Powered by Deep Web Technologies
Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



Office of Legacy Management (LM)

:; / 2. ' :; / 2. ' b-:-"y .",...4 * .-.a 2 IL !< :. 34 --' -, ' ' < I ,-. g Tvo"l r . . .-i- :- " .1-. . . . . NC0 /L ' J,, ' ;.' , -_I( + ? CENTRAL FILES c -&' { ' c;$y ;;j*' E ,J): ' i' Z, 1; p -^ r-raL-r.nuzT".Fn., , ,..-y - -' -ie .". iJ.&:~e!ct.;;' sf ' ;;i_is ,trip ' JG,' go f-Jj;~ey~ 2123 -:s Cc::!<:\.& a k,ea 1:1,:r a;::: zzft:k-~ .sl.x"fe:; an:: , I to a&-isc 2n tiie g Tc;t?z ~,;~~~,;;'


Category:Wichita, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wichita, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wichita KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Wichita KS Westar Energy Inc.png SVHospital Wichita KS ... 64 KB SVLargeHotel Wichita KS Westar Energy Inc.png SVLargeHotel Wichita K... 59 KB SVLargeOffice Wichita KS Westar Energy Inc.png SVLargeOffice Wichita ... 64 KB SVMediumOffice Wichita KS Westar Energy Inc.png SVMediumOffice Wichita... 62 KB SVMidriseApartment Wichita KS Westar Energy Inc.png SVMidriseApartment Wic... 61 KB SVOutPatient Wichita KS Westar Energy Inc.png SVOutPatient Wichita K... 62 KB SVPrimarySchool Wichita KS Westar Energy Inc.png


Category:Goodland, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Goodland, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Goodland KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Goodland KS Westar Energy Inc.png SVHospital Goodland KS... 63 KB SVLargeHotel Goodland KS Westar Energy Inc.png SVLargeHotel Goodland ... 59 KB SVLargeOffice Goodland KS Westar Energy Inc.png SVLargeOffice Goodland... 65 KB SVMediumOffice Goodland KS Westar Energy Inc.png SVMediumOffice Goodlan... 63 KB SVMidriseApartment Goodland KS Westar Energy Inc.png SVMidriseApartment Goo... 60 KB SVOutPatient Goodland KS Westar Energy Inc.png SVOutPatient Goodland ... 63 KB SVPrimarySchool Goodland KS Westar Energy Inc.png


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................


DOE - Office of Legacy Management -- Spencer Chemical Co - KS 0-01  

Office of Legacy Management (LM)

KS 0-01 KS 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (KS.0-01 ) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works KS.0-01-1 Location: Pittsburg , Kansas KS.0-01-1 Evaluation Year: 1985 KS.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. KS.0-01-3 KS.0-01-4 Site Disposition: Eliminated - No Authority - AEC licensed KS.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium; Thorium KS.0-01-6 Radiological Survey(s): Yes KS.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation



Office of Legacy Management (LM)

ixa6-q ?k.m+~ ixa6-q ?k.m+~ @ lo3 IL.26 -ORNL/TM-11552 OAK RIDGE NATIONAL LABORATORY PRELIMINARY RESULTS OF THE RADIOLOGICAL SURVEY AT THE FORMER DOW CHEMICAL COMPANY SITE, MADISON, ILLINOIS c W . D. Cottrell J. K. W illiams OPERATED BY MARTIN MARIETTA ENERGY SYSTEMS, INC. FOR THE UNITED STATES DEPARTMENT OF ENERGY This report has been reproduced directly from the best available copy. Available to DOE and DOE contractors from the Office of Scientific and Techni- cal Information, P.O. Box 62. Oak Ridge, TN 37831; prices available from (615) 5766401, PTS 626-840 1. Availabie to the public from the National Technical Information Service, U.S. Department of Commerce, 5285 Port Royal Rd., Springfield, VA 22161. I I This report was prepared as an account of work sponsored by an agency of


fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


State Laboratory Contacts IL  

Science Conference Proceedings (OSTI)

State Laboratory Contact Information IL. Idaho. ... State of Iowa Metrology Laboratory Ellsworth Community College 1100 College Ave. ...



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.



Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax



Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...


A new limit on the CP violating decay KS -> 3pi0 with the KLOE experiment  

E-Print Network (OSTI)

We have carried out a new direct search for the CP violating decay KS -> 3pi0 with 1.7 fb^-1 of e+e- collisions collected by the KLOE detector at the phi-factory DAFNE. We have searched for this decay in a sample of about 5.9 x 10^8 KS KL events tagging the KS by means of the KL interaction in the calorimeter and requiring six prompt photons. With respect to our previous search, the analysis has been improved by increasing of a factor four the tagged sample and by a more effective background rejection of fake KS tags and spurious clusters. We find no candidates in data and simulated background samples, while we expect 0.12 standard model events. Normalizing to the number of KS -> 2pi0 events in the same sample, we set the upper limit on BR(KS -> 3pi0 < 2.6 x 10^-8 at 90% C.L., five times lower than the previous limit. We also set the upper limit on the eta_000 parameter, |eta_000 | < 0.0088 at 90% C.L., improving by a factor two the latest direct measurement.

Babusci, D; Balwierz-Pytko, I; Bencivenni, G; Bini, C; Bloise, C; Bossi, F; Branchini, P; Budano, A; Balkestahl, L Caldeira; Capon, G; Ceradini, F; Ciambrone, P; Curciarello, F; Czerwinski, E; Dane, E; De Leo, V; De Lucia, E; De Robertis, G; De Santis, A; Di Domenico, A; Di Donato, C; Di Salvo, R; Domenici, D; Erriquez, O; Fanizzi, G; Fantini, A; Felici, G; Fiore, S; Franzini, P; Gauzzi, P; Giardina, G; Giovannella, S; Gonnella, F; Graziani, E; Happacher, F; Heijkenskjold, L; Hoistad, B; Iafolla, L; Jacewicz, M; Johansson, T; Kacprzak, K; Kupsc, A; Lee-Franzini, J; Leverington, B; Loddo, F; Loffredo, S; Mandaglio, G; Martemianov, M; Martini, M; Mascolo, M; Messi, R; Miscetti, S; Morello, G; Moricciani, D; Moskal, P; Nguyen, F; Passeri, A; Patera, V; Longhi, I Prado; Ranieri, A; Redmer, C F; Santangelo, P; Sarra, I; Schioppa, M; Sciascia, B; Silarski, M; Taccini, C; Tortora, L; Venanzoni, G; Wislicki, W; Wolke, M; Zdebik, J




Office of Legacy Management (LM)

,,.. .r' ,,.. .r' +p,o~ ,!,*' A;>$, :.::> ,' ; ,.;I:- : ~ ", ,r .,,. ' , ' i.,l<, ~ ,1* .iT ,.~~~~~~~I~ _,L :,~.:/: .,,.,,,.,' ,, ;, ,, ,, I .. ,(: _ : ; . , y.,+ lar&f&r!rj&~+ ,id) L"'w#~~~~* I. ,& f ;";.y,m; ,I @ & **t&,y%:iis ;*a k' q&t ,:.: ;,I,' ,,, ,_ *, . ,. ,,&S_ ;, , (, t+ I . 1. -. ' ,' ~' i"'i,!..l + *I .(, h," ,rz ,. ,' :' ,' . :,' . ,.' _-#I_ ,. ,I. :, ,.' , ..I>. Xi,,? ,I. , ,r c/i' ,"" >.:1.. .>,. w/.&q:r*x Il.-'",.' !,.~~,,,~~iyY;~~~aj' ,~,,~~~~~~~~~ri~ *~i..iz~~ri~~~J~illi~;' ~(l~.~~i:)i9:ll~,-' i ?, ".' a? ,,?J,?" ~~~~I~~.~,~~~~~~~~.~~~~~~~~~~~~~-~ +q86?,r$w4t .r:~:@o:, " .", ' 1 j/ +$+. : WJl @+&?+&&w ' . 2 _ ._ b )., .;,a. :,. I .b.i.:.,*. A'


Control of Well Ks-8 in the Kilauea Lower East Rift Zone | Open Energy  

Open Energy Info (EERE)

of Well Ks-8 in the Kilauea Lower East Rift Zone of Well Ks-8 in the Kilauea Lower East Rift Zone Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Control of Well Ks-8 in the Kilauea Lower East Rift Zone Abstract In June 1991, a well located in Hawaii kicked and unloaded at 3,476 ft (1,059 m). This well was estimatedto have a possible bottomhole temperature of 650°F (343°C)and a reservoir pressure approaching 2,300 psi 5,858 Immediate attempts to kill the well were unsuccessful, and the long processof well control was started. Besides the harsh geological and reservoir conditions encountered,the scarce availability of materials in a remote location and long distance transportation of necessary equipment figured heavily in to the time delay of the final kill procedure of the


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Il Vopiscus di Lucio Afranio.  

E-Print Network (OSTI)

??In un quadro bibliografico molto ridotto, il presente lavoro si prefigge di ricercare un metodo per proporre un testo, una traduzione e un commento esegetico, (more)





NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


IL Wted States Government  

Office of Legacy Management (LM)

Tis&: p/WI-3 Tis&: p/WI-3 . IL Wted States Government ' 1, -1. \ k. 4 4L La. -iF 1 I ' __, 7, Department of Energy memorandum


DOE - Office of Legacy Management -- Chicago North IL Site - IL 05  

Office of Legacy Management (LM)

North IL Site - IL 05 North IL Site - IL 05 FUSRAP Considered Sites Chicago North, IL Alternate Name(s): National Guard Armory 124th Field Artillery Armory Illinois National Guard Armory Site IL.05-4 IL.05-5 Location: 5200 Cottage Grove Avenue, Chicago, Illinois IL.05-4 Historical Operations: Processed and stored uranium metal, resulting in uranium metal and dry uranium oxide contamination. Metallurgical operations were conducted by the University of Chicago, an MED contractor. IL.05-5 IL.05-7 IL.05-8 Eligibility Determination: Eligible IL.05-1 IL.05-2 IL.05-3 Radiological Survey(s): Assessment Surveys, Verification Surveys IL.05-6 IL.05-7 Site Status: Certified-Certification Basis, Federal Register Notice Included IL.05-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



US ENC IL Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

IL IL Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC IL Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC IL Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC IL Expenditures dollars ELECTRICITY ONLY average per household * Illinois households use 129 million Btu of energy per home, 44% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Illinois households spending 2% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC IL Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

IL IL Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC IL Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC IL Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC IL Expenditures dollars ELECTRICITY ONLY average per household * Illinois households use 129 million Btu of energy per home, 44% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Illinois households spending 2% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


File:USDA-CE-Production-GIFmaps-KS.pdf | Open Energy Information  

Open Energy Info (EERE)

KS.pdf KS.pdf Jump to: navigation, search File File history File usage Kansas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 317 KB, MIME type: application/pdf) Description Kansas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kansas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,650 × 1,275 (317 KB) MapBot (Talk | contribs) Automated bot upload


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Category:Chicago, IL | Open Energy Information  

Open Energy Info (EERE)

IL IL Jump to: navigation, search Go Back to PV Economics By Location Media in category "Chicago, IL" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Chicago IL Commonwealth Edison Co.png SVFullServiceRestauran... 74 KB SVHospital Chicago IL Commonwealth Edison Co.png SVHospital Chicago IL ... 68 KB SVLargeHotel Chicago IL Commonwealth Edison Co.png SVLargeHotel Chicago I... 75 KB SVLargeOffice Chicago IL Commonwealth Edison Co.png SVLargeOffice Chicago ... 76 KB SVMediumOffice Chicago IL Commonwealth Edison Co.png SVMediumOffice Chicago... 73 KB SVMidriseApartment Chicago IL Commonwealth Edison Co.png SVMidriseApartment Chi... 77 KB SVOutPatient Chicago IL Commonwealth Edison Co.png SVOutPatient Chicago I... 74 KB SVPrimarySchool Chicago IL Commonwealth Edison Co.png


DOE - Office of Legacy Management -- Granite City IL Site - IL 28  

Office of Legacy Management (LM)

Granite City IL Site - IL 28 Granite City IL Site - IL 28 FUSRAP Considered Sites Granite City, IL Alternate Name(s): Granite City Steel General Steel Industries General Steel Casings Corporation New Betatron Building IL.28-3 Location: 1417 State Street, Granite City, Illinois IL.28-3 Historical Operations: Under subcontract with Mallinckrodt and using a government-owned Betatron (magnetic induction electron accelerator), x-rayed natural uranium ingots and dingots to detect metallurgical flaws. Contamination from rubbing off of oxidized uranium during handling. IL.28-3 IL.28-5 Eligibility Determination: Eligible IL.28-1 IL.28-2 Radiological Survey(s): Assessment Surveys, Verification Survey IL.28-6 IL.28-7 IL.28-8 Site Status: Certified - Certification Basis, Federal Register Notice included IL.28-9


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Springfield, IL | Open Energy Information  

Open Energy Info (EERE)

IL IL Jump to: navigation, search Go Back to PV Economics By Location Media in category "Springfield, IL" The following 16 files are in this category, out of 16 total. SVQuickServiceRestaurant Springfield IL Commonwealth Edison Co.png SVQuickServiceRestaura... 75 KB SVFullServiceRestaurant Springfield IL Commonwealth Edison Co.png SVFullServiceRestauran... 75 KB SVHospital Springfield IL Commonwealth Edison Co.png SVHospital Springfield... 67 KB SVLargeHotel Springfield IL Commonwealth Edison Co.png SVLargeHotel Springfie... 75 KB SVLargeOffice Springfield IL Commonwealth Edison Co.png SVLargeOffice Springfi... 76 KB SVMediumOffice Springfield IL Commonwealth Edison Co.png SVMediumOffice Springf... 74 KB SVMidriseApartment Springfield IL Commonwealth Edison Co.png


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Benchmarks for the New-Physics Search through CP Violation in B^0->pi^0 K_S  

E-Print Network (OSTI)

Using isospin relations, we predict the Standard-Model correlation between S_{pi^0 K_S}=(sin 2beta)_{pi^0 K_S} and A_{pi^0 K_S}, the mixing-induced and direct CP asymmetries of B^0-> pi^0 K_S. The calculation uses flavour SU(3) only to fix the isospin-3/2 amplitude through the B^\\pm->pi^\\pm pi^0 branching ratio, and thus has a small irreducible theoretical error. It can reach percent level precision thanks to expected future lattice-QCD progress for the calculation of the relevant SU(3)-breaking form-factor ratio, and serves as a benchmark for new-physics searches. We obtain an interesting picture in the A_{pi^0 K_S} - S_{pi^0 K_S} plane, where the current experimental data show a discrepancy with the Standard Model, and comment on the direct CP asymmetries of B^0->pi^-K^+ and B^+ -> pi^0 K^+. A modified electroweak penguin with a large new CP-violating phase can explain the discrepancy and allows us to accommodate also the corresponding data for other b->s penguin-dominated decays.

Robert Fleischer; Sebastian Jager; Dan Pirjol; Jure Zupan



Quantitative analysis of IL-2 and IL-15 signal transduction in T lymphocytes  

E-Print Network (OSTI)

IL-2 and IL-15 are common y-chain family cytokines critically involved in regulation of T cell differentiation and homeostasis. Both cytokines signal through a heterotrimeric surface receptor complex (IL-2/15R) composed ...

Arneja, Abhinav



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



DOE - Office of Legacy Management -- Chicago South IL Site - IL 06  

NLE Websites -- All DOE Office Websites (Extended Search)

South IL Site - IL 06 South IL Site - IL 06 FUSRAP Considered Sites Chicago South, IL Alternate Name(s): University of Chicago Charles Herbert Jones Chemical Laboratory Ryerson Physical Laboratory Eckhart Hall Kent Chemical Laboratory Ricketts Laboratory IL.06-3 Location: University of Chicago, Ellis Avenue and East 58th Street, Chicago, Illinois IL.06-3 Historical Operations: Performed activities associated with (1) production and purification of plutonium, which involved the handling and processing of uranium compounds; (2) demonstrating the self-sustaining nature of the fission process and the production of Pu-239 from U-238 (nuclear fission and Chicago Pile-1); and (3) health effects (metal toxicology and radiation effects). IL.06-5 IL.06-6 IL.06-7 Eligibility Determination: Eligible IL.06-1


DOE - Office of Legacy Management -- Chicago South IL Site - IL 06  

Office of Legacy Management (LM)

South IL Site - IL 06 South IL Site - IL 06 FUSRAP Considered Sites Chicago South, IL Alternate Name(s): University of Chicago Charles Herbert Jones Chemical Laboratory Ryerson Physical Laboratory Eckhart Hall Kent Chemical Laboratory Ricketts Laboratory IL.06-3 Location: University of Chicago, Ellis Avenue and East 58th Street, Chicago, Illinois IL.06-3 Historical Operations: Performed activities associated with (1) production and purification of plutonium, which involved the handling and processing of uranium compounds; (2) demonstrating the self-sustaining nature of the fission process and the production of Pu-239 from U-238 (nuclear fission and Chicago Pile-1); and (3) health effects (metal toxicology and radiation effects). IL.06-5 IL.06-6 IL.06-7 Eligibility Determination: Eligible IL.06-1


Weights and Measures State Directors IL  

Science Conference Proceedings (OSTI)

State Directors IL. Idaho. Mailing Address, Contact Information. ISDA Bureau of Weights & Measures PO Box 790 Boise, ID 83701. ...



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


DOE - Office of Legacy Management -- Madison - IL 26  

Office of Legacy Management (LM)

Madison - IL 26 Madison - IL 26 FUSRAP Considered Sites Madison, IL Alternate Name(s): Spectrulite Consortium, Inc. Former Dow Chemical Company Site IL.26-3 IL.26-4 Location: Intersection of College and Weaver Streets, Madison, Illinois IL.26-4 Historical Operations: Conducted experimental work in natural uranium metal extrusion. IL.26-4 IL.26-5 Eligibility Determination: Eligible IL.26-1 IL.26-2 Radiological Survey(s): Assessment Survey, Verification Survey IL.26-4 LTSM00011565 LTSM00013029 LTSM00011563 Site Status: Cleanup Complete LTSM00011565 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP Also see Madison, Illinois, Site Documents Related to Madison, IL FACT SHEET The Madison, Illinois, Site is located northeast of and


Inclusive production of $\\Lambda$, $K^0_s$ and exotic narrow resonances for systems $K_s^0 p$, $K_s^0 \\Lambda$, $\\Lambda p$ from p+propane interactions at 10 GeV/c  

E-Print Network (OSTI)

Experimental data from the 2m propane bubble chamber for production of $\\Lambda$, $K^0_s$ have been used to search of exotic baryon states, in the $K_s^0 p$, $K_s^0 \\Lambda$ and $\\Lambda p$ decay mode for the reaction p+propane at 10 GeV/c. The estimation of experimental inclusive cross sections for $\\Lambda$ and $K^0_s$ production in the p$^{12}C$ collision is equal to $\\sigma_{\\Lambda}$= 13.3$\\pm$1.7 mb and $\\sigma_{K^0_s}$= 3.8$\\pm$0.6 mb, respectively. The measured $\\Lambda /\\pi^+$ ratio from pC reaction is equal to (5.3$\\pm0.8)*10^{-2}$. The experimental $\\Lambda /\\pi^+$ ratio from the pC reaction is approximately two times larger than the $\\Lambda /\\pi^+$ ratio simulated by FRITIOF model from the pC reaction. The invariant mass spectrum $\\Lambda K^0_s$ registered narrow peaks in regions of 1750 and 1795 MeV/$c^2$. The statistical significance of these peaks has been estimated as 5.6 and 3.3 S.D., respectively. These would be candidates for the $N^0$ or the $\\Xi^0$ pentaquark states. The $pK^0_s$ invaria...

