Powered by Deep Web Technologies
Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Office of Legacy Management (LM)

:; / 2. ' :; / 2. ' b-:-"y .",...4 * .-.a 2 IL !< :. 34 --' -, ' ' < I ,-. g Tvo"l r . . .-i- :- " .1-. . . . . NC0 /L ' J,, ' ;.' , -_I( + ? CENTRAL FILES c -&' { ' c;$y ;;j*' E ,J): ' i' Z, 1; p -^ r-raL-r.nuzT".Fn., , ,..-y - -' -ie .". iJ.&:~e!ct.;;' sf ' ;;i_is ,trip ' JG,' go f-Jj;~ey~ 2123 -:s Cc::!<:\.& a k,ea 1:1,:r a;::: zzft:k-~ .sl.x"fe:; an:: , I to a&-isc 2n tiie g Tc;t?z ~,;~~~,;;'


Sugar Land, TX -  

NLE Websites -- All DOE Office Websites (Extended Search)

Petroleum Engineering Alumnus Recognized by Secretary of Energy for Work at National Lab Sugar Land, TX - The National Energy Technology Laboratory is proud to announce that...


Sugar Land, TX -  

NLE Websites -- All DOE Office Websites (Extended Search)

Alumnus Recognized by Secretary of Energy for Work at National Lab Sugar Land, TX - The National Energy Technology Laboratory is proud to announce that U.S. Air Force Academy...


Category:Amarillo, TX | Open Energy Information  

Open Energy Info (EERE)

Amarillo, TX Amarillo, TX Jump to: navigation, search Go Back to PV Economics By Location Media in category "Amarillo, TX" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Amarillo TX CPS Energy.png SVFullServiceRestauran... 62 KB SVHospital Amarillo TX CPS Energy.png SVHospital Amarillo TX... 66 KB SVLargeHotel Amarillo TX CPS Energy.png SVLargeHotel Amarillo ... 61 KB SVLargeOffice Amarillo TX CPS Energy.png SVLargeOffice Amarillo... 59 KB SVMediumOffice Amarillo TX CPS Energy.png SVMediumOffice Amarill... 62 KB SVMidriseApartment Amarillo TX CPS Energy.png SVMidriseApartment Ama... 61 KB SVOutPatient Amarillo TX CPS Energy.png SVOutPatient Amarillo ... 60 KB SVPrimarySchool Amarillo TX CPS Energy.png SVPrimarySchool Amaril... 61 KB SVQuickServiceRestaurant Amarillo TX CPS Energy.png


Category:Houston, TX | Open Energy Information  

Open Energy Info (EERE)

TX TX Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houston, TX" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houston TX Entergy Texas Inc..png SVFullServiceRestauran... 73 KB SVHospital Houston TX Entergy Texas Inc..png SVHospital Houston TX ... 74 KB SVLargeHotel Houston TX Entergy Texas Inc..png SVLargeHotel Houston T... 74 KB SVLargeOffice Houston TX Entergy Texas Inc..png SVLargeOffice Houston ... 74 KB SVMediumOffice Houston TX Entergy Texas Inc..png SVMediumOffice Houston... 78 KB SVMidriseApartment Houston TX Entergy Texas Inc..png SVMidriseApartment Hou... 77 KB SVOutPatient Houston TX Entergy Texas Inc..png SVOutPatient Houston T... 75 KB SVPrimarySchool Houston TX Entergy Texas Inc..png


US WSC TX Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

WSC TX WSC TX Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US WSC TX Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US WSC TX Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US WSC TX Expenditures dollars ELECTRICITY ONLY average per household * Texas households consume an average of 77 million Btu per year, about 14% less than the U.S. average. * Average electricity consumption per Texas home is 26% higher than the national average, but similar to the amount used in neighboring states. * The average annual electricity cost per Texas household is $1,801, among the highest in the nation, although similar to other warm weather states like Florida. * Texas homes are typically newer, yet smaller in size, than homes in other parts of


US WSC TX Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

WSC TX WSC TX Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US WSC TX Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 4,000 8,000 12,000 16,000 US WSC TX Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US WSC TX Expenditures dollars ELECTRICITY ONLY average per household * Texas households consume an average of 77 million Btu per year, about 14% less than the U.S. average. * Average electricity consumption per Texas home is 26% higher than the national average, but similar to the amount used in neighboring states. * The average annual electricity cost per Texas household is $1,801, among the highest in the nation, although similar to other warm weather states like Florida. * Texas homes are typically newer, yet smaller in size, than homes in other parts of



Office of Legacy Management (LM)

*. *. ( ARGONNE RATIONAL 1-Ci3ORATORY . 1 D&TX 7. my 19, 1349 70 t. Z. ROse at L, Em &=i*p~~4 DVur;uM hLl%L ?bvs -Lcs . FReti c. c. Fqpr an2 2. E. sulu+rr fis2 S*crep t & fbQ s-e: of the ?atagel DrFAm%un !! 1 0 * the >rt &Fz=z d t& &men of ScieJce & >&7*-z 4-q 2s'; %rZion 0C the ZLLS~~~ of Science a2 31~52-37 fo2 T&imcyyg c.=A+=< he-< - ,,a uas c:cgetes ALL 12, 1SL9. Z 0 sor;~~,-~-lioi! c.jme s 'm&-go& ~WC& c ",& d*cg&A c&.6 be ciS',&Ctti 03 2.q ZLS CC the 5iiUdi; 0~ eqt&-p*t ~-3 niq b the &-CT iq95, - < less Se&,-0~22 3 wels off tze b.ckm5n' ,e ueze t& 233 &,/zip fe pe*-se a?& coL&cs El5 less t&3 c. 5z/z fo- pcxabi beta-g+iis couxezs.


60-day waste compatibility safety issue and final results for 244-TX DCRT, grab samples TX-95-1, TX-95-2, and TX-95-3  

Science Conference Proceedings (OSTI)

Three grab samples (TX-95-1, TX-95-2, and TX-95-3) were taken from tank 241- TX-244 riser 8 on November 7, 1995 and received by the 222-S Laboratory on that same day. Samples TX-95-1 and TX-95-2 were designated as supernate liquids, and sample TX-95-3 was designated as a supernate/sludge. These samples were analyzed to support the waste compatibility safety program. Accuracy and precision criteria were met for all analyses. No notifications were required based on sample results. This document provides the analysis to support the waste compatibility safety program.

Esch, R.A.




NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


Penitas, TX Natural Gas Pipeline Imports From Mexico (Million...  

Annual Energy Outlook 2012 (EIA)

View History: Annual Download Data (XLS File) Penitas, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) Penitas, TX Natural Gas Pipeline Imports From Mexico...


Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Annual Download Data (XLS File) Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) Hidalgo, TX Natural Gas Pipeline Imports From Mexico...


Alamo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Alamo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Alamo, TX Natural Gas Pipeline Exports to Mexico...


Penitas, TX Natural Gas Pipeline Exports to Mexico (Dollars per...  

U.S. Energy Information Administration (EIA) Indexed Site

View History: Monthly Annual Download Data (XLS File) Penitas, TX Natural Gas Pipeline Exports to Mexico (Dollars per Thousand Cubic Feet) Penitas, TX Natural Gas Pipeline Exports...


Penitas, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Penitas, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Penitas, TX Natural Gas Pipeline Exports to Mexico...


Clint, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Annual Energy Outlook 2012 (EIA)

View History: Monthly Annual Download Data (XLS File) Clint, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Clint, TX Natural Gas Pipeline Exports to Mexico...


Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Hidalgo, TX Natural Gas Pipeline Exports to Mexico...


Alamo, TX Natural Gas Pipeline Imports From Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Annual Download Data (XLS File) Alamo, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) Alamo, TX Natural Gas Pipeline Imports From Mexico (Million...


Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Dollars per...  

U.S. Energy Information Administration (EIA) Indexed Site

View History: Monthly Annual Download Data (XLS File) Hidalgo, TX Natural Gas Pipeline Exports to Mexico (Dollars per Thousand Cubic Feet) Hidalgo, TX Natural Gas Pipeline Exports...


Freeport, TX Natural Gas LNG Imports (Price) From Nigeria (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Freeport, TX Natural Gas LNG Imports (Price) From Nigeria (Dollars per Thousand Cubic Feet) Freeport, TX Natural Gas LNG Imports (Price) From Nigeria (Dollars per Thousand Cubic...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price...  

Gasoline and Diesel Fuel Update (EIA)

Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price) (Dollars per Thousand Cubic Feet) Golden Pass, TX Natural Gas Liquefied Natural Gas Imports (price) (Dollars per...


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................


AOCS Official Method Tx 1a-66  

Science Conference Proceedings (OSTI)

Hydroxyl Value of Epoxidized Oils AOCS Official Method Tx 1a-66 Methods Downloads Methods Downloads DEFINITION The hydroxyl value is defined as the mg of potassium hydroxide equivalent to the hydroxyl content of 1


TX-100 manufacturing final project report.  

DOE Green Energy (OSTI)

This report details the work completed under the TX-100 blade manufacturing portion of the Carbon-Hybrid Blade Developments: Standard and Twist-Coupled Prototype project. The TX-100 blade is a 9 meter prototype blade designed with bend-twist coupling to augment the mitigation of peak loads during normal turbine operation. This structural coupling was achieved by locating off axis carbon fiber in the outboard portion of the blade skins. The report will present the tooling selection, blade production, blade instrumentation, blade shipping and adapter plate design and fabrication. The baseline blade used for this project was the ERS-100 (Revision D) wind turbine blade. The molds used for the production of the TX-100 were originally built for the production of the CX-100 blade. The same high pressure and low pressure skin molds were used to manufacture the TX-100 skins. In order to compensate for the difference in skin thickness between the CX-100 and the TX-100, however, a new TX-100 shear web plug and mold were required. Both the blade assembly fixture and the root stud insertion fixture used for the CX-100 blades could be utilized for the TX-100 blades. A production run of seven TX-100 prototype blades was undertaken at TPI Composites during the month of October, 2004. Of those seven blades, four were instrumented with strain gauges before final assembly. After production at the TPI Composites facility in Rhode Island, the blades were shipped to various test sites: two blades to the National Wind Technology Center at the National Renewable Energy Laboratory in Boulder, Colorado, two blades to Sandia National Laboratory in Albuquerque, New Mexico and three blades to the United States Department of Agriculture turbine field test facility in Bushland, Texas. An adapter plate was designed to allow the TX-100 blades to be installed on existing Micon 65/13M turbines at the USDA site. The conclusion of this program is the kick-off of the TX-100 blade testing at the three testing facilities.

Ashwill, Thomas D.; Berry, Derek S. (TPI Composites, Inc., Warren, RI)



Category:El Paso, TX | Open Energy Information  

Open Energy Info (EERE)

El Paso, TX El Paso, TX Jump to: navigation, search Go Back to PV Economics By Location Media in category "El Paso, TX" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant El Paso TX CPS Energy.png SVFullServiceRestauran... 60 KB SVHospital El Paso TX CPS Energy.png SVHospital El Paso TX ... 65 KB SVLargeHotel El Paso TX CPS Energy.png SVLargeHotel El Paso T... 60 KB SVLargeOffice El Paso TX CPS Energy.png SVLargeOffice El Paso ... 59 KB SVMediumOffice El Paso TX CPS Energy.png SVMediumOffice El Paso... 62 KB SVMidriseApartment El Paso TX CPS Energy.png SVMidriseApartment El ... 60 KB SVOutPatient El Paso TX CPS Energy.png SVOutPatient El Paso T... 60 KB SVPrimarySchool El Paso TX CPS Energy.png SVPrimarySchool El Pas... 61 KB SVQuickServiceRestaurant El Paso TX CPS Energy.png


Response Robot Evaluation Exercise Disaster City, TX DAY 1 ...  

Science Conference Proceedings (OSTI)

Page 1. Response Robot Evaluation Exercise Disaster City, TX and Meeting of the ASTM International Committee on Homeland ...



DOE - Office of Legacy Management -- Sutton Steele and Steele Co - TX 09  

Office of Legacy Management (LM)

Sutton Steele and Steele Co - TX 09 Sutton Steele and Steele Co - TX 09 FUSRAP Considered Sites Site: SUTTON, STEELE & STEELE CO. (TX.09) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Sutton, Steele & Steele, Inc. TX.09-1 Location: Dallas , Texas TX.09-1 Evaluation Year: 1993 TX.09-2 Site Operations: Conducted operations to separate Uranium shot by means of air float tables and conducted research to air classify C-Liner and C-Special materials. TX.09-1 TX.09-3 TX.09-4 TX.09-5 Site Disposition: Eliminated - Potential for contamination considered remote TX.09-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium TX.09-4 TX.09-5 Radiological Survey(s): Health and Safety Monitoring TX.09-4 TX.09-5 Site Status: Eliminated from consideration under FUSRAP



Office of Legacy Management (LM)

ixa6-q ?k.m+~ ixa6-q ?k.m+~ @ lo3 IL.26 -ORNL/TM-11552 OAK RIDGE NATIONAL LABORATORY PRELIMINARY RESULTS OF THE RADIOLOGICAL SURVEY AT THE FORMER DOW CHEMICAL COMPANY SITE, MADISON, ILLINOIS c W . D. Cottrell J. K. W illiams OPERATED BY MARTIN MARIETTA ENERGY SYSTEMS, INC. FOR THE UNITED STATES DEPARTMENT OF ENERGY This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office of Scientific and Techni- cal Information, P.O. Box 62. Oak Ridge, TN 37831; prices available from (615) 5766401, PTS 626-840 1. Availabie to the public from the National Technical Information Service, U.S. Department of Commerce, 5285 Port Royal Rd., Springfield, VA 22161. I I This report was prepared as an account of work sponsored by an agency of


CleanTX Foundation | Open Energy Information  

Open Energy Info (EERE)

CleanTX Foundation CleanTX Foundation Address 3925 W Braker Lane Place Austin, Texas Zip 78759 Region Texas Area Notes Promotes entrepreneurship in the field of clean technology, by providing educational forums, content, awareness and networking opportunities Website http://cleantx.org/ Coordinates 30.396989°, -97.735768° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.396989,"lon":-97.735768,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


,"Hidalgo, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Hidalgo, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Penitas, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Penitas, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2002 ,"Release Date:","172014" ,"Next...


,"Alamo, TX Natural Gas Pipeline Imports From Mexico (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Alamo, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Eagle Pass, TX Natural Gas Pipeline Exports to Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Eagle Pass, TX Natural Gas Pipeline Exports to Mexico (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"El Paso, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","El Paso, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2002 ,"Release Date:","12122013"...


Price Liquefied Freeport, TX Natural Gas Exports Price to United...  

Gasoline and Diesel Fuel Update (EIA)

United Kingdom (Dollars per Thousand Cubic Feet) Price Liquefied Freeport, TX Natural Gas Exports Price to United Kingdom (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1...



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use


fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


State Laboratory Contacts IL  

Science Conference Proceedings (OSTI)

State Laboratory Contact Information IL. Idaho. ... State of Iowa Metrology Laboratory Ellsworth Community College 1100 College Ave. ...



EDF Industrial Power Services (TX), LLC | Open Energy Information  

Open Energy Info (EERE)

Power Services (TX), LLC Power Services (TX), LLC Jump to: navigation, search Name EDF Industrial Power Services (TX), LLC Place Texas Utility Id 56315 Utility Location Yes Ownership R NERC ERCOT Yes ISO Ercot Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Industrial: $0.0394/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=EDF_Industrial_Power_Services_(TX),_LLC&oldid=410609" Categories: EIA Utility Companies and Aliases

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Golden Pass, TX Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

from Qatar (Million Cubic Feet) Golden Pass, TX Natural Gas Liquefied Natural Gas Imports from Qatar (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...


Freeport, TX Exports to India Liquefied Natural Gas (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Exports to India Liquefied Natural Gas (Million Cubic Feet) Freeport, TX Exports to India Liquefied Natural Gas (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct...


Freeport, TX Liquefied Natural Gas Exports to Brazil (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

to Brazil (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Exports to Brazil (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 2,581 2012 2,601...


Freeport, TX Liquefied Natural Gas Exports to South Korea (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

South Korea (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Exports to South Korea (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,157...


Freeport, TX Natural Gas Liquefied Natural Gas Imports (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Liquefied Natural Gas Imports (Million Cubic Feet) Freeport, TX Natural Gas Liquefied Natural Gas Imports (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...


Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Dollars...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) Hidalgo, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Freeport, TX Natural Gas Liquefied Natural Gas Imports from Trinidad...  

Gasoline and Diesel Fuel Update (EIA)

Trinidad and Tobago (Million Cubic Feet) Freeport, TX Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug...


Penitas, TX Natural Gas Pipeline Imports From Mexico (Dollars...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) Penitas, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Alamo, TX Natural Gas Pipeline Imports From Mexico (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Dollars per Thousand Cubic Feet) Alamo, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...


Freeport, TX Liquefied Natural Gas Imports from Yemen (Million...  

Annual Energy Outlook 2012 (EIA)

from Yemen (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Imports from Yemen (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 2,869 3,108...


Freeport, TX Liquefied Natural Gas Imports From Peru (Million...  

Annual Energy Outlook 2012 (EIA)

From Peru (Million Cubic Feet) Freeport, TX Liquefied Natural Gas Imports From Peru (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,175 3,338 3,262...


Freeport, TX Natural Gas Liquefied Natural Gas Imports from Egypt...  

Gasoline and Diesel Fuel Update (EIA)

Egypt (Million Cubic Feet) Freeport, TX Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 2,969 -...


Price Liquefied Freeport, TX Natural Gas Exports Price to Japan...  

Gasoline and Diesel Fuel Update (EIA)

Japan (Dollars per Thousand Cubic Feet) Price Liquefied Freeport, TX Natural Gas Exports Price to Japan (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


DOE - Office of Legacy Management -- Pantex Sewage Reservoir - TX 03  

Office of Legacy Management (LM)

Pantex Sewage Reservoir - TX 03 Pantex Sewage Reservoir - TX 03 FUSRAP Considered Sites Site: Pantex Sewage Reservoir (TX.03 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: This site is one of a group of 77 FUSRAP considered sites for which few, if any records are available in their respective site files to provide an historical account of past operations and their relationship, if any, with MED/AEC operations. Reviews of contact lists, accountable station lists, health and safety records and other documentation of the period do not provide sufficient information to warrant further search of historical records for information on these sites. These site files remain "open" to


McAllen, TX Natural Gas Pipeline Imports From Mexico (Million...  

Annual Energy Outlook 2012 (EIA)

View History: Annual Download Data (XLS File) McAllen, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet) McAllen, TX Natural Gas Pipeline Imports From Mexico...


McAllen, TX Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) McAllen, TX Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) McAllen, TX Natural Gas Pipeline Exports to Mexico...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Price of Freeport, TX Natural Gas LNG Imports (Dollars per Thousand...  

U.S. Energy Information Administration (EIA) Indexed Site

Freeport, TX Natural Gas LNG Imports (Dollars per Thousand Cubic Feet) Price of Freeport, TX Natural Gas LNG Imports (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2...


TEXAS TECH UNIVERSITY Lubbock, TX 79409-1108  

E-Print Network (OSTI)

TEXAS TECH UNIVERSITY Box 41108 Lubbock, TX 79409-1108 Name (as shown on your income tax return by the appropriate ownership type that applies to you or your business. I L *Texas Limited Partnership: SSN & Social Security Number (SSN) T *Texas Corporation Owners Name

Westfall, Peter H.


Double-contained receiver tank 244-TX, grab samples, 244TX-97-3 analytical results for the final report  

Science Conference Proceedings (OSTI)

This document is the final report for the double-contained receiver tank (DCRT) 244-TX grab samples. Three grabs samples were collected from riser 8 on May 29, 1997. Analyses were performed in accordance with the Compatibility Grab Sampling and Analysis Plan (TSAP) and the Data Quality Objectives for Tank Farms Waste Compatibility Program (DQO). The analytical results are presented in a table.

Esch, R.A.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

illThIl!NT OF ENERGY illThIl!NT OF ENERGY EERE PROJECT MA"IAGEMENT CENTER NEPA DE:rJ!IU...lINATION RECIPIENT:TX STATE ENERGY CONSERVATION OFFICE PROJECT TITLE: SHARYLAND ISD Page 1 of2 STATE: TX Funding Opportunity Announcement Number Procurement Instmment Number NEPA Control Number CIO Number DE-EEOOO116 DE-EEOOO116 GFO-OOO0116-032 GOO Based OD my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 85.16 Solar photovoltaic systems The installation, modification. operation, and removal of commercially avaUable solar photovoltaic systems located on a building or other structure (such as rooftop, par1o:.ing lot or facility, and mounted to signage, lighting, gates, or fences), or if



Office of Legacy Management (LM)

,,.. .r' ,,.. .r' +p,o~ ,!,*' A;>$, :.::> ,' ; ,.;I:- : ~ ", ,r .,,. ' , ' i.,l<, ~ ,1* .iT ,.~~~~~~~I~ _,L :,~.:/: .,,.,,,.,' ,, ;, ,, ,, I .. ,(: _ : ; . , y.,+ lar&f&r!rj&~+ ,id) L"'w#~~~~* I. ,& f ;";.y,m; ,I @ & **t&,y%:iis ;*a k' q&t ,:.: ;,I,' ,,, ,_ *, . ,. ,,&S_ ;, , (, t+ I . 1. -. ' ,' ~' i"'i,!..l + *I .(, h," ,rz ,. ,' :' ,' . :,' . ,.' _-#I_ ,. ,I. :, ,.' , ..I>. Xi,,? ,I. , ,r c/i' ,"" >.:1.. .>,. w/.&q:r*x Il.-'",.' !,.~~,,,~~iyY;~~~aj' ,~,,~~~~~~~~~ri~ *~i..iz~~ri~~~J~illi~;' ~(l~.~~i:)i9:ll~,-' i ?, ".' a? ,,?J,?" ~~~~I~~.~,~~~~~~~~.~~~~~~~~~~~~~-~ +q86?,r$w4t .r:~:@o:, " .", ' 1 j/ +$+. : WJl @+&?+&&w ' . 2 _ ._ b )., .;,a. :,. I .b.i.:.,*. A'


GRR/Section 8-TX-b - ERCOT Interconnection | Open Energy Information  

Open Energy Info (EERE)

8-TX-b - ERCOT Interconnection 8-TX-b - ERCOT Interconnection < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-TX-b - ERCOT Interconnection 8-TX-b - ERCOT Interconnection Process.pdf Click to View Fullscreen Regulations & Policies PUCT Substantive Rule 25.198 Triggers None specified Click "Edit With Form" above to add content 8-TX-b - ERCOT Interconnection Process.pdf 8-TX-b - ERCOT Interconnection Process.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedures for interconnection with Electricity Reliability Council of Texas (ERCOT) in Texas. According to PUCT Substantive Rule 25.198, the responsibility for


GRR/Section 8-TX-c - Distributed Generation Interconnection | Open Energy  

Open Energy Info (EERE)

GRR/Section 8-TX-c - Distributed Generation Interconnection GRR/Section 8-TX-c - Distributed Generation Interconnection < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-TX-c - Distributed Generation Interconnection 8-TX-c - Distributed Generation Interconnection.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUCT Substantive Rule 25.211 PUCT Substantive Rule 25.212 Triggers None specified Click "Edit With Form" above to add content 8-TX-c - Distributed Generation Interconnection.pdf 8-TX-c - Distributed Generation Interconnection.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process for distributed generation (DG)


GRR/Section 3-TX-g - Lease of Relinquishment Act Lands | Open Energy  

Open Energy Info (EERE)

3-TX-g - Lease of Relinquishment Act Lands 3-TX-g - Lease of Relinquishment Act Lands < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-g - Lease of Relinquishment Act Lands 03-TX-g - Lease of Relinquishment Act Lands.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-g - Lease of Relinquishment Act Lands.pdf 03-TX-g - Lease of Relinquishment Act Lands.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of obtaining a geothermal lease on Relinquishment Act Lands in Texas. The Texas General Land Office (GLO) of Texas handles the leasing process on Relinquishment Act Lands through Title



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lAl.4Il lAl.4Il ) U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION RECIPIENT: NREL PROJECT TITLE: los Indios Meteorological Tower; NREL Tracking No. 11-008 Page 1 of2 STATE : TX funding Opportunity Announcement Number PJ"O(urement Instrument Number NEPA Control Number em Number NREL-11-OO8 G010337 Based on my review nflhe information concerning the proposed adion, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, aUdits). data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply


Staubli TX-90XL robot qualification at the LLIHE.  

