Powered by Deep Web Technologies
Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

ICON-070  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth7-1D: Vegetation ProposedUsingFun withconfinementEtching. | EMSL Bubblesstructure theby J.H. Ray,ICON-070

2

What Makes an Icon Effective?  

SciTech Connect (OSTI)

Several criteria like conspicuity, legibility, and comprehension must be met for an icon to be effective. Previous studies found that visual and cognitive features of icons have significant influence on meeting the criteria for icon effectiveness. The aim of this paper is to present a review on visual features (color, shape, size) and cognitive features (familiarity, concreteness, complexity, meaningfulness, semantic distance). The influence of these features on icon effectiveness was studied. The relationships amongst cognitive features and ways to quantify cognitive features were identified. Suggestions regarding opportunities for future research on icons were also highlighted. Such a review would be helpful in formulating research plans and methodologies for icon studies in the future. In addition, this review would facilitate graphic designers to create more user-friendly icons in various contexts.

Ng, Annie Wy; Chan, Alan Hs [Department of Manufacturing Engineering and Engineering Management City University of Hong Kong, Kowloon Tong (Hong Kong)

2009-01-12T23:59:59.000Z

3

The DOE Virtual University (DVU) Icon  

Broader source: Energy.gov [DOE]

The Office of Learning & Workforce Development launched a desktop icon for its virtual university. The DOE Virtual University (DVU) icon is on most of the DOE desktops (most of HQ, except EIA...

4

Byzantine Icons The Art and Science of Depiction  

E-Print Network [OSTI]

to write an icon. Project Focus Art&Science of Depiction Software Engineering Byzantine Icons Software' of writing icons is at its core a spiritual discipline." (Olga Milenback, Instructor) Technique "Before

Durand, Frédo

5

Byzantine Icons The Art and Science of Depiction  

E-Print Network [OSTI]

. #12;Project Focus Art&Science of Depiction Software Engineering Byzantine Icons Software #12;Where of iconography is that the 'art' of writing icons is at its core a spiritual discipline." (Olga Milenback

Durand, Frédo

6

Modern architecture: an analysis of the Iconic vision in film  

E-Print Network [OSTI]

ourselves what cultural forces contribute to the iconizing of certain architectural monuments in the world's subconscious. Are these icons valid? And most importantly, is it something we, as a society, should remedy in order to prevent other acts...

Johnston, Benjamin Michael

2013-02-22T23:59:59.000Z

7

Byzantine Icons The Art and Science of Depiction  

E-Print Network [OSTI]

to write an icon. #12;2 Project Focus Art&Science of Depiction Software Engineering Byzantine Icons Software Where to Start · History · Technique · Analysis #12;3 History · Byzantium is the name given of the techniques of iconography is that the 'art' of writing icons is at its core a spiritual discipline." (Olga

Durand, Frédo

8

An iconic approach to representing climate change  

E-Print Network [OSTI]

1 An iconic approach to representing climate change Saffron Jessica O'Neill A thesis submitted-experts to be meaningfully engaged with the issue of climate change. This thesis investigates the value of engaging non-experts with climate change at the individual level. Research demonstrates that individuals perceive climate change

Feigon, Brooke

9

Icon Solar Power, LLC | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI Solar Jump to: navigation,Icon Solar Power, LLC

10

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

11

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

12

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

13

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

14

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

15

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

16

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

17

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

18

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

19

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

20

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

22

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

23

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

24

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

25

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

26

iCons, 2011 Alzheimers and Aluminum: Lesson Plan  

E-Print Network [OSTI]

© iCons, 2011 Alzheimers and Aluminum: Lesson Plan Handouts to explore mechanistic link between Alzheimer's and aluminum 5. Brief proposal expanding Points to Aluminum's Link With Alzheimer's Disease" from 1989. Provide handout

Auerbach, Scott M.

27

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

28

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

29

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

30

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

31

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

32

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

33

From Spaceship Earth to Google Ocean: Planetary Icons, Indexes, and Infrastructures  

E-Print Network [OSTI]

What sort of image does the planet Earth possess at the opening of the 21st century? If in the 1960s, the Whole Earth, the planet as seen from space, became a cold war, proto-environmentalist icon for a fragile ocean planet, ...

Helmreich, Stefan

34

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

35

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

36

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

37

iCons 3E Syllabus (NatSci389H) NatSci 389H (formerly 390IH) Team-oriented Lab Discovery  

E-Print Network [OSTI]

in Renewable Energy [iCons 3E] Syllabus Spring 2014 Course Vision This course involves student-driven, team-oriented laboratory projects focused on the interrelated principles of energy generation, conversion, storage be used to solve energy problems faced by society. The iCons Energy Laboratory encompasses a four

Auerbach, Scott M.

38

Building Footprints (Shapefile) of University of Kansas, Lawrence Campus  

E-Print Network [OSTI]

Data layer geneated with Intention to have basic building dataset for data analysis and generation of maps, for Lawrence Campus of the University of Kansas. Building outlines were digitized using ArcMap in ca. 2007 from aerial photograph to create...

Houser, Rhonda

2011-02-18T23:59:59.000Z

39

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

40

iCons 2 Renewable Energy [NatSci 290IH (2) aka i2e] Spring 2013 Syllabus i2e Faculty Guides  

E-Print Network [OSTI]

1 iCons 2 Renewable Energy [NatSci 290IH (2) aka i2e] ­ Spring 2013 Syllabus i2e Faculty Guides Objectives: Students learn to ... in the context of Renewable Energy problems. 1. ... write effectively Trip: Campus Heating and Power (CHP) Thursday Feb 9: Work on Energy Flow Diagram for UMass Amherst

Auerbach, Scott M.

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Cella Energy Limited, a spinout company from STFC, is to set up a new facility at NASA's iconic Kennedy Space Center (NASA KSC) after a new round of  

E-Print Network [OSTI]

equity raised by international institutions and will see the number of jobs at Cella Energy more than Stephen Voller, CEO of Cella Energy Limited. "It will also see the number of jobs at Cella increase fromCella Energy Limited, a spinout company from STFC, is to set up a new facility at NASA's iconic

42

Geochemistry AFM (Icon) | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickr Flickr Editor'sshort version)Unveils High-TechNatural Magmas

43

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

44

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

45

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

46

Corporate icons in the suburban landscape  

E-Print Network [OSTI]

The image of the modern workplace in the American suburb has long been a contentious topic of discussion among academics, planning and development professionals, and the public. Today, the critics of office parks in the ...

Abolina, Viktorija

2013-01-01T23:59:59.000Z

47

An Evaluation of computer-based icons  

E-Print Network [OSTI]

NPL XH-CK HP ATARI APPLE FUJITSU RICOH SHARP ASK II CANNON COMPANY J. HITACHI AMIGA JULIETA 13 4 15 3 12 4 16 8 3 1 1 4 1 1 2 2 2 1 1 TOTAL 25 26 22 As can be seen in Table 2, users showed a preference for some...

Yamakawa, Julieta Kaoru

1989-01-01T23:59:59.000Z

48

Widget:AnchorIcon | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: SaltTroyer &

49

Widget:IconContainer | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: SaltTroyerGetRecommendations Jump to:HIDEIconContainer Jump to:

50

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

51

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

52

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

53

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

54

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

55

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

56

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

57

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

58

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

59

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

60

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

62

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

63

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

64

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

65

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

66

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

67

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

68

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

69

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

70

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

71

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

72

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

73

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

74

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

75

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

76

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

77

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

78

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

79

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

80

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

82

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

83

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

84

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

85

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

86

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

87

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

88

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

89

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

90

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

91

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

92

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

93

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

94

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

95

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

96

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

97

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

98

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

99

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

100

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

102

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

103

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

104

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

105

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

106

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

107

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

108

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

109

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

110

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

111

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

112

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

113

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

114

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

115

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

116

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

117

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

118

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

119

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

120

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

122

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

123

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

124

iCons, 2011 Top 10 Scientific Achievements: Lesson Plan  

E-Print Network [OSTI]

by negative (i.e. what's /not/ scientific). Example to help clarify might be Fire / Internal Combustion Engine.e. what's /not/ scientific). Example to help clarify might be Fire / Internal Combustion Engine

Auerbach, Scott M.

125

Grounding the Simulation of Iconic Gestures in Gesture Typology  

E-Print Network [OSTI]

shows under (1) the pointed gothic church-window presented in a VR-video film as perceived from an agent. As an illustration of every aspect of our methodology, we will discuss a church-window-example from the SAGA corpus shown in Figure 1 throughout the talk (restricted to the top of the window). Empirical Study

Kouroupetroglou, Georgios

126

Porn, Pedagogy, and the Passing of an Icon  

E-Print Network [OSTI]

by A n n a E . Wa r d Porn, Pedagogy, and the Passing of anoverlaps with the field of porn studies and as a teacher,common within the field of porn studies itself. This is

Ward, Anna E.

2010-01-01T23:59:59.000Z

127

A German-American Icon: O, du schne Schnitzelbank!  

E-Print Network [OSTI]

in Detroit, Michigan, highlighting the location as a place for food and drink. Here the " langer Mann" and " Tanenbaum" are exchanged for the two couplets: Ist das nicht eine gute Wurst? - Ja, das ist eine gute Wurst! Ist das nicht ein grosser Durst? - Ja... Rapids, Michigan, and Jasper, Indiana. The classical German-American Schnitzelbank chart and song would seem to be something truly "made in America." Judging by the frequency with which the Schnitzelbank or some variation of it appears in American...

Keel, William

2003-09-01T23:59:59.000Z

128

Voyage of discovery The iconic Sainsbury Centre for Visual Arts  

E-Print Network [OSTI]

will see an area of mostly agricultural land near Shanghai transformed into an eco-city. CRed has teamed up the world's first sustainable city. The Dongtan Sustainable Technologies and Renewables (STAR) project Investment Company (SIIC) as well as Alsop architects to work on the project. The renewable-energy plant

Feigon, Brooke

129

The Universal Quixote: Appropriations of a Literary Icon  

E-Print Network [OSTI]

The classic study of the connection between Erasmus and Cervantes, Erasmo y Espa?a, was done by Marcel Bataillon in 1966. A more recent reevaluation written by Francisco M?rquez Villanueva in 1984 is ?Erasmo y Cervantes, una vez m?s.? 3 heterocosm...). The distance from Mainz, Germany was also a factor in how rapidly the printing technology spread, and since Toledo is 1,600 kilometers away, the establishment and growth of the printing industry arrived in Spain later than it did in other important cities...

McGraw, Mark David

2013-07-09T23:59:59.000Z

130

BY EWEN CALLAWAY he iconic status of Archaeopteryx, the  

E-Print Network [OSTI]

up in limestone quarries in Bavaria, southern Germany, in the early 1860s. Until recently, they were

Napp, Nils

131

A Cool Roof for the Iconic Cyclotron | Department of Energy  

Office of Environmental Management (EM)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergy Cooperation |South Valley ResponsibleSubmissionof Energy 5ofA Boost forA ConversationA

132

Bill Sergeant … An icon of Oak Ridge Security  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr MayAtmospheric Optical Depth (AOD)ProductssondeadjustsondeadjustAboutScienceCareers Apply for aCould Work asAdministration BillBillBill

133

AJ\\EC 1005, 1006 I;CON 2005, 2006  

E-Print Network [OSTI]

Analysis :l FST 4524 Food Quality Assurance (WI) 3 FST 4604 Food Microbiology 4 MGT 3304 Administrative standing, cr~tlil by examination. and freshman rule hours). students must have passed at least 12 semester, advanced placement. advanced standing. credit by examination, and freshman rule hours). students must: a

Virginia Tech

134

75Radiation Dose and Distance This iconic photo was  

E-Print Network [OSTI]

on March 15, a few days after the Japan 2011 earthquake, which caused severe damage to the Fukushima Press/Kyodo News) The devastating Japan 2011 earthquake damaged the nuclear reactors in Fukushima, which: Date Distance (km) Location Dose Rate (microSeiverts/hr) March 15 1 km Fukushima #2 plant 8,200 March

135

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

136

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

137

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

138

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

139

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

140

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

142

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

143

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

144

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schfer, Eberhard

145

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

146

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

147

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

148

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

149

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

150

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

151

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

152

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

153

Private Narratives and Infant Views: Iconizing 1970s Militancy in Contemporary Argentine Cinema  

E-Print Network [OSTI]

construction based on an original representation of militancy (Ranzani, 2012; Prez Zabala, 2012; Feinmann, 2012; Kairuz, 2012).3 2 The Movimiento Peronista Montonero was formed around 1970... was (at least partially) false. For further information on Montoneros, see Donatello, 2010; Gelman, 1987; Gillespie, 1998; Giussiani, 2011; Moyano, 1995; Vezzeti, 2002 and 2009. 3 There are also some readings that do not focus on the representation...

Garibotto, Veró nica

2015-01-01T23:59:59.000Z

154

The ICoN integrated communication and navigation protocol for underwater acoustic networks  

E-Print Network [OSTI]

The deployment of autonomous underwater devices has increased dramatically in the last several years, presenting a strong and growing need for a network protocol to mediate acoustic communications between devices. This ...

Kanthan, Rupesh R

2005-01-01T23:59:59.000Z

155

Why Do Robots Rebel? The Labor History of a Cultural Icon  

E-Print Network [OSTI]

images. And Roland Marchand, in his studies of AmericanPress, 1998); Roland Marchand, Creating the Corporate SoulPress, 1998; Roland Marchand, Advertising the American

Higbie, Tobias

2012-01-01T23:59:59.000Z

156

Il Regno del Quasi. Icone cinesi nelle rappresentazioni partenopee di Ermanno Rea e Roberto Saviano  

E-Print Network [OSTI]

lavvallo dello stesso governo, pienamente consapevole delleFu]. E mi spieg che il governo di Pechino, per queste cose,

Fulginiti, Valentina

2012-01-01T23:59:59.000Z

157

Il Regno del Quasi. Icone cinesi nelle rappresentazioni partenopee di Ermanno Rea e Roberto Saviano  

E-Print Network [OSTI]

York: Routledge, 2007. Parise, Goffredo. Cara Cina. Milano:la posizione di Goffredo Parise, secondo Loreto di Nucci (indalla testimonianza di Goffredo Parise (Cara Cina, 1967),

Fulginiti, Valentina

2012-01-01T23:59:59.000Z

158

Becoming Joaquin Murrieta: John Rollin Ridge and the Making of an Icon  

E-Print Network [OSTI]

Californias Confederate Cherokee. The Californians. 8.4 (Books, 1999. Print. ---. The Cherokee Nation: A History.Everett and Gaston Litton. Cherokee Cavaliers: Forty Years

Hausman, Blake Michael

2011-01-01T23:59:59.000Z

159

The New York Yankees as an American Cultural Icon, 1940-1970  

E-Print Network [OSTI]

The New York Yankees baseball club, arguably the United States' most successful and well-known sports franchise, have acquired many cultural connotations over the years, meanings transcending the immediate world of on-field sporting contest...

Bishop, William

2014-05-31T23:59:59.000Z

160

iCons students work on science problems that capture their interest and prepare them for  

E-Print Network [OSTI]

studies, laboratory work, and research, center on societal problems including biomedicine, renewable energy, climate change, and clean water, all areas of research excellence at UMass Amherst. The first Auerbach. The program caught the attention of faculty members from the Swiss Federal Institute

Auerbach, Scott M.

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

NQA-1 Requirements for Commercial Grade Item Acceptance: ICONE20-54738  

SciTech Connect (OSTI)

Objectives are: (1) Present the DOE Chemistry and Metallurgy Research Replacement (CMRR) Project Commercial Grade Item (CGI) Dedication Process; and (2) Present CMRR Project CGI Lessons-Learned.

Van Valkenburg, Taunia S. [Los Alamos National Laboratory; Holmes, Richard A. [Los Alamos National Laboratory; Tepley, Daniel J. [Los Alamos National Laboratory; Sandquist, Gary [APPLIED SCIENCE PROFESSIONALS

2012-07-19T23:59:59.000Z

162

EcoCAR 3: Collegiate Teams to Pump up Fuel Efficiency of Iconic...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

State University University of Washington University of Waterloo Wayne State University West Virginia University For more on EcoCAR 3, read this Vehicle Technologies Office...

163

Without measure : Marions apophatic-virtue phenomenology of iconic love.  

E-Print Network [OSTI]

??I investigate Jean-Luc Marion's phenomenology of love and its relation to ethics. I argue that his phenomenology of love provides a possibility for developing ethics. (more)

Antoninka, Amy.