Aslanyan, P Z



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


DOE - Office of Legacy Management -- Podbeilniac Corp - IL 22  

Office of Legacy Management (LM)

Podbeilniac Corp - IL 22 Podbeilniac Corp - IL 22 FUSRAP Considered Sites Site: PODBEILNIAC CORP. (IL.22) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.22-1 Evaluation Year: 1990 IL.22-2 Site Operations: MED used equipment for a uranium extraction experiment in 1957. IL.22-1 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities performed at the site IL.22-2 IL.22-3 IL.22-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.22-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to PODBEILNIAC CORP. IL.22-1 - Report, Ross to Quigley; Trip Report to Podbeilniac Corp.,


DOE - Office of Legacy Management -- Fansteel Metallurgical Corp - IL 16  

NLE Websites -- All DOE Office Websites (Extended Search)

Fansteel Metallurgical Corp - IL 16 Fansteel Metallurgical Corp - IL 16 FUSRAP Considered Sites Site: Fansteel Metallurgical Corp. (IL.16 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.16-1 Evaluation Year: 1987 IL.16-3 Site Operations: Sole producer and supplier of tantalum and columbium metals to the MED. IL.16-1 IL.16-3 Site Disposition: Eliminated - No radioactive materials handled at this site IL.16-2 IL.16-3 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None IL.16-2 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Fansteel Metallurgical Corp. IL.16-1 - MED Memorandum; Greninger to the File; Subject: Visit to

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Precision Extrusion Co - IL 20  

NLE Websites -- All DOE Office Websites (Extended Search)

Precision Extrusion Co - IL 20 Precision Extrusion Co - IL 20 FUSRAP Considered Sites Site: PRECISION EXTRUSION CO. (IL.20) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 720 East Green Avenue , Bensenville , Illinois IL.20-1 Evaluation Year: 1987 IL.20-2 Site Operations: 1956-1959, metal fabrication - extruded uranium billets. IL.20-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of materials handled at the site IL.20-2 Radioactive Materials Handled: Yes IL.20-1 Primary Radioactive Materials Handled: Uranium IL.20-1 Radiological Survey(s): Yes IL.20-3 Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to PRECISION EXTRUSION CO.


IL.06-123 057 I I  

Office of Legacy Management (LM)

IL.06-123 057 I I IL.06-123 057 I I 7 Bechtel National. Inc Systems Engmeers - Constructors Jackson Plaza Tower e 800 Oak Ridge Turnpike Oak Ridge. Tennessee 37830 AII.il Addr.u P.O 80.350. 0.' R,dg_. 7N 3713' .0350 7.'-. 3785873 NOV 1 5 . . u.s. Department of Energy Oak Ridge Operations Post Office Box E Oak Ridge, Tennessee 37831 Attention: Peter J. Gross, Director Technical Services Division Subject: Bechtel Job No. 14501, FUSRAP Project DOE Contract No. DE-AC05-810R20722 Revised Letter Characterization Report for the George Herbert Jones Chemical Laboratory at the Unive sity of Chicago Site, Chicago, Illinois Code: 7330/WBS: 131 Dear Mr. Gross: Radiological characterization and remedial action activities were performed by Bechtel National, Inc. (BNI) at George


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


RELAP5/MOD3.2 Assessment Using CHF Data from the KS-1 and V-200 Experiment Facilities  

SciTech Connect

The RELAP/MOD3.2 computer code has been assessed using rod bundle critical heat flux data from the KS-1 and V-200 facilities. This work was performed as part of the U.S. Department of Energys International Nuclear Safety Program, and is part of the effort addressing the capability of the RELAP5/MOD3.2 code to model transients in Soviet-designed reactors. Designated VVER Standard Problem 7, these tests addressed one of the important phenomena related to VVER behavior that the code needs to simulate well, core heat transfer. The code was judged to be in minimal agreement with the experiment data, consistently overpredicting the measured critical heat flux. It is recommended that a model development effort be undertaken to develop a critical heat flux model for RELAP5 that better represents the behavior in VVER rod bundles.

Bayless, Paul David



The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Rock Island Arsenal - IL 09  

NLE Websites -- All DOE Office Websites (Extended Search)

Rock Island Arsenal - IL 09 Rock Island Arsenal - IL 09 FUSRAP Considered Sites Site: ROCK ISLAND ARSENAL ( IL.09 ) Eliminated from consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Rock Island , Illinois IL.09-1 Evaluation Year: 1987 IL.09-2 Site Operations: Site located on a DOD facility and operated under AEC control. Exact nature or time period of operations not clear. No indication that radioactive materials were involved. Contract work with Albuquerque Operations office performed. IL.09-1 IL.09-2 Site Disposition: Eliminated - No Authority - Referred to DOD IL.09-2 Radioactive Materials Handled: None Indicated IL.09-2 Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated


DOE - Office of Legacy Management -- Kaiser Aluminum Corp - IL 19  

NLE Websites -- All DOE Office Websites (Extended Search)

Kaiser Aluminum Corp - IL 19 Kaiser Aluminum Corp - IL 19 FUSRAP Considered Sites Site: KAISER ALUMINUM CORP. (IL.19 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Dolton , Illinois IL.19-2 Evaluation Year: 1987 IL.19-2 Site Operations: Performed limited duration work extruding uranium billets into three CP-5 fuel elements, circa 1959. IL.19-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities IL.19-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.19-2 Radiological Survey(s): Yes - health and safety monitoring during operations IL.19-4 Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Blockson Chemical Co - IL 07  

Office of Legacy Management (LM)

Blockson Chemical Co - IL 07 Blockson Chemical Co - IL 07 FUSRAP Considered Sites Site: Blockson Chemical Co. (IL.07) Eliminated from consideration under FUSRAP - Referred to US EPA Region V and the State of Illinios Designated Name: Not Designated Alternate Name: Olin Corporation IL.07-1 Location: Patterson Road , Joliet , Illinois IL.07-2 Evaluation Year: 1985 IL.07-1 Site Operations: Process development studies and pilot plant testing of uranium recovery from phosphoric acid during the 1950s. Site Disposition: Eliminated - No Authority IL.07-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Radiological Survey(s): Yes IL.07-2 Site Status: Eliminated from consideration under FUSRAP - Referred to US EPA Region V and the State of Illinios IL.07-1


DOE - Office of Legacy Management -- Kankakee Ordnance Plant - IL 32  

Office of Legacy Management (LM)

Kankakee Ordnance Plant - IL 32 Kankakee Ordnance Plant - IL 32 FUSRAP Considered Sites Site: KANKAKEE ORDNANCE PLANT (IL.32 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Kankakee , Illinois IL.32-1 Evaluation Year: 1991 IL.32-1 Site Operations: Kankakee Ordnance Plant was cited as a possible location for the disposal of radioactive waste material. There is no indication that any radioactive waste was brought to Kankakee. IL.32-1 IL.32-2 Site Disposition: Eliminated - No indication that radioactive materials were handled at this site IL.32-1 Radioactive Materials Handled: None Indicated IL.32-1 Primary Radioactive Materials Handled: None Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Swenson Evaporator Co - IL 23  

NLE Websites -- All DOE Office Websites (Extended Search)

Swenson Evaporator Co - IL 23 Swenson Evaporator Co - IL 23 FUSRAP Considered Sites Site: SWENSON EVAPORATOR CO. (IL.23 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Harvey , Illinois IL.23-1 Evaluation Year: 1987 IL.23-1 Site Operations: Scheduled a raffinate spray drying test that was later cancelled. IL.23-1 Site Disposition: Eliminated - No indication that radioactive materials were handled at this site IL.23-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to SWENSON EVAPORATOR CO. IL.23-1 - Memorandum/Checklist; D.Levine to the File; Subject:


DOE - Office of Legacy Management -- Crane Co - IL 13  

Office of Legacy Management (LM)

Crane Co - IL 13 Crane Co - IL 13 FUSRAP Considered Sites Site: Crane Co. (IL.13 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.13-2 Evaluation Year: 1987 IL.13-2 Site Operations: MED activities during late-1940s to early/mid-1950s included the development of valves and possibly the use of test quantities of normal uranium in the development process. IL.13-4 Site Disposition: Eliminated - Potential for contamination remote due to limited scope of operations IL.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.13-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Crane Co.


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)




Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



DOE - Office of Legacy Management -- Heavy Minerals Inc - IL...  

Office of Legacy Management (LM)

Subject: FUSRAP Considered Site Recommendation; July 9, 1990. IL.14-2 - Heavy Minerals Co. Letter; Wyatt to Faulkner; Subject: Crude Thorium Hydroxide Proposal; December 1, 1954...


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



DOE - Office of Legacy Management -- W E Pratt Manufacturing Co - IL 12  

Office of Legacy Management (LM)

E Pratt Manufacturing Co - IL 12 E Pratt Manufacturing Co - IL 12 FUSRAP Considered Sites Site: W.E. PRATT MANUFACTURING CO. (IL.12) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: William E. Pratt Manufacturing Co. Klassing Handbrake Company IL.12-1 IL.12-2 Location: 18 Henderson Street , Joliet , Illinois IL.12-3 Evaluation Year: 1990 IL.12-4 IL.12-5 Site Operations: Performed metal fabrication tasks (machining and grinding). IL.12-1 IL.12-4 Site Disposition: Eliminated - Radiation levels below criteria IL.12-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal IL.12-1 IL.12-3 Radiological Survey(s): Yes IL.12-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to W.E. PRATT MANUFACTURING CO.


Print http://us.mg4.mail.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency  

E-Print Network (OSTI)

.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency From: Michael Klemen (wind4energy;Print http://us.rng4.mail.yahoo.comlneo/launch?.rand=deOsgko4ks4 energy in the wind is proportional://www.ndsu.edu/ndsu/klemen/Perfect_Turbine.htm You can see that for an ideal real life wind turbine ("good turbine") the increase in energy


DOE - Office of Legacy Management -- Quality Hardware and Machine Co - IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Quality Hardware and Machine Co - Quality Hardware and Machine Co - IL 11 FUSRAP Considered Sites Site: QUALITY HARDWARE AND MACHINE CO. (IL.11) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Ravenswood Venture Marden Manufacturing Co. IL.11-1 IL.11-2 Location: 5823/5849 North Ravenswood Avenue , Chicago , Illinois IL.11-3 Evaluation Year: 1990 IL.11-4 IL.11-5 Site Operations: From 1944 to 1945, entered into subcontracts with the University of Chicago to furnish personnel, facilities, and equipment to produce special tools, dies, fixtures, etc., from materials furnished by the University; was involved in the Hanford slug canning process. IL.11-10 IL.11-6 IL.11-7 IL.11-8 IL.11-9 Site Disposition: Eliminated - Radiation levels below criteria IL.11-11


DOE - Office of Legacy Management -- GSA 39th Street Warehouse - IL 02  

Office of Legacy Management (LM)

GSA 39th Street Warehouse - IL 02 GSA 39th Street Warehouse - IL 02 FUSRAP Considered Sites Site: GSA 39TH STREET WAREHOUSE (IL.02 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 1716 West Pershing Road , Chicago , Illinois IL.02-1 Evaluation Year: 1985 IL.02-2 IL.02-3 Site Operations: Stored radioactive materials. IL.02-1 IL.02-2 Site Disposition: Eliminated - Radiation levels below criteria IL.02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Unknown IL.02-2 Radiological Survey(s): Yes IL.02-1 IL.02-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to GSA 39TH STREET WAREHOUSE IL.02-1 - Report (DOE/EV-0005/9); Formerly Utilized MED/AEC Sites Remedial Action Program Radiological Survey of the Former GSA 39th Street


DOE - Office of Legacy Management -- Lindsay Light and Chemical Co - IL 10  

Office of Legacy Management (LM)

Lindsay Light and Chemical Co - IL Lindsay Light and Chemical Co - IL 10 FUSRAP Considered Sites Site: LINDSAY LIGHT AND CHEMICAL CO. ( IL.10 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: West Chicago , Illinois IL.10-3 Evaluation Year: 1995 IL.10-4 Site Operations: Processed thorium ores - chiefly monazite sands - for thorium and rare earth metals. IL.10-1 IL.10-2 Site Disposition: Eliminated - No Authority - NRC licensed operation IL.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium IL.10-2 Radiological Survey(s): Yes IL.10-2 IL.10-5 Site Status: Eliminated from consideration under FUSRAP IL.10-4 Also see Documents Related to LINDSAY LIGHT AND CHEMICAL CO. IL.10-1 - Lindsay Light & Chemical Letter; J. Murray to E. Lintner;


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Executive Bios: Dr. Yoon Il Chang - Nuclear Engineering Division (Argonne)  

NLE Websites -- All DOE Office Websites (Extended Search)

Yoon Il Chang Yoon Il Chang Director's Welcome Organization Achievements Awards Patents Professional Societies Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and Technology Legacy Opportunities within NE Division Visit Argonne Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE on Flickr Celebrating the 70th Anniversary of Chicago Pile 1 (CP-1) Argonne OutLoud on Nuclear Energy Argonne Energy Showcase 2012 Distinguished Fellows Bookmark and Share Dr. Yoon Il Chang Dr. Yoon Il Chang Senior Technical Advisor Distinguished Fellow PhD, Engineer Nuclear Engineering Division Argonne Experts: Y.I. Chang Dr. Chang joined Argonne National Laboratory in 1974 and has been


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


DOE - Office of Legacy Management -- American Machine and Metals Inc - IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Machine and Metals Inc - Machine and Metals Inc - IL 24 FUSRAP Considered Sites Site: American Machine and Metals Inc (IL.24 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: E. Moline , Illinois IL.24-1 Evaluation Year: 1994 IL.24-2 IL.24-3 Site Operations: Tested process for dewatering green salt by centrifugation. IL.24-1 IL.24-2 Site Disposition: Eliminated - Potential for contamination considered remote due to limited amount of radioactive materials handled IL.24-1 IL.24-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide (Green Salt) IL.24-1 Radiological Survey(s): Health and Safety Monitoring IL.24-1 Site Status: Eliminated from consideration under FUSRAP Also see


DOE - Office of Legacy Management -- Great Lakes Carbon Corp - IL 21  

Office of Legacy Management (LM)

Great Lakes Carbon Corp - IL 21 Great Lakes Carbon Corp - IL 21 FUSRAP Considered Sites Site: GREAT LAKES CARBON CORP. ( IL.21 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 333 North Michigan Avenue , Chicago , Illinois IL.21-1 Evaluation Year: 1987 IL.21-1 Site Operations: Facility performed a limited amount of nuclear fuel fabrication in the 1950s. Facility also developed graphite production under an AEC contract. IL.21-1 IL.21-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited scope of activities performed IL.21-1 Radioactive Materials Handled: Yes IL.21-3 Primary Radioactive Materials Handled: Uranium, Thorium IL.21-3 Radiological Survey(s): Yes IL.21-3

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Wyckoff Drawn Steel Co - IL 0-09  

Office of Legacy Management (LM)

Drawn Steel Co - IL 0-09 Drawn Steel Co - IL 0-09 FUSRAP Considered Sites Site: Wyckoff Drawn Steel Co (IL 0-09) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Chicago , Illinois IL.0-09-1 Evaluation Year: 1987 IL.0-09-3 Site Operations: Experimentation on centerless grinding of uranium rods in 1943. IL.0-09-2 IL.0-09-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited scope of activities at the site IL.0-09-1 IL.0-09-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IL.0-09-2 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Wyckoff Drawn Steel Co IL.0-09-1 - DOE Letter; Wagoner to Daley; Subject: Wycoff Steel Co.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


DOE - Office of Legacy Management -- Granite City Army Depot - IL 0-02  

Office of Legacy Management (LM)

Granite City Army Depot - IL 0-02 Granite City Army Depot - IL 0-02 FUSRAP Considered Sites Site: GRANITE CITY ARMY DEPOT ( IL.0-02 ) Eliminated from consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: Granite City , Illinois IL.0-02-1 Evaluation Year: 1987 IL.0-02-1 Site Operations: Site was used for storage of GSA thorium residues until circa 1964. IL.0-02-1 Site Disposition: Eliminated - Referred to DOD IL.0-02-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium IL.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP - Referred to DOD IL.0-02-1 Also see Documents Related to GRANITE CITY ARMY DEPOT IL.0-02-1 - DOE Letter; J.Fiore to C.Schafer; Information regarding


Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa



Secretary Bodman Highlights Advanced Energy Initiative in Peoria, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bodman Highlights Advanced Energy Initiative in Peoria, Bodman Highlights Advanced Energy Initiative in Peoria, IL Secretary Bodman Highlights Advanced Energy Initiative in Peoria, IL April 6, 2006 - 10:15am Addthis PEORIA, IL - Secretary of Energy Samuel W. Bodman today highlighted the goals of President Bush's Advanced Energy Initiative after consulting on an energy savings assessment at Caterpillar Inc.'s manufacturing facility in Peoria, Illinois. To answer President Bush's call for Americans to be more energy efficient, the Department of Energy (DOE) is conducting no-cost energy assessments at 200 of the nation's most energy-intensive manufacturing facilities to identify energy- and money-saving opportunities. "President Bush has called on all Americans to be more energy efficient. Private industry is joining the federal government in taking a leading role



Office of Legacy Management (LM)

F3on: A 6 IL F3on: A 6 IL ---A------------ ALTERNATE CITY: l4v+&a ------- _-__------___-___ STATE: -~-~-- if yes, date contacted _____ & Development a Facility Type 0 Prndurtion scale testing 0 Pilot Scale 0 Makfacturing .a Bench Scale 0 0 Process University 0 0 Theoretical Studies Reseaich Organization cl Sample & Analysis 0 Gopernment Sponsored Facility 0 Other -~~-~~~--_-~~-__----- 0 Production I 0 Disposal/Storage TYPE OF CONTRACT ~------__--_____ q Prime q Subcontract& u Purchase Order Cl Other'infcrmation (i.e., cost + fixed fee, unit price; time & material, +r) ------- ' 'Con+act/Purchase Order # nls.vP ---------------------------- --------------------_____________ CONTRACTING P=3IOD- -----------w-=---T- h,Jn<, ------------------------------- _


Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D.G. NISHIMURA  

E-Print Network (OSTI)

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D are shown in Figure 2. Conclusions We have demonstrated real-time cardiac imaging at 3 Tesla with high SNR

Nayak, Krishna


DOE - Office of Legacy Management -- Era Tool and Engineering Co - IL 29  

NLE Websites -- All DOE Office Websites (Extended Search)

Era Tool and Engineering Co - IL 29 Era Tool and Engineering Co - IL 29 FUSRAP Considered Sites Site: Era Tool and Engineering Co. (IL.29 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Audi-Tex Industries, Incorporated IL.29-1 Location: 4555 West Addison Street , Chicago , Illinois IL.29-2 Evaluation Year: 1989 IL.29-3 Site Operations: From February 1944 through June 1944, provided personnel, facilities, and equipment to produce machined parts for special equipment, tools, jigs, fixtures, etc., from materials furnished by the University of Chicago IL.29-4 IL.29-5 Site Disposition: Eliminated - Radiation levels below criteria IL.29-2 Radioactive Materials Handled: None indicated Primary Radioactive Materials Handled: None indicated


DOE - Office of Legacy Management -- Eimco Corp - IL 0-01  

Office of Legacy Management (LM)

Eimco Corp - IL 0-01 Eimco Corp - IL 0-01 FUSRAP Considered Sites Site: Eimco Corp. (IL.0-01 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Palatine , Illinois IL.0-01-1 Evaluation Year: 1987 IL.0-01-1 Site Operations: Conducted laboratory leaf filtration tests IL.0-01-1 Site Disposition: Eliminated - Potential for contamination considered remote based on the limited scope of activities at the site IL.0-01-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium (Yellow Cake Uranium). IL.0-01-1 Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Eimco Corp. IL.0-01-1 - Memorandum/Checklist; Levine to the File; Subject:


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Metodi per il miglioramento continuo della qualit. Il caso di Cesab Carrelli elavatori S.p.A (gruppo Toyota Material Handling).  

