Powered by Deep Web Technologies
Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

shapefile | OpenEI  

Open Energy Info (EERE)

shapefile shapefile Dataset Summary Description Abstract: Monthly and annual average solar resource potential for the lower 48 states of the United States of America. Purpose: Provide information on the solar resource potential for the for the lower 48 states of the United States of America. Source NREL Date Released September 30th, 1999 (15 years ago) Date Updated October 30th, 2009 (5 years ago) Keywords csp GIS NREL shapefile solar United States Data application/zip icon Shapefile (zip, 3.6 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

2

Icon  

Science Journals Connector (OSTI)

An icon, or symbol, is a visual representation of a word or linguistic concept. Icons are used in selection-based iconic communication... Visual Schedules ). The ico...

Dr. Elizabeth Spencer

2013-01-01T23:59:59.000Z

3

Icon  

Science Journals Connector (OSTI)

Originally, the Greek word eikon...stood for an image, carrying some meaning as in typical portraits of sacred persons within the Orthodox Church. An operational definition of icon was given by Peirce [1] as anyt...

Stefano Levialdi

2009-01-01T23:59:59.000Z

4

icon  

Science Journals Connector (OSTI)

1. A pictorial representation of an idea or a concept. Note: In computer operations, icons may be used in windows or menus...2. In computer systems, a small, pictorial representation of an applicatio...

2001-01-01T23:59:59.000Z

5

Icons  

E-Print Network [OSTI]

Categorical orthodoxy has it that collections of ordinary mathematical structures such as groups, rings, or spaces, form categories (such as the category of groups); collections of 1-dimensional categorical structures, such as categories, monoidal categories, or categories with finite limits, form 2-categories; and collections of 2-dimensional categorical structures, such as 2-categories or bicategories, form 3-categories. We describe a useful way in which to regard bicategories as objects of a 2-category. This is a bit surprising both for technical and for conceptual reasons. The 2-cells of this 2-category are the crucial new ingredient; they are the icons of the title. These can be thought of as ``the oplax natural transformations whose components are identities'', but we shall also give a more elementary description. We describe some properties of these icons, and give applications to monoidal categories, to 2-nerves of bicategories, to 2-dimensional Lawvere theories, and to bundles of bicategories.

Lack, Stephen

2007-01-01T23:59:59.000Z

6

Multidimensional icons  

Science Journals Connector (OSTI)

Background: Direct manipulation interfaces, such as the Macintosh desktop, often represent objects with icons [l, 41. For example, text files are represented by icons. Selection of the icon invokes an editor to view the file it represents, thus the icon ...

Tyson R. Henry; Scott E. Hudson

1990-01-01T23:59:59.000Z

7

A Multitasking Icon Interpreter  

Science Journals Connector (OSTI)

This chapter describes MT Icon, a multitasking Icon interpreter that provides key features of Alamo for the Icon language. MT Icon allows multiple Icon programs to be loaded and run simultaneously ... other than ...

Clinton L. Jeffery

1999-01-01T23:59:59.000Z

8

Icon-function relationship in toolbar icons  

Science Journals Connector (OSTI)

Icons, widely used in computer programs, are part of the Graphical User Interface (GUI). They facilitate computer use regardless of users’ level of expertise. The authors report the results of a study focused on measuring performance of computer users in correctly and quickly associating toolbar icons and the action they represent in GUI. The study aimed to investigate the relationships between the rapidity of icon-function detection by user and user expertise, nature of icon (object or symbol) and context (appropriate, inappropriate, neutral). Findings indicated a scarce variation for different levels of expertise in relation to symbols, but only for icons depicting real-world objects, an overall better performance for objects and no significant response to the context. The discussion suggests future investigations in the field and offers practical considerations for GUI designers.

Stefano Passini; Filiberto Strazzari; Annamaria Borghi

2008-01-01T23:59:59.000Z

9

ANNOUNCEMENT: ZIP Code Information.  

Science Journals Connector (OSTI)

THE U. S. Post Office Department has announced that the use of ZIP Codes will be mandatory on all domestic addresses for subscriptions and other mailings by 1 January 1967. Accordingly, the American Institute of Physics has established a procedure for obtaining the necessary information. You are requested to follow this procedure exactly.First, do not submit a change of address request consisting merely of the addition of your ZIP Code. Second, if your address changes in any other way, do include the ZIP Code of the new address. Third, and most important, be sure to furnish your ZIP Code in accordance with instructions included with all renewal invoices and renewal orders which have been sent out by the AIP.Failure to conform to this procedure may result in delays.

