, with a population of 4,170, was chartered as a city in 1837, its commerce and growth were crippled by wretched transportation to and from the hinterlands. During many periods of each year it was surrounded and isolated by mud. To be sure, there were dirt thoroughfares in all directions, graded and drained as best they could in those days, but not surfaced. No one who has never experienced it can appreciate how gooey and gluey a black prairie soil can be when wet. A wagon's wheels often become solid cylinders of mud as wide as a bass drum.

124

New passive solar cooking system. Final report  

SciTech Connect

The development of a solar cooking system which uses a phase change process to passively transfer heat from a collector to a cooker is presented. In the design of this cooking system steam is produced in the collector and then is used as the heat transfer fluid in the cooker. The most efficient use of the system is to heat food directly by condensing the steam onto the food, whereas a heat exchanger is necessary to heat an oven or a frying pan. A pressure cooker was successfully built and tested using the steam from the collector. Brief discussions on the collector design and performance, and heat storage phase change materials are provided. (BCS)

Schlussler, L.

1981-11-01T23:59:59.000Z

125

Performance of Installed Cooking Exhaust Devices  

NLE Websites -- All DOE Office Websites (Extended Search)

Performance of Installed Cooking Exhaust Devices Performance of Installed Cooking Exhaust Devices Title Performance of Installed Cooking Exhaust Devices Publication Type Journal Article Refereed Designation Refereed LBNL Report Number LBNL-5265E Year of Publication 2012 Authors Singer, Brett C., William W. Delp, Michael G. Apte, and Phillip N. Price Journal Indoor Air Volume 22 Issue 3 Pagination 224-234 Date Published 06/2012 Keywords carbon monoxide, natural gas burners, nitrogen dioxide, range hood, task ventilation, unvented combustion, indoor environment group, Range Hood Test Facility Abstract The performance metrics of airflow, sound, and combustion product capture efficiency (CE) were measured for a convenience sample of fifteen cooking exhaust devices, as installed in residences. Results were analyzed to quantify the impact of various device- and installation-dependent parameters on CE. Measured maximum airflows were 70% or lower than values noted on product literature for 10 of the devices. Above-the-cooktop devices with flat bottom surfaces (no capture hood) - including exhaust fan/microwave combination appliances - were found to have much lower CE at similar flow rates, compared to devices with capture hoods. For almost all exhaust devices and especially for rear-mounted downdraft exhaust and microwaves, CE was substantially higher for back compared with front burner use. Flow rate, and the extent to which the exhaust device extends over the burners that are in use, also had a large effect on CE. A flow rate of 95 liters per second (200 cubic feet per minute) was necessary, but not sufficient, to attain capture efficiency in excess of 75% for the front burners. A-weighted sound levels in kitchens exceeded 57 dB when operating at the highest fan setting for all 14 devices evaluated for sound performance.

126

Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc 401k 401k D PP PT2 Dental Pre-Paid PT 2 Misc Miscellaneous Deductions ROTH ROTH 401(k)  

E-Print Network (OSTI)

FICA Additional Medicare Tax ORP ING1 ORP Retirement ING 10% TCRS NF TCRS Retirement Non-Faculty AFLACSIC Aflac - Sickness Indemnity Foundat Foundation ORP ING2 ORP Retirement ING Two Split TCRS TCB Closed Teacher Class B Contrib AFLCIEET Aflac - Critical ILL-EE-Tobacco Foundat ETSU Foundation ORP ING3

Karsai, Istvan

127

Cooking Appliance Use in California Homes - Data Collected from a  

NLE Websites -- All DOE Office Websites (Extended Search)

Cooking Appliance Use in California Homes - Data Collected from a Cooking Appliance Use in California Homes - Data Collected from a Web-Based Survey Title Cooking Appliance Use in California Homes - Data Collected from a Web-Based Survey Publication Type Report LBNL Report Number LBNL-5028E Year of Publication 2011 Authors Klug, Victoria L., Agnes B. Lobscheid, and Brett C. Singer Date Published August 2011 Publisher Lawrence Berkeley National Laboratory City Berkeley, CA Keywords Range Hood Test Facility Abstract Cooking of food and use of natural gas cooking burners generate pollutants that can have substantial impacts on residential indoor air quality. The extent of these impacts depends on cooking frequency, duration and specific food preparation activities in addition to the extent to which exhaust fans or other ventilation measures (e.g. windows) are used during cooking. With the intent of improving our understanding of indoor air quality impacts of cooking-related pollutants, we created, posted and advertised a web-based survey about cooking activities in residences. The survey included questions similar to those in California's Residential Appliance Saturation Survey (RASS), relating to home, household and cooking appliance characteristics and weekly patterns of meals cooked. Other questions targeted the following information not captured in the RASS: (1) oven vs. cooktop use, the number of cooktop burners used and the duration of burner use when cooking occurs, (2) specific cooking activities, (3) the use of range hood or window to increase ventilation during cooking, and (4) occupancy during cooking. Specific cooking activity questions were asked about the prior 24 hours with the assumption that most people are able to recollect activities over this time period. We examined inter-relationships among cooking activities and patterns and relationships of cooking activities to household demographics. We did not seek to obtain a sample of respondents that is demographically representative of the California population but rather to inexpensively gather information from homes spanning ranges of relevant characteristics including the number of residents and presence or absence of children. This report presents the survey, the responses obtained, and limited analysis of the results.

128

How Chula Vista, California Is Turning Cooking Oil Into Savings |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

How Chula Vista, California Is Turning Cooking Oil Into Savings How Chula Vista, California Is Turning Cooking Oil Into Savings How Chula Vista, California Is Turning Cooking Oil Into Savings January 19, 2011 - 1:21pm Addthis Truck 51 of the Chula Vista Fire Department. Truck 51 of the Chula Vista Fire Department. John Young What does this project do? Reuses cooking oil that is normally considered waste, saving taxpayer dollars. Reduces reliance on foreign oil Cuts emissions Anyone who has ever worked in a restaurant probably shudders at the mention of having to dispose of used cooking oil. While not much can be done to eliminate this unpleasant kitchen task, what's changing is how that oil can be recycled to help reduce our dependence on foreign sources of energy. Used cooking oil is a key (and very low cost) ingredient in the production

129

Dr. Donald L. Cook | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Donald L. Cook | National Nuclear Security Administration Donald L. Cook | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > About Us > Our Leadership > Dr. Donald L. Cook Dr. Donald L. Cook Deputy Administrator for Defense Programs Dr. Donald L. Cook Dr. Donald L. Cook serves as the Deputy Administrator for Defense Programs at the National Nuclear Security Administration. Appointed to the position

130

Dr. Donald L. Cook | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

and for Sandia's Safeguards and Security Technologies Program. From 1977-1999, Dr. Cook led efforts in pulsed power accelerator design and experimentation, fusion research,...

131

Alcoholic fermentation of sorghum without cooking  

Science Conference Proceedings (OSTI)

Sorgum was used as raw material for alcoholic fermentation without cooking. Two varieties of sorghum grown in Thailand, KU 439 and KU 257, contained 80.0 and 75.8% of total sugar. Optimum amount of sorghum for alcoholic fermentation should be between 30 and 35% (w/v) in the fermentation broth. In these conditions 13.0 and 12.6% (v/v) of alcohol could be obtained in 84 and 91.9% yield based on the theoretical value of the starch content from KU 439 and KU 257, respectively.

Thammarutwasik, P.; Koba, Y.; Ueda, S.

1986-07-01T23:59:59.000Z

132

Early Cook County Roads -- Part One  

NLE Websites -- All DOE Office Websites (Extended Search)

One One Nature Bulletin No. 738 January 11, 1964 Forest Preserve District of Cook County Seymour Simon, President Roberts Mann, Conservation Editor EARLY COOK COUNTY ROADS -- PARK ONE When Chicago was incorporated as a village in 1833 it was only a squalid hamlet of about 350 inhabitants and appeared to be so poorly situated that it was hopeless -- "crude cabins and flimsy shacks in a chaos of mud, rubbish and confusion. " Only a few feet above the level of Lake Michigan, the place was almost entirely surrounded by swamps and miles and miles of prairies that became nearly impassable after spring thaws and during periods of heavy rainfall. There were only two important routes that afforded access at all times. One was the Green Bay Trail, ancestor of North Clark St. in Chicago, Ridge Ave. in Evanston, and Green Bay Road north of that. The other, traveled by the soldiers coming from Detroit to build Fort Dearborn in 1803, used the Great Sauk Trail to La Porte, Indiana, then a trail northwesterly to what is now Michigan City, and the firm sands of the lake beach the rest of the way.

133

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Bhandare M. Sc. Abas Ahmad Fauzi Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann M. Sc. Selwan K. Ibrahim Dr.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl

Noé, Reinhold

134

Enabling nutrition-aware cooking in a smart kitchen  

Science Conference Proceedings (OSTI)

We present a smart kitchen that can enhance the traditional meal preparation and cooking process by raising awareness of the nutrition facts in food ingredients that go into a meal. The goal is to promote healthy cooking. Our smart kitchen is augmented ... Keywords: context-aware computing, home computing, interaction design, kitchen, nutrition, smart environments, ubiquitous computing

Pei-yu Chi; Jen-hao Chen; Hao-hua Chu; Bing-Yu Chen

2007-04-01T23:59:59.000Z

135

Community and Economic Development Association of Cook County (CEDA) | Open  

Open Energy Info (EERE)

Association of Cook County (CEDA) Association of Cook County (CEDA) Jump to: navigation, search Name Community and Economic Development Association of Cook County (CEDA) Place Chicago, IL Website http://www.cedaorg.net References CEDA Website[1] Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building Systems Integration LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Community and Economic Development Association of Cook County (CEDA) is a company located in Chicago, IL. References ↑ "CEDA Website" Retrieved from "http://en.openei.org/w/index.php?title=Community_and_Economic_Development_Association_of_Cook_County_(CEDA)&oldid=382336"

136

Proceedings of the TOUGH Symposium 2009  

E-Print Network (OSTI)

and oil recovery by waterflood- ing, SPE ReservoirY. and N.R. Morrow, Waterflood performance by injection ofof low-salinity waterflood- ing, the exact mechanisms

Moridis, George J.

2010-01-01T23:59:59.000Z

137

Investigation of Combustion Kinetic Cooking Oil Tar Samples with Thermogravimetric Analysis  

Science Conference Proceedings (OSTI)

The cooking fire not only brought huge economic losses and adverse social impact. The combustible material of fire in fog discharge pipe is the cooking oil tar. In order to solve the problem of fire in fog discharge pipe, it is necessary to research ... Keywords: combustion science, fog discharge pipe of cooking, cooking oil tar, combustion characteristics, reaction kinetics

Xie Zheng-wen; Su Kai-yu; Wu Chao

2011-01-01T23:59:59.000Z

138

Pantex firefighters cook it up | National Nuclear Security Administration  

NLE Websites -- All DOE Office Websites (Extended Search)

firefighters cook it up | National Nuclear Security Administration firefighters cook it up | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Pantex firefighters cook it up Pantex firefighters cook it up Posted By Office of Public Affairs B&W Pantex volunteers dish up barbecue at the recent Amarillo Chamber of Commerce Good Times Celebration and Barbecue Cookoff. For more than a

139

Don Cook talks about future of Pantex mission | National Nuclear...  

National Nuclear Security Administration (NNSA)

Follow this link to skip to the main content Facebook Flickr RSS Twitter YouTube Don Cook talks about future of Pantex mission | National Nuclear Security Administration Our...

140

Bio-Terre Cook Farm Anaerobic Digester Project  

Science Conference Proceedings (OSTI)

This report details the preliminary research and construction of a novel low temperature earthen cell for anaerobic digestion and biogas production facility at Cook Feeders Ltd., a 6,000 head swine finisher operation, located in central Manitoba, Canada.

2005-09-07T23:59:59.000Z

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Energy-Efficient Cooking for Winter | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cooking for Winter Cooking for Winter Energy-Efficient Cooking for Winter September 30, 2008 - 4:06pm Addthis Jen Carter What does this mean for me? Use your kitchen more efficiently when the seasons turn cold to help save energy and money at home. When I was growing up, the most poignant harbinger of winter wasn't the smell of fallen leaves or the slowly shortening days; it was the first time I came home from school to find a pot of my mother's homemade chicken soup simmering gently on the stove. That pot would be the first of many. As long as the thermometer outside the kitchen window hovered around freezing, my mother's weekly pot of soup remained a household staple. I've noticed much the same seasonal shift in my own kitchen. When summer's heat starts to make cooking oppressive, I turn off the oven and embrace the

142

List of Commercial Cooking Equipment Incentives | Open Energy Information  

Open Energy Info (EERE)

Cooking Equipment Incentives Cooking Equipment Incentives Jump to: navigation, search The following contains the list of 39 Commercial Cooking Equipment Incentives. CSV (rows 1 - 39) Incentive Incentive Type Place Applicable Sector Eligible Technologies Active AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) Utility Rebate Program Ohio Commercial Industrial Local Government Municipal Utility Nonprofit Schools State Government Central Air conditioners Chillers Comprehensive Measures/Whole Building Custom/Others pending approval Energy Mgmt. Systems/Building Controls Heat pumps Lighting Lighting Controls/Sensors Motor VFDs Motors Water Heaters Commercial Cooking Equipment Commercial Refrigeration Equipment Room Air Conditioners Yes Agricultural Energy Efficiency Program (New York) State Rebate Program New York Agricultural Agricultural Equipment

143

Performance Assessment of U.S. Residential Cooking Exhaust Hoods  

E-Print Network (OSTI)

curves relating airflow to duct static pressure, sound levels, and exhaust gas for centrifugal fan devices. Pollutant capture efficiency (CE) ranged from 98 gas cooking burners emit air pollutants1-3 at rates that can lead to indoor

144

Improved Biomass Cooking Stoves | Open Energy Information  

Open Energy Info (EERE)

Improved Biomass Cooking Stoves Improved Biomass Cooking Stoves Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Improved Biomass Cooking Stoves Agency/Company /Organization: various Sector: Energy Focus Area: Biomass Phase: Determine Baseline, Evaluate Options, Prepare a Plan, Create Early Successes Topics: Co-benefits assessment, - Energy Access Resource Type: Case studies/examples, Guide/manual, Presentation, Video User Interface: Website Website: ttp://www.bioenergylists.org/ Cost: Free Language: "English, Spanish; Castilian" is not in the list of possible values (Abkhazian, Achinese, Acoli, Adangme, Adyghe; Adygei, Afar, Afrihili, Afrikaans, Afro-Asiatic languages, Ainu, Akan, Akkadian, Albanian, Aleut, Algonquian languages, Altaic languages, Amharic, Angika, Apache languages, Arabic, Aragonese, Arapaho, Arawak, Armenian, Aromanian; Arumanian; Macedo-Romanian, Artificial languages, Assamese, Asturian; Bable; Leonese; Asturleonese, Athapascan languages, Australian languages, Austronesian languages, Avaric, Avestan, Awadhi, Aymara, Azerbaijani, Balinese, Baltic languages, Baluchi, Bambara, Bamileke languages, Banda languages, Bantu (Other), Basa, Bashkir, Basque, Batak languages, Beja; Bedawiyet, Belarusian, Bemba, Bengali, Berber languages, Bhojpuri, Bihari languages, Bikol, Bini; Edo, Bislama, Blin; Bilin, Blissymbols; Blissymbolics; Bliss, Bosnian, Braj, Breton, Buginese, Bulgarian, Buriat, Burmese, Caddo, Catalan; Valencian, Caucasian languages, Cebuano, Celtic languages, Central American Indian languages, Central Khmer, Chagatai, Chamic languages, Chamorro, Chechen, Cherokee, Cheyenne, Chibcha, Chichewa; Chewa; Nyanja, Chinese, Chinook jargon, Chipewyan; Dene Suline, Choctaw, Chuukese, Chuvash, Classical Newari; Old Newari; Classical Nepal Bhasa, Classical Syriac, Coptic, Cornish, Corsican, Cree, Creek, Creoles and pidgins , Crimean Tatar; Crimean Turkish, Croatian, Cushitic languages, Czech, Dakota, Danish, Dargwa, Delaware, Dinka, Divehi; Dhivehi; Maldivian, Dogri, Dogrib, Dravidian languages, Duala, Dutch; Flemish, Dyula, Dzongkha, Eastern Frisian, Efik, Egyptian (Ancient), Ekajuk, Elamite, English, Erzya, Esperanto, Estonian, Ewe, Ewondo, Fang, Fanti, Faroese, Fijian, Filipino; Pilipino, Finnish, Finno-Ugrian languages, Fon, French, Friulian, Fulah, Ga, Gaelic; Scottish Gaelic, Galibi Carib, Galician, Ganda, Gayo, Gbaya, Geez, Georgian, German, Germanic languages, Gilbertese, Gondi, Gorontalo, Gothic, Grebo, Greek, Modern, Guarani, Gujarati, Gwich'in, Haida, Haitian; Haitian Creole, Hausa, Hawaiian, Hebrew, Herero, Hiligaynon, Himachali languages; Western Pahari languages, Hindi, Hiri Motu, Hittite, Hmong; Mong, Hungarian, Hupa, Iban, Icelandic, Ido, Igbo, Ijo languages, Iloko, Inari Sami, Indic languages, Indo-European languages, Indonesian, Ingush, Interlingue; Occidental, Inuktitut, Inupiaq, Iranian languages, Irish, Iroquoian languages, Italian, Japanese, Javanese, Judeo-Arabic, Judeo-Persian, Kabardian, Kabyle, Kachin; Jingpho, Kalaallisut; Greenlandic, Kalmyk; Oirat, Kamba, Kannada, Kanuri, Kara-Kalpak, Karachay-Balkar, Karelian, Karen languages, Kashmiri, Kashubian, Kawi, Kazakh, Khasi, Khoisan languages, Khotanese; Sakan, Kikuyu; Gikuyu, Kimbundu, Kinyarwanda, Kirghiz; Kyrgyz, Klingon; tlhIngan-Hol, Komi, Kongo, Konkani, Korean, Kosraean, Kpelle, Kru languages, Kuanyama; Kwanyama, Kumyk, Kurdish, Kurukh, Kutenai, Ladino, Lahnda, Lamba, Land Dayak languages, Lao, Latin, Latvian, Lezghian, Limburgan; Limburger; Limburgish, Lingala, Lithuanian, Lojban, Lower Sorbian, Lozi, Luba-Katanga, Luba-Lulua, Luiseno, Lule Sami, Lunda, Luo (Kenya and Tanzania), Lushai, Luxembourgish; Letzeburgesch, Macedonian, Madurese, Magahi, Maithili, Makasar, Malagasy, Malay, Malayalam, Maltese, Manchu, Mandar, Mandingo, Manipuri, Manobo languages, Manx, Maori, Mapudungun; Mapuche, Marathi, Mari, Marshallese, Marwari, Masai, Mayan languages, Mende, Mi'kmaq; Micmac, Minangkabau, Mirandese, Mohawk, Moksha, Mon-Khmer languages, Mongo, Mongolian, Mossi, Multiple languages, Munda languages, N'Ko, Nahuatl languages, Nauru, Navajo; Navaho, Ndebele, North; North Ndebele, Ndebele, South; South Ndebele, Ndonga, Neapolitan, Nepal Bhasa; Newari, Nepali, Nias, Niger-Kordofanian languages, Nilo-Saharan languages, Niuean, North American Indian languages, Northern Frisian, Northern Sami, Norwegian, Nubian languages, Nyamwezi, Nyankole, Nyoro, Nzima, Occitan (post 1500); Provençal, Ojibwa, Oriya, Oromo, Osage, Ossetian; Ossetic, Otomian languages, Pahlavi, Palauan, Pali, Pampanga; Kapampangan, Pangasinan, Panjabi; Punjabi, Papiamento, Papuan languages, Pedi; Sepedi; Northern Sotho, Persian, Philippine languages, Phoenician, Pohnpeian, Polish, Portuguese, Prakrit languages, Pushto; Pashto, Quechua, Rajasthani, Rapanui, Rarotongan; Cook Islands Maori, Romance languages, Romanian; Moldavian; Moldovan, Romansh, Romany, Rundi, Russian, Salishan languages, Samaritan Aramaic, Sami languages, Samoan, Sandawe, Sango, Sanskrit, Santali, Sardinian, Sasak, Scots, Selkup, Semitic languages, Serbian, Serer, Shan, Shona, Sichuan Yi; Nuosu, Sicilian, Sidamo, Sign Languages, Siksika, Sindhi, Sinhala; Sinhalese, Sino-Tibetan languages, Siouan languages, Skolt Sami, Slave (Athapascan), Slavic languages, Slovak, Slovenian, Sogdian, Somali, Songhai languages, Soninke, Sorbian languages, Sotho, Southern, South American Indian (Other), Southern Altai, Southern Sami, Spanish; Castilian, Sranan Tongo, Sukuma, Sumerian, Sundanese, Susu, Swahili, Swati, Swedish, Swiss German; Alemannic; Alsatian, Syriac, Tagalog, Tahitian, Tai languages, Tajik, Tamashek, Tamil, Tatar, Telugu, Tereno, Tetum, Thai, Tibetan, Tigre, Tigrinya, Timne, Tiv, Tlingit, Tok Pisin, Tokelau, Tonga (Nyasa), Tonga (Tonga Islands), Tsimshian, Tsonga, Tswana, Tumbuka, Tupi languages, Turkish, Turkmen, Tuvalu, Tuvinian, Twi, Udmurt, Ugaritic, Uighur; Uyghur, Ukrainian, Umbundu, Uncoded languages, Undetermined, Upper Sorbian, Urdu, Uzbek, Vai, Venda, Vietnamese, Volapük, Votic, Wakashan languages, Walamo, Walloon, Waray, Washo, Welsh, Western Frisian, Wolof, Xhosa, Yakut, Yao, Yapese, Yiddish, Yoruba, Yupik languages, Zande languages, Zapotec, Zaza; Dimili; Dimli; Kirdki; Kirmanjki; Zazaki, Zenaga, Zhuang; Chuang, Zulu, Zuni) for this property.