E-Print Network (OSTI)

??La tesi affronta diversi argomenti, legati ai metodi e agli strumenti per il miglioramento continuo della Qualit all'intern del mondo Toyota. Ho approfondito dunque i (more)

Dal Pra', Sarah




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lincoln lincoln u.s. DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION Pagc 1 of3 STATE: NE PROJECT TITLE: EECBG DE- EE 0000664 City of Lincoln Statement of Work Template (S) {Activities 1, 2, 3 , 4, 5 , 6 , 7 , 8, 10 & 14 on SOW; Add'i CX for 9,13,15,16,17] Funding Opportunity Announ<:ement Number PrCKurement Instrument Number NEPA Control Number cm Number DE-FOA-OOOOO13 DE-EEOOOO664 0 Based OD my review of the information con<:erning the proposed a<:tion, as NEPA Complian<:e Offi<:er (authorized under DOE Order 451.IA), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited 10, literature surveys, inventories, audits), data analysis (including


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



The IL-9 receptor gene (IL9R): Genomic structure, chromosomal localization in the pseudoautosomal region of the long arm of sex chromosomes, and identification of IL9R pseudogenes at 9qter, 10pter, 16pter, 18pter  

Science Conference Proceedings (OSTI)

Cosmids containing the human IL-9 receptor (R) gene (IL9R) have been isolated from a genomic library using the IL9R cDNA as a probe. We have shown that the human IL9R gene is composed of 11 exons and 10 introns, stretching over {approx} 17 kb, and is located within the pseudoautosomal region of the Xq and Yq chromosome, in the vicinity of the telomere. Analysis of the 5` flanking region revealed multiple transcription initiation sites as well as potential binding motifs for AP1, AP2, AP3, Sp1, and NF-kB, although this region lacks a TATA box. Using the human IL9R cosmid as a probe to perform fluorescence in situ hybridization, additional signals were identified in the subtelomeric regions of chromosomes 9q, 10p, 16p, and 18p. IL9R homologs located on chromosomes 9 and 18 were partially characterized, while those located on chromosomes 16 and 10 were completely sequenced. Although they are similiar to the IL9R gene ({approx} 90% identity), none of these copies encodes a functional receptor: none of them contains sequences homologous to the 5` flanking region or exon 1 of the IL9R gene, and the remaining ORFs have been inactivated by various point mutations and deletions. Taken together, our results indicate that the IL9R gene is located at Xq28 and Yq12, in the long arm pseudoautosomal region, and that four IL9R pseudogenes are located on 9q34, 10p15, 16p13.3 and 18p11.3, probably dispersed as the result of translocations during evolution. 42 refs., 6 figs., 3 tabs.

Kermouni, A.; Godelaine, D.; Lurquin, C.; Szikora, J.P. [Ludwig Institute for Cancer Research, Brussels (Belgium)] [and others



DOE - Office of Legacy Management -- Morse Chemical Co - IL 0-05  

Office of Legacy Management (LM)

Morse Chemical Co - IL 0-05 Morse Chemical Co - IL 0-05 FUSRAP Considered Sites Site: MORSE CHEMICAL CO. (IL.0-05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: 8 South Michigan Avenue , Chicago , Illinois IL.05-1 Evaluation Year: 1987 IL.05-3 Site Operations: Submitted a bid to AEC for thorium work; proposal was not accepted; no indication work done for a DOE predecessor at this site. IL.05-3 Site Disposition: Eliminated - No Authority - No work for a DOE predecessor was done at the site IL.05-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MORSE CHEMICAL CO.


Blockage of IL-6 secretion in glia by lead and mercury  

E-Print Network (OSTI)

Mercury (Hg) and lead (Pb) are toxic to the development and function of the central nervous system (CNS). Interleukin-6 (IL 6) produced by astroglia protects neurons from damage in many progressive degenerative disorders. IL-6 secretion is chaperoned by a 78 kD glucose-regulated protein (GRP78), which is an ER-chaperone protein involved in protein folding, assembly, and trafficking. We hypothesized that Pb and Hg could target GRP78 and thereby block IL-6 secretion from astroglia. In this report, we constructed an IL-6-EGFP chimera and transiently transfected rat C6 glioma cells and rat primary astroglia. IL-6-EGFP signal in transfected cultures exposed to Pb, Hg, or anti-oligos against GRP78 was detected with a bio-image fluorescence microscope. Data of the bio-image analysis showed that the retention of IL-6-EGFP in both astroglia and C6 cells transfected with IL-6-EGFP was at an undetectable level. However, the IL-6-EGFP signal in these cultures, while exposed to Pb (0-10 ?M) or Hg (0-10 ?M) for 24 hours, apparently increased, suggesting that Pb or Hg could block IL-6 secretion from astroglia. Furthermore, when these transfected cultures were exposed to anti-oligos against GRP78, as expected, the retention of IL-6-EGFP within the cultures increased. In order to quantify the increase of IL-6-EGFP retention, we used ELISA to detect IL-6 levels in the medium of non-transfected astroglia exposed to Pb (0-100 ?M) and Hg (0-10 ?M). Data showed that IL-6 levels in the medium decreased when the primary astrocyte cultures were exposed to Pb or Hg, suggesting that the increased retention results in part from a decrease in IL-6 secretion. We used an immunocytochemistry assay as an additional approach for quantifying IL-6 amounts of cells treated or not treated with metals. The immunocytochemistry data concurred with the ELISA findings. These data, together with our previous studies, suggest that Pb and Hg may target GRP78, thereby reducing the amount of IL-6 secreted from astroglia. The decrease in IL-6 secretion prevents this cytokine from doing its job of protecting and restoring neighboring neural tissue.

Pourrajabi, Nima Matthew


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



Structural comparison and chromosomal localization of the human and mouse IL-13 genes  

SciTech Connect

The genomic structure of the recently described cytokine IL-13 has been determined for both human and mouse genes. The nucleotide sequence of a 4.6-kb DNA segment of the human gene is described. The human IL-13 gene (IL 13) occurs as a single copy in the haploid genome and maps to human chromosome 5. A 4.3-kb DNA fragment of the mouse IL-13 gene (Il 13) has been sequenced and found to occur as a single copy, mapping to mouse chromosome 11. Intrachromosomal mapping studies revealed that both genes contain four exons and three introns and show a high degree of sequence identify throughout their length. Potential recognition sequences for transcription factors that are present in the 5'-flanking region and are conserved between both genes include IFN-responsive elements, binding sites for AP-1, AP-2, and AP-3, an NF-lL 6 site, and a TATA-like sequence. Both genes map to chromosomal locations adjacent to genes encoding other cytokines, including IL-3, GM-CSF, IL-5, and IL-4 suggesting that IL-13 is another member of this cytokine gene family that may have arisen by gene duplication. 26 refs., 5 figs., 3 tabs.

McKenzie, A.N.J.; Sato, A.; Doyle, E.L.; Zurawski, G. (DNAX Research Institute of Cellular and Molecular Biology, Palo Alto, CA (United States)); Li, X.; Milatovich, A.; Francke, U. (Stanford Univ. Medical School, CA (United States)); Largaespada, D.A.; Copeland, N.G.; Jenkins, N.A. (National Cancer Institute, Frederick, MD (United States))



Il fenomeno dei fan nel mercato della musica. Analisi netnografica dei seguaci italiani di Bruce Springsteen.  

E-Print Network (OSTI)

??Lo studio ha ad oggetto la comunit dei fan italiani di Bruce Springsteen. Dopo aver analizzato la letteratura e descritto il fenomeno dei fan e (more)

Gallo, Sara



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.




Office of Legacy Management (LM)

decontmlmtlon proceam takee longer than originally anticipated decontmlmtlon proceam takee longer than originally anticipated 'U&e order .are urgently required to prevent a shutdown. "Z, mo-1 ' 2lda.p - from 4a6-55 to a possible 4-5-55 based on the receipt of vendor's plantby 1-22-55. #iWNCD W ONTAININO Il@MQWm; ;g hours worked; Hours worked will be observed and under the control of . . M%-.'E.Section . (Copy of Vendorts letter of quotation dated l/5/55 is VAWNWWXlINALORDEt :Y $ u(,507.60 upoDRpuiI9APPROPAk &movND* 0 3375.00 (rllaxlmum) Field approval contained in .!lT Savannah.A L, 1 Not required., Gosney to Hutton. (The Operating Departmeni Ato& Bad-~ Cadeaiaa agrees on the urgency and the need for autho -,. ,n - this premiumpayment.) l-13-55 loiD. 365 duPont l topa 4-26-55 pa and the faettbat


Signaling thresholds govern heterogeneity in IL-7-receptor-mediated responses of nave CD8? T cells  

E-Print Network (OSTI)

Variable sensitivity to T-cell-receptor (TCR)- and IL-7-receptor (IL-7R)-mediated homeostatic signals among nave T cells has thus far been largely attributed to differences in TCR specificity. We show here that even when ...

Palmer, Megan Joan


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Ionizing radiation induces IL-6-production by human fibroblasts involving activation of nuclear factor-. kappa. B  

Science Conference Proceedings (OSTI)

The authors report that human lung fibroblasts respond to X-ray treatment with release of interleukin (IL) -6. Synthesis of IL-6 upon ionizing radiation is preceded by an increase of IL-6 transcript levels resulting from transcriptional activation of the IL-6 gene. Analysis of deleted fragments of the IL-6 promoter revealed that transcriptional induction of the IL-6 promoter is due to enhanced binding activity of the transcription factor NF-kB. Although AP-1 does not participate in the rapid induction of the IL-6 promoter its binding activity is also enhanced upon XRT. In contrast to binding kinetics observed with NF-kB, AP-1 binding upon XRT. In contrast to binding kinetics observed with NF-kB- and the AP-1 recognition sequence, conferred inducibility by XRT to a heterologous promoter, with reporter gene activity being maximal 24 hours or 48 hours upon XRT, respectively. Sequential activation of two distinct transcription factors might thus contribute to synchronize transcriptional activation of different genes participating in the X-ray response.

Brach, M.A.; Gruss, H.J.; Kaisho, Tsuneyasu; Asano, Yoshinobu; Vos, Sven de; Mertelsmann, R.; Hirano, Toshio; Herrmann, F. (Univ. of Freiburg (Germany) Osaka Univ. (Japan))



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


TCL: Comandi utili versione 2.1. [open stringa mode] restituisce il descrittore di un file aperto (di nome stringa) in modalit "riscrittura" (se mode w) o in  

E-Print Network (OSTI)

TCL: Comandi utili versione 2.1. [open stringa mode] restituisce il descrittore di un file aperto]) restituisce il nome del file .tcl corrente [$ns get-ns-traceall] restituisce il descrittore del file di trace

Bregni, Stefano



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



Bakken Formation Producing Wells W il sto nBa North Dakota ...  

U.S. Energy Information Administration (EIA)

USA CANADA SD MT ND Saskatchewan Manitoba Dunn Ward Dawson McLean McKenzie Morton W il ams Stark Richland R os ev lt Mountrail Divide Prairie McHenry Burke Sheridan


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



INVITED REVIEW On the Role of sIL-2R Measurements in Rheumatoid Arthritis and Cancers  

E-Print Network (OSTI)

A soluble IL-2 receptor (sIL-2R) is a circulating form of a membrane receptor localized on lymphoid and some cancer cells. The biological function of sIL-2R has not been completely understood. Substantially, it seems to reflect T-lymphocyte activation in diseases of different pathology. Moreover, the soluble receptor has been considered, at least in part, responsible for unsuccessful immunotherapy with IL-2 in cancers. Several lines of evidence indicate sIL-2R measurements to be useful in determining disease progress and prognosis. This review summarizes current knowledge on the sIL-2R behavior in RA and solid cancers of varied etiology.

Anna Maria Witkowska




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIlENT OF ENERGY DEPARTlIlENT OF ENERGY EERE PROJECT M ANAGE MENT CEN T ER NEPA DETERlIlINATION Page 1 of2 STATE: NC PROJECT TITLE : Charlotte Activity 3 * 1-485 Park & Ride Energy Efficiency Lighting Pilot ARRA-EECBG Strategy-Only Funding Opportunity Announcement Number DE·FOA-OOOOO13 Pr()(urement Instrument Number DE-EEOOO0765.001 NEPA Control Number elO Number o BaRd on my re",iew of the information concerning the proposed action, as NEPA Compliance Officer (authoriud under DOE Order 451.IA), I have made the following ddumination: ex, EA, EIS APPENDIX AN» NUMBER: Description: 82.5 Safety and environmental improvements of a facility , including replacement and upgrade of facility components, that do not result in a significant change in the expected useful life, design capacity, or function of the facility and during which



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

lAl.4Il lAl.4Il ) U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIlINATION RECIPIENT: NREL PROJECT TITLE: los Indios Meteorological Tower; NREL Tracking No. 11-008 Page 1 of2 STATE : TX funding Opportunity Announcement Number PJ"O(urement Instrument Number NEPA Control Number em Number NREL-11-OO8 G010337 Based on my review nflhe information concerning the proposed adion, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, aUdits). data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DICHIARAZIONE CONGIUNTA DICHIARAZIONE CONGIUNTA TRA IL GOVERNO DEGLI STAT1 UNIT1 D'AMERICA IL GOVERNO DELLA REPUBBLICA ITALIANA IN TEMA DI COOPERAZIONE INDUSTRIALE E COMMERCIALE NEL SETTORE DELL'ENERGIA NUCLEARE I1 Governo degli Stati Uniti d'America e il Governo della Repubblica Italians, in seguito i "Partecipanti", RICONOSCENDO la necessita di considerare un mix adeguato di fonti di energia sicure e sostenibili dal punto di vista ambientale - compresa l'energia nucleare - per soddisfare le necessita energetiche delle popolazioni dei rispettivi Paesi; RICONOSCENDO la necessita di rispondere alle sfide derivanti dalle crescenti necessita energetiche che interessano i Paesi partecipanti, come pure la comunita internazionale in generale, in maniera da contribuire alla riduzione degli effetti nocivi dei gas serra sul



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H



Re: RE: disappointment BlIl.Lehr 0 Rainey, David I  

E-Print Network (OSTI)

History: Re: RE: disappointment t BlIl.Lehr 0 Rainey, David I Cc: Kathryn Moran, mcnutt, Jane. Bill Original Message - - - -- From: "Rainey, David I" Da te: Sunday, May 23, 2010 9 :30 pm Subject: RE > > -- -- -original Message-- -- - > From : Bill.Lehr@noaa.gov ( > Sent: Sunday, May 23, 2010 8:56 PM > To: Rainey, Da


Microsoft Word - Gage-KS.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Intercomparisons of Cloud Observations Intercomparisons of Cloud Observations from the AL S-band Profiler and the ETL K-band Millimeter-Wave Cloud Radar on the R/V Ronald H. Brown during Nauru99 K. S. Gage and D. A. Carter National Oceanic and Atmospheric Administration Aeronomy Laboratory Boulder, Colorado P. E. Johnston and C. R. Williams Cooperative Institute for Research in Environmental Sciences University of Colorado Boulder, Colorado M. Ryan Science Technology Corporation Boulder, Colorado D. Hazen and B. W. Orr National Oceanic and Atmospheric Administration Environmental Technology Laboratory Boulder, Colorado Introduction Nauru99 took place in the western and central Pacific during June and July 1999. During Nauru99, a diverse suite of instruments was located on the research vessel (R/V) Ronald H. Brown to measure cloud



SciTech Connect

We report the detection in Ks-band of the secondary eclipse of the hot Jupiter CoRoT-1b from time series photometry with the ARC 3.5 m telescope at Apache Point Observatory. The eclipse shows a depth of 0.336 +- 0.042% and is centered at phase 0.5022{sup +0.0023}{sub -0.0027}, consistent with a zero eccentricity orbit (e cos omega = 0.0035{sup +0.0036}{sub -0.0042}). We perform the first optical to near-infrared multi-band photometric analysis of an exoplanet's atmosphere and constrain the reflected and thermal emissions by combining our result with the recent 0.6, 0.71, and 2.09 mum secondary eclipse detections by Snellen et al., Gillon et al., and Alonso et al. Comparing the multi-wavelength detections to state-of-the-art radiative-convective chemical-equilibrium atmosphere models, we find the near-infrared fluxes difficult to reproduce. The closest blackbody-based and physical models provide the following atmosphere parameters: a temperature T = 2460{sup +80}{sub -160} K; a very low Bond albedo A{sub B} = 0.000{sup +0.081}{sub -0.000}; and an energy redistribution parameter P{sub n} = 0.1, indicating a small but nonzero amount of heat transfer from the day to nightside. The best physical model suggests a thermal inversion layer with an extra optical absorber of opacity kappa{sub e} = 0.05 cm{sup 2} g{sup -1}, placed near the 0.1 bar atmospheric pressure level. This inversion layer is located 10 times deeper in the atmosphere than the absorbers used in models to fit mid-infrared Spitzer detections of other irradiated hot Jupiters.