SciTech Connect

The Light Initiated High Explosive (LIHE) Facility uses a robotic arm to spray explosive material onto test items for impulse tests. In 2007, the decision was made to replace the existing PUMA 760 robot with the Staubli TX-90XL. A qualification plan was developed and implemented to verify the safe operating conditions and failure modes of the new system. The robot satisfied the safety requirements established in the qualification plan. A performance issue described in this report remains unresolved at the time of this publication. The final readiness review concluded the qualification of this robot at the LIHE facility.

Covert, Timothy Todd



,"McAllen, TX Natural Gas Pipeline Imports From Mexico (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","McAllen, TX Natural Gas Pipeline Imports From Mexico (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Modal testing of the TX-100 wind turbine blade.  

DOE Green Energy (OSTI)

This test report covers the SNL modal test results for two nominally identical TX-100 wind turbine blades. The TX-100 blade design is unique in that it features a passive braking, force-shedding mechanism where bending and torsion are coupled to produce desirable aerodynamic characteristics. A specific aim of this test is to characterize the coupling between bending and torsional dynamics. The results of the modal tests and the subsequent analysis characterize the natural frequencies, damping, and mode shapes of the individual blades. The results of this report are expected to be used for model validation--the frequencies and mode shapes from the experimental analysis can be compared with those of a finite-element analysis. Damping values are included in the results of these tests to potentially improve the fidelity of numerical simulations, although numerical finite element models typically have no means of predicting structural damping characteristics. Thereafter, an additional objective of the test is achieved in evaluating the test to test and unit variation in the modal parameters of the two blades.

Reese, Sarah; Griffith, Daniel Todd; Casias, Miguel; Simmermacher, Todd William; Smith, Gregory A.



Il Vopiscus di Lucio Afranio.  

E-Print Network (OSTI)

??In un quadro bibliografico molto ridotto, il presente lavoro si prefigge di ricercare un metodo per proporre un testo, una traduzione e un commento esegetico, (more)




GRR/Section 13-TX-a - State Land Use Assessment | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 13-TX-a - State Land Use Assessment GRR/Section 13-TX-a - State Land Use Assessment < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 13-TX-a - State Land Use Assessment 13-TX-a - State Land Use Assessment.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Regulations & Policies Open Beaches Act Dune Protection Act Beach Dune Rules Triggers None specified Click "Edit With Form" above to add content 13-TX-a - State Land Use Assessment.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Texas General Land Office (GLO) is in charge of making sure construction on the Texas coast that affects the beach and dunes is


GRR/Section 3-TX-e - Lease of Texas Parks & Wildlife Department Land | Open  

Open Energy Info (EERE)

TX-e - Lease of Texas Parks & Wildlife Department Land TX-e - Lease of Texas Parks & Wildlife Department Land < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-e - Lease of Texas Parks & Wildlife Department Land 03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of leasing Texas Parks & Wildlife Department (TPWD) land in Texas. The Texas General Land Office manages


GRR/Section 3-TX-d - Lease of Permanent School Fund Land | Open Energy  

Open Energy Info (EERE)

3-TX-d - Lease of Permanent School Fund Land 3-TX-d - Lease of Permanent School Fund Land < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-d - Lease of Permanent School Fund Land 03-TX-d - Lease of Public School Fund Land (1).pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-d - Lease of Public School Fund Land (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of leasing Public School Fund (PSF) lands in Texas. The Texas General Land Office (GLO) oversees the leasing process for PSF lands through Title 31 of the Texas Administrative Code


GRR/Section 19-TX-e - Temporary Surface Water Permit | Open Energy  

Open Energy Info (EERE)

-TX-e - Temporary Surface Water Permit -TX-e - Temporary Surface Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-e - Temporary Surface Water Permit 19-TX-e Temporary Surface Water Permit.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11.138 Triggers None specified Click "Edit With Form" above to add content 19-TX-e Temporary Surface Water Permit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Texas, the Texas Commission on Environmental Quality (TCEQ), or in certain instances regional TCEQ offices or local Watermasters, issue


GRR/Section 3-TX-f - Lease of Land Trade Lands | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 3-TX-f - Lease of Land Trade Lands GRR/Section 3-TX-f - Lease of Land Trade Lands < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-f - Lease of Land Trade Lands 03-TX-f - Lease of Land Trade Lands.pdf Click to View Fullscreen Triggers None specified Click "Edit With Form" above to add content 03-TX-f - Lease of Land Trade Lands.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of leasing Land Trade Lands in Texas. The Texas General Land Office (GLO) administers leases on Land Trade Lands through Title 31 of the Texas Administrative Code Section 155.42.

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


IL Wted States Government  

Office of Legacy Management (LM)

Tis&: p/WI-3 Tis&: p/WI-3 . IL Wted States Government ' 1, -1. \ k. 4 4L La. -iF 1 I ' __, 7, Department of Energy memorandum


CX-100 and TX-100 blade field tests.  

SciTech Connect

In support of the DOE Low Wind Speed Turbine (LWST) program two of the three Micon 65/13M wind turbines at the USDA Agricultural Research Service (ARS) center in Bushland, Texas will be used to test two sets of experimental blades, the CX-100 and TX-100. The blade aerodynamic and structural characterization, meteorological inflow and wind turbine structural response will be monitored with an array of 75 instruments: 33 to characterize the blades, 15 to characterize the inflow, and 27 to characterize the time-varying state of the turbine. For both tests, data will be sampled at a rate of 30 Hz using the ATLAS II (Accurate GPS Time-Linked Data Acquisition System) data acquisition system. The system features a time-synchronized continuous data stream and telemetered data from the turbine rotor. This paper documents the instruments and infrastructure that have been developed to monitor these blades, turbines and inflow.

Holman, Adam (USDA-Agriculture Research Service, Bushland, TX); Jones, Perry L.; Zayas, Jose R.




Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...


DOE - Office of Legacy Management -- Chicago North IL Site - IL 05  

Office of Legacy Management (LM)

North IL Site - IL 05 North IL Site - IL 05 FUSRAP Considered Sites Chicago North, IL Alternate Name(s): National Guard Armory 124th Field Artillery Armory Illinois National Guard Armory Site IL.05-4 IL.05-5 Location: 5200 Cottage Grove Avenue, Chicago, Illinois IL.05-4 Historical Operations: Processed and stored uranium metal, resulting in uranium metal and dry uranium oxide contamination. Metallurgical operations were conducted by the University of Chicago, an MED contractor. IL.05-5 IL.05-7 IL.05-8 Eligibility Determination: Eligible IL.05-1 IL.05-2 IL.05-3 Radiological Survey(s): Assessment Surveys, Verification Surveys IL.05-6 IL.05-7 Site Status: Certified-Certification Basis, Federal Register Notice Included IL.05-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


US ENC IL Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

IL IL Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC IL Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC IL Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC IL Expenditures dollars ELECTRICITY ONLY average per household * Illinois households use 129 million Btu of energy per home, 44% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Illinois households spending 2% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC IL Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

IL IL Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC IL Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC IL Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC IL Expenditures dollars ELECTRICITY ONLY average per household * Illinois households use 129 million Btu of energy per home, 44% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Illinois households spending 2% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Category:Chicago, IL | Open Energy Information  

Open Energy Info (EERE)

IL IL Jump to: navigation, search Go Back to PV Economics By Location Media in category "Chicago, IL" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Chicago IL Commonwealth Edison Co.png SVFullServiceRestauran... 74 KB SVHospital Chicago IL Commonwealth Edison Co.png SVHospital Chicago IL ... 68 KB SVLargeHotel Chicago IL Commonwealth Edison Co.png SVLargeHotel Chicago I... 75 KB SVLargeOffice Chicago IL Commonwealth Edison Co.png SVLargeOffice Chicago ... 76 KB SVMediumOffice Chicago IL Commonwealth Edison Co.png SVMediumOffice Chicago... 73 KB SVMidriseApartment Chicago IL Commonwealth Edison Co.png SVMidriseApartment Chi... 77 KB SVOutPatient Chicago IL Commonwealth Edison Co.png SVOutPatient Chicago I... 74 KB SVPrimarySchool Chicago IL Commonwealth Edison Co.png


DOE - Office of Legacy Management -- Granite City IL Site - IL 28  

Office of Legacy Management (LM)

Granite City IL Site - IL 28 Granite City IL Site - IL 28 FUSRAP Considered Sites Granite City, IL Alternate Name(s): Granite City Steel General Steel Industries General Steel Casings Corporation New Betatron Building IL.28-3 Location: 1417 State Street, Granite City, Illinois IL.28-3 Historical Operations: Under subcontract with Mallinckrodt and using a government-owned Betatron (magnetic induction electron accelerator), x-rayed natural uranium ingots and dingots to detect metallurgical flaws. Contamination from rubbing off of oxidized uranium during handling. IL.28-3 IL.28-5 Eligibility Determination: Eligible IL.28-1 IL.28-2 Radiological Survey(s): Assessment Surveys, Verification Survey IL.28-6 IL.28-7 IL.28-8 Site Status: Certified - Certification Basis, Federal Register Notice included IL.28-9


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


ORNL measurements at Hanford Waste Tank TX-118  

Science Conference Proceedings (OSTI)

A program of measurements and calculations to develop a method of measuring the fissionable material content of the large waste storage tanks at the Hanford, Washington, site is described in this report. These tanks contain radioactive waste from the processing of irradiated fuel elements from the plutonium-producing nuclear reactors at the Hanford site. Time correlation and noise analysis techniques, similar to those developed for and used in the Nuclear Weapons Identification System at the Y-12 Plant in Oak Ridge, Tennessee, will be used at the Hanford site. Both ``passive`` techniques to detect the neutrons emitted spontaneously from the waste in the tank and ``active`` techniques using AmBe and {sup 252}Cf neutron sources to induce fissions will be used. This work is divided into three major tasks: (1) development of high-sensitivity neutron detectors that can selectively count only neutrons in the high {gamma} radiation fields in the tanks, (2) Monte Carlo neutron transport calculations using both the KENO and MCNP codes to plan and analyze the measurements, and (3) the measurement of time-correlated neutrons by time and frequency analysis to distinguish spontaneous fission from sources inside the tanks. This report describes the development of the detector and its testing in radiation fields at the Radiation Calibration Facility at Oak Ridge National Laboratory and in tank TX-118 at the 200 W area at Westinghouse Hanford Company.

Koehler, P.E.; Mihalczo, J.T.



GRR/Section 3-TX-c - Highway Right of Way Lease | Open Energy Information  

Open Energy Info (EERE)

3-TX-c - Highway Right of Way Lease 3-TX-c - Highway Right of Way Lease < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-c - Highway Right of Way Lease 03TXCEncroachmentIssues.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Texas Department of Transportation Regulations & Policies 43 TAC 21.600 43 TAC 21.603 43 TAC 21.606 Triggers None specified Click "Edit With Form" above to add content 03TXCEncroachmentIssues.pdf 03TXCEncroachmentIssues.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedure for obtaining a state highway asset lease in Texas. The Texas Department of Transportation (TxDOT) may lease any highway asset.


GRR/Section 11-TX-a - State Cultural Considerations Overview | Open Energy  

Open Energy Info (EERE)

GRR/Section 11-TX-a - State Cultural Considerations Overview GRR/Section 11-TX-a - State Cultural Considerations Overview < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-TX-a - State Cultural Considerations Overview 11TXAStateCulturalConsiderationsOverview.pdf Click to View Fullscreen Contact Agencies Texas Historical Commission Regulations & Policies NRC Ch. 191: Antiquities Code CCP Ch. 49: Inquests Upon Dead Bodies Triggers None specified Click "Edit With Form" above to add content 11TXAStateCulturalConsiderationsOverview.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative 11-TX-a.1 - Have Potential Human Remains Been Discovered?


GRR/Section 11-TX-c - Cultural Resource Discovery Process | Open Energy  

Open Energy Info (EERE)

-TX-c - Cultural Resource Discovery Process -TX-c - Cultural Resource Discovery Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-TX-c - Cultural Resource Discovery Process 11TXCCulturalResourceDiscoveryProcess.pdf Click to View Fullscreen Contact Agencies Texas Historical Commission Regulations & Policies Sec. 191: Antiquities Code Triggers None specified Click "Edit With Form" above to add content 11TXCCulturalResourceDiscoveryProcess.pdf 11TXCCulturalResourceDiscoveryProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative 11-TX-c.1 - Is the Project Located on State or Local Public Land? Before breaking ground at a project location on state or local public land,


EIS-0412: Federal Loan Guarantee to Support Construction of the TX Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12: Federal Loan Guarantee to Support Construction of the TX 12: Federal Loan Guarantee to Support Construction of the TX Energy LLC, Industrial Gasification Facility near Beaumont, Texas EIS-0412: Federal Loan Guarantee to Support Construction of the TX Energy LLC, Industrial Gasification Facility near Beaumont, Texas Overview The Department of Energy is assessing the potential environmental impacts for its proposed action of issuing a Federal loan guarantee to TX Energy, LLC (TXE). TXE submitted an application to DOE under the Federal loan guarantee program pursuant to the Energy Policy Act of 2005 (EPAct 2005) to support construction of the TXE industrial Gasification Facility near Beaumont, Texas. TXE is a subsidiary of Eastman Chemical Company (Eastman) and proposes to develop the Facility on a 417-acre parcel of land. The Facility would


GRR/Section 19-TX-b - New Water Right Process For Surface Water...  

Open Energy Info (EERE)

TX-b - New Water Right Process For Surface Water and Ground Water < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of...



NLE Websites -- All DOE Office Websites (Extended Search)

2005 Hurricanes on the Natural Gas Industry in the Gulf of Mexico Region Mexico FL GA SC AL MS LA TX AR TN TN Katrina - Cumulative wind > 39 mph Katrina - Cumulative wind > 73 mph...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


McAllen, TX Natural Gas Pipeline Imports From Mexico (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Dollars per Thousand Cubic Feet) McAllen, TX Natural Gas Pipeline Imports From Mexico (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Springfield, IL | Open Energy Information  

Open Energy Info (EERE)

IL IL Jump to: navigation, search Go Back to PV Economics By Location Media in category "Springfield, IL" The following 16 files are in this category, out of 16 total. SVQuickServiceRestaurant Springfield IL Commonwealth Edison Co.png SVQuickServiceRestaura... 75 KB SVFullServiceRestaurant Springfield IL Commonwealth Edison Co.png SVFullServiceRestauran... 75 KB SVHospital Springfield IL Commonwealth Edison Co.png SVHospital Springfield... 67 KB SVLargeHotel Springfield IL Commonwealth Edison Co.png SVLargeHotel Springfie... 75 KB SVLargeOffice Springfield IL Commonwealth Edison Co.png SVLargeOffice Springfi... 76 KB SVMediumOffice Springfield IL Commonwealth Edison Co.png SVMediumOffice Springf... 74 KB SVMidriseApartment Springfield IL Commonwealth Edison Co.png


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


RCRA Assessment Plan for Single-Shell Tank Waste Management Area TX-TY  

SciTech Connect

WMA TX-TY contains underground, single-shell tanks that were used to store liquid waste that contained chemicals and radionuclides. Most of the liquid has been removed, and the remaining waste is regulated under the RCRA as modified in 40 CFR Part 265, Subpart F and Washington States Hazardous Waste Management Act . WMA TX-TY was placed in assessment monitoring in 1993 because of elevated specific conductance. A groundwater quality assessment plan was written in 1993 describing the monitoring activities to be used in deciding whether WMA TX-TY had affected groundwater. That plan was updated in 2001 for continued RCRA groundwater quality assessment as required by 40 CFR 265.93 (d)(7). This document further updates the assessment plan for WMA TX-TY by including (1) information obtained from ten new wells installed at the WMA after 1999 and (2) information from routine quarterly groundwater monitoring during the last five years. Also, this plan describes activities for continuing the groundwater assessment at WMA TX TY.

Horton, Duane G.



Quantitative analysis of IL-2 and IL-15 signal transduction in T lymphocytes  

E-Print Network (OSTI)

IL-2 and IL-15 are common y-chain family cytokines critically involved in regulation of T cell differentiation and homeostasis. Both cytokines signal through a heterotrimeric surface receptor complex (IL-2/15R) composed ...

Arneja, Abhinav



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



GRR/Section 19-TX-b - New Water Right Process For Surface Water and Ground  

Open Energy Info (EERE)

TX-b - New Water Right Process For Surface Water and Ground TX-b - New Water Right Process For Surface Water and Ground Water < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-b - New Water Right Process For Surface Water and Ground Water 19TXBNewWaterRightProcessForSurfaceWaterAndGroundWater.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Texas Water Development Board Regulations & Policies Tex. Water Code § 11 Triggers None specified Click "Edit With Form" above to add content 19TXBNewWaterRightProcessForSurfaceWaterAndGroundWater.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 11-TX-b - Human Remains Process | Open Energy Information  

Open Energy Info (EERE)

1-TX-b - Human Remains Process 1-TX-b - Human Remains Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 11-TX-b - Human Remains Process 11TXBHumanRemainsProcess.pdf Click to View Fullscreen Regulations & Policies CCP Art. 49 Triggers None specified Click "Edit With Form" above to add content 11TXBHumanRemainsProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the procedure a developer must follow when human remains are discovered on or near the project site. Local law enforcement must conduct an investigation into the death of the person, and is the


GRR/Section 14-TX-c - Underground Injection Control Permit | Open Energy  

Open Energy Info (EERE)

TX-c - Underground Injection Control Permit TX-c - Underground Injection Control Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-c - Underground Injection Control Permit Pages from 14TXCUndergroundInjectionControlPermit (4).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 27 16 TAC 3.9 46 TAC 3.46 16 TAC 3.30 - MOU between the RRC and the TCEQ Triggers None specified Click "Edit With Form" above to add content Pages from 14TXCUndergroundInjectionControlPermit (4).pdf Pages from 14TXCUndergroundInjectionControlPermit (4).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 7-TX-b - REC Generator | Open Energy Information  

Open Energy Info (EERE)

TX-b - REC Generator TX-b - REC Generator < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-TX-b - REC Generator 07TXBRECGeneratorCertification.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies Goal for Renewable Energy, PUCT Substantive Rule 25.173 Triggers None specified Click "Edit With Form" above to add content 07TXBRECGeneratorCertification.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the application and approval process for participating in the Renewable Energy Credit program in Texas.