145

Performance of Installed Cooking Exhaust Devices  

Science Conference Proceedings (OSTI)

The performance metrics of airflow, sound, and combustion product capture efficiency (CE) were measured for a convenience sample of fifteen cooking exhaust devices, as installed in residences. Results were analyzed to quantify the impact of various device- and installation-dependent parameters on CE. Measured maximum airflows were 70% or lower than values noted on product literature for 10 of the devices. Above-the-cooktop devices with flat bottom surfaces (no capture hood) including exhaust fan/microwave combination appliances were found to have much lower CE at similar flow rates, compared to devices with capture hoods. For almost all exhaust devices and especially for rear-mounted downdraft exhaust and microwaves, CE was substantially higher for back compared with front burner use. Flow rate, and the extent to which the exhaust device extends over the burners that are in use, also had a large effect on CE. A flow rate of 95 liters per second (200 cubic feet per minute) was necessary, but not sufficient, to attain capture efficiency in excess of 75% for the front burners. A-weighted sound levels in kitchens exceeded 57 dB when operating at the highest fan setting for all 14 devices evaluated for sound performance.

Singer, Brett C.; Delp, William W.; Apte, Michael G.; Price, Philip N.

2011-11-01T23:59:59.000Z

146

Don Cook discusses NNSA's Defense Programs at Woodrow Wilson Center |  

National Nuclear Security Administration (NNSA)

discusses NNSA's Defense Programs at Woodrow Wilson Center | discusses NNSA's Defense Programs at Woodrow Wilson Center | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Don Cook discusses NNSA's Defense Programs at ... Don Cook discusses NNSA's Defense Programs at Woodrow Wilson Center Posted By Office of Public Affairs Cook at WW

147

Ameren Illinois (Gas) - Cooking and Heating Business Efficiency Incentives  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ameren Illinois (Gas) - Cooking and Heating Business Efficiency Ameren Illinois (Gas) - Cooking and Heating Business Efficiency Incentives Ameren Illinois (Gas) - Cooking and Heating Business Efficiency Incentives < Back Eligibility Commercial Industrial Multi-Family Residential Nonprofit Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Construction Commercial Weatherization Design & Remodeling Other Appliances & Electronics Water Heating Maximum Rebate General: $600,000 Program Info Expiration Date 05/31/2013 State Illinois Program Type Utility Rebate Program Rebate Amount Custom: $1.20/therm saved/yr Steamers: $300-$1200 Fryer: $400 Griddle: $50/ln. ft. Ovens: custom Storage Water Heaters: $150/unit Tankless Water Heater: $300/unit Gas Boiler/Furnace Replacement: $400 - $6,000

148

Respiratory symptoms in Indian women using domestic cooking fuels  

SciTech Connect

The effect of domestic cooking fuels producing various respiratory symptoms was studied in 3,701 women. Of these, 3,608 were nonsmoking women who used four different types of cooking fuels: biomass, LPG, kerosene, and mixed fuels. The overall respiratory symptoms were observed in 13 percent of patients. Mixed fuel users experienced more respiratory symptoms (16.7 percent), followed by biomass (12.6 percent), stove (11.4 percent), and LPG (9.9 percent). Chronic bronchitis in chulla users was significantly higher than that in kerosene and LPG users (p less than 0.05). Dyspnea and postnasal drip were significantly higher in the women using mixed fuels. Smoking women who are also exposed to cooking fuels experienced respiratory symptoms more often than nonsmokers (33.3 percent vs 13 percent).

Behera, D.; Jindal, S.K. (Postgraduate Institute of Medical Education and Research, Chandigarh (India))

1991-08-01T23:59:59.000Z

149

Economic Contributions of the California Nursery Industry  

E-Print Network (OSTI)

energy and input costs, government regulation, chang- ing market structure, competition, information,

Carman, Hoy; Rodriguez, Ana Maria

2004-01-01T23:59:59.000Z

150

Chemical Education Today JChemEd.chem.wisc.edu Vol. 75 No. 5 May 1998 Journal of Chemical Education 537  

E-Print Network (OSTI)

esoteric than necessary. Chemistry is certainly a complicated subject, but shroud- ing it in esoteric

Rioux, Frank

151

Techniques for Maximizing Efficiency of Solar Energy Harvesting Systems (Invited Paper)  

E-Print Network (OSTI)

power point tracking, energy harvest- ing, solar panel, photovoltaic cell, supercapacitor, ultracapac

Shinozuka, Masanobu

152

Short-Term Energy Outlook - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

153

Arizona - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

154

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Wissenschaftliche Mitarbeiter und Stipen- diaten Dr. Olaf Adamczyk Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dr.-Ing. Sebastian Hoffmann Dipl.-Ing. Benjamin Koch Dr. rer. nat. Manfred Lichtinger Dr.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo

Noé, Reinhold

155

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

/2009 ­ 02/2010) Prof. Dr.-Ing. Reinhold Noé Personal Wissenschaftliche Mitarbeiter und Stipendiaten Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath Dr.-Ing. Timo Pfau Stip. M. EE. Kidsanapong Puntsri Dr.-Ing. David Sandel Dr.-Ing. Stephan Schulz Technische

Noé, Reinhold

156

News Briefs  

Science Conference Proceedings (OSTI)

... ing and cleanup, decontamination and decommissioning efforts, testing for ... the commercial radioactivity laboratories, nuclear power radiochemistry ...

1997-11-25T23:59:59.000Z

157

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

158

RADIATION RESEARCH 153, 220238 (2000) 0033-7587/00 $5.00  

E-Print Network (OSTI)

): the light water reactor [(LWR) in both pressurized and boil- ing versions]; heavy water (CANDU) reactor

159

DOI: 10.1126/science.1184167 , 76 (2010);328Science  

E-Print Network (OSTI)

, includ- ing nanolubricants and components in micro- and nanoeletromechanical systems devices. References

Kim, Philip

160

About EIA - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Uranium fuel, nuclear reactors, ... Environment. Greenhouse gas data, voluntary report- ing, ... Office of Personnel Management;

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

162

Event-Places in North America: City Meaning and Making [Research and Debate  

E-Print Network (OSTI)

events in the cityscape triggers both memories and anticipation, bridg- ing the gap between performances.

Frenchman, Dennis

2004-01-01T23:59:59.000Z

163

United States - Search - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

164

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

165

Microsoft PowerPoint - 16.1225_Terry Cooke-Davies - Project Complexity...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

225Terry Cooke-Davies - Project Complexity as of 16 Mar Microsoft PowerPoint - 16.1225Terry Cooke-Davies - Project Complexity as of 16 Mar Microsoft PowerPoint - 16.1225Terry...

166

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 1,043 49 141 128 26 393 7 112 20 46 122 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 115 6 13 5 3 28 2 40 2 3 11 5,001 to 10,000 ....................... 86 5 11 5 2 28 1 17 2 3 11 10,001 to 25,000 ..................... 142 8 16 15 4 54 1 17 3 6 19 25,001 to 50,000 ..................... 116 5 18 16 3 41 (*) 11 2 5 14 50,001 to 100,000 ................... 153 8 22 23 4 59 1 10 2 6 17

167

 

Gasoline and Diesel Fuel Update (EIA)

E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 3,559 167 481 436 88 1,340 24 381 69 156 418 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 392 19 44 18 11 96 7 138 8 12 39 5,001 to 10,000 ....................... 293 18 38 18 8 95 4 57 6 10 39 10,001 to 25,000 ..................... 485 26 55 52 14 184 3 57 10 20 63 25,001 to 50,000 ..................... 397 18 62 55 12 140 2 37 7 17 48 50,001 to 100,000 ................... 523 28 77 78 15 202 3 35 7 20 59

168

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 890 34 116 113 15 335 6 104 19 43 105 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 113 5 13 5 3 27 2 40 2 3 11 5,001 to 10,000 ....................... 77 4 10 5 2 24 1 16 2 3 10 10,001 to 25,000 ..................... 119 6 14 13 2 44 1 15 3 6 16 25,001 to 50,000 ..................... 103 4 16 15 3 35 (*) 10 2 5 12 50,001 to 100,000 ................... 119 5 17 19 2 46 1 9 2 5 13

169

 

Gasoline and Diesel Fuel Update (EIA)

. Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 5,820 2,203 431 384 448 1,143 167 354 64 148 478 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 672 207 45 18 48 93 48 137 8 12 55 5,001 to 10,000 ....................... 516 198 36 17 40 83 35 56 6 9 39 10,001 to 25,000 ..................... 776 324 47 44 43 151 25 53 9 19 62 25,001 to 50,000 ..................... 673 262 57 50 55 121 13 34 7 16 58 50,001 to 100,000 ................... 759 293 59 65 55 158 11 29 6 18 64

170

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................... 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 .......................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ........................ 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ........................ 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ...................... 405 16 57 65 7 158 2 29 6 18 45 100,001 to 200,000 .................... 483 16 62 80 5 195 1 24 Q 31 56 200,001 to 500,000 .................... 361 8 51 54 5 162 1 9 8 19 43 Over 500,000 ............................. 383 8 47 56 3 181 2 12 8 23 43 Principal Building Activity

171

 

Gasoline and Diesel Fuel Update (EIA)

A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 6,523 2,365 516 436 501 1,340 190 381 69 156 569 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 685 213 46 18 49 96 49 138 8 12 56 5,001 to 10,000 ....................... 563 212 39 18 43 95 37 57 6 10 46 10,001 to 25,000 ..................... 899 357 57 52 51 184 29 57 10 20 83 25,001 to 50,000 ..................... 742 281 63 55 60 140 16 37 7 17 66 50,001 to 100,000 ................... 913 325 79 78 67 202 17 35 7 20 83

172

Modeling Population Exposures to Pollutants Emitted from Natural Gas Cooking Burners  

E-Print Network (OSTI)

and policy implications of gas cooking appliance emissions resulting from a transition from baseline NG to liquefied natural

Lobscheid, Agnes

2012-01-01T23:59:59.000Z

173

Methods for differentiating recycled cooking oil needed in China  

Science Conference Proceedings (OSTI)

Researchers from the West China School of Public Health at Sichuan University in Chengdu, China, explain why the reuse of recycled cooking oil, or gutter oil, is such a difficult problem for government and public health officials to address. Methods for

174

COOKING APPLIANCE USE IN CALIFORNIA HOMES DATA COLLECTED FROM A WEB-BASED SURVEY  

SciTech Connect

Cooking of food and use of natural gas cooking burners generate pollutants that can have substantial impacts on residential indoor air quality. The extent of these impacts depends on cooking frequency, duration and specific food preparation activities in addition to the extent to which exhaust fans or other ventilation measures (e.g. windows) are used during cooking. With the intent of improving our understanding of indoor air quality impacts of cooking-related pollutants, we created, posted and advertised a web-based survey about cooking activities in residences. The survey included questions similar to those in California's Residential Appliance Saturation Survey (RASS), relating to home, household and cooking appliance characteristics and weekly patterns of meals cooked. Other questions targeted the following information not captured in the RASS: (1) oven vs. cooktop use, the number of cooktop burners used and the duration of burner use when cooking occurs, (2) specific cooking activities, (3) the use of range hood or window to increase ventilation during cooking, and (4) occupancy during cooking. Specific cooking activity questions were asked about the prior 24 hours with the assumption that most people are able to recollect activities over this time period. We examined inter-relationships among cooking activities and patterns and relationships of cooking activities to household demographics. We did not seek to obtain a sample of respondents that is demographically representative of the California population but rather to inexpensively gather information from homes spanning ranges of relevant characteristics including the number of residents and presence or absence of children. This report presents the survey, the responses obtained, and limited analysis of the results.

Klug, Victoria; Lobscheid, Agnes; Singer, Brett

2011-08-01T23:59:59.000Z

175

February 9, 2004, Board Public Meeting Presentations - Beverly A. Cook  

NLE Websites -- All DOE Office Websites (Extended Search)

Beverly Cook, Assistant Secretary Beverly Cook, Assistant Secretary Environment, Safety and Health U.S. Department of Energy Before the Defense Nuclear Facilities Safety Board February 9,2004 Thank you, Mr. Chairman, and members of the Board, for this opportunity to address you today. You have invited me to speak on the roles and responsibilities of the Office of Environment, Safety and Health in the oversight process. In keeping with some of the questions you have sent to me, I would like to expand my remarks somewhat to the role of EH in assuring safety of the operations of the Department of Energy. I will speak to both my role personally, and that of my organization. I will also address efforts underway to improve DOES performance, and where I continue to be concerned. I would like to start with some of my overall assumptions. I absolutely believe that our

176

MHK Projects/Cook Inlet Tidal Energy | Open Energy Information  

Open Energy Info (EERE)

Cook Inlet Tidal Energy Cook Inlet Tidal Energy < MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":60.6893,"lon":-151.437,"alt":0,"address":"","icon":"http:\/\/prod-http-80-800498448.us-east-1.elb.amazonaws.com\/w\/images\/7\/74\/Aquamarine-marker.png","group":"","inlineLabel":"","visitedicon":""}]}

177

McCook Public Power District | Open Energy Information  

Open Energy Info (EERE)

McCook Public Power District McCook Public Power District Place Nebraska Utility Id 10550 Utility Location Yes Ownership P NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting HPS Non-Metered Lighting Area Lighting HPS Residential/Non-Domestic Metered Lighting Area Lighting HPS Residential/Non-Domestic Unmetered Lighting Area Lighting HPS Street Lighting Lighting Commercial Oil Commercial Commercial Oil, Load Management Rates Commercial Idel Fee 1 Phase Commercial Idel Fee 3 Phase 150-250 HP Commercial

178

Preliminary evaluation of wind energy potential: Cook Inlet area, Alaska  

DOE Green Energy (OSTI)

This report summarizes work on a project performed under contract to the Alaska Power Administration (APA). The objective of this research was to make a preliminary assessment of the wind energy potential for interconnection with the Cook Inlet area electric power transmission and distribution systems, to identify the most likely candidate regions (25 to 100 square miles each) for energy potential, and to recommend a monitoring program sufficient to quantify the potential.

Hiester, T.R.

1980-06-01T23:59:59.000Z

179

Performance Assessment of U.S. Residential Cooking Exhaust Hoods  

NLE Websites -- All DOE Office Websites (Extended Search)

Performance Assessment of U.S. Residential Cooking Exhaust Hoods Performance Assessment of U.S. Residential Cooking Exhaust Hoods Title Performance Assessment of U.S. Residential Cooking Exhaust Hoods Publication Type Journal Article LBNL Report Number LBNL-5545E Year of Publication 2012 Authors Delp, William W., and Brett C. Singer Journal Environmental Science & Technology Volume 46 Issue 11 Pagination 6167-6173 Date Published 05/08/2012 Keywords Range Hood Test Facility Abstract This study assessed the performance of seven new residential cooking exhaust hoods representing common U.S. designs. Laboratory tests were conducted to determine fan curves relating airflow to duct static pressure, sound levels, and exhaust gas capture efficiency for front and back cooktop burners and the oven. Airflow rate sensitivity to duct flow resistance was higher for axial fan devices than for centrifugal fan devices. Pollutant capture efficiency (CE) ranged from 98%, varying across hoods and with airflow and burner position for each hood. CE was higher for back burners relative to front burners, presumably because most hoods covered only part of the front burners. Open hoods had higher CE than those with grease screen and metal-covered bottoms. The device with the highest CE-exceeding 80% for oven and front burners-had a large, open hood that covered most of the front burners. The airflow rate for this hood surpassed the industry-recommended level of 118 L·s-1 (250 cfm) and produced sound levels too high for normal conversation. For hoods meeting the sound and fan efficacy criteria for Energy Star, CE was <30% for front and oven burners.

180

Effects of cooking on sweet sorghum juice fermentation  

Science Conference Proceedings (OSTI)

Full scale ethanol plant and laboratory fermentation on sweet sorghum juice show not cooking prior to fermentation results in poor sugar to alcohol conversion. Sugar conversion was much higher when heating for microbial control to 60 degrees C and 85 degrees C with no significant difference between the two. Changes in sugar content of the juice through the season had no effect on fermentation efficiency.

Rein, B.; Ogden, R.; Walker, C.

1982-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Effects of cooking on sweet sorghum juice fermentation  

Science Conference Proceedings (OSTI)

Full scale ethanol plant and laboratory fermentation on sweet sorghum juice show not cooking prior to fermentation results in poor sugar to alcohol conversion. Sugar conversion was much higher when heating for microbial control to 60/sup 0/C and 85/sup 0/C with no significant difference between the two. Changes in sugar content of the juice through the season had no effect on fermentation efficiency.

Rein, B.; Ogden, R.; Walker, C.

1982-12-01T23:59:59.000Z

182

Experimental Evaluation of Installed Cooking Exhaust Fan Performance  

NLE Websites -- All DOE Office Websites (Extended Search)

Experimental Evaluation of Installed Cooking Exhaust Fan Performance Experimental Evaluation of Installed Cooking Exhaust Fan Performance Title Experimental Evaluation of Installed Cooking Exhaust Fan Performance Publication Type Report LBNL Report Number LBNL-4183E Year of Publication 2010 Authors Singer, Brett C., William W. Delp, and Michael G. Apte Publisher Lawrence Berkeley National Laboratory City Berkeley Keywords airflow & pollutant transport group, cooktop, energy analysis and environmental impacts department, gas burners, indoor air quality, indoor environment department, kitchen, nitrogen dioxide, oven, pollutant emissions, range hood, residential, source control, task ventilation, technology, sustainability and impact assessment group Abstract The installed performance of cooking exhaust fans was evaluated through residential field experiments conducted on a sample of 15 devices varying in design and other characteristics. The sample included two rear downdraft systems, two under-cabinet microwave over range (MOR) units, three different installations of an under-cabinet model with grease screens across the bottom and no capture hood, two devices with grease screens covering the bottom of a large capture hood (one under-cabinet, one wall-mount chimney), four under-cabinet open hoods, and two open hoods with chimney mounts over islands. Performance assessment included measurement of airflow and sound levels across fan settings and experiments to quantify the contemporaneous capture efficiency for the exhaust generated by natural gas cooking burners. Capture efficiency is defined as the fraction of generated pollutants that are removed through the exhaust and thus not available for inhalation of household occupants. Capture efficiency (CE) was assessed for various configurations of burner use (e.g. single front, single back, combination of one front and one back, oven) and fan speed setting. Measured airflow rates were substantially lower than the levels noted in product literature for many of the units. This shortfall was observed for several units costing in excess of $1000. Capture efficiency varied widely (from <5% to roughly 100%) across devices and across conditions for some devices. As expected, higher capture efficiencies were achieved with higher fan settings and the associated higher air flow rates. In most cases, capture efficiencies were substantially higher for rear burners than for front burners. The best and most consistent performance was observed for open hoods that covered all cooktop burners and operated at higher airflow rates. The lowest capture efficiencies were measured when a front burner was used with a rear backdraft system or with lowest fan setting for above the range systems that do not cover the front burners.