Rogers, Justin C. [Department of Physics and Astronomy, Johns Hopkins University, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Apai, Daniel [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Lopez-Morales, Mercedes [Department of Terrestrial Magnetism, Carnegie Institution of Washngton, 5241 Broad Branch Rd. NW, Washington, DC 20015 (United States); Sing, David K. [UPMC Univ Paris 06, CNRS, Institut d'Astrophysique de Paris, 98bis boulevard Arago, F-75014 Paris (France); Burrows, Adam, E-mail: rogers@pha.jhu.ed [Department of Astrophysical Sciences, Princeton University, Peyton Hall, Princeton, NJ 08544 (United States)



" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...


File:USDA-CE-Production-GIFmaps-IL.pdf | Open Energy Information  

Open Energy Info (EERE)

IL.pdf IL.pdf Jump to: navigation, search File File history File usage Illinois Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 387 KB, MIME type: application/pdf) Description Illinois Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Illinois External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,275 × 1,650 (387 KB) MapBot (Talk | contribs) Automated bot upload



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAG EMENT CENTER NEPA DETERMINATION RECIPIENT: Northwest Energy Innovations Page 1 of3 STATE: OR PROJECT TITLE: WAVE ENERGY TECHNOLOGY-NEW ZEALAND MULTI-MODE WAVE ENERGY CONVERTER ADVANCEMENT PROJECT Funding Opportunity Announcement Number Procurement Instr ument Number NEPA Control Number elD Number DE-FOA -OOOO293 DE-EEOOO3642 GFO-OO03642-OO2 G03642 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.1A), I have made the rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: Rational for determination: EA Category: DOE/EA 1917 and DOE Mitigated FONSI signed 8-15-2012 This determination is being made for tasks 2.12 -



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIlENT OF ENERGY DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEM ENT CENT ER NEPA DFTFRlIllNATION Page 1 of2 RECIPIENT:City of Cleveland· Division of Engineering & Construction STATE: OH PROJECT TITLE: Cleveland City ARRA·EECBG Act 9 (Lake-to--Lake Bikeway) Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number OE·EEOOOO705 0 Based on my review oflhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), [have made the following determination: CX, EA, E[S APPENDIX AND NUMBER: Description: A11 Technical advice and planning assistance to internaUonal, national, stale, and local organizations, A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including


Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agreement on FutureGen Project in Mattoon, Agreement on FutureGen Project in Mattoon, IL Secretary Chu Announces Agreement on FutureGen Project in Mattoon, IL June 12, 2009 - 12:00am Addthis Washington, D.C. - U.S. Secretary of Energy Steven Chu today announced an agreement with the FutureGen Alliance that advances the construction of the first commercial scale, fully integrated, carbon capture and sequestration project in the country in Mattoon, Illinois. "This important step forward for FutureGen reflects this Administration's commitment to rapidly developing carbon capture and sequestration technology as part of a comprehensive plan to create jobs, develop clean energy and reduce climate change pollution." said Energy Secretary Steven Chu. "The FutureGen project holds great promise as a flagship facility to



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DETERlIlINATION DETERlIlINATION RECIPIENT:Westmoreland County Page 101"2 STATE: PA PROJECf TITLE: Westmoreland County (PA)· Geothermal at New Juvenile Detention Center· ARRA-EECBG Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOAOOOOO13 DE-EE00CI0940 0 Based on my review or the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, EIS APPEND IX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Differential transcriptional regulation of IL-8 expression by human airway epithelial cells exposed to diesel exhaust particles  

Science Conference Proceedings (OSTI)

Exposure to diesel exhaust particles (DEP) induces inflammatory signaling characterized by MAP kinase-mediated activation of NFkB and AP-1 in vitro and in bronchial biopsies obtained from human subjects exposed to DEP. NFkB and AP-1 activation results in the upregulation of genes involved in promoting inflammation in airway epithelial cells, a principal target of inhaled DEP. IL-8 is a proinflammatory chemokine expressed by the airway epithelium in response to environmental pollutants. The mechanism by which DEP exposure induces IL-8 expression is not well understood. In the current study, we sought to determine whether DEP with varying organic content induces IL-8 expression in lung epithelial cells, as well as, to develop a method to rapidly evaluate the upstream mechanism(s) by which DEP induces IL-8 expression. Exposure to DEP with varying organic content differentially induced IL-8 expression and IL-8 promoter activity human airway epithelial cells. Mutational analysis of the IL-8 promoter was also performed using recombinant human cell lines expressing reporters linked to the mutated promoters. Treatment with a low organic-containing DEP stimulated IL-8 expression by a mechanism that is predominantly NFkB-dependent. In contrast, exposure to high organic-containing DEP induced IL-8 expression independently of NFkB through a mechanism that requires AP-1 activity. Our study reveals that exposure to DEP of varying organic content induces proinflammatory gene expression through multiple specific mechanisms in human airway epithelial cells. The approaches used in the present study demonstrate the utility of a promoter-reporter assay ensemble for identifying transcriptional pathways activated by pollutant exposure.

Tal, Tamara L. [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Simmons, Steven O. [Integrated Systems Toxicology, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Silbajoris, Robert; Dailey, Lisa [Environmental and Public Health, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Cho, Seung-Hyun [Air Pollution Prevention Control Division, National Risk Management Research Laboratory, U.S. EPA (United States); Research Participation Program, Oak Ridge Institute for Science and Education, Oak Ridge (United States); Ramabhadran, Ram [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Integrated Systems Toxicology, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States); Linak, William [Air Pollution Prevention Control Division, National Risk Management Research Laboratory, U.S. EPA (United States); Reed, William; Bromberg, Philip A. [Center for Environmental Medicine, Asthma, and Lung Biology, University of North Carolina, Chapel Hill (United States); Samet, James M., E-mail: samet.james@epa.go [Curriculum in Toxicology, University of North Carolina, Chapel Hill (United States); Environmental and Public Health, National Health and Environmental Effects Research Laboratory, U.S. EPA (United States)



Demonstration Assessment of Light-Emitting Diode (LED) Accent Lighting at the Field Museum in Chicago, IL  

SciTech Connect

This report reviews a demonstration of light-emitting diode (LED) accent lighting compared to halogen (typical) accent lighting in a gallery of the Field Museum in Chicago, IL.

Myer, Michael; Kinzey, Bruce R.


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Search for the decay B^+ \\to K_S^0 K_S^0 \\pi ^+  

SciTech Connect

The authors search for charmless decays of charged B mesons to the three-body final state K{sub S}{sup 0}K{sub S}{sup 0}{pi}{sup +}. Using a data sample of 423.7 fb{sup -1} collected at the {Upsilon}(4S) resonance with the BABAR detector, corresponding to (465.1 {+-} 5.1) x 10{sup 6} B{bar B} pairs, they find no significant signal and determine a 90% confidence level upper limit on the branching fraction of 5.1 x 10{sup -7}.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.




Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

!AUll !AUll u.s. DEP.-lliThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIP1ENT: Texas Engineering Experiment Station PROJECf TITLE: Novel Mechanical Pretreatment for Ugnocellulosic Feedstocks Page I of I STATE: TX t'unding Opportunity Announctment Number Procurement Instrument Number NEPA Control Numbu CID Numbtr Oe-FOA-0000337 EEOOO500S GFO-OOO5005-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (a ulhori7.ed under DOE Order 451.1A).1 haH' made the followinll: detumination: ex, EA, [IS APPENDIX AND NUMBER: Descriptio n: 8 3.6 Siting. construction (or modification), operation, and decommissioning of facinlies for Indoor bench-scale research projects and conventional laboratory operations (for example. preparation of chemical sta

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Challenge Home Case Study, Weiss Building & Development, LLC., Custom Home, Downer Grove, IL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC LLC Custom Home Downers Grove, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


DOE Challenge Home Case Study, Weiss Building & Development, LLC., System Home, River Forest, IL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LLC LLC System Home River Forest, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

p-, ** p-, ** ~ , u.s DEPARTMENT OFENFRGY EERE PROJECT MAN AGEM ENT CENT ER NEPA DETEIU.IlNATION RECIPIENT:Simpson College; a SEP ARRA sub-recipient of the Iowa Economic Development Authority PROJECf TITLE: Simpson College Boiler Plant De-Centralization Page 1 of3 STATE: lA Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number DE-EEOOOO162 NEPA Control Number em Number GF0-0000162-020 EE162 Based on my review of the information concerning the proposed aelion, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 (a) Actions to conserve energy or water, demonstrate potential energy or water conservation, and promote energy



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

21 21 Recipient: County of McHenry, IL ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Project #1: Daylighting B5.1 None Project #2: Occupancy Sensors B5.1 None Project #3: Administration Building - LED Parking Lot Lighting B5.1 Waste Stream Clause Project #4: Annex A - Replace Hot Water Boiler B5.1 Waste Stream Clause *boiler replacements cannot result in a net increase in air emissions. Project #5: Annex A - Window Film B5.1 None Project #6: Department of Transportation Building - Skylights B5.1 Historic Preservation Clause Waste Stream Clause Project #7: Department of Transportation Building - HID to T8 Fluorescent with Occupancy Sensors



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FINDING FINDING OF NO SIGNIFICANT IMPACT FOR LINAC COHERENT LIGHT SOURCE-Il PROJECT SLAC NATIONAL ACCELERATOR LABORATORY AGENCY: U. S. Department of Energy (DOE) ACTION: Finding of No Significant Impact (FONSI) SUMMARY: The U. S. Department of Energy (DOE) has completed an Environmental Assessment (DOE/EA-1904) on a project to expand the existing Linac Coherent Light Source (LCLS) facility at the SLAC National Accelerator Laboratory (SLAC). One of SLAC's major scientific facilities is the LCLS, the world's first hard X-ray free electron laser. The LCLS X-ray laser beams enable the simultaneous investigation of a material's electronic and structural properties on the size (sub-nanometer) and time (femto-second) scales that determine their function. Research programs at SLAC include materials science, catalytic sciences, structural molecular biology, and molecular environmental


DOE Challenge Home Case Study, StreetScape Development, LLC, Libertyville, IL, Custom  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

StreetScape StreetScape Development, LLC Libertyville, IL BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


Snapshots of the IL-4 Receptor Ternary Complexes: An Opportunity to  

NLE Websites -- All DOE Office Websites (Extended Search)

Snapshots of the IL-4 Receptor Ternary Snapshots of the IL-4 Receptor Ternary Complexes: An Opportunity to Visualize the Basis of Cytokine Receptor Pleiotropy in the Immune System Cytokines are a group of proteins and peptides that are employed in complex multi-cellular organisms as signaling compounds produced by individual cells to transmit information from one cell to another. The distances across which these cytokine signals may travel varies from within the neighborhood of a tissue or organ to remote tissues far away from the cytokine source via the blood. They are variously named as interleukins, lymphokines, and chemokines as well as other "factors" and with the names based upon the presumed function at the time of discovery. These cytokines act by binding to a cell surface receptor in either of two ways. In the first case a cytokine binds the extracellular domain of a receptor and recruits additional receptors where a receptor is composed of three domains: extracellular ligand binding domain, a single trans-membrane helix domain and an intracellular domain; in this case, cytokine binding and subsequent extracellular domain rearrangements change the spacing and orientation of the intracellular domains resulting in signal transduction across the cell membrane in a deliberate manner. In the second case a cytokine binds to a multi-spanning transmembrane protein causing movements within the transmembrane region, which conveys the signal more directly across the membrane, where this latter mechanism is beyond the scope of our research results. Due to their central role in the immune system, cytokines are involved in a variety of immunological, inflammatory, and infectious diseases. When the body is fighting pathogens, cytokines activate and recruit immune cells to travel to the site of infection, for example. These cytokine-mediated processes are known to go awry in some diseases.


Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links  

E-Print Network (OSTI)

An Epigenetic Switch Involving NF-kB, Lin28, Let-7 MicroRNA, and IL6 Links Inflammation to Cell to cancer, and NF-kB appears to play a causa- tive role, but the mechanisms are poorly understood. We show activation triggers an inflammatory response mediated by NF-kB that directly activates Lin28 transcription


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.




Science Conference Proceedings (OSTI)

In both cases of packages for either low-level and intermediate-level short-lived (LL-IL/SL) or high-level and intermediate-level long-lived (HL-IL/LL) radioactive waste, Andra has defined a quality reference system, manages it, follows up its appropriate implementation in production plants and verifies its effectiveness in production. The purpose of such a reference system is to ensure, in the first case, that waste packages comply with the Centre de l'Aube's acceptance criteria and, in the second case, that the characteristics submitted by the waste generators to Andra as input data for the deep geological repository project reflect the actual production conditions. In that context, the three management steps of the quality reference system include differences due to the fact that HL-IL/SL packages have not been submitted yet to any technical acceptance criterion. Compliance with any such criterion should be the subject of a characterization report during the qualification phase and of a examination during the verification phase. The management of the quality reference system also involves similarities that facilitate the joint work carried out by Andra with the waste generators, especially in the facilities where both package types are produced.

Trentesaux, C.; Cairon, P.; Dumont, J.-N.; Felix, B.; Losada, F.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

illThIl!NT OF ENERGY illThIl!NT OF ENERGY EERE PROJECT MA"IAGEMENT CENTER NEPA DE:rJ!IU...lINATION RECIPIENT:TX STATE ENERGY CONSERVATION OFFICE PROJECT TITLE: SHARYLAND ISD Page 1 of2 STATE: TX Funding Opportunity Announcement Number Procurement Instmment Number NEPA Control Number CIO Number DE-EEOOO116 DE-EEOOO116 GFO-OOO0116-032 GOO Based OD my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 85.16 Solar photovoltaic systems The installation, modification. operation, and removal of commercially avaUable solar photovoltaic systems located on a building or other structure (such as rooftop, par1o:.ing lot or facility, and mounted to signage, lighting, gates, or fences), or if



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'""c-.-n. '""c-.-n. j!." OJ . U.S. DEP.-\RTUENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERl\ilNATION RECIPIENT:James Hardie Building Products PROJECT TITLE: XLD Reject Reclamation STATE: IL Page 1 of2 / ~ ~,' .' unding Opportunity AnnounCEment Number Procurement Instrument Numbu NEPA Control Number CID Number DE-FOA-OOOOOS2 EEOOOO119 GFO-1Q.-322 EE119 Baud on my rnitw oftht information concerning the proposed action, 85 NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Office of Legacy Management (LM)

IlONITORING REPORT FOR THE NEVADA TEST SITE IlONITORING REPORT FOR THE NEVADA TEST SITE AND OTHER TEST AREAS USED FOR UNDERGROUND NUCLEAR DETONATIONS January through December 1975 Nonitoring Operations Division Environmental Monitoring and Support Laboratory U.S. ENVIRONMENTAL PROTECTION AGENCY Las Vegas, Nevada 89114 APRIL 1976 This work performed under a Memorandum of Understanding No. AT(26-1)-539 for the U . S . ENERGY RESEARCH & DEVELOPMENT ADMINISTRATION EMSL-LV-5 39-4 May 1976 ENVIRONMENTAL 14ONITORING REPORT FOR THE NEVADA TEST SITE AND OTHER TEST AREAS USED FOR UNDERGROUND NUCLEAR DETONATIONS January through December I975 Monitoring Operations Division Environmental Monitoring and Support Laboratory U.S. ENVIRONMENTAL PROTECTION AGENCY Las Vegas, Nevada 89114 APRIL 1976 This work performed under a Memorandum of



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARThIl!NT OF ENERGY DEPARThIl!NT OF ENERGY EERE PROJECT MANAGEMENT CENTER NllPA DEl'ER}.fiNATION RECIPIENT:Cortiand County Business Development Corporation PROJE(.T TITLE : Energy Independent Agri-Business Outreach Page I of2 STATE: NY Funding Opportunity Announcement Number DE-EOOO3110 Procurement Instrument Number EEOOO3110 NEPA Control Number em Number GFO-10-573 0 Based on my review orlbe information concerning the proposed action, as N[PA Compliance Officer (autborized under DOE Order 4SI.IA),1 have made tbe follol'iing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, bul nollimiled 10, literature surveys. inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENTER CENTER NEPA DETER!vIlNATION RECIPIENT:l1linois Department of Commerce and Economic Opportunity PROJECf TITLE: Fluorecycle. Inc Page 1 of2 / ® STATE: IL Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number EEOOOO119 NEPA Control Number em Numbcr EEll9 Based on my rc"iew ortbe information cODeeming the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following detennination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy--efficiency that do nol increase the indoor concentrations of potentially hannful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


C E N T R A L F IL E S  

Office of Legacy Management (LM)

;zJy, y ;zJy, y J l . T;? : Tflj~j : - ..- ":'cyi$:T,;L . . :z*:, 0 , _ _ : 7 r;-2 :: '7 .' . A 1 :- :-; '3 s:s:a *;iy,:;.~ ~ r.3 , :,& . fJ . A . -y& ~ :.-, ;,!*3 , J. -. v :+ tn g C E N T R A L F IL E S ~ > m cTpnz '3 F T E iP T h e o b ;ectl'.'e o f th e ? = r i ~ ';lila to d 9 c u s s th e h e a l th a n d s a fe ty a s p e c ts o f a - p r O p O S e d O f? -31'te te s t involving electro n b e a m m e l tin g o f s o l & 2 a m n l u m n e tal a t th e S ta u ffer-Temescal C o m p a n y , R i c h m o n d , C a lifornia. T h e technical a s p e c ts o f th e te a t w e r e d iscussed a t - 3 n e s a m e rr?eeti!? g by A . D . C a v e tt, M e tallurgical IIe p a r tze n t, w h o is submitting a sepsi-ate trip r e p o r t. S o m e w h a t sim ilar work xlth uraniiun h a s b e e n d o n e by th e S tsu ffer- T e m e s c a l C o m p a n y iJ th e s a m e fu r 2 3 a c e o n tw o previous occasions - for Y o rth A m e rilcan A viatio


Characterization of the Transient Response of the ILS with One Module Installed to Heatup Changes in Power Level and Cooldown  

DOE Green Energy (OSTI)

This report provides documentation of the initial startup and testing of the first electrolysis module in the Idaho National Laboratory (INL) High Temperature Steam Electrolysis Integrated Laboratory Scale (ILS) facility. Initial shakedown testing of the INL ILS experimental facility commenced on August 22, 2007. This fulfilled a DOE Level 2 milestone. Heatup of the first ILS module started at approximately 4:10 PM on September 24, 2007. Initial module testing continued for 420 hours. The test average H2 production rate was approximately 1.3 Nm3/hr (0.116 kg H2/hr), with a peak measured value of over 2 Nm3/hr (0.179 kg H2/hr). Significant module performance degradation was observed over the first 250 hours, after which no further degradation was noted for the remainder of the test. Once all test objectives had been successfully met, the test was terminated in a controlled fashion. Discussion is included concerning several modifications that will be incorporated into the facility components to improve reliability and ease of operation for future long term testing.