2009-01-01T23:59:59.000Z

164

Il Regno del Quasi. Icone cinesi nelle rappresentazioni partenopee di Ermanno Rea e Roberto Saviano  

E-Print Network [OSTI]

i suoi lettori per le fogne di Parigi. Rey Chow, Primitiveda due innamorati a Parigi, ma anche di fenomeni pi

Fulginiti, Valentina

2012-01-01T23:59:59.000Z

165

Becoming Joaquin Murrieta: John Rollin Ridge and the Making of an Icon  

E-Print Network [OSTI]

as a wedding or a birth certificate. Neruda acknowledges hiscantata but a birth certificate. Neruda wryly declaresClerk: what about a birth certificate? Three-Fingers: Never

Hausman, Blake Michael

2011-01-01T23:59:59.000Z

166

Civil War Icon Becomes National Clean Energy Model | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up fromDepartmentTieCelebrate Earth DayFuels ChemicalChrisCincinnatinear2011 |CityC C

167

Inductive Generation of Icon Trees in Foveated Multi-Resolution Recognition  

E-Print Network [OSTI]

Brugnot,S. Siebert,J.P. Cowan,C.W. IEE Seventh International Conference on Image Processing and Its Applications, Manchester, UK. Vol. 465 pp 275-279

Brugnot, S.

168

Iconic author Edward Abbey focus of Earth Day lecture April 22  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May JunDatastreamsmmcrcalgovInstrumentsruc DocumentationP-SeriesFlickr FlickrGuidedCH2MLLCBasicsScience atIan Smith smit306 PrimaryEdward

169

EcoCAR 3: Collegiate Teams to Pump up Fuel Efficiency of Iconic American  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana.Program - LibbyofThisStatement Tuesday, SeptemberofEbony MeeksMuscle Car |

170

Learning and Identifying Haptic Icons under Workload Technical Report TR-2004-15  

E-Print Network [OSTI]

interface designers. Force feedback plays a direct role in many virtual and teleoperated environments; e, but without their intrusiveness. Auto manufacturers have begun introducing haptics into vehicle cockpits: BMW

MacLean, Karon

171

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

172

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

173

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

174

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

175

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5GCGCGCCCATGGGCCCTGCCACCACCCGA3 (forward primer with NcoI restriction site), 5GCGCGCCATATGCCTGCCACCACCCGAGGG3 (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

176

New sciences program, iCons, stresses problem solving By: Alyssa Creamer | September 13, 2010 | ShareThis  

E-Print Network [OSTI]

or renewable energy, and the concentration will be recognized as a certification in the students' chosen field, renewable energy, clean water and climate change. "We picked these four topics," Auerback said. "Because to be able to take the course in the spring because it was our creation and it was us kids that made

Auerbach, Scott M.

177

Coordination-Chemistry Control of Proton Conductivity in the Iconic Metal-Organic Framework Material HKUST-1  

E-Print Network [OSTI]

. As shown below, we find that this approach can increase proton conductivity by close to 2 orders of magnitude. While any of several MOFs featuring open coordination sites3c,14 should be capable constructed from paddlewheel-coordinated (CuII )2 nodes and 1,3,5-benzenetricarboxylate (BTC) linkers15 (Chart

178

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

179

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

180

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Topographic and Air-Photo Lineaments in Various Locations Related to Geothermal Exploration in Colorado  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

These shapefiles was constructed as an aid to geothermal exploration in preparation for a site visit for field checking. We make no claims as to the existence of the lineaments, their location, orientation, and/or nature.

Zehner, Richard

182

16 au Spring 2012 esri.com Areas of concern defined by ZIP Code Water quality monitoring station and hydro buffers  

E-Print Network [OSTI]

on implementing best management practices on livestock farms and mitigating failing septic systems. [Nonpoint landowners whose land-use practices might be contributing to the impair- ment of water bodies in the Catawba and are generally carried off the land by storm water. According to the EPA, a TMDL "is the amount of a single

Short, Daniel

183

The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta.zip. Please provide feedback or  

E-Print Network [OSTI]

1 The Excel model for Beta testing is available for download at http://www.ornl.gov/HTSC/pdf/HTSMarketBeta

184

Codes for the fast SSS QR eigens  

E-Print Network [OSTI]

Fortran 90 codes (zip file); Matlab codes (zip file). Please email. A fast O(n^2) time QR eigensolver for companion matrices/polynomials. Fortran 90 codes (zip...

185

Climate Change Impacts in the United States INFORMATION DRAWN FROM THIS CHAPTER IS INCLUDED IN THE HIGHLIGHTS REPORT AND IS IDENTIFIED BY THIS ICON  

E-Print Network [OSTI]

, is projected to reduce this rate of forest CO2 uptake. 3. Bioenergy could emerge as a new market for wood, globalization of forestry markets, emerging markets for bioenergy, and U.S. climate change policy. FORESTS7 near or in the woods. In rural areas, market factors drive land uses among commercial forestry and land

186

Efficacy of ICON(R) Maxx in the laboratory and against insecticide-resistant Anopheles gambiae in central Cote d'Ivoire  

E-Print Network [OSTI]

Kisumu strain established at IPR for each of the two nettingthe Institut Pierre Richet (IPR) in Bouak, central Cte dtransferred to the laboratory of IPR and identified to the

2012-01-01T23:59:59.000Z

187

Climate Change Impacts in the United States INFORMATION DRAWN FROM THIS CHAPTER IS INCLUDED IN THE HIGHLIGHTS REPORT AND IS IDENTIFIED BY THIS ICON  

E-Print Network [OSTI]

for infrastructure, placing additional stresses on ecosystems. Land-based energy exploration will be affected Climate Assessment, J. M. Melillo, Terese (T.C.) Richmond, and G. W. Yohe, Eds., U.S. Global Change, Huntington Consulting Carl Markon, U.S. Geological Survey Molly McCammon, Alaska Ocean Observing System A

Ickert-Bond, Steffi

188

Ground Magnetic Data for west-central Colorado  

SciTech Connect (OSTI)

Ground Magnetic Data for west-central Colorado Modeled ground magnetic data was extracted from the Pan American Center for Earth and Environmental Studies database at http://irpsrvgis08.utep.edu/viewers/Flex/GravityMagnetic/GravityMagnetic_CyberShare/ on 2/29/2012. The downloaded text file was then imported into an Excel spreadsheet. This spreadsheet data was converted into an ESRI point shapefile in UTM Zone 13 NAD27 projection, showing location and magnetic field strength in nano-Teslas. This point shapefile was then interpolated to an ESRI grid using an inverse-distance weighting method, using ESRI Spatial Analyst. The grid was used to create a contour map of magnetic field strength. This dataset includes the raw spreadsheet data, an ESRI point shapefile showing magnetic sample locations and magnetic field strength, and an ESRI line shapefile showing magnetic contours. Projection: UTM Zone 13 NAD27 Magnetic Contour Shapefile Extent: West -108.698836 East -105.283977 North 41.048206 South 36.950086 Magnetic Point Shapefile Extent: West -108.698832 East -105.283908 North 41.048142 South 36.950086

Zehner, Richard

2012-03-08T23:59:59.000Z

189

Microsoft Word - VIPERS instructions.doc  

Office of Environmental Management (EM)

Name Number Recipient Information Number Fill in if applicable and Street and Street City, State Recipient Information City, State and ZIP Code and ZIP Code 11. COMPUTATION OF...

190

DOE PAGES Beta Flyer | OSTI, US Dept of Energy, Office of Scientific...  

Office of Scientific and Technical Information (OSTI)

Flyer Document Files and References Available Downloads for this Document: applicationpdf icon Flyer...

191

DOE PAGES Beta Fact Card | OSTI, US Dept of Energy, Office of...  

Office of Scientific and Technical Information (OSTI)

Fact Card Document Files and References Available Downloads for this Document: applicationpdf icon Fact Card...

192

Boise State University Human Resource Services Employee Information Form  

E-Print Network [OSTI]

: ____________________ State: ___ Zip: ______ Home Phone: _________________Work Phone: _________________ Cell Phone: ____________________________________ Relationship__________________________ Home Phone: _________________Work Phone: _________________ Cell Phone

Barrash, Warren

193

Geologic Map and Cross Sections of the McGinness Hills Geothermal Area - GIS Data  

SciTech Connect (OSTI)

Geologic map data in shapefile format that includes faults, unit contacts, unit polygons, attitudes of strata and faults, and surficial geothermal features. 5 cross?sections in Adobe Illustrator format. Comprehensive catalogue of drill?hole data in spreadsheet, shapefile, and Geosoft database formats. Includes XYZ locations of well heads, year drilled, type of well, operator, total depths, well path data (deviations), lithology logs, and temperature data. 3D model constructed with EarthVision using geologic map data, cross?sections, drill?hole data, and geophysics.

Faulds, James E.

2013-12-31T23:59:59.000Z

194

Geologic Map and Cross Sections of the McGinness Hills Geothermal Area - GIS Data  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

Geologic map data in shapefile format that includes faults, unit contacts, unit polygons, attitudes of strata and faults, and surficial geothermal features. 5 cross?sections in Adobe Illustrator format. Comprehensive catalogue of drill?hole data in spreadsheet, shapefile, and Geosoft database formats. Includes XYZ locations of well heads, year drilled, type of well, operator, total depths, well path data (deviations), lithology logs, and temperature data. 3D model constructed with EarthVision using geologic map data, cross?sections, drill?hole data, and geophysics.

Faulds, James E.

195

aluminum pressure vessels: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

angular region on the surface Stokes, Yvonne 204 iCons, 2011 Alzheimers and Aluminum: Lesson Plan Chemistry Websites Summary: iCons, 2011 Alzheimers and Aluminum: Lesson Plan...

196

Using value stream mapping to improve forging processes  

E-Print Network [OSTI]

Value stream mapping is a technique that uses icons to map the flow of product through a manufacturing system. These icons are aided by summary statistics to further detail the specific manufacturing system. The value ...

King, Stephen G. (Stephen George), 1974-

2004-01-01T23:59:59.000Z

197

Monthly '3-way' Reconciliation Procedures Note: This reconciliation process must be completed on a monthly basis. All '3-way reconciliation' with  

E-Print Network [OSTI]

the date on the receipt o Initial next to where you dated. **Suggested best practice: The next day after; hit the 'drill' icon; hit 'magnifier' icon; · Put in Orgn# in the right side spot then hit 'Go

Fernandez, Eduardo

198

How to Use SIFT Vectors to Analyze an Image with Database Templates  

E-Print Network [OSTI]

. For example, a brand icon will appear on a large number of images in database. Thus, if the input image contains a single product with this brand icon, all the database images having this icon will be foundHow to Use SIFT Vectors to Analyze an Image with Database Templates Adrien Auclair1 , Laurent Cohen

Cohen, Laurent

199

Admissions Checklist for Degree Seeking U.S. Resident Aliens You can save a filled copy of this form on your computer by clicking on the icon on your browser.  

E-Print Network [OSTI]

Admissions Checklist for Degree Seeking U.S. Resident Aliens You can save a filled copy as quickly as possible to ensure timely processing. 5. [ ] Documentation verifying U.S. Resident Alien

Texas at Arlington, University of

200

Honors Program Parent Society MEMBERSHIP INFORMATION  

E-Print Network [OSTI]

: State: Zip: Home Phone: Business Phone: Cell Phone: Email: Name of Business: UGAAlum: Yes No Graduation 30602 Parent/Guardian Name: Home Address: City: State: Zip: Home Phone: Business Phone: Cell Phone

Arnold, Jonathan

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

E-Print Network 3.0 - addressing medical coding Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summer Camp Registration Form Child's Name Date of Birth Sex Summary: Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information... 's...

202

[ Enter captions text ] THURSDAY, AUGUST 26, 2010.  

E-Print Network [OSTI]

MARIA AND WE HAVE ZIP CAR ON CAMPUS. A CAR SHARING PROGRAM. WE HAVE AN ESCORT VAN THAT RUNS, ISSUES AROUND CAMPUS TO ZIP CAR, TRANSIT. ANYTHING ALTERNATIVE TRANSPORTATION. >> THAT'S YOUR THING

Sze, Lawrence

203

The University of Utah Alumni Association Young Alumni  

E-Print Network [OSTI]

________________________________________________________________ Cell Phone __________________ Work Phone _____________________________________ Address ___________________________________________________________________________ Address _________________________________________________________________________ City State Zip Cell Phone ___________________ Work Phone _________________ Work FAX _______________ Home Phone

204

SOLARPERMIT.ORG  

Energy Science and Technology Software Center (OSTI)

003183WKSTN00 The National Solar Permitting Database https://github.com/solarpermit/solarpermit/archive/devel.zip

205

Title: Ontario Wind Power Allocation Ontario Ministry of Natural Resources  

E-Print Network [OSTI]

Title: Ontario Wind Power Allocation Data Creator / Copyright Owner: Ontario Ministry of Natural/A Updates: N/A Abstract: This data consists of a polygon shapefile, Wind Power Allocation Block. A Wind Power Allocation Block is an area that could be allocated for the exploration of wind power generation

206

Book Review: Arc Marine -GIS For A Blue Planet on 22-09-2007 10:44  

E-Print Network [OSTI]

and different types of sensors used to monitor and study oceans. The term marine in this book refers to deep commonly associated with ArcGIS. Unlike the shapefile, the geodatabase is much more robust in terms chapter, Search powered by About Contact Us Advertise Archives HOME NEWS ARTICLES DIALOGUE EVENTS V1 BLOGS

Wright, Dawn Jeannine

207

Z:\\gis553s12\\lab5\\demo\\grid2poly.py Wednesday, January 18, 2012 4:49 PM # Create a square quadrat (polygon) dataset based on the input feature class.  

E-Print Network [OSTI]

(polygon) dataset based on the input feature class. # The output polygon dataset cover all of the input where your point dataset is stored." print "2. The NAME of your point dataset." print "3. The SIZE, one_input("Enter the name of your point dataset (include .shp if a shapefile): ") quadrat = raw_input("Enter the size

Hung, I-Kuai

208

Z:\\gis553_lab\\lab5\\grid2poly.py Tuesday, February 18, 2014 8:30 PM # Create a square quadrat (polygon) dataset based on the input feature class.  

E-Print Network [OSTI]

(polygon) dataset based on the input feature class. # The output polygon dataset covers all of the input where your point dataset is stored. " print "2. The NAME of your point dataset." print "3. The SIZE, one = raw_input("Enter the name of your point dataset (include .shp if a shapefile):") quadrat = raw

Hung, I-Kuai

209

Soda Lake Well Lithology Data and Geologic Cross-Sections  

SciTech Connect (OSTI)

Comprehensive catalogue of drill?hole data in spreadsheet, shapefile, and Geosoft database formats. Includes XYZ locations of well heads, year drilled, type of well, operator, total depths, well path data (deviations), lithology logs, and temperature data. Plus, 13 cross?sections in Adobe Illustrator format.

Faulds, James E.

2013-12-31T23:59:59.000Z

210

Appendix H Colorado Statewide Forest Resource Assessment Urban Influence Areas  

E-Print Network [OSTI]

1 Appendix H ­ Colorado Statewide Forest Resource Assessment Urban Influence Areas Overview of the Urban and Community Forestry Layer 1. Start with Night Lights data and clip to Colorado Boundary code = 11020). a. Create a new shapefile called UrbanInfluenceAreas_withCapacity.shp. b. Add fields

211

Title: Gridded Population of World and Global Rural-Urban Mapping Project Data Creator /  

E-Print Network [OSTI]

Title: Gridded Population of World and Global Rural-Urban Mapping Project Data Creator / Copyright Data Format: BIL, ASCII, Grid, Shapefile, CSV, XLS, E00 Datum / Map Projection: N/A Resolution: N Science Information Network (CIESIN). "Gridded Population of World and Global Rural-Urban Mapping Project

212

UCR 05/2013 Washington Academic Internship Program  

E-Print Network [OSTI]

: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if: Address: City: State: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 05/2013 Do you different from above): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship

213

AQUATIC PLANT CONTROL RESEARCH PROGRAM  

E-Print Network [OSTI]

. Michael Smart, John W. Barko Environmental Laboratory DEPARTMENT OF THE ARMY Waterways Experiment. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and ZIP Code) PO Box 631 Vicksburg, MS NUMBER ORGANIZATION (If IIPplicable) US Army Corps of Engineers 8c. ADDRESS (City, State, and ZIP Code

US Army Corps of Engineers

214

Topographic and Air-Photo Lineaments in Various Locations Related to Geothermal Exploration in Colorado  

SciTech Connect (OSTI)

Title: Topographic and Air-Photo Lineaments in Various Locations Related to Geothermal Exploration in Colorado Tags: Colorado, lineaments, air-photo, geothermal Summary: These line shapefiles trace apparent topographic and air-photo lineaments in various counties in Colorado. It was made in order to identify possible fault and fracture systems that might be conduits for geothermal fluids, as part of a DOE reconnaissance geothermal exploration program. Description: Geothermal fluids commonly utilize fault and fractures in competent rocks as conduits for fluid flow. Geothermal exploration involves finding areas of high near-surface temperature gradients, along with a suitable plumbing system that can provide the necessary permeability. Geothermal power plants can sometimes be built where temperature and flow rates are high. This line shapefile is an attempt to use desktop GIS to delineate possible faults and fracture orientations and locations in highly prospective areas prior to an initial site visit. Geochemical sampling and geologic mapping could then be centered around these possible faults and fractures. To do this, georeferenced topographic maps and aerial photographs were utilized in an existing GIS, using ESRI ArcMap 10.0 software. The USA_Topo_Maps and World_Imagery map layers were chosen from the GIS Server at server.arcgisonline.com, using a UTM Zone 13 NAD27 projection. This line shapefile was then constructed over that which appeared to be through-going structural lineaments in both the aerial photographs and topographic layers, taking care to avoid manmade features such as roads, fence lines, and utility right-of-ways. Still, it is unknown what actual features these lineaments, if they exist, represent. Although the shapefiles are arranged by county, not all areas within any county have been examined for lineaments. Work was focused on either satellite thermal infrared anomalies, known hot springs or wells, or other evidence of geothermal systems. Finally, lineaments may be displaced somewhat from their actual location, due to such factors as shadow effects with low sun angles in the aerial photographs. Projection Information: UTM Zone 13 NAD 27 projection Credits: These lineament shapefile was created by Geothermal Development Associates, as part of a geothermal geologic reconnaissance performed by Flint Geothermal, LLC, of Denver Colorado. Funding was provided in part by DOE Grant DE-EEE0002828. Use Limitation These shapefiles was constructed as an aid to geothermal exploration in preparation for a site visit for field checking. We make no claims as to the existence of the lineaments, their location, orientation, and/or nature.