GRR/Section 19-TX-c - Surface Water Permit | Open Energy Information  

Open Energy Info (EERE)

19-TX-c - Surface Water Permit 19-TX-c - Surface Water Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-c - Surface Water Permit 19TXCSurfaceWaterPermit.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11 30 TAC 295 30 TAC 297 Triggers None specified Click "Edit With Form" above to add content 19TXCSurfaceWaterPermit.pdf 19TXCSurfaceWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Texas, the Texas Commission on Environmental Quality (TCEQ) issues surface water permits. Under, Tex. Water Code § 11, surface water permits


GRR/Section 5-TX-a - Drilling and Well Development | Open Energy  

Open Energy Info (EERE)

GRR/Section 5-TX-a - Drilling and Well Development GRR/Section 5-TX-a - Drilling and Well Development < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 5-TX-a - Drilling and Well Development 05TXADrillingAndWellDevelopment.pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas Texas Water Development Board Regulations & Policies 16 TAC 3.5: Application To Drill, Deepen, Reenter, or Plug Back 16 TAC 3.78: Fees and Financial Security Requirements 16 TAC 3.37: Statewide Spacing Rule 16 TAC 3.38: Well Densities 16 TAC 3.39: Proration and Drilling Units: Contiguity of Acreage and Exception 16 TAC 3.33: Geothermal Resource Production Test Forms Required Triggers None specified Click "Edit With Form" above to add content


GRR/Section 14-TX-b - Texas NPDES Permitting Process | Open Energy  

Open Energy Info (EERE)

14-TX-b - Texas NPDES Permitting Process 14-TX-b - Texas NPDES Permitting Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-b - Texas NPDES Permitting Process 14TXBTexasNPDESPermittingProcess (4).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas United States Environmental Protection Agency Regulations & Policies Tex. Water Code § 26.131(b) 16 TAC 3.8 Memorandum of Understanding between the RRC and the TCEQ 16 TAC 3.30 Triggers None specified Click "Edit With Form" above to add content 14TXBTexasNPDESPermittingProcess (4).pdf 14TXBTexasNPDESPermittingProcess (4).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative


,"Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)" Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description","# Of Series","Frequency","Latest Data for" ,"Data 1","Galvan Ranch, TX Natural Gas Pipeline Imports From Mexico (Million Cubic Feet)",1,"Annual",2012 ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","nga_epg0_irp_ygrt-nmx_mmcfa.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/nga_epg0_irp_ygrt-nmx_mmcfa.htm" ,"Source:","Energy Information Administration"


GRR/Section 8-TX-a - Transmission Siting | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 8-TX-a - Transmission Siting GRR/Section 8-TX-a - Transmission Siting < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 8-TX-a - Transmission Siting 08TXATransmissionSiting.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUCT Substantive 25.83: Transmission Construction Reports PUCT Substantive Rule 25.101: Certification Criteria Triggers None specified Click "Edit With Form" above to add content 08TXATransmissionSiting.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Transmission siting is handled by the Public Utility Commission of Texas


GRR/Section 6-TX-a - Extra-Legal Vehicle Permitting Process | Open Energy  

Open Energy Info (EERE)

6-TX-a - Extra-Legal Vehicle Permitting Process 6-TX-a - Extra-Legal Vehicle Permitting Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-TX-a - Extra-Legal Vehicle Permitting Process 06TXAExtraLegalVehiclePermittingProcess.pdf Click to View Fullscreen Contact Agencies Texas Department of Motor Vehicles Texas Department of Transportation Regulations & Policies Tex. Transportation Code § 621 Tex. Transportation Code § 622 Tex. Transportation Code § 623 43 TAC 219 Triggers None specified Click "Edit With Form" above to add content 06TXAExtraLegalVehiclePermittingProcess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


GRR/Section 19-TX-d - Transfer of Surface Water Right | Open Energy  

Open Energy Info (EERE)

19-TX-d - Transfer of Surface Water Right 19-TX-d - Transfer of Surface Water Right < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-d - Transfer of Surface Water Right 19TXDTransferOfWaterRight.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11 30 TAC 297.81 30 TAC 297.82 30 TAC 297.83 Triggers None specified Click "Edit With Form" above to add content 19TXDTransferOfWaterRight.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Texas water law allows surface water rights to be transferred from one party to another. (Tex. Water Code § 11)


GRR/Section 18-TX-a - Underground Storage Tank Process | Open Energy  

Open Energy Info (EERE)

TX-a - Underground Storage Tank Process TX-a - Underground Storage Tank Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 18-TX-a - Underground Storage Tank Process 18TXAUndergroundStorageTanks (1).pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies 30 Texas Administrative Code 334 - Underground and Aboveground Storage Tanks 30 Texas Administrative Code 37 - Financial Assurance for Petroleum Underground Storage Tanks Triggers None specified Click "Edit With Form" above to add content 18TXAUndergroundStorageTanks (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 3-TX-a - State Geothermal Lease | Open Energy Information  

Open Energy Info (EERE)

3-TX-a - State Geothermal Lease 3-TX-a - State Geothermal Lease < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-a - State Geothermal Lease 03TXAStateGeothermalLease.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Regulations & Policies Texas Natural Resources Code 31 TAC 9.22 31 TAC 13.33 31 TAC 13.62 31 TAC 155.42 Triggers None specified Click "Edit With Form" above to add content 03TXAStateGeothermalLease.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of obtaining a state geothermal lease from the state of Texas. The Texas General Land Office manages


GRR/Section 19-TX-a - Water Access and Water Issues Overview | Open Energy  

Open Energy Info (EERE)

9-TX-a - Water Access and Water Issues Overview 9-TX-a - Water Access and Water Issues Overview < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 19-TX-a - Water Access and Water Issues Overview 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Tex. Water Code § 11 Triggers None specified Click "Edit With Form" above to add content 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf 19TXAWaterAccessAndWaterRightsIssuesOverview.pdf Flowchart Narrative In the late 1960's Texas transitioned its water law system, switching


GRR/Section 12-TX-a - Flora and Fauna Considerations | Open Energy  

Open Energy Info (EERE)

TX-a - Flora and Fauna Considerations TX-a - Flora and Fauna Considerations < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 12-TX-a - Flora and Fauna Considerations 12TXAFloraAndFaunaConsiderations.pdf Click to View Fullscreen Contact Agencies Texas Parks and Wildlife Department Regulations & Policies Texas Parks and Wildlife Code § 68 31 TAC 65.175 31 TAC 65.176 31 TAC 65.173 Triggers None specified Click "Edit With Form" above to add content 12TXAFloraAndFaunaConsiderations.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative In Texas, no person may capture, trap, take, or kill, or attempt to


GRR/Section 14-TX-a - Nonpoint Source Pollution | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 14-TX-a - Nonpoint Source Pollution GRR/Section 14-TX-a - Nonpoint Source Pollution < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-a - Nonpoint Source Pollution 14TXANonpointSourcePollution.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Clean Water Act CWA §319(b) Triggers None specified Click "Edit With Form" above to add content 14TXANonpointSourcePollution.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative The Texas Nonpoint Source Management Program (Management Program) is required under the Clean Water Act(CWA), specifically CWA §319(b). The


GRR/Section 6-TX-b - Construction Storm Water Permitting Process | Open  

Open Energy Info (EERE)

6-TX-b - Construction Storm Water Permitting Process 6-TX-b - Construction Storm Water Permitting Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 6-TX-b - Construction Storm Water Permitting Process 06TXBConstructionStormWaterPermit.pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality EPA Regulations & Policies TPDES Construction General Permit (TXR150000) 30 Texas Administrative Code 205 General Permits for Waste Discharges Texas Water Code 26.040 General Permits Clean Water Act Triggers None specified Click "Edit With Form" above to add content 06TXBConstructionStormWaterPermit.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


GRR/Section 4-TX-a - State Exploration Process | Open Energy Information  

Open Energy Info (EERE)

4-TX-a - State Exploration Process 4-TX-a - State Exploration Process < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 4-TX-a - State Exploration Process 04TXAStateExplorationProcess.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Railroad Commission of Texas Texas Parks and Wildlife Department Regulations & Policies 16 TAC 3.5: Application to Drill, Deepen, Reenter, or Plug Back 16 TAC 3.7: Strata to Be Sealed Off 16 TAC 3.79: Definitions 16 TAC 3.100: Seismic Holes and Core Holes 31 TAC 10.2: Prospect Permits on State Lands 31 TAC 155.40: Definitions 31 TAC 155.42: Mining Leases on Properties Subject to Prospect 31 TAC 9.11: Geophysical and Geochemical Exploration Permits Triggers None specified


GRR/Section 14-TX-d - Section 401 Water Quality Certification | Open Energy  

Open Energy Info (EERE)

4-TX-d - Section 401 Water Quality Certification 4-TX-d - Section 401 Water Quality Certification < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-d - Section 401 Water Quality Certification 14TXDSection401WaterQualityCertification (2).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas Regulations & Policies 16 TAC 3.93 - RRC Water Quality Certification 16 TAC 3.30 - MOU between the RRC and the TCEQ Triggers None specified Click "Edit With Form" above to add content 14TXDSection401WaterQualityCertification (2).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Section 401 of the Clean Water Act (CWA) requires a Water Quality


GRR/Section 3-TX-b - Land Access | Open Energy Information  

Open Energy Info (EERE)

3-TX-b - Land Access 3-TX-b - Land Access < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 3-TX-b - Land Access 03TXBLandAccess.pdf Click to View Fullscreen Contact Agencies Texas General Land Office Railroad Commission of Texas Regulations & Policies Tex. Nat. Rec. Code Sec. 51.291(a) Tex. Nat. Rec. Code Sec. 33.111 Triggers None specified Click "Edit With Form" above to add content 03TXBLandAccess.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the process of gaining access to certain types of land in Texas apart from the geothermal resource lease process.


GRR/Section 14-TX-e - Ground Water Discharge Permit | Open Energy  

Open Energy Info (EERE)

GRR/Section 14-TX-e - Ground Water Discharge Permit GRR/Section 14-TX-e - Ground Water Discharge Permit < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 14-TX-e - Ground Water Discharge Permit 14TXEGroundWaterDischargePermit (1).pdf Click to View Fullscreen Contact Agencies Railroad Commission of Texas United States Environmental Protection Agency Regulations & Policies 16 TAC 3.8 (Rule 8) Triggers None specified Click "Edit With Form" above to add content 14TXEGroundWaterDischargePermit (1).pdf 14TXEGroundWaterDischargePermit (1).pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative Pits are used in drilling operations to contain drilling related fluids and


Hanford Tank Farms Vadose Zone, Addendum to the TX Tank Farm Report  

Science Conference Proceedings (OSTI)

This addendum to the TX Tank Farm Report (GJO-97-13-TAR, GJO-HAN-11) published in September 1997 incorporates the results of high-rate and repeat logging activities along with shape factor analysis of the logging data. A high-rate logging system was developed and deployed in the TX Tank Farm to measure cesium-137 concentration levels in high gamma flux zones where the spectral gamma logging system was unable to collect usable data because of high dead times and detector saturation. This report presents additional data and revised visualizations of subsurface contaminant distribution in the TX Tank Farm at the DOE Hanford Site in the state of Washington.

Spatz, R.



GRR/Section 7-TX-a - Energy Facility Registration | Open Energy Information  

Open Energy Info (EERE)

GRR/Section 7-TX-a - Energy Facility Registration GRR/Section 7-TX-a - Energy Facility Registration < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-TX-a - Energy Facility Registration 07TXAEnergyFacilitySiting.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUC Substantive Rule 25.109: Registration of Power Generation Companies and Self-Generators Triggers None specified Click "Edit With Form" above to add content 07TXAEnergyFacilitySiting.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Flowchart Narrative This flowchart illustrates the necessary process for registering as an


GRR/Section 7-TX-c - Certificate of Convenience and Necessity | Open Energy  

Open Energy Info (EERE)

GRR/Section 7-TX-c - Certificate of Convenience and Necessity GRR/Section 7-TX-c - Certificate of Convenience and Necessity < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 7-TX-c - Certificate of Convenience and Necessity 07TXCCertificateOfConvenienceAndNecessity.pdf Click to View Fullscreen Contact Agencies Public Utility Commission of Texas Regulations & Policies PUCT Substantive Rule 22 PUCT Substantive Rule 25.5 PUCT Substantive Rule 25.83 PUCT Substantive Rule 25.101 Public Utility Regulatory Act Triggers None specified Click "Edit With Form" above to add content 07TXCCertificateOfConvenienceAndNecessity.pdf Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range. Error creating thumbnail: Page number not in range.


DOE - Office of Legacy Management -- Chicago South IL Site - IL 06  

NLE Websites -- All DOE Office Websites (Extended Search)

South IL Site - IL 06 South IL Site - IL 06 FUSRAP Considered Sites Chicago South, IL Alternate Name(s): University of Chicago Charles Herbert Jones Chemical Laboratory Ryerson Physical Laboratory Eckhart Hall Kent Chemical Laboratory Ricketts Laboratory IL.06-3 Location: University of Chicago, Ellis Avenue and East 58th Street, Chicago, Illinois IL.06-3 Historical Operations: Performed activities associated with (1) production and purification of plutonium, which involved the handling and processing of uranium compounds; (2) demonstrating the self-sustaining nature of the fission process and the production of Pu-239 from U-238 (nuclear fission and Chicago Pile-1); and (3) health effects (metal toxicology and radiation effects). IL.06-5 IL.06-6 IL.06-7 Eligibility Determination: Eligible IL.06-1


DOE - Office of Legacy Management -- Chicago South IL Site - IL 06  

Office of Legacy Management (LM)

South IL Site - IL 06 South IL Site - IL 06 FUSRAP Considered Sites Chicago South, IL Alternate Name(s): University of Chicago Charles Herbert Jones Chemical Laboratory Ryerson Physical Laboratory Eckhart Hall Kent Chemical Laboratory Ricketts Laboratory IL.06-3 Location: University of Chicago, Ellis Avenue and East 58th Street, Chicago, Illinois IL.06-3 Historical Operations: Performed activities associated with (1) production and purification of plutonium, which involved the handling and processing of uranium compounds; (2) demonstrating the self-sustaining nature of the fission process and the production of Pu-239 from U-238 (nuclear fission and Chicago Pile-1); and (3) health effects (metal toxicology and radiation effects). IL.06-5 IL.06-6 IL.06-7 Eligibility Determination: Eligible IL.06-1


Vehicle Technologies Office: Fact #672: April 25, 2011 Freight...  

NLE Websites -- All DOE Office Websites (Extended Search)

82.4 167.9 Long Beach, CA Water 4 32.8 119.2 152 Houston, TX Water 5 68.5 78.2 146.7 Detroit, MI Land 6 66.5 53.7 120.2 Laredo, TX Land 7 53.9 61.8 115.8 Chicago, IL Air 8 35.9...


Weights and Measures State Directors IL  

Science Conference Proceedings (OSTI)

State Directors IL. Idaho. Mailing Address, Contact Information. ISDA Bureau of Weights & Measures PO Box 790 Boise, ID 83701. ...



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)


Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Texas AgriLife Research and Extension Center 17360 Coit Road, Dallas, TX 75252  

E-Print Network (OSTI)

Texas AgriLife Research and Extension Center 17360 Coit Road, Dallas, TX 75252 Fall Integrated Pest Management Seminar Melody Lee Texas Department of Agriculture -- Dallas Dr. Dotty Woodson Texas AgriLife Extension Service--Dallas Dr. Young-Ki Jo Texas AgriLife Extension Service -- College Station Dr. James Mc

Wilkins, Neal


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

!AUll !AUll u.s. DEP.-lliThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIP1ENT: Texas Engineering Experiment Station PROJECf TITLE: Novel Mechanical Pretreatment for Ugnocellulosic Feedstocks Page I of I STATE: TX t'unding Opportunity Announctment Number Procurement Instrument Number NEPA Control Numbu CID Numbtr Oe-FOA-0000337 EEOOO500S GFO-OOO5005-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (a ulhori7.ed under DOE Order 451.1A).1 haH' made the followinll: detumination: ex, EA, [IS APPENDIX AND NUMBER: Descriptio n: 8 3.6 Siting. construction (or modification), operation, and decommissioning of facinlies for Indoor bench-scale research projects and conventional laboratory operations (for example. preparation of chemical sta


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


File:15-TX-a- Fact Sheet - Tips for a Speedy Administrative Review.pdf |  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search File Edit History Facebook icon Twitter icon » File:15-TX-a- Fact Sheet - Tips for a Speedy Administrative Review.pdf Jump to: navigation, search File File history File usage Metadata File:15-TX-a- Fact Sheet - Tips for a Speedy Administrative Review.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 16 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 14:17, 12 June 2013 Thumbnail for version as of 14:17, 12 June 2013 1,275 × 1,650 (16 KB) Apalazzo (Talk | contribs)


File:USDA-CE-Production-GIFmaps-TX.pdf | Open Energy Information  

Open Energy Info (EERE)

TX.pdf TX.pdf Jump to: navigation, search File File history File usage Texas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 442 KB, MIME type: application/pdf) Description Texas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Texas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:21, 27 December 2010 Thumbnail for version as of 16:21, 27 December 2010 1,650 × 1,275 (442 KB) MapBot (Talk | contribs) Automated bot upload


File:03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf |  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search File Edit History Facebook icon Twitter icon » File:03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-e - Lease of Texas Parks & Wildlife Department Land (1).pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 46 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 12:50, 26 July 2013 Thumbnail for version as of 12:50, 26 July 2013 1,275 × 1,650 (46 KB) Apalazzo (Talk | contribs)


GRR/Section 15-TX-a - Air Permit - Permit to Construct | Open Energy  

Open Energy Info (EERE)

GRR/Section 15-TX-a - Air Permit - Permit to Construct GRR/Section 15-TX-a - Air Permit - Permit to Construct < GRR Jump to: navigation, search GRR-logo.png GEOTHERMAL REGULATORY ROADMAP Roadmap Home Roadmap Help List of Sections Section 15-TX-a - Air Permit - Permit to Construct 15TXAAirPermitPermitToConstruct (1).pdf Click to View Fullscreen Contact Agencies Texas Commission on Environmental Quality Regulations & Policies Title 30 of the Texas Administrative Code 30 TAC 116.114 30 TAC 39.418 30 TAC 39.604 30 TAC 39.605 30 TAC 39.409 30 TAC 116.136 30 TAC 55.254 30 TAC 116.136 30 TAC 116.137 Triggers None specified Click "Edit With Form" above to add content 15TXAAirPermitPermitToConstruct (1).pdf 15TXAAirPermitPermitToConstruct (1).pdf 15TXAAirPermitPermitToConstruct (1).pdf Error creating thumbnail: Page number not in range.


File:03-TX-g - Lease of Relinquishment Act Lands.pdf | Open Energy  

Open Energy Info (EERE)

-TX-g - Lease of Relinquishment Act Lands.pdf -TX-g - Lease of Relinquishment Act Lands.pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-g - Lease of Relinquishment Act Lands.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Go to page 1 2 Go! next page → next page → Full resolution ‎(1,275 × 1,650 pixels, file size: 82 KB, MIME type: application/pdf, 2 pages) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 11:49, 29 July 2013 Thumbnail for version as of 11:49, 29 July 2013 1,275 × 1,650, 2 pages (82 KB) Apalazzo (Talk | contribs) 14:43, 26 July 2013 Thumbnail for version as of 14:43, 26 July 2013 1,275 × 1,650, 2 pages (82 KB) Apalazzo (Talk | contribs)


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


DOE - Office of Legacy Management -- Madison - IL 26  

Office of Legacy Management (LM)

Madison - IL 26 Madison - IL 26 FUSRAP Considered Sites Madison, IL Alternate Name(s): Spectrulite Consortium, Inc. Former Dow Chemical Company Site IL.26-3 IL.26-4 Location: Intersection of College and Weaver Streets, Madison, Illinois IL.26-4 Historical Operations: Conducted experimental work in natural uranium metal extrusion. IL.26-4 IL.26-5 Eligibility Determination: Eligible IL.26-1 IL.26-2 Radiological Survey(s): Assessment Survey, Verification Survey IL.26-4 LTSM00011565 LTSM00013029 LTSM00011563 Site Status: Cleanup Complete LTSM00011565 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP Also see Madison, Illinois, Site Documents Related to Madison, IL FACT SHEET The Madison, Illinois, Site is located northeast of and


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rick Dunst Rick Dunst Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 MS 922-273C Pittsburgh, PA 15236-0940 412-386-6694 richard.dunst@netl.doe.gov Felicia Manciu Principal Investigator University of Texas at El Paso 500 West University Avenue El Paso, TX 79968-8900 915-747-5715 fsmanciu@utep.edu PROJECT DURATION Start Date 01/15/2009 End Date 12/15/2013 COST Total Project Value $249,546 DOE/Non-DOE Share $249,546 / $0


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


DOE - Office of Legacy Management -- Podbeilniac Corp - IL 22  

Office of Legacy Management (LM)

Podbeilniac Corp - IL 22 Podbeilniac Corp - IL 22 FUSRAP Considered Sites Site: PODBEILNIAC CORP. (IL.22) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.22-1 Evaluation Year: 1990 IL.22-2 Site Operations: MED used equipment for a uranium extraction experiment in 1957. IL.22-1 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities performed at the site IL.22-2 IL.22-3 IL.22-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.22-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to PODBEILNIAC CORP. IL.22-1 - Report, Ross to Quigley; Trip Report to Podbeilniac Corp.,


DOE - Office of Legacy Management -- Fansteel Metallurgical Corp - IL 16  

NLE Websites -- All DOE Office Websites (Extended Search)

Fansteel Metallurgical Corp - IL 16 Fansteel Metallurgical Corp - IL 16 FUSRAP Considered Sites Site: Fansteel Metallurgical Corp. (IL.16 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.16-1 Evaluation Year: 1987 IL.16-3 Site Operations: Sole producer and supplier of tantalum and columbium metals to the MED. IL.16-1 IL.16-3 Site Disposition: Eliminated - No radioactive materials handled at this site IL.16-2 IL.16-3 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None IL.16-2 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Fansteel Metallurgical Corp. IL.16-1 - MED Memorandum; Greninger to the File; Subject: Visit to


Tank 241-TX-118, core 236 analytical results for the final report  

SciTech Connect

This document is the analytical laboratory report for tank 241-TX-118 push mode core segments collected between April 1, 1998 and April 13, 1998. The segments were subsampled and analyzed in accordance with the Tank 241-TX-118 Push Mode Core sampling and Analysis Plan (TSAP) (Benar, 1997), the Safety Screening Data Quality Objective (DQO) (Dukelow, et al., 1995), the Data Quality Objective to Support Resolution of the Organic Complexant Safety Issue (Organic DQO) (Turner, et al, 1995) and the Historical Model Evaluation Data Requirements (Historical DQO) (Sipson, et al., 1995). The analytical results are included in the data summary table (Table 1). None of the samples submitted for Differential Scanning Calorimetry (DSC) and Total Organic Carbon (TOC) exceeded notification limits as stated in the TSAP (Benar, 1997). One sample exceeded the Total Alpha Activity (AT) analysis notification limit of 38.4{micro}Ci/g (based on a bulk density of 1.6), core 236 segment 1 lower half solids (S98T001524). Appropriate notifications were made. Plutonium 239/240 analysis was requested as a secondary analysis. The statistical results of the 95% confidence interval on the mean calculations are provided by the Tank Waste Remediation Systems Technical Basis Group in accordance with the Memorandum of Understanding (Schreiber, 1997) and are not considered in this report.




File:03-TX-f - Lease of Land Trade Lands.pdf | Open Energy Information  

Open Energy Info (EERE)

f - Lease of Land Trade Lands.pdf f - Lease of Land Trade Lands.pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-f - Lease of Land Trade Lands.pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 42 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 13:54, 26 July 2013 Thumbnail for version as of 13:54, 26 July 2013 1,275 × 1,650 (42 KB) Apalazzo (Talk | contribs) You cannot overwrite this file. Edit this file using an external application (See the setup instructions for more information) File usage The following page links to this file: GRR/Section 3-TX-f - Lease of Land Trade Lands

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Precision Extrusion Co - IL 20  

NLE Websites -- All DOE Office Websites (Extended Search)

Precision Extrusion Co - IL 20 Precision Extrusion Co - IL 20 FUSRAP Considered Sites Site: PRECISION EXTRUSION CO. (IL.20) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 720 East Green Avenue , Bensenville , Illinois IL.20-1 Evaluation Year: 1987 IL.20-2 Site Operations: 1956-1959, metal fabrication - extruded uranium billets. IL.20-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of materials handled at the site IL.20-2 Radioactive Materials Handled: Yes IL.20-1 Primary Radioactive Materials Handled: Uranium IL.20-1 Radiological Survey(s): Yes IL.20-3 Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to PRECISION EXTRUSION CO.


IL.06-123 057 I I  

Office of Legacy Management (LM)

IL.06-123 057 I I IL.06-123 057 I I 7 Bechtel National. Inc Systems Engmeers - Constructors Jackson Plaza Tower e 800 Oak Ridge Turnpike Oak Ridge. Tennessee 37830 AII.il Addr.u P.O 80.350. 0.' R,dg_. 7N 3713' .0350 7.'-. 3785873 NOV 1 5 . . u.s. Department of Energy Oak Ridge Operations Post Office Box E Oak Ridge, Tennessee 37831 Attention: Peter J. Gross, Director Technical Services Division Subject: Bechtel Job No. 14501, FUSRAP Project DOE Contract No. DE-AC05-810R20722 Revised Letter Characterization Report for the George Herbert Jones Chemical Laboratory at the Unive sity of Chicago Site, Chicago, Illinois Code: 7330/WBS: 131 Dear Mr. Gross: Radiological characterization and remedial action activities were performed by Bechtel National, Inc. (BNI) at George


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Chattanooga Eagle Ford Western Gulf TX-LA-MS Salt Basin Uinta Basin  

U.S. Energy Information Administration (EIA) Indexed Site

Western Western Gulf TX-LA-MS Salt Basin Uinta Basin Devonian (Ohio) Marcellus Utica Bakken*** Avalon- Bone Spring San Joaquin Basin Monterey Santa Maria, Ventura, Los Angeles Basins Monterey- Temblor Pearsall Tuscaloosa Big Horn Basin Denver Basin Powder River Basin Park Basin Niobrara* Mowry Niobrara* Heath** Manning Canyon Appalachian Basin Antrim Barnett Bend New Albany Woodford Barnett- Woodford Lewis Hilliard- Baxter- Mancos Excello- Mulky Fayetteville Floyd- Neal Gammon Cody Haynesville- Bossier Hermosa Mancos Pierre Conasauga Michigan Basin Ft. Worth Basin Palo Duro Basin Permian Basin Illinois Basin Anadarko Basin Greater Green River Basin Cherokee Platform San Juan Basin Williston Basin Black Warrior Basin A r d m o r e B a s i n Paradox Basin Raton Basin Montana Thrust Belt Marfa Basin Valley & Ridge Province Arkoma Basin Forest


RCRA Assessment Plan for Single-Shell Tank Waste Management Area TX-TY at the Hanford Site  

SciTech Connect

A groundwater quality assessment plan was prepared to investigate the rate and extent of aquifer contamination beneath Waste Management Area TX-TY on the Hanford Site in Washington State. This plan is an update of a draft plan issued in February 1999, which guided work performed in fiscal year 2000.