K. G. Condie; C. M. Stoots; J. E. O'Brien; J. S. Herring



Studio di fattibilit per un impianto a biogas nel settore vitivinicolo: il caso della "Cantina Valpantena Verona S.c.a.".  

E-Print Network (OSTI)

??Analisi del settore biogas dal punto di vista energetico,tecnico e normativo, con riferimento al DM 6 luglio 2012 (Decreto rinnovabili).Il caso di studio specifico riguarda (more)

Bonfante, Nicola


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Orion Mark Graf University of Kansas, Lawrence, KS 2010-Present  

E-Print Network (OSTI)

Distributions, Origins, and their Association with Y-chromosome Markers in the Aleutian Archipelago Advisor) "Surname Distributions and their Association with Y-chromosome Markers in the Aleutian Islands" Human in the Aleutian Archipelago: Evidence from Y- chromosome markers and historical accounts" Poster presentation

Peterson, Blake R.


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tvIENT OF ENERG tvIENT OF ENERG Y EERE PROJ ECT MANAGEMENT CEN T ER NEPA DETERlIlINAIION RECIPIENT;County of Montgomery Page 1 of2 STATE: PA ~ R liO i ~ PROJELi TITLE: Montgomery County (PA): Financial Incentive Program and Energy Efficiency Retrofits -- ARRA-EECBG (S) Funding Opportunity Announcement Number DE-FOA-0000013 Procurement Instrument Number DE-EE0000938 NEPA Control Number em Number o Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1 A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and planning assistance to international, national, state, and local organizations. A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE EE RE PROJECT MANAGEMENT CENTER NEPA DETERlIlIN.-\IION Page 1 of2 RECIPIENT:Delaware State Energy Office - DNREC . STATE: DE PROJECf TITLE: EECBG Rehoboth Beach Convention Center VVhile Roof and Insulation Project Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO775 GFO.()()()()775-003 0 Based on my review of the information (on("eruing the proposed actioD, as NEPA Compliance Omen (authorized under DOE Order 451.11\), I have made tbe following determination: ex, EA, [IS APPENDIX AND NUMBER: Descriptiun: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase Ihe indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

·O'.G: , ·O'.G: , u.s. DEPARTlIlENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION RECIPIENT:Polk County PROJECT TITLE: Polk County, FL EECBG - SOW Building Control Systems EE Retrofits (S) Page 1 of2 STATE: FL Funding Opportunity Announcement Number DE-FOAOOOO013 Procurement Instrument Number DE-EE0000796 NEPA Control Number CID Number o Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency thai do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIIENT OF ENERGY DEPARTlIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERJl.ilNATION Page 1 01'2 RECIPIENT:County of Baltimore STATE: MD PROJECT TITLE: County of Baltimore ARRA-EEC8G (5) funding Opportunity Announcement Number DE-FOA-OOOOO13 Procurement Instrument Number DE-EEOOOO740 NEPA Control Number em Numbn o Baud on my nview oftht information concerning the proposed action, as NEPA Compliance Offien (authoril:ed under DOE Order 45I.1A), I han made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 InfOm1ation gathering (including. but not limited to, literature surveys, inventories, audits), data analysis (induding computer modeling), document preparation (such as conceptual design or feasibi lity studies, analytical energy supply

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Noriolk City of Noriolk u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAG EMEN T CENTER NEPA DETERl\ilNATION Page 1 of2 STATE: VA PROJECT TITLE: Green Vision Community Energy Program and Evergreen Municipal Energy Efficiency Program- SOW (5) Funding Opportunity Announcement Number Proc:urt:mtnt Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 OE-EEOOOO880/000 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Maria Cadeddu, James C. Liljegren, and Andrew Pazmany Decision and Information Sciences Division, Argonne National Laboratory, Argonne, IL  

NLE Websites -- All DOE Office Websites (Extended Search)

and Retrievals from a New 183-GHz Water Vapor Radiometer in the Arctic and Retrievals from a New 183-GHz Water Vapor Radiometer in the Arctic Maria Cadeddu, James C. Liljegren, and Andrew Pazmany Decision and Information Sciences Division, Argonne National Laboratory, Argonne, IL Prosensing, Inc., Amherst, MA This work was supported by the Climate Change Research Division, U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research, under contract W-31-109-Eng-38, as part of the DOE Atmospheric Radiation Measurement (ARM) Program. Argonne National Laboratory is managed by The University of Chicago for the U.S. Department of Energy. The two-channels microwave water vapor radiometer (MWR) shown in Fig. 1 measures brightness temperatures at the microwave frequencies of 23.8 and 31.4 GHz. Brightness


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


XL-A A.&lx A!i' X!Ii?Z IL';;i'  

Office of Legacy Management (LM)

-- :I 9 .a # ** ,. . . m . . pJ;-,L' ,' i:-t.T .)r' yjs JzZ~ J~~;L,;.~;r 1:). 2 . m I;S~X:T ?I?. ::.:-25-::%-I.:.Glu~ XL-A A.&lx A!i' X!Ii?Z IL';;i' , X2,-d c i.XZEA?, th At3Ac Z:r.zr.~ f4z22s343n >q3 pquask$ tL,..- psg zd of &,-cc b&ldjmms: >UAeT; :,:,. &&;j L' *r: ! 3 ..m 3CCU"pxy &jJdbc ' Au ..3* 6u, I;..:; ' 2. CL&51, 1;; *-- l - l &j-2+; z5 a?, ft . IALP !13. f&%-i;& 2$&J 3;. ft.1 sq, ft.; &ii+ m* i.3. $+, hZE2X, it >a tmn dds=ir.ti mailzblc for t.ha us rcq:~sted. eat 3' tid tulla.Eg axi 2zd3 are . - \ .'iizx, E ri~h~ysl.-eT;try m3 frrnt-cd to tB3 Atod~ Crmycp Caziszlon ta use xxi occ-2;~7 tahze3 'fi--- 34 acma of la& "d&&e+ &-J-.*3 lisp, G;i &;>?ma'$Q


NMR Study of the Dynamics of ILs with -CH2Si(CH3)3 vs CH2C(CH3)3  

NLE Websites -- All DOE Office Websites (Extended Search)

Magnetic Resonance Study of the Dynamics of Imidazolium Ionic Magnetic Resonance Study of the Dynamics of Imidazolium Ionic Liquids with -CH2Si(CH3)3 vs CH2C(CH3)3 Substituents S. H. Chung, R. Lopato, S. G. Greenbaum, H. Shirota, E. W. Castner, Jr. and J. F. Wishart J. Phys. Chem. B 111, 4885-4893 (2007). [Find paper at ACS Publications] or use ACS Articles on Request Abstract: Trimethylsilylmethyl (TMSiM)-substituted imidazolium bis(trifluoromethylsulfonyl)imide (NTf2-), and tetrafluoroborate (BF4-) ionic liquids (ILs) have lower room-temperature viscosities by factors of 1.6 and 7.4, respectively, than isostructural neopentylimidazolium ILs. In an attempt to account for the effects of silicon substitution in imidazolium RTILs and to investigate the ion dynamics, we report nuclear magnetic resonance (NMR) measurements of 1H (I = 1/2) and 19F (I = 1/2)



Office of Legacy Management (LM)

design. The ingot size will be 5 inch diameter and 46 inches long approximately before crop- ping. It i estimated-that the total cycle for a run containing zinc will be 12 hours,...



NLE Websites -- All DOE Office Websites (Extended Search)

address Address: 15013 Denver West Parkway City: Golden StateorProvince: CO PostalCode: 80401 Country: USA ContactVoiceTelephone: 303-384-7098 ContactFacsimileTelephone:...


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



U.S. Coalbed Methane Proved Reserves and Production  

Gasoline and Diesel Fuel Update (EIA)

Area: U.S. Alabama Colorado New Mexico Utah Wyoming Virginia Eastern States (IL, IN, OH, PA, WV) Western States (AR, KS, LA, MT, OK) Other States Period: Annual Download Series...



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming


Le Cercle Benveniste est un club informel de linguistique. Il se veut un forum de discussion o toute personne s'intressant la linguistique peut venir changer et dbattre, informellement et en franais, des  

E-Print Network (OSTI)

LE CERCLE Le Cercle Benveniste est un club informel de linguistique. Il se veut un forum de discussion où toute personne s'intéressant à la linguistique peut venir échanger et débattre, informellement impasses ; bref, explorer différents aspects du langage, à la recherche de Problèmes de linguistique

Maurer, Frank


International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009) Saratoga Springs, New York, May 3-7, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009)  

E-Print Network (OSTI)

International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009) Saratoga Springs, New York, May 3-7, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009 International Conference on Mathematics, Computational Methods & Reactor Physics (M&C 2009), Saratoga Springs

Benzi, Michele



E-Print Network (OSTI)

NY NY NJ OH PA NY IN NJ Rate Score Cancer of the Rectum :-Bergen New York Lake NJ IL NJ NY OH Rate Score Cancer of theNew York Middlesex Rate Score IL NJ MI OH NY PA NY IL NY MA

Selvin, S.



Tatyana V. Wilds, Most Pure Heart of Mary School, Topeka, KS  

E-Print Network (OSTI)

in San Francisco Stalin, Churchill/Attlee meet in Potsdam US drops Atomic Bomb on Hiroshima and Nagasaki) Churchill's "Iron Curtain" speech in Fulton, Missouri 1949 Soviets detonate their first Atomic Bomb in the Cold War. For example, what if Truman had not fired General Macarthur and he had decided to drop bombs

Peterson, Blake R.


# workstation-ks.cfg # version 1.0.0 2011-09-30 # Copyright ...  

Science Conference Proceedings (OSTI)

... 9 (Rows 2 - 6) volgroup vgroup1 pv.01 logvol ... row 134) -sysklogd rsyslog # Post-install commands # Some post-installation configuration can ...



KS-REPORT(7-24-87} The Eigenvalue Problem for an N-Sector Ring  

E-Print Network (OSTI)

\\.., -.. ·~.t~ -..-7. -..-.. ~ -,.. -')It · · ... ,.- J ·· ··· 5 ·· ··· :-O' ··· ··· leee -7. 10 · ttl L(H · ,01

Kemner, Ken

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Search for Lepton Flavour Violating Decays Tau -> l Ks with the BABAR Detector  

SciTech Connect

We present the search for the lepton flavour violating decay {tau} {yields} lK{sup 0}{sub s} with the BaBar experiment data. This process and many other lepton flavour violating {tau} decays, like {tau} {yields} {mu}{gamma} and {tau} {yields} lll, are one of the most promising channel to search for evidence of new physics. According to the Standard Model and the neutrino mixing parameters, branching fractions are estimated well below 10{sup -14}, but many models of new physics allow for branching fractions values close to the present experimental sensitivity. This analysis is based on a data sample of 469fb{sup -1} collected by BABAR detector at the PEP-II storage ring from 1999 to 2007, equivalent to 431 millions of {tau} pairs. the BABAR experiment, initially designed for studying CP violation in B mesons, has demonstrated to be one of the most suitable environments for studying {tau} decays. The tracking system, the calorimeter and the particle identification of BABAR, together with the knowledge of the {tau} initial energy, allow an extremely powerful rejection of background events that, for this analysis, is better than 10{sup -9}. Being {tau} {yields} lK{sup 0}{sub s} a decay mode without neutrinos, the signal {tau} decay can be fully reconstructed. Kinematical constraints are used in a fit that provides a decay tree reconstruction with a high resolution. For this analysis MC simulated events play a decisive role for estimating the signal efficiency and study the residual background. High statistics MC sample are produced simulating detector conditions for different periods of data collection, in order to reduce any discrepancies with the data. When discrepancies can not be removed, we perform studies to compute a correction factor or an estimation of systematic errors that need to be included in the final measurement. A significant improvement of the current result can be reached only with a higher statistics and, therefore, with a new collider providing a luminosity from 10 to 100 times more than PEP-II. A new detector, with improved performance and able to collect data in a high background environment, is also requested to fully exploit the capability of such amount of data. In fact, only keeping the efficiency and the background as similar as possible to present ones, we will be able to scale almost linearly the estimated upper limit according to the luminosity. The strong potential of improvement for the search of lepton flavour violation {tau} decays makes the building of such a machine highly desirable.

Cenci, Riccardo; /SLAC



Search for CP Violation in the Decay D+/- to Ks pi+/-  

SciTech Connect

We report on a search for CP violation in the decay D{sup {+-}} {yields} K{sub S}{sup 0}{pi}{sup {+-}} using a data set corresponding to an integrated luminosity of 469 fb{sup -1} collected with the BABAR detector at the PEP-II asymmetric energy e{sup +}e{sup -} storage rings. The CP-violating decay rate asymmetry A{sub CP} is determined to be (-0.44 {+-} 0.13(stat) {+-} 0.10(syst))%, consistent with zero at 2.7 {sigma} and with the standard model prediction of (-0.332 {+-} 0.006)%. This is currently the most precise measurement of this parameter.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; /INFN, Bari /Bari U.; Milanes, D.A.; /INFN, Bari; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Harvey Mudd Coll. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison



Demonstration Assessment of Light-Emitting Diode (LED) Parking Lot Lighting in Leavenworth, KS  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology in a commercial parking lot lighting application, under the U.S. Department of Energy (DOE) Solid-State Lighting Technology GATEWAY Demonstration Program. The parking lot is for customers and employees of a Walmart Supercenter in Leavenworth, Kansas and this installation represents the first use of the LED Parking Lot Performance Specification developed by the DOEs Commercial Building Energy Alliance. The application is a parking lot covering more than a half million square feet, lighted primarily by light-emitting diodes (LEDs). Metal halide wall packs were installed along the building facade. This site is new construction, so the installed baseline(s) were hypothetical designs. It was acknowledged early on that deviating from Walmarts typical design would reduce the illuminance on the site. Walmart primarily uses 1000W pulse-start metal halide (PMH) lamps. In order to provide a comparison between both typical design and a design using conventional luminaires providing a lower illuminance, a 400W PMH design was also considered. As mentioned already, the illuminance would be reduced by shifting from the PMH system to the LED system. The Illuminating Engineering Society of North America (IES) provides recommended minimum illuminance values for parking lots. All designs exceeded the recommended illuminance values in IES RP-20, some by a wider margin than others. Energy savings from installing the LED system compared to the different PMH systems varied. Compared to the 1000W PMH system, the LED system would save 63 percent of the energy. However, this corresponds to a 68 percent reduction in illuminance as well. In comparison to the 400W PMH system, the LED system would save 44 percent of the energy and provide similar minimum illuminance values at the time of relamping. The LED system cost more than either of the PMH systems when comparing initial costs. However, when the life-cycle costs from energy and maintenance were factored into the scenario, the LED system had lower costs at the end of a 10-year analysis period. The LED system had a 6.1 year payback compared to the 1000W PMH system and a 7.5 year payback versus the 400W PMH system. The costs reflect high initial cost for the LED luminaire, plus more luminaires and (subsequently) more poles for the LED system. The other major issue affecting cost effectiveness was that Leavenworth, Kansas has very low electricity costs. The melded rate for this site was $0.056 per kWh for electricity. However, if the national electricity rate of $0.1022/kWh was used the payback would change to between four and five years for the LED system. This demonstration met the GATEWAY requirements of saving energy, matching or improving illumination, and being cost effective. The project also demonstrated that the Commercial Building Energy Alliance (CBEA) specification works in practice. Walmart appreciated having an entire site lighted by LEDs to gain more experience with the technology. Walmart is reviewing the results of the demonstration as they consider their entire real estate portfolio.

Myer, Michael; Kinzey, Bruce R.; Curry, Ku'uipo



Search for Lepton Flavour Violating Decays tau- to l- Ks with the BaBar experiment  

SciTech Connect

A search for the lepton flavor violating decays {tau}{sup -} {yields} l{sup -} K{sub S}{sup 0} (l = e or {mu}) has been performed using a data sample corresponding to an integrated luminosity of 469 fb{sup -1}, collected with the BABAR detector at the SLAC PEP-II e{sup +}e{sup -} asymmetric energy collider. No statistically significant signal has been observed in either channel and the estimated upper limits on branching fractions are {Beta}({tau}{sup -} {yields} e{sup -} K{sub S}{sup 0}) < 3.3 x 10{sup -8} and {Beta}({tau}{sup -} {yields} {mu}{sup -}K{sub S}{sup 0}) < 4.0 x 10{sup -8} at 90% confidence level.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Measurement of Time-Dependent CP Asymmetry in B0 --> KS pi0 gamma Decays  

SciTech Connect

The authors measure the time-dependent CP asymmetry in B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} decays for two regions of K{sub S}{sup 0}-{pi}{sup 0} invariant mass, m(K{sub S}{sup 0}{pi}{sup 0}), using the final BABAR data set of 467 x 10{sup 6} B{bar B} pairs collected at the PEP-II e{sup +}e{sup -} collider at SLAC. They find 339 {+-} 24 B{sup 0} {yields} K*{sup 0}{gamma} candidates and measure S{sub K*{gamma}} = -0.03 {+-} 0.29 {+-} 0.03 and C{sub K*{gamma}} = -0.14 {+-} 0.16 {+-} 0.03. In the range 1.1 < m(K{sub S}{sup 0}{pi}{sup 0}) < 1.8 GeV/c{sup 2} they find 133 {+-} 20 B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} candidates and measure S{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.78 {+-} 0.59 {+-} 0.09 and C{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.36 {+-} 0.33 {+-} 0.04. The uncertainties are statistical and systematic, respectively.

Aubert, Bernard; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, Antimo; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, Bjarne; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, Robert N.; Jacobsen, R.G.; /LBL, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Genoa U. /INFN, Genoa /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Pennsylvania U. /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /Frascati /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...



U.S. Energy Information Administration (EIA) Indexed Site

BUTANENGL",3901,"CHICAGO, IL","ILLINOIS",2,260,"CANADA",1,0,0,,,,, 32904,"ALPENA OIL CO INC",1,411,"DISTILLATE FUEL, TOTAL",3843,"ALPENA, MI","MICHIGAN",2,260,"CANADA",40,0...


II castelletto sui Carso - Springer  

Science Conference Proceedings (OSTI)

rona con attenzione il progetto che avevo in mente e mi dissero che non c'erano problemi. Potevo utilizzare la struttura e Ie attrez- zature dell'lstituto, awalermi...