Zehner, Richard

2012-02-01T23:59:59.000Z

215

E-Print Network 3.0 - andre sp brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de So Paulo Collection: Mathematics 68 REGISTRATION NOW OPEN 6th Frontiers in Bioenergy Summary: ), Purdue University Dr. Andr Nassar, CEO of ICONE, SP, Brazil Dr....

216

Working with Advertisements: From Functional Grammar to Cooperative Communication by Adriana Vizental. Arad: University Press, 2008, 324 pp.  

E-Print Network [OSTI]

iconicity of letters and brand images, with detailed Issuesand image. It begins with a functional perspective on the basic advertising sentence of the brand

Pop, Anisoara

2008-01-01T23:59:59.000Z

217

STI_Announcement _Web_Services_Manual_2.0.pdf | OSTI, US Dept...  

Office of Scientific and Technical Information (OSTI)

STIAnnouncement WebServicesManual2.0.pdf Document Info Available Downloads for this Document: applicationpdf icon STIAnnouncement WebServicesManual2.00...

218

Stoner LBNL's AN 241 1 Web Service Experience.pdf | OSTI, US...  

Office of Scientific and Technical Information (OSTI)

Stoner LBNL's AN 241 1 Web Service Experience.pdf Document Description Document Info Available Downloads for this Document: applicationpdf icon Stoner LBNL's AN 241 1 Web Service...

219

Integration of stream and watershed data for hydrologic modeling  

E-Print Network [OSTI]

-resolution datasets are required, vector datasets have an advantage because they would present the same amount of information that raster would, but the vector file size increase is not as significant as that of raster. The evolution of DEMs suggests... can also be attributed with non-spatial information. Only features of one shape type can be collected together for storage. These storage types can be classified as file- based storage (e.g. shapefiles and coverages) or DBMS (Database Management...

Koka, Srikanth

2004-09-30T23:59:59.000Z

220

Name * First Last Address Street Address Address Line 2 City State ...  

E-Print Network [OSTI]

Name * First Last; Address. Street Address Address Line 2. City State / Province / Region Postal / Zip Code. United States, United Kingdom, Australia, Canada...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Encore Energy Systems formerly Energy Vision International formerly...  

Open Energy Info (EERE)

Oxford, Massachusetts Zip: 38655 Sector: Geothermal energy Product: Provider geothermal heat pumps primarily for heating and air conditioning. Coordinates: 43.781517,...

222

Institute of Chemical Engineering and High Temperature Chemical...  

Open Energy Info (EERE)

Chemical Processes ICEHT Jump to: navigation, search Name: Institute of Chemical Engineering and High Temperature Chemical Processes (ICEHT) Place: Hellas, Greece Zip:...

223

National Interest Security Company NISC Formerly Technology Management...  

Open Energy Info (EERE)

search Name: National Interest Security Company (NISC) (Formerly Technology & Management Services (TMS) Inc.) Place: Gaithersburg, Maryland Zip: 20879 Product: TMS provides...

224

Wind: wind power density GIS data at 50m above ground and 1km...  

Open Energy Info (EERE)

of Columns: 735Number of Rows: 949Pixel Resolution (m): 1000Data Type: integer Spatial Reference Information (End) ** Data and Resources Download DataZIP Download Data...

225

E-Print Network 3.0 - aldrich death rode Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Spruce Street City, State, Zip... (S) Wear self-contained breathing apparatus, rubber boots, and heavy rubber gloves. ALDRICH - B85927 ... Source: Choi, Kyu Yong - Department of...

226

Institute of Photo Electronic Thin Film Devices and Technology...  

Open Energy Info (EERE)

Technology of Nankai University Place: Tianjin Municipality, China Zip: 300071 Sector: Solar Product: A thin-film solar cell research institute in China. References: Institute...

227

E-Print Network 3.0 - american industry classification Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

... Source: Knuth, Kevin H. - Department of Physics, State University of New York at Albany Collection: Physics 22 City Zip 98104 Industry description (e.g., Manufacture of motor...

228

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Minneapolis, Minnesota Reference Buildings by Climate Zone and Representative City: 6A Minneapolis, Minnesota In addition to the ZIP file for each building type, you can directly...

229

E-Print Network 3.0 - acute abdomen pt Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PHYSICIAN'S PERSONAL COPY TO: STREET CITY ZIP Summary: % BILIRUBIN mg% RBC HOSPITAL TUBE STATION 31 Platelet Count: INR: PT: PTT: 12;GASTRO INTESTINAL ANGIOGRAPHIC... CONTRAST)...

230

Cape Peninsula University of Technology - Centre for Distributed...  

Open Energy Info (EERE)

Peninsula University of Technology Address: Symphony way, Bellville Place: Cape Town, South Africa Zip: 7535 Region: Western cape Number of Employees: 11-50 Year Founded: 2004...

231

THE JOHNS HOPKINS UNIVERSITY School of Nursing  

E-Print Network [OSTI]

: (__ __ __) __ __ __ - __ __ __ __ 8. Cell Phone: (__ __ __) __ __ __ - __ __ __ __ 9. Emergency Phone: ______________________________________________________________________ If Maryland address, County name______________________ Street City State Zip Code 5. Local Phone: (__ __ __) __ __ __ - __ __ __ __ 6. Permanent Phone: (__ __ __) __ __ __ - __ __ __ __ 7. Work Phone

Connor, Ed

232

CSUF CHILDREN'S CENTER SUMMER SESSION 2014 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

233

Furman Graduate Studies Registration Form Spring 2014 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

234

Furman Graduate Studies Registration Form 2013 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

235

Hot Topics | Photosynthetic Antenna Research Center  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

taught * Home Address Address * City * State * Zip Code * Home Phone * Work Phone * Cell Phone * Work Email * Home Email * Would you like to receive School Partnership news...

236

Furman Graduate Studies Registration Form 2012 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone ___________________________________ Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone: (864) 294

237

FLORIDA ATLANTIC UNIVERSITY OFFICE OF INTERNATIONAL PROGRAMS  

E-Print Network [OSTI]

: ____________________________ Alt. Email: _______________________________ Cell phone number: ___________________ Home phone number State Zip code Cell phone number: ___________________ Office phone number: _____________________ Home: ________________________________________________________ Z number: _________________________ Office phone number: _______________________ Email

Fernandez, Eduardo

238

CSUF CHILDREN'S CENTER SUMMER SESSION 2013 ENROLLMENT APPLICATION  

E-Print Network [OSTI]

#________________________Work Phone______/_______________Cell Phone______/__________________ Email (print clearly #______________________Work Phone_______/________________Cell Phone______/_________________ Email (print clearly:__________________________________________________________________________________________ City_________________________________ Zip___________ Home Phone: _______/_______________________ Parent

de Lijser, Peter

239

Participant Medical Record Ocean Classroom Foundation  

E-Print Network [OSTI]

____________________________ Day phone (_____)________________ Evening phone (_____)________________ Cell phone/State/Zip __________________________________________________________ Day phone ____________________________________ Evening phone _____________________________ Cell ____________________________________ Evening phone _____________________________ Cell/other phone _________________________ Email

Pontius Jr., Duane H.

240

Furman Graduate Studies Registration Form Spring 2015 Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Furman Graduate Studies Registration Form 2014 Fall Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone) Financial Aid Furman University Office of Graduate Studies 3300 Poinsett Highway Greenville, SC 29613 Phone

242

Indian Ministry of New and Renewable Energy formerly Ministry...  

Open Energy Info (EERE)

Renewable Energy (formerly Ministry of Non-Conventional Energy Sources) Place: New Delhi, India Zip: 110 003 Product: Involved in policy making, planning, programme formulation and...

243

E-Print Network 3.0 - assembly competent proteins Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Paper 2270 Summary: A. Voelz and Ken A. Dill, "Exploring zipping and assembly as a protein folding principle" (2007... :repositories.cdlib.orgpostprints2270 12;Exploring...

244

Hawaii Department of Land and Natural Resources Commission on...  

Open Energy Info (EERE)

Hawaii Department of Land and Natural Resources Commission on Water Resource Management Address: Kalanimoku Building 1151 Punchbowl Street Room 227 Place: Honolulu, Hawaii Zip:...

245

Hawaii Department of Land and Natural Resources Division of Forestry...  

Open Energy Info (EERE)

Name: Hawaii Department of Land and Natural Resources Division of Forestry and Wildlife Address: Kalanimoku Building 1151 Punchbowl St., Room 325 Place: Honolulu, Hawaii Zip:...

247

Tss4U BV formerly Holecsol R S Renewable Energy Systems and Shell...  

Open Energy Info (EERE)

Holecsol, R&S Renewable Energy Systems and Shell Solar Energy) Place: Veldhoven, Netherlands Zip: 5503 Sector: Solar, Wind energy Product: Provides small solar and wind for...

248

african higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

counterfactual Danforth, Bryan Nicholas 134 Application for Higher Education Internship City: Zip Code Mathematics Websites Summary: Application for Higher Education Internship...

249

affect foreign bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

250

allied irish bank: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sciences Websites Summary: University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account...

251

affects higher education: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Mathematics Websites Summary: Application for Higher Education Internship Name: Address: City: Zip Code: Country: Phone Number: E supervising faculty? Name: E-mail: Phone Number:...

252

XRAY XRAY XRAY XRAY XRAY XRAY XRAY . DUKE UNIVERSITY HOSPITAL  

E-Print Network [OSTI]

of Birth Name __________________________________ City of Birth Address City _______________________________________________________________ City ____________________________________ State Zip Date of Birth _____________________________ Social _____________________________________________________________________ Address Phone # _______________________ Certificate # (usually SS#) Group

253

E-Print Network 3.0 - attentional set shifting Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sample search results for: attentional set shifting Page: << < 1 2 3 4 5 > >> 1 Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along...

254

Wind: wind power density maps at 50m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Ghana. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Ghana. Data and Resources Download MapsZIP Download Maps More...

255

Wind: wind power density maps at 50 m above ground and 1km resolution...  

Open Energy Info (EERE)

density for Cuba. (Purpose):HTMLREMOVEDHTMLREMOVEDTo provide information on the wind resource potential in Cuba. Data and Resources Download MapsZIP Download Maps More...

256

Getting Started with MATLAB This guide is intended to quickly get you familiar with the way that MATLAB works. MATLAB has many  

E-Print Network [OSTI]

Getting Started with MATLAB This guide is intended to quickly get you familiar with the way that MATLAB works. MATLAB has many features that we cannot cover in a short guide, but the guide should information. To start MATLAB, you can double-click the icon on the desktop. If the icon is not there, you can

King, Chris

257

MATH 1503 Introduction to Linear Algebra Notes on MATLAB  

E-Print Network [OSTI]

1 MATH 1503 Introduction to Linear Algebra Notes on MATLAB MATLAB (`MATrix LABoratory as a programming language. MATLAB is available to UNB students on the University's Novell network ­ click on the `More Applications' icon, then click on the `MATLAB' icon. More than one release of MATLAB may

Monson, Barry

258

JOURNAL OF MICROELECTROMECHANICAL SYSTEMS, VOL. 21, NO. 2, APRIL 2012 497 Rapid Silicon-to-Steel Bonding by Induction  

E-Print Network [OSTI]

, thermocompressive diffusion bonding has been demonstrated for the bonding of sil- icon nitride to steel [1], [2-to-Steel Bonding by Induction Heating for MEMS Strain Sensors Brian D. Sosnowchik, Robert G. Azevedo, Member, IEEE and manufacturable technique to bond sil- icon to steel for microelectromechanical system (MEMS) sensor applications

Lin, Liwei

259

NatSci 390IH Team-oriented Lab Discovery in Renewable Energy Course Vision  

E-Print Network [OSTI]

NatSci 390IH ­ Team-oriented Lab Discovery in Renewable Energy [iCons 3E] Syllabus 3/13/2012 Course Vision This course involves student-driven, team-oriented laboratory projects focused on the interrelated by society. The iCons Energy Laboratory encompasses a four-week "energy bootcamp" followed by two

Auerbach, Scott M.

260

Building a Smarter Planet: 3 in a Series IBM, the IBM logo, ibm.com, Smarter Planet and the planet icon are trademarks of International Business Machines Corp., registered in many jurisdictions worldwide.A current list of IBM trademarks is available on th  

E-Print Network [OSTI]

, infusing our power grids, banking systems, retail supply chains and city streets with intelligence. Are we of the whole. Dallas-based electricity distributor Oncor has deployed a smart meter network that is also a more systems. And those systems are shared--and shaped--by businesses, cities, government agencies

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

IBM, the IBM logo, ibm.com, Smarter Planet and the planet icon are trademarks of International Business Machines Corp., registered in many jurisdictions worldwide. Other product and service names might be trademarks of IBM or other companies. A current li  

E-Print Network [OSTI]

.ibm.com/legal/copytrade.shtml. International Business Machines Corporation 2010. Welcome to the decade of smart. Building a Smarter Planet: 1, roadways, power grids, clothes, even natural systems such as agriculture and waterways. Trillions companies to cities. A year into this new era, the signs of a smarter planet are all around us. Smarter

262

Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

263

Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

264

Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

265

Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

266

Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

267

STUDENT / PARENT INFORMATION MAIL DELIVERY ON CAMPUS The information below provides the basic information you need to send and receive United States  

E-Print Network [OSTI]

West Street Address (if applicable) 522 Thurstin Ave. Bowling Green State University Bowling Green State University City, State and Zip Code Bowling Green, OH 43403-4603 Please note that BGSU has its own zip code, 43403, which is unique from the city of Bowling Green (43402). Please ensure to include

Moore, Paul A.

268

Reference Buildings by Building Type: Secondary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

269

Reference Buildings by Building Type: Primary school  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

270

Sandia Group Medicare Advantage Plan Enrollment Form Senior Advantage Health Plan Choices (Choose One)  

E-Print Network [OSTI]

Home Phone: Cell: E-Mail Address: Permanent Residence Address: City: State: Zip Code: County: Mailing Address (only if different from your Permanent Residence Address): City: State: Zip Code: County drug coverage, including other private insurance, TRI- CARE, Federal employee health benefits coverage

Fuerschbach, Phillip

271

2011 ODU Game Development Summer Camp Registration Form Child's Name Date of Birth Sex  

E-Print Network [OSTI]

Contacts Primary Emergency Contact Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work or Cell Phone Home Phone Work or Cell Phone Address Address City, ST ZIP Code City, ST ZIP Code Medical Information's/Guardian's Name Relationship ([ ]) ([ ]) ([ ]) ([ ]) Home Phone Work Phone Home Phone Work Phone Address Address

272

Finance Division Employee Status Form Finance Division  

E-Print Network [OSTI]

's Date: Employee Name: Home Address: City/State: Zip/Postal Code: Work Phone Home Phone: Cell Phone Phone: Work Phone: Cell Phone: Relationship: Name (2): Address: State/Province: Zip/Postal Code: Home Phone: Work Phone: Cell Phone: Relationship: Special Notes: Department New Employee Resignation Change

Crews, Stephen

273

University of Washington Transplant Services Rev. 5/23/02  

E-Print Network [OSTI]

.: City: State: Country: Zip Code: - Home Phone: Work Phone: Ext.: Cell Phone: Home Phone: Cell phone: Work Phone: DEMOGRAPHIC INFORMATION LIVING KIDNEY DONOR FORM #12;University to you: Street Address: Apt No: City, State, Zip: Home Phone: Cell phone: Work Phone: EMPLOYER Name

Borenstein, Elhanan

274

UCR 09/2014 Washington Academic Internship Program  

E-Print Network [OSTI]

: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: Permanent Address (if different from above: Zip: Home Phone: ( ) Cell Phone: ( ) Work Phone: ( ) Email: #12;UCR 09/2014 Do you currently receive): Address: City: State: Zip: Phone: ( ) Emergency Contact Info: Name: Relationship: Address: City: State

275

#~i;:~~.:(' . AQUATIC PLANT CONTROL  

E-Print Network [OSTI]

-4 EFFECTS OF WATER CHEMISTRY ON SUBMERSED AQUATIC PLANTS: A SYNTHESIS by R. Michael Smart Environmental. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City. State, and ZIP Code) 3909 Halls Ferry Road IDENTIFICATION NUMBER ORGANIZATION (If applicable) US Army Corps of Engineers Be. ADDRESS (City, Stitte

US Army Corps of Engineers

276

LES VOYAGEURS College of Agriculture Ambassadors  

E-Print Network [OSTI]

. - Uphold the policies outlined by the LSU Code of Student Conduct. - Make a commitment of time and energy area of study, questions regarding the transition into college life, campus activities, and other address City State Zip Local phone number Home phone number Home address City State Zip Country E

277

Note: The State Clearinghouse will assign identification numbers for all new projects. If a SCH number already exists for a project (e.g. Notice of Preparation or previous draft document) please fill in.  