Hodges, Floyd N.; Chou, Charissa J.



E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



DOE - Office of Legacy Management -- Rock Island Arsenal - IL 09  

NLE Websites -- All DOE Office Websites (Extended Search)

Rock Island Arsenal - IL 09 Rock Island Arsenal - IL 09 FUSRAP Considered Sites Site: ROCK ISLAND ARSENAL ( IL.09 ) Eliminated from consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Rock Island , Illinois IL.09-1 Evaluation Year: 1987 IL.09-2 Site Operations: Site located on a DOD facility and operated under AEC control. Exact nature or time period of operations not clear. No indication that radioactive materials were involved. Contract work with Albuquerque Operations office performed. IL.09-1 IL.09-2 Site Disposition: Eliminated - No Authority - Referred to DOD IL.09-2 Radioactive Materials Handled: None Indicated IL.09-2 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated


DOE - Office of Legacy Management -- Kaiser Aluminum Corp - IL 19  

NLE Websites -- All DOE Office Websites (Extended Search)

Kaiser Aluminum Corp - IL 19 Kaiser Aluminum Corp - IL 19 FUSRAP Considered Sites Site: KAISER ALUMINUM CORP. (IL.19 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Dolton , Illinois IL.19-2 Evaluation Year: 1987 IL.19-2 Site Operations: Performed limited duration work extruding uranium billets into three CP-5 fuel elements, circa 1959. IL.19-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities IL.19-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.19-2 Radiological Survey(s): Yes - health and safety monitoring during operations IL.19-4 Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Blockson Chemical Co - IL 07  

Office of Legacy Management (LM)

Blockson Chemical Co - IL 07 Blockson Chemical Co - IL 07 FUSRAP Considered Sites Site: Blockson Chemical Co. (IL.07) Eliminated from consideration under FUSRAP - Referred to US EPA Region V and the State of Illinios Designated Name: Not Designated Alternate Name: Olin Corporation IL.07-1 Location: Patterson Road , Joliet , Illinois IL.07-2 Evaluation Year: 1985 IL.07-1 Site Operations: Process development studies and pilot plant testing of uranium recovery from phosphoric acid during the 1950s. Site Disposition: Eliminated - No Authority IL.07-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Radiological Survey(s): Yes IL.07-2 Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA Region V and the State of Illinios IL.07-1


DOE - Office of Legacy Management -- Kankakee Ordnance Plant - IL 32  

Office of Legacy Management (LM)

Kankakee Ordnance Plant - IL 32 Kankakee Ordnance Plant - IL 32 FUSRAP Considered Sites Site: KANKAKEE ORDNANCE PLANT (IL.32 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Kankakee , Illinois IL.32-1 Evaluation Year: 1991 IL.32-1 Site Operations: Kankakee Ordnance Plant was cited as a possible location for the disposal of radioactive waste material. There is no indication that any radioactive waste was brought to Kankakee. IL.32-1 IL.32-2 Site Disposition: Eliminated - No indication that radioactive materials were handled at this site IL.32-1 Radioactive Materials Handled: None Indicated IL.32-1 Primary Radioactive Materials Handled: None Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Swenson Evaporator Co - IL 23  

NLE Websites -- All DOE Office Websites (Extended Search)

Swenson Evaporator Co - IL 23 Swenson Evaporator Co - IL 23 FUSRAP Considered Sites Site: SWENSON EVAPORATOR CO. (IL.23 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Harvey , Illinois IL.23-1 Evaluation Year: 1987 IL.23-1 Site Operations: Scheduled a raffinate spray drying test that was later cancelled. IL.23-1 Site Disposition: Eliminated - No indication that radioactive materials were handled at this site IL.23-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to SWENSON EVAPORATOR CO. IL.23-1 - Memorandum/Checklist; D.Levine to the File; Subject:


DOE - Office of Legacy Management -- Crane Co - IL 13  

Office of Legacy Management (LM)

Crane Co - IL 13 Crane Co - IL 13 FUSRAP Considered Sites Site: Crane Co. (IL.13 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.13-2 Evaluation Year: 1987 IL.13-2 Site Operations: MED activities during late-1940s to early/mid-1950s included the development of valves and possibly the use of test quantities of normal uranium in the development process. IL.13-4 Site Disposition: Eliminated - Potential for contamination remote due to limited scope of operations IL.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.13-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Crane Co.


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Application of CC at a Corporate Headquarters Facility in Dallas, TX  

E-Print Network (OSTI)

A corporate headquarters complex located in Dallas, TX consists of four buildings served by a central utility plant. The Continuous Commissioning (CC) process was applied to one building with approximately 688,000 square feet of primarily of data floor space. This building was identified as a candidate for the CC process because it consumed 58% of the 132 million kWh of electricity used by the complex in 2010 and had recently received several HVAC upgrades. CC is an ongoing process for existing buildings and central plant facilities to resolve operating problems, improve comfort, optimize energy use, and identify retrofits based on current building usage rather than original design intent [1]. The data floor optimization process consisted of three components: traditional commissioning activities, CC measure implementation, and low cost retrofits. Various M&V strategies were also utilized to quantify the resulting energy savings in a building whose energy use is dominated by data equipment load. Using six months of pre- and post- implementation HVAC equipment electrical service meter trend data, a savings of 948,700 kWh was achieved. When these savings are extrapolated to twelve months, this project is expected to reduce the 2010 HVAC electricity usage by 25% ($133,000). Once the central plant savings are included, the overall savings of this project is approximately $146,000/year.

Meline, K.; Kimla, J.



Lessons Learned from Continuous Commissioning of the Robert E. Johnson State Office Building, Austin, TX  

E-Print Network (OSTI)

The Robert E. Johnson State Office building is a 5-story, 303,389 square foot office building built in 2000 located in downtown Austin, TX. The original building design included a number of energy conservation measures that were incorporated into the final construction. During the investigation of the building, four energy conservation measures were identified, three of which deal with conventional HVAC systems. The fourth is related to the currently unutilized daylighting system which was one of the energy conservation measures of the original building design. Utilizing this system would lead to approximately 18.5% annual lighting energy savings or 5.6% annual whole building energy savings based on a DOE-2 simulation analysis. Three main lessons were learned from the experience with the Robert E. Johnson building: The traditional design-construction-operation team must include the energy conservation analysis team The entire building process should be reorganized to assure that complete information is provided and passed on from the energy conservation analysis team High performance buildings should be continuously monitored and analyzed

Bynum, J.; Claridge, D. E.



File:03-TX-d - Lease of Public School Fund Land (1).pdf | Open Energy  

Open Energy Info (EERE)

Land (1).pdf Land (1).pdf Jump to: navigation, search File File history File usage Metadata File:03-TX-d - Lease of Public School Fund Land (1).pdf Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 41 KB, MIME type: application/pdf) File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 11:26, 29 July 2013 Thumbnail for version as of 11:26, 29 July 2013 1,275 × 1,650 (41 KB) Apalazzo (Talk | contribs) 13:47, 26 July 2013 Thumbnail for version as of 13:47, 26 July 2013 1,275 × 1,650 (41 KB) Apalazzo (Talk | contribs) You cannot overwrite this file. Edit this file using an external application (See the setup instructions for more information)


TxDOT Goes Beyond Compliance by Purchasing 100% AFVs. EPAct Fleet Information and Regulations, State& Alternative Fuel Provider Program Success Story  

DOE Green Energy (OSTI)

Fact sheet features the challenges the Texas Department of Transportation (TxDOT) faced and overcame in complying to a Texas legislation that calls for the acquisition of only alternative fuel vehicles.

Not Available



CALDERN, HCTOR. Narratives of Greater Mxico: Essays on Chicano Literary History, Genre, and Borders. Austin, TX: U of Texas P, 2004. 284 pp.  

E-Print Network (OSTI)

Borders. Austin, TX: U of Texas P, 2004. 284 pp. "There areEl New Paso and Ro Grande, Texas; Mxico; San Francisco andthe and cultural migrant Texas-Mexican farmworker community

Prez, Marisol



To be presented at the 2007 ASHRAE Winter Meeting, January 27-31, 2007, Dallas, TX. Measured energy performance a US-China demonstration  

E-Print Network (OSTI)

LBNL-60978 To be presented at the 2007 ASHRAE Winter Meeting, January 27-31, 2007, Dallas, TX efficient than ASHRAE 90.1- 1999. The utility data from the first year's operation match well the analysis


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



DOE - Office of Legacy Management -- Heavy Minerals Inc - IL...  

Office of Legacy Management (LM)

Subject: FUSRAP Considered Site Recommendation; July 9, 1990. IL.14-2 - Heavy Minerals Co. Letter; Wyatt to Faulkner; Subject: Crude Thorium Hydroxide Proposal; December 1, 1954...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



DOE - Office of Legacy Management -- W E Pratt Manufacturing Co - IL 12  

Office of Legacy Management (LM)

E Pratt Manufacturing Co - IL 12 E Pratt Manufacturing Co - IL 12 FUSRAP Considered Sites Site: W.E. PRATT MANUFACTURING CO. (IL.12) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: William E. Pratt Manufacturing Co. Klassing Handbrake Company IL.12-1 IL.12-2 Location: 18 Henderson Street , Joliet , Illinois IL.12-3 Evaluation Year: 1990 IL.12-4 IL.12-5 Site Operations: Performed metal fabrication tasks (machining and grinding). IL.12-1 IL.12-4 Site Disposition: Eliminated - Radiation levels below criteria IL.12-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal IL.12-1 IL.12-3 Radiological Survey(s): Yes IL.12-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to W.E. PRATT MANUFACTURING CO.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Rodosta Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Darin Damiani Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4398 darin.damiani@netl.doe.gov Vivak Malhotra Principal Investigator Southern Illinois University Neckers 483A Mailcode: 4401 Carbondale, IL 62901 618-453-2643 Fax: 618-453-1056 vmalhotra@physics.siu.edu PARTNERS None Risk Assessment and Monitoring of Stored CO2 in Organic Rock under Non-Equilibrium Conditions Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)


DOE - Office of Legacy Management -- Quality Hardware and Machine Co - IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Quality Hardware and Machine Co - Quality Hardware and Machine Co - IL 11 FUSRAP Considered Sites Site: QUALITY HARDWARE AND MACHINE CO. (IL.11) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Ravenswood Venture Marden Manufacturing Co. IL.11-1 IL.11-2 Location: 5823/5849 North Ravenswood Avenue , Chicago , Illinois IL.11-3 Evaluation Year: 1990 IL.11-4 IL.11-5 Site Operations: From 1944 to 1945, entered into subcontracts with the University of Chicago to furnish personnel, facilities, and equipment to produce special tools, dies, fixtures, etc., from materials furnished by the University; was involved in the Hanford slug canning process. IL.11-10 IL.11-6 IL.11-7 IL.11-8 IL.11-9 Site Disposition: Eliminated - Radiation levels below criteria IL.11-11


DOE - Office of Legacy Management -- GSA 39th Street Warehouse - IL 02  

Office of Legacy Management (LM)

GSA 39th Street Warehouse - IL 02 GSA 39th Street Warehouse - IL 02 FUSRAP Considered Sites Site: GSA 39TH STREET WAREHOUSE (IL.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1716 West Pershing Road , Chicago , Illinois IL.02-1 Evaluation Year: 1985 IL.02-2 IL.02-3 Site Operations: Stored radioactive materials. IL.02-1 IL.02-2 Site Disposition: Eliminated - Radiation levels below criteria IL.02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Unknown IL.02-2 Radiological Survey(s): Yes IL.02-1 IL.02-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to GSA 39TH STREET WAREHOUSE IL.02-1 - Report (DOE/EV-0005/9); Formerly Utilized MED/AEC Sites Remedial Action Program Radiological Survey of the Former GSA 39th Street


DOE - Office of Legacy Management -- Lindsay Light and Chemical Co - IL 10  

Office of Legacy Management (LM)

Lindsay Light and Chemical Co - IL Lindsay Light and Chemical Co - IL 10 FUSRAP Considered Sites Site: LINDSAY LIGHT AND CHEMICAL CO. ( IL.10 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: West Chicago , Illinois IL.10-3 Evaluation Year: 1995 IL.10-4 Site Operations: Processed thorium ores - chiefly monazite sands - for thorium and rare earth metals. IL.10-1 IL.10-2 Site Disposition: Eliminated - No Authority - NRC licensed operation IL.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium IL.10-2 Radiological Survey(s): Yes IL.10-2 IL.10-5 Site Status: Eliminated from consideration under FUSRAP IL.10-4 Also see Documents Related to LINDSAY LIGHT AND CHEMICAL CO. IL.10-1 - Lindsay Light & Chemical Letter; J. Murray to E. Lintner;


Optimal Deployment Plan of Emission Reduction Technologies for TxDOT's Construction Equipment  

E-Print Network (OSTI)

The purpose of this study was to develop and test an optimization model that will provide a deployment plan of emission reduction technologies to reduce emissions from non-road equipment. The focus of the study was on the counties of Texas that have nonattainment (NA) and near-nonattainment (NNA) status. The objective of this research was to develop methodologies that will help to deploy emission reduction technologies for non-road equipment of TxDOT to reduce emissions in a cost effective and optimal manner. Three technologies were considered for deployment in this research, (1) hydrogen enrichment (HE), (2) selective catalytic reduction (SCR) and (3) fuel additive (FA). Combinations of technologies were also considered in the study, i.e. HE with FA, and SCR with FA. Two approaches were investigated in this research. The first approach was "Method 1" in which all the technologies, i.e. FA, HE and SCR were deployed in the NA counties at the first stage. In the second stage the same technologies were deployed in the NNA counties with the remaining budget, if any. The second approach was called "Method 2" in which all the technologies, i.e. FA, HE and SCR were deployed in the NA counties along with deploying only FA in the NNA counties at the first stage. Then with the remaining budget, SCR and HE were deployed in the NNA counties in the second stage. In each of these methods, 2 options were considered, i.e. maximizing NOx reduction with and without fuel economy consideration in the objective function. Thus, the four options investigated each having different mixes of emission reduction technologies include Case 1A: Method 1 with fuel economy consideration; Case 1B: Method 1 without fuel economy consideration; Case 2A: Method 2 with fuel economy consideration; and Case 2B: Method 2 without fuel economy consideration and were programmed with Visual C++ and ILOG CPLEX. These four options were tested for budget amounts ranging from $500 to $1,183,000 and the results obtained show that for a given budget one option representing a mix of technologies often performed better than others. This is conceivable because for a given budget the optimization model selects an affordable option considering the cost of technologies involved while at the same time maximum emission reduction, with and without fuel economy consideration, is achieved. Thus the alternative options described in this study will assist the decision makers to decide about the deployment preference of technologies. For a given budget, the decision maker can obtain the results for total NOx reduction, combined diesel economy and total combined benefit using the four models mentioned above. Based on their requirements and priorities, they can select the desired model and subsequently obtain the required deployment plan for deploying the emission reduction technologies in the NA and NNA counties.

Bari, Muhammad Ehsanul



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


2004 Initial Assessments for the T and TX TY Tank Farm Field Investigation Report (FIR): Numerical Simulations  

SciTech Connect

In support of CH2M HILL Hanford Group, Inc.s (CHG) preparation of a Field Investigative Report (FIR) for the Hanford Site Single-Shell Tank Waste Management Area (WMA) T and TX-TY, a suite of numerical simulations of flow and solute transport was executed using the STOMP code to predict the performance of surface barriers for reducing long-term risks from potential groundwater contamination at the T and TX-TY WMA. The scope and parametric data for these simulations were defined by a modeling data package provided by CHG. This report documents the simulation involving 2-D cross sections through the T Tank and the TX-TY Tank Farm. Eight cases were carried out for the cross sections to simulate the effects of interim barrier, water line leak, inventory distribution, and surface recharge on water flow and the transport of long-lived radionuclides (i.e., technecium-99 and uranium) and chemicals (i.e., nitrate and chromium For simulations with barriers, it is assumed that an interim barrier is in place by the year 2010. It was also assumed that, for all simulations, as part of tank farm closure, a closure barrier was in place by the year 2040. The modeling considers the estimated inventories of contaminants within the vadose zone and calculates the associated risk. It assumes that no tanks will leak in the future. Initial conditions for contaminant concentration are provided as part of inventory estimates for uranium, technetium-99, nitrate, and chromium. For moisture flow modeling, Neumann boundary conditions are prescribed at the surface with the flux equal to the recharge rate estimate. For transport modeling, a zero flux boundary is prescribed at the surface for uranium, technetium-99, nitrate, and chromium. The western and eastern boundaries are assigned no-flux boundaries for both flow and transport. The water table boundary is prescribed by water table elevations and the unconfined aquifer hydraulic gradient. No-flux boundaries are used for the lower boundary. Numerical results were obtained for compliance at the WMA boundary, 200 Areas boundary, exclusion boundary beyond the 200 Areas, and the Columbia River (DOE-RL 2000). Streamtube/analytical models were used to route computed contaminant concentrations at the water table to the downstream compliance points. When the interim barrier was applied at 2010, the soil was desaturated gradually. The difference in saturation of the soil with and without the interim barrier was the largest at 2040, the time the closure barrier was applied. After this, the difference in saturation in the two cases became smaller with time. Generally, the solutes broke though faster if there was a water line leak. A relative small five-day leak (Case 4) had little effect on the peak concentration, while a large 20-yr leak (Case 3) increased the peak concentration significantly and reduced the solute travel in the vadose zone. The distribution of the inventory, either uniform or nonuniform, has little effect on peak arrival time; the peak concentrations of the conservative solutes varied by -6.9 to 0.2% for the T tank farm and by 11 to 49.4% for the TX tank farm. The reduction of the meteoric recharge before the barrier was applied led to less soil saturation, as expected, and thus longer solute travel time in the vadose zone and smaller peak fence line concentration. The effect on soil saturation lasted for about another 50 years after the barrier was applied at 2050. However, the reduced recharge rate affected the breakthough curve till the end of the simulation. The fence line concentrations at the year 3000 were always higher for cases with reduced natural recharge than for those of the base case, which indicates that the fundamental impact of the reduced natural recharge is a smoothing of the breakthrough concentrations at the compliance points.

Zhang, Z. F.; Freedman, Vicky L.; Waichler, Scott R.



Executive Bios: Dr. Yoon Il Chang - Nuclear Engineering Division (Argonne)  

NLE Websites -- All DOE Office Websites (Extended Search)

Yoon Il Chang Yoon Il Chang Director's Welcome Organization Achievements Awards Patents Professional Societies Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and Technology Legacy Opportunities within NE Division Visit Argonne Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE on Flickr Celebrating the 70th Anniversary of Chicago Pile 1 (CP-1) Argonne OutLoud on Nuclear Energy Argonne Energy Showcase 2012 Distinguished Fellows Bookmark and Share Dr. Yoon Il Chang Dr. Yoon Il Chang Senior Technical Advisor Distinguished Fellow PhD, Engineer Nuclear Engineering Division Argonne Experts: Y.I. Chang Dr. Chang joined Argonne National Laboratory in 1974 and has been


DOE - Office of Legacy Management -- American Machine and Metals Inc - IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Machine and Metals Inc - Machine and Metals Inc - IL 24 FUSRAP Considered Sites Site: American Machine and Metals Inc (IL.24 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: E. Moline , Illinois IL.24-1 Evaluation Year: 1994 IL.24-2 IL.24-3 Site Operations: Tested process for dewatering green salt by centrifugation. IL.24-1 IL.24-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited amount of radioactive materials handled IL.24-1 IL.24-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide (Green Salt) IL.24-1 Radiological Survey(s): Health and Safety Monitoring IL.24-1 Site Status: Eliminated from consideration under FUSRAP Also see


DOE - Office of Legacy Management -- Great Lakes Carbon Corp - IL 21  

Office of Legacy Management (LM)

Great Lakes Carbon Corp - IL 21 Great Lakes Carbon Corp - IL 21 FUSRAP Considered Sites Site: GREAT LAKES CARBON CORP. ( IL.21 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 333 North Michigan Avenue , Chicago , Illinois IL.21-1 Evaluation Year: 1987 IL.21-1 Site Operations: Facility performed a limited amount of nuclear fuel fabrication in the 1950s. Facility also developed graphite production under an AEC contract. IL.21-1 IL.21-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities performed IL.21-1 Radioactive Materials Handled: Yes IL.21-3 Primary Radioactive Materials Handled: Uranium, Thorium IL.21-3 Radiological Survey(s): Yes IL.21-3


DOE - Office of Legacy Management -- Wyckoff Drawn Steel Co - IL 0-09  

Office of Legacy Management (LM)

Drawn Steel Co - IL 0-09 Drawn Steel Co - IL 0-09 FUSRAP Considered Sites Site: Wyckoff Drawn Steel Co (IL 0-09) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.0-09-1 Evaluation Year: 1987 IL.0-09-3 Site Operations: Experimentation on centerless grinding of uranium rods in 1943. IL.0-09-2 IL.0-09-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited scope of activities at the site IL.0-09-1 IL.0-09-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.0-09-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Wyckoff Drawn Steel Co IL.0-09-1 - DOE Letter; Wagoner to Daley; Subject: Wycoff Steel Co.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


DOE - Office of Legacy Management -- Granite City Army Depot - IL 0-02  

Office of Legacy Management (LM)

Granite City Army Depot - IL 0-02 Granite City Army Depot - IL 0-02 FUSRAP Considered Sites Site: GRANITE CITY ARMY DEPOT ( IL.0-02 ) Eliminated from consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Granite City , Illinois IL.0-02-1 Evaluation Year: 1987 IL.0-02-1 Site Operations: Site was used for storage of GSA thorium residues until circa 1964. IL.0-02-1 Site Disposition: Eliminated - Referred to DOD IL.0-02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium IL.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP - Referred to DOD IL.0-02-1 Also see Documents Related to GRANITE CITY ARMY DEPOT IL.0-02-1 - DOE Letter; J.Fiore to C.Schafer; Information regarding


Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa


Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Secretary Bodman Highlights Advanced Energy Initiative in Peoria, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bodman Highlights Advanced Energy Initiative in Peoria, Bodman Highlights Advanced Energy Initiative in Peoria, IL Secretary Bodman Highlights Advanced Energy Initiative in Peoria, IL April 6, 2006 - 10:15am Addthis PEORIA, IL - Secretary of Energy Samuel W. Bodman today highlighted the goals of President Bush's Advanced Energy Initiative after consulting on an energy savings assessment at Caterpillar Inc.'s manufacturing facility in Peoria, Illinois. To answer President Bush's call for Americans to be more energy efficient, the Department of Energy (DOE) is conducting no-cost energy assessments at 200 of the nation's most energy-intensive manufacturing facilities to identify energy- and money-saving opportunities. "President Bush has called on all Americans to be more energy efficient. Private industry is joining the federal government in taking a leading role



Office of Legacy Management (LM)

F3on: A 6 IL F3on: A 6 IL ---A------------ ALTERNATE CITY: l4v+&a ------- _-__------___-___ STATE: -~-~-- if yes, date contacted _____ & Development a Facility Type 0 Prndurtion scale testing 0 Pilot Scale 0 Makfacturing .a Bench Scale 0 0 Process University 0 0 Theoretical Studies Reseaich Organization cl Sample & Analysis 0 Gopernment Sponsored Facility 0 Other -~~-~~~--_-~~-__----- 0 Production I 0 Disposal/Storage TYPE OF CONTRACT ~------__--_____ q Prime q Subcontract& u Purchase Order Cl Other'infcrmation (i.e., cost + fixed fee, unit price; time & material, +r) ------- ' 'Con+act/Purchase Order # nls.vP ---------------------------- --------------------_____________ CONTRACTING P=3IOD- -----------w-=---T- h,Jn<, ------------------------------- _


DOE - Office of Legacy Management -- Era Tool and Engineering Co - IL 29  

NLE Websites -- All DOE Office Websites (Extended Search)

Era Tool and Engineering Co - IL 29 Era Tool and Engineering Co - IL 29 FUSRAP Considered Sites Site: Era Tool and Engineering Co. (IL.29 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Audi-Tex Industries, Incorporated IL.29-1 Location: 4555 West Addison Street , Chicago , Illinois IL.29-2 Evaluation Year: 1989 IL.29-3 Site Operations: From February 1944 through June 1944, provided personnel, facilities, and equipment to produce machined parts for special equipment, tools, jigs, fixtures, etc., from materials furnished by the University of Chicago IL.29-4 IL.29-5 Site Disposition: Eliminated - Radiation levels below criteria IL.29-2 Radioactive Materials Handled: None indicated Primary Radioactive Materials Handled: None indicated


DOE - Office of Legacy Management -- Eimco Corp - IL 0-01  

Office of Legacy Management (LM)

Eimco Corp - IL 0-01 Eimco Corp - IL 0-01 FUSRAP Considered Sites Site: Eimco Corp. (IL.0-01 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Palatine , Illinois IL.0-01-1 Evaluation Year: 1987 IL.0-01-1 Site Operations: Conducted laboratory leaf filtration tests IL.0-01-1 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited scope of activities at the site IL.0-01-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium (Yellow Cake Uranium). IL.0-01-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Eimco Corp. IL.0-01-1 - Memorandum/Checklist; Levine to the File; Subject:


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Metodi per il miglioramento continuo della qualit. Il caso di Cesab Carrelli elavatori S.p.A (gruppo Toyota Material Handling).  

E-Print Network (OSTI)

??La tesi affronta diversi argomenti, legati ai metodi e agli strumenti per il miglioramento continuo della Qualit all'intern del mondo Toyota. Ho approfondito dunque i (more)

Dal Pra', Sarah




U.S. Energy Information Administration (EIA) Indexed Site

THURSDAY, APRIL 2, 2009 The meeting convened at 9:00 a.m. in Room 8E-089 of the James Forrestal Building, 1000 Independence Avenue, SW, Washington, D.C., Ed Blair, Chair, presiding. COMMITTEE MEMBERS PRESENT: EDWARD BLAIR, Chair STEVE BROWN MICHAEL COHEN BARBARA FORSYTH WALTER HILL VINCENT IANNACCHIONE NANCY KIRKENDALL EDWARD KOKKELENBERG ISRAEL MELENDEZ MICHAEL TOMAN JOHN WEYANT (202) 234-4433 Neal R. Gross & Co., Inc. Page 2 EIA STAFF PRESENT: STEPHANIE BROWN, Designated Federal Official, Director, Statistics and Methods Group (SMG) JAMES BERRY CAROL JOYCE BLUMBERG TINA BOWERS JAKE BOURNAZIAN, SMG EUGENE BURNS MICHAEL COLE, Office of Integrated Analysis and Forecasting (OIAF) JOHN CONTI BRENDA COX, SRA RAMESH DANDEKAR, SMG



U.S. Energy Information Administration (EIA) Indexed Site

FRIDAY APRIL 3, 2009 The meeting convened at 9:00 a.m. in Room 8E-089 of the James Forrestal Building, 1000 Independence Avenue, S.W., Washington, D.C., Edward Blair, Chair, presiding. COMMITTEE MEMBERS PRESENT: EDWARD BLAIR, Chair STEVE BROWN BARBARA FORSYTH WALTER HILL VINCENT IANNACCHIONE NANCY KIRKENDALL EDWARD KOKKELENBERG ISRAEL MELENDEZ MICHAEL TOMAN JOHN WEYANT (202) 234-4433 Neal R. Gross & Co., Inc. Page 2 EIA STAFF PRESENT: STEPHANIE BROWN, Designated Federal Official, Director, Statistics and Methods Group (SMG) JAMES BERRY CAROL JOYCE BLUMBERG TINA BOWERS JAKE BOURNAZIAN, SMG EUGENE BURNS MICHAEL COLE, Office of Integrated Analysis and Forecasting (OIAF) JOHN CONTI BRENDA COX, SRA RAMESH DANDEKAR, SMG JOHN PAUL DELEY, OIT



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lincoln lincoln u.s. DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION Pagc 1 of3 STATE: NE PROJECT TITLE: EECBG DE- EE 0000664 City of Lincoln Statement of Work Template (S) {Activities 1, 2, 3 , 4, 5 , 6 , 7 , 8, 10 & 14 on SOW; Add'i CX for 9,13,15,16,17] Funding Opportunity Announ<:ement Number PrCKurement Instrument Number NEPA Control Number cm Number DE-FOA-OOOOO13 DE-EEOOOO664 0 Based OD my review of the information con<:erning the proposed a<:tion, as NEPA Complian<:e Offi<:er (authorized under DOE Order 451.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited 10, literature surveys, inventories, audits), data analysis (including


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



The IL-9 receptor gene (IL9R): Genomic structure, chromosomal localization in the pseudoautosomal region of the long arm of sex chromosomes, and identification of IL9R pseudogenes at 9qter, 10pter, 16pter, 18pter  

Science Conference Proceedings (OSTI)

Cosmids containing the human IL-9 receptor (R) gene (IL9R) have been isolated from a genomic library using the IL9R cDNA as a probe. We have shown that the human IL9R gene is composed of 11 exons and 10 introns, stretching over {approx} 17 kb, and is located within the pseudoautosomal region of the Xq and Yq chromosome, in the vicinity of the telomere. Analysis of the 5` flanking region revealed multiple transcription initiation sites as well as potential binding motifs for AP1, AP2, AP3, Sp1, and NF-kB, although this region lacks a TATA box. Using the human IL9R cosmid as a probe to perform fluorescence in situ hybridization, additional signals were identified in the subtelomeric regions of chromosomes 9q, 10p, 16p, and 18p. IL9R homologs located on chromosomes 9 and 18 were partially characterized, while those located on chromosomes 16 and 10 were completely sequenced. Although they are similiar to the IL9R gene ({approx} 90% identity), none of these copies encodes a functional receptor: none of them contains sequences homologous to the 5` flanking region or exon 1 of the IL9R gene, and the remaining ORFs have been inactivated by various point mutations and deletions. Taken together, our results indicate that the IL9R gene is located at Xq28 and Yq12, in the long arm pseudoautosomal region, and that four IL9R pseudogenes are located on 9q34, 10p15, 16p13.3 and 18p11.3, probably dispersed as the result of translocations during evolution. 42 refs., 6 figs., 3 tabs.

Kermouni, A.; Godelaine, D.; Lurquin, C.; Szikora, J.P. [Ludwig Institute for Cancer Research, Brussels (Belgium)] [and others



DOE - Office of Legacy Management -- Morse Chemical Co - IL 0-05  

Office of Legacy Management (LM)

Morse Chemical Co - IL 0-05 Morse Chemical Co - IL 0-05 FUSRAP Considered Sites Site: MORSE CHEMICAL CO. (IL.0-05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 8 South Michigan Avenue , Chicago , Illinois IL.05-1 Evaluation Year: 1987 IL.05-3 Site Operations: Submitted a bid to AEC for thorium work; proposal was not accepted; no indication work done for a DOE predecessor at this site. IL.05-3 Site Disposition: Eliminated - No Authority - No work for a DOE predecessor was done at the site IL.05-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MORSE CHEMICAL CO.


Alkali/TX sub 2 catalysts for CO/H sub 2 conversion to C sub 1 -C sub 4 alcohols  

DOE Green Energy (OSTI)

The objective of this research is to investigate and develop novel catalysts for the conversion of coal-derived synthesis gas into C{sub 1}--C{sub 4} alcohols by a highly selective process. Therefore, the variations of catalyst activity and selectivity for the synthesis of alcohols from H{sub 2}/CO {le}1 synthesis gas for a series of A/TX{sub 2} compounds, where A is a surface alkali dopant, T is a transition metal, and X is a S, Se, or Te, will be determined. The alkali component A, which is essential for C-O and C-C bond forming reactions leading to alcohols, will be highly dispersed on the TX{sub 2} surfaces by using chemical vapor deposition (CVD) and chemical complexation/anchoring (CCA) methods. Catalysts that have been prepared during this quarter include RuS{sub 2}, NbS{sub 2}, K/MoS{sub 2}, and K/Crown either/MoS{sub 2}. Catalysts tested include KOH/MoS{sub 2} and K/Crown ether/MoS{sub 2}. 9 refs., 10 figs., 2 tabs.

Klier, K.; Herman, R.G.; Brimer, A.; Richards, M.; Kieke, M.; Bastian, R.D.



Characterization of Vadose Zone Sediments Below the TX Tank Farm: Boreholes C3830, C3831, C3832 and RCRA Borehole 299-W10-27  

Science Conference Proceedings (OSTI)

This report was revised in September 2008 to remove acid-extractable sodium data from Tables 4.8, 4.28,4.43, and 4.59. The sodium data was removed due to potential contamination introduced during the acid extraction process. The rest of the text remains unchanged from the original report issued in April 2004. The overall goal of the Tank Farm Vadose Zone Project, led by CH2M HILL Hanford Group, Inc., is to define risks from past and future single-shell tank farm activities at Hanford. To meet this goal, CH2M HILL Hanford Group, Inc. tasked scientists from Pacific Northwest National Laboratory to perform detailed analyses on vadose zone sediments from within Waste Management Area (WMA) T-TX-TY. This report is the first of two reports written to present the results of these analyses. Specifically, this report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from boreholes C3830, C3831, and C3832 in the TX Tank Farm, and from borehole 299-W-10-27 installed northeast of the TY Tank Farm.

Serne, R. Jeffrey; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; Legore, Virginia L.; Orr, Robert D.; Kutnyakov, Igor V.; Baum, Steven R.; Geiszler, Keith N.; Valenta, Michelle M.; Vickerman, Tanya S.



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Blockage of IL-6 secretion in glia by lead and mercury  

E-Print Network (OSTI)

Mercury (Hg) and lead (Pb) are toxic to the development and function of the central nervous system (CNS). Interleukin-6 (IL 6) produced by astroglia protects neurons from damage in many progressive degenerative disorders. IL-6 secretion is chaperoned by a 78 kD glucose-regulated protein (GRP78), which is an ER-chaperone protein involved in protein folding, assembly, and trafficking. We hypothesized that Pb and Hg could target GRP78 and thereby block IL-6 secretion from astroglia. In this report, we constructed an IL-6-EGFP chimera and transiently transfected rat C6 glioma cells and rat primary astroglia. IL-6-EGFP signal in transfected cultures exposed to Pb, Hg, or anti-oligos against GRP78 was detected with a bio-image fluorescence microscope. Data of the bio-image analysis showed that the retention of IL-6-EGFP in both astroglia and C6 cells transfected with IL-6-EGFP was at an undetectable level. However, the IL-6-EGFP signal in these cultures, while exposed to Pb (0-10 ?M) or Hg (0-10 ?M) for 24 hours, apparently increased, suggesting that Pb or Hg could block IL-6 secretion from astroglia. Furthermore, when these transfected cultures were exposed to anti-oligos against GRP78, as expected, the retention of IL-6-EGFP within the cultures increased. In order to quantify the increase of IL-6-EGFP retention, we used ELISA to detect IL-6 levels in the medium of non-transfected astroglia exposed to Pb (0-100 ?M) and Hg (0-10 ?M). Data showed that IL-6 levels in the medium decreased when the primary astrocyte cultures were exposed to Pb or Hg, suggesting that the increased retention results in part from a decrease in IL-6 secretion. We used an immunocytochemistry assay as an additional approach for quantifying IL-6 amounts of cells treated or not treated with metals. The immunocytochemistry data concurred with the ELISA findings. These data, together with our previous studies, suggest that Pb and Hg may target GRP78, thereby reducing the amount of IL-6 secreted from astroglia. The decrease in IL-6 secretion prevents this cytokine from doing its job of protecting and restoring neighboring neural tissue.

Pourrajabi, Nima Matthew



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)


Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Structural comparison and chromosomal localization of the human and mouse IL-13 genes  

SciTech Connect

The genomic structure of the recently described cytokine IL-13 has been determined for both human and mouse genes. The nucleotide sequence of a 4.6-kb DNA segment of the human gene is described. The human IL-13 gene (IL 13) occurs as a single copy in the haploid genome and maps to human chromosome 5. A 4.3-kb DNA fragment of the mouse IL-13 gene (Il 13) has been sequenced and found to occur as a single copy, mapping to mouse chromosome 11. Intrachromosomal mapping studies revealed that both genes contain four exons and three introns and show a high degree of sequence identify throughout their length. Potential recognition sequences for transcription factors that are present in the 5'-flanking region and are conserved between both genes include IFN-responsive elements, binding sites for AP-1, AP-2, and AP-3, an NF-lL 6 site, and a TATA-like sequence. Both genes map to chromosomal locations adjacent to genes encoding other cytokines, including IL-3, GM-CSF, IL-5, and IL-4 suggesting that IL-13 is another member of this cytokine gene family that may have arisen by gene duplication. 26 refs., 5 figs., 3 tabs.

McKenzie, A.N.J.; Sato, A.; Doyle, E.L.; Zurawski, G. (DNAX Research Institute of Cellular and Molecular Biology, Palo Alto, CA (United States)); Li, X.; Milatovich, A.; Francke, U. (Stanford Univ. Medical School, CA (United States)); Largaespada, D.A.; Copeland, N.G.; Jenkins, N.A. (National Cancer Institute, Frederick, MD (United States))



Il fenomeno dei fan nel mercato della musica. Analisi netnografica dei seguaci italiani di Bruce Springsteen.  

E-Print Network (OSTI)

??Lo studio ha ad oggetto la comunit dei fan italiani di Bruce Springsteen. Dopo aver analizzato la letteratura e descritto il fenomeno dei fan e (more)

Gallo, Sara



Characterization of Vadose Zone Sediments Below the TX Tank Farm: Probe Holes C3830, C3831, C3832 and 299-W10-27  

Science Conference Proceedings (OSTI)

Pacific Northwest National Laboratory performed detailed analyses on vadose zone sediments from within Waste Management Area T-TX-TY. This report contains all the geologic, geochemical, and selected physical characterization data collected on vadose zone sediment recovered from three probe holes (C3830, C3831, and C3832) in the TX Tank Farm, and from borehole 299-W-10-27. Sediments from borehole 299-W-10-27 are considered to be uncontaminated sediments that can be compared with contaminated sediments. This report also presents our interpretation of the sediment lithologies, the vertical extent of contamination, the migration potential of the contaminants, and the likely source of the contamination in the vadose zone and groundwater below the TX Tank Farm. Sediment from the probe holes was analyzed for: moisture, radionuclide and carbon contents;, one-to-one water extracts (soil pH, electrical conductivity, cation, trace metal, and anion data), and 8 M nitric acid extracts. Overall, our analyses showed that common ion exchange is a key mechanism that influences the distribution of contaminants within that portion of the vadose zone affected by tank liquor. We did not observe significant indications of caustic alteration of the sediment mineralogy or porosity, or significant zones of slightly elevated pH values in the probe holes. The sediments do show that sodium-, nitrate-, and sulfate-dominated fluids are present. The fluids are more dilute than tank fluids observed below tanks at the SX and BX Tank Farms. Three primary stratigraphic units were encountered in each probe hole: (1) backfill material, (2) the Hanford formation, and (3) the Cold Creek unit. Each of the probe holes contain thin fine-grained layers in the Hanford H2 stratigraphic unit that may impact the flow of leaked fluids and effect irregular and horizontal flow. The probe holes could not penetrate below the enriched calcium carbonate strata of the Cold Creek lower subunit; therefore, we did not identify the maximum vertical penetration of the tank related plumes. However, the more elevated portions of the electrical conductivity (EC) profile at probe hole C3830 currently resides at the bottom of a fine-grained thin lens in the Hanford H2 unit at 87 ft bgs. At C3831, we lack good sample coverage to ascertain whether the salt plume has significantly descended into the Cold Creek Unit. There is strong indication at probe hole C3832 that the saline plume has descended into the Cold Creek Unit. The profiles do collectively suggest that the deepest penetration of tank related fluids is found in probe hole C3832. The water potential data from 299-W10-27?s H2 unit, the unit where most of the contaminants reside in the TX probe holes, are consistent with a draining profile. Despite the evidence that elevated EC values may be present in all three probe holes to their depth of refusal, the concentrations of long-term risk drivers are not large. The inventories of potential contaminants of concern, nitrate, technetium-99, uranium, and chromium, are provided. In addition, in situ desorption Kd values for these contaminants are provided. For conservative modeling purposes, we recommend using Kd values of 0 mL/g for nitrate and technetium-99, a value of 1 mL/g for uranium, and 10 mL/g for chromium to represent the entire vadose zone profile from the bottoms of the tanks to the water table. These conservative Kd values along with the provided inventories in the vadose zone sediments obtained from the three probe holes can be used in long-term risk projections that rely on estimates of water recharge and vadose zone and aquifer transport calculations.

Serne, R JEFFREY.; Bjornstad, Bruce N.; Horton, Duane G.; Lanigan, David C.; Lindenmeier, Clark W.; Lindberg, Michael J.; Clayton, Ray E.; LeGore, Virginia L.; Orr, Robert D.; Kutnyakov, Igor V.; Baum, Steven R.; Geiszler, Keith N.; Valenta, Michelle M.; Vickerman, Tanya S.



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.




Office of Legacy Management (LM)

decontmlmtlon proceam takee longer than originally anticipated decontmlmtlon proceam takee longer than originally anticipated 'U&e order .are urgently required to prevent a shutdown. "Z, mo-1 ' 2lda.p - from 4a6-55 to a possible 4-5-55 based on the receipt of vendor's plantby 1-22-55. #iWNCD W ONTAININO Il@MQWm; ;g hours worked; Hours worked will be observed and under the control of . . M%-.'E.Section . (Copy of Vendorts letter of quotation dated l/5/55 is VAWNWWXlINALORDEt :Y $ u(,507.60 upoDRpuiI9APPROPAk &movND* 0 3375.00 (rllaxlmum) Field approval contained in .!lT Savannah.A L, 1 Not required., Gosney to Hutton. (The Operating Departmeni Ato& Bad-~ Cadeaiaa agrees on the urgency and the need for autho -,. ,n - this premiumpayment.) l-13-55 loiD. 365 duPont l topa 4-26-55 pa and the faettbat


Signaling thresholds govern heterogeneity in IL-7-receptor-mediated responses of nave CD8? T cells  

E-Print Network (OSTI)

Variable sensitivity to T-cell-receptor (TCR)- and IL-7-receptor (IL-7R)-mediated homeostatic signals among nave T cells has thus far been largely attributed to differences in TCR specificity. We show here that even when ...

Palmer, Megan Joan


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Ionizing radiation induces IL-6-production by human fibroblasts involving activation of nuclear factor-. kappa. B  

Science Conference Proceedings (OSTI)

The authors report that human lung fibroblasts respond to X-ray treatment with release of interleukin (IL) -6. Synthesis of IL-6 upon ionizing radiation is preceded by an increase of IL-6 transcript levels resulting from transcriptional activation of the IL-6 gene. Analysis of deleted fragments of the IL-6 promoter revealed that transcriptional induction of the IL-6 promoter is due to enhanced binding activity of the transcription factor NF-kB. Although AP-1 does not participate in the rapid induction of the IL-6 promoter its binding activity is also enhanced upon XRT. In contrast to binding kinetics observed with NF-kB, AP-1 binding upon XRT. In contrast to binding kinetics observed with NF-kB- and the AP-1 recognition sequence, conferred inducibility by XRT to a heterologous promoter, with reporter gene activity being maximal 24 hours or 48 hours upon XRT, respectively. Sequential activation of two distinct transcription factors might thus contribute to synchronize transcriptional activation of different genes participating in the X-ray response.

Brach, M.A.; Gruss, H.J.; Kaisho, Tsuneyasu; Asano, Yoshinobu; Vos, Sven de; Mertelsmann, R.; Hirano, Toshio; Herrmann, F. (Univ. of Freiburg (Germany) Osaka Univ. (Japan))



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


TCL: Comandi utili versione 2.1. [open stringa mode] restituisce il descrittore di un file aperto (di nome stringa) in modalit "riscrittura" (se mode w) o in  

E-Print Network (OSTI)

TCL: Comandi utili versione 2.1. [open stringa mode] restituisce il descrittore di un file aperto]) restituisce il nome del file .tcl corrente [$ns get-ns-traceall] restituisce il descrittore del file di trace

Bregni, Stefano



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Bakken Formation Producing Wells W il sto nBa North Dakota ...  