Sixth American Nuclear Society International Topical Meeting on Nuclear Plant Instrumentation, Control, and Human-Machine Interface Technologies NPIC&HMIT 2009, Knoxville, Tennessee, April 5-9, 2009, on CD-ROM, American Nuclear Society, LaGrange Park, IL  

E-Print Network (OSTI)

Sixth American Nuclear Society International Topical Meeting on Nuclear Plant Instrumentation, on CD-ROM, American Nuclear Society, LaGrange Park, IL (2009) FUELASSEMBLY SELF SHIELDING Polytechnic Institute Department of Mechanical, Aerospace and Nuclear Engineering Romanc2@rpi.edu; Danony

Danon, Yaron


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...


Measurement of $D^0-overline{D}^0$ mixing parameters using $D^0 \\to K_S^0 \\pi^ \\pi^-$ and $D^0 \\to K_S^0 K^ K^-$ decays  

Science Conference Proceedings (OSTI)

We report a direct measurement of D{sup 0}-{bar D}{sup 0} mixing parameters through a time-dependent amplitude analysis of the Dalitz plots of D{sup 0} {yields} K{sub S}{sup 0}{pi}{sup +}{pi}{sup -} and, for the first time, D{sup 0} {yields} K{sub S}{sup 0}K{sup +}K{sup -} decays. The low-momentum pion {pi}{sub s}{sup +} in the decay D*{sup +} {yields} D{sup 0}{pi}{sub s}{sup +} identifies the flavor of the neutral D meson at its production. Using 468.5 fb{sup -1} of e{sup +}e{sup -} colliding-beam data recorded near {radical}s = 10.6 GeV by the BABAR detector at the PEP-II asymmetric-energy collider at SLAC, we measure the mixing parameters x = [1.6 {+-} 2.3 (stat.) {+-} 1.2 (syst.) {+-} 0.8 (model)] x 10{sup -3}, and y = [5.7 {+-} 2.0 (stat.) {+-} 1.3 (syst.) {+-} 0.7 (model)] x 10{sup -3}. These results provide the best measurement to date of x and y. The knowledge of the value of x, in particular, is crucial for understanding the origin of mixing.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Columbus Supercond., Genova /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Mycologia, 96(4), 2004, pp. 866878. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

66044-8897 Two new Ophiostoma species with Sporothrix anamorphs from Austria and Azerbaijan Dilzara N with Sporothrix anamorphs recently collected in Austria and Azerbaijan. The isolates were charac- terized based and Azerbaijan. Growth at 25 C and morphology revealed some differences between the two groups, and supported


Mycologia, 96(3), 2004, pp. 548557. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

exorientia. Rhizoidaceae structurae absentes. Stip- ites erectus, pallide brunnei vel atro-brunnei, 1


Fermilab Cultural Events in Batavia, IL  

NLE Websites -- All DOE Office Websites (Extended Search)

Click here to order for all of our upcoming events - no fees! Fermilab Arts & Lecture Series Presents: Dirty Dozen Brass Band Saturday, January 25, 2014 @ 8 pm Pre-Performance Prix-Fixe Dinner at Chez Leon is available, with seating at 6 pm Menu is Corn Chowder, Pork Tenderloin, Bourbon-Walnut Sweet Potato Mash, Sautéed Brussels Sprouts, and Pecan Rum Cake Phone Chez Leon directly at 630/840.3524 for reservations. Follow us on Facebook, and be sure to share our exciting events with your friends & neighbors! The Rise of Supersmart Super Computers Dr. Pete Beckman, Argonne National Laboratory Fri., Jan. 17 @ 8 pm - $7 Pre-Lecture Dinner at 6 pm at Chez Leon Menu: Zucchini Fritters w/Yogurt Dill Sauce, Filet Mignon w/Cabernet Sauce, Peppery Baked Onions, w/Sage & Gruyere Smashed Potatoes, & Espresso Crème Brule



NLE Websites -- All DOE Office Websites (Extended Search)

two figures show measurements performed during the IMPACT campaign 2008 in Cabauw (NL). The data were sampled in a field of shallow cumulus two figures show measurements performed during the IMPACT campaign 2008 in Cabauw (NL). The data were sampled in a field of shallow cumulus clouds with cloud top in about 2000 m. During this flight leg, ACTOS was at a nearly constant height in 1930 m above ground level and 50 m below cloud top. The left plot shows the time series of reflectance at a wavelength of 1645 nm (red curve) measured onboard the helicopter and effective radius (blue triangles) measured with the PVM onboard ACTOS. The right plot shows the corresponding time series of vertical velocity w, measurement height z, liquid water content LWC, and temperature T. Reference Siebert, H., H. Franke, K. Lehmann, R. Maser, E. W. Saw, D. Schell, R. A. Shaw, and M. Wendisch (2006) Probing Fine-Scale Dynamics and Microphysics of Clouds with Helicopter-Borne


Tetraalkylphosphonium polyoxometalate ILs: Organic-Inorganic...  

NLE Websites -- All DOE Office Websites (Extended Search)

F. Wishart and Mark L. Dietz J. Phys. Chem. B 111, 4685-4692 (2007). Find paper at ACS Publications or use ACS Articles on Request Abstract: Pairing of a Keggin or Lindqvist...


Yoon Il Chang | Argonne National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

analysis Energy storage Batteries Lithium-ion batteries Lithium-air batteries Smart Grid Energy economy Energy policy Environment Biology Environmental biology Molecular...

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

21. Domestic Crude Oil First Purchase Prices 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1978 ..................... 9.00 9.56 12.25 W 14.72 14.48 11.91 13.81 13.70 13.20 13.73 11.86 11.40 1979 ..................... 12.64 13.01 14.30 W 24.13 23.35 18.33 23.49 23.28 21.57 22.55 14.47 18.13 1980 ..................... 21.59 22.65 22.66 W 37.46 36.92 30.12 35.78 35.91 34.20 34.98 23.54 30.60 1981 ..................... 31.77 33.71 35.22 W 36.03 35.63 35.63 36.03 36.07 35.80 35.90 35.74 35.32 1982 ..................... 28.52 30.43 31.77 30.91 30.77 29.98 31.65 31.69 31.66 30.79 31.19 31.80 30.98 1983 ..................... 26.19 28.00 28.32 28.19 28.28 27.27 29.17 29.12 29.06 28.45 28.60 28.93 28.58 1984 ..................... 25.88



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly



Gasoline and Diesel Fuel Update (EIA)

Table 18. Domestic Crude Oil First Purchase Prices Table 18. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1983 ..................... 26.19 28.00 28.32 28.19 28.28 27.27 29.17 29.12 29.06 28.45 28.60 28.93 28.58 1984 ..................... 25.88 27.59 27.76 27.70 27.71 26.90 28.62 28.76 28.72 27.99 28.24 28.54 27.83 1985 ..................... 24.09 25.74 25.88 25.19 25.05 24.35 25.94 26.90 26.82 25.33 26.20 26.16 25.42 1986 ..................... 12.51 14.13 14.76 16.03 15.77 14.68 14.30 14.70 14.55 14.02 14.20 14.61 13.70 1987 ..................... 15.40 16.83 16.52 17.40 17.43 16.56 17.42 17.53 17.49 17.37 17.19 17.63 17.08 1988 ..................... 12.58 13.97 14.21 W 15.26 14.35 14.65 14.79 14.78 14.55 14.58 14.92 14.08 1989 .....................


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management



U.S. Energy Information Administration (EIA) Indexed Site

1 1 U.S. Energy Information Administration/Petroleum Marketing Monthly December 2013 Table 18. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1985 .............. 24.09 25.74 25.88 25.19 25.05 24.35 25.94 26.90 26.82 25.33 26.20 26.16 25.42 1986 .............. 12.51 14.13 14.76 16.03 15.77 14.68 14.30 14.70 14.55 14.02 14.20 14.61 13.70 1987 .............. 15.40 16.83 16.52 17.40 17.43 16.56 17.42 17.53 17.49 17.37 17.19 17.63 17.08 1988 .............. 12.58 13.97 14.21 W 15.26 14.35 14.65 14.79 14.78 14.55 14.58 14.92 14.08 1989 .............. 15.86 17.13 17.16 W 18.15 17.18 18.04 18.36 18.37 18.18 18.36 18.06 17.36 1990 .............. 20.03 21.57 22.06 23.32 23.00 22.16 22.88 23.36 23.46 23.21 23.20


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



IlIl RecuperoRecupero EnergeticoEnergetico deldel RifuitiRifuiti  

E-Print Network (OSTI)

.J. Themelis and P. Ulloa, "Capture and Utilization of Landfill Gas", in Renewable Energy 2005) THE GLOBAL 7.0 Singapore 4.0 China 3.0 Switzerland and Norway 3.8 South Korea 1.0 All other 9 Total 143 · Comparison with WTE: #12;WTE can be a major source of Renewable Energy (U.S. DOE 2002) Energy source Billion

Columbia University


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

rinuncia (shanli ??), A te che in sei anni di difficolt praticasti completamente le pramit, A te, che hai ottenuto il dhyna vittorioso, io mi prostro. * Rifugio nel Dharma. A te che al fine di condurre gli esseri senzienti (youqing ??)13 ad abbandonare... ogni sofferenza, Hai sottomesso tutte le terrificanti torme di Mra, E che nel corso di quarantanove anni hai predicato lindicibile, A te, che (hai realizzato) il nirva supremo, io mi prostro.14 * Rifugio nel Sagha. A voi, fluente corpo di...

Achard, Jean-Luc



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

nouvelles classifications : gshin rje, ma mo, srin po, gnod sbyin, mi' am ci, sa bdag, btsan, bdud ; et lha, btsan, bdud, gza', dmu, srin po, rgyal po, ma mo4. Questionn sur les recoupements, mais aussi les diver- gences que prsentent ces trois listes, il... citant les an- ciens voquent la possibilit pour les klu dapparatre sous la forme dtres surnaturels mi-humains mi-serpents. Les anciens disent que dans la mer vivent des klu et des klu mo ou klu femelles tte et torse d'homme ou de femme et ...

Achard, Jean-Luc



miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...


Vehicle Technologies Office: Fact #672: April 25, 2011 Freight...  

NLE Websites -- All DOE Office Websites (Extended Search)

82.4 167.9 Long Beach, CA Water 4 32.8 119.2 152 Houston, TX Water 5 68.5 78.2 146.7 Detroit, MI Land 6 66.5 53.7 120.2 Laredo, TX Land 7 53.9 61.8 115.8 Chicago, IL Air 8 35.9...


U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Measurement of Branching Fractions and CP Asymmetries in B -> wK Decays and First Evidence of CP Violation in B0 -> wKS0  

E-Print Network (OSTI)

We present a measurement of the branching fractions and charge-parity (CP) violating parameters in B --> omega K decays. The results are obtained from the final data sample containing 772 million BBbar pairs collected at the {\\Upsilon}(4S) resonance with the Belle detector at the KEKB asymmetric-energy e+e- collider. We obtain the branching fractions, B(B0 --> omega K0) = (4.5+/- 0.4 (stat) +/- 0.3 (syst)) x 10^-6, B(B+ --> omega K+) = (6.8 +/- 0.4 (stat) +/- 0.4 (syst)) x 10^-6, which are in agreement with their respective current world averages. For the CP violating parameters we obtain, A (B0 --> omega K0S) = -0.36 +/- 0.19 (stat) +/- 0.05 (syst), S (B0 --> omega K0S) = +0.91 +/- 0.32 (stat) +/- 0.05 (syst), A (B+ --> omega K+) = -0.03 +/- 0.04 (stat) +/- 0.01 (syst), where A and S represent the direct and mixing-induced CP asymmetry, respectively. We find no evidence of CP violation in the decay channel B+ --> omega K+; however, we obtain the first evidence of CP violation in the B0 --> omega K0 decay channel at the level of 3.1 standard deviations.

V. Chobanova; J. Dalseno; C. Kiesling; I. Adachi; H. Aihara; D. M. Asner; V. Aulchenko; T. Aushev; T. Aziz; A. M. Bakich; A. Bala; Y. Ban; K. Belous; B. Bhuyan; A. Bobrov; G. Bonvicini; A. Bozek; M. Bra?ko; T. E. Browder; D. ?ervenkov; V. Chekelian; A. Chen; B. G. Cheon; K. Chilikin; R. Chistov; K. Cho; Y. Choi; D. Cinabro; M. Danilov; Z. Doleal; Z. Drsal; D. Dutta; K. Dutta; S. Eidelman; S. Esen; H. Farhat; J. E. Fast; T. Ferber; V. Gaur; N. Gabyshev; S. Ganguly; A. Garmash; R. Gillard; Y. M. Goh; B. Golob; J. Haba; K. Hayasaka; X. H. He; Y. Horii; Y. Hoshi; W. -S. Hou; Y. B. Hsiung; H. J. Hyun; T. Iijima; K. Inami; A. Ishikawa; Y. Iwasaki; T. Iwashita; I. Jaegle; T. Julius; J. H. Kang; E. Kato; H. Kawai; T. Kawasaki; D. Y. Kim; H. J. Kim; J. B. Kim; J. H. Kim; M. J. Kim; Y. J. Kim; K. Kinoshita; J. Klucar; B. R. Ko; P. Kody; S. Korpar; P. Krokovny; B. Kronenbitter; T. Kuhr; T. Kumita; A. Kuzmin; J. S. Lange; S. -H. Lee; J. Li; Y. Li; L. Li Gioi; J. Libby; D. Liventsev; P. Lukin; D. Matvienko; K. Miyabayashi; H. Miyake; H. Miyata; R. Mizuk; G. B. Mohanty; A. Moll; N. Muramatsu; R. Mussa; E. Nakano; M. Nakao; Z. Natkaniec; M. Nayak; E. Nedelkovska; C. Ng; N. K. Nisar; S. Nishida; O. Nitoh; S. Ogawa; S. Okuno; P. Pakhlov; G. Pakhlova; C. W. Park; H. Park; H. K. Park; T. K. Pedlar; T. Peng; R. Pestotnik; M. Petri?; L. E. Piilonen; M. Ritter; M. Rhrken; A. Rostomyan; H. Sahoo; T. Saito; Y. Sakai; L. Santelj; T. Sanuki; V. Savinov; O. Schneider; A. J. Schwartz; D. Semmler; K. Senyo; O. Seon; M. E. Sevior; M. Shapkin; T. -A. Shibata; J. -G. Shiu; B. Shwartz; A. Sibidanov; F. Simon; Y. -S. Sohn; S. Stani?; M. Stari?; M. Steder; K. Sumisawa; T. Sumiyoshi; U. Tamponi; G. Tatishvili; Y. Teramoto; K. Trabelsi; M. Uchida; T. Uglov; Y. Unno; S. Uno; C. Van Hulse; P. Vanhoefer; G. Varner; K. E. Varvell; A. Vinokurova; V. Vorobyev; M. N. Wagner; C. H. Wang; M. -Z. Wang; P. Wang; M. Watanabe; Y. Watanabe; K. M. Williams; E. Won; H. Yamamoto; Y. Yamashita; S. Yashchenko; Z. P. Zhang; V. Zhilich; V. Zhulanov; A. Zupanc



Print http://us.mg4.mail.yahoo.comfneo/launch?.rand=deOsgk04ks40i Subject: Re: [s-w-h] Solar verses wind efficiency  

E-Print Network (OSTI)

& Pltry Sci-AS-PHD PHD ANA 11ANP 11ANPPHD Animl Sci & Pltry Sci-PS-PHD PHD ANA 11ANS 11ANSMR Animal Sci


Modeling Solid-Particle Erosion of Ductile Alloys B.F. LEVIN, K.S. VECCHIO, J.N. DuPONT, and A.R. MARDER  

E-Print Network (OSTI)

hardening **HASTELLOY and STELLITE are trademarks of Stoody Deloro Stel- lite, Inc., Industry, CA. HAYNES.removal. Only a few attempts have been made to measure the STELLITE**-6, and 316L SS) and commercially pure Cu repre- variation in mechanical properties. The Stellite-6 alloy con- sent a measure of energy absorbed

DuPont, John N.


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


Recombination of Photogenerated Lophyl Radicals in Imidazolium-Based ILs  

NLE Websites -- All DOE Office Websites (Extended Search)

Recombination of Photogenerated Lophyl Radicals in Imidazolium-Based Ionic Recombination of Photogenerated Lophyl Radicals in Imidazolium-Based Ionic Liquids V. Strehmel, J. F. Wishart, D. E. Polyansky and B. Strehmel ChemPhysChem 10, 3112-3118 (2009). [Find paper at Wiley] Abstract: Laser flash photolysis is applied to study the recombination reaction of lophyl radicals in ionic liquids in comparison with dimethylsulfoxide as an example of a traditional organic solvent. The latter exhibits a similar micropolarity as the ionic liquids. The ionic liquids investigated are 1-butyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (1), 1-hexyl-3-methylimidazolium hexafluorophosphate (2), and 1-butyl-3-methylimidazolium tetafluoroborate (3). The recombination of the photolytic generated lophyl radicals occur significantly faster in the ionic liquids than expected from their


Studio e progettazione di attrezzature per il sollevamento dei reattori.  

E-Print Network (OSTI)

??Lattivita di tirocinio stata svolta presso lUfficio Tecnico dellazienda Nuovo Pignone GE Oil and Gas, stabilimento di Massa, che si occupa principalmente della produzione (more)




DOE - Office of Legacy Management -- Sciaky Brothers Inc - IL...  

Office of Legacy Management (LM)

1987 Historical documents may contain links which are no longer valid or to outside sources. LM can not attest to the accuracy of information provided by these links. Please see...


Temperature-Dependent Dynamics and Friction in IL Local Environments  

NLE Websites -- All DOE Office Websites (Extended Search)

Wishart, and E. W. Castner, Jr. J. Phys. Chem. B 111, 4963-4977 (2007). Find paper at ACS Publications or use ACS Articles on Request Abstract: The solvation dynamics and local...


batyam@savion.huji.ac.il Prof. Gerald M. Friedman  

E-Print Network (OSTI)

:00 Harold Vinegar, Chief Scientist, Israel Energy Initiatives Ltd Synergies between natural gas and oil shale in Israel 12:30 Lunch break 13:00 Yaakov Mimran, Petroleum Commissioner, Ministry of National

Daniel, Rosenfeld


GSLIS, UIUC; 501 East Daniel Street; Champaign; IL; 61820 ...  

Science Conference Proceedings (OSTI)

... N - 1 eigenvalues (for a real symmetric matrix ... complexity of the principal components analysis, coupled ... are suitable for visualization and navigation ...