183

 

Gasoline and Diesel Fuel Update (EIA)

0. Fuel Oil Consumption (gallons) and Energy Intensities by End Use for 0. Fuel Oil Consumption (gallons) and Energy Intensities by End Use for Non-Mall Buildings, 2003 Total Fuel Oil Consumption (million gallons) Fuel Oil Energy Intensity (gallons/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ........................ 1,602 1,397 125 Q 69 0.11 0.09 0.01 Q (*) Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 249 228 Q (*) Q 0.41 0.38 Q (*) Q 5,001 to 10,000 ....................... 261 237 Q 1 Q 0.37 0.33 Q (*) Q 10,001 to 25,000 ..................... 196 177 10 (*) Q 0.20 0.18 0.01 (*) Q 25,001 to 50,000 ..................... 117 112 Q (*) 4 0.14 0.14 Q (*) (*)

184

Table B27. Cooking Energy Sources, Number of Buildings and Floorspace...  

U.S. Energy Information Administration (EIA) Indexed Site

7. Cooking Energy Sources, Number of Buildings and Floorspace, 1999" ,"Number of Buildings (thousand)",,,,,"Total Floorspace (million square feet)" ,"All Buildings","All Buildings...

185

A Seismic Attribute Study to Assess Well Productivity in the Ninilchik Field, Cook Inlet Basin, Alaska.  

E-Print Network (OSTI)

??Coal bed methane which has formed in the Tertiary Kenai Group strata has been produced from the Ninilchik field of Cook Inlet, Alaska since 2001. (more)

Sampson, Andrew

2011-01-01T23:59:59.000Z

186

A modified concentrating type solar oven for outdoor cooking  

Science Conference Proceedings (OSTI)

Solar cookers offer a partial solution to many problems for the poor developing areas of the world. In these regions energy used for cooking sometimes comprises four fifths of the total energy demand. Solar cookers are generally four catagories: direct focusing, oven, ovenfocusing and indirect types. The direct focusing types failed to boil water under windy conditions due to excessive convection losses from the bare cooking pot placed at the concentrator focus. The oven type cookers, such as Telkes oven, observe the rules of energy conservation and thus are more efficient and less affected by windy weather. However, this oven suffers from two major problems. First, tilting the oven could cause food spillage unless a hinged support is used for the pot. This adds complication to the design of Telkes oven. Second, the solar radiation is added to the pot from the top for high solar altitude angles. This leads to poor heat transfer to the food inside the pot. The advantages of concentrating and oven cookers can be obtained by widding of a point focus concentrator to a new oven type receiver. In this paper the concept and design details of such an oven are introduced. Theoretical and experimental analyses of the developed cooker are given.

Khalifa, A.M.A.

1983-12-01T23:59:59.000Z

187

Structure of a Low-Level Jet over Lower Cook Inlet, Alaska  

Science Conference Proceedings (OSTI)

During February 1982 a NOAA research aircraft investigated a cold, low-level jet blowing from a gap between mountain ranges on line west side of Cook Inlet, Alaska. The jet blew 200 km southeastward across Cook Inlet between the Kenai Peninsula ...

S. Allen Macklin; Nicholas A. Bond; Jeffrey P. Walker

1990-12-01T23:59:59.000Z

188

How Do You Save Energy and Stay Cool While Cooking in the Summer? |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

and Stay Cool While Cooking in the Summer? and Stay Cool While Cooking in the Summer? How Do You Save Energy and Stay Cool While Cooking in the Summer? August 19, 2010 - 7:30am Addthis On Monday, Andrea discussed some ways you can keep cooking during the summer while saving energy and staying cool. How do you save energy and stay cool while cooking in the summer? Each Thursday, you have the chance to share your thoughts on a question about energy efficiency or renewable energy for consumers. Please comment with your answers, and also feel free to respond to other comments. E-mail your responses to the Energy Saver team at consumer.webmaster@nrel.gov. Addthis Related Articles How Do You Save Energy in the Summer? How Do You Save Energy When Entertaining in the Summer? At What Temperature Do You Set Your Thermostat in the Summer

189

Experimental Evaluation of Installed Cooking Exhaust Fan Performance  

SciTech Connect

The installed performance of cooking exhaust fans was evaluated through residential field experiments conducted on a sample of 15 devices varying in design and other characteristics. The sample included two rear downdraft systems, two under-cabinet microwave over range (MOR) units, three different installations of an under-cabinet model with grease screens across the bottom and no capture hood, two devices with grease screens covering the bottom of a large capture hood (one under-cabinet, one wall-mount chimney), four under-cabinet open hoods, and two open hoods with chimney mounts over islands. Performance assessment included measurement of airflow and sound levels across fan settings and experiments to quantify the contemporaneous capture efficiency for the exhaust generated by natural gas cooking burners.Capture efficiency is defined as the fraction of generated pollutants that are removed through the exhaust and thus not available for inhalation of household occupants. Capture efficiency (CE) was assessed for various configurations of burner use (e.g., single front, single back, combination of one front and one back, oven) and fan speed setting. Measured airflow rates were substantially lower than the levels noted in product literature for many of the units. This shortfall was observed for several units costing in excess of $1000. Capture efficiency varied widely (from<5percent to roughly 100percent) across devices and across conditions for some devices. As expected, higher capture efficiencies were achieved with higher fan settings and the associated higher air flow rates. In most cases, capture efficiencies were substantially higher for rear burners than for front burners. The best and most consistent performance was observed for open hoods that covered all cooktop burners and operated at higher airflow rates. The lowest capture efficiencies were measured when a front burner was used with a rear backdraft system or with lowest fan setting for above the range systems that do not cover the front burners.

Singer, Brett C.; Delp, William W.; Apte, Michael G.

2010-11-01T23:59:59.000Z

190

Experimental Evaluation of Installed Cooking Exhaust Fan Performance  

Science Conference Proceedings (OSTI)

The installed performance of cooking exhaust fans was evaluated through residential field experiments conducted on a sample of 15 devices varying in design and other characteristics. The sample included two rear downdraft systems, two under-cabinet microwave over range (MOR) units, three different installations of an under-cabinet model with grease screens across the bottom and no capture hood, two devices with grease screens covering the bottom of a large capture hood (one under-cabinet, one wall-mount chimney), four under-cabinet open hoods, and two open hoods with chimney mounts over islands. Performance assessment included measurement of airflow and sound levels across fan settings and experiments to quantify the contemporaneous capture efficiency for the exhaust generated by natural gas cooking burners.Capture efficiency is defined as the fraction of generated pollutants that are removed through the exhaust and thus not available for inhalation of household occupants. Capture efficiency (CE) was assessed for various configurations of burner use (e.g., single front, single back, combination of one front and one back, oven) and fan speed setting. Measured airflow rates were substantially lower than the levels noted in product literature for many of the units. This shortfall was observed for several units costing in excess of $1000. Capture efficiency varied widely (fromfan settings and the associated higher air flow rates. In most cases, capture efficiencies were substantially higher for rear burners than for front burners. The best and most consistent performance was observed for open hoods that covered all cooktop burners and operated at higher airflow rates. The lowest capture efficiencies were measured when a front burner was used with a rear backdraft system or with lowest fan setting for above the range systems that do not cover the front burners.

Singer, Brett C.; Delp, William W.; Apte, Michael G.

2010-11-01T23:59:59.000Z

191

AERIAL SURVEYS OF BELUGA IN COOK INLET, ALASKA,  

E-Print Network (OSTI)

The National Marine Fisheries Service (NMFS) conducted an aerial survey of the beluga population in Cook Inlet, Alaska, during 4-11 June 2002. The 45 hr survey was flown in a twin-engine, high-wing aircraft at an altitude of 244 m (800 ft) and speed of 185 km/hr (100 kt), consistent with NMFS surveys conducted each year since 1993. The flights in June 2002 included one or more surveys of coastal areas (flown 1.4 km offshore) around the entire Inlet and 1,234 km of transects across the Inlet, effectively searching more than 26 % of Cook Inlet but nearly 100 % of the coastal areas. Paired, independent observers searched on the coastal (left) side of the plane, where virtually all beluga sightings occur, while a single observer was on the right. A computer operator/data recorder was also on the left side. After finding beluga groups, a series of aerial passes were made with two pairs of primary observers each making 4 or more independent counts of each group. Median counts made in optimal viewing conditions on 2 to 6 different days were 0-93 beluga in the Susitna Delta (between the Beluga and Little Susitna Rivers), 54-97 in Knik Arm (there appeared to be exchanges of whales between the Susitna area and Knik Arm), and 10-11 in Chickaloon Bay. No belugas were seen elsewhere. This sighting distribution has been consistent in June or July most years since 1996. The sum of the median aerial estimates (a very rough but quick index of relative abundance, not corrected for estimates of whales missed) for June 2002 is 192 belugas. This

David J. Rugh; Barbara A. Mahoney; Laura K. Litzky; Brad Smith

2002-01-01T23:59:59.000Z

192

Viability of waste-based cooking fuels for Developing countries : combustion emissions and field feasibility  

E-Print Network (OSTI)

Biomass-derived cooking fuels are used by three billion people worldwide. The drawbacks of such fuels, typically wood or wood-derived charcoal, include health hazards, negative environmental effects, and perpetuation of ...

Banzaert, Amy, 1976-

2013-01-01T23:59:59.000Z

193

File:EIA-AK-CookInlet-Liquids.pdf | Open Energy Information  

Open Energy Info (EERE)

AK-CookInlet-Liquids.pdf AK-CookInlet-Liquids.pdf Jump to: navigation, search File File history File usage Alaska's Cook Inlet By 2001 Liquids Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 10.19 MB, MIME type: application/pdf) Description Alaska's Cook Inlet By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment

194

Compilation of Published PM2.5 Emission Rates for Cooking, Candles...  

NLE Websites -- All DOE Office Websites (Extended Search)

Compilation of Published PM2.5 Emission Rates for Cooking, Candles and Incense for Use in Modeling of Exposures in Residences Title Compilation of Published PM2.5 Emission Rates...

195

Performance of Charcoal Cookstoves for Haiti, Part 2: Results from the Controlled Cooking Test  

Science Conference Proceedings (OSTI)

Five charcoal cookstoves were tested using a Controlled Cooking Test (CCT) developed from cooking practices in Haiti. Cookstoves were tested for total burn time, specific fuel consumption, and emissions of carbon monoxide (CO), carbon dioxide (CO{sub 2}), and the ratio of carbon monoxide to carbon dioxide (CO/CO{sub 2}). These results are presented in this report along with LBNL testers observations regarding the usability of the stoves.

Lask, Kathleen; Jones, Jennifer; Booker, Kayje; Ceballos, Cristina; Yang, Nina; Gadgil, Ashok

2011-11-30T23:59:59.000Z

196

Alcohol production from various enzyme-converted starches with or without cooking  

Science Conference Proceedings (OSTI)

The effectiveness of alcoholic fermentation was compared by measuring alcoholic yields from various starch mashes, both cooked and uncooked. Alcohol yields from cooked and liquefied starch by bacterial ..cap alpha..-amylase were 93.9% for corn, 92.0% for cassava, 90.6% for potato, and 73.0% for babassu, whereas alcohol yields from raw starch were 90.0% for corn, 89.0% for cassava, 48.9% for babassu, and 11.4% for potato. (JMT)

Park, Y.K.; Rivera, B.C.

1982-02-01T23:59:59.000Z

197

Pollutant Removal Efficiency of Residential Cooking Exhaust Hoods  

Science Conference Proceedings (OSTI)

Capture efficiency (CE) of exhaust from a natural gas cooking range was quantified for three common designs of residential range hoods in laboratory experiments: (A) microwave exhaust combination; (B) short hood with grease-screen-covered air inlet at bottom; and (C) deep, open hood exhausting at top. Devices were evaluated at varying installation heights, at highest and lowest fan settings, and with the hood installed 15 cm away from back wall with intent to improve CE for front burners. Each configuration was evaluated for the oven and for three cooktop burner combinations (two back, two front, one front and one back). At highest fan settings and standard installation against the wall, Hoods A and C captured back cooktop burner exhaust at > 90 percent and Hood B at > 80 percent. In this configuration, CE for front burner exhaust was 73-78 percent for Hoods A and C but only 46-63 percent for Hood B. CEs followed similar patterns but were substantially lower on the lowest fan speed. Installing the hood away from the wall improved CE for oven and front burners on Hood A at low speed, but substantially reduced CE for back burners for all hoods at low and high speed.

Singer, Brett C.; Sherman, Alexander D.; Hotchi, Toshifumi; Sullivan, Douglas P.

2011-07-01T23:59:59.000Z

198

Mansaa thai June is, 1989  

E-Print Network (OSTI)

.ing cell.ing cell.iving cell.ging cell.nnn ccccggggng cell.ggggg cng cell.eelg cell.eee l.lke up every

Kemner, Ken

199

he Romberg Tiburon Center in Marin County is not an easy place to find. While running late and driving too  

E-Print Network (OSTI)

is complete as yellow sun rays blend with the rust-colored towers of the iconic Golden Gate Bridge. Dur- ing originally built for offload- ing coal. Later, it was used to support the assembly of submarine nets

200

Network computing : limits and achievability  

E-Print Network (OSTI)

insufficiency of linear network cod- ing. 2009. [88] R.and K. Zeger. Network cod- ing for computing. In Allertonto target function f is C cod (N , f ) = sup k : ? (k, n)

Karamchandani, Nikhil

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

In Proceed- ings of Thermal Energy Storage in Aquifers Work-Mathematical Modeling of Thermal Energy storage in Aquifers.In Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

202

Copyright 2008 No part of this presentation may be reproduced in any form without prior authorization.  

E-Print Network (OSTI)

demon- stration project for Xcel Energy, convert- ing a Ford Escape Hybrid PHEV vehicle to put power. Utilizing fully automated fast processing, the new technology will be capable of produc- ing one solar cell

Amin, S. Massoud

203

74 Scientific American, April 2011 Illustration by Tom Whalen Earthquake early-warning networks  

E-Print Network (OSTI)

, but it is enough to send shutdown warn- ings to power plants and rail networks, automatically open ele- vator doors comes in two parts: a fast- moving, sudden jolt and a slower-mov- ing wave that causes the great

Allen, Richard M.

204

Natural Gas Productive Capacity for the Lower 48 States 1986 ...  

U.S. Energy Information Administration (EIA)

con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy o r any other or - gani za tion. Preface

205

BUILDING CORRELATORS WITH MANY-CORE HARDWARE Rob V. van Nieuwpoort and John W. Romein  

E-Print Network (OSTI)

- ing techniques, but more on signal-processing techniques. For example, LOFAR [1], MeerKAT (Karoo Array International Conference on Supercomput- ing, New York, NY, June 2009, pp. 440­449. [11] "Karoo array telescope

Romein, John W.

206

OFFICE OF AUDITOR OF STATE STATE OF IOWA  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Daniels, Thomas E.

207

Public servants A key part of the  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Manapat, Michael

208

B U S I N E S SB U S I N E S S ROBERT H. SMITH SCHOOL OF BUSINESS UNIVERSITY OF MARYLAND SPRING 2011 VOL. 12 NO. 1  

E-Print Network (OSTI)

and cellphone products. Employees were asked daily over a period of 10 work- ing days to list any incidents

Milchberg, Howard

209

e3_Coyote Case Study2000/L&J  

Science Conference Proceedings (OSTI)

... graphic design technology; biotechnology; heat- ing, ventilating ... the local school districts and work ... HVAC Heating, Ventilating, and Air Conditioning ...

2013-06-04T23:59:59.000Z

210

Cross-market relationships strengthened in the third quarter of ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... The correlation between prompt-month West Texas Intermediate ...

211

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... What is shale gas and why is it important? ...

212

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

213

More recycling raises average energy content of waste used to ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

214

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

215

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

216

Annual Energy Outlook 2013 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

217

State-Level Energy-Related Carbon Dioxide Emissions, 2000-2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

218

Cross State Air Pollution Rule requires emissions reductions from ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

219

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

220

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Does EIA have maps or information on the location of natural gas ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

222

The geology of natural gas resources - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

223

UNIVERSITE DE NICE-SOPHIA ANTIPOLIS -UFR SCIENCES Ecole Doctorale Sciences et Technologies de l'Information et de la Communication  

E-Print Network (OSTI)

- ing the properties of such a ladder in this poorly explored regime. Acknowledgements The work at ORNL

Paris-Sud XI, Université de

224

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... CBECS enters the final phase of questionnaire design.

225

Paycheck Deduction Codes 01/10 Deduct Code Description  

E-Print Network (OSTI)

Garnishment GFNOPROV GF Mand Ret-No Providor Chosen GFTSAING GF - TSA ING GFTSALINC GF - TSA Lincoln GFTSASEC

Peterson, Blake R.

226

Electricity use by machine drives varies significantly by ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Fossil fuels may be used to drive turbines, reciprocating engines, ...

227

Fermi and the ergodic problem Giovanni Gallavotti  

E-Print Network (OSTI)

the esoteric (quasi) ergodic problem. Consider- ing a `{degrees of freedom system, ` > 2, with Hamilto- nian H

Roma "La Sapienza", Università di

228

Reference List 1751-2000  

Science Conference Proceedings (OSTI)

... 1934. Wurmb-Schwark, N. v, Michaela Harbeck, Urs Wiesbrock, Inge Schroeder, Stefanie Ritz-Timme, and Manfred Oehmichen. ...

2003-12-18T23:59:59.000Z

229

ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980  

E-Print Network (OSTI)

storm and double-pane windows, insulat- ing shutters, caulking and weatherstripping, fur- nace retrofits, and active and passive solar

Authors, Various

2010-01-01T23:59:59.000Z

230

Underwater 3D Mapping: Experiences and Lessons learned  

E-Print Network (OSTI)

in Okinawa in 1998[5]. Monitoring the health of coral reefs is a difficult and time consum- ing task

Jenkin, Michael R. M.

231

Mid-Atlantic electricity market reacts to Tuesday's earthquake ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... after the event. ...

232

Selected publications, with commentary William Bialek February 11, 2004  

E-Print Network (OSTI)

synergistic cod- ing, and this synergy is a significant component of the high coding efficiency seen in [66

233

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

234

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

235

Electric Power Monthly - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

236

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel, nuclear reactors, generation, spent fuel. ... Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

237

Markov decision process (MDP) framework for software power optimization using call profiles on mobile phones  

E-Print Network (OSTI)

Duke researchers [21] extend this approach to the system level by formulat- ing a general framework to manage energy

Jung, Eric; Maker, Frank; Cheung, Tang Lung; Liu, Xin; Akella, Venkatesh

2010-01-01T23:59:59.000Z

238

View / Download  

Science Conference Proceedings (OSTI)

developing fields of technology, mak- ing major advancements in traditional fields of engineering, or developing/ implementing innovative approaches.

239

THE CORROSION OF SILICATE MATERIALS BY HYDROGEN GAS AND HYDROFLUORIC ACID SOLUTION  

E-Print Network (OSTI)

occurring in the coal gasifier and then find- ing a methodmaterial for the coal gasifier applica- tion. The corrosion

Tso, Stephen T.

2011-01-01T23:59:59.000Z

240

Fuel economy standards have affected vehicle efficiency - Today in ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Notes: Combined means both foreign and domestic vehicles.