U.S. Energy Information Administration (EIA)

USA CANADA SD MT ND Saskatchewan Manitoba Dunn Ward Dawson McLean McKenzie Morton W il ams Stark Richland R os ev lt Mountrail Divide Prairie McHenry Burke Sheridan


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



INVITED REVIEW On the Role of sIL-2R Measurements in Rheumatoid Arthritis and Cancers  

E-Print Network (OSTI)

A soluble IL-2 receptor (sIL-2R) is a circulating form of a membrane receptor localized on lymphoid and some cancer cells. The biological function of sIL-2R has not been completely understood. Substantially, it seems to reflect T-lymphocyte activation in diseases of different pathology. Moreover, the soluble receptor has been considered, at least in part, responsible for unsuccessful immunotherapy with IL-2 in cancers. Several lines of evidence indicate sIL-2R measurements to be useful in determining disease progress and prognosis. This review summarizes current knowledge on the sIL-2R behavior in RA and solid cancers of varied etiology.

Anna Maria Witkowska




Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIlENT OF ENERGY DEPARTlIlENT OF ENERGY EERE PROJECT M ANAGE MENT CEN T ER NEPA DETERlIlINATION Page 1 of2 STATE: NC PROJECT TITLE : Charlotte Activity 3 * 1-485 Park & Ride Energy Efficiency Lighting Pilot ARRA-EECBG Strategy-Only Funding Opportunity Announcement Number DE·FOA-OOOOO13 Pr()(urement Instrument Number DE-EEOOO0765.001 NEPA Control Number elO Number o BaRd on my re",iew of the information concerning the proposed action, as NEPA Compliance Officer (authoriud under DOE Order 451.IA), I have made the following ddumination: ex, EA, EIS APPENDIX AN» NUMBER: Description: 82.5 Safety and environmental improvements of a facility , including replacement and upgrade of facility components, that do not result in a significant change in the expected useful life, design capacity, or function of the facility and during which



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DICHIARAZIONE CONGIUNTA DICHIARAZIONE CONGIUNTA TRA IL GOVERNO DEGLI STAT1 UNIT1 D'AMERICA IL GOVERNO DELLA REPUBBLICA ITALIANA IN TEMA DI COOPERAZIONE INDUSTRIALE E COMMERCIALE NEL SETTORE DELL'ENERGIA NUCLEARE I1 Governo degli Stati Uniti d'America e il Governo della Repubblica Italians, in seguito i "Partecipanti", RICONOSCENDO la necessita di considerare un mix adeguato di fonti di energia sicure e sostenibili dal punto di vista ambientale - compresa l'energia nucleare - per soddisfare le necessita energetiche delle popolazioni dei rispettivi Paesi; RICONOSCENDO la necessita di rispondere alle sfide derivanti dalle crescenti necessita energetiche che interessano i Paesi partecipanti, come pure la comunita internazionale in generale, in maniera da contribuire alla riduzione degli effetti nocivi dei gas serra sul

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WEDNESDAY WEDNESDAY OCTOBER 19, 2011 + + + + + The Electricity Advisory Committee met in the Conference Center of the National Rural Electric Cooperative Association Headquarters, 4301 Wilson Boulevard, Arlington, Virginia, at 2:00 p.m., Richard Cowart, Chair, presiding. MEMBERS PRESENT RICHARD COWART, Regulatory Assistance Project, Chair THE HONORABLE ROBERT CURRY, New York State Public Service Commission JOSE DELGADO, American Transmission Company (Ret.) ROGER DUNCAN, Austin Energy (Ret.) ROBERT GRAMLICH, American Wind Energy Association MICHAEL HEYECK, American Electric Power JOSEPH KELLIHER, NextEra Energy, Inc. EDWARD KRAPELS, Anbaric Holdings RALPH MASIELLO, KEMA RICH MEYER, National Rural Electric



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

+ + + + + STUDYING THE COMMUNICATIONS REQUIREMENTS OF ELECTRIC UTILITIES TO INFORM FEDERAL SMART GRID POLICIES + + + + + PUBLIC MEETING + + + + + THURSDAY, JUNE 17, 2010 + + + + + The Public Meeting was held in Room 8E069 at the Department of Energy, Forrestal Building, 1000 Independence Avenue, S.W., Washington, D.C., at 10:00 a.m., Scott Blake Harris, Chair, presiding. PRESENT: BECKY BLALOCK SHERMAN J. ELLIOTT LYNNE ELLYN SCOTT BLAKE HARRIS JIM INGRAHAM JIM L. JONES MICHAEL LANMAN KYLE McSLARROW ROY PERRY 202-234-4433 Neal R. Gross & Co., Inc. Page 2


IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H



Re: RE: disappointment BlIl.Lehr 0 Rainey, David I  

E-Print Network (OSTI)

History: Re: RE: disappointment t BlIl.Lehr 0 Rainey, David I Cc: Kathryn Moran, mcnutt, Jane. Bill Original Message - - - -- From: "Rainey, David I" Da te: Sunday, May 23, 2010 9 :30 pm Subject: RE > > -- -- -original Message-- -- - > From : Bill.Lehr@noaa.gov ( > Sent: Sunday, May 23, 2010 8:56 PM > To: Rainey, Da


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



File:USDA-CE-Production-GIFmaps-IL.pdf | Open Energy Information  

Open Energy Info (EERE)

IL.pdf IL.pdf Jump to: navigation, search File File history File usage Illinois Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 387 KB, MIME type: application/pdf) Description Illinois Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Illinois External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,275 × 1,650 (387 KB) MapBot (Talk | contribs) Automated bot upload



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAG EMENT CENTER NEPA DETERMINATION RECIPIENT: Northwest Energy Innovations Page 1 of3 STATE: OR PROJECT TITLE: WAVE ENERGY TECHNOLOGY-NEW ZEALAND MULTI-MODE WAVE ENERGY CONVERTER ADVANCEMENT PROJECT Funding Opportunity Announcement Number Procurement Instr ument Number NEPA Control Number elD Number DE-FOA -OOOO293 DE-EEOOO3642 GFO-OO03642-OO2 G03642 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made the rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: Rational for determination: EA Category: DOE/EA 1917 and DOE Mitigated FONSI signed 8-15-2012 This determination is being made for tasks 2.12 -



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIlENT OF ENERGY DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEM ENT CENT ER NEPA DFTFRlIllNATION Page 1 of2 RECIPIENT:City of Cleveland· Division of Engineering & Construction STATE: OH PROJECT TITLE: Cleveland City ARRA·EECBG Act 9 (Lake-to--Lake Bikeway) Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number OE·EEOOOO705 0 Based on my review oflhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), [have made the following determination: CX, EA, E[S APPENDIX AND NUMBER: Description: A11 Technical advice and planning assistance to internaUonal, national, stale, and local organizations, A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including


Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agreement on FutureGen Project in Mattoon, Agreement on FutureGen Project in Mattoon, IL Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL June 12, 2009 - 12:00am Addthis Washington, D.C. - U.S. Secretary of Energy Steven Chu today announced an agreement with the FutureGen Alliance that advances the construction of the first commercial scale, fully integrated, carbon capture and sequestration project in the country in Mattoon, Illinois. "This important step forward for FutureGen reflects this Administration's commitment to rapidly developing carbon capture and sequestration technology as part of a comprehensive plan to create jobs, develop clean energy and reduce climate change pollution." said Energy Secretary Steven Chu. "The FutureGen project holds great promise as a flagship facility to



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DETERlIlINATION DETERlIlINATION RECIPIENT:Westmoreland County Page 101"2 STATE: PA PROJECf TITLE: Westmoreland County (PA)· Geothermal at New Juvenile Detention Center· ARRA-EECBG Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOAOOOOO13 DE-EE00CI0940 0 Based on my review or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, EIS APPEND IX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Differential transcriptional regulation of IL-8 expression by human airway epithelial cells exposed to diesel exhaust particles  

Science Conference Proceedings (OSTI)

Exposure to diesel exhaust particles (DEP) induces inflammatory signaling characterized by MAP kinase-mediated activation of NFkB and AP-1 in vitro and in bronchial biopsies obtained from human subjects exposed to DEP. NFkB and AP-1 activation results in the upregulation of genes involved in promoting inflammation in airway epithelial cells, a principal target of inhaled DEP. IL-8 is a proinflammatory chemokine expressed by the airway epithelium in response to environmental pollutants. The mechanism by which DEP exposure induces IL-8 expression is not well understood. In the current study, we sought to determine whether DEP with varying organic content induces IL-8 expression in lung epithelial cells, as well as, to develop a method to rapidly evaluate the upstream mechanism(s) by which DEP induces IL-8 expression. Exposure to DEP with varying organic content differentially induced IL-8 expression and IL-8 promoter activity human airway epithelial cells. Mutational analysis of the IL-8 promoter was also performed using recombinant human cell lines expressing reporters linked to the mutated promoters. Treatment with a low organic-containing DEP stimulated IL-8 expression by a mechanism that is predominantly NFkB-dependent. In contrast, exposure to high organic-containing DEP induced IL-8 expression independently of NFkB through a mechanism that requires AP-1 activity. Our study reveals that exposure to DEP of varying organic content induces proinflammatory gene expression through multiple specific mechanisms in human airway epithelial cells. The approaches used in the present study demonstrate the utility of a promoter-reporter assay ensemble for identifying transcriptional pathways activated by pollutant exposure.

Tal, Tamara L. [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Simmons, Steven O. [Integrated Systems Toxicology, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Silbajoris, Robert; Dailey, Lisa [Environmental and Public Health, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Cho, Seung-Hyun [Air Pollution Prevention Control Division, National Risk Management Research Laboratory, U.S. EPA (United States); Research Participation Program, Oak Ridge Institute for Science and Education, Oak Ridge (United States); Ramabhadran, Ram [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Integrated Systems Toxicology, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Linak, William [Air Pollution Prevention Control Division, National Risk Management Research Laboratory, U.S. EPA (United States); Reed, William; Bromberg, Philip A. [Center for Environmental Medicine, Asthma, and Lung Biology, University of North Carolina, Chapel Hill (United States); Samet, James M., E-mail: samet.james@epa.go [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Environmental and Public Health, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States)



Demonstration Assessment of Light-Emitting Diode (LED) Accent Lighting at the Field Museum in Chicago, IL  

SciTech Connect

This report reviews a demonstration of light-emitting diode (LED) accent lighting compared to halogen (typical) accent lighting in a gallery of the Field Museum in Chicago, IL.

Myer, Michael; Kinzey, Bruce R.




U.S. Energy Information Administration (EIA) Indexed Site



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available




Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



DOE Challenge Home Case Study, Weiss Building & Development, LLC., Custom Home, Downer Grove, IL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC LLC Custom Home Downers Grove, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


DOE Challenge Home Case Study, Weiss Building & Development, LLC., System Home, River Forest, IL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC LLC System Home River Forest, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

p-, ** p-, ** ~ , u.s DEPARTMENT OFENFRGY EERE PROJECT MAN AGEM ENT CENT ER NEPA DETEIU.IlNATION RECIPIENT:Simpson College; a SEP ARRA sub-recipient of the Iowa Economic Development Authority PROJECf TITLE: Simpson College Boiler Plant De-Centralization Page 1 of3 STATE: lA Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number DE-EEOOOO162 NEPA Control Number em Number GF0-0000162-020 EE162 Based on my review of the information concerning the proposed aelion, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 (a) Actions to conserve energy or water, demonstrate potential energy or water conservation, and promote energy

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 21 Recipient: County of McHenry, IL ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Project #1: Daylighting B5.1 None Project #2: Occupancy Sensors B5.1 None Project #3: Administration Building - LED Parking Lot Lighting B5.1 Waste Stream Clause Project #4: Annex A - Replace Hot Water Boiler B5.1 Waste Stream Clause *boiler replacements cannot result in a net increase in air emissions. Project #5: Annex A - Window Film B5.1 None Project #6: Department of Transportation Building - Skylights B5.1 Historic Preservation Clause Waste Stream Clause Project #7: Department of Transportation Building - HID to T8 Fluorescent with Occupancy Sensors



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FINDING FINDING OF NO SIGNIFICANT IMPACT FOR LINAC COHERENT LIGHT SOURCE-Il PROJECT SLAC NATIONAL ACCELERATOR LABORATORY AGENCY: U. S. Department of Energy (DOE) ACTION: Finding of No Significant Impact (FONSI) SUMMARY: The U. S. Department of Energy (DOE) has completed an Environmental Assessment (DOE/EA-1904) on a project to expand the existing Linac Coherent Light Source (LCLS) facility at the SLAC National Accelerator Laboratory (SLAC). One of SLAC's major scientific facilities is the LCLS, the world's first hard X-ray free electron laser. The LCLS X-ray laser beams enable the simultaneous investigation of a material's electronic and structural properties on the size (sub-nanometer) and time (femto-second) scales that determine their function. Research programs at SLAC include materials science, catalytic sciences, structural molecular biology, and molecular environmental


DOE Challenge Home Case Study, StreetScape Development, LLC, Libertyville, IL, Custom  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

StreetScape StreetScape Development, LLC Libertyville, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


Snapshots of the IL-4 Receptor Ternary Complexes: An Opportunity to  

NLE Websites -- All DOE Office Websites (Extended Search)

Snapshots of the IL-4 Receptor Ternary Snapshots of the IL-4 Receptor Ternary Complexes: An Opportunity to Visualize the Basis of Cytokine Receptor Pleiotropy in the Immune System Cytokines are a group of proteins and peptides that are employed in complex multi-cellular organisms as signaling compounds produced by individual cells to transmit information from one cell to another. The distances across which these cytokine signals may travel varies from within the neighborhood of a tissue or organ to remote tissues far away from the cytokine source via the blood. They are variously named as interleukins, lymphokines, and chemokines as well as other "factors" and with the names based upon the presumed function at the time of discovery. These cytokines act by binding to a cell surface receptor in either of two ways. In the first case a cytokine binds the extracellular domain of a receptor and recruits additional receptors where a receptor is composed of three domains: extracellular ligand binding domain, a single trans-membrane helix domain and an intracellular domain; in this case, cytokine binding and subsequent extracellular domain rearrangements change the spacing and orientation of the intracellular domains resulting in signal transduction across the cell membrane in a deliberate manner. In the second case a cytokine binds to a multi-spanning transmembrane protein causing movements within the transmembrane region, which conveys the signal more directly across the membrane, where this latter mechanism is beyond the scope of our research results. Due to their central role in the immune system, cytokines are involved in a variety of immunological, inflammatory, and infectious diseases. When the body is fighting pathogens, cytokines activate and recruit immune cells to travel to the site of infection, for example. These cytokine-mediated processes are known to go awry in some diseases.


ITP Chemicals: Metal Dusting Phenomenon  

NLE Websites -- All DOE Office Websites (Extended Search)

IL DuPont Central Research Wilmington, DE Duraloy Technologies, Inc. Scottsdale, PA Exxon Chemical Company Baytown, TX Haynes International, Inc. Kokomo, IN Sandvik Steel...


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links  

E-Print Network (OSTI)

An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell to cancer, and NF-kB appears to play a causa- tive role, but the mechanisms are poorly understood. We show activation triggers an inflammatory response mediated by NF-kB that directly activates Lin28 transcription


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.




Science Conference Proceedings (OSTI)

In both cases of packages for either low-level and intermediate-level short-lived (LL-IL/SL) or high-level and intermediate-level long-lived (HL-IL/LL) radioactive waste, Andra has defined a quality reference system, manages it, follows up its appropriate implementation in production plants and verifies its effectiveness in production. The purpose of such a reference system is to ensure, in the first case, that waste packages comply with the Centre de l'Aube's acceptance criteria and, in the second case, that the characteristics submitted by the waste generators to Andra as input data for the deep geological repository project reflect the actual production conditions. In that context, the three management steps of the quality reference system include differences due to the fact that HL-IL/SL packages have not been submitted yet to any technical acceptance criterion. Compliance with any such criterion should be the subject of a characterization report during the qualification phase and of a examination during the verification phase. The management of the quality reference system also involves similarities that facilitate the joint work carried out by Andra with the waste generators, especially in the facilities where both package types are produced.

Trentesaux, C.; Cairon, P.; Dumont, J.-N.; Felix, B.; Losada, F.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'""c-.-n. '""c-.-n. j!." OJ . U.S. DEP.-\RTUENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERl\ilNATION RECIPIENT:James Hardie Building Products PROJECT TITLE: XLD Reject Reclamation STATE: IL Page 1 of2 / ~ ~,' .' unding Opportunity AnnounCEment Number Procurement Instrument Numbu NEPA Control Number CID Number DE-FOA-OOOOOS2 EEOOOO119 GFO-1Q.-322 EE119 Baud on my rnitw oftht information concerning the proposed action, 85 NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Office of Legacy Management (LM)

IlONITORING REPORT FOR THE NEVADA TEST SITE IlONITORING REPORT FOR THE NEVADA TEST SITE AND OTHER TEST AREAS USED FOR UNDERGROUND NUCLEAR DETONATIONS January through December 1975 Nonitoring Operations Division Environmental Monitoring and Support Laboratory U.S. ENVIRONMENTAL PROTECTION AGENCY Las Vegas, Nevada 89114 APRIL 1976 This work performed under a Memorandum of Understanding No. AT(26-1)-539 for the U . S . ENERGY RESEARCH & DEVELOPMENT ADMINISTRATION EMSL-LV-5 39-4 May 1976 ENVIRONMENTAL 14ONITORING REPORT FOR THE NEVADA TEST SITE AND OTHER TEST AREAS USED FOR UNDERGROUND NUCLEAR DETONATIONS January through December I975 Monitoring Operations Division Environmental Monitoring and Support Laboratory U.S. ENVIRONMENTAL PROTECTION AGENCY Las Vegas, Nevada 89114 APRIL 1976 This work performed under a Memorandum of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DEl'ER}.fiNATION RECIPIENT:Cortiand County Business Development Corporation PROJE(.T TITLE : Energy Independent Agri-Business Outreach Page I of2 STATE: NY Funding Opportunity Announcement Number DE-EOOO3110 Procurement Instrument Number EEOOO3110 NEPA Control Number em Number GFO-10-573 0 Based on my review orlbe information concerning the proposed action, as N[PA Compliance Officer (autborized under DOE Order 4SI.IA),1 have made tbe follol'iing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul nollimiled 10, literature surveys. inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENTER CENTER NEPA DETER!vIlNATION RECIPIENT:l1linois Department of Commerce and Economic Opportunity PROJECf TITLE: Fluorecycle. Inc Page 1 of2 / ® STATE: IL Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number EEOOOO119 NEPA Control Number em Numbcr EEll9 Based on my rc"iew ortbe information cODeeming the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following detennination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy--efficiency that do nol increase the indoor concentrations of potentially hannful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


C E N T R A L F IL E S  

Office of Legacy Management (LM)

;zJy, y ;zJy, y J l . T;? : Tflj~j : - ..- ":'cyi$:T,;L . . :z*:, 0 , _ _ : 7 r;-2 :: '7 .' . A 1 :- :-; '3 s:s:a *;iy,:;.~ ~ r.3 , :,& . fJ . A . -y& ~ :.-, ;,!*3 , J. -. v :+ tn g C E N T R A L F IL E S ~ > m cTpnz '3 F T E iP T h e o b ;ectl'.'e o f th e ? = r i ~ ';lila to d 9 c u s s th e h e a l th a n d s a fe ty a s p e c ts o f a - p r O p O S e d O f? -31'te te s t involving electro n b e a m m e l tin g o f s o l & 2 a m n l u m n e tal a t th e S ta u ffer-Temescal C o m p a n y , R i c h m o n d , C a lifornia. T h e technical a s p e c ts o f th e te a t w e r e d iscussed a t - 3 n e s a m e rr?eeti!? g by A . D . C a v e tt, M e tallurgical IIe p a r tze n t, w h o is submitting a sepsi-ate trip r e p o r t. S o m e w h a t sim ilar work xlth uraniiun h a s b e e n d o n e by th e S tsu ffer- T e m e s c a l C o m p a n y iJ th e s a m e fu r 2 3 a c e o n tw o previous occasions - for Y o rth A m e rilcan A viatio


Characterization of the Transient Response of the ILS with One Module Installed to Heatup Changes in Power Level and Cooldown  

DOE Green Energy (OSTI)

This report provides documentation of the initial startup and testing of the first electrolysis module in the Idaho National Laboratory (INL) High Temperature Steam Electrolysis Integrated Laboratory Scale (ILS) facility. Initial shakedown testing of the INL ILS experimental facility commenced on August 22, 2007. This fulfilled a DOE Level 2 milestone. Heatup of the first ILS module started at approximately 4:10 PM on September 24, 2007. Initial module testing continued for 420 hours. The test average H2 production rate was approximately 1.3 Nm3/hr (0.116 kg H2/hr), with a peak measured value of over 2 Nm3/hr (0.179 kg H2/hr). Significant module performance degradation was observed over the first 250 hours, after which no further degradation was noted for the remainder of the test. Once all test objectives had been successfully met, the test was terminated in a controlled fashion. Discussion is included concerning several modifications that will be incorporated into the facility components to improve reliability and ease of operation for future long term testing.

K. G. Condie; C. M. Stoots; J. E. O'Brien; J. S. Herring




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

THURSDAY THURSDAY OCTOBER 20, 2011 + + + + + The Electricity Advisory Committee met, in the Conference Center of the National Rural Electric Cooperative Association Headquarters, 4301 Wilson Boulevard, Arlington, Virginia, at 8:00 a.m., Richard Cowart, Chair, presiding. MEMBERS PRESENT RICHARD COWART, Regulatory Assistance Project, Chair RICK BOWEN, Alcoa RALPH CAVANAGH, Natural Resources Defense Council THE HONORABLE ROBERT CURRY, New York State Public Service Commission JOSE DELGADO, American Transmission Company (Ret.) ROGER DUNCAN, Austin Energy (Ret.) ROBERT GRAMLICH, American Wind Energy Association MICHAEL HEYECK, American Electric Power JOSEPH KELLIHER, NextEra Energy, Inc. EDWARD KRAPELS, Anbaric Holdings


Freeport, TX LNG Imports from All Countries  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Micro-Grids for Colonias (TX)  

Science Conference Proceedings (OSTI)

This report describes the results of the final implementation and testing of a hybrid micro-grid system designed for off-grid applications in underserved Colonias along the Texas/Mexico border. The project is a federally funded follow-on to a project funded by the Texas State Energy Conservation Office in 2007 that developed and demonstrated initial prototype hybrid generation systems consisting of a proprietary energy storage technology, high efficiency charging and inverting systems, photovoltaic cells, a wind turbine, and bio-diesel generators. This combination of technologies provided continuous power to dwellings that are not grid connected, with a significant savings in fuel by allowing power generation at highly efficient operating conditions. The objective of this project was to complete development of the prototype systems and to finalize and engineering design; to install and operate the systems in the intended environment, and to evaluate the technical and economic effectiveness of the systems. The objectives of this project were met. This report documents the final design that was achieved and includes the engineering design documents for the system. The system operated as designed, with the system availability limited by maintenance requirements of the diesel gensets. Overall, the system achieved a 96% availability over the operation of the three deployed systems. Capital costs of the systems were dependent upon both the size of the generation system and the scope of the distribution grid, but, in this instance, the systems averaged $0.72/kWh delivered. This cost would decrease significantly as utilization of the system increased. The system with the highest utilization achieved a capitol cost amortized value of $0.34/kWh produced. The average amortized fuel and maintenance cost was $0.48/kWh which was dependent upon the amount of maintenance required by the diesel generator. Economically, the system is difficult to justify as an alternative to grid power. However, the operational costs are reasonable if grid power is unavailable, e.g. in a remote area or in a disaster recovery situation. In fact, avoided fuel costs for the smaller of the systems in use during this project would have a payback of the capital costs of that system in 2.3 years, far short of the effective system life.