Energy.gov (U.S. Department of Energy (DOE))

The Department of Energy (DOE) and Department of Homeland Security (DHS), in coordination with the Federal Bureau of Investigation, the Federal Energy Regulatory Commission's Office of Energy Infrastructure Security, the Electricity Sector Information Sharing and Analysis Center (ES-ISAC), North American Electricity Reliability Corporation (NERC), and industry experts, will conduct a series of briefings across the country with electricity sector owners and operators, and local law enforcement on the physical security of electricity substations.


A Brief History i-l Research Reactors  

E-Print Network (OSTI)

stainless steel sam- ples in the High Flux Isotope Reactor (HFIR) at tem- peratures of 380 to 680" with up/cm' to balance the gas pressure were used m their calculation. A comparison of the results with HFIR and the HFIR ex- perimental data is presented in section 5. Applications of the model to various fusion designs



SciTech Connect

This is the second progress and final technical report of the remediation of abandoned wells in Clay and Wayne Counties in Illinois. The wells will be identified as the Routt No.3 and No.4 and the Bates Hosselton 1 and 2. Both sites have met all legal, financial and environmental requirements to drill and/or pump oil on both leases. We have also obtained all available information about both leases. All steps were taken to improve access roads, dig the necessary pits, and build the necessary firewalls. This progress and final technical report will address the remediation efforts as well as our results and conclusions.

Peter L. Dakuras; Larry Stieber; Dick Young


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................


Seasonal And Decadal Variation of the Mixed Layer Across the ACRF Using RWP Data  

NLE Websites -- All DOE Office Websites (Extended Search)

Seasonal And Decadal Variation of the Mixed Layer Seasonal And Decadal Variation of the Mixed Layer Across the ACRF Using RWP Data Richard Coulter, Barry Lesht, and Brad Orr Argonne National Laboratory, Argonne, IL INTRODUCTION The radar wind profilers (RWPs) located at the ACRF Southern Great Plains site have been collecting data for more than a decade at the intermediate facilities (I1: Beaumont, KS; I2: Medicine Lodge, KS; I3 Meeker OK) and 15 years at the Central Facility. They provide a good picture of the temporal and spatial variation across the SGP site over this time period Here we elucidate the variation of the height of the mixed layer (z i ) and precipitation, two parameters that illustrate the potential richness of the wind profiler data beyond wind profiles. Daytime Mixed Layer An automated routine, operating


Designation of Sites for Remedial Action - Metal Hydrides, Beverly,  

Office of Legacy Management (LM)

T: T: Designation of Sites for Remedial Action - Metal Hydrides, Beverly, MA; Bridgeport Brass, Adrian, MI and Seymour, Chicago, IL CT; National Guard Armory, 0: Joe LaGrone, Manager Oak Ridge Operations Office Based on the attached radiological survey data (Attachments 1 through 3) and an appropriate authority review, the following properties are being authorized for remedial action. It should be noted that the attached survey data are for designation purposes only and that Bechtel National, Inc. (BNI) should conduct appropriate comprehensive characterization studies to determine the extent'and magnitude of contamination on properties. Site Location Priority Former Bridgeport Brass Co. (General Motors) Adrian, MI Low Former Bridgeport Brass Co.


Tagore au Tibet  

E-Print Network (OSTI)

modernit loccidentale.50 Quoi quil en soit, 47 Tagore 2002b : 99.48 Gru gzings 2001 : 152 (Brtsams chos nang gi mi sna gtso bo Rgya gar chos lugs pa Kar la ni rgyalgces kyi snying stobs shugs drag... cing / rang gshis brtan zhing brling bai na gzhon zhig yin / Slobchen mthar phyin ma thag Rgya gar rgyal gces pai mthun tshogs kyi dbu bzhugs su bsdad pas / mirigs bcings grol gyi ched du dbyin jii mi ser spel mkhan mthar skrod gtong ba khur du...

Robin, Francoise



Contribution aux nombrables de la tradition Bon po : l'Appendive de bsTan 'dzin Rin chen rgyal mtshan a la Sphere de Cristal des Dieux et des Demons de Shar rdza rin po che  

E-Print Network (OSTI)

lettre Ha) ; 2. lessence fminine manifeste sous la forme du a shad etlocalise lextrmit infrieure du canal central ; et 3. le thig le indestructi-ble (mi shig pai thig le) localise dans le cur et exprime en fonction duneEssence vide (ngo bo... familiarisation avec les principes de lapratique, lors de la fusion des essences conscutive au Brasier et lEcoulement (bar dzag)44, il entre alors dans des expriences contemplativesde Dlice (bde ba), de Clart (gsal ba) et de Non-discursivit (mi rtog pa...

Achard, Jean-Luc



A propos d'un premier inventaire des monasteres bon po du Tibet et de l'Himalaya. Notes de lecture  

E-Print Network (OSTI)

bon po au Gansu (p. 504 et 506) et 10 au Qinghai (p.497-500, de faon plus dtaille). Revue dEtudes Tibtaines44 Bon po, la grande statue de Buddha du Bingling si (Gansu) est celle degShen rab mi bo. Il cite galement des relevs chinois des annes... 'dition de 1982 (Lanzhou,Kan su'u mi rigs dpe skrun khang), le numro de ligne est celui o apparat lenom du monastre ; sa dfinition ou localisation sommaire telle qu'elle peut tredduite des brves mentions du texte ou du contexte ; ventuellement...

Chayet, Anne



David Robertson Argonne National Laboratory Chemical Sciences and Engineering Division  

NLE Websites -- All DOE Office Websites (Extended Search)

Robertson Robertson Argonne National Laboratory Chemical Sciences and Engineering Division 9700 South Cass Avenue, Building 205 Argonne, IL 60439-4837 Phone: 630/252-7906; fax: 630/972-4468 e-mail: robertsond@anl.gov Professional Experience * May 2010-present: Argonne National Laboratory, Argonne, IL: Engineering Specialist, Electrochemical Analysis and Diagnostics Laboratory, Testing of advanced battery technologies, DOE contract deliverables, benchmarking of foreign battery technologies * July 2007-May 2010: LGCPI, Troy, MI: Electrical Engineering Manager, Lead the development, validation and integration of Battery Management and Control systems, electrical interfaces, wiring systems and sensing interfaces of large format lithium ion batteries for automotive and other applications.



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................


Mr. Jack W. Anderson Chief Operating Officer Fermilab  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Jack W. Anderson Jack W. Anderson Chief Operating Officer Fermilab P.O. Box 500 Batavia, IL 60510 Dear Mr. Anderson: SUBJECT: NATIONAL ENVIRONMENTAL POLICY ACT (NEPA) DETERMINATION AT i FERMI NATIONAL ACCELERATOR LABORATORY (FERMILAB) - HYDROSTATIC RELIEF ACTION AT THE NEUTRINOS AT THE MAIN INJECTOR (NUMI) Reference: Letter, from J. Anderson to M. Weis, dated January 16, 2013, Subject: NEPA Environmental Evaluation Notification Form (EENF) for the Hydrostatic Relief Action at NuMI have reviewed the Fermilab EENF for the Hydrostatic Relief Action at NuMI. Based on the information provided in the EENF, I have approved the following categorical exclusion (CX): Project Name Approved CX Hydrostatic Relief Action at NuMI 1/76/2013 B2.5 am returning a signed copy of the EENF for your records. No further NEPA review is required.


Aggregationn of Space-Time Processes  

E-Print Network (OSTI)

irfxvrq LhihiUi? |_tU ttL? t@? _@TT*U@|L? tLu| i5T@UiA4i -i|@*i_hiuihi? Uit@? _@_tU ttL? Lui} |4@|h tTiU U@|L? U@?i? |% | uhL4| i5T@UiA4i tTL? |i_L |M)`i@? _ -@hiM@ti_L? |

Giacomini, Raffaella; Granger, Clive W.J.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Il.II.': , Il.II.': , u.s. DEPARTMENT OFFNERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DFTFnIINATION RECIPIENT: FDC Enterprises, Inc. Page 1 of2 STATE: KS PROJECT TITLE: Design and Demonstration of an Advanced Agricultural Feedstock Supply System for lignocellulosic Bioenergy Production Funding Opportunity AonOUDCtment Number DE-FOA-0000060 Pnxunmtol Instrument Number EEOOO1033 NEPA Control Number em Number GF()..10-532 0 Based on my review oflbe information concerning the propostd action, 85 NEPA Compliance Officer (authorized under DOE Order 4Sl.IA). I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits). data analysis (including



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513


Il ruolo dei processi ossidativi nei livelli piu' superficiali delle coperture delle discariche di rifiuti RSU: il caso della discarica di Legoli (Peccioli, Pisa).  

E-Print Network (OSTI)

??Studio e stima della distribuzione spaziale del flusso di biogas emesso dal suolo, composizione chimica ed isotopica del biogas. Campagna di misure di flusso di (more)




NETL: NEPA Categorical Exclusions - July 2011 to September 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to September 2011 1 to September 2011 Archive (November 2009 - July 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 9/30/2011 IGCC Affordability and Availability (Houston) General Electric Company Houston, TX FE/Gasification Division N 9/30/2011 IGCC Affordability and Availability (Schenectady) General Electric Company Schenectady, NY FE/Gasification Division Y 9/30/2011 Geothermal Incentive Program Connecticut Wallingford, CT EE/PMC/IPOD Y 9/29/2011 Midwest Region Alternative Fuels Project Metropolitan Energy Center Kansas City, KS EE/PMC/PVT Y 9/28/2011 Ohio Advanced Transportation Partnership/Roush CleanTech LPG Conversions of Frito Lay Vehicles Clean Fuels Ohio Plymouth Twp., MI EE/PVT/Clean Cities Y 9/28/2011 Ohio Advanced Transportation Partnership/Frito Lay Columbus Propane Fueling Infrastructure Clean Fuels Ohio Columbus, OH EE/PVT/Clean Cities


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Vertical relationships between manufacturers and retailers: inference with limited data  

E-Print Network (OSTI)

OR Electricity (industrial) OH Expon (price-estimatedprice IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (price IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (

Villas-Boas, Sofia B.



Vertical relationships between manufacturers and retailers: inference with limited data  

E-Print Network (OSTI)

Electricity (industrial) OH Dependent Variable = Expon (Price -price IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (price IL Retail rental IL Gasoline IL Gasoline OH Electricity (industrial) IL Electricity (

Villas-Boas, Sofia B.



The male germ cell gene regulator CTCFL is functionally different from CTCF and binds CTCF-like consensus sites in a nucleosome composition-dependent manner  

E-Print Network (OSTI)

2010, 3:19. 15. Nativio R, Wendt KS, Ito Y, Huddleston JE,2008, Page 20 of 21 17. Wendt KS, Yoshida K, Itoh T, Bando



Microsoft Word - Mar EA w Jun Apps  

NLE Websites -- All DOE Office Websites (Extended Search)

Office 5020 Tuttle Creek Blvd Manhattan, KS 66502 USFWS Ecological Services Mike LeValley Project Leader 2609 Anderson Ave Manhattan, KS 66502 FAA, ATO Obstruction Evaluation...



Science Conference Proceedings (OSTI)

... 9, No. 3, R&D Publications, Lawrence, KS, March, 1991. Libes ... 9, No. 1, R&D Publications, Lawrence, KS, January 1991. Libes ...



Cover image: Postcard illustration of Wacker Drive, Chicago, IL. Published by the Gerson Bros.  

E-Print Network (OSTI)

NUCLEAR POWER in CALIFORNIA: 2007 STATUS REPORT CALIFORNIA ENERGY COMMISSION October 2007 CEC-100, California Contract No. 700-05-002 Prepared For: California Energy Commission Barbara Byron, Senior Nuclear public workshops on nuclear power. The Integrated Energy Policy Report Committee, led by Commissioners


'5 ,-62994:'03-6958575:1533-6910950 e-mail: assa-gr@actcom.net.il  

E-Print Network (OSTI)

;-82- -" . . . 40 , , , .ASTM110 . . . .NFPA-12A 34.02.5.: . 5" " " 5. " 1). , 2:1; 12): 110%-60; 125%-10; 13)150%-60; 1,000%-1; 14): 100%. -2 A . . . . " " . . 10, , 25. . -NFPA' ,1220. #12;-71- -" . "9002. . -. 34

Maoz, Shahar

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

project management activities for both proposed project initiatives. DOE has determined thai impacts related to these tasks will have negligible or no affects on the human and...


Costo del capitale e valutazione del rischio in investimenti in energie rinnovabili: il caso del biogas.  

E-Print Network (OSTI)

??La tesi dopo aver discusso i modelli pi importanti per la stima del costo del capitale, propone l'analisi industriale degli impianti a biogas. La terza (more)

Simonetto, Stefano



Extraction of tetra-oxo anions into a hydrophobic IL without...  

NLE Websites -- All DOE Office Websites (Extended Search)

T. D. Qadah, and S. L. Garvey Ind. Eng. Chem. Res. 49, 5863-5868 (2010). Find paper at ACS Publications Selected for the ACS Special Virtual Issue on Ionic Liquids (March 2011)....


Luciano Floridi Research Fellow del Wolson College e Lecturer in Logic and Epistemology presso il St.  

E-Print Network (OSTI)

a nostra insaputa, mentre i crimini variano dalla pornografia elettronica ai virus, dalla riproduzione

Floridi, Luciano


Politics on parade : immigration, ethnicity and national identity in Chicago, IL  

E-Print Network (OSTI)

Parades are many things. They are treasured annual traditions, community gatherings, expressions of identity and pride. Parades interrupt the daily flow of city life, rerouting traffic, crowding sidewalks and public ...

Sengupta, Annis Whitlow



e-mail: elperin@menix.bgu.ac.il Department of Mechanical Engineering,  

E-Print Network (OSTI)

developed a theoretical model of a novel thermal laser shock method for separation of glass and glass-ceramic.1115/1.1649245 Introduction High quality separation of nonmetallic e.g., glass, glass- ceramic wafers into chips is of great significance in electronic industry. Since chips often operate at large thermal loadings, high quality

Elperin, Tov


Impaired Cytokine Signaling in Mice Lacking the IL-1 Receptor-Associated Kinase1  

E-Print Network (OSTI)

first generation college students, have a verified disability, or receive a Pell Grant as part of the Jerry Yang Resource and Support Center for Undocumented Students was to provide a supportive environment. It was the intention of the Jerry Yang Resource and Support Center for Undocumented Students to provide academic


Status of initial testing of the H2SO4 section of the ILS experiment.  

DOE Green Energy (OSTI)

A sulfuric acid catalytic decomposer section was assembled and tested for the Integrated Laboratory Scale experiments of the Sulfur-Iodine Thermochemical Cycle. This cycle is being studied as part of the U. S. Department of Energy Nuclear Hydrogen Initiative. Tests confirmed that the 54-inch long silicon carbide bayonet could produce in excess of the design objective of 100 liters/hr of SO{sub 2} at 2 bar. Furthermore, at 3 bar the system produced 135 liters/hr of SO{sub 2} with only 31 mol% acid. The gas production rate was close to the theoretical maximum determined by equilibrium, which indicates that the design provides adequate catalyst contact and heat transfer. Several design improvements were also implemented to greatly minimize leakage of SO{sub 2} out of the apparatus. The primary modifications were a separate additional enclosure within the skid enclosure, and replacement of Teflon tubing with glass-lined steel pipes.

Moore, Robert Charles; Parma, Edward J., Jr.; Gelbard, Fred




NLE Websites -- All DOE Office Websites (Extended Search)

Center - Parking Lot Lighting Controls B5.1 None Project 11: Government Center - Wall Wash LED Lighting B5.1 Waste Stream Clause Project 12: Government Center - Domestic Hot...


987 Orrington Road (847) 555-3700 Evanston, IL 60208 b-cats@baxter.org  

E-Print Network (OSTI)

from 82% to 99.7% through enhanced queue design, work flow analysis, phone skills training, and call Results-oriented leader with extensive experience in general management, multi-channel marketing Creation New Market and Product Development General Management, Finance, Operations B-to-B and B

Shull, Kenneth R.


High School Visits (WI, IL, MN and other states) Arranged in alpha order  

E-Print Network (OSTI)

High School 10/5/12 8:15 a.m. Black River Falls High School 9/21/12 9:00 a.m. Bollingbrook High School High School 10/16/12 12:00 p.m. Crystal Lake Central High School 10/15/12 9:40 a.m. Cuba City High

Saldin, Dilano


A High-throughput Screening Approach Identifies Selective Regulators of Il12b Transcription  

E-Print Network (OSTI)

TLR4, in contrast to NF-kB and AP-1, whose activities aresignaling pathways, such as NF-kB and MAP kinase pathways,

Doty, Kevin Richard



TREC-Il Routing Experiments with the TRW/Paracel Fast Data ...  

Science Conference Proceedings (OSTI)

... 0 19 12 B~nk Failures 87 151 75 42 2 42 36 S&L Prosecutions 88 32 29 21 0 11 26 Crude Oil Price Trends 89 17 8 2 0 3 7 OPEC Investments 90 ...



Epitaxial Ge/Il-V Heterostructures : MOCVD growth, characterization, and applications  

E-Print Network (OSTI)

Epitaxial Ge thin films are being investigated for many important roles in next generation microelectronics. Metal-oxide-semiconductor field effect transistors (MOSFETs) utilizing Ge channels have demonstrated dramatic ...

Bai, Yu, Ph.D. Massachusetts Institute of Technology



Apr il 11, 1 988 Feasibility Study into the Use of Mechanical Choppers  

E-Print Network (OSTI)

·· Plenum Press (1980). 2. D. Moncton, in "New Rings Ivorkshop," SSRL Report 83-02 (1983). 3. G. K. Shenoy;REFERENCE 1. Go1ovchenko, J. A., in SSRL Report 83/102, ed. K. Cantwell and C. Mitchell, (1983), p. 147. 30

Kemner, Ken


Topological visual navigation in large environments IlPyung Park and John R. Kender  

E-Print Network (OSTI)

a new model for robot navigation in large unstructured environments. Our model consists of two parts. Traversing on a trajectory enables the navigator to move reliably towards a target, based on shapes formed direction follower (navigator). Previous qualitative approaches to robot navigation include: the TOUR model


-i&k'il (uI//X -8^O^O --o ~u^ 1MASTER  

E-Print Network (OSTI)

conducted a variety of R&D projects involving absorption systems, gas-engine-driven systems, Rankine-cycle systems, desiccant systems, ejector systems, etc. Of these, three residential absorption systems made, for a somewhat different application -- gas-fired heat pumps for space heating and cooling. Although

Oak Ridge National Laboratory


Optimization of X-ray Radiographic Imaging Birsen Yazici, Il-Young Son, An Jin  

E-Print Network (OSTI)

- Energy Storage and Organic Photovoltaic Devices - Next-Generation Organic Materials and Device after July 14, 2010. Accommodations Hotels Many comfortable hotels with easy access to the conference venue are located along with the subway lines in Kyoto City. Blocks of rooms at the following hotels

Yazici, Birsen


Proc. of the sixteenth symposium on energy engineering sciences, May 13-15, 1998, Argonne, IL.  