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Second-Generation Nickel-Base Single Crystal Superalloy  

Science Conference Proceedings (OSTI)

creased, the demands placed on turbine airfoils have escalated dramatically. ... The demand- ing goals established ..... (maximum tensile strain at minimum...

242

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, biomass and ethanol. ... Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights

243

ICAL: A Tool for Analyzing Imperfect Comparison Algorithms Wee-Chong Oon and Martin Henz  

E-Print Network (OSTI)

[7] that was based on temporal difference learn- ing, and the checkers program Anaconda [1, 2] based

Henz, Martin

244

SOLAR ENERGY PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT ANNUAL REPORT 1978  

E-Print Network (OSTI)

of develop- ing a photovoltaic cell, based on a catalyst (has been shown that a photovoltaic cell can be constructed

authors, Various

2011-01-01T23:59:59.000Z

245

Assessing regional evapotranspiration and water balance across a Mediterranean montane climate gradient  

E-Print Network (OSTI)

topography and calculated solar radiation. Hydrol. Process.al. (2011). Incom- ing solar radiation was derived from the

Anderson, Ray G.; Jin, Yufang; Goulden, Michael L.

2012-01-01T23:59:59.000Z

246

Puerto Rico - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico Energy Affairs Administration, Administracin de Asuntos Energticos;

247

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico* Saint Kitts and Nevis Saint Lucia Saint Vincent ...

248

Markov Random field edge-centric image/video processing  

E-Print Network (OSTI)

using adaptive fast B-spline ?lter- ing, IEEE Internationalimage resizing using modi?ed B-splines, IEEE International

Li, Min

2007-01-01T23:59:59.000Z

249

How is electricity used in U.S. homes? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... heating elements, and motors not listed above. Learn more:

250

U.S. total motor gasoline exports down slightly from last year but ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Total motor gasoline = finished motor gasoline + motor gasoline blending components.

251

COMBINING MAGNETIC SHIELDING AND CRYOPUMPING FOR A NEUTRAL BEAM SOURCE  

E-Print Network (OSTI)

generated by the fusion reactor while the cold surface willfor the Toka. -nak Fusion Test Reactor", in Proceed ings of

Tanabe, J.

2010-01-01T23:59:59.000Z

252

Integrating Rhetorical-Semantic Relation Models for Query ...  

Science Conference Proceedings (OSTI)

... In Galia Angelova, Kalina Bontcheva, Ruslan Mitkov, Nicolas Nicolov, and Nikolai Nikolov, editors, Proceed- ings of the International Conference ...

2006-10-03T23:59:59.000Z

253

Common coastal foraging areas for loggerheads in the Gulf of Mexico: Opportunities for marine conservation  

E-Print Network (OSTI)

and its find- ings validated. On the other hand, to confirm the validity of the new tag tracking method

Florida, University of

254

Illinois coal production pushes Illinois Basin production above ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... based on the Mine Safety and Health Administration (MSHA).

255

Alkylation is an important source for octane in gasoline - Today ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (like temperature and pressure) along with different safety considerations.

256

Eastern Mediterranean natural gas exploration focused on the ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Gaza Marine: 1: unknown: Sources: EIA estimates, IHS, ...

257

Error-reducing corrections for the method of regularized Stokeslet for fluid-membrane interactions  

E-Print Network (OSTI)

for SDS [1], and sec- ond, we investigate the summarisation of XML documents by tak- ing into account

Ullmer, Brygg

258

Applied and Computational Mathematics Division Applied and ...  

Science Conference Proceedings (OSTI)

... ing, materials science, chemistry, bioscience, engineering, fire ... mathematics are fundamental tools enabling ... The NIST Handbook of Mathematical ...

2013-05-08T23:59:59.000Z

259

Arizona - Rankings - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Markets & Finance. Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ...

260

EXPERIMENTAL ANALYSIS OF HEURISTICS FOR THE ...  

E-Print Network (OSTI)

order from inaccurate adjacency information [19], medical image process- ing [2] ...... salesman problem, Research Report, Department of Computer Science,...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Greenhouse gas data, voluntary report- ing, electric power plant ...

262

Kazakhstan - Analysis - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power ... by the Kazakhstan's Electricity Grid Operating ... regional electricity distribution .. ...

263

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

264

 

Gasoline and Diesel Fuel Update (EIA)

E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 E4. Electricity Consumption (Btu) Intensities by End Use for Non-Mall Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 48.0 1.8 6.3 6.1 0.8 18.1 0.3 5.6 1.0 2.3 5.6 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.8 2.9 6.8 2.9 1.7 14.6 1.1 21.6 1.2 1.9 6.0 5,001 to 10,000 ....................... 42.2 2.0 5.6 2.8 0.9 13.3 0.7 9.0 0.9 1.5 5.7 10,001 to 25,000 ..................... 35.8 1.7 4.1 3.9 0.7 13.3 0.3 4.6 0.8 1.7 4.7 25,001 to 50,000 ..................... 41.8 1.8 6.6 6.0 1.0 14.4 0.2 4.1 0.8 1.9 5.0

265

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ............................. 91.0 33.0 7.2 6.1 7.0 18.7 2.7 5.3 1.0 2.2 7.9 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 99.0 30.7 6.7 2.7 7.1 13.9 7.1 19.9 1.1 1.7 8.2 5,001 to 10,000 .......................... 80.0 30.1 5.5 2.6 6.1 13.6 5.2 8.2 0.8 1.4 6.6 10,001 to 25,000 ........................ 71.0 28.2 4.5 4.1 4.1 14.5 2.3 4.5 0.8 1.6 6.5 25,001 to 50,000 ........................ 79.0 29.9 6.8 5.9 6.3 14.9 1.7 3.9 0.8 1.8 7.1 50,001 to 100,000 ...................... 88.7 31.6 7.6 7.6 6.5 19.6 1.7 3.4 0.7 2.0 8.1 100,001 to 200,000 .................... 104.2 39.1 8.2 8.9 7.9 22.9 1.1 2.9 Q 3.2 8.7 200,001 to 500,000 ....................

266

 

Gasoline and Diesel Fuel Update (EIA)

E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, E4A. Electricity Consumption (Btu) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (thousand Btu/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 50.7 2.4 6.9 6.2 1.3 19.1 0.3 5.4 1.0 2.2 6.0 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 60.6 2.9 6.8 2.8 1.7 14.8 1.1 21.2 1.2 1.8 6.0 5,001 to 10,000 ....................... 44.0 2.6 5.7 2.8 1.1 14.3 0.7 8.6 0.9 1.4 5.8 10,001 to 25,000 ..................... 38.8 2.1 4.4 4.1 1.1 14.7 0.2 4.5 0.8 1.6 5.1 25,001 to 50,000 ..................... 43.7 2.0 6.8 6.1 1.3 15.4 0.2 4.0 0.8 1.9 5.3

267

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, A. Electricity Consumption (kWh) Intensities by End Use for All Buildings, 2003 Electricity Energy Intensity (kWh/square foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 14.9 0.7 2.0 1.8 0.4 5.6 0.1 1.6 0.3 0.7 1.7 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 17.8 0.9 2.0 0.8 0.5 4.4 0.3 6.2 0.4 0.5 1.8 5,001 to 10,000 ....................... 12.9 0.8 1.7 0.8 0.3 4.2 0.2 2.5 0.3 0.4 1.7 10,001 to 25,000 ..................... 11.4 0.6 1.3 1.2 0.3 4.3 0.1 1.3 0.2 0.5 1.5 25,001 to 50,000 ..................... 12.8 0.6 2.0 1.8 0.4 4.5 0.1 1.2 0.2 0.6 1.5

268

Efficient Cook Stoves for Darfur : Future Technologies : From the Lab to  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficient Cook Stoves for Darfur Efficient Cook Stoves for Darfur From the Lab to the Marketplace Ten Years Later, Energy Efficient Technologies from Research at the Lawrence Berkeley National Laboratory Berkeley Lab logo (left) with six rows of gray dots transitioning to a line art drawing of a cityscape and residential houses. Efficient Cook Stoves for Darfur Beginning in 2003, hundreds of thousands of people have been killed, and another 2.2 million have become internal refugees in the Darfur region of Sudan. Although the refugees are relatively safe inside the refugee camps, they risk murder and rape when they leave to fetch firewood. To reduce the amount of firewood the refugees need, Berkeley Lab scientist Ashok Gadgil modified an existing cookstove design to create one that is 75% more

269

Thomas B. Cook,1971 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Thomas B. Cook,1971 Thomas B. Cook,1971 The Ernest Orlando Lawrence Award Lawrence Award Home Nomination & Selection Guidelines Award Laureates 2000's 1990's 1980's 1970's 1960's Ceremony The Life of Ernest Orlando Lawrence Contact Information The Ernest Orlando Lawrence Award U.S. Department of Energy SC-2/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-9395 E: lawrence.award@science.doe.gov 1970's Thomas B. Cook,1971 Print Text Size: A A A RSS Feeds FeedbackShare Page Weapons: For his significant contributions to the study of nuclear weapons effects, for his original work in the translation of this knowledge into advanced technology for peaceful and military uses of atomic energy, and for his outstanding contributions to the nation through his service as an

270

Cooking Up Hot Quark Soup | U.S. DOE Office of Science (SC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Cooking Up Hot Quark Soup Cooking Up Hot Quark Soup Stories of Discovery & Innovation Cooking Up Hot Quark Soup Enlarge Photo Image courtesy of Brookhaven National Laboratory These images contrast the degree of interaction and collective motion, or "flow," among quarks in the predicted gaseous quark-gluon plasma state (Figure on left, see mpeg animation ) vs. the liquid state that has been observed in gold-gold collisions at RHIC (Figure on right, see mpeg animation ). The green "force lines" and collective motion (visible on the animated version only) show the much higher degree of interaction and flow among the quarks in what is now being described as a nearly "perfect" liquid. Enlarge Photo Photo courtesy of Brookhaven National Laboratory Brookhaven National Laboratory's Relativistic

271

File:EIA-AK-CookInlet-Gas.pdf | Open Energy Information  

Open Energy Info (EERE)

File File Edit with form History Facebook icon Twitter icon » File:EIA-AK-CookInlet-Gas.pdf Jump to: navigation, search File File history File usage Alaska's Cook Inlet By 2001 Gas Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 10.19 MB, MIME type: application/pdf) Description Alaska's Cook Inlet By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time.

272

A fuzzy mixed integer goal programming approach for cooking and heating energy planning in rural India  

Science Conference Proceedings (OSTI)

In this study, a fuzzy mixed integer goal programming model (FMIGP) has been developed for rural cooking and heating energy planning in the Chikhli taluka of Buldhana district, Maharashtra, Central India. The model considers various scenarios such as ... Keywords: Energy planning, Fuzzy goal programming, Fuzzy sets

A. M. Jinturkar; S. S. Deshmukh

2011-09-01T23:59:59.000Z

273

Pollutant exposures from unvented gas cooking burners: A simulation-based  

NLE Websites -- All DOE Office Websites (Extended Search)

Pollutant exposures from unvented gas cooking burners: A simulation-based Pollutant exposures from unvented gas cooking burners: A simulation-based assessment for Southern California Title Pollutant exposures from unvented gas cooking burners: A simulation-based assessment for Southern California Publication Type Journal Article Year of Publication 2013 Authors Logue, Jennifer M., Neil E. Klepeis, Agnes B. Lobscheid, and Brett C. Singer Journal Environmental Health Perspectives Date Published 11/2013 Abstract Background: Residential natural gas cooking burners (NGCBs) can emit substantial quantities of pollutants and they are typically used without venting. Objective: Quantify pollutant concentrations and occupant exposures resulting from NGCB use in California homes. Methods: A mass balance model was applied to estimate time-dependent pollutant concentrations throughout homes and the "exposure concentrations" experienced by individual occupants. The model was applied to estimate nitrogen dioxide (NO2), carbon monoxide (CO), and formaldehyde (HCHO) concentrations for one week each in summer and winter for a representative sample of Southern California homes. The model simulated pollutant emissions from NGCBs, NO2 and CO entry from outdoors, dilution throughout the home, and removal by ventilation and deposition. Residence characteristics and outdoor concentrations of CO and NO2 were obtained from available databases. Ventilation rates, occupancy patterns, and burner use were inferred from household characteristics. Proximity to the burner(s) and the benefits of using venting range hoods were also explored. Replicate model executions using independently generated sets of stochastic variable values yielded estimated pollutant concentration distributions with geometric means varying less than 10%.

274

File:EIA-AK-CookInlet-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

CookInlet-BOE.pdf CookInlet-BOE.pdf Jump to: navigation, search File File history File usage Alaska's Cook Inlet By 2001 BOE Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 10.19 MB, MIME type: application/pdf) Description Alaska's Cook Inlet By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Alaska File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:55, 20 December 2010 Thumbnail for version as of 16:55, 20 December 2010 5,100 × 6,600 (10.19 MB) MapBot (Talk | contribs) Automated bot upload

275

A study of object naming according to the manufacturing processes in a cooking activity  

Science Conference Proceedings (OSTI)

Usually, an intermediate object that appears for a short time during a process of production, for instance "minced onion," does not have a common and specific name. In this paper, we study how people designate such an intermediate object using their ... Keywords: cooking, human-robot communication, intermediate object, manufacturing process, natural language understanding, object naming, object recognition, recipe

Yoko Yamakata; Takuya Funatomi; Koh Kakusho; Michihiko Minoh

2009-10-01T23:59:59.000Z

276

Domestic food and sustainable design: a study of university student cooking and its impacts  

Science Conference Proceedings (OSTI)

In four university student kitchens over twenty-one days, we captured participants' food preparation activity, quantified the greenhouse gas emissions and direct energy connected to the food and cooking, and talked to participants about their food practices. ... Keywords: energy, everyday life, food, greenhouse gas, practices, sustainability

Adrian K. Clear; Mike Hazas; Janine Morley; Adrian Friday; Oliver Bates

2013-04-01T23:59:59.000Z

277

Cooking with Healthier Fats and Oils When you do use fats  

E-Print Network (OSTI)

Oil Margarine (stick) Cottonseed Oil Chicken Fat Lard Beef Tallow Bacon Grease Palm Oil Butter CoconutCooking with Healthier Fats and Oils When you do use fats and oils, choose those with less saturated fat, trans fat, and cholesterol. parent tips Percent of Saturated Fat Choose

Bandettini, Peter A.

278

FoodManager: a cooking, eating and appliance controlling support system for the elderly  

Science Conference Proceedings (OSTI)

These days, many support systems are being developed to improve independence and quality of life of elderly and impaired people at home. Most of them have been hitherto focused on providing home healthcare-related services, and little attention has been ... Keywords: ambient assisted living, cooking, eating, elderly people, smart kitchen

Rosa Iglesias; Ibai Ibarguren; Nuria Gmez de Segura; Julen Ugalde; Leticia Coello; Miren Iturburu

2010-06-01T23:59:59.000Z

279

The FlashBake oven: Lightwave oven delivers high-quality, quick cooking  

SciTech Connect

The FlashBake oven is a well-publicized new electrotechnology that over 40 utilities are promoting for commercial food service applications, but is it worth its high price? E Source research shows that this $5,000 to $8,500 lightwave oven can increase sales and profitability in a number of applications, thus paying for itself within months to a year or two. The FlashBake does so by cooking foods less than two inches thick in two minutes or less, as quickly as microwave ovens do, but with quality equal to or greater than that of conventional gas and electric ovens. The FlashBake makes sense for restaurants and kiosks that offer quick-order menus, as well as for full-menu restaurants that can use the FlashBake during slow periods (instead of larger ovens) and during busy periods (for extra capacity). In these target market applications, the FlashBake is likely to use less energy due to its extremely low idle energy use. It is not well suited to banquet and institutional kitchens that require large numbers of the same item to be cooked and ready simultaneously. The FlashBake has only one tray, so cooking large volumes may take longer, require more labor, and use more energy than a conventional oven that has multiple cooking racks. Energy use is rarely a major concern of those who buy FlashBake ovens, since energy for cooking represents a small fraction of a restaurant`s overall operating costs. The main selling point of the FlashBake is menu and productivity enhancement.

Gregerson, J.

1995-06-01T23:59:59.000Z

280

Changes in quality of whole cooked sorghum {Sorghum bicolor (l) Moench} using precooking methods  

E-Print Network (OSTI)

Four sorghum cultivars (white, sumac, high tannin and black) differing in kernel characteristics were evaluated for cooking quality using whole, cracked and decorticated kernels. Whole grain had longer minimum cooking time (MCT) and lower water uptake. MCT ranged from 20 to 55 min for all varieties. Soluble solid loses (SSL) were lower than for cracked grain (1.0 to 1.5%). Formation of a gruel-like texture, darker pericarp color, splitting and agglomeration of kernels occurred especially for white grain. Cracked sorghum had shorter MCT (8.8. to 17.5 min) but produced higher SSL (1.3 to 2.9%). Changes in color and appearance due to leaching of pigments especially for the sorghums with a pigmented testa occurred. Utilization of decorticated kernels reduced MCT (11 to 25.3 min), but nutritional value is affected with the removal of the pericarp, plus the SSL (0.5 to 0.7%) produced during cooking. The long grain rice types have comparatively lower values in terms of MCT (22 min) than whole sorghum and SSL are similar to values obtained for cracked grain (1.7 to 2.2%) showing a minimum of splitting. Short and medium rice grain shows relatively long cooking time (30 to 35 min) but no longer than cracked or decorticated sorghum and produced higher SSL (28% to 40%) during processing, showing extensive disintegration. When sorghum was precooked; cooking quality improved. The combination of dry heat and microwave reduced MCT and SSL from 31 to 49% and 6.6 to 41.3%, respectively for all varieties compared to the control. This treatment produced grain with softer texture, increased dietary fiber and higher antioxidant activity retention (67.8%) for the tannin varieties than the control (22.7%). Evaluations of cooking quality of whole sorghum and the application of precooking process have more applications than just preparation of rice-like products. Whole boiled sorghum could be used in the elaboration of nutraceutical foods like an ingredient for yogurts, desserts or side dishes like exotic salads with other cereals. The inclusion of whole boiled sorghum as an ingredient in foods is promising with excellent potential health benefits.

Calderon de Zacatares, Vilma Ruth

2007-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Electric Commercial Cooking Appliance Development Needs: Preparation and Characterization of Chromium- Coated Residual Heat Removal System Piping  

Science Conference Proceedings (OSTI)

Foodservice establishments are the most energy-intensive customers in the commercial sector. This report addresses the need to improve the energy efficiency of electric cooking appliances by identifying current market opportunities and technologies for further development.

1993-08-01T23:59:59.000Z

282

Data Assimilation R. L. Coulter, T. J. Martin, and D. R. Cook  

NLE Websites -- All DOE Office Websites (Extended Search)

R. L. Coulter, T. J. Martin, and D. R. Cook R. L. Coulter, T. J. Martin, and D. R. Cook Argonne National Laboratory Argonne, IL 60439 To investigate these problems, ARM science team members conducted two field studies near Boardman, Oregon, during June of 1991 and 1992. The site was chosen to provide strong contrasts in surface moisture while minimizing the differences in topography. The region, described in detail by Doran et al. (1992), consists of a substantial dry steppe (desert) upwind of an extensive area of heavily irrigated farm land, 15 km in width and divided into 800-m-diameter circular fields in a close packed array, in which wheat, alfalfa, corn, or potatoes were grown (Figure 1). A full rotation of the irrigation arm was completed approximately once every 28 or 35 h during the growing season. This region provides marked

283

McCook County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

McCook County, South Dakota: Energy Resources McCook County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.6310744°, -97.3516558° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.6310744,"lon":-97.3516558,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

284

Effects of cooking on levels of PCBs in the fillets of winter flounder (Pseudopleuronectes americanus)  

SciTech Connect

The Pacific Northwest Laboratory and Battelle Ocean Sciences performed a study to determine the effect of cooking on polychlorinated biphenyl (PCB) levels in the fillets of winter flounder (Pseudopleuronectes americanus). Broiling, pan frying, and deep frying in oil were tested on fillets from 21 fish collected from New Bedford Harbor, Massachusetts, on February 21, 1991. The evaluation involved estimating the change in PCB concentrations using a mass-balance approach that factored the change in fillet weight resulting from cooking with the changes in PCB concentration expressed on a precooked wet-weight basis. Deep frying in oil resulted in a 47% reduction in total PCB levels in fillet tissue. Additionally, deep frying caused a 40% reduction in fillet mass. Pan frying and broiling resulted in statistically in insignificant increases in total PCB levels of 15% and 17%, respectively. Fillet mass reductions resulting from pan frying and broiling were 7% and 15%, respectively. The effects of cooking on 18 individual congeners generally paralleled the results observed for total PCB. All 18 congeners were significantly reduced by deep frying. Congener Cl{sub 2}(08) also was significantly reduced by either pan frying. Congeners Cl{sub 5}(105) and Cl{sub 5}(118) showed apparent significant increases in concentrations following pan frying. Congeners Cl{sub 5}(105), Cl{sub 5}(118), and C1{sub 6}(138) showed significant increases in concentration following broiling.