Dean Schneider; Michael Martin; Renee Berry; Charles Moyer



TX, RRC District 6 Proved Nonproducing Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Includes only those ...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Studio di fattibilit per un impianto a biogas nel settore vitivinicolo: il caso della "Cantina Valpantena Verona S.c.a.".  

E-Print Network (OSTI)

??Analisi del settore biogas dal punto di vista energetico,tecnico e normativo, con riferimento al DM 6 luglio 2012 (Decreto rinnovabili).Il caso di studio specifico riguarda (more)

Bonfante, Nicola



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



EIA Drilling Productivity Report  

U.S. Energy Information Administration (EIA) Indexed Site

Drilling Productivity Report Drilling Productivity Report For Center on Global Energy Policy, Columbia University October 29, 2013 | New York, NY By Adam Sieminski, Administrator The U.S. has experienced a rapid increase in natural gas and oil production from shale and other tight resources Adam Sieminski, EIA Drilling Productivity Report October 29, 2013 2 0 5 10 15 20 25 30 35 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 2000 2002 2004 2006 2008 2010 2012 Eagle Ford (TX) Bakken (MT & ND) Granite Wash (OK & TX) Bonespring (TX Permian) Wolfcamp (TX Permian) Spraberry (TX Permian) Niobrara-Codell (CO) Woodford (OK)



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA


Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...



NLE Websites -- All DOE Office Websites (Extended Search)




NLE Websites -- All DOE Office Websites (Extended Search)

A . ID 'ODE Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 PAGE 1 OF 2 PAGES MI83 I April 1,2009 6. ISSUED BY CODE U.S. Department of Energy...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tvIENT OF ENERG tvIENT OF ENERG Y EERE PROJ ECT MANAGEMENT CEN T ER NEPA DETERlIlINAIION RECIPIENT;County of Montgomery Page 1 of2 STATE: PA ~ R liO i ~ PROJELi TITLE: Montgomery County (PA): Financial Incentive Program and Energy Efficiency Retrofits -- ARRA-EECBG (S) Funding Opportunity Announcement Number DE-FOA-0000013 Procurement Instrument Number DE-EE0000938 NEPA Control Number em Number o Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and planning assistance to international, national, state, and local organizations. A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE EE RE PROJECT MANAGEMENT CENTER NEPA DETERlIlIN.-\IION Page 1 of2 RECIPIENT:Delaware State Energy Office - DNREC . STATE: DE PROJECf TITLE: EECBG Rehoboth Beach Convention Center VVhile Roof and Insulation Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO775 GFO.()()()()775-003 0 Based on my review of the information (on("eruing the proposed actioD, as NEPA Compliance Omen (authorized under DOE Order 451.11\), I have made tbe following determination: ex, EA, [IS APPENDIX AND NUMBER: Descriptiun: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase Ihe indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

·O'.G: , ·O'.G: , u.s. DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION RECIPIENT:Polk County PROJECT TITLE: Polk County, FL EECBG - SOW Building Control Systems EE Retrofits (S) Page 1 of2 STATE: FL Funding Opportunity Announcement Number DE-FOAOOOO013 Procurement Instrument Number DE-EE0000796 NEPA Control Number CID Number o Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency thai do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIIENT OF ENERGY DEPARTlIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERJl.ilNATION Page 1 01'2 RECIPIENT:County of Baltimore STATE: MD PROJECT TITLE: County of Baltimore ARRA-EEC8G (5) funding Opportunity Announcement Number DE-FOA-OOOOO13 Procurement Instrument Number DE-EEOOOO740 NEPA Control Number em Numbn o Baud on my nview oftht information concerning the proposed action, as NEPA Compliance Offien (authoril:ed under DOE Order 45I.1A), I han made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 InfOm1ation gathering (including. but not limited to, literature surveys, inventories, audits), data analysis (induding computer modeling), document preparation (such as conceptual design or feasibi lity studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Noriolk City of Noriolk u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAG EMEN T CENTER NEPA DETERl\ilNATION Page 1 of2 STATE: VA PROJECT TITLE: Green Vision Community Energy Program and Evergreen Municipal Energy Efficiency Program- SOW (5) Funding Opportunity Announcement Number Proc:urt:mtnt Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 OE-EEOOOO880/000 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Maria Cadeddu, James C. Liljegren, and Andrew Pazmany Decision and Information Sciences Division, Argonne National Laboratory, Argonne, IL  

NLE Websites -- All DOE Office Websites (Extended Search)

and Retrievals from a New 183-GHz Water Vapor Radiometer in the Arctic and Retrievals from a New 183-GHz Water Vapor Radiometer in the Arctic Maria Cadeddu, James C. Liljegren, and Andrew Pazmany Decision and Information Sciences Division, Argonne National Laboratory, Argonne, IL Prosensing, Inc., Amherst, MA This work was supported by the Climate Change Research Division, U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, under contract W-31-109-Eng-38, as part of the DOE Atmospheric Radiation Measurement (ARM) Program. Argonne National Laboratory is managed by The University of Chicago for the U.S. Department of Energy. The two-channels microwave water vapor radiometer (MWR) shown in Fig. 1 measures brightness temperatures at the microwave frequencies of 23.8 and 31.4 GHz. Brightness


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


XL-A A.&lx A!i' X!Ii?Z IL';;i'  

Office of Legacy Management (LM)

-- :I 9 .a # ** ,. . . m . . pJ;-,L' ,' i:-t.T .)r' yjs JzZ~ J~~;L,;.~;r 1:). 2 . m I;S~X:T ?I?. ::.:-25-::%-I.:.Glu~ XL-A A.&lx A!i' X!Ii?Z IL';;i' , X2,-d c i.XZEA?, th At3Ac Z:r.zr.~ f4z22s343n >q3 pquask$ tL,..- psg zd of &,-cc b&ldjmms: >UAeT; :,:,. &&;j L' *r: ! 3 ..m 3CCU"pxy &jJdbc ' Au ..3* 6u, I;..:; ' 2. CL&51, 1;; *-- l - l &j-2+; z5 a?, ft . IALP !13. f&%-i;& 2$&J 3;. ft.1 sq, ft.; &ii+ m* i.3. $+, hZE2X, it >a tmn dds=ir.ti mailzblc for t.ha us rcq:~sted. eat 3' tid tulla.Eg axi 2zd3 are . - \ .'iizx, E ri~h~ysl.-eT;try m3 frrnt-cd to tB3 Atod~ Crmycp Caziszlon ta use xxi occ-2;~7 tahze3 'fi--- 34 acma of la& "d&&e+ &-J-.*3 lisp, G;i &;>?ma'$Q


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


NMR Study of the Dynamics of ILs with -CH2Si(CH3)3 vs CH2C(CH3)3  

NLE Websites -- All DOE Office Websites (Extended Search)

Magnetic Resonance Study of the Dynamics of Imidazolium Ionic Magnetic Resonance Study of the Dynamics of Imidazolium Ionic Liquids with -CH2Si(CH3)3 vs CH2C(CH3)3 Substituents S. H. Chung, R. Lopato, S. G. Greenbaum, H. Shirota, E. W. Castner, Jr. and J. F. Wishart J. Phys. Chem. B 111, 4885-4893 (2007). [Find paper at ACS Publications] or use ACS Articles on Request Abstract: Trimethylsilylmethyl (TMSiM)-substituted imidazolium bis(trifluoromethylsulfonyl)imide (NTf2-), and tetrafluoroborate (BF4-) ionic liquids (ILs) have lower room-temperature viscosities by factors of 1.6 and 7.4, respectively, than isostructural neopentylimidazolium ILs. In an attempt to account for the effects of silicon substitution in imidazolium RTILs and to investigate the ion dynamics, we report nuclear magnetic resonance (NMR) measurements of 1H (I = 1/2) and 19F (I = 1/2)



Office of Legacy Management (LM)

design. The ingot size will be 5 inch diameter and 46 inches long approximately before crop- ping. It i estimated-that the total cycle for a run containing zinc will be 12 hours,...



NLE Websites -- All DOE Office Websites (Extended Search)

address Address: 15013 Denver West Parkway City: Golden StateorProvince: CO PostalCode: 80401 Country: USA ContactVoiceTelephone: 303-384-7098 ContactFacsimileTelephone:...



U.S. Energy Information Administration (EIA) Indexed Site




U.S. Energy Information Administration (EIA) Indexed Site




U.S. Energy Information Administration (EIA) Indexed Site



Urban Surfaces and Heat Island Mitigation Potentials  

E-Print Network (OSTI)

8. Surface-types in Sacramento, CA (Above-the-canopy view).for fur cities: Sacramento, CA, Salt Lake City, UT, Chicago,IL, Houston, TX, Sacramento, CA, and Salt Lake City, UT.

Akbari, Hashem



Urban surfaces and heat island mitigation potentials  

NLE Websites -- All DOE Office Websites (Extended Search)

aerial color orthophotography, for four metropolitan areas of Chicago, IL, Houston, TX, Sacramento, CA, and Salt Lake City, UT. The digital high resolution (0.3 to 0.5-m) aerial...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Oil and Gas Field Code Index  

U.S. Energy Information Administration (EIA)

000478 TX Cat 000479 TX Cattail Hollow 000480 TX Catto 000481 TX Cavallo West 000482 TX Cayman 000483 TX Cecile South 000484 TX Celery 000485 OK Centerpoint SW


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada




Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding


TX, RRC District 4 Onshore Nonassociated Natural Gas Proved Reserves...  

Gasoline and Diesel Fuel Update (EIA)

Increases 860 980 1,064 798 1,129 2,390 1979-2011 Revision Decreases 1,900 854 1,684 1,456 882 1,133 1979-2011 Sales 1,198 1,895 191 273 219 964 2000-2011 Acquisitions 1,235...


TX, RRC District 1 Nonassociated Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

,048 1,029 987 1,456 2,332 5,227 1979-2011 Adjustments 83 -6 113 5 -95 -42 1979-2011 Revision Increases 32 51 37 110 430 2,184 1979-2011 Revision Decreases 186 109 143 110 331 116...


TX, RRC District 3 Onshore Nonassociated Natural Gas Proved Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

1979-2011 Adjustments 28 16 74 -105 56 -29 1979-2011 Revision Increases 401 445 324 456 419 355 1979-2011 Revision Decreases 454 444 491 338 288 225 1979-2011 Sales 412 565 70...


El Paso, TX Natural Gas Pipeline Exports to Mexico (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 958: 860: 509: 487: 503: 482: 449: 452: 456: 531: 670: 1,024: 2012: 710: 783: 648: 505: 407: 432: 469: 490 ...


TX, RRC District 8 Associated-Dissolved Natural Gas Proved ...  

U.S. Energy Information Administration (EIA)

Area: Period: Annual : Download Series History: Definitions, Sources ... 51: 102: 285: 153: 2000-2011: Acquisitions: 148: 169: 189: 119: 805: 485: 2000-2011 ...


TX, RRC District 1 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

2 435 1,564 5,123 2007-2011 Adjustments 5 8 0 2009-2011 Revision Increases 1 322 2,141 2009-2011 Revision Decreases 0 251 48 2009-2011 Sales 0 409 1,132 2009-2011 Acquisitions 0...


TX, RRC District 9 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

7,134 8,700 10,756 12,573 10,276 2007-2011 Adjustments 179 533 42 2009-2011 Revision Increases 580 1,044 3,005 2009-2011 Revision Decreases 469 191 5,864 2009-2011 Sales 53 83...


TX, RRC District 5 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

8,099 11,408 13,691 16,032 19,747 2007-2011 Adjustments 657 105 233 2009-2011 Revision Increases 928 643 3,094 2009-2011 Revision Decreases 587 405 1,405 2009-2011 Sales 5 0 5,772...


TX, RRC District 10 Shale Gas Proved Reserves, Reserves Changes...  

Annual Energy Outlook 2012 (EIA)

0 0 0 0 0 2007-2011 Adjustments 0 0 -1 2009-2011 Revision Increases 0 0 0 2009-2011 Revision Decreases 0 0 0 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 0 2009-2011 Extensions...


TX, RRC District 3 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

0 0 1 2007-2011 Adjustments 0 0 1 2009-2011 Revision Increases 0 0 0 2009-2011 Revision Decreases 0 0 0 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 0 2009-2011 Extensions 0 0...


TX, RRC District 2 Onshore Shale Gas Proved Reserves, Reserves...  

Gasoline and Diesel Fuel Update (EIA)

2010 2011 View History Proved Reserves as of Dec. 31 395 1,692 2010-2011 Adjustments 6 237 2010-2011 Revision Increases 6 388 2010-2011 Revision Decreases 5 402 2010-2011 Sales 0...


TX, State Offshore Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

0 0 0 0 2007-2010 Adjustments 0 0 2009-2010 Revision Increases 0 0 2009-2010 Revision Decreases 0...


TX, State Offshore Shale Gas Proved Reserves, Reserves Changes...  

Annual Energy Outlook 2012 (EIA)

2007 2008 2009 2010 View History Proved Reserves as of Dec. 31 0 0 0 0 2007-2010 Adjustments 0 0 2009-2010 Revision Increases 0 0 2009-2010 Revision Decreases 0 0 2009-2010 Sales...


TX, RRC District 10 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

-1 2009-2011 Revision Increases 0 0 0 2009-2011 Revision Decreases 0 0 0 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 0 2009-2011 Extensions 0 0 1...


TX, RRC District 4 Onshore Shale Gas Proved Reserves, Reserves...  

Annual Energy Outlook 2012 (EIA)

78 565 2,611 2007-2011 Adjustments 53 0 185 2009-2011 Revision Increases 0 66 792 2009-2011 Revision Decreases 0 12 295 2009-2011 Sales 0 0 75 2009-2011 Acquisitions 0 0 75...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TX, RRC District 8 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

5 48 24 90 61 2007-2011 Adjustments -1 53 -79 2009-2011 Revision Increases 2 20 45 2009-2011 Revision Decreases 22 0 12 2009-2011 Sales 0 0 0 2009-2011 Acquisitions 0 0 20...


TX, RRC District 6 Shale Gas Proved Reserves, Reserves Changes...  

Gasoline and Diesel Fuel Update (EIA)

0 173 1,161 4,381 6,584 2007-2011 Adjustments 40 1,968 26 2009-2011 Revision Increases 422 1,206 2,322 2009-2011 Revision Decreases 8 1,319 1,860 2009-2011 Sales 0 88 879 2009-2011...


TX, RRC District 3 Onshore Crude Oil Proved Reserves, Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


TX, RRC District 1 Crude Oil Proved Reserves, Reserves Changes ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


Dallas-Fort Worth, TX Clean Taxi Replacement Incentive  

Energy.gov (U.S. Department of Energy (DOE))

The North Central Texas Council of Governments has partnered with the U.S. Environmental Protection Agency and the City of Dallas to develop the North Texas Green & Go Clean Taxi Partnership as...


Freeport, TX LNG Imports from Trinidad/Tobago  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Galvan Ranch, TX Natural Gas Imports by Pipeline from Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Eagle Pass, TX Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


McAllen, TX Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


Houston-Galveston, TX Alternative Fuel Vehicle (AFV) Incentives...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Savings For Alternative Fuel Vehicles Program Information Funding Source Greater Houston Clean Cities Coalition Texas Program Type Vehicle Purchase & Infrastructure Development...


El Paso, TX Natural Gas Imports by Pipeline from Mexico  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 1998 1999 2000 2001 2002 View...


Alamo, TX Natural Gas Imports by Pipeline from Mexico  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2006 2007 2008 2009 2010 2011 View...


Hidalgo, TX Natural Gas Imports by Pipeline from Mexico  

Annual Energy Outlook 2012 (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2006 2007 2008 2009 2010 2011 View...


Penitas, TX Natural Gas Imports by Pipeline from Mexico  

Gasoline and Diesel Fuel Update (EIA)

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 1996 1998 1999 2000 2001 2002 View...


Freeport, TX Natural Gas LNG Imports (Price) From Peru (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's 7.44 7.38...


Freeport, TX Liquefied Natural Gas Imports From Peru (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's 0 0 0 2010's 6,463 9,775...


,"TX, RRC District 1 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 3 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 4 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 8 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"TX, RRC District 2 Onshore Shale Gas Proved Reserves, Reserves...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 5 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 9 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, State Offshore Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 10 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


,"TX, RRC District 6 Shale Gas Proved Reserves, Reserves Changes...  

U.S. Energy Information Administration (EIA) Indexed Site

Shale Gas Proved Reserves, Reserves Changes, and Production" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of Series","Frequency","Latest...


Freeport, TX LNG Imports (Price) from Yemen (Dollars per Thousand...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's -- 10.30...


Freeport, TX Liquefied Natural Gas Exports Price to Brazil (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 2000's -- -- -- 2010's -- 12.74 11.19...



Energy.gov (U.S. Department of Energy (DOE))

The Department of Energy (DOE) and Department of Homeland Security (DHS), in coordination with the Federal Bureau of Investigation, the Federal Energy Regulatory Commission's Office of Energy Infrastructure Security, the Electricity Sector Information Sharing and Analysis Center (ES-ISAC), North American Electricity Reliability Corporation (NERC), and industry experts, will conduct a series of briefings across the country with electricity sector owners and operators, and local law enforcement on the physical security of electricity substations.


DOE - Office of Legacy Management -- Falls City Mill Site - TX...  

NLE Websites -- All DOE Office Websites (Extended Search)

Materials Handled: Radiological Survey(s): Site Status: Also see Falls City, Texas, Disposal Site Documents Related to Falls City Mill Site Data Validation Package for...


TX, RRC District 8A Crude Oil Proved Reserves, Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


TX, RRC District 3 Onshore Lease Condensate Proved Reserves,...  

U.S. Energy Information Administration (EIA) Indexed Site

75 128 65 74 75 76 1979-2011 Adjustments 3 -2 3 2009-2011 Revision Increases 20 19 18 2009-2011 Revision Decreases 10 16 9 2009-2011 Sales 1 4 11 2009-2011 Acquisitions 1 12 10...


Galvan Ranch, TX Natural Gas Imports by Pipeline from Mexico  

U.S. Energy Information Administration (EIA)

Pipeline Volumes: 19: 18: 20: 20: 14: 28: 2011-2013: Pipeline Prices: 2.42: 2.34: 2.53: 2.53: 3.21: 3.21: 2011-2013-= No Data Reported; --= Not Applicable; NA = Not ...


TX, RRC District 4 Onshore Lease Condensate Proved Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Federal Offshore ...


TX, RRC District 10 Coalbed Methane Proved Reserves, Reserves ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 8A Natural Gas Liquids Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 1 Dry Natural Gas Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


TX, RRC District 2 Onshore Proved Nonproducing Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Includes only those ...


TX, RRC District 6 Crude Oil Proved Reserves, Reserves Changes ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...


TX, RRC District 9 Crude Oil Proved Reserves, Reserves Changes ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous includes ...

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


TX, RRC District 7B Lease Condensate Proved Reserves, Reserve ...  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Federal Offshore ...


TX, RRC District 3 Onshore Natural Gas Liquids Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


El Paso, TX Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


Le Cercle Benveniste est un club informel de linguistique. Il se veut un forum de discussion o toute personne s'intressant la linguistique peut venir changer et dbattre, informellement et en franais, des  

E-Print Network (OSTI)

LE CERCLE Le Cercle Benveniste est un club informel de linguistique. Il se veut un forum de discussion où toute personne s'intéressant à la linguistique peut venir échanger et débattre, informellement impasses ; bref, explorer différents aspects du langage, à la recherche de Problèmes de linguistique

Maurer, Frank


International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009) Saratoga Springs, New York, May 3-7, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009)  

E-Print Network (OSTI)

International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009) Saratoga Springs, New York, May 3-7, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009 International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009), Saratoga Springs

Benzi, Michele



E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.



AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...



U.S. Energy Information Administration (EIA) Indexed Site

BUTANENGL",3901,"CHICAGO, IL","ILLINOIS",2,260,"CANADA",1,0,0,,,,, 32904,"ALPENA OIL CO INC",1,411,"DISTILLATE FUEL, TOTAL",3843,"ALPENA, MI","MICHIGAN",2,260,"CANADA",40,0...


II castelletto sui Carso - Springer  

Science Conference Proceedings (OSTI)

rona con attenzione il progetto che avevo in mente e mi dissero che non c'erano problemi. Potevo utilizzare la struttura e Ie attrez- zature dell'lstituto, awalermi...


Sixth American Nuclear Society International Topical Meeting on Nuclear Plant Instrumentation, Control, and Human-Machine Interface Technologies NPIC&HMIT 2009, Knoxville, Tennessee, April 5-9, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL  

E-Print Network (OSTI)

Sixth American Nuclear Society International Topical Meeting on Nuclear Plant Instrumentation, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009) FUELASSEMBLY SELF SHIELDING Polytechnic Institute Department of Mechanical, Aerospace and Nuclear Engineering Romanc2@rpi.edu; Danony

Danon, Yaron


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...


January 6, 2004 ORNL/TM-2003/286 Retrofit Best Practices Guide  

E-Print Network (OSTI)

. Bakersfield, CA. Chicago, IL. Atlanta, GA. Washington, DC Fort Worth, TX. Minneapolis, MN Miami, FL. air Phoenix and Bakersfield Dallas and Miami Boulder, Chicago, and Minneapolis Seattle, Atlanta, Washington DC a house "work"? 1 Inspecting your house 2 Moisture 4 Walls 4 Windows 4 Step 2: Your Options 5 Replacement

Oak Ridge National Laboratory


Status and outlook for shale gas and tight oil development in the U.S.  