E-Print Network [OSTI]

: City: Zip: County: Project Location: County: City/Nearest Community: Cross Streets: Zip Code: Longitude Waste Land Use Drainage/Absorption Population/Housing Balance Toxic/Hazardous Cumulative Effects For LCNG Fueling Facility California Energy Commission Donald Coe 1516 Ninth Street (916) 654

278

Reference Buildings by Building Type: Outpatient health care  

Broader source: Energy.gov [DOE]

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

279

Reference Buildings by Building Type: Hospital  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

280

Reference Buildings by Building Type: Full service restaurant  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Reference Buildings by Building Type: Large office  

Office of Energy Efficiency and Renewable Energy (EERE)

In addition to the ZIP file for each building type, you can directly view the "scorecard" spreadsheet that summarizes the inputs and results for each location. This Microsoft Excel spreadsheet is also included in the ZIP file. For version 1.4, only the IDF file is included.

282

Introduction to SAS Programming Registration Form  

E-Print Network [OSTI]

* Date of Birth Employer Job Title Work Address * Home Address City / State / Zip * City / State / Zip a certificate, you must complete at least 80% of the online quizzes and programming activities with scores of 70% or higher. Certificates of completion may take up to two weeks to process once your program has concluded

283

UPS, the UPS brandmark and the color brown are trademarks that are used with permission by the owner, United Parcel Service of America, Inc. All rights reserved. You may type directly into this form  

E-Print Network [OSTI]

UPS, the UPS brandmark and the color brown are trademarks that are used with permission VALUE Post / Zip Post / Zip UPS NEXT DAY AIR Most deliveries made by 10:30 a.m. UPS GROUND Delivery in 15 business days (in-state deliveries usually arrive next day) UPS WORLDWIDE SAVERSM Int'l Service

Jones, Michelle

284

A Second-Site Noncomplementation Screen for Modifiers of Rho1 Signaling during Imaginal Disc Morpogenesis in Drosophila  

E-Print Network [OSTI]

+/+ RhoGEF2 11-3b 21 31 (239) 25 75 (61) Rho1 E3.10 +/+ RhoGEF2 11-3b 21 20 (143) 25 20 (30) Rho1 k02107b +/+ RhoGEF2 11-3b 21 80 (5) 25 100 (9) Rho1 J3.8 +/+ RhoGEF2 11-3b 21 55 (62) 25 91 (22) Rho1 E(br)246 +/+ zip E(br) 21 50 (82) 25 66 (44) Rho1 E...(br)233 +/+ zip E(br) 21 20 (102) 25 66 (29) Rho1 E3.10 +/+ zip E(br) 21 ND 25 33 (12) Rho1 k02107b +/+ zip E(br) 21 ND 25 ND Rho1 J3.8 +/+ zip E(br) 21 95 (20) 25 97 (30) a Balanced, Rho heterozygous mutant virgin females were crossed to either w 1118...

Patch, Kistie; Stewart, Shannon; Welch, Aaron; Ward, Robert

2009-10-23T23:59:59.000Z

285

Physician Preference Cardiac Alert Modality system  

E-Print Network [OSTI]

and ~ The icon/connector The front panel specifies the user interface of the VI. The block diagram consists of the executable code that is created using nodes, terminals, and wires. With the icon/connector you can use a VI as a subVI in the block diagram... of another VI, A VI consists of an interactive user interface, a dataflow diagram that serves as the source code, and icon connections that allow the VI to be called from higher-level VIs. An application is created by starting at the top-level VI...

Borade, Pravin

2001-01-01T23:59:59.000Z

286

Approaches to fifteenth- and early sixteenth-century painting in Dalmatia  

E-Print Network [OSTI]

near Perast (in modern day Montenegro) was the work of Lovrothe old city of Bar in Montenegro, and a two-sided icon inScholars in Serbia and Montenegro ignored these arguments

Reed, Laurel Elizabeth

2009-01-01T23:59:59.000Z

287

LRRB Pavement Management Systems Pavement Management Systems  

E-Print Network [OSTI]

LRRB Pavement Management Systems Pavement Management Systems Presented by: Michael Marti SRF for implementing and monitoring research results (RIC) #12;LRRB Pavement Management Systems LRRB Structure LRRB Current Pavement Management System Used ICON (Goodpointe) Year of Pavement Management System

Minnesota, University of

288

Cute displays: Developing an Emotional Bond with Your Mobile Interface  

E-Print Network [OSTI]

affectionate perception of mobile technology increases userof the icon to mobile communication technology. This sectiontechnology invented, it might not be inaccurate to say that users can and do treat their mobile

Rousi, Rebekah

2009-01-01T23:59:59.000Z

289

H?Otel : a new model for integrating water systems and coastal architecture  

E-Print Network [OSTI]

During the Industrial Era, "dams, water towers, sewage systems, and the like were celebrated as glorious icons, carefully designed, ornamented, and prominently located in the city, testifying to the modern promise of ...

Brown, Danielle C. (Danielle Collinsworth)

2011-01-01T23:59:59.000Z

290

E-Print Network 3.0 - ancient buried valleys Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

marvel at the Step Pyramid of Zozer. Admire the iconic Pyramids... endless Valley of the Kings and Queens before embarking on a cruise of the Nile River. Continue... 's tomb and...

291

2011 Department at a Glance Points of Pride  

E-Print Network [OSTI]

.S. and international universities. I The department is a leader in developing iCons: integrated Concentration to underrepresented groups. I The Research Experience for Undergraduates (REU) program provides research opportunities

Schweik, Charles M.

292

Office of the Registrar How to Create a WhatIf Report 1) Go to my.BoiseState.edu.  

E-Print Network [OSTI]

course catalog' button to search for and select a course. Next, choose a term from the `Term' drop down menu and enter a grade by clicking the (spyglass) icon. #12;Office of the Registrar ­ How

Barrash, Warren

293

he Romberg Tiburon Center in Marin County is not an easy place to find. While running late and driving too  

E-Print Network [OSTI]

is complete as yellow sun rays blend with the rust-colored towers of the iconic Golden Gate Bridge. Dur- ing." Workers also wound some of the cables for the Golden Gate Bridge on the site, he says. Ferner's most

294

For Students Blackboard 9.1 Service Pack 9  

E-Print Network [OSTI]

allows the module to appear in a new browser window. The Collapse Icon minimizes the module, hiding, enter keyword"film"and choose the button"search entire catalog". Select"GO"for a list film-related Bb

Weston, Ken

295

Articulating the urban boundary : integrating Bogota with Los Cerros Orientales  

E-Print Network [OSTI]

Los Cerros Orientales, a ridge of mountains that spans the eastern edge of Bogota are the most iconic and monumental feature of the city. They were also critical in the city's history as they provided the resources to ...

Bernal, Juan Andres

2013-01-01T23:59:59.000Z

296

Personality Traits and User Behavior  

E-Print Network [OSTI]

and below the median value. This is illustrated in Fig. 9 below. 28 y = 0.0519x + 1.3563 R2 = 0.9743 y = 0.049x + 1.0474 R2 = 0.9811 1 2 3 4 5 6 7 8 0 12 24 36 48 60 72 84 96 108 120 132 Num Icons Se ar ch Ti m e (se co n ds... 2000;42(4):630-635. 37 APPENDIX A Icon Search Results SAS program PROC GLM; CLASS Animation Icons; MODEL Time = O C E A N Animation |Icons / noint solution; RUN; Table A.1 Results of SAS Program. The SAS System The GLM Procedure...

King, Christopher Ronald

2012-02-14T23:59:59.000Z

297

Happy Birthday DVU!  

Broader source: Energy.gov [DOE]

Please join us in celebrating the first birthday of the DOE Virtual University! In the past year, seven colleges have been stood up, numerous web pages have been created and a desktop icon has...

298

Loxahatchee Non-profit Sends Mobile Wildlife Laboratory to Island of Dominica  

E-Print Network [OSTI]

gear, veterinary supplies, and wildlife monitoring and surveillance equipment, and can support six Dominica. The national bird is revered as the icon of Dominica, adorning the nation's flag and coat

299

TEXTS OF EMPOWERMENT: A FUNCTIONAL RHETORICAL ANALYSIS OF MS. MAGAZINE IN THE FIRST FIVE YEARS  

E-Print Network [OSTI]

Ms. was the first mass mediated feminist magazine in the United States and has often been identified as an icon of the feminist movement. This study examines three rhetorical sites in the magazine during the first five ...

Partlow Lefevre, Sarah Taylor

2009-07-21T23:59:59.000Z

300

SOAJ | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SciTech Connection is a consolidation of two core DOE search engines, the Information Bridge and the Energy Citations Database. DDE150icon.png DOE Data Explorer Discover...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

George Beauchamp and the rise of the electric guitar up to 1939  

E-Print Network [OSTI]

This thesis examines the rise of the electric guitar in the United States arguably the most iconic and successful musical instrument of the 20th century and the role of George Beauchamp in its invention and development. ...

Hill, Matthew William

2014-06-27T23:59:59.000Z

302

CruzBuy Punch-out Access Issue-Firefox (23.0.1) Firefox Users Firefox has introduced a Mixed Content Blocker in version 23 which causes Firefox to block sites that  

E-Print Network [OSTI]

Content Blocker in version 23 which causes Firefox to block sites that contain mixed content, (ie to the address bar and click on the "shield" icon 2) From the drop-down menu, click on "Disable Protection

California at Santa Cruz, University of

303

iPortal and BI Training Classes  

Broader source: Energy.gov [DOE]

To register for a course, please click here to log into the iPortal. Once logged in, click on iPortal Training icon located on the left-hand side of the screen

304

Museum Fan Downloads  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ted Hall Atmospheric Testing icons Nevada Pacific, Pacific, Nevada Test Site Eniwetok Bikini Test Site Charlie Mike Bravo Hornet Charlie Mike Bravo Hornet Oct 30, '51 Oct 31, '52...

305

FACTSABOUT THE INTERNATIONAL COUNCIL ON NANOTECHNOLOGY To develop and communicate information regarding potential environmental and health risks of  

E-Print Network [OSTI]

. WORKING GROUPS Governance Environment, Health & Safety Knowledge Base Best Practices Communication information regarding potential environmental and health risks of nanotechnology, thereby fostering risk and Environmental Nanotechnology (CBEN) at Rice University in Houston, Texas. ICON is a technically

306

Driving Demand for Home Energy Improvements: Motivating residential customers to invest in comprehensive upgrades that eliminate energy waste, avoid high utility bills, and spur the economy  

E-Print Network [OSTI]

Conservation Corporation (WECC). The projects goal was toConservation Corporation (WECC was contracted to support theRESNET RFP RPV SMUD VCEM WECC ZIP Baltimore Neighborhood

Fuller, Merrian C.

2011-01-01T23:59:59.000Z

307

Matlab-Kinect Interface Code  

E-Print Network [OSTI]

This .zip file contains code and installation instructions for acquiring 3d arm movements in Matlab using the Microsoft Kinect 3d camera. The provided code has been validated in 32-bit and 64-bit Matlab with 32-bit and ...

Kowalski, Kevin

2012-06-01T23:59:59.000Z

308

GT Human Resources PERSONAL DATA FORM  

E-Print Network [OSTI]

GT Human Resources PERSONAL DATA FORM Page 1 Updated: 05/01/2014 Student Employee? Yes No Print clearly using black or blue ink. Personal Information Name) __________________________________________________________________________________________ (City) (State) (Zip) (County) Personal Telephone #: (_______)________-__________ GT Work Telephone

Jacobs, Laurence J.

309

E-Print Network 3.0 - approaches reveal splicing Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

RNA Structures... Structures at Mammalian Splice Sites Keywords: RNA secondary structure; looping-out; long-range; alternative... splicing; SF1; HNRNPK; ZFX; ZIP7; SLC39A7; ZNF384;...

310

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' Thursday, January 15, 2015  

E-Print Network [OSTI]

CONNECTICUT VEGETABLE & SMALL FRUIT GROWERS' CONFERENCE Thursday, January 15, 2015 Maneeley. Connecticut Vegetable & Small Fruit Growers' Conference (We need folks to pre-register so Maneeley's has:______________________________________ ---- Town:______________ State:_____ Zip:____________ ---- Check off: Vegetable grower ___ Fruit grower

Alpay, S. Pamir

311

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name  

E-Print Network [OSTI]

ACCOUNTS PAYABLE CHECK REQUEST FORM Vendor Name Remit to Address City State Zip Code SECTION 2 INSTRUCTIONS Use the link to view approved categories. Vendor Number (if known) DP Requester AP Entry Check

de Lijser, Peter

312

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

1A Miami, Florida Reference Buildings by Climate Zone and Representative City: 1A Miami, Florida In addition to the ZIP file for each building type, you can directly view the...

313

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Boulder, Colorado Reference Buildings by Climate Zone and Representative City: 5B Boulder, Colorado In addition to the ZIP file for each building type, you can directly view the...

314

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Chicago, Illinois Reference Buildings by Climate Zone and Representative City: 5A Chicago, Illinois In addition to the ZIP file for each building type, you can directly view the...

315

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Phoenix, Arizona Reference Buildings by Climate Zone and Representative City: 2B Phoenix, Arizona In addition to the ZIP file for each building type, you can directly view the...

316

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

7 Duluth, Minnesota Reference Buildings by Climate Zone and Representative City: 7 Duluth, Minnesota In addition to the ZIP file for each building type, you can directly view the...

317

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Baltimore, Maryland Reference Buildings by Climate Zone and Representative City: 4A Baltimore, Maryland In addition to the ZIP file for each building type, you can directly view...

318

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C Seattle, Washington Reference Buildings by Climate Zone and Representative City: 4C Seattle, Washington In addition to the ZIP file for each building type, you can directly view...

319

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Atlanta, Georgia Reference Buildings by Climate Zone and Representative City: 3A Atlanta, Georgia In addition to the ZIP file for each building type, you can directly view the...

320

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

8 Fairbanks, Alaska Reference Buildings by Climate Zone and Representative City: 8 Fairbanks, Alaska In addition to the ZIP file for each building type, you can directly view the...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Las Vegas, Nevada Reference Buildings by Climate Zone and Representative City: 3B Las Vegas, Nevada In addition to the ZIP file for each building type, you can directly view the...

322

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

A Houston, Texas Reference Buildings by Climate Zone and Representative City: 2A Houston, Texas In addition to the ZIP file for each building type, you can directly view the...

323

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Helena, Montana Reference Buildings by Climate Zone and Representative City: 6B Helena, Montana In addition to the ZIP file for each building type, you can directly view the...

324

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

C San Francisco, California Reference Buildings by Climate Zone and Representative City: 3C San Francisco, California In addition to the ZIP file for each building type, you can...

325

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Los Angeles, California Reference Buildings by Climate Zone and Representative City: 3B Los Angeles, California In addition to the ZIP file for each building type, you can...

326

APPLICATION FOR ADMISSION TO UNDECIDED-GRAD CLASSIFICATION For Office Use Only GRADUATE SCHOOL, WASHINGTON STATE UNIVERSITY  

E-Print Network [OSTI]

) (State) (Zip) (County if Washington) Gender M F Date of Birth Place of Birth Are you a citizen of the U State University: Fall (year) Spring (year) Summer (year) Location: Pullman Spokane Tri-Cities Vancouver

Collins, Gary S.

327

REQUEST FOR REENROLLMENT GRADUATE SCHOOL  

E-Print Network [OSTI]

-Mail Address Present address (Street) (City) (State) (Zip) (County if Washington) Telephone (Work) (Home 20 Location: Pullman Spokane Tri-Cities Vancouver Global Campus (On-line) I am stating

Collins, Gary S.

328

The Evolution of a Modular Software Network Miguel A. Fortuna  

E-Print Network [OSTI]

The Evolution of a Modular Software Network Miguel A. Fortuna , Juan A. Bonachela, and Simon A the website of this journal as a zip folder. To whom correspondence should be addressed. E-mail: fortuna

Fortuna, Miguel A.