Poston, T.M. [Pacific Northwest Lab., Richland, WA (United States); Durell, G.S.; Koczwara, G.; Spellacy, A.M. [Battelle Ocean Sciences, Duxbury, MA (United States)

1995-08-01T23:59:59.000Z

285

SC/51/SM11 AERIAL SURVEYS OF BELUGA WHALES IN COOK INLET, ALASKA,  

E-Print Network (OSTI)

The National Marine Mammal Laboratory (NMML), in cooperation with the NMFS Alaska Regional Office, the Alaska Beluga Whale Committee (ABWC) and the Cook Inlet Marine Mammal Council (CIMMC), conducted an aerial survey of the beluga whale population in Cook Inlet, Alaska, during 9-15 June 1998. The 39.4 hr survey was flown in a twin-engine, high-wing aircraft at an altitude of 244 m (800 ft) altitude and speed of 185 km/hr (100 kt) along a trackline 1.4 km from shore. This provided complete coverage of coastal areas around the entire inlet (1,388 km) one or more times and 1,320 km of transects across the inlet. Throughout most of this survey, a test of sighting rates was conducted with multiple independent observers on the coastal (left) side of the plane, where virtually all sightings occur. A single observer and a computer operator/data recorder were on the right side. After finding beluga groups, a series of aerial passes were made to allow at least two pairs of observers to make 4 or more counts of each group. The sum of the aerial estimates (using median counts from each site, not corrected for missed whales) ranged from 173 to 192 whales, depending on survey day. There were 57-109 belugas counted near the Susitna River, 42-93 in Knik Arm and 23-42 in Chickaloon Bay, but only one (dead) beluga whale was found in lower Cook Inlet.

David J. Rugh; Roderick C. Hobbs; Kim E. W. Shelden; Barbara A. Mahoney; Laura K. Litzky

1998-01-01T23:59:59.000Z

286

Modeling Population Exposures to Pollutants Emitted from Natural Gas Cooking Burners  

Science Conference Proceedings (OSTI)

We developed a physics-based data-supported model to investigate indoor pollutant exposure distributions resulting from use of natural gas cooking appliances across households in California. The model was applied to calculate time-resolved indoor concentrations of CO, NO2 and formaldehyde resulting from cooking burners and entry with outdoor air. Exposure metrics include 1-week average concentrations and frequency of exceeding ambient air quality standards. We present model results for Southern California (SoCal) using two air-exchange scenarios in winter: (1) infiltration-only, and (2) air exchange rate (AER) sampled from lognormal distributions derived from measurements. In roughly 40percent of homes in the SoCal cohort (N=6634) the 1-hour USEPA NO2 standard (190 ?g/m3) was exceeded at least once. The frequency of exceeding this standard was largely independent of AER assumption, and related primarily to building volume, emission rate and amount of burner use. As expected, AER had a more substantial impact on one-week average concentrations.

Lobscheid, Agnes; Singer, Brett C.; Klepeis, Neil E.

2011-06-01T23:59:59.000Z

287

Alcoholic fermentation of raw cassava starch by Rhizopus koji without cooking  

Science Conference Proceedings (OSTI)

Using only wheat bran koji from the Rhizopus strain, raw cassava starch and cassava pellets converted reasonably well to alcohol (ethanol) without cooking at 35 degrees C and pH 4.5-5.0. When the initial broth contained 30 g raw cassava starch, 10 g Rhizopus species koji, and 100 mL tap water, 12.1 g of alcohol was recovered by final distillation from fermented broth. In this case, 12.1 g alcohol corresponds to an 85.5% conversion rate based on the theoretical value of the starch content. When the initial broth contained 40 g cassava starch, 14.1 g of alcohol was recovered, where 14.1 g corresponds to a 74.5% conversion rate. The alcoholic fermentation process described in the present work is considered more effective and reasonable than the process using raw starch without cooking reported until now, since the new process makes it unnecessary to add yeast cells and glucoamylase preparation. (Refs. 15).

Fuijo, Y.; Suyanadona, P.; Attasampunna, P.; Ueda, S.

1984-04-01T23:59:59.000Z

288

Alcoholic fermentation of raw cassava starch by Rhizopus koji without cooking  

Science Conference Proceedings (OSTI)

Using only wheat bran koji from the Rhizopus strain, raw cassava starch and casava pellets converted reasonably well to alcohol (ethanol) without cooking at 35/sup 0/C and pH 4.5-5.0. When the initial broth contained 30 g raw cassava starch, 10 g Rhizopus sp. koji, and 100 mL tap water, 12.1 g of alcohol was recovered by final distillation from fermented broth. In this case, 12.1 g alcohol corresponds to an 85.5% conversion rate based on the theoretical value of the starch content. When the initial broth contained 40 g cassava starch, 14.1 g of alcohol was recovered, where 14.1 g corresponds to a 74.5% conversion rate. The alcoholic fermentation process described in the present work is considered more effective and reasonable than the process using raw starch without cooking reported until now, since the new process makes it unnecessary to add yeast cells and glucoamylase preparation.

Fujio, Y.; Suyanadona, P.; Attasampunna, P.; Ueda, S.

1984-01-01T23:59:59.000Z

289

SC/49/SM20 AERIAL SURVEYS OF BELUGA WHALES IN COOK INLET, ALASKA,  

E-Print Network (OSTI)

The National Marine Mammal Laboratory (NMML), in cooperation with the NMFS Alaska Regional Office, the Alaska Beluga Whale Committee (ABWC) and the Cook Inlet Marine Mammal Council (CIMMC), conducted an aerial survey of the beluga whale population in Cook Inlet, Alaska, during 8-10 June 1997. This provided a thorough coverage of the coasts around the entire inlet (1,388 km). Therefore, 100 % of the coastal areas where belugas were expected to be during this season were searched one or more times. The 23 hr survey was flown in a twin-engine, high-wing aircraft at 244 m (800 ft) altitude and 185 km/hr (100 kt) along a trackline 1.4 km from shore. Throughout most of this survey, a test of sighting rates was conducted with multiple independent observers on the coastal (left) side of the plane, where virtually all sightings occur. A single observer and a computer operator/data recorder were on the right side. After finding beluga groups, a series of aerial passes were made to allow at least two pairs of observers to make 4 or more counts of whales. The sum of the aerial estimates (using median counts from each site, not corrected for missed whales) ranged from 217 to 264 whales, depending on survey day. Only 1 beluga whale was found in lower Cook Inlet, 51-73 were counted near the Susitna River, 139-161 were seen in Knik Arm and 26-29 were counted in Chickaloon Bay. Combining data from 1994-97, almost half (46%) of the initial sightings occurred>1.4 km from the aircraft- the perimeter of the standard viewing area- with mean sighting distances of 1.2 km for small groups ( = 20). In only 8 of 59 instances were whale groups>1.4 km from the trackline. Of 106 groups recorded by paired, independent observers in 1994-97, 20 were reported by only one primary observer, while 86 (81%) were reported by both observers.

David J. Rugh; Roderick C. Hobbs; Kim E. W. Shelden; Janice M. Waite

1997-01-01T23:59:59.000Z

290

AOCS/SFA Edible Oils Manual, 2nd EditionChapter 7 Use of Edible Oil in the Cooking Process  

Science Conference Proceedings (OSTI)

AOCS/SFA Edible Oils Manual, 2nd Edition Chapter 7 Use of Edible Oil in the Cooking Process Food Science eChapters Food Science & Technology AOCS 8E134A7EA3AB61D946A428416A4138F4 Press Downloadable pdf of

291

Nuclear Power Plant License Renewal Environmental Compliance Program: Donald C. Cook Nuclear Case Study, Phase 1--Preliminary Planni ng  

Science Conference Proceedings (OSTI)

This report describes preliminary environmental compliance planning activities that American Electric Power (AEP) is taking to preserve the option of renewing the Donald C. Cook Nuclear Plant license. The activities are based on a program plan manual published previously by EPRI. The report includes an evaluation of the usefulness of that manual.

1997-07-08T23:59:59.000Z

292

 

Gasoline and Diesel Fuel Update (EIA)

A. Fuel Oil Consumption (gallons) and Energy Intensities by End Use for All Buildings, 2003 A. Fuel Oil Consumption (gallons) and Energy Intensities by End Use for All Buildings, 2003 Total Fuel Oil Consumption (million gallons) Fuel Oil Energy Intensity (gallons/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings.......................... 1,644 1,429 131 Q 72 0.10 0.09 0.01 Q (*) Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 249 228 Q (*) Q 0.41 0.38 Q (*) Q 5,001 to 10,000 ....................... 262 237 Q 1 Q 0.36 0.32 Q (*) Q 10,001 to 25,000 ..................... 201 179 11 (*) Q 0.19 0.17 0.01 (*) Q 25,001 to 50,000 ..................... 124 115 Q (*) 4 0.14 0.13 Q (*) (*) 50,001 to 100,000 ................... 209 188 10 Q 7 0.11 0.10 0.01 Q (*)

293

 

Gasoline and Diesel Fuel Update (EIA)

. Fuel Oil Consumption (Btu) and Energy Intensities by End Use for . Fuel Oil Consumption (Btu) and Energy Intensities by End Use for Non-Mall Buildings, 2003 Total Fuel Oil Consumption (trillion Btu) Fuel Oil Energy Intensity (thousand Btu/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ........................ 222 194 17 Q 10 14.7 12.8 1.1 Q 0.6 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 34 32 Q (*) Q 57.4 52.7 Q (*) Q 5,001 to 10,000 ....................... 36 33 Q (*) Q 50.6 45.8 Q 0.1 Q 10,001 to 25,000 ..................... 27 25 1 (*) Q 28.2 25.4 1.5 0.1 Q 25,001 to 50,000 ..................... 16 15 Q (*) 1 19.7 18.8 Q (*) 0.7 50,001 to 100,000 ................... 26 23 1 Q 1 15.0 13.3 0.8 Q 0.6

294

 

Gasoline and Diesel Fuel Update (EIA)

. Natural Gas Consumption (Btu) and Energy Intensities by End Use for . Natural Gas Consumption (Btu) and Energy Intensities by End Use for Non-Mall Buildings, 2003 Total Natural Gas Consumption (trillion Btu) Natural Gas Energy Intensity (thousand Btu/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ....................... 1,928 1,316 332 142 137 44.3 30.3 7.6 3.3 3.2 Building Floorspace (Square Feet) 1,001 to 5,000 ........................ 250 155 35 41 18 81.1 50.4 11.5 13.4 5.9 5,001 to 10,000 ...................... 209 143 32 30 Q 56.5 38.8 8.7 8.2 Q 10,001 to 25,000 .................... 309 248 32 22 8 43.9 35.1 4.6 3.1 1.1 25,001 to 50,000 .................... 258 188 41 12 Q 42.7 31.1 6.8 2.0 Q

295

 

Gasoline and Diesel Fuel Update (EIA)

. Natural Gas Consumption (cubic feet) and Energy Intensities by End Use for Non-Mall Buildings, 2003 . Natural Gas Consumption (cubic feet) and Energy Intensities by End Use for Non-Mall Buildings, 2003 Total Natural Gas Consumption (billion cubic feet) Natural Gas Energy Intensity (cubic feet/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ........................ 1,870 1,276 322 138 133 43.0 29.4 7.4 3.2 3.1 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 243 151 34 40 18 78.7 48.9 11.1 13.0 5.7 5,001 to 10,000 ....................... 202 139 31 29 Q 54.8 37.6 8.5 7.9 Q 10,001 to 25,000 ..................... 300 240 31 21 7 42.5 34.1 4.4 3.0 1.1 25,001 to 50,000 ..................... 250 182 40 11 Q 41.5 30.2 6.6 1.9 Q

296

 

Gasoline and Diesel Fuel Update (EIA)

1A. District Heat Consumption (Btu) and Energy Intensities by End Use for All Buildings, 2003 1A. District Heat Consumption (Btu) and Energy Intensities by End Use for All Buildings, 2003 Total District Heat Consumption (trillion Btu) District Heat Energy Intensity (thousand Btu/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ......................... 636 580 46 1 Q 114.0 103.9 8.3 0.2 Q Building Floorspace (Square Feet) 1,001 to 5,000 ......................... Q Q Q Q Q Q Q Q Q Q 5,001 to 10,000 ....................... Q Q Q Q Q Q Q Q Q Q 10,001 to 25,000 ..................... Q Q Q Q Q Q Q Q Q Q 25,001 to 50,000 ..................... Q Q Q Q Q Q Q Q Q Q 50,001 to 100,000 ................... Q Q Q Q Q Q Q Q Q Q

297

 

Gasoline and Diesel Fuel Update (EIA)

A. Natural Gas Consumption (Btu) and Energy Intensities by End Use for A. Natural Gas Consumption (Btu) and Energy Intensities by End Use for All Buildings, 2003 Total Natural Gas Consumption (trillion Btu) Natural Gas Energy Intensity (thousand Btu/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ......................... 2,100 1,420 348 164 168 43.3 29.3 7.2 3.4 3.5 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 257 161 36 42 18 81.0 50.6 11.3 13.3 5.8 5,001 to 10,000 ....................... 224 152 33 32 7 56.5 38.3 8.4 8.1 1.7 10,001 to 25,000 ..................... 353 273 35 26 19 45.2 34.9 4.5 3.3 2.4 25,001 to 50,000 ..................... 278 202 43 14 Q 42.2 30.6 6.5 2.1 3.0

298

 

Gasoline and Diesel Fuel Update (EIA)

A. Natural Gas Consumption (cubic feet) and Energy Intensities by End Use for All Buildings, 2003 A. Natural Gas Consumption (cubic feet) and Energy Intensities by End Use for All Buildings, 2003 Total Natural Gas Consumption (billion cubic feet) Natural Gas Energy Intensity (cubic feet/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ......................... 2,037 1,378 338 159 163 42.0 28.4 7.0 3.3 3.4 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 249 156 35 41 18 78.6 49.1 11.0 12.9 5.6 5,001 to 10,000 ....................... 218 147 32 31 7 54.8 37.1 8.1 7.9 1.7 10,001 to 25,000 ..................... 343 265 34 25 18 43.8 33.9 4.4 3.2 2.3 25,001 to 50,000 ..................... 270 196 41 13 Q 40.9 29.7 6.3 2.0 2.9

299

 

Gasoline and Diesel Fuel Update (EIA)

A. Fuel Oil Consumption (Btu) and Energy Intensities by End Use for All A. Fuel Oil Consumption (Btu) and Energy Intensities by End Use for All Buildings, 2003 Total Fuel Oil Consumption (trillion Btu) Fuel Oil Energy Intensity (thousand Btu/square foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ......................... 228 198 18 Q 10 14.0 12.2 1.1 Q 0.6 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 34 32 Q (*) Q 56.9 52.2 Q (*) Q 5,001 to 10,000 ....................... 36 33 Q (*) Q 49.4 44.7 Q 0.1 Q 10,001 to 25,000 ..................... 28 25 1 (*) Q 26.7 23.8 1.4 0.1 Q 25,001 to 50,000 ..................... 17 16 Q (*) 1 19.1 17.8 Q (*) 0.6 50,001 to 100,000 ................... 29 26 1 Q 1 15.6 14.1 0.7 Q 0.5

300

The WIRED Survey. IV. New Dust Disks from the McCook & Sion White Dwarf Catalog  

E-Print Network (OSTI)

We have compiled photometric data from the Wide-field Infrared Survey Explorer All Sky Survey and other archival sources for the more than 2200 objects in the original McCook & Sion Catalog of Spectroscopically Identified White Dwarfs. We applied color-selection criteria to identify 28 targets whose infrared spectral energy distributions depart from the expectation for the white dwarf photosphere alone. Seven of these are previously known white dwarfs with circumstellar dust disks, five are known central stars of planetary nebulae, and six were excluded for being known binaries or having possible contamination of their infrared photometry. We fit white dwarf models to the spectral energy distributions of the remaining ten targets, and find seven new candidates with infrared excess suggesting the presence of a circumstellar dust disk. We compare the model dust disk properties for these new candidates with a comprehensive compilation of previously published parameters for known white dwarfs with dust disks....

Hoard, D W; Wachter, Stefanie; Leisawitz, David T; Cohen, Martin

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Build an oven, cook a meal: How solar energy empowered women in Costa Rica  

Science Conference Proceedings (OSTI)

A pilot solar cooking project in the hot, northern province of Guanacaste promises to serve as a model for community groups wanting to build their own solar ovens. An $8,000 (US) grant has been awarded by the Canadian Embassy in Costa Rica to take the Guanacaste project into a second stage in 1990-91. Two construction workshops, with twelve participants in each, are planned in communities near Oriente. Three women from the Oriente group will have paid jobs as organizational facilitators and workshop supervisors. In popular education this is called the multiplier effect - the users of solar cookers construct the ovens themselves, and then instruct others to do the same. 3 refs.

Blankenship, J. (Canadian Univ. Service Organization, San Jose (Costa Rica))

1990-12-01T23:59:59.000Z

302

Tag: nuclear deterrence | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

nuclear deterrence nuclear deterrence Tag: nuclear deterrence Displaying 1 - 10 of 31... Category: Employees & Retirees "Cook"ing at Y-12 for 70 years We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America. More... Category: Employees & Retirees Red light, green light Even in the face of a furlough, we were thorough, professional and kept an eye on safety and security. More... Category: News Uranium at Y-12: Rolling and Forming Rolling involves preheating a uranium or uranium alloy workpiece and passing it through a mill to reduce its thickness. More... Category: News Uranium at Y-12: Heat Treating and Machining Heat treating operations allow uranium to acquire the appropriate mechanical properties.

303

Tag: Naval Reactors | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

Naval Reactors Naval Reactors Tag: Naval Reactors Displaying 1 - 7 of 7... Category: Employees & Retirees "Cook"ing at Y-12 for 70 years We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America. More... Category: News Y-12 Knows Uranium Y-12 produces many forms of uranium. More... Category: News A Rich Resource Requires Recovery Given the value and scarcity of enriched uranium, Y-12 recycles and reuses as much of it as possible. More... Category: News Seawolf Manufacturing Challenge For decades, attack submarines were either fast or quiet - but never both. The fast subs were so loud that an enemy could hear them long before they were within striking distance. More... Category: News Reliable fuel source

304

Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites

About About Careers Community Employees & Retirees Library Suppliers Contact Us Y-12 Home Y-12 National Security Complex Home Nuclear Deterrence Global Security Naval Reactors Partnerships Security News Search form Search... Search Latest News | B&W Y-12 donates $75,000 to Emory Valley Center Facebook Twitter YouTube Flickr RSS Feature Stories Expertise Our NRFTC trainers have many years of operational experience at Y-12 as well as on numerous international missions. Nuclear Detection and Forensics A strong technical nuclear detection and forensics capability is important to the nation's security. "Cook"ing at Y-12 for 70 years We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America. Young Innovators' Society Awesome Eyeballs visit Y-12

305

Tag: Employees & Retirees | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

Employees & ... Employees & ... Tag: Employees & Retirees Displaying 1 - 10 of 31... Category: Employees & Retirees "Cook"ing at Y-12 for 70 years We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America. More... Category: Employees & Retirees Red light, green light Even in the face of a furlough, we were thorough, professional and kept an eye on safety and security. More... Category: Employees & Retirees Young Innovators' Society Awesome Eyeballs visit Y-12 Tweens spawn ingenious mercury experiment. More... Category: Employees & Retirees United Way Campaign Kick-Off Lady Vols head coach Holly Warlick helps Y-2 kick off the 2013 United Way campaign. More... Category: Employees & Retirees

306

NIST CENTER FOR NEUTRON RESEARCH LAYOUT  

Science Conference Proceedings (OSTI)

... 17 18 19 13 13 Spin Echo Spectrometer offer- ing neV energy resolution, based upon Jlich design, sponsored by NIST, Jlich, and ExxonMobil. ...