Gasoline and Diesel Fuel Update (EIA)

Joint Forum on US Shale Gas & Pacific Gas Markets Joint Forum on US Shale Gas & Pacific Gas Markets May 14, 2013 | New York, NY By Adam Sieminski, Administrator U.S. Shale Gas 2 Adam Sieminski , May 14, 2013 Domestic production of shale gas has grown dramatically over the past few years Adam Sieminski , May 14, 2013 3 0 5 10 15 20 25 30 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) shale gas production (dry) billion cubic feet per day Sources: LCI Energy Insight gross withdrawal estimates as of March 2013 and converted to dry production estimates with EIA-calculated average gross-to-dry shrinkage factors by state and/or shale play. Shale gas leads growth in total gas production through 2040 to



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78


Fermilab Cultural Events in Batavia, IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Click here to order for all of our upcoming events - no fees! Fermilab Arts & Lecture Series Presents: Dirty Dozen Brass Band Saturday, January 25, 2014 @ 8 pm Pre-Performance Prix-Fixe Dinner at Chez Leon is available, with seating at 6 pm Menu is Corn Chowder, Pork Tenderloin, Bourbon-Walnut Sweet Potato Mash, Sautéed Brussels Sprouts, and Pecan Rum Cake Phone Chez Leon directly at 630/840.3524 for reservations. Follow us on Facebook, and be sure to share our exciting events with your friends & neighbors! The Rise of Supersmart Super Computers Dr. Pete Beckman, Argonne National Laboratory Fri., Jan. 17 @ 8 pm - $7 Pre-Lecture Dinner at 6 pm at Chez Leon Menu: Zucchini Fritters w/Yogurt Dill Sauce, Filet Mignon w/Cabernet Sauce, Peppery Baked Onions, w/Sage & Gruyere Smashed Potatoes, & Espresso Crème Brule



NLE Websites -- All DOE Office Websites (Extended Search)

two figures show measurements performed during the IMPACT campaign 2008 in Cabauw (NL). The data were sampled in a field of shallow cumulus two figures show measurements performed during the IMPACT campaign 2008 in Cabauw (NL). The data were sampled in a field of shallow cumulus clouds with cloud top in about 2000 m. During this flight leg, ACTOS was at a nearly constant height in 1930 m above ground level and 50 m below cloud top. The left plot shows the time series of reflectance at a wavelength of 1645 nm (red curve) measured onboard the helicopter and effective radius (blue triangles) measured with the PVM onboard ACTOS. The right plot shows the corresponding time series of vertical velocity w, measurement height z, liquid water content LWC, and temperature T. Reference Siebert, H., H. Franke, K. Lehmann, R. Maser, E. W. Saw, D. Schell, R. A. Shaw, and M. Wendisch (2006) Probing Fine-Scale Dynamics and Microphysics of Clouds with Helicopter-Borne


Tetraalkylphosphonium polyoxometalate ILs: Organic-Inorganic...  

NLE Websites -- All DOE Office Websites (Extended Search)

F. Wishart and Mark L. Dietz J. Phys. Chem. B 111, 4685-4692 (2007). Find paper at ACS Publications or use ACS Articles on Request Abstract: Pairing of a Keggin or Lindqvist...


Yoon Il Chang | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

analysis Energy storage Batteries Lithium-ion batteries Lithium-air batteries Smart Grid Energy economy Energy policy Environment Biology Environmental biology Molecular...


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

on Local and Regional Air on Local and Regional Air Quality Impacts of Oil and Natural Gas Development Goal The NETL research effort in improving the assessment of impacts to air quality from oil and gas exploration and production activities has the following goals: (1) using NETL's mobile air monitoring laboratory, conduct targeted on-site measurements of emissions from oil and gas production activities that may impact the environment and (2) use collected data in atmospheric chemistry and transport models to further understanding of local and regional air quality impacts. Background The development of shale gas and shale oil resources requires horizontal drilling and multi-stage hydraulic fracturing, two processes that have been known for many years but have only recently become common practice. In addition, fugitive atmospheric


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Evaluation of the Carbon Sequestration Evaluation of the Carbon Sequestration Potential of the Cambro Ordovician Strata of the Illinois and Michigan Basins Background Carbon capture and storage (CCS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strand- plain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef.


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Air Products and Chemicals, Inc.: Air Products and Chemicals, Inc.: Demonstration of CO2 Capture and Sequestration of Steam Methane Reforming Process Gas Used for Large-Scale Hydrogen Production Background Carbon dioxide (CO2) emissions from industrial processes, among other sources, are linked to global climate change. Advancing development of technologies that capture and store or beneficially reuse CO2 that would otherwise reside in the atmosphere for extended periods is of great importance. Advanced carbon capture, utilization and storage (CCUS) technologies offer significant potential for reducing CO2 emissions and mitigating global climate change, while minimizing the economic impacts of the solution. Under the Industrial Carbon Capture and Storage (ICCS) program, the U.S. Department


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Filtration to Improve Single Filtration to Improve Single Crystal Casting Yield-Mikro Systems Background Single crystal (SX) nickel superalloys are a primary material choice for gas turbine hot gas path component castings because of their high resistance to deformation at elevated temperatures. However, the casting yields of these components need to be improved in order to reduce costs and encourage more widespread use within the gas turbine industry. Low yields have been associated with a number of process-related defects common to the conventional casting of SX components. One innovative improvement, advanced casting filter designs, has been identified as a potential path toward increasing the yield rates of SX castings for high-temperature gas turbine applications. Mikro Systems, Inc. (Mikro) proposes to increase SX casting yields by developing


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Siemens Energy Siemens Energy Background Siemens Energy, along with numerous partners, has an ongoing U.S. Department of Energy (DOE) program to develop hydrogen turbines for coal-based integrated gasification combined cycle (IGCC) power generation that will improve efficiency, reduce emissions, lower costs, and allow for carbon capture and storage (CCS). Siemens Energy is expanding this program for industrial applications such as cement, chemical, steel, and aluminum plants, refineries, manufacturing facilities, etc., under the American Recovery and Reinvestment Act (ARRA). ARRA funding will be utilized to facilitate a set of gas turbine technology advancements that will improve the efficiency, emissions, and cost performance of turbines for industrial CCS. ARRA industrial technology acceleration,


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Design of Advanced Engineering Design of Advanced Hydrogen-Carbon Dioxide Palladium and Palladium/Alloy Composite Membrane Separations and Process Intensification Background Technologies for pre-combustion carbon dioxide (CO2) capture and economical hydrogen (H2) production will contribute to the development of a stable and sustainable U.S. energy sector. The integrated gasification combined cycle (IGCC) system can produce synthesis gas (syngas) that can be used to produce electricity, hydrogen, fuels, and/or chemicals from coal and coal/biomass-mixtures in an environmentally responsible manner. The water-gas shift (WGS) reaction is a key part of this process for production of H2. The application of H2 separation technology can facilitate the production of high-purity H2 from gasification-based systems, as well as allow for process


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Enhancement of SOFC Cathode Electro- Enhancement of SOFC Cathode Electro- chemical Performance Using Multi-Phase Interfaces- University of Wisconsin Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), NETL is leading the research, development, and demonstration of SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. The electrochemical performance of SOFCs can be substantially influenced by


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Computational Materials Design of Computational Materials Design of Castable SX Ni-based Superalloys for IGT Blade Components-QuesTek Innovations Background Higher inlet gas temperatures in industrial gas turbines (IGTs) enable improved thermal efficiencies, but creep-the tendency of materials to deform gradually under stress-becomes more pronounced with increasing temperature. In order to raise inlet temperatures of IGTs, turbine blade materials are required to have superior creep rupture resistance. Nickel (Ni)-based single crystal (SX) blades have higher creep strength in comparison with directionally solidified blades and are widely used in aerospace engines. However, their use in IGTs, which require larger-size castings (two to three times the size needed in aerospace applications), is limited


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maira Reidpath Maira Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Steven S.C. Chuang Principal Investigator The University of Akron Department of Chemical and Biomolecular Engineering 230 E. Buchtel Commons Akron, OH 44325 330-972-6993 schuang@uakron.edu PARTNERS None PROJECT DURATION Start Date End Date 09/01/2009 08/31/2013 COST Total Project Value $1,713,961 DOE/Non-DOE Share $1,370,977/$342,984 AWARD NUMBER Techno-Economic Analysis of Scalable Coal-Based Fuel Cells-University of Akron Background In this congressionally directed project, the University of Akron (UA) will develop a scalable coal fuel cell manufacturing process to a megawatt scale. UA has demonstrated the


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Combined Pressure, Temperature Combined Pressure, Temperature Contrast, and Surface-Enhanced Separation of Carbon Dioxide (CO 2 ) for Post-Combustion Carbon Capture Background The mission of the U.S. Department of Energy/National Energy Technology Laboratory (DOE/NETL) Carbon Capture Research & Development (R&D) Program is to develop innovative environmental control technologies to enable full use of the nation's vast coal reserves, while at the same time allowing the current fleet of coal-fired power plants to comply with existing and emerging environmental regulations. The Carbon Capture R&D Program portfolio of carbon dioxide (CO 2 ) emissions control tech- nologies and CO 2 compression is focused on advancing technological options for new and existing coal-fired


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Conductivity, High Thermal Conductivity, High Durability Thermal Barrier Coatings for IGCC Environments-University of Connecticut Background Improved turbine materials are needed to withstand higher component surface temperatures and water vapor content for successful development and deployment of integrated gasification combined cycle (IGCC) power plants. Thermal barrier coatings (TBCs) in particular are required to have higher surface temperature capability, lower thermal conductivity, and resistance to attack at high temperature by contaminants such as calcium-magnesium-alumina-silicate (CMAS) and water vapor. There is also a concurrent need to address cost and availability issues associated with rare earth elements used in all low thermal conductivity TBCs.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Reducing Uncertainties in Model Reducing Uncertainties in Model Predictions via History Matching of CO2 Migration and Reactive Transport Modeling of CO2 Fate at the Sleipner Project, Norwegian North Sea Background The overall goal of the Department of Energy's (DOE) Carbon Storage Program is todevelop and advance technologies that will significantly improve the effectiveness of geologic carbon storage, reduce the cost of implementation, and prepare for widespread commercial deployment between 2020 and 2030. Research conducted to develop these technologies will ensure safe and permanent storage of carbon dioxide (CO2) to reduce greenhouse gas (GHG) emissions without adversely affecting energy use or hindering economic growth. Geologic carbon storage involves the injection of CO2 into underground formations


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Molecular Separations Using Micro- Molecular Separations Using Micro- Defect Free Ultra-Thin Films Background Current methods for separating carbon dioxide (CO 2 ) from methane (CH 4 ) in fuel gas streams are energy and cost-intensive. Molecular sieve membrane development for carbon capture has been pursued for several decades because of the potential these membranes have for high selectivity while using less energy than cryogenic separation methods and greater flux (permselectivity) than is possible from polymeric membranes. However, the adoption of molecular sieve membrane technology has been hindered by high production costs and the micro-defect fissures that always accompany this type of membrane when fabricated using conventional techniques. The Department of Energy's (DOE) National Energy Technology Laboratory (NETL), has


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Characterization of the South Characterization of the South Georgia Rift Basin for Source Proximal CO 2 Storage Background Carbon capture, utilization and storage (CCUS) technologies offer the potential for reducing CO 2 emissions without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications requires adequate geologic formations capable of (1) storing large volumes of CO 2 , (2) receiving injected CO 2 at efficient and economic rates, and (3) retaining CO 2 safely over extended periods. Research efforts are currently focused on conventional and unconventional storage formations within depositional environments such as: deltaic, fluvial, alluvial, strandplain, turbidite, eolian, lacustrine, clastic shelf, carbonate shallow shelf, and reef. Conventional


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Traci Rodosta Traci Rodosta Carbon Storage Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road PO Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Joshua Hull Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-0906 joshua.hull@netl.doe.gov Erik Westman Principal Investigator Virginia Polytechnic Institute and State University 100 Holden Hall Blacksburg, VA 24061 540-0231-7510 Fax: 540-231-4070 ewestman@vt.edu PROJECT DURATION Start Date End Date 12/01/2009 12/31/2012 COST Total Project Value $257,818 DOE/Non-DOE Share $248,441 / $9,377 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. P R OJ E C T FAC T


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory Scale Liquids Production Laboratory Scale Liquids Production and Assessment: Coal and Biomass to Drop-In Fuels Background A major problem with the production of liquid fuels from coal is that the production process and subsequent combustion of the fuel generate excessive greenhouse gases over the entire production and usage lifecycle. Adding lignocellulosic biomass (as a raw feed material) along with coal has the potential to reduce lifecycle greenhouse gas emissions to below those of petroleum products. Altex Technologies Corporation (Altex) has developed an innovative thermo-chemical process capable of converting coal and biomass to transportation fuel ready for blending. The Department of Energy (DOE) National Energy Technology Laboratory (NETL) has partnered with Altex to

Note: This page contains sample records for the topic "il tx mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Capture and Storage Training Carbon Capture and Storage Training Background Carbon capture, utilization, and storage (CCUS) technologies offer great potential for mitigating carbon dioxide (CO2) emissions emitted into the atmosphere without adversely influencing energy use or hindering economic growth. Deploying these technologies in commercial-scale applications will require a drastically expanded workforce trained in CCUS related disciplines, including geologists, engineers, scientists, and technicians. Training to enhance the existing CCUS workforce and to develop new professionals can be accomplished through focused educational initiatives in the CCUS technology area. Key educational topics include simulation and risk assessment; monitoring, verification, and accounting (MVA); geology-related


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Program Technology Program Technology Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-1345 traci.rodosta@netl.doe.gov Dawn Deel Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507 304-285-4133 dawn.deel@netl.doe.gov Sherry Mediati Business Contact California Energy Commission 1516 9th Street, MS 1 Sacramento, CA 95814 916-654-4204 smediati@energy.state.ca.us Mike Gravely Principal Investigator California Energy Commission 1516 Ninth Street, MS 43 Sacramento, CA 95814 916-327-1370 mgravely@energy.state.ca.us Elizabeth Burton Technical Director Lawrence Berkeley National Laboratory 1 Cyclotron Road, MS 90-1116 Berkeley, CA 94720 925-899-6397 eburton@lbl.gov West Coast Regional Carbon


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Andrea Dunn Andrea Dunn Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-7594 andrea.dunn@netl.doe.gov Marte Gutierrez Principal Investigator Colorado School of Mines 1600 Illinois Street Golden, CO 80401 303-273-3468 Fax: 303-273-3602 mgutierr@mines.edu PROJECT DURATION Start Date 12/01/2009 End Date 5/31/2013 COST Total Project Value $297,505 DOE/Non-DOE Share $297,505 / $0 Government funding for this project is provided in whole or in part through the American Recovery and Reinvestment Act. Training and Research on Probabilistic Hydro-Thermo-Mechanical Modeling of Carbon Dioxide Geological Sequestration in Fractured Porous Rocks Background Fundamental and applied research on carbon capture, utilization and storage (CCUS)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency Efficiency Molten Bed Oxy- Coal Combustion with Low Flue Gas Recirculation Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO 2 ) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO 2 capture. Additionally, the program looks to accomplish this while maintaining near


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Gasification Characteristics of Gasification Characteristics of Coal/Biomass Mixed Fuels Background Domestically abundant coal is a primary energy source and when mixed with optimum levels of biomass during the production of liquid fuels may have lower carbon footprints compared to petroleum fuel baselines. Coal and biomass mixtures are converted via gasification into synthesis gas (syngas), a mixture of predominantly carbon monoxide and hydrogen, which can be subsequently converted to liquid fuels by Fischer-Tropsch chemistry. The Department of Energy (DOE) is supporting research focused on using coal and biomass to produce clean and affordable power, fuels and chemicals. The DOE's National Energy Technology Laboratory (NETL) is partnering with Leland Stanford Junior


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbonaceous Chemistry for Carbonaceous Chemistry for Computational Modeling (C3M) Description C3M is chemistry management software focused on computational modeling of reacting systems. The primary function of C3M is to provide direct links between r e l i a b l e s o u r c e s o f k i n e t i c information (kinetic modeling soft- ware, databases, and literature) and commonly used CFD software su ch as M FIX , FLUEN T, an d BARRACUDA with minimal effort from the user. C3M also acts as a virtual kinetic laboratory to allow a CFD practitioner or researcher to evaluate complex, large sets of kinetic expressions for reliability and suitability and can interact with spreadsheet and process models. Once the chemical model is built within C3M, the software also allows the user to directly export


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Phase III Xlerator Program: Electro-deposited Phase III Xlerator Program: Electro-deposited Mn-Co Alloy Coating for Solid Oxide Fuel Cell Interconnects-Faraday Technology Background Based on preliminary cost analysis estimates, Faraday Technology has shown that its FARADAYIC TM electrodeposition process for coating interconnects is cost competitive. Funding from the American Recovery and Reinvestment Act (ARRA) under the Small Business Innovation Research (SBIR) Phase III Xlerator Program will be directed toward developing, optimizing, and validating the FARADAYIC process as an effective and economical manufacturing method for coating interconnect materials with a manganese-cobalt (Mn-Co) alloy for use in solid oxide fuel cell (SOFC) stacks. This project is managed by the U.S. Department of Energy (DOE) National Energy


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology to Mitigate Syngas Technology to Mitigate Syngas Cooler Fouling Background Coal gasification, in conjunction with integrated gasification combined cycle (IGCC) power production, is under development to increase efficiency and reduce greenhouse gas emissions associated with coal-based power production. However, coal gasification plants have not achieved their full potential for superior performance and economics due to challenges with reliability and availability. In particular, performance of the syngas cooler located downstream of the gasifier has been an issue. The syngas cooler is a fire tube heat exchanger located between the gasifier and the gas turbine. The purpose of the syngas cooler is to cool the raw syngas from the gasifier and recover heat. Although


Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Processing and Evaluation of Next Processing and Evaluation of Next Generation Oxygen Carrier Materials for Chemical Looping Combustion Background The Department of Energy (DOE) supports research towards the development of efficient and inexpensive CO 2 capture technologies for fossil fuel based power generation. The Department of Energy Crosscutting Research Program (CCR) serves as a bridge between basic and applied research. Projects supported by the Crosscutting Research Program conduct a range of pre-competitive research focused on opening new avenues to gains in power plant efficiency, reliability, and environmental quality by research in materials and processes, coal utilization science, sensors and controls, and computational energy science. Within the CCR, the University Coal Research (UCR) Program sponsors


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Studies to Enable Robust, Studies to Enable Robust, Reliable, Low Emission Gas Turbine Combustion of High Hydrogen Content Fuels-University of Michigan Background The University of Michigan will perform experimental and computational studies which can provide an improved and robust understanding of the reaction kinetics and other fundamental characteristics of combustion of high hydrogen content (HHC) fuels that are vital to advancing HHC turbine design and to making coal gasification power plants environmentally sustainable and cost- competitive. The scope of work includes Rapid Compression Facility (RCF) studies of HHC ignition delay times and hydroxyl radical (OH) time-histories, flame speeds, and flammability limits. A range of temperatures, pressures, and test gas mixture compositions will


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Maria Reidpath Maria Reidpath Project Manager National Energy Technology Laboratory 3610 Collins Ferry Road P.O. Box 880 Morgantown, WV 26507-0880 304- 285-4140 maria.reidpath@netl.doe.gov Bogdan Gurau Principal Investigator NuVant Systems, Inc. 130 N West Street Crown Point, IN 46307 219-644-3232 b.gurau@nuvant.com PARTNERS None PROJECT DURATION Start Date End Date 08/01/2009 05/31/2013 COST Total Project Value $1,142,481 DOE/Non-DOE Share $913,985 / $228,496 AWARD NUMBER Improved Flow-field Structures for Direct Methanol Fuel Cells-NuVant Systems, Inc. Background In this congressionally directed project, NuVant Systems, Inc. (NuVant) will improve the performance of direct methanol fuel cells (DMFCs) by designing anode flow-fields specifically for the delivery of liquid methanol. The goal is to deliver concentrated


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Environmental Considerations and Environmental Considerations and Cooling Strategies for Vane Leading Edges in a Syngas Environment- University of North Dakota Background Cooling airfoil leading edges of modern first stage gas turbine vanes presents a con- siderable challenge due to the aggressive heat transfer environment and efficiency penalties related to turbine hot gas path cooling. This environment is made more complex when natural gas is replaced by high hydrogen fuels (HHF) such as synthesis gas (syngas) derived from coal gasification with higher expected levels of impurities. In this project the University of North Dakota (UND) and The Ohio State University (OSU) will explore technology opportunities to improve the reliability of HHF gas turbines by analyzing the effects


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Alternative Low-Cost Process for Alternative Low-Cost Process for Deposition of MCrAlY Bond Coats for Advanced Syngas/Hydrogen Turbine Applications-Tennessee Technological University Background One of the material needs for the advancement of integrated gasification combined cycle (IGCC) power plants is the development of low-cost effective manufacturing processes for application of coating architectures with enhanced performance and durability in coal derived synthesis gas (syngas)/hydrogen environments. Thermal spray technologies such as air plasma spray (APS) and high-velocity oxy-fuel (HVOF) are currently used to fabricate thermal barrier coating (TBC) systems for large land- based turbine components. In this research Tennessee Technological University (TTU) will develop metal chromium-aluminum-yttrium (MCrAlY; where M = nickel [Ni], cobalt


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid-Fueled Pressurized Chemical Solid-Fueled Pressurized Chemical Looping with Flue-Gas Turbine Combined Cycle for Improved Plant Efficiency and CO2 Capture Background The Advanced Combustion Systems (ACS) Program of the U.S. Department of Energy/ National Energy Technology Laboratory (DOE/NETL) is aiming to develop advanced oxy- combustion systems that have the potential to improve the efficiency and environmental impact of coal-based power generation systems. Currently available carbon dioxide (CO2) capture and storage technologies significantly reduce the efficiency of the power cycle. The ACS Program is focused on developing advanced oxy-combustion systems capable of achieving power plant efficiencies approaching those of air-fired systems without CO2 capture. Additionally, the program looks to accomplish this while


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Hafnia-Based Nanostructured Hafnia-Based Nanostructured Thermal Barrier Coatings for Advanced Hydrogen Turbine Technology- University of Texas at El Paso Background Thermal barrier coatings (TBCs) are protective layers of low thermal conductivity ceramic refractory material that protect gas turbine components from high temperature exposure. TBCs improve efficiency by allowing gas turbine components to operate at higher temperatures and are critical to future advanced coal-based power generation systems. Next generation gas turbine engines must tolerate fuel compositions ranging from natural gas to a broad range of coal-derived synthesis gasses (syngas) with high hydrogen content. This will require TBCs to withstand surface temperatures much higher than those currently experienced by standard materials. In this project the University of Texas at El Paso (UTEP)


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

Direct Utilization of Coal Syngas in High Direct Utilization of Coal Syngas in High Temperature Fuel Cells-West Virginia University Background The mission of the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL) is to advance energy options to fuel our economy, strengthen our security, and improve our environment. With the Solid Oxide Fuel Cells (SOFCs) program and systems coordination from the Solid State Energy Conversion Alliance (SECA), DOE/ NETL is leading the research, development, and demonstration SOFCs for both domestic coal and natural gas fueled central generation power systems that enable low cost, high efficiency, near-zero emissions and water usage, and carbon dioxide (CO 2 ) capture. West Virginia University's (WVU) project will establish the tolerance limits of contaminant


Albany, OR * Anchorage, AK * Morgantown, WV * Pittsburgh, PA * Sugar Land, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

and Geotechnical Site and Geotechnical Site Investigations for the Design of a CO2 Rich Flue Gas Direct Injection and Storage Facility in an Underground Mine in the Keweenaw Basalts Background Fundamental and applied research on carbon capture, utilization and storage (CCUS) technologies is necessary in preparation for future commercial deployment. These technologies offer great potential for mitigating carbon dioxide (CO2) emissions into the atmosph