329

U.S. DEPARTMENT OF ENERGY  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

YLARS 1 AM I'U*CHASQVO MY HOME BY ( )MORTGAGE () UND CONTRACT NAME ADDRESS CITY STATE ZIP PHONE (HOME )..... .. (CELL) (WORK). fF.ST TIME TO CALL ( 9 am to l pm) (I pm to S pm )...

330

Furman Graduate Studies Registration Form 2013 Spring Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

331

Furman Graduate Studies Registration Form 2013 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

332

PARENT INFORMATION FORM WWEELLCCOOMMEE PPRROOUUDD AANNTTEEAATTEERR PPAARREENNTTSS!!  

E-Print Network [OSTI]

: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status: Single Preferred Phone: Home / Business / Cell Home Phone: ( ) Cell Phone: ( ) Business Phone: ( ) Marital Status Last Relationship to Student: Language Spoken at Home: Address: Street City State Zip Preferred Phone

Barrett, Jeffrey A.

333

Child Information: Our Little Village  

E-Print Network [OSTI]

/State/Zip Parent Information: Student ID #: _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email _____________________ Parent Name _______________ Cell Phone ______________ Phone 2 ________________ email Insurance Information: Provider Provider Phone Policy Holder Policy

Escher, Christine

334

Schiefelbusch Hearing Clinic  

E-Print Network [OSTI]

_______ Zip_____________ E-Mail Cell Phone (____)_____________ Day Phone (____)_______________ Evening Phone to Jane Wegner by email at jwegner@ku.edu or by phone at 864-4690. Camper Information Camper Name

335

Furman Graduate Studies Registration Form 2014 Summer Term  

E-Print Network [OSTI]

_____________________ Work Phone _________________________ Cell Phone _______________________ Email address __________________________________________________________ City ___________________________________State ___________Zip ______________ Home Phone Highway Greenville, SC 29613 Phone: (864) 294-2213 email: grad.studies@furman.edu To register, complete

336

UT EID# __________ Student ID #: __________ AY: 20____ -20____ School: ____________________________ Grade: ________________  

E-Print Network [OSTI]

: ___________________________________________ _________________________________________________________ CITY STATE ZIP Home Phone: ___________________ Cell#: __________________ Student Email _________________ ______________ ___________ __________ Parent(1)/Guardian Address Home Phone # Work Phone # Primary Language _________________ ______________ ___________ __________ Parent(2)/Guardian Address Home Phone # Work Phone # Primary Language In case of an emergency, contact

Texas at Austin, University of

337

Trends in template/fragment-free protein structure prediction  

E-Print Network [OSTI]

1998) Pathways to a protein folding intermediate observed instudy of all-atom protein folding and structure predic-JD, Dill KA (2007) Protein folding by zipping and assembly.

Zhou, Yaoqi; Duan, Yong; Yang, Yuedong; Faraggi, Eshel; Lei, Hongxing

2011-01-01T23:59:59.000Z

338

T-612: False Positive Detection Generic.dx!yxk in DAT 6329 |...  

Broader source: Energy.gov (indexed) [DOE]

in sdatInstaller.zip. This can be deployed via a Group Policy if you have Active Directory as described below. Addthis Related Articles V-101: McAfee VirusScan Enterprise Lets...

339

arabidopsis bzip transcription: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

13 14 15 16 17 18 19 20 21 22 23 24 25 Next Page Last Page Topic Index 1 Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor Texas A&M University -...

340

University of New Hampshire Project SMART  

E-Print Network [OSTI]

University of New Hampshire Project SMART Student Application Form Summer Institute: July 2: ____________________ (Please include first, middle initial and last name) Home Address: _____________________________ City/Junior): _______ School Address: ______________________________ City, State, Zip Code: ____________________ List

New Hampshire, University of

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Covanta Energy Corporation formerly Ogden Martin Systems of Hillsborou...  

Open Energy Info (EERE)

Inc) Place: Fairfield, New Jersey Zip: 7004 Product: Owner and operator of modern waste-to-energy facilities (over 1GW). Coordinates: 47.38522, -117.171254 Show Map...

342

NORTHERN CHAPTER OF MICHIGAN SOCIETY OF PROFESSIONAL LAND SURVEYORS SCHOLARSHIP  

E-Print Network [OSTI]

program located in the state of Michigan, and qualify for some form of financial aid which can be verified __________________________________________________________ City ______________________________________ MI Zip Code ________________ App Classification: ____Fr ______________________________________ A complete Scholarship Application must include the following: 1. A statement expressing your educational

343

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone BBGS-001WS 1.50 Total Fees ($) Fee Adjustment Instructions: 1. Complete the fee collector's name

344

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone Verification: Instructions: 1. Complete the fee collector's name, address, phone number, crab receiver permit

345

C:\\...\\mailquestionnaire. [PFP#1121010499  

Annual Energy Outlook 2013 [U.S. Energy Information Administration (EIA)]

FULL NAME OF BOTTLED GAS COMPANY BOTTLED GAS LOCATION OF COMPANY (IF KNOWN): STREET, CITY, STATE, AND ZIP CODE (LPG or Propane) ACCOUNT NUMBER (IF KNOWN) TELEPHONE NUMBER (IF...

346

Nanoscience Discovery AcademyNanoscience Discovery Academy A two-week Science Academy for 9th  

E-Print Network [OSTI]

Houston area high schools Students competitively selected What Hands-on exposure to environmental science researchers using nanotechnology to tackle civilization's grand challenges energy, water, environment and Street ________________________________________________________________________ City State Zip 3. E

347

USAJOBS -Search Jobs http://jobview.usajobs.gov/...t+(Postdoctoral+Research+Associate)&jbf574=AG03&q=postdoctoral+NOT+%22RA-11-032L%22&AVSDM=2011-04-12+00%3a36%3a00[6/23/2011 2:47:01 PM  

E-Print Network [OSTI]

sensing-based energy balance ET algorithms (EB-ET) - Soil and Water Assessment Tool (SWAT) - ground water: (keywords) Where: (U.S. city, state or zip code) Go to section of this Job: #12;USAJOBS - Search Jobs http

Behmer, Spencer T.

348

THE OSHER REENTRY SCHOLARSHIP AWARD The Bernard Osher Foundation Reentry scholarship targets students who did not have the  

E-Print Network [OSTI]

PHILANTHROPY: INVESTING IN YOU Venture philanthropy brings a new intensity and energy to providing scholarships in the future of students who have demonstrated the ability to balance work and competing demands with college City Zip

Huang, Jianyu

349

E-Print Network 3.0 - aus der uebung Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Information Sciences 2 Institut fur Computational Science Dept. of Computer Science, ETH Zurich Summary: . In uebung3.zip fin- den Sie das C-Programm integrateNeedleMap zur...

350

PARS II CPP Upload Template File | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

teProjectTemplate.zip More Documents & Publications Proposed Data Elements for PARS II Web Application PARS II - Integrated Project Team Meeting PARS II End-of-Month Checklist...

351

UNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION  

E-Print Network [OSTI]

program in order to reduce Federal employee's contribution to traffic congestion and air pollutionUNITED STATES AIR FORCE OUTSIDE THE NATIONAL CAPITAL REGION PUBLIC TRANSPORTATION BENEFIT PROGRAM): ____________ City (Residence): __________________________State: _______________ Zip Code: ________________ Air Force

352

Designing libraries of chimeric proteins using SCHEMA recombination Matthew A. Smith and Frances H. Arnold*  

E-Print Network [OSTI]

1 Designing libraries of chimeric proteins using SCHEMA recombination and RASPP Matthew A. Smith toolbox. This is available from: http://cheme.che.caltech.edu/groups/fha/media/schema-tools.zip 3

Arnold, Frances H.

353

Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold*  

E-Print Network [OSTI]

1 Non-contiguous SCHEMA protein recombination Matthew A. Smith and Frances H. Arnold* Division downloaded and unpacked. This is available from: http://cheme.che.caltech.edu/groups/fha/media/ncr.zip 3

Arnold, Frances H.

354

2/1/2014 Using TinyWindmills To Power Portable Electronics http://www.simplygreen.co.za/articles/articles/using-tiny-windmills-to-power-portable-electronics.html 1/2  

E-Print Network [OSTI]

NEWSLETTERS ADVERTISE SEARCH Cost Of Solar Panels www.homeadvisor.com Enter Your Zip Code & Connect. Pre: Climate Impacts Could Lead To Drastic Increases In Food Prices Over Coming Decades Wind Power Growth

Chiao, Jung-Chih

355

International Oil and Gas Board International Oil and Gas Board...  

Open Energy Info (EERE)

Oil and Gas Board Address Place Zip Website Abu Dhabi Supreme Petroleum Council Abu Dhabi Supreme Petroleum Council Abu Dhabi http www abudhabi ae egovPoolPortal WAR appmanager...

356

OGS/cm:5/24/07 OFFICE OF GRADUATE STUDIES  

E-Print Network [OSTI]

Personal Data Name: Last First Middle Home Address Street Phone: City, State, Zip E-mail Date of Birth: Sex degree Location of the Institution Degrees or Certificates Dates of Attendance Subject or Field Date

Tsien, Roger Y.

357

University of Kentucky Automatic Bank Draft Donation Agreement  

E-Print Network [OSTI]

University of Kentucky Automatic Bank Draft Donation Agreement Name: Address: City: State: Zip by the University of Kentucky on my bank account for purpose of charitable donations. Donations paid by bank draft

Hayes, Jane E.

358

To the student: The top portion of this form should be completed by you and given to the recommender who has agreed to provide you with an academic recommendation to accompany your application to the University of Kentucky.  

E-Print Network [OSTI]

to the University of Kentucky _____________________________________________________________________________ ____________________________________________________________ City State Zip Code Name of High School To the recommender: The University of Kentucky appreciates your of Kentucky Office of Undergraduate Admission 100 Funkhouser Building Lexington, KY 40506-0054 Or send

Hayes, Jane E.

359

To the student: The top portion of this form should be completed by you and given to the recommender who has agreed to provide you with an academic recommendation to accompany your application to the University of Kentucky.  

E-Print Network [OSTI]

to the University of Kentucky _____________________________________________________________________________ ____________________________________________________________ City State Zip Code Name of High School To the recommender: The University of Kentucky appreciates your: University of Kentucky Office of Undergraduate Admission 100 Funkhouser Building Lexington, KY 40506

Hayes, Jane E.

360

Reference Buildings by Climate Zone and Representative City:...  

Broader source: Energy.gov (indexed) [DOE]

B Albuquerque, New Mexico Reference Buildings by Climate Zone and Representative City: 4B Albuquerque, New Mexico In addition to the ZIP file for each building type, you can...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

PART 1 OF TUTORIAL ON EXTREMES TOOLKIT (1) Installation of R software  

E-Print Network [OSTI]

PART 1 OF TUTORIAL ON EXTREMES TOOLKIT (1) Installation of R software R-2.9.2-win32.exe Use default options (2) Installation of Extremes Toolkit extRemes (R package for extreme value analysis): extRemes_1.60.zip ismev (R package used by extRemes): ismev_1.34.zip Lmoments (R package used by extRemes): Lmoments

Katz, Richard

362

Ten Priceless Images  

E-Print Network [OSTI]

") would sell easily for Rs. 2500/- in Cal cutta and we were not interested to cheat him. The Tibetan refugee said "I know that your scholar friends, Indian or American, may pay even Rs. 5000/-. But I want a proper custody for my house hold icon which... Handed figure on Lotus Seat would bear out. Vide Plate Six . TARA Plate Seven depicts three icons of Tara (Dol rna), two in brass and one in sacred clay. The brass pieces are 3 inches and 4 inches high and the clay one 2 inches. The clay piece...

Sinha, Nirmal Chandra

1984-01-01T23:59:59.000Z

363

Cloud feedback studies with a physics grid  

SciTech Connect (OSTI)

During this project the investigators implemented a fully parallel version of dual-grid approach in main frame code ICON, implemented a fully conservative first-order interpolation scheme for horizontal remapping, integrated UCLA-LES micro-scale model into ICON to run parallely in selected columns, and did cloud feedback studies on aqua-planet setup to evaluate the classical parameterization on a small domain. The micro-scale model may be run in parallel with the classical parameterization, or it may be run on a "physics grid" independent of the dynamics grid.

Dipankar, Anurag [Max Planck Institute for Meteorology Hamburg; Stevens, Bjorn [Max Planck Institute for Meteorology Hamburg

2013-02-07T23:59:59.000Z

364

Penrose Well Temperatures  

SciTech Connect (OSTI)

Penrose Well Temperatures Geothermal waters have been encountered in several wells near Penrose in Fremont County, Colorado. Most of the wells were drilled for oil and gas exploration and, in a few cases, production. This ESRI point shapefile utilizes data from 95 wells in and around the Penrose area provided by the Colorado Oil and Gas Conservation Commission (COGCC) database at http://cogcc.state.co.us/ . Temperature data from the database were used to calculate a temperature gradient for each well. This information was then used to estimate temperatures at various depths. Projection: UTM Zone 13 NAD27 Extent: West -105.224871 East -105.027633 North 38.486269 South 38.259507 Originators: Colorado Oil and Gas Conservation Commission (COGCC) Karen Christopherson

Christopherson, Karen

2013-03-15T23:59:59.000Z

365

30 Minute Session Finding Reports  

Broader source: Energy.gov [DOE]

To register for a course, please click here to log into the iPortal. Once logged in, click on iPortal Training icon located on the left-hand side of the screenFor all iPortal Collaboration training...

366

Introduction to MATLAB Matlab is a program that allows you to carry out computations in a straightforward manner,  

E-Print Network [OSTI]

Introduction to MATLAB Matlab is a program that allows you to carry out computations started You start Matlab by simply clicking on the icon in the desktop. This will open a command window a prompt, which is where it is waiting for you to type a command. The Matlab prompt looks like this

Bishop, Sonia

367

Matlab Tutorial In association with Lab #3 of Phys 322, Observational Astronomy  

E-Print Network [OSTI]

Lab # 3 Matlab Tutorial In association with Lab #3 of Phys 322, Observational Astronomy Start IDL: To start Matlab, click on the Matlab icon on the left in the task bar. After a moment, a window will appear Matlab's current directory setting (using the text box at the top of the screen) to the directory where

Gary, Dale E.

368

Design and Strategy in Organic Synthesis by Stephen Hanessian, Simon Giroux, and Bradley L.  

E-Print Network [OSTI]

naturally occurring small molecules as starting materials, catalytic asymmetric methods are also included as a corollary whenever relevant. The Selected Papers of William N. Lipscomb Jr. edited by Jianpeng Ma QD22.L57 Professor William N Lipscomb, Jr. Lipscomb is a long-standing icon in the fields of structural chemistry

Heller, Eric

369

75057Federal Register / Vol. 77, No. 244 / Wednesday, December 19, 2012 / Rules and Regulations performing the inspection and the date  

E-Print Network [OSTI]

229.305 is amended by removing the definition for the term ``new or next-generation locomotive control comments via the e-Rulemaking Portal, first click the ``submit a comment'' icon, then enter NOAA­NMFS­2012­0121 in the keyword search. Locate the document you wish to comment on from the resulting list and click

370

Calendar | OSTI, US Dept of Energy, Office of Scientific and...  

Office of Scientific and Technical Information (OSTI)

2014-12-22 13:20 20110316.pdf 2014-12-22 13:53 National Library of Energy NLE Beta 250 icon 2014-12-22 13:58 2009Attendees.pdf 2014-12-22 14:44 20111214.pdf 2014-12-22...

371

Calendar | OSTI, US Dept of Energy, Office of Scientific and...  

Office of Scientific and Technical Information (OSTI)

Figure 3 (top) 2014-11-25 10:01 Figure 3 (middle, bottom) 2014-11-25 10:02 Figure 4 2014-11-25 10:04 Figure 5 2014-11-25 10:05 PAGES Beta Icon with DOE and Text 2014-11-25 14:22...

372

EPMA Instructions for Thin Film Samples General guidelines to reading computer related commands  

E-Print Network [OSTI]

EPMA Instructions for Thin Film Samples General guidelines to reading computer related commands: `Single quote' = menu item, window, or icon "Double quote" = something you type = button you your sample, thin film up, on the dot of epoxy 4. Repeat until all samples are on the puck 5. Flip your

373

Updated 4/23/2010 On the GoTM  

E-Print Network [OSTI]

site enables access to the full functionality of the Books24x7 platform, including powerful search your company's portal or Learning Management System. 2. Click the "Mobile Users" icon that displays Use the Main Menu items to navigate the site. 5. Click on Search. 6. Enter your Keywords and Search

Vasilyev, Oleg V.