2001-02-27T23:59:59.000Z

307

COMPARISON OF PROPORTIONAL AND ON/OFF COLLECTOR LOOP CONTROL STRATEGIES USING A DYNAMIC COLLECTOR MODEL  

E-Print Network (OSTI)

Department of Energy. "Solar heating and Cooling ProjectProgram." ings of the Solar Heating and Operational Resultsin the Control of Solar Heating and Cooling Systems."

Schiller, Steven R.

2013-01-01T23:59:59.000Z

308

Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

kinetic and sum frequency gen- eration vibrational spectroscopy study. Journal of the American Chemicalkinetic studies of their activity and stability against leach- ing. Journal of the American Chemical

Ewers, Trevor David

2012-01-01T23:59:59.000Z

309

China Energy Databook - Rev. 4  

E-Print Network (OSTI)

com- mercial energy source, petroleum began contribut- ing aFrom British Petroleum. Source: China Energy StatisticalSource: United Nations, 1994; World Energy Council, 1992; British Petroleum,

Sinton Editor, J.E.

2010-01-01T23:59:59.000Z

310

An Attractor-Repeller Approach to Floorplanning  

E-Print Network (OSTI)

ing the optimal positions for a given set of modules of fixed area (but perhaps ...... 51. This problem has 10 mobile modules. (departments) and, in contrast with...

311

Markets expect Marcellus growth to drive Appalachian natural gas ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

312

Why Sandia?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia? Sandia was doing cyber before the term cyberspace existed. Today, with cybersecurity a daunting - and rapidly grow- ing - national security problem, Sandia is applying...

313

FEMP Outdoor Solid State Lighting Intiative: Resources for Outdoor...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fact Sheet - The Consortium shares technical information and experi- ences related to LED street and area light- ing demonstrations. The Consortium also serves as an objective...

314

Three Public Neighborhoods [EDRA / Places Awards -- Research  

E-Print Network (OSTI)

Enhanced maintenance and management performance. Improvedbetter maintenance, stricter management and increasedand management of the importance of their collective contribution to redevelopment and ongo- ing maintenance.

Nesmith, Barbara Stabin

2001-01-01T23:59:59.000Z

315

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... CAFE standards August 3, 2012 Fuel economy standards have affected vehicle efficiency.

316

Recently, S&P 500 Index and WTI crude oil futures price movements ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... One notable exception to this recent price correlation came on August 9.

317

STATE OF GREEN bUSINESS 2012  

Science Conference Proceedings (OSTI)

... Cool technologies are start- ing to make home energy efficiency more com ... years, hundreds of millions of households and businesses worldwide will ...

2013-07-29T23:59:59.000Z

318

Member News_Dec 2011_7M.indd - TMS  

Science Conference Proceedings (OSTI)

The nomination form and support- ing documentsincluding ... bridge University's science program, and then just to see ... a pipe organ construction business in.

319

METAHEURISTIC HYBRIDIZATION WITH GRASP 1. Introduction ...  

E-Print Network (OSTI)

Apr 14, 2008 ... ing, scheduling, inventory and production planning, and facility location. ..... that the size of the neighborhood be such that its exploration can.

320

Secretaries Chu and Salazar to Convene Meeting on Strengthening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commandant for Operations, United States Coast Guard Andrew Inglis, Chief Executive of Exploration & Production, BP Rex W. Tillerson, Chairman& CEO, ExxonMobil Hon. Don Winter,...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Shot boundary detection using the moving query window  

Science Conference Proceedings (OSTI)

... and after it will usually be near- symmetrical. ... while using only the luminance component of the ... Proceed- ings of the SPIE; Visualization and Optimi ...

2002-11-08T23:59:59.000Z

322

Georgia - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Georgia's power grid was previously part of an integrated South Caucasus network.

323

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

324

FLAMMABILITY OF HFC/HCFC -AIR MIXTURES AT ...  

Science Conference Proceedings (OSTI)

... a hatch for inspection and cleaning, sockets for installation of pressure transducers, thermocouples and an igniter and a jacket for thermostat- ing. ...

2011-10-13T23:59:59.000Z

325

View / Download - TMS  

Science Conference Proceedings (OSTI)

neer at EWI, Columbus, Ohio. Work- ing in the materials group, he provides expertise on ceramics and fundamen- tal materials science to clients in such.

326

Assessment of Hybrid Geothermal Heat Pump Systems - Technology...  

NLE Websites -- All DOE Office Websites (Extended Search)

cool- ing needs of the building and offers general guidelines Assessment of Hybrid Geothermal Heat Pump Systems Geothermal heat pumps offer attractive choice for space...

327

February 2010 TOC.indd  

Science Conference Proceedings (OSTI)

Feb 2, 2010 ... and geothermal power is available. Ad- ditional sources of hydro power are be- ing developed in China and Brazil and this trend is expected to...

328

Estimation of Hurricane Wind Speed Probabilities: Application ...  

Science Conference Proceedings (OSTI)

... of experienc- ing nonlinear behavior under exceptionally strong windstorm events, or for the design of Liquid Natural Gas (LNG) facilities, required ...

2013-07-26T23:59:59.000Z

329

Sandia Labs Accomplishments 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

THz transceiver. Engineering sciences The first large-scale liquefied natural gas (LNG) fire test in the Phoenix series was successfully conducted. The result- ing fire was...

330

DISTRIBUTED SENSOR PROCESSING OVER AN AD HOC ...  

Science Conference Proceedings (OSTI)

... ing mechanisms that consider the remaining battery life of a node? ... The Linked Cluster algorithm (LCA) [1] was used to self-organize the network ...

2009-02-03T23:59:59.000Z

331

Impact of Ground-level Aviation Emissions on Air Quality in the Western United States.  

E-Print Network (OSTI)

??The aviation industry has experienced sustained growth since its inception result- ing in an increase in air pollutant emissions. Exposure to particulate matter less than (more)

Clark, Eric Edward

2010-01-01T23:59:59.000Z

332

View / Download  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames

333

COMMUNICATIONS OF THE ACM January 2002/Vol. 45, No. 1 43 ameBots [1] is a virtual reality  

E-Print Network (OSTI)

is available in Tcl/Tk, Java, C/C++, and more. Tools for visualiz- ing the terrain in which agents interact

Kaminka, Gal A.

334

SHA-3 Conference, August 2010, CubeHash  

Science Conference Proceedings (OSTI)

... he analysis! ... were the easy issues. issues, most interesting arty analyses of CubeHash: ingly sophisticated ntial attacks. ... No Limited RAM size? ...

2012-05-30T23:59:59.000Z

335

Health and Rights at the Margins  

E-Print Network (OSTI)

City, on the China-Myanmar line, the flow of drugs, people,in China when a study found that 146 inject- ing drug users

Shih, Elena

2012-01-01T23:59:59.000Z

336

A NONSTANDARD SIMPLEX ALGORITHM FOR LINEAR ...  

E-Print Network (OSTI)

standard simplex algorithm. 2. Pivoting operations. In the next section, we describe column and row pivot- ing operations. This topic is closely related to the ...

337

eTuner: tuning schema matching software using synthetic scenarios  

Science Conference Proceedings (OSTI)

ranked list of answers to the human user. In such sce- narios ... manually, largely by trial and error a time consum- ing, frustrating, and error prone process.

338

OP - SFNET - Volume 15, Number 2 March 15, 2008  

Science Conference Proceedings (OSTI)

... ing WAVE - WAVElets S - Signal processing People interested in attending the workshop and/or the banquet can register using the website http ...

2008-06-30T23:59:59.000Z

339

Gender and Modernity in Colonial Korea  

E-Print Network (OSTI)

by Jennifer J. Jung-Kim Gender & Modernity in Colonial Koreathe ongo- ing reformulation of gender identities. First, Iupdate he reconstruction of gender identities My findings

Jung-Kim, Jennifer J.

2006-01-01T23:59:59.000Z

340

Table 5.13d Petroleum Consumption Estimates: Electric ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, ... For 1949-1979, data are for gas turbine and internal combustion plant use of petroleum. For 1980-2000, ...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

MEASUREMENT SCIENCE AND TECHNOLOGY FOR THE ...  

Science Conference Proceedings (OSTI)

... To boost fuel efficiency, the US auto industry is striv- ing to manufacture cars from lightweight ... for evaluating how parts of a hydro- gen pipeline ...

2012-11-14T23:59:59.000Z

342

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

Department of Energy, Energy Storage Division through thegeneration and energy storage, Presented at Frontiers ofIn Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

343

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

aquifers for thermal energy storage. Problems outlined aboveModeling of Thermal Energy Storage in Aquifers," Proceed-ings of Aquifer Thermal Energy Storage Workshop, Lawrence

Tsang, C.-F.

2011-01-01T23:59:59.000Z

344

Exhibition Directory  

Science Conference Proceedings (OSTI)

Feb 7, 2008 ... Fundamentals ..... ing ASM Handbooks Online, ASM Alloy Center and the Al- ..... sales engineers to answer any questions you may have.

345

Automated extraction and classification of thunderstorm and ...  

Science Conference Proceedings (OSTI)

... found that thunder- storms dominated the wind climate in West Texas. ... may be unrealistically long, suggest- ing that intermediate beginning and ...

2013-01-17T23:59:59.000Z

346

Total Energy - Data - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

347

Press Room - Press Releases - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

348

The Ethics of Industry Experimentation Using Employees: The Case of Taste-Testing Pesticide-Treated Tobacco  

E-Print Network (OSTI)

RJ, Barbeau EM. Tobacco industry documents: com- paring theRE, Balbach ED. Tobacco industry documents: treasure trovecombined meet- ing of the Industry Technical Committee and

McDaniel, Patricia A; Solomon, Gina; Malone, Ruth E

2006-01-01T23:59:59.000Z

349

Ctontents  

Science Conference Proceedings (OSTI)

... "Time that material started flaming where ... a 4D shift from left to right, and start- ing with ... by repeating the length change calcula- tions starting at the ...

2003-10-14T23:59:59.000Z

350

A new lower bound for one-machine earliness-tardiness scheduling  

E-Print Network (OSTI)

the 50-job instances remain unsolved within a large time limit. ..... Our heuristic is based on the analysis of the pseudo-schedule correspond- ing to the optimum...

351

The NIST Length Scale Interferometer  

Science Conference Proceedings (OSTI)

... This approach to measurements was pioneered by Churchill ... as part of this study of systematic effects but ... the stand- ing wave train between the ...

2013-10-22T23:59:59.000Z

352

International Carbon Dioxide Emissions and Carbon Intensity  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

353

Angola - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... but in the short-term access to power will remain a challenge.

354

Few transportation fuels surpass the energy densities of gasoline ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

355

Fast dimensional inspection of deformable parts from partial views Andres Jaramillo a  

E-Print Network (OSTI)

Nacional de Colombia, Cra 27 No. 64-60 Manizales, Caldas, Colombia b Depto. Ing. Meca´nica y Mecatro

Alberta, University of

356

Qatar - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, ... voluntary report- ing, ... Qatar's Oryx GTL project is in operation and the Pearl GTL project is expected to begin ...

357

Invariant semidefinite programs - Optimization Online  

E-Print Network (OSTI)

V.I. Levenshtein, Universal bounds for codes and designs, in Handbook of Cod- ing Theory, eds V. Pless and W. C. Huffmann, Amsterdam: Elsevier, 1998,.

358

Structural Changes During Thermal Fatigue of Two Nickel-Based ...  

Science Conference Proceedings (OSTI)

greatly affect the thermal endurance of these heat-resisting alloys. I?. ... factors govern- ing the thermal fatigue behavior of a number of commercial nickel-.

359

Netherlands - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (BkWh) of electricity in 2011, mostly from conventional thermal power plants.

360

at Clemson University Department of Forest Resources  

E-Print Network (OSTI)

prediction. For. Sci. 54(5):553­566. ZHANG, L., J.A. MOORE, AND J.D. NEWBERRY. 1993. Disaggregat- ing stand

Bolding, M. Chad

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

362

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

using aquifers for thermal energy storage. Problems outlinedmatical Modeling of Thermal Energy Storage in Aquifers,"Proceed- ings of Aquifer Thermal Energy Storage Workshop,

Tsang, C.-F.

2011-01-01T23:59:59.000Z

363

U.S. energy intensity projected to continue its steady decline ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Light-duty vehicles are by far the largest energy consuming part of ...

364

Homeward Bound: Food-Related Transportation Strategies in Low Income and Transit Dependent Communities  

E-Print Network (OSTI)

s Ad Hoc Food Security ing Home the Broccoli: Innovativeor administrative home for food security planning, includingtheir goods home. broadly, food security approaches. The

Gottlieb, Robert; Fisher, Andrew; Dohan, Marc; O'Connor, Linda; Parks, Virginia

1996-01-01T23:59:59.000Z

365

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... A report of historical annual energy statistics. For many series, ...

366

View / Download - TMS  

Science Conference Proceedings (OSTI)

neering at the University of Leeds,. United Kingdom. She received the award for research on bioengineer- ing, in particular on the tribology of hip replacements.

367

Die emanzipierte Emanzipationsgegnerin: Caroline Pichlers theoretische Schriften  

E-Print Network (OSTI)

Lit- eraturwissenschaft. Hrsg. Inge Stephan und SigridVon Brgern und ihren Frauen. Hrsg. Mar- gret Friedrich undEin Bonner Symposium. Hrsg. Karl Konrad Polheim. Bonn:

Laukov, Lucia

2011-01-01T23:59:59.000Z

368

NANOSTRUCTURED CATALYTIC MEMBRANES - Argonne National Laboratory  

different sources, including coal, natural gas, or biomass such as corn. NCMs also can be used for selective ... ing production costs, and improving ...

369

A Provably Secure Operating System  

Science Conference Proceedings (OSTI)

... ing availability of desired facilities, correctness of ... hierarchical structure and the doctrine of invisibility of ... An on-line facility for interactive editing of ...

2013-04-15T23:59:59.000Z

370

Passive Cooling of a Micromechanical Oscillator with a ...  

Science Conference Proceedings (OSTI)

... Closely related passive cooling has been reported in [9,20 ... Although rather modest cooling is obtained here ... eventually provide ground state cool- ing ...

2007-09-26T23:59:59.000Z

371

Section 4.1.3 Natural Ventilation: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

in and through build- ings. These airflows may be used both for ventilation air and for passive cooling strategies. Natural ventila- tion is often strongly preferred by building...

372

Cooperative motions in supercooled liquids and glasses  

E-Print Network (OSTI)

method[167, 168, 169] (WHAM). The resulting free energy pro?in ?gure 5.4a. Us- ing WHAM and the library construction

Stevenson, Jacob D.

2009-01-01T23:59:59.000Z

373

How much tax do we pay on a gallon of gasoline and diesel fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

374

Does EIA publish off-road diesel fuel prices? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

375

Laser Plasma Particle Accelerators: Large Fields for Smaller Facility Sources  

E-Print Network (OSTI)

Scientific Comput- ing (NERSC) Center Analytics Team, usingsimulations on Seaborg at NERSC, made possible by an INCITEand ongoing work on Franklin at NERSC and Atlas at Lawrence

Geddes, Cameron G.R.

2010-01-01T23:59:59.000Z

376

What do you prefer? Using Preferences to Enhance Learning Technology  

E-Print Network (OSTI)

-based courses to self-organized home-based learning mak- ing use of on-line material. These courses might target

Olmedilla, Daniel

377

Basing Transport Planning on Principles of Social Justice  

E-Print Network (OSTI)

M. Frost, et al. (2000). Transport and Social Exclusion inG. Willumsen. (1994). Modelling Transport. Chichester: JohnG. Willumsen. (2001). Modelling Transport. Chichester: John

Martens, Karel

2006-01-01T23:59:59.000Z

378

A GENETIC ALGORITHM FOR THE WEIGHT SETTING PROBLEM ...  

E-Print Network (OSTI)

Oct 9, 2001 ... versity of Michigan, 1971. [16] Internet Engineering Task Force. Ospf version 2. Technical Report RFC 1583, Network Work- ing Group, 1994.

379

GROWTH OF PACIFIC SAUR~ COWLABlS SAlRA, IN THE NORTHEASTERN AND NORTHWESTERN PACIFIC OCEANI  

E-Print Network (OSTI)

on the embryonic development of killifish rpnnl"t.p.1i hv Arm"trona "nli r.h;]n il QAI'\\ {)h".,.r,,_ ing

380

Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

MOST Multiple Objective Spanning Trees Repository Project  

E-Print Network (OSTI)

VLSI layout, electricity, water, telecommunication or traffic networks. (Sack and ... a set of trade-off compromises between all concurring weights, result- ing in a...

382

Vehicle use varies across U.S. regions - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Reliance on vehicles can vary significantly across the United States.

383

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, ...

384

Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, 1949-2010:

385

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... flexible fuel vehicles October 10, 2013 New-vehicle fuel economy continues to increase.

386

Essays on Foreign Direct Investment, Growth and the Environment  

E-Print Network (OSTI)

high levels of capital intensity. The principal limitationof labor at current capital intensity using the base-periodlabor at base-period capital intensity us- ing the current

Gu, Waner

2011-01-01T23:59:59.000Z

387

Energy Star Building Upgrade Manual Introduction Chapter 1  

NLE Websites -- All DOE Office Websites (Extended Search)

offer- ings. The label now covers new homes, commercial and institutional buildings, residential heating and cooling equipment, major appliances, office equipment, lighting,...

388

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

389

Legal Metrology Devices Program  

Science Conference Proceedings (OSTI)

... such as retail motor-fuel dispensers or gas pumps, vehicle mounted meters for delivering home heating oil, and liquefied petroleum gas liquid-ing ...

2013-07-31T23:59:59.000Z

390

Planning Water Use in California  

E-Print Network (OSTI)

the University of Maryland Water Policy Collaborative, 2006.FURTH ER READ ING California Department of Water Resources.California Water Plan Update 2005: A Framework for Action.

Eisenstein, William; Kondolf, G. Mathias

2008-01-01T23:59:59.000Z

391

Using seafloor geodesy to monitor volcanic collapse on the south flank of Kilauea Volcano, Hawaii  

E-Print Network (OSTI)

accommodat- ing subsidence in the summit caldera (Lipman etshow the amount of subsidence (in meters) measured theremagnitude seaward slip and subsidence on the south ?ank as

Phillips, Kathleen A.

2006-01-01T23:59:59.000Z

392

Domestic Violence and Risk Factors among Korean Immigrant ...  

Science Conference Proceedings (OSTI)

Mar 23, 2007 ... ing laundry (Wife), driving the car (Husband), shopping for groceries (Wife), paying bills (Both), taking care of the chil- dren (Wife), disciplining...

393

Review of Literature Related to Residential Ventilation Requirements  

E-Print Network (OSTI)

Refrigerating, and Air -Conditioning Engineers, Atlanta, GRefrigerat ing, and Air-Conditioning Engineers, Atlanta, Gof Ventilation and Air Conditioning: Is C E R N up to Date

McWilliams, Jennifer; Sherman, Max

2005-01-01T23:59:59.000Z

394

China consumes nearly as much coal as the rest of the world ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

395

Ohio - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... Ohio Energy Resources Division;

396

X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

evacuations. Following the storm-related interruptions to production, refin- xii Energy Information AdministrationPetroleum Marketing Annual 2002 ing, and delivery...