Science Conference Proceedings (OSTI)

This Proceedings Volume includes the technical papers that were presented during the Sixteenth Symposium on Energy Engineering Sciences on May 13--15, 1998, at Argonne National Laboratory, Argonne, Illinois. The Symposium was structured into eight technical sessions, which included 30 individual presentations followed by discussion and interaction with the audience. A list of participants is appended to this volume. The DOE Office of Basic Energy Sciences (BES), of which Engineering Research is a component program, is responsible for the long-term, mission-oriented research in the Department. The Office has prime responsibility for establishing the basic scientific foundation upon which the Nation's future energy options will be identified, developed, and built. BES is committed to the generation of new knowledge necessary to solve present and future problems regarding energy exploration, production, conversion, and utilization, while maintaining respect for the environment. Consistent with the DOE/BES mission, the Engineering Research Program is charged with the identification, initiation, and management of fundamental research on broad, generic topics addressing energy-related engineering problems. Its stated goals are to improve and extend the body of knowledge underlying current engineering practice so as to create new options for enhancing energy savings and production, prolonging the useful life of energy-related structures and equipment, and developing advanced manufacturing technologies and materials processing. The program emphasis is on reducing costs through improved industrial production and performance and expanding the nation's store of fundamental knowledge for solving anticipated and unforeseen engineering problems in energy technologies. To achieve these goals, the Engineering Research Program supports approximately 130 research projects covering a broad spectrum of topics that cut across traditional engineering disciplines. The program focuses on three areas: (1) mechanical sciences, (2) control systems and instrumentation, and (3) engineering data and analysis. The Sixteenth Symposium involved approximately one-fourth of the research projects currently sponsored by the DOE/BES Engineering Research Program.





Office of Legacy Management (LM)

for Resihol Rndioncri.e Mnretil 01 Fonncrv Erili-cd Sites Rcmedinl Acfion Propm and Remote Sqhs Fociliries fnnogc:mwr Progwn Sires, Rev. 2. U.S. Department of Energy,...

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti




Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................


Better Buildings Neighborhood Program: Fayette County, Pennsylvania  

NLE Websites -- All DOE Office Websites (Extended Search)

Fayette Fayette County, Pennsylvania to someone by E-mail Share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Facebook Tweet about Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Twitter Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Google Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Delicious Rank Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Digg Find More places to share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


Better Buildings Neighborhood Program: Bainbridge Island, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Bainbridge Bainbridge Island, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Bainbridge Island, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Bainbridge Island, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Google Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Delicious Rank Better Buildings Neighborhood Program: Bainbridge Island, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Bainbridge Island, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Better Buildings Neighborhood Program: Communities Throughout Oregon  

NLE Websites -- All DOE Office Websites (Extended Search)

Communities Communities Throughout Oregon to someone by E-mail Share Better Buildings Neighborhood Program: Communities Throughout Oregon on Facebook Tweet about Better Buildings Neighborhood Program: Communities Throughout Oregon on Twitter Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Google Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Delicious Rank Better Buildings Neighborhood Program: Communities Throughout Oregon on Digg Find More places to share Better Buildings Neighborhood Program: Communities Throughout Oregon on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY


Lippi Brandolini on King Mathias or on Deterioration of Health  

E-Print Network (OSTI)

of Marsilio Ficino, Vol.7. (London, 2003) esp. letters 37, 48, and 57. #2; The contemporaries were rather cautious in characterising or describing Jnos Corvinus, to say the least: while his father was alive, they praised him, and after his death did not care... , Milano: Berlusconi, 2003, see esp. 1-32: Oh, fossi ucciso nel grembo, e tomba mi fosse state mia madre e il concepimento della sua vagina non arisse avuto mai fine! Sarei stato come se non fossi stato trasferito dalla vagina alla tomba (p.6...

Horvath, Agnes



Midcontinent Interactive Digital Carbon Atlas and Relational Database (MIDCARB)  

NLE Websites -- All DOE Office Websites (Extended Search)

MIDCONTINENT INTERACTIVE DIGITAL CARBON ATLAS AND MIDCONTINENT INTERACTIVE DIGITAL CARBON ATLAS AND RELATIONAL DATABASE (MIDCARB) Timothy R., Carr (tcarr@kgs.ukans.edu; 785-864-2135) Scott W. White (whites@kgs.ukans.edu; 785-864-2135) Kansas Geological Survey, University of Kansas Lawrence, KS 66047-3726 Lawrence H. Wickstrom (larry.wickstrom@dnr.state.oh.us; 614-265-6598) Ohio Department of Natural Resources, Division of Geological Survey, Columbus, OH 43224-1362 James A., Drahovzal (drahovzal@kgs.mm.uky.edu; 859-257-5500) Kentucky Geological Survey, University of Kentucky, Lexington, KY 40506-0107 Beverly Seyler (seyler@isgs.uiuc.edu; 217-244-2389) Illinois State Geological Survey, Champaign, IL 61820 John, A. Rupp (rupp@indiana.edu; 812-855-1323) Indiana Geological Survey, Indiana University, Bloomington, IN 47405-2208



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Atchison Atchison u.s. DI!PARThIl1NT OF l?NERGY EERE PROJECT MA.NAGEMENT CENTER NEPA DFTFIU.1INATION PROJECT TITLE: EECBG DE-EEOOOO727 Atchison Library Ground Source Heat Pump Page 1 of2 STATE : KS Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE FOA 0000013 0 Based on my review of the information tORcuning the proposed action, as NEPA Compliam::e Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.


Strategic Standardization  

Science Conference Proceedings (OSTI)

... Program Strategic Standardization Curriculum (CMGT 564 - 2010) ... com. Curriculum ks eport, 1992), Grading (Research paper, ...




NLE Websites -- All DOE Office Websites (Extended Search)

Design of Metal Organic Design of Metal Organic Frameworks for the Separation of Carbon Dioxide From Flue Gas and Gasification Streams John J. Low UOP LLC, 50 E. Algonquin Rd, Des Plaines, IL 60017-5016, (847) 391-3046, John.Low@uop.com Randall Q. Snurr Northwestern University, Department of Chemical & Biological Engineering, Evanston, IL 60208 (847) 467-2977, snurr@northwestern.edu Omar Yaghi and Adam Matzger University of Michigan, 2815 DOW Laboratory, Department of Chemistry, Ann Arbor, MI 48109-1055, (734) 615-2146, oyaghi@umich.edu Project Objectives Develop a low cost novel adsorbent to remove CO 2 from flue gas and gasification streams -High selectivity -High adsorption capacity -Good adsorption/desorption rates -Adsorbent has low enough binding energy for regenerability Scope of Work


U.S. Spent Nuclear Fuel Data as of December 31,2002 -Table 2  

Gasoline and Diesel Fuel Update (EIA)

6 6 Table 1 | Table 3 Table 2. Nuclear Power Plant Data as of December 31, 2002 Reactor Name State Reactor Type Reactor Vendor a Core Size (number of assemblies) Startup Date (year)b License Expiration (year) Actual Retirement (year) Arkansas Nuclear 1 AR PWR B&W 177 1974 2034 Arkansas Nuclear 2 AR PWR CE 177 1978 2018 Beaver Valley 1 PA PWR WE 157 1976 2016 Beaver Valley 2 PA PWR WE 157 1987 2027 Big Rock Point MI BWR GE 84 1962 2000 1998 Braidwood 1 IL PWR WE 193 1987 2026 Braidwood 2 IL PWR WE 193 1988 2027 Browns Ferry 1 AL BWR GE 764 1973 2013 Browns Ferry 2 AL BWR GE 764 1974 2014 Browns Ferry 3 AL BWR GE 764 1976 2016 Brunswick 1 NC BWR GE 560 1976 2016



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

'I.'~l 'I.'~l US DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NFPA DI1T:ERMINATION Page 1 01'2 RECIPIENT: National Center for Manufacturing Sciences STATE: MI PROJECf TITLE: Innovation Realization: Building and Supporting an Advanced Contract Manufacturing Cluster in Southeast Michigan Funding Opportunity Announcement Number JIAC2102AM Procurement Instrument Number DE~EEOOO6030 NEPA Control Number elD Number GF0-0006030-001 G06030 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathering, analysis, and dissemination Information gathering (including, but not limited to, literature surveys, inventories, site visits, and


Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard



Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...

Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro



Cytokine-capture nanoparticles to quantify IL-2 concentrations within the immunological synapse during T cell activation  

E-Print Network (OSTI)

The feasibility of bringing a nascent technology for detection and quantification of local cytokine concentrations on cell surfaces to market is presented in this paper. Quantum dots or fluorochrome-loaded nanoparticles ...

Hong, Julee Y. (Julee Yang-A.), 1980-




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

order to circulate through the STM site. Once a vehicle has been searched by security thai vehicle must remain within control of the NREl approved driver at all times during the...


Il faut mditerraniser la peinture: Giorgio de Chiricos Metaphysical Painting, Nietzsche, and the Obscurity of Light  

E-Print Network (OSTI)

literally: incorporating esoteric symbols mentioned byimperatives jealously esoteric and exclusive? Thethat it confused his esoteric genius with the exoteric

Merjian, Ara H.



In vitro receptor autoradiography reveals angiotensin IL (ANG II) binding associated with sensory and motor components of the vagus  

SciTech Connect

Specific, high affinity Ang II binding in the dog's dorsal medulla is concentrated in the area postrema, nucleus tractus solitarii (nTS) and dorsal motor nucleus of the vagus (dmnX). More recently Ang II binding sites were observed where bundles of vagal afferent fibers enter the dorsal medulla 6 mm rostral to obex and in the nodose ganglia and peripheral vagal nerves. Since Ang II binding in the nTS and dmnX overlies the distribution of vagal afferent fibers and efferent neurons, the effects of nodose ganglionectomy and cervical vagotomy on Ang II binding in the dorsal medulla were studied in rats and dogs using autoradiography after incubation of 14 ..mu..m coronal sections with 0.4 nM /sup 125/I-Ang II. Nonspecific binding was determined in the presence of 1 ..mu..m unlabeled Ang II. Two weeks after unilateral nodose ganglionectomy Ang II binding sites were absent ipsilaterally in the region where vagal afferent fibers enter the dorsal medulla. In the nTS and dmnX, binding near obex was reduced, while more rostrally these nuclei were almost completely devoid of Ang II binding on the denervated side. After cervical vagotomy, the loss of binding was restricted to the ipsilateral dmnX. These data are the first to reveal that Ang II binding in the dorsal medulla requires an intact vagal system.

Diz, D.I.; Barnes, K.L.; Ferrario, C.M.



La perception et la production des sons relveraient de deux habilets distinctes. Ils empchent aussi l'altration  

E-Print Network (OSTI)

imbibés de concoctions douteuses. Les débuts sont diffici- les pour les ancêtres de Jean Coutu. Moins

Charette, André


Tecniche di apprendimento automatico per la rilevazione di malfunzionamenti in sistemi HVAC: il caso di un refrigeratore di liquido centrifugo.  

E-Print Network (OSTI)

??Malfunzionamenti in sistemi di riscaldamento, ventilazione e aria condizionata (HVAC) possono essere rilevati attraverso sitemi di Fault Detection. Spesso le informazioni riguardanti guasti e anomalie (more)

Corazzol, Chiara



Mira Conference at Argonne National Laboratory, ALCF, Bldg. 240,# 1416, 12pm, March 6, 2013, Argonne, IL  

E-Print Network (OSTI)

reads PAPI_L2_DCW 0x80000047 No Level 2 data cache writes PAPI_L1_ICA 0x8000004c No Level 1 instruction

Kemner, Ken


Benjamin L. Lev, Ph.D. Curriculum Vitae, April 2011 Personal Address: 1110 W. Green St., Urbana, IL 61801  

E-Print Network (OSTI)

measurements in deuterated (TMTSF)2ClO4 9/92 to 6/95 Crystal River High School, Crystal River, Florida. Goldbart, Atom-light crystallization of BECs in multimode cavities: Nonequilibrium classical and quantum

Lev, Benjamin L.


Presence of Terminal EPIYA Phosphorylation Motifs in Helicobacter pylori CagA Contributes to IL-8 Secretion,  

E-Print Network (OSTI)

Ba phosphorylation and confirmed CagA involvement in NF-kB activation. Furthermore, we observed that presence of EPIYA-C functional phosphorylation motifs contributed to NF-kB activation. NF-kB upstream signaling-/- mouse embryonic fibroblasts (MEFs) failed to induce NF-kB activity, unlike the respective control MEFs


IL-17A is increased in the serum and in spinal cord CD8 and mast cells of ALS patients  

E-Print Network (OSTI)

motor neuron degeneration in ALS. Annu Rev Neurosci 2004, 3.in Familial and Sporadic ALS. Antioxid Redox Signal 2009, 4.non-native SOD1 in sporadic ALS patients. PLoS One 5-e11552.



P.O. Box 500, MS 301 Batavia, IL 60510 Phone: (630) 840-3865 FAX: (630) 840-8766  

E-Print Network (OSTI)

of Nuclear Physics, epithermal neutron source for neutron-capture therapy was built and neutron generation of Nuclear Physics (Novosi- birsk, Russia) an original source of epithermal neutrons has been conceived based. Conclusions At the Budker Institute of Nuclear Physics, a pilot epithermal neutron source has been built

Karonis, Nicholas T.


INCT FOR CLIMATE CHANGE | 2009.2010 | ACTIVITY REPORT | BRAzIL National Institute of Science and  

E-Print Network (OSTI)

, Tennessee BEN CHANDLER, Kentucky RUSS CARNAHAN, Missouri BARON P. HILL, Indiana HARRY E. MITCHELL, Arizona, New Mexico PAUL D. TONKO, New York JIM MATHESON, Utah LINCOLN DAVIS, Tennessee BEN CHANDLER, Kentucky and Assistant Director for Academic Affairs, Labora- tory for Laser Energetics, University of Rochester Oral


Natural Gas and Hydrogen Infrastructure Opportunities Workshop, October 18-19, 2011, Argonne National Laboratory, Argonne, IL : Summary Report.  

Science Conference Proceedings (OSTI)

The overall objective of the Workshop was to identify opportunities for accelerating the use of both natural gas (NG) and hydrogen (H{sub 2}) as motor fuels and in stationary power applications. Specific objectives of the Workshop were to: (1) Convene industry and other stakeholders to share current status/state-of-the-art of NG and H{sub 2} infrastructure; (2) Identify key challenges (including non-technical challenges, such as permitting, installation, codes, and standards) preventing or delaying the widespread deployment of NG and H{sub 2} infrastructure. Identify synergies between NG and H{sub 2} fuels; and (3) Identify and prioritize opportunities for addressing the challenges identified above, and determine roles and opportunities for both the government and industry stakeholders. Plenary speakers and panel discussions summarized the current status of the NG and H{sub 2} infrastructure, technology for their use in transportation and stationary applications, and some of the major challenges and opportunities to more widespread use of these fuels. Two break-out sessions of three groups each addressed focus questions on: (1) infrastructure development needs; (2) deployment synergies; (3) natural gas and fuel cell vehicles (NGVs, FCVs), specialty vehicles, and heavy-duty trucks; (4) CHP (combined heat and power), CHHP (combined hydrogen, heat, and power), and synergistic approaches; and (5) alternative uses of natural gas.

Kumar, R. comp.; Ahmed, S. comp. (Chemical Sciences and Engineering Division)



Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050ks2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050ks2a.htm" ,"Source:","Energy Information...


Microsoft PowerPoint - Post-2014 August 25, 2011 Proposed Allocations...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summer Winter Summer Winter Summer Kilowatthours Winter Kilowatthours Summer Kilowatts Winter Kilowatts Jetmore, KS 458,186 301,817 280 201 S * Pomona, KS 355,544 254,634*...


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

in KS - Deep Saline Arbuckle Aquifer in south-central KS - Select depleted mature oil fields Start Date - Dec 2009 No CO 2 will be injected in this 3-year project. C e n t...


The Use of Trust Regions in Kohn-Sham Total Energy Minimization  

E-Print Network (OSTI)

of the KS total energy optimization problem, which has beenthe original total energy minimization problem is. Secondly,the KS total energy minimiza- tion problem as min E total (

Yang, Chao; Meza, Juan C.; Wang, Lin-wang


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ARM - Instrument - nwsupa  

NLE Websites -- All DOE Office Websites (Extended Search)

: NWS profiles at Dodge City, KS with 1-second resolution 01snwsupaoun : NWS profiles at Oklahoma City, OK with 1-second resolution 01snwsupatop : NWS profiles at Topeka, KS with...


Agricultural expansion induced by biofuels: Comparing predictions of market?equilibrium models to historical trends  

E-Print Network (OSTI)

KS Tyson. An overview of biodiesel and petroleum diesel lifecally maize ethanol and biodiesel from vegetable oils are

Rajagopal, Deepak



SGI Proprietary Eine Einfhrung in die Benutzung der SGI Altix  

E-Print Network (OSTI)

distribution of application memory pages across nodes: % dlook ls anaconda-ks.cfg install.log install

Sanderson, Yasmine


Tolerance Limits  

Science Conference Proceedings (OSTI)




Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation



Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan




SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan



1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael


Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...


Note: This page contains sample records for the topic "il ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL



SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan



Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass



50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan



AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico



SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan



Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


National Transportation Stakeholders Forum  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

N N ti l T t ti National Transportation Stakeholders Forum Chicago, IL, May 26, 2010 Ahmad Al-Daouk Date and page number - 1 Director, National Security Department National Nuclear Security Administration Service Center - Albuquerque, NM National Transportation Stakeholders Forum OSRP * NNSA Contractors transporting in commerce, are required law to comply with applicable regulations required law to comply with applicable regulations (e.g. federal, local, tribal) * Great majority of NNSA shipments are non-secured * Off-Site Source Recovery Program (OSRP) - OSRP is a U.S. Government activity sponsored and overseen by NNSA Office of Global Threat Reduction and the program is managed by LANL Mi i i t t d b d d Date and page number - 2 - Mission is to remove excess, unwanted, abandoned, or


Better Buildings Neighborhood Program: Los Angeles County, California  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Angeles Los Angeles County, California to someone by E-mail Share Better Buildings Neighborhood Program: Los Angeles County, California on Facebook Tweet about Better Buildings Neighborhood Program: Los Angeles County, California on Twitter Bookmark Better Buildings Neighborhood Program: Los Angeles County, California on Google Bookmark Better Buildings Neighborhood Program: Los Angeles County, California on Delicious Rank Better Buildings Nei