374

International Year of the Rhino Living Planet Report 2012  

E-Print Network [OSTI]

in South Africa, WWF invests an incredible amount of time and resources into the protection of our iconicInternational Year of the Rhino Living Planet Report 2012 A `Decisive' victory for ethical food by the announcement that June 2012 marked the start of the International Year of the Rhino. Internationally and here

de Villiers, Marienne

375

Commonness, population depletion and conservation biology  

E-Print Network [OSTI]

and alleviate significant depletion events. Priority species Judgements about extinction risk are key drivers to be targets for conservation invest- ment. Indeed, high extinction risk typifies the most iconic species, flagship or indicator species [24]), the use of extinction risk to set conservation priorities has

Queensland, University of

376

SJSU Information Support Services Hire a Teaching Associate or Graduate Assistant info-support@sjsu.edu, 408-924-1530 Page 1  

E-Print Network [OSTI]

displays. 1. From the Main Menu, click the CSU ID Search hyperlink. 2. Enter any known search criteria. 3 Name Description Enter the Position Click the lookup icon to perform search, if unknown. When you click the tab or outside of the field, position data will populate. Term Enter term in a four-digit format

Su, Xiao

377

Configure Microsoft Outlook 2011 for Mac HMS Help Desk: (617) 432-2000  

E-Print Network [OSTI]

Configure Microsoft Outlook 2011 for Mac HMS Help Desk: (617) 432 HMS Help Desk: (617) 432-2000 2 · Click on the icon to the left Help Desk: (617) 432-2000 3 · Enter the following fields: o E

Blackwell, Keith

378

Issue 23 201112 Inside: A word from the wise our Leadership  

E-Print Network [OSTI]

Issue 23 201112 Inside: A word from the wise our Leadership Mentors are helping students stand individual generosity with the financial power of the University to achieve extraordinary results. I am of cutting-edge digital technologies. We are transforming our iconic Chancellor's Court through

Heinke, Dietmar

379

Muhammed Basheer's work has taken him on a journey from India to Belfast and back  

E-Print Network [OSTI]

is the most appropriate for manufacturing concrete that is less porous, to see how it can be protected. He and his team are now world leaders in the technology of concrete structures, how to test them building of the concrete structure that has become one of the 21st century's most iconic images, the Bird

Paxton, Anthony T.

380

Calendar | OSTI, US Dept of Energy, Office of Scientific and...  

Office of Scientific and Technical Information (OSTI)

14:53 NLE 2014 refresh 2014-12-15 14:53 STIP Home - Reference 2014-12-15 15:11 Aerogels Figure 1 2014-12-15 15:13 E-Link 2014-12-15 15:17 SciLab150 icon 2014-12-15 15:19...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

http://www.staradvertiser.com/newspremium/20130824_Small_school_stands_tall_as_science_powerhouse_.html?id=220927791&c=n Page 1 of 3 Aug 28, 2013 07:39:07PM MDT  

E-Print Network [OSTI]

http://www.staradvertiser.com/newspremium/20130824_Small_school_stands_tall_as_science_powerhouse_.html?id=220927791&c=n Page 1 of 3 Aug 28, 2013 07:39:07PM MDT Small school stands tall as science powerhouse POSTED fifth -- well ahead of engineering powerhouses including the iconic Massachusetts Institute

382

August 2012 Style Guide  

E-Print Network [OSTI]

, positive image of the Environment / Health / Safety / Security Division. Follow these guidelines to maintain integrity of the EHSS brand and ensure clarity and strong presence in every use. If you have any of the brand and should follow the style that was developed for the EHSS system. EHSS icons are built in 4

Eisen, Michael

383

Investigation of Rheological and Nano-Rheological Properties of Asphalt Binders  

E-Print Network [OSTI]

absorption. The amount of 0.2-0.3 grams of binders were spread on a 0.53 (cm2) area to prepare the samples. 2.2.2 Equipment The Bruker Dimension Icon AFM and the data processing unit were used to measure mechanical properties at room temperature (25 C...

Kabir, Pooyan

2014-08-04T23:59:59.000Z

384

iPortal Town Hall Meeting  

Broader source: Energy.gov [DOE]

To register for a course, please click here to log into the iPortal. Once logged in, click on iPortal Training icon located on the left-hand side of the screenFor all iPortal Collaboration training...

385

Rayleigh-Plateau instability causes the crown splash Robert D. Deegan,1,  

E-Print Network [OSTI]

such as air-sea gas transfer, cooling, and combustion. In the crown splash parameter regime, the splash and applications such as gas transfer across the air-sea interface [1], cooling [2], coatings [3], and combustion unanswered [8]. Here we focus on the crown splash, as exemplified in Edgerton's iconic photograph Milk

Brunet, Philippe

386

arXiv:0806.3050v1[physics.flu-dyn]18Jun2008 Rayleigh-Plateau instability causes the crown splash  

E-Print Network [OSTI]

, cooling, and combustion. In the crown splash parameter regime, the splash pattern is highly regular. We the air-sea interface [1], cooling [2], coatings [3], and combus- tion [4]. The spatial pattern and size in Edgerton's iconic photograph Milk Coronet [9], and show that number of secondary droplets is governed

Eggers, Jens

387

The Facility The Propellants North Administrative and Maintenance  

E-Print Network [OSTI]

and Maintenance Facility Inside Propellants North is window glazing and framing from the iconic firing rooms with energy recovery technology · Highly insulated roof and walls · Lighting fixtures with smart lighting glazing and framing · Reclaimed and processed waste concrete from Kennedy's demolition projects

388

BU BRAIN Self Service GRADING PROCEDURES  

E-Print Network [OSTI]

1 BU BRAIN Self Service GRADING PROCEDURES FOR FACULTY Updated May 2014/PD #12;2 Table of Contents BRAIN Self Service icon on left side of page: #12;4 Entering Grades: Once in BU BRAIN Self Service, go BRAIN Self Service; Registered ­ student registered through the department). Grade: Student's grade

Suzuki, Masatsugu

389

Research Priorities to Advance Eco-Responsible Nanotechnology  

E-Print Network [OSTI]

Research Priorities to Advance Eco- Responsible Nanotechnology Pedro J. J. Alvarez,, * Vicki Colvin nanotechnology revolution has great potential to enhance a wide variety of products, services, and in- dustries than a future environmental liability, the Interna- tional Council on Nanotechnology (ICON

Alvarez, Pedro J.

390

s rsrt r t rs Pstr5  

E-Print Network [OSTI]

Model Target MetaModel Matching MetaModel Source Model Target Model MTBE Engine links Transformation rulesModel Matching MetaModel Source Model Target Model MTBE Engine Transformation rules Matching Engine conformsTo input/outputIcons: http://cathycreatif.free.fr/ http://www.mecaniqueindustrielle.com/ Simple MTBE

Paris-Sud XI, Université de

391

Ellen Griffith Spears Environmental Historian  

E-Print Network [OSTI]

) and from the city's role as a storage depot for Cold War era chemical weapons marks the locale as an iconic In Anniston, Alabama, toxic pollution resulting from industrial production of polychlorinated biphenyls (PCBs significant in lifting the veil of secrecy that surrounded the city's industrial and military missions. Visit

392

Nottingham Trent University, PhD Studentship Opportunities in Architecture, Design and the Built Environment, October 2014  

E-Print Network [OSTI]

, but not limited to the following area: 1. District heating. 2. Energy from flooded coal mines. 3. Evaluation buildings including building utilisations and energy use. 5. Smart cities and resource optimisation. 6 of the identity of a city, a region or a country: iconic architecture, for example, has been used

Evans, Paul

393

High-resolution, rapid image acquisition for studying biological structures and dynamic cellular processes  

E-Print Network [OSTI]

can be fully integrated with their IX (inverted) and BX (upright) microscopes. The combination) with online analysis. The advanced autofocus gives consistently clear images, and TTL pulse triggering to specific functions are simply selected and linked together in the order required.These command icons

Cai, Long

394

STOCK ASSESSMENT OF THE BLUE CRAB  

E-Print Network [OSTI]

STOCK ASSESSMENT OF THE BLUE CRAB IN CHESAPEAKE BAY 2011 #12;2011 Stock assessment for blue crab in Chesapeake Bay iii Executive Summary The blue crab (Callinectes sapidus) is an icon for the Chesapeake Bay region. The commercial fisheries for blue crab in the Bay remain one of the most valuable fishery sectors

395

Algorithms for solving rubik's cubes  

E-Print Network [OSTI]

The Rubiks Cube is perhaps the worlds most famous and iconic puzzle, well-known to have a rich underlying mathematical structure (group theory). In this paper, we show that the Rubiks Cube also has a rich underlying ...

Demaine, Erik D.

396

business.uts.edu.au POSTGRADUATE  

E-Print Network [OSTI]

UTS: BUSINESS business.uts.edu.au POSTGRADUATE COURSES 2013 #12;Aspacewherecreativity is encouraged and all ideasarewelcome. UTS Business School will soon be home to Sydney's newest iconic building. The Dr 11331 postgraduate coursework students 1245 higher degree research students 2797 staff UTS Business

University of Technology, Sydney

397

Prototyping Tangible Input Devices with Digital Fabrication  

E-Print Network [OSTI]

have previously investigated the benefits of tangibility in How Bodies Matter. 3D printing holds users of 3D printing can currently create such objects. For example, we surveyed the the online in this last sector are typically experts in PCB design and design for 3D printing. "Iconic Lion at the Steps

Hartmann, Björn

398

Page 1 of 2 CREATING AN ANNOUNCEMENT IN ANGEL  

E-Print Network [OSTI]

to modify. As always, if you have trouble with Angel, email your respective help desk. In the case't use Control-V or "right click" and "paste." Instead, go to the Save icon in the tool bar and choose

Collins, Gary S.

399

Articles of Tibet Trade 1784  

E-Print Network [OSTI]

would be accepted in the monasteriu as Wt,U as orthodox househQlds unless it was from Phagyul 24 (Aryabhumi-Land of Buddha). It w:;.s also learned that if available Varal1asi silk was preferred to the best from China for making garmnts for icons...

Sinha, Nirmal Chandra

1984-01-01T23:59:59.000Z

400

AMIS Training Material 1 Institutional Research and Planning October 2012  

E-Print Network [OSTI]

AMIS Training Material 1 Institutional Research and Planning October 2012 University of Nebraska Panel" #12;AMIS Training Material 2 Institutional Research and Planning October 2012 University of Nebraska-Lincoln Page 2 of 9 Change View by: "Category" to "Small Icons" #12;AMIS Training Material 3

Farritor, Shane

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Donald Bren School of Environmental Science & Management  

E-Print Network [OSTI]

regarding best practices? There's Value in Participating: Participants can benefit by influencing the debateDonald Bren School of Environmental Science & Management University of California, Santa Barbara with the International Council on Nanotechnology (ICON) to design and administer a survey examining the environmental

402

Low-cost wearable low-vision aid using a handmade retinal light-scanning microdisplay  

E-Print Network [OSTI]

scanning fiber display6 to present icons indicating the location of potential hazards. The scanning fiberLow-cost wearable low-vision aid using a handmade retinal light-scanning microdisplay Ryland C) is a portable system that uses machine vision to track potential walking hazards for the visually impaired

Washington at Seattle, University of

403

Revisiting the Uniqueness of Simple Demographics in the US Population  

E-Print Network [OSTI]

Revisiting the Uniqueness of Simple Demographics in the US Population Philippe Golle Palo Alto% of the US population can be uniquely identified by gen- der, ZIP code and full date of birth. This short paper revisits the uniqueness of simple demographics in the US population based on the most recent

Golle, Philippe

404

USACE Small Business Area of Responsibility  

E-Print Network [OSTI]

ACE Page 1 USACE Small Business Area of Responsibility OFC CODE STREET CITY ST ZIP TELEPHONE D S N-761-4609 Deputy to PARCs , Office of Small Business Prog, HQ U.S. Army Corps of CESB 60 Forsyth Street RM10M15

US Army Corps of Engineers

405

The Surprising Impact of Technology on Real Estate  

E-Print Network [OSTI]

1993 Transactions 8,132,000 1993 Sales Volume $473 million 2012 Transactions 9,380,000 2012 Sales ZipRealty Redfin #12;Today Top 10 Real Estate Websites by US Market Share of Visits (%) November 2012 impacts? Brokerage firms and sales professionals have shifted over 75% of their advertising and marketing

Stephens, Graeme L.

406

Efficient Algorithms for Comparing, Storing, and Sharing Large Collections of Phylogenetic Trees  

E-Print Network [OSTI]

relationships contained in tree collections. Our algorithms MrsRF and Phlash are the fastest in the field for comparing large collections of trees. Our algorithm TreeZip is the most efficient way to store large tree collections. Lastly, we developed Noria, a...

Matthews, Suzanne

2012-07-16T23:59:59.000Z

407

413 South Hall Bowling Green, OH 43403-0185  

E-Print Network [OSTI]

(Street, City, State, and Zip Code): I , a student at Bowling Green State University give permission413 South Hall Bowling Green, OH 43403-0185 Phone 419-372-8495, TTY 419-372-9455 Fax 419 with specific test results or clinical observations. #12;Page 2 of 4 413 South Hall Bowling Green, OH 43403

Moore, Paul A.

408

Pennsylvania Fish and Boat Commission 2008 Approved Triploid Grass Carp Dealers  

E-Print Network [OSTI]

person Street City State Zip Code Phone Number Dealer # Angelo Trout Farm John A. Angelo 181 Rogers Mill-08 Frey's Fish Ponds Mark W. Frey 820 Pine Hill Road Gulph Mills PA 19406 (610)995-2700 217-08 Hilltop Melkovitz P. O. Box 166, 6444 Hwy. Keo AR 72083 (501)842-2872 216-08 Keystone Aquaculture, Inc. John M

Boyer, Elizabeth W.

409

Summer Academy Scholarship Application Name: Date  

E-Print Network [OSTI]

Summer Academy Scholarship Application Name: Date: Address: City: State: Zip Code: Please for this scholarship? In the spirit of St. Vincent DePaul, Summer Academy scholarships are distributed based on both Date Apply online to the Summer Academy before submitting your scholarship application. You must first

Schaefer, Marcus

410

2/1/2014 Micro Windmill-Powered Chargers -This 1.88MM Wide Windmill Can Recharge Your Smartphone Battery(VIDEO) http://www.trendhunter.com/trends/windmill-powered 1/7  

E-Print Network [OSTI]

Trends Cost Of Solar Panels www.homeadvisor.com Enter Your Zip Code & Connect. Pre-Screened Contractors Battery(VIDEO) http://www.trendhunter.com/trends/windmill-powered 1/7 Select Category TECH Wholesale Solar Panels www.solarhome.org 290W Trina Panels - from $0.69/watt In Pallet or Container Quantity Published

Chiao, Jung-Chih

411

Page 1 of 12 CONTRACTOR NAME CONTRACT # CONTRACT  

E-Print Network [OSTI]

Page 1 of 12 CONTRACTOR NAME CONTRACT # CONTRACT START CONTRACT EXPIRE ADDRESS LINE 1 CITY STATE-3-/850/10/31/14 11-01-2011 10-31-2014 21 Griffin Road North Windsor CT 06095 Jennifer Peshka CONTRACTOR NAME CONTRACT # CONTRACT START CONTRACT EXPIRE ADDRESS LINE 1 CITY STATE ZIP CODE CONTACT NAME CDM Smith 005

Holsinger, Kent

412

Draft Site-Wide Environmental Impact Statement Nevada Summary...  

National Nuclear Security Administration (NNSA)

49.51 KB NNSA NSO 2010b.zip 160.88 KB NSOE 2009.pdf 6.1 MB NSOE 2010.pdf 8.63 MB NSTec 2008.pdf 670.44 KB Parker and King 1998.pdf 815.29 KB Scott et al 1971.pdf 747.5 KB...

413

Student Release of Records Form Use Black or Blue Ink Only  

E-Print Network [OSTI]

Student Release of Records Form Use Black or Blue Ink Only STUDENT INFORMATION Name (Last, First, Middle) Student ID Number Telephone Number City Zip CodeHome Address State Student information from a student's educational record to a third party without the student's explicit written

Hart, Gus

414

Test Preparation Options Free Test Prep Websites  

E-Print Network [OSTI]

Test Preparation Options Free Test Prep Websites ACT: http: http://www.collegeboard.com/student/testing/sat/prep_one/test.html http://www.number2.com://testprep.princetonreview.com/CourseSearch/Search.aspx?itemCode=17&productType=F&rid=1&zip=803 02 Test Prep Classes Front Range Community College: Classes

Stowell, Michael

415

SIGMA-ALDRICH MATERIAL SAFETY DATA SHEET  

E-Print Network [OSTI]

1.1 Section 1 - Product and Company Information Product Name BUTYL ACRYLATE, 99+% Product Number 234923 Brand ALDRICH Company Sigma-Aldrich Street Address 3050 Spruce Street City, State, Zip, Country °C Partition Coefficient Log Kow: 2.38 Decomposition Temp. N/A Flash Point 96.8 °F 36 °C Method

Choi, Kyu Yong

416

SIGMA-ALDRICH MATERIAL SAFETY DATA SHEET  

E-Print Network [OSTI]

1.4 Section 1 - Product and Company Information Product Name 4-TERT-BUTYLPHENOL, 99% Product Number B99901 Brand ALDRICH Company Sigma-Aldrich Street Address 3050 Spruce Street City, State, Zip/A Evaporation Rate N/A Viscosity N/A Surface Tension N/A Partition Coefficient Log Kow: 3.29 Decomposition Temp

Choi, Kyu Yong

417

SIGMA-ALDRICH MATERIAL SAFETY DATA SHEET  

E-Print Network [OSTI]

1.5 Section 1 - Product and Company Information Product Name 1-PROPANOL, 99.5+%, HPLC GRADE Product Number 293288 Brand ALDRICH Company Sigma-Aldrich Street Address 3050 Spruce Street City, State, Zip Coefficient Log Kow: 0.25 - 0.