397

Blanchard Cr JohnsonGulch  

E-Print Network (OSTI)

Whale Cr Tepee Cr Thoma Cr KintlaCr Logg ing Cr Anaconda Cr Bo wmanCr Kintla Cr Cam a s Cr A naco nda

398

Next generation solutions for the energy services industry  

E-Print Network (OSTI)

to target cost-effective energy efficiency upgrades. and analyze energy efficiency cost and performance data canEnergy Efficiency Services to Large Commercial Firms: Operat- ing Cost

Kumar, Satish; Kromer, Steve

2006-01-01T23:59:59.000Z

399

South Carolina - State Energy Profile Analysis - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

400

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

U.S. States - Maps - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

402

Georgia - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

403

Rhode Island - State Energy Profile Overview - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

404

United States - Rankings - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

405

Delaware - Compare - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

406

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

407

Statistical Analysis of Dross Data for Hydro Aluminium Casthouses  

Science Conference Proceedings (OSTI)

Presentation Title, Statistical Analysis of Dross Data for Hydro Aluminium Casthouses. Author(s), Christian Rosenkilde, Inge Johansen, Amanda Bowles. On-Site...

408

Land Use Planning to Promote Marine Conservation of Coral reef Ecosystems in Moorea, French Polynesia  

E-Print Network (OSTI)

material, creat- ing rich compost that can be used forcrops. Manage Solids Compost: Pig waste and carcasses can bematerials such as mats. Compost Solid waste from the solid

Timothy Duane

2006-01-01T23:59:59.000Z

409

The Cultivar newsletter, Spring/Summer 2005  

E-Print Network (OSTI)

to disease; and incorporating compost to enhance biologicalways to adjust fertilizer and compost levels and applicationSUMMER 2005 ing pre-plant compost applications, especially

Brown, Martha

2005-01-01T23:59:59.000Z

410

The Riemann Hypothesis Peter Borwein - CECM  

E-Print Network (OSTI)

The distribution of such prime numbers among all natural numbers does ... ing the distribution of prime numbers. ... inent mathematician of his generation, raised .

411

The Influence of VIM Crucible Composition, Vacuum Arc Remelting ...  

Science Conference Proceedings (OSTI)

ing a weight of 23 kilograms. (50 pounds). The as-cast ingot surface was maintained on all ingots. VIM Ingot Cleanliness. Evaluation. The cleanliness evaluation.

412

Research Article A Comprehensive Evaluation of Indoor ...  

Science Conference Proceedings (OSTI)

... fixed-length sliding window originat- ing at the beginning of the impulse response ... ments with range below 10 m to protect it from over- load and also ...

2007-12-10T23:59:59.000Z

413

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

414

Highlights Year in Review - 2004 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Highlights Year in Review - 2004 International crude oil prices rose considerably dur-ing 2004. While many issues contributed to higher prices, perhaps the most ...

415

Meso-machining  

NLE Websites -- All DOE Office Websites (Extended Search)

following meso-machin- ing technologies: * Focused ion beam (FIB) machining, * Micro-milling and -turning, * Femto-second laser machining * Micro-Electro Discharge Machining...

416

View / Download  

Science Conference Proceedings (OSTI)

director of the Quad Cities Manufac- turing Laboratory, a nonprofit research and development company in the Rock. Island ArsenalJoint Manufactur- ing and...

417

View / Download - TMS  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames ...

418

CONTROL OF POPULATION DENSITIES SURROUNDING NUCLEAR POWER PLANTS. VOLUME 5 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

Commission. Office of Nuclear Reactor Licens- ing. StandardCommission. Office of Nuclear Reactor Regula- tion.Nuclear Regulatory Commission Standard Review Plan for Light Water Reactor

Nero, jA.V.

2010-01-01T23:59:59.000Z

419

Advanced Modeling and Evaluation of the Response of Base-Isolated Nuclear Facility Structures to Vertical Earthquake Excitation  

E-Print Network (OSTI)

II Offshore Platforms. environmentalprotection.com.retrofit of Chirag 1 offshore platform, Proceed- ings, Int.have been used for offshore oil platforms including the

Keldrauk, Eric Scott

2012-01-01T23:59:59.000Z

420

Evince Technology | Open Energy Information  

Open Energy Info (EERE)

Evince Technology Jump to: navigation, search Name Evince Technology Place United Kingdom Sector Efficiency, Wind energy Product String representation "Evince has pion ... ing...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

422

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

423

Berkeley Lab Computing Sciences: Accelerating Scientific Discovery  

E-Print Network (OSTI)

facilities NERSC and ESnet and by conduct- ing appliedCOMPUTATIONAL SCIENCE ESnet is a reliable, high- bandwidthdevelopment. NERSC and ESnet staff participate in advanced

Hules, John A

2009-01-01T23:59:59.000Z

424

Quinine, an old anti-malarial drug in a modern world: role in the treatment of malaria  

E-Print Network (OSTI)

versus quinine-doxycycline in the Western Amazon region ofof quinine plus doxycycline, tetracycline or clindamycin astreated with quinine+doxycycline [46]. Consider- ing the

2011-01-01T23:59:59.000Z

425

Application of a simple and sensitive GCMS method for ...  

Science Conference Proceedings (OSTI)

ing with isopropanol, deionized water, and isopropanol, dried at room ... several months after the last intake, because they enter the hair roots from the...

426

Meshless Deformable Models for LV Motion Analysis Xiaoxu Wang Dimitis Metaxas  

E-Print Network (OSTI)

-Assisted Intervention, pages 469­476, 2007. 6 [3] T. Chen, S. Chung, and L. Axel. Automated tag tracking us- ing gabor

427

Physical Similitude in Hierarchical Engineered Systems  

E-Print Network (OSTI)

scal- ing methodology for severe accident technical issuein the case of severe accidents, bismuth alloys have beenexperiments investigating severe accident phenomenology are

Blandford, Edward David

2010-01-01T23:59:59.000Z

428

1471-2164-10-34.fm  

NLE Websites -- All DOE Office Websites (Extended Search)

of Z. mobilis for bio-ethanol fermentation from the lignocellulosic res- idues such as corn stover 9. Z. mobilis ferments glucose, fructose, and sucrose produc- ing ethanol...

429

Can feedstock production for biofuels be sustainable in California?  

E-Print Network (OSTI)

gallons annually of corn ethanol, 1 bil- lion gallons oflocations) and corn for ethanol, and oil palm, soybean andinvestment in corn-grain-based ethanol manufactur- ing in

Kaffka, Stephen R.

2009-01-01T23:59:59.000Z

430

High-rate chemical vapor deposition of nanocrystalline silicon carbide films by radio frequency thermal plasma  

E-Print Network (OSTI)

by liquid spray injection of disilanes into an argon­hydrogen RF plasma operat- ing at 20­40 kPa [4]. Here

Zachariah, Michael R.

431

RADIOLOGICAL HEALTH AND RELATED STANDARDS FOR NUCLEAR POWER PLANTS. VOLUME 2 OF HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

On the ather hand, ather radionuclides, such as I and Sr,The remain- ing radionuclides cantributed much less to thedoses Important radionuclides for background exposures and

Nero, A.V.

2010-01-01T23:59:59.000Z

432

Section 9.7 Employee Incentive Programs: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Management Awards are presented by DOE in conjunction with the Federal Interagency Energy Policy Committee (the "656" Committee). The program recognizes outstand- ing...

433

Coal - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Electric power sector consumption of coal by census region, 2010

434

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network (OSTI)

of iron de?ciency on photosynthesis Aimee M. Terauchi rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

435

DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

are potential raw materials for production of biofuels. TheRaw plant material, or dedicated bioenergy crops, can provide the starting point for mak- ing biofuels.

Gilbert, David

2009-01-01T23:59:59.000Z

436

STATEMENT OF CONSIDERATIONS CLASS WAIVER OF U.S. AND FOREIGN...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

model ing and simulation. This approach will harness the power of systems biology to overcome bioma ss recalcitrance. The BESC currently has eighteen members...

437

Synthesis of D-Glucose-1-C14 and D-Mannose-1-C14  

Science Conference Proceedings (OSTI)

... The product weighed 470 mg, rep- resenting a ... ing formation of esters, condensation products, and the ... The alco- holic liquors were neutralized with ...

2006-03-29T23:59:59.000Z

438

Distributed Energy Harvesting for Energy Neutral Sensor Networks  

E-Print Network (OSTI)

to exploit to develop piezoelectric energy harvesters. Manyenergy. Current piezoelectric energy harvest- ing researchwill improve piezoelectric energy harvesting technologys

Kansal, Aman; Srivastava, Mani B.

2005-01-01T23:59:59.000Z

439

Quantifying Changes in Building Electricity Use, with Application to Demand Response  

E-Print Network (OSTI)

build- ings, Journal of Solar Energy Engineering, vol. 120,buildings, Journal of Solar Energy Engineering, vol. 120,modeling, Journal of Solar Energy Engineering, vol. 120, p.

Mathieu, Johanna L.

2012-01-01T23:59:59.000Z

440

The TREC-2001 Video Track Report  

Science Conference Proceedings (OSTI)

... Marchionini, 2001), the NIST Digital Video Library (Over, 2001 ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

The TREC-2002 Video Track Report  

Science Conference Proceedings (OSTI)

... on Project RDD/G/235 to the British Library Research and ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

442

Blueberry research launches exciting new California specialty crop  

E-Print Network (OSTI)

2. Estimated highbush blueberry crop, 2004 State Growers whoin spearhead- ing specialty crops research and efforts tonew California specialty crop Manuel Jimenez Francis

Jimenez, Manuel; Carpenter, Francis; Molinar, Richard H.; Wright, Kathryn; Day, Kevin R.

2005-01-01T23:59:59.000Z

443

A Statistical Profile of Horticultural Crop Farm Industries in California  

E-Print Network (OSTI)

Profile of Horticultural Crop Farm Industries in Californiaproject funded by the Federal Crop Insurance Corporation,Williams. Model- ing Farm-Level Crop Insurance Demand with

Lee, Hyunok; Blank, Steven C.

2004-01-01T23:59:59.000Z

444

License Application Guidelines  

6. A review of the competition currently existing or expected to develop follow-ing introduction of the product. 7. A comparison of this product to ...

445

Instructions for use Phenomenology of supersymmetry SU5 GUT with neutrinophilic Higgs boson  

E-Print Network (OSTI)

of the primary goals of LHC is the search for the Higgs boson, the last miss- ing ingredient of the Standard

Tsunogai, Urumu

446

timeline_PNNL_PRINT.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

1997 PNNL developed a highly sensitive sampleranalyzer that can be used to prevent proliferation of nuclear weapons by remotely detect- ing trace quantities of materials...

447

BFRL98Annual Cvrs 1-4  

Science Conference Proceedings (OSTI)

... In addition to the programs of the individual ... of roof solar reflectance on the annual heat- ing ... BFRL's Thermal Analysis Research Program (TARP) for ...

2000-03-16T23:59:59.000Z

448

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

449

Technology Transfer Division - Los Alamos National Lab: National ...  

administer commercial, noncommercial, ... As one of the U.S. Department of Energys multiprogram, ... ing 47 technical areas with 8 million square feet under roof.

450

Monitoring Power Quality  

Science Conference Proceedings (OSTI)

... or without filter), isola- tion transformer, voltage regulator ... reality before expensive line condition- ing equipment is ... if any line conditioning is required. ...

2013-05-17T23:59:59.000Z

451

southeastern geographer, 44(1) 2004: pp. 814 Rethinking the Region  

E-Print Network (OSTI)

-runners, allow- ing for the sale of cotton to European mar- kets and the purchase of all-important guns and steel

Gamble, Douglas W.

452

48 CRO MAR/APR 2008 Climate Change  

E-Print Network (OSTI)

regulations that limit tobacco sales and public smoking. Similarly,therewillbenoscientificsmok- ing gun Companies looking for smoking gun should skip the science,looktotheeco

Hoffman, Andrew J.

453

Petroleum & Other Liquids - Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Projects published on Beta are not final and may not include up-to-date data.

454

Evaluation of antioxidative/antimicrobial potential of Oriental nutraceutical herb extracts in raw and cooked goat meat and beef products  

E-Print Network (OSTI)

This study was conducted to determine the effects of alcohol extracts of several Oriental nutraceutical herbs on storage properties of raw and cooked ground goat meat and beef. White peony root, red peony root, sappanwood stem, rehmania root, moutan cortex root, angelica root, and rosemary leaves were dehydrated, extracted with 95% ethanol, and freed of the solvent. The sappanwood, moutan cortex, and rosemary samples contained the largest amounts of total phenolics. Extracts were added to ground goat meat, and treated meat samples were aerobically stored at 4C for 6 days, with or without cooking. Each herbal extract was also added to ground beef at 0.25% (w/w), with or without adding NaCl at 2% (w/w), and stored as raw and cooked patties. Peony (red or white) root extracts, whether added at 0.5, 1, or 2% levels, showed strong antioxidant effects in cooked goat meat, decreasing TBARS content more than 90% at day 6. The extracts were less antioxidative in raw goat meat, lowering the day-6 TBARS content less than 50%. The extracts from rehmania root, sappanwood, and moutan cortex were as antioxidative as the extracts from red and white peony roots, decreasing the TBARS content in cooked goat meat more than 88% at day 6. When red peony root extract was evaluated for antimicrobial activity in raw goat meat, it decreased APCs at day 3, but not at day 6. Extracts from white and red peony roots, sappanwood, moutan cortex, and rosemary were highly antioxidative in both raw and cooked beef patties, decreasing TBARS more than 88% by day 6. However, rehmania and angelica root extracts were less inhibitory. The antioxidant activity of the herbal extracts correlated (P 0.05) with total phenolic levels. All the extracts, other than rosemary extract, showed no antimicrobial activity in raw beef patties at either day 3 or day 6, presumably due to the relatively high microbial counts found in the initial untreated meat. Rosemary extract decreased APCs only at day 3.

Han, Jaejoon

2001-01-01T23:59:59.000Z

455

Environmental review for Site A/Plot M, Palos Forest Preserve, Cook County, Illinois  

Science Conference Proceedings (OSTI)

This report is an environmental review of two sites known as Site A and Plot M, which are located in the Palos Forest Preserve of the Forest Preserve District of Cook County, approximately 20 mi southwest of downtown Chicago and about 3 mi east of the current site of Argonne National Laboratory (ANL). An enlarged map of the area around the sites is shown in a figure. Site A covers about 19 acres, and Plot M covers about 1 acre. This document consists of the following sections: a review of the site history and environment, a description of the conceptual pathway models for both Site A and Plot M and a brief discussion of previous sampling events, a discussion of possible transport pathways, an evaluation of the Phase 2 Work Plan for Site A, a review of the applicable or relevant and appropriate regulations (ARARs), and recommendations for future study. The recommendations are based on an evaluation of previously collected data. Where data were sufficient, a geologic conceptual model was developed. If data were not sufficient to develop a model, recommendations for data collection are made. A new base map was developed for the site by using the base survey conducted in the 1940s, aerial photographs dating back to 1948, and site visits.

Biang, R.P.; Yuen, C.R.; Avci, H.I.; Haffenden, R.

1993-06-01T23:59:59.000Z

456

Modeling and Reasoning about Everyday Events Dustin Arthur Smith  

E-Print Network (OSTI)

that is inexpensive (and what price is "expensive"?).For example, the way one travels to an event (e.g., taxi, foot already filled in, or searching for alternative restaurants in the expected neigh- borhood and price range- ing context aware assistance, us- ing information from the calen- dar program and the cellphone (e

457

Port Lions, Alaska 26 January 2006  

E-Print Network (OSTI)

to the benefits it produces, when you consider that high school and college baseball is played during the time- ing the season. Maintain Pitcher's Mound and Home Plate A few minutes each day repairing the pitcher's mound and home plate area keeps them in good play- ing condition. Sweep the mound with a stiff broom

US Army Corps of Engineers

458

Annual Report of ADVANCE Program for University of Wisconsin-Madison  

E-Print Network (OSTI)

in Natural Language Process- ing, pages 620­627, Vancouver, British Columbia, Canada, October. Gabriele of the Ninth International Workshop on Pars- ing Technology, pages 83­92, Vancouver, British Columbia, October of syntactic and semantic representations is a viable alter- native to approaches based on a pipeline of local

Sheridan, Jennifer

459

Kansas Board of Regents Mandatory Retirement Plan Enrollment Information  

E-Print Network (OSTI)

Plan Providers: ING and TIAA-CREF. For additional information about the Plan, see the KU HR website://www.ingretirementplans.com/custom/KansasBOREnrollmentServices/. For additional ING information, visit http://www6.ingretirementplans.com/SponsorExtranet/KansasBOR/. TIAA-CREF: To enroll and to find fund lineup information, see the TIAA-CREF microsite http://www.tiaa

Peterson, Blake R.

460

A Novel Process for Demulsification of Water-in-Crude Oil Emulsions by Dense Carbon Dioxide  

E-Print Network (OSTI)

using a wide variety of equipments such as centrifuges, rotary vacuum filters, belt presses, and filter concentrations behave as a liquid, with Newtonian flow characteristics. Centrifugal dewater- ing is possible obtained, which was considered acceptable since a dry- ing system followed centrifugation. Pressure filters

Kilpatrick, Peter K.

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

REcuRsiVE TRust-REGion MEthoDs FoR MuLtiLEVEL NonLinEAR ...  

E-Print Network (OSTI)

Aug 11, 2004 ... the minimie ing se& uence at level6s 1.`r f%n&s 1b&t belongs to this minimie ing se uence,Hg e use the notation n55 Pt...

462

Pour diffusion immdiate En pleine refonte du rgime forestier,  

E-Print Network (OSTI)

en 2010 pour répondre aux nouveaux défis Robert Beauregard, doyen de la Faculté de foresterie, de donner des entrevues. Porte-parole Fonctions Sujets Robert Beauregard, ing., ing.f, Ph.D. Doyen de la

Laval, Université

463

Biannual Report Department of Mathematics  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Kohlenbach, Ulrich

464

Abrahamse, W., L. Steg, et al. (2005). "A review of intervention studies aimed at household energy conservation." Journal of Environmental Psychology 25(3): 273-291.  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

465

(S11lSC) sruals,(5lueure8euey4les?qete6l's:olndruoc leuosred Jo uoqcnportur eqt reu? perylldurs  

E-Print Network (OSTI)

of Tsunami Deposits . . . . . . . . . . . . . . . 17 3.5 Search Methods Research (NCTR) was established to conduct re- search and development in support of the NOAA mission was a result of search- ing the tsunami runup database by state with no other conditions and divid- ing

Hack, Robert

466

Long-Term Surveillance Plan for the Site A/Plot M Sites, Palos Forest Preserve, Cook COunty, Illinois  

Office of Legacy Management (LM)

Long-Term Surveillance Plan for the Site A/Plot M Sites Palos Forest Preserve, Cook County, Illinois September 1999 Prepared by U.S. Department of Energy Grand Junction Office Grand Junction, Colorado Work Performed Under DOE Contract Number DE-AC13-96GJ87335 Task Order Number MAC 99-06 Document Number S00218 DOE/Grand Junction Office Site A/Plot M LTSP September 1999 Page iii Contents 1.0 Introduction......................................................................................................................... 1- 1 1.1 Purpose....................................................................................................................... 1- 1 1.2 Legal and Regulatory Requirements.......................................................................... 1- 1

467

Characterization of novel rice germplasm from West Africa and genetic marker associations with rice cooking quality  

E-Print Network (OSTI)

Genetic resource enhancement is the foundation of any good breeding program. Landraces from West Africa, interspecifics between Oryza sativa and Oryza glaberrima and improved lines from the West African Rice Development Association and other research centers were introduced to the Beaumont Rice Research center for in situ evaluation and characterization. Beside the introduction of seeds, milled samples were also introduced for grain chemistry analysis. Field evaluation combined with physicochemical and molecular characterization revealed unique characteristics among African germplasm. New rice for Africa (NERICA) lines performed well in the USA environment. Varieties like Nerica 2, Nerica 3, Nerica 4, and Nerica 5 need more attention because of their superior performance in yield and grain quality. Landraces did not perform well due to their height and late maturity and their resulting problems with lodging. The rapid visco analyzer RVA profiles showed that the cultivar Jaya has unusually strong paste viscosity features. Comparing West Africa samples grown in Cote dâ??Ivoire with those grown in Texas, parameters like AA, ASV, Hot, Cool, and CT were not stongly affected by the environment. According to the Stbk value, cultivars grown in Cote dâ??Ivoire will cook softer than when they were grown in Texas. The lack of the environmental effect is somewhat surprising considering the difference in latitude, soil types, weather patterns, and management practices between the two locations. Apparent amylose is a key element to characterize a rice cultivar; however certain varieties like Cocodrie and Dixiebelle have similar apparent amylose content but dramatically different functional qualities. A population derived from Cocodrie and Dixiebelle was developed for genotypic and phenotypic analysis of grain chemistry traits that affect functionality. It was concluded that the amount of soluble amylose in the grain had a significant effect on flour pasting properties, even when total apparent amylose content did not vary. Marker association studies revealed that the Waxy microsatellite and the Waxy exon 10 SNP markers were associated with soluble amylose content and RVA characteristics. These markers will speed up the development of new rice cultivars with desirable quality characteristics in West Africa and in the USA.