Choi, Kyu Yong

418

Campus Reference # Do not use this form for invoice payments against BuzzMart PO's. Only one vendor invoice per check request.  

E-Print Network [OSTI]

Campus Reference # Do not use this form for invoice payments against BuzzMart PO's. Only one vendor: Phone: City: State: ________ Zip: Country: VENDOR ID: NEW US VENDORS REQUIRE SUBMISSION OF VENDOR PROFILE FORM, INTERNATIONAL VENDORS MUST SUBMIT A W-8 FORM. Project #: Account Code: Amount: $ Project

Li, Mo

419

Authorization For Direct Deposit Of Vendor Payments (ACH) Click here for online help.  

E-Print Network [OSTI]

Authorization For Direct Deposit Of Vendor Payments (ACH) Click here for online help. Instructions) CANCELLATION of a prior request Vendor is responsible for notifying The University of Memphis of any changes. Vendor Name: Federal Tax ID/U Number: Remit-to-Address: City: State: Zip Code: E-mail Address (REQUIRED

Dasgupta, Dipankar

420

TOWER FOUNDATION OF SJSU VENDOR/CONSULTANT DATA FORM  

E-Print Network [OSTI]

TOWER FOUNDATION OF SJSU VENDOR/CONSULTANT DATA FORM ONE WASHINGTON SQUARE, SAN JOSE, CA 95192. Vendor/Consultant Name: Mailing Address: City, State, Zip Code: Telephone Number: Email Address: Vendor or an employee of SJSU. Vendor's Taxpayer I.D. Number ­ NOTE: Payment will not be processed without

Eirinaki, Magdalini

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

5 ways McGill researchers are BUILDING YOUR FUTURE  

E-Print Network [OSTI]

you. COVER STORIES 15 Building Your Future Forget about jet-packs. The real world of tomorrow-engineering projects 25 Future Engines Getting more bang out of biofuels 28 Future Farms A five-point plan for growing efficient. A few years from now, the cars zipping past may be propelled by Earth-friendly biofuels, thanks

Fabry, Frederic

422

CURRICULUM VITAE University of Idaho  

E-Print Network [OSTI]

: Professor of Fish and Wildlife Resources DEPARTMENT AND CAMPUS ZIP: Fish and Wildlife Resources, 1136 OFFICE and Research Appointments: July 1998-present, Professor, Department of Fish and Wildlife Resources, University of Idaho 1990-June 1998, Associate Professor, Department of Fish and Wildlife Resources, University

423

Friends of Computer Science (FoCS) Recruiting Profile We reserve the right to edit profiles. You will receive a final copy for approval.  

E-Print Network [OSTI]

Address City State Zip Code Recruiting Information About Us (150/ 775 character max) (Suggested items of Lockheed Martin's business is with the U.S. Department of Defense and the U.S. federal government agencies. Lockheed Martin is the largest provider of IT services, systems integration, and training to the U.S

Ghosh, Joydeep

424

L AMENDMENT OF SOLICITATION/MODIFICATION OF CONTRACT  

National Nuclear Security Administration (NNSA)

De pa rtment of Energ y NNSA Y-12 S it e Offic e P. O. Box 2 05 0 Bu ilding 97 0 4- 2 Oak Ridge TN 37831 8 . NAME AND ADDRESS OF CONTRACTOR (No., street, county. state and ZIP...

425

Reviewed and approved by the Provost's Office, May 2011; reviewed and updated August 2012. All forms must be returned to the appropriate dean's office before the experience in the laboratory or studio begins.  

E-Print Network [OSTI]

([ ]) Work/Cell Phone ([ ]) Home Phone ([ ]) Work/Cell Phone ([ ]) Address Address City, ST ZIP Code City, ST Phone ([ ]) Work/Cell Phone ([ ]) Home Phone ([ ]) Work/Cell Phone ([ ]) Medical Information ANYONE's/Guardian's Name (if under 18 years of age) Parent's/Guardian's Name (if under 18 years of age) Home Phone

Palmeri, Thomas

426

[OMB # 0648-0327 EXP 07-31-2015] NATIONAL OCEANIC AND ATMOSPHERIC ADMINISTRATION  

E-Print Network [OSTI]

Phone No. ( ) City State Zip Code Fax Phone No. ( ) Email Address Website Cell Phone No. ( ) SECTION 2 No. ( ) Email Address Birth Date (mm/dd/yy) Cell Phone No. ( ) SECTION 4 - ADDITIONAL FEDERAL - ADDITIONAL FACILITIES (add additional sheets if necessary) Business Name Daytime Phone No. Fax Phone No

427

ALBERT EINSTEIN COLLEGE OF MEDICINE GLOBAL HEALTH SUMMER/SENIOR FELLOWSHIP  

E-Print Network [OSTI]

ADDRESS: NUMBER AND STREET CITY STATE ZIP CODE HOME PHONE: CELL PHONE: WORK PHONE: _____ (initial) I MENTOR CONTACT INFORMATION LAST NAME: FIRST NAME: DEPARTMENT: TITLE: HOME PHONE: CELL PHONE: WORK PHONE ADDRESS: CURRENT ADDRESS: NUMBER AND STREET CITY COUNTRY HOME PHONE: CELL PHONE: WORK PHONE: PREFERRED WAY

Yates, Andrew

428

STUDENT APPLICATION STUDENT INFORMATION  

E-Print Network [OSTI]

: State: ZIP Code: Home phone: Cell phone: Email: Ethnicity (circle all that apply): African Contact: Relationship: Address: Lives with student: Yes No Cell phone: E-mail: Work phone: City: State Parent/Guardian: Relationship: Address: Lives with student: Yes No Cell phone: E-mail: Work phone: City

Texas at Austin, University of

429

Tear out this form and take it with you on your trip. Also leave a copy at home with a friend or relative.  

E-Print Network [OSTI]

phone Business e-mail Business fax BNL Supervisor Name Phone Assistant Name Phone Cell phone Cell phone or relative. Personal Information Full name Home address Street City State Zip Home phone E-mail address password Emergency and Medical Information Emergency contact Name Phone Doctor Name Phone Doctor's address

Ohta, Shigemi

430

COMPLAINT FORM Submit To: Today's Date  

E-Print Network [OSTI]

Phone City / State / Zip _________ Cell Phone II. TYPE & BASIS OF COMPLAINT (Check the boxes that apply.) Complainant (Name & Title) ______ Department UFID # Address (University) Work Phone Address (Residence) Home #1 (Name & Title) ______ Address (Work) Work Phone Address (Home) Home Phone Mobile Phone Respondent

Pilyugin, Sergei S.

431

Spatial Distribution of U.S. Household Carbon Footprints Reveals Suburbanization Undermines Greenhouse Gas Benefits of Urban  

E-Print Network [OSTI]

Spatial Distribution of U.S. Household Carbon Footprints Reveals Suburbanization Undermines that were used to derive average household carbon footprints (HCF) for U.S. zip codes, cities, counties, and metropolitan areas. We find consistently lower HCF in urban core cities (40 tCO2e) and higher carbon footprints

Kammen, Daniel M.

432

CEC-1038 R1, (11-2011) RESERVATION REQUEST FORM  

E-Print Network [OSTI]

and Height (For wind only - Tower, Pole, or Roof-mounted) Phone: ( ) Fax: ( ) Estimated annual energy of System Installation Submit complete application by fax at (916) 653-2543 or by mail to: California Energy: City: State: Zip 2. Purchaser Name and Mailing Address 6. Equipment (Turbines, fuel cells, inverters

433

Schrepel, Eric From: Jenkins, Kris  

E-Print Network [OSTI]

for 6,000 megawatts of new wind energy over the next 20 years. However, I am VERY disappointed:17:53 --------------------------------------------------------------------------- fname: Lisa lname: Riehl address_2: 4738 SE Kelly St. city: Portland state/province: OR zip/postal code of its anticipated load growth with energy efficiency is a major step forward, as is identifying the need

434

Schrepel, Eric From: Jenkins, Kris  

E-Print Network [OSTI]

city: Seattle state/province: WA zip/postal code: 98107 phone: 206 706 1931 comments: Dear Northwest encouraged that increased efficiency and wind power are major components of this plan. I attended a hearing for solar energy production, both thermal and electric, is evenly distributed (varying geographically

435

Schrepel, Eric From: Jenkins, Kris  

E-Print Network [OSTI]

of new wind energy over the next 20 years. However, I am very disappointed that the plan includes 400:05:21 --------------------------------------------------------------------------- fname: Ellen lname: Knight address_2: 5800 Rattlesnake city: Missoula state/province: Mt zip/postal code growth with energy efficiency is a major step forward, as is identifying the need for 6,000 megawatts

436

Schrepel, Eric From: Jenkins, Kris  

E-Print Network [OSTI]

for 6,000 megawatts of new wind energy over the next 20 years. However, I am very disappointed:43:35 --------------------------------------------------------------------------- fname: Kristin affiliation: Peterson address_2: 4021 SW Oregon ST. city: Seattle state/province: wa zip of its anticipated load growth with energy efficiency is a major step forward, as is identifying the need

437

Schrepel, Eric From: Jenkins, Kris  

E-Print Network [OSTI]

is a major step forward, as is identifying the need for 6,000 megawatts of new wind energy over the next 20 city: Seattle state/province: WA zip/postal code: 98101 phone: 206-770-7779 comments: Dear Northwest. Proposing that the region meet more than half of its anticipated load growth with energy efficiency

438

Requestor's Name: Organization  

E-Print Network [OSTI]

Requestor's Name: Organization: Address: (No PO BOX) City, State, Zip: Cell: Phone: Fax: E showing major natural gas pipelines identified by owner and pipe diameter. 6) California Wind Resource Annual Wind Speed, Annual Wind Power, and Seasonal Wind Speed measured at various elevations (meters

439

Center for Learning & Attention Disorders Portsmouth, New Hampshire  

E-Print Network [OSTI]

in Children and Adolescents; Coaching Students with Executive Skills Deficits; and Smart but Scattered Past by children whose problems in school seem to have little to do with how smart they are or how easily of registration, coffee hour, and lunch. Name (please print) Address City State Zip Email address Professional

Johnson Jr.,, Ray

440

Date Posted: 03/11/13 Job Opportunity Posting  

E-Print Network [OSTI]

- LMSW, LCSW, LPCi and LPC Employer/ Agency: National Smart Healthcare Services, Inc. Job Description). Salary/Hours: Flexible schedule Employer/Agency: National Smart Healthcare Services Address: 1012 W. Alabama Street City, State, Zip: Houston, TX 77006 #12;Contact Person: Sarah Olson Contact Title: HR

Azevedo, Ricardo

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

QUICK REFERENCE GUIDE FOR CANDIDATES How to Apply  

E-Print Network [OSTI]

Search near your zip code or city. You may also click the Advanced Search tab to search by: Shift Posting. Result: The Career Section displays on the Job Search tab. Notice the search options you have at the top of the page as well as the search fields below. You will perform a Basic Search for your job. 3. You can

Bordenstein, Seth

442

Address for applications only: International School for Graduate Studies (ISGS)  

E-Print Network [OSTI]

Family Name First Name Sex/ Date of Birth Place of Birth Citizenship Male Female dd/mm/yy 3/ Zip code Town Country Email Phone/ Fax Please attach photo here #12;2 5. YOUR EDUCATIONAL BACKGROUND of the Certificates! 5.1 School Education What is the highest level of your secondary education? 5.2 Higher Education

Madlener, Klaus

443

Last revised July 2008 Harvard University  

E-Print Network [OSTI]

Last revised July 2008 Harvard University Purchasing Card Individual Cardholder Application, Part 1 Harvard Office Mailing Address City, State, Zip Code Harvard Phone Number ( ) - 33-Digit Default General") are pleased to offer you the Purchasing Card. The Purchasing Card represents Harvard's trust in you

Chen, Yiling

444

FallProofTM Instructor Shirts Indicate quantity of each size  

E-Print Network [OSTI]

Shirts = $ 6.00 total 3 ­ 4 Shirts = $10.00 total 5+ call or e-mail for rates E-mail for international rates $ __________ Sub-total $ __________ S & H $ __________ Total Mail your completed form and payment@fullerton.edu Name Address City/State/Zip Phone E-Mail Payment by check only, payable to: CSUF Cashiers These quality

de Lijser, Peter

445

HyperCube Updates Version 11.2 (05/9/14)  

E-Print Network [OSTI]

and 64 bit) needed to process Lidar full wave form (FWF) sample data files (SDF) in now included. This functionality only applies to the Windows PC version. An SDF example data set, Duncan Knob.zip, has been added and process Riegl (www.riegl.com) full wave form (FWF) sample data files (SDF) has been added (menu File

446

Technical Assistance Application Bright Schools Program  

E-Print Network [OSTI]

audit ­ evaluate energy efficiency opportunities at existing facilities Evaluate opportunitiesTechnical Assistance Application Bright Schools Program C a l i f o r n i a E n e r g y C o m m i: Zip: Contact Person: Title: Department: Phone Number: Email: * Name of K-12 school/ District 2. Attach

447

Department of Elementary & Bilingual Education Master of Science in Education  

E-Print Network [OSTI]

Department of Elementary & Bilingual Education Master of Science in Education Study Plan-Please complete with advisor CWID Date Address Home Phone: ZIP Work Phone: E-mail address The following pre-classification by EDEL 511. Signed Date Graduate Program Adviser ALL STATE AND UNIVERSITY REQUIREMENTS ARE TO BE MET

de Lijser, Peter

448

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name  

E-Print Network [OSTI]

OMB Control # 0648-0376 Expires 2/29/2012 Fee Collector's Name Mailing Address City State Zip Phone Number Fee Collector's Permit or Buyer Code Settlement Sheet Date Month and Year of Landings Contact the fee collector's name, address, telephone number, fee collector's permit number, date of this fee

449

Educational programs of the Texas A&M AgriLife Extension Service are open to all people without regard to race, color, sex, disability, religion, age, or  

E-Print Network [OSTI]

: City, State: Zip: Home Phone: E-mail Address: Address: How many people in your family will participateEducational programs of the Texas A&M AgriLife Extension Service are open to all people without kids! Start a healthy habit! is an 8-week walking program for teams of eight people or school classes

450

Helpful Resources Online Rescue Network provides a list of pet rescue groups by  

E-Print Network [OSTI]

Helpful Resources Online Rescue Network provides a list of pet rescue groups by state--select your mammals, but they may be able to connect you with local rescue groups who will help place exotic pets of qualified exotic pet veterinarians, searchable by zip code. Contact them for advice or euthanasia services

Jawitz, James W.

451

Pre-Publication Copy Summer (May/June) 2007 (Vol. II, No. 5)  

E-Print Network [OSTI]

MORRIS, IL 61054-7521 Name Address 1 Address 2 City State Zip Country E-mail Credit Card Exp. NameIrrelevanceoftheMiddleEast by Philip E. Auerswald Neither our energy vulnerability nor the danger of terrorism is all it's cracked up IslaminAmerica by Peter Skerry Four new books try to strike a balance between fear and complacency over

Huang, Jianyu

452

THEJOURNALOFCELLBIOLOGY The Rockefeller University Press $8.00  

E-Print Network [OSTI]

-Kettering Cancer Center, Long Island City, NY 11101 sing a cell fusion assay, we show here that in ad- dition permanent and approximately one third were U reversible. We predict that this relatively close balance among fusion (Sollner et al., 1993). Energy made available from the zipping-up of the SNARE complex (Sutton et

Sulzer, David

453

Evaluated Nuclear (reaction) Data from the Evaluated Nuclear Data File (ENDF)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The current version is ENDF/B VII.0, released in 2006. Users can search ENDF via specialized interfaces, browse sub-libraries or download them as zipped files. Data plots can be generated through the Sigma interface. The ENDF web page also provides access to covariance data processing and plots. (Specialized Interface)

454

Heavy Oil Database from the National Institute for Petroleum and Energy Research (NIPER)  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

The Heavy Oil Database resulted from work funded by DOE and performed at the National Institute for Petroleum and Energy Research (NIPER). It contains information on more than 500 resevoirs in a Microsoft Excel spreadsheet. The information was collected in 1992 and updated periodically through 2003. Save the zipped file to your PC, then open to access the data.