Traore, Karim

2005-08-01T23:59:59.000Z

468

Microsoft PowerPoint - 16.1225_Terry Cooke-Davies - Project Complexity as of 16 Mar  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Complexity Complexity Dr Terry Cooke-Davies, Group Chairman Group Chairman, Human Systems International Talking about Complexity Talking about Complexity Causes of Complexity in Projects Projects Today's Talk Responses to Complexity y 2 Why do we do it, and what do we mean when we are Talking about Complexity? g p y 3 What is Complexity? * No generally agreed definition What is Complexity? No generally agreed definition - "If you don't know what will happen when you kick it, then it is complex." * Any definition risks being inadequate * Any definition risks being inadequate - "Complex" is different from "Complicated" - Complexity is both relative and absolute. What is Complexity p y 4 Why are we so interested in it? * Need for managers of more challenging projects F il f

469

Subject: Proposed 216(h) Regulations To: Brian.Mills@hq.doe.gov and Lot.Cooke@hq.doe.gov.  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 12, 2012 February 12, 2012 Subject: Proposed 216(h) Regulations To: Brian.Mills@hq.doe.gov and Lot.Cooke@hq.doe.gov. We appreciate the opportunity to review the Proposed Regulation for 216(h) of the FPA (16 U.S.C. 824p(h)) and provide comments. After review of the proposed rule, we believe a few changes to the text could greatly improve in the likelihood of reducing the time and cost of necessary environmental reviews, consultations, and permit processing for electric transmission facilities crossing Federal Lands while increasing the efficiency and coordination intended by that section of the Energy Policy Act of 2005 and the nine-agency MOU. Comments are organized by section, with explanation and proposed changes in the wording of a specific section of the proposed rule made in bold.

470

ECOR VAP Flux Corrections, Gap-filling, and Results David R. Cook, Meredith Franklin, Donna J. Holdridge  

NLE Websites -- All DOE Office Websites (Extended Search)

ECOR VAP Flux Corrections, Gap-filling, and Results ECOR VAP Flux Corrections, Gap-filling, and Results David R. Cook, Meredith Franklin, Donna J. Holdridge Argonne National Laboratory, Argonne, IL This work was supported by the U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, Climate Change Research Division, under contract DE-AC02-06CH11357, as part of the Atmospheric Radiation Measurement Program. Argonne National Laboratory is managed by UChicago Argonne, LLC for the U.S. Department of Energy ABSTRACT An eddy correlation (ECOR) value-added product (VAP) has been developed that uses ECOR temperature, humidity, and wetness state (or default values of the same) to determine corrections to and gap-filling of the flux measurements. An outlier routine is used to remove obvious incorrect data before gap-filling is performed.

471

The effects of cooking, storage, and ionizing irradiation on carotenoids, antioxidant activity, and phenolics in potato (Solanum tuberosum L.)  

E-Print Network (OSTI)

Past research conducted by our lab demonstrated that potatoes contain significant levels of phytochemicals important to human health. However, since potatoes are not consumed raw, it is important to determine the effects of processing on these levels. Therefore, the changes in carotenoid content, antioxidant activity, and phenolic content were investigated using combinations of cultivars, cooking methods, storage treatments, and low-dose ionizing irradiation. Carotenoid content was measured via absorbance at 445 nm, 450 nm, and HPLC identification. Antioxidant activity was measured initially and at stabilization via the DPPH method and phenolic content was measured via the Folin method and HPLC identification. Microwaved, baked, fried, and raw potato samples contained more carotenoids than boiled samples. The samples microwaved, baked, and fried contained higher antioxidant activity and phenolics than the boiled or raw samples. However, the compound quercetin dihydrate appeared to decrease with cooking. Carotenoids, antioxidant activity, and phenolics appeared to decrease with storage; however, high storage temperatures and long storage times were believed to cause a dehydration and concentration of compounds, which caused levels to be equal to or greater than before storage. However, this decreasing trend was not linear and there were multiple significant interactions. The compound chlorogenic acid appeared to be quite sensitive to high temperature storage. Irradiation dose appeared to have only a minor, if any, effect on carotenoid levels. The interaction between storage time and irradiation dose was very influential on antioxidant activity. In early stages of storage, higher doses of irradiation had greater antioxidant activity, while, with continued storage, low doses had higher antioxidant activity. Exposure to irradiation appeared to cause an increase in phenolic content, determined by the Folin method. There may be a stimulation, induction, or release of some compounds due to processing; however, its magnitude is not believed to be as great as genetic control. The effects of processing can not be denied and should continue to be investigated. Future studies investigating the health properties of fruits and vegetables, particularly potatoes should include processing effects.

Blessington, Tyann

2005-08-01T23:59:59.000Z

472

The LEAF  

NLE Websites -- All DOE Office Websites (Extended Search)

LEAF LEAF picosecond pulse radiolysis facility at Brookhaven National Laboratory James F. Wishart, a) Andrew R. Cook, and John R. Miller Chemistry Department, Brookhaven National Laboratory, Upton, New York 11973-5000 (Received 9 February 2004; accepted 14 July 2004; published 29 October 2004) The BNL Laser-Electron Accelerator Facility (LEAF) uses a laser-pulsed photocathode, radio-frequency electron gun to generate ജ7 ps pulses of 8.7 MeV electrons for pulse radiolysis experiments. The compact and operationally simple accelerator system includes synchronized laser pulses that can be used to probe or excite the electron-pulsed samples to examine the dynamics and reactivity of chemical species on the picosecond time scale. © 2004 American Institute of Physics. [DOI: 10.1063/1.1807004] I. INTRODUCTION Pulse radiolysis has been an important method for study- ing chemical

473

August 2006 BWXTymes, a newsletter for the employees and friends of the Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

AUGUST 2006 AUGUST 2006 W H AT ' S I N S I D E Mark your calendar-all-hands set 2 Hitch a ride with KAT 4 How I spent my summer vacation 6 Y-12 priorities 8 Kenny Cook, Atomic Trades and Labor Council president, shares his feelings about United Way. I truly believe in United Way and con- tribute not only through payroll deduction but also with my time and energy. What United Way means to me This year, we are seeking to increase ATLC participation, and we are challeng- ing Council affi liates to begin an annual contribution to the campaign or increase the current contribution amount. Many United Way agencies are experiencing shortfalls, and their needs are greater this year because of re- cent natural disasters. I encourage all ATLC employees to focus on what the United Way

474

Determination of compliance with PL 92-500 Section 316(b) for the Donald C. Cook Nuclear Power Plant of the Indiana and Michigan Power Company  

Science Conference Proceedings (OSTI)

Region III of the US Fish and Wildlife Service contracted with the Division of Environmental Impact Studies, Argonne National Laboratory, to make the 316(b) determination for the Donald C. Cook Nuclear Power Plant of the Indiana and Michigan Power Company and to make recommendations for improvement in intake design to facilitate compliance. To conduct this assessment, appropriate literature on screening systems and reports furnished by the applicant on intake design and operation and on ecological studies at the site were reviewed. Modifications of the location and design of the existing intake and possibilities of retrofitting with fine-mesh screening to screen larval forms of fishes were examined. It was determined that currently there is no dictated need for fine-mesh screening of intake flow at the D.C. Cook Nuclear Power Plant.

Sharma, R K; Freeman, III, R F

1980-04-01T23:59:59.000Z

475

Microbiological, sensory, color and chemical characteristics of vacuum-packaged ground beef patties and cooked beef top rounds treated with the salts of various organic acids  

E-Print Network (OSTI)

The study was conducted in two phases. In Phase 1, vacuum-packaged ground beef patties containing sodium lactate, sodium propionate, sodium acetate and sodium citrate at various levels and combinations were stored up to 28 days at 4'C. Addition of sodium lactate alone or in combination with sodium propionate increased the shelf life of the patties by decreasing microbiological growth, decreasing negative flavor notes associated with lipid oxidation and decreasing water activity. Lean color of the patties also was improved by the addition of sodium lactate alone or in combination with sodium propionate. Lipid oxidation as measured by TBA (2-thiobarbituric acid) analysis was unaffected by treatment addition. In Phase 11, cooked vacuum-packaged beef top rounds containing 3% sodium lactate or 3 or 4% sodium lactate in combination with 0. 1 or 0.2% sodium propionate were stored for up to 84 days at 4'C. Addition of any of the treatments to the roasts in this phase greatly reduced total APCs (Aerobic Plate Counts). Positive flavor notes associated with fresh beef were enhanced by ingredient addition and tended to be highest in roasts containing 3% sodium lactate + 0.2% sodium propionate. Cooked roast beef color was enhanced by the additon of sodium lactate alone or in combination with 0. I % sodium propionate. Lipid oxidation and water activity were decreased by the addition of sodium lactate in combination with sodium propionate and pH and cooked yield were increased with any level and combination of ingredient addition.

Maca, Jennifer Vahalik

1995-01-01T23:59:59.000Z

476

Note: Does The Graphemic Buffer Play A Role In Reading?  

E-Print Network (OSTI)

this paper, we investigate the read ing performance of a patient previously reported as hav ing an impairment at the level of the graphem ic buffer (Kay & Hanley , 1994). Desp ite his spelling problems, this patient is good at read ing fam iliar words, at reading nonwords, and at written lexical decision. This pattern of performance is d iscussed w ith respect to Caramazza, Capasso, and Miceli's (1996) recent claim that damage to the graphem ic buffer leads to a problem in reading that w ill be obvious especially when the patient is asked to read nonwords

J. Richard Hanley; Janice Kay

1998-01-01T23:59:59.000Z

477

Performance test reports and comparison of emission characteristics of prototype liquid multifuel burners developed for US military field cooking applications  

SciTech Connect

The objective of this project is to provide data to the U.S. Army Natick RD&E Center on the performance of three prototype burners, which have the capability of firing with multiple types of fuels (diesel and JP-8), and the conventional gasoline-fired M-2 burner. The prototype burners are intended to replace the M-2 unit currently used in food cooking appliances in the Army. The burners supplied to Brookhaven National Laboratory (BNL) for the purpose of testing under this project included one M-2 unit, one M-3 prototype unit designed by Natick, one Babington prototype unit designed by Babington Engineering, and one ITR prototype designed by International Thermal Research Ltd. It should be noted, however, that after the project began, Babington Engineering provided an upgraded prototype unit for testing which replaced the unit initially provided by the Natick Center. The M-3 unit replaced the Karcher unit listed in the contract. The test procedures which were described in a Test Method Report allowed for the measurement of the concentrations of specific compounds emitted from the burners. These compounds included oxygen (O{sub 2}), carbon monoxide (CO), oxides of nitrogen (NOx), formaldehyde, and particulate emissions. The level of smoke produced was also measured by using a Bacharach Smoke Number system (ASTM Standard D2156). A separate Performance Test Report for each burner was prepared as part of this project, and is attached as part of this report. In those reports details of the measurement techniques, instrumentation, test operating conditions, and data for each burner were included. This paper provides a summary and a comparison of the results for all burners. A brief discussion of emissions from other similar small oil combustion systems is also part of this document to provide perspective on the type of contaminants and levels expected from these systems.

Litzke, W.; Celebi, Y.; McDonald, R.

1994-08-01T23:59:59.000Z

478

BWXTymes, A newsletter for the employees and friends of the Y...  

NLE Websites -- All DOE Office Websites (Extended Search)

cameras and sniper detection, Y-12 is forc- ing adversaries to abandon use of armored vehicles or face engagement before they are ready. Thus, offi cers are able to...

479

Role of Surface Proteins in the Deposition Kinetics of Cryptosporidium parvum Oocysts  

E-Print Network (OSTI)

strengths where DLVO theory predicts the absence of an electrostatic energy barrier. An "electrosteric.Additionally,treatmentofsurface watersbynaturalfiltrationthroughalluvialvalleyaquifer sedimentssa process known as bank filtrationsis emerg- ing as a feasible method for the removal

Elimelech, Menachem

480

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

jpg Electric light ing comprises 515,000,000 MWh or 20% of the nation's electricity consumption. Of this total, approximately 10-15% is used to light a building's perimeter zone...

Note: This page contains sample records for the topic "ing cook ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Section 7.1.3 Wood Products: Greening Federal Facilities; Second...  

NLE Websites -- All DOE Office Websites (Extended Search)

wood is being used in a building, there is an opportunity to advance good forest management by specifying certified wood products. When wood is be- ing used for framing-more...

482

Member News August 2012_8S.indd  

Science Conference Proceedings (OSTI)

dering GPS system that has directed them into more than a few tight spots. But for Belt, this ... ing gas money. The Belts plan to eventually settle on a permanent...

483

Lab Tests Demonstrate Effectiveness of Advanced Power Strips...  

NLE Websites -- All DOE Office Websites (Extended Search)

choose the right one for their plug loads. Many consumer electronics devices waste energy even after they are turned off via "vampire" loads, mean- ing they continue to draw...

484

How to Start Your Own Business  

enough money to get going. In this ar-ticle, the sixth in our Business Engineer-ing series, Ill try to answer some of your questions about raising money for

485

FACT: A Framework for the Application of Throughput and Power Optimizing Transformations to Control-flow Intensive Behavioral Descriptions  

E-Print Network (OSTI)

Inthispaper,wepresentanalgorithmfortheapplicationofa generalclassoftransformationstocontrol-flowintensivebehavioraldescriptions. Ouralgorithmisbasedontheobservationthat incorporationofschedulinginformationcanhelpguidetheselectionandapplicationofcandidatetransformations, andsignificantly enhancethequalityofthesynthesizedsolution.Theefficacyofthe selectedthroughputandpoweroptimizingtransformationsisenhancedbytheabilityofouralgorithmtotranscendbasicblocksin thebehavioraldescription.Thisabilityisimpartedtoouralgorithm byageneraltechniquewehavedevised.Oursystemcurrentlysupportsassociativity, commutativity,distributivity,constantpropagation, codemotion,andloopunrolling.Itisintegratedwithaschedulerwhichperformsimplicitloopunrollingandfunctionalpipelin - ing,andhastheabilitytoparallelizetheexecutionofindependent iterativeconstructswhosebodiescanshareresources.Othertransformationscaneasilybeincorporatedwithintheframework. We demonstratetheefficacyofouralgorithmbyapplyingittoseveral commonlyavai...

Ganesh Lakshminarayana; Niraj K. Jha; Ganeshlakshminarayana Andnirajk Jha

1998-01-01T23:59:59.000Z

486

A 6.4 TESLA DIPOLE MAGNET FOR THE SSC  

E-Print Network (OSTI)

Engineering, Volume 31 A 6.4 TESLA DIPOLE MAGNET FOR THE SSCR. SCANLAN SSC-MAG A 6.4 TESLA DIPOLE MAGiET FOR THE SSC* C.increa.ing up to . 28 tesla . - The resultins systematic

Taylor, C.E.

2010-01-01T23:59:59.000Z

487

System level design of power distribution network for mobile computing platforms  

E-Print Network (OSTI)

to meet the system voltage noise requirements. Introductiondifferent voltage level specs due to V cc min requirement ofvoltage and frequency scaling (DVFS), Dynamic Power Gat- ing (DPM), and area/performance requirements

Shayan Arani, Amirali

2011-01-01T23:59:59.000Z

488

scripps institution of oceanography, university of california, san diego Cecil H. & Ida M. Green Institute of Geophysics & Planetary Physics  

E-Print Network (OSTI)

- ing Philippine Sea Experiment Over the past year I have been partipating in an ocean acoustic in the Philippine Sea starting in 2009 and ending in 2011. This location is in a chal- lenging and dynamic part

Constable, Steve

489

1. executive committee bylaws  

Science Conference Proceedings (OSTI)

teer requests uthorized. and execute nonvoting, all ng). Technical Div ng and organ recommenda ficant action in ors. m time-to-tim ing non-inclu nd the procedu.

490

Parimutuel Betting on Permutations  

E-Print Network (OSTI)

||?g(Y )||2 ? ng(Y ) ?. ? n||?g(Y )||2. Proof. See the appendix. Now, we can obtain an approximate separat- ing oracle for the ellipsoid method. Lemma 5.6.

491

231.ps  

E-Print Network (OSTI)

Vn := f1;:::;ng, En := fij j 1 ing, and dn := jEnj = n. 2 . Let Sn denote the. set of n n symmetric matrices. For X 2Sn, X 0 means that X is positive semide nite.

492

Released: June 2006  

U.S. Energy Information Administration (EIA) Indexed Site

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" 2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" ,"Number of Buildings (thousand)",,,,,"Total Floorspace (million square feet)" ,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment",,,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment" ,,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems",,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems" "All Buildings* ...............",4645,3472,2513,785,175,64783,56478,34671,11540,10267

493

Doing Well by Doing Good? Green Office Buildings  

E-Print Network (OSTI)

we obtained the data on energy usage reported to theWe also discuss the energy usage data made available to usengineer- ing studies of energy usage. There seems to be a

Eichholtz, Piet; Kok, Nils; Quigley, John M.

2009-01-01T23:59:59.000Z

494

ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978  

E-Print Network (OSTI)

Characteristics of Medieval Brasses H. V. Michel, F. Asaro,and the tarnish- ing of brass fixtures and silver. In vapor-Characteristics of Medieval Brasses* H. V. Michel, F. Asaro

Cairns, E.L.

2011-01-01T23:59:59.000Z

495

Computational Aesthetics in Graphics, Visualization and Imaging (2005) L. Neumann, M. Sbert, B. Gooch, W. Purgathofer (Editors)  

E-Print Network (OSTI)

finishes. The software makes use of a reflection model for car paint that is based on industry standards- ture, the glaze of a ceramic vase, or the color of an oil paint- ing are all important aesthetic

Meyer, Gary

496

285.ps  

E-Print Network (OSTI)

Feb 23, 2001 ... ing strategy makes extensive use of dual information associated ...... The total potential energy, expressed in terms of the coe cients of the approximating ...... population and have di erential costs of production and marketing.

497

Sample Size Calculation for Method Validation Using Linear Regression  

E-Print Network (OSTI)

, J. L. O. Miranda Departament of Statistics, Federal University of Minas Gerais, 31270-901 - Belo. Compared to a traditional method and us- ing Monte Carlo simulations, encouraging results attest

Cruz, Frederico

498

References - Energy Information Administration  

U.S. Energy Information Administration (EIA)

References 1.En ergy In for ma tion Ad min istra tion. Natu ral Gas Pro - duc tive Ca pac ity for the Lower 48 States 1980 through 1991 . DOE/EIA- 0542 (Wash ing ton ...

499

Baseline information development for energy smart schools -- applied research, field testing and technology integration  

E-Print Network (OSTI)

swimm ing pools and climate zones. Th e major findings aresound statements. The way the climate zones are divided waswhich aggregated CEC 16 climate zones into four regions by

Xu, Tengfang; Piette, Mary Ann

2004-01-01T23:59:59.000Z

500

330.ps.Z - Optimization Online  

E-Print Network (OSTI)

May 24, 2001 ... tion of ow through a pipe is modeled by a disjunction. ...... ing, S.T., Klepeis, J.L., Meyer, C.A. and Schweiger, C.A. Handbook of Test Problems.