455

Vehicle Registration Card Use this form to register a vehicle with Parking Services. Complete this form and deliver to Parking Services along with a copy of  

E-Print Network [OSTI]

Vehicle Registration Card Use this form to register a vehicle with Parking Services. Complete this form and deliver to Parking Services along with a copy of your DMV Vehicle Registration. Last First Name M.I. Mailing City State ZIP University ID Student Sta Faculty Other Vehicle License State Year

Ickert-Bond, Steffi

456

Vehicle Registration Card Use this form to register a vehicle with Parking Services. Complete this form and deliver to Parking Services along with a copy of  

E-Print Network [OSTI]

Vehicle Registration Card Use this form to register a vehicle with Parking Services. Complete this form and deliver to Parking Services along with a copy of your DMV Vehicle Registration. Last First Name M.I. Mailing City State ZIP University ID Student Staff Faculty Other Vehicle License State Year

Ickert-Bond, Steffi

457

VEHICLE LEASE This form is an agreement between a University of Michigan (U-M) department and U-M Parking and Transportation  

E-Print Network [OSTI]

VEHICLE LEASE This form is an agreement between a University of Michigan (U-M) department and U-M Parking and Transportation Services (PTS) Fleet Services to lease a vehicle. Form-1470 or mail/deliver to 1213 Kipke Drive Zip 2002 Department Information U-M Vehicle # Shortcode Parking

Kirschner, Denise

458

UCI SUMMER SESSION 2012 SUMMER SCHOLAR PROGRAM THROUGH ACCESS UCI  

E-Print Network [OSTI]

questions, call us at (949) 824-0234. LAST: FIRST: MIDDLE: ADDRESS: CITY: STATE: ZIP: PRIMARY STUDENT PHONE SECURITY #: PRESENT AGE: BIRTH DATE: GENDER: YOUR HIGH SCHOOL: CLASS LEVEL AS OF NEXT FALL (2012): 2 . SUP recommendation A transcript of your high school record A short essay (500 words maximum) describing your

Rose, Michael R.

459

Revised 6.2.09 GradCare off-site registration form  

E-Print Network [OSTI]

Care off-site registration form For University of Michigan students enrolled in off-campus academic study or other off-site field placement. Instructions To obtain expanded coverage outside the GradCare network ______________________________________________________________________________________________ Off-site address City State Zip Dependents (spouse, other qualified adult, children, etc) ­ complete

Shyy, Wei

460

Green Homebuilding By Design- a Systems Approach  

E-Print Network [OSTI]

ESL-IC-09-11-29 Proceedings of the Ninth International Conference for Enhanced Building Operations, Austin, Texas, November 17 - 19, 2009 E-mail Address: GREENARCHS@aol.com Mailing Address: 1800 West 6th Street City, State, Zip Code: Austin...

Pfeiffer, P. L.

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Legal Business Name and DBA Name (as applicable) Permanent Business Address (number & street or P.O. Box) (Required)  

E-Print Network [OSTI]

Legal Business Name and DBA Name (as applicable) Permanent Business Address (number & street or P) Permanent Remittance (Address (if different from Business Address) (Required) City, State and Zip code Email, Santa Cruz Payee Setup Request (204) Required in lieu of IRS W-9 when doing business with the State

California at Santa Cruz, University of

462

(Business/Store Name) (Business/Store Address)  

E-Print Network [OSTI]

(Business/Store Name) (Business/Store Address) (City) (State) (Zip Code) (Business/Store Phone Number) (Business/Store Fax Number) (Business Description) (Business/Store Primary Contact) (Primary Contact E-mail address) (Business/Store Secondary Contact) (Secondary Contact E-mail Address) (Business

Maroncelli, Mark

463

Family business Information Update Please list all members that would like to receive information about the Family Business Council events.  

E-Print Network [OSTI]

Family business Information Update Please list all members that would like to receive information about the Family Business Council events. Name Company Mailing Address City State/Province ZipPhone #12;Thank you for helping us update our records. Please send information about the Family Business

de Lijser, Peter

464

4/2/2014 Micro windmills maysoon recharge your mobile phone -Yahoo News Philippines https://ph.news.yahoo.com/micro-windmills-may-soon-recharge-mobile-phone-091158453.html 1/1  

E-Print Network [OSTI]

with thousand of windmills could be made and mounted on the walls of houses or building to harvest energy www.homeadvisor.com Enter Your Zip Code & Connect To Pre-Screened Solar Panel Installers Water Pumping the concept. "Tiny windmills might not be the energy crisis panacea you had in mind, but thinking outside

Chiao, Jung-Chih

465

TUTORIAL FOR UW NETWORK CODING USING OPNET AND CHRIS LYDICK  

E-Print Network [OSTI]

have downloaded the .zip or .tar.gz file from the UWEE FUNLAB web- site (http, the packets we are processing for network coding) follow the dark blue arrow to either a sink processor to all of its output streams (again, the dark blue arrows going from the nc-proc processor to other

Roy, Sumit

466

Monthly Tank Inspection Log Name of Campus  

E-Print Network [OSTI]

Monthly Tank Inspection Log Name of Campus Street Address of Campus City, State, and Zip Code of Campus 1 of 2 1. Facility PBS Registration Number 6. DISTRIBUTE TO : 2. Tank Number 3. Tank Registered(S) Satisfactory Repair or Adjustment Required Not Applicable Additional Comments Attached ABOVEGROUND STORAGE TANK

Rosen, Jay

467

42A804-E (2-07) Commonwealth of Kentucky  

E-Print Network [OSTI]

Form K-4E 42A804-E (2-07) Commonwealth of Kentucky DEPARTMENT OF REVENUE Special Withholding, State and ZIP Code Employee--File this certificate with your employer. Otherwise Kentucky income tax's Certification--I certify under the penalties of perjury that I anticipate no Kentucky income tax liability

Simaan, Nabil

468

PD AVIAN FORM 01 (May 2014) All Requested Data Must Be Provided Page 1 of 2 Please use the avian necropsy submission form if for diagnostic necropsy/analysis on birds or tissues.  

E-Print Network [OSTI]

Store Hauler Live Bird Market (At Market) Passive Surveillance Truck/Crate Wash Wholesaler Production8 LCD EGG QC Other Pullet House Name Layer House Destination Regulatory Investigation / Disease Premises Identification Number Flock ID/Name/House #/Floor #/Pen # or Q # Address City, State, Zip Phone

Omiecinski, Curtis

469

"Who Are All These Lessons Learned from Working With  

E-Print Network [OSTI]

#12;5 FAA's Role in NEPA Process For an EIS: FAA is responsible for comple1ng the EIS Selects & directs consultant Develops scope & content Speed Rail Tier 1 EIS scoping Twin Cities to Rochester ZIP Rail Tier 1 EIS scoping Twin Cities

Minnesota, University of

470

UCSF Bicycle Permit Application Transportation Services  

E-Print Network [OSTI]

UCSF Bicycle Permit Application Transportation Services 500 Parnassus Ave, Box 0240 MU- P7 Room 26 ____________________________________________________________________ ____________________________ ______________________________ ____________________________________________________________________ Street City State Zip Home Phone Number Work Phone Number Bicycle Make Color Frame Serial #Bicycle Model 1. Bicycles which are not moved for a period of 7 days or longer will be tagged for removal

Yamamoto, Keith

471

Copyright 1995,1997,2001,2003,2004,2005,2008, 2009 2012 CSUF Small Business Institute. All Rights Reserved-WEB 2012 Request for Consulting Application  

E-Print Network [OSTI]

): Street Address: City: Zip: Fax #: E-mail: (print) Company Website: Cell #: Describe your products and blocks to solve challenges in areas such as productivity, motivation, retention, restructuring, team/Leadership: Improve bottom line by optimizing and aligning human resources. Conduct an organizational audit to solve

de Lijser, Peter

472

CLAIMANT AUTO ACCIDENT REPORT For Completion by Driver  

E-Print Network [OSTI]

CLAIMANT AUTO ACCIDENT REPORT For Completion by Driver D E P A R T M E N T O F A D M I N I S T R Address City State Zip For what purpose was car being used at time of accident? Has damage been repaired signals did you give? Other Driver? Who investigated? Who Cited and Why? Describe Accident CONTINUE

Tullos, Desiree

473

Methods and systems relating to an augmented virtuality environment  

DOE Patents [OSTI]

Systems and methods relating to an augmented virtuality system are disclosed. A method of operating an augmented virtuality system may comprise displaying imagery of a real-world environment in an operating picture. The method may further include displaying a plurality of virtual icons in the operating picture representing at least some assets of a plurality of assets positioned in the real-world environment. Additionally, the method may include displaying at least one virtual item in the operating picture representing data sensed by one or more of the assets of the plurality of assets and remotely controlling at least one asset of the plurality of assets by interacting with a virtual icon associated with the at least one asset.

Nielsen, Curtis W; Anderson, Matthew O; McKay, Mark D; Wadsworth, Derek C; Boyce, Jodie R; Hruska, Ryan C; Koudelka, John A; Whetten, Jonathan; Bruemmer, David J

2014-05-20T23:59:59.000Z

474

L'valuation des comptences relationnelles et sociales : obstacles idologiques et reconceptualisations ncessaires.  

E-Print Network [OSTI]

reconceptualisations nécessaires. Odile Camus ­ MCF HDR en psychologie sociale - Laboratoire ICONES ­ Université de Rouen - 76821 Mont-Saint- Aignan Cedex odile.camus@remuements.net 02 35 14 71 14 Travail effectué dans lesquels la place de chacun dans le monde du travail se trouve légitimée (Camus 2003:125). Cet article se

Paris-Sud XI, Université de

475

Main Screen: students and advisors will use during the advising engagement and is prepopulated with degree plans per major. Sequences plan by terms; term courses populated by degree plans per each major.  

E-Print Network [OSTI]

1 #12;2 #12;3 #12;4 #12;5 #12;6 #12;7 #12;8 #12;9 #12;10 #12;Main Screen: students and advisors by either the student or advisor Advisor Message: allows advisor to leave message for student on that particular course. Students view only; Advisors: create/edit; Pencil icon: blank message; pencil with note

Barrash, Warren

476

Challenges and Techniques for Personal Environment Management  

E-Print Network [OSTI]

of a directory structure as a reminder to complete work contained in the files. Macintosh users reported behaviors such as moving icons near the trash can as a reminder to delete them.? According to Barreau and Nardi [Barreau and Nardi, 1995... by browsing the directory structure they created as opposed to using search. Similar to Malone?s finding in the study of 14 paper documents, they noticed that users place documents in certain positions in a computer system and use browsing practices...

Zacchi, Anna 1967-

2011-10-22T23:59:59.000Z

477

The Higgs Boson for the Masses?  

SciTech Connect (OSTI)

The Higgs boson is the object of one of the greatest campaigns in the history of particle physics and a pop-culture icon. But what is a Higgs boson, and what would we like it to do for us? What will we understand after a discovery that we don't understand before? How would the world be different if nothing did the job of the Higgs boson? We will explore all these questions and more through demonstration, simulation, and audience participation.

Quigg, Chris (FNAL) [FNAL

2012-04-04T23:59:59.000Z

478

System Process Document How to Create an Online Journal Entry  

E-Print Network [OSTI]

/20/2013 4:00:00 PM Step Action 20. To select the Fund, click the Look up Fund icon. 21. Each drop down menu Document Generation Date 12/20/2013 4:00:00 PM Date Modified 12/20/2013 4:00:00 PM Last Changed by Status Entry. Step Action 1. Click the Main Menu button in the top menu. 2. Click the General Ledger menu. 3

Haykin, Simon

479

Indiana/Wind Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429 Throttled (bot load) Error 429Indiana Wind Resources WindTurbine-icon.png

480

Ida County, Iowa: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI Solar Jump to: navigation,Icon Solar Power,

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

IdaTech plc | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI Solar Jump to: navigation,Icon Solar

482

Idaho - IC 61-516 - Priority Designation for Electric Transmission Projects  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI Solar Jump to: navigation,Icon

483

Idaho - IDAPA 20.03.08 - Easements on State-Owned Lands | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI Solar Jump to: navigation,IconInformation 8

484

Idaho - IDAPA 39.03.42 - Encroachment on State Highway Rights-of-Way | Open  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI Solar Jump to: navigation,IconInformation

485

Rocky Mountain Basins Produced Water Database  

DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

Historical records for produced water data were collected from multiple sources, including Amoco, British Petroleum, Anadarko Petroleum Corporation, United States Geological Survey (USGS), Wyoming Oil and Gas Commission (WOGC), Denver Earth Resources Library (DERL), Bill Barrett Corporation, Stone Energy, and other operators. In addition, 86 new samples were collected during the summers of 2003 and 2004 from the following areas: Waltman-Cave Gulch, Pinedale, Tablerock and Wild Rose. Samples were tested for standard seven component "Stiff analyses", and strontium and oxygen isotopes. 16,035 analyses were winnowed to 8028 unique records for 3276 wells after a data screening process was completed. [Copied from the Readme document in the zipped file available at http://www.netl.doe.gov/technologies/oil-gas/Software/database.html] Save the Zipped file to your PC. When opened, it will contain four versions of the database: ACCESS, EXCEL, DBF, and CSV formats. The information consists of detailed water analyses from basins in the Rocky Mountain region.

486

Interannual variability in water storage over 2003-2007 in the Amazon Basin2 from GRACE space gravimetry, in situ river level3  

E-Print Network [OSTI]

Hidrologia, Ilha do Fundão, Zip Code:9 21945-970, Rio de Janeiro-RJ, Brasil , Phone: +552125627837, Fax - 118, Route de Narbonne - F-31062 Toulouse cedex 912 3 CEPEL (Centro de Pesquisa em Energia Eletrica) ­ Av. Horácio Macedo, 354- Cidade Universitária - Ilha13 do Fundão, Rio de Janeiro - RJ - Brasil - Cep

Boyer, Edmond

487

personal_data_form.doc 2011-07-27 T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A  

E-Print Network [OSTI]

personal_data_form.doc 2011-07-27 T H E U N I V E R S I T Y O F B R I T I S H C O L U M B I A - PERSONAL DATA FORM - IDENTIFICATION ­ Provide all information in this section EMPLOYEE ID PREFIX FIRST NAME CURRENT HOME ADDRESS CITY PROV/ST POSTAL/ZIP COUNTRY SIGNATURES SIGNATURE DATE (yyyy-mm-dd) * Personal

Michelson, David G.

488

TP 1 M1 Informatique Apprentissage Automatique Premi`eres classifications : apprentissage et evaluation  

E-Print Network [OSTI]

de crit`eres observ´es sur 3 esp`eces diff´erentes d'iris de Gasp´esie (Setosa, Versicolor, Verginica suivant : def plot_2D(data, target, target_names): colors = cycle('rgbcmykw') # cycle de couleurs target_ids = range(len(target_names)) pl.figure() for i, c, label in zip(target_ids, colors, target_names): Universit

Denis, François

489

TP 1 M1 Informatique Apprentissage Automatique Premi`eres classifications : apprentissage et evaluation  

E-Print Network [OSTI]

de crit`eres observ´es sur 3 esp`eces diff´erentes d'iris de Gasp´esie (Setosa, Versicolor, Verginica suivant : def plot_2D(data, target, target_names): colors = cycle('rgbcmykw') # cycle de couleurs target_ids = range(len(target_names)) pl.figure() for i, c, label in zip(target_ids, colors, target_names): pl

Denis, François

490

Prepared by the Employment & Training Institute, University of Wisconsin-Milwaukee and the Milwaukee Area Workforce Investment Board  

E-Print Network [OSTI]

) 9 to 1 12 to 1 Tri-County (Racine, Kenosha, Walworth) 10 to 1 18 to 1 7-County Region 9 to 1 13 to 1 for the seven-county region, with 13 job seekers for every 1 full-time job opening, and a job gap ZIP codes 10 to 1 25 to 1 Milwaukee County 9 to 1 13 to 1 WOW (Waukesha, Ozaukee, Washington counties

Saldin, Dilano

491

Schrepel, Eric From: Jenkins, Kris  

E-Print Network [OSTI]

and the work you've done to identify 6,000 megawatts of new wind energy over the next 20 years. Bravo! However:44:15 --------------------------------------------------------------------------- fname: Robert lname: Gala address_2: 5401 1st Ave N city: Seattle state/province: WA zip/postal code Northwest, I applaud your plan to meet more than half of regional load growth with energy efficiency

492

Agri Energy LLC | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende NewSowitecAWSAgri-Energy LLC Place: Luverne, Minnesota Zip:

493

Aurora Cooperative | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWendeGuo Feng Bio Jump to: navigation, search Place: Nebraska Zip:

494

Utah UC 54-2-1, Public Utilities Definitions | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip: 84111 Phone

495

Utah's 2nd congressional district: Energy Resources | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip: 84111

496

Utility Energy Efficiency Schemes: Savings Obligations and Trading  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip: 84111Jump

497

Utility Rate | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip: 84111Jumpand

498

Utility Rate | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip: 84111Jumpandbuilding

499

Utility Savings & Refund, LLC | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip:

500

Veeco Solar Equipment formerly Mill Lane Engineering | Open Energy  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 East 300 South Place: Salt Lake City, Utah Zip:Scale