1965-09-27T23:59:59.000Z

10

Icon Solar Power, LLC | Open Energy Information  

Open Energy Info (EERE)

Icon Solar Power, LLC Icon Solar Power, LLC Jump to: navigation, search Name Icon Solar Power, LLC Address 862 East Crescentville Rd. Place Cincinnati, Ohio Zip 45246 Sector Geothermal energy, Solar Product String representation "Agriculture;Bus ... g and education" is too long. Phone number 513-396-7777 Website http://www.iconsolarpower.com Coordinates 39.3016177°, -84.4536249° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.3016177,"lon":-84.4536249,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

11

Icon Abacus and Ghost Icons Eric A. Bier  

E-Print Network [OSTI]

Icon Abacus and Ghost Icons Eric A. Bier Palo Alto Research Center, Inc. 3333 Coyote Hill Road Palo that make document collection visualizations more informative. Icon abacus uses the horizontal position of icon groups to communicate document attributes. Ghost icons show linked documents by adding temporary

12

Execution Monitoring in MT Icon  

Science Journals Connector (OSTI)

MT Icon allows the execution of multiple Icon programs in almost any configuration, including execution ... monitoring. As motivated in Chapter 4, MT Icon characterizes monitoring as a special case of ... languag...

Clinton L. Jeffery

1999-01-01T23:59:59.000Z

13

"Dancing Icons" Detection Itamar Friedman  

E-Print Network [OSTI]

"Dancing Icons" Detection Itamar Friedman Technion Haifa, Israel ItamarF@tx.technion.ac.il Lihi these particular applications could be by taking a photo of their corresponding icons as displayed on our friend's screen. We then need to develop methods for au- tomatic detection and recognition of the icons

Zelnik-Manor, Lihi - Zelnik-Manor, Lihi

14

Co-expression in Icon  

Science Journals Connector (OSTI)

...Article Co-expression in Icon* S. B. Wample 1 R. E. Griswold 2...Arizona, Tucson, Arizona 85721, USA The Icon programming language has generators that...describes co-expressions, an extension to Icon that allows generators to be used at......

S. B. Wample; R. E. Griswold

1983-01-01T23:59:59.000Z

15

Renovating cultural icons  

Science Journals Connector (OSTI)

Three case studies of historic renovations are presented where acoustics were a key component of the renovation process. Each hall is an icon of the cultural life in the surrounding community. The first case study is Troy Savings Bank Music Hall a late nineteenth century musical gem where recent renovations (adding variable acoustic features) required that the unamplified acoustics be unaltered. The second example the Coronado Theatre in Rockford Illinois illustrates the sensitive modification of the acoustics in a historic vaudeville house adapted to modern multi?use requirements. Finally The Great Hall at The Cooper Union in New York City where Abraham Lincoln delivered his great ‘‘Right Makes Might’’ speech in 1860 is presented as an example of a renovation that utterly destroyed a historic acoustic environment and discusses how this can be avoided.

2005-01-01T23:59:59.000Z

16

What Makes an Icon Effective?  

SciTech Connect (OSTI)

Several criteria like conspicuity, legibility, and comprehension must be met for an icon to be effective. Previous studies found that visual and cognitive features of icons have significant influence on meeting the criteria for icon effectiveness. The aim of this paper is to present a review on visual features (color, shape, size) and cognitive features (familiarity, concreteness, complexity, meaningfulness, semantic distance). The influence of these features on icon effectiveness was studied. The relationships amongst cognitive features and ways to quantify cognitive features were identified. Suggestions regarding opportunities for future research on icons were also highlighted. Such a review would be helpful in formulating research plans and methodologies for icon studies in the future. In addition, this review would facilitate graphic designers to create more user-friendly icons in various contexts.

Ng, Annie Wy; Chan, Alan Hs [Department of Manufacturing Engineering and Engineering Management City University of Hong Kong, Kowloon Tong (Hong Kong)

2009-01-12T23:59:59.000Z

17

What Makes an Icon Effective?  

Science Journals Connector (OSTI)

Several criteria like conspicuity legibility and comprehension must be met for an icon to be effective. Previous studies found that visual and cognitive features of icons have significant influence on meeting the criteria for icon effectiveness. The aim of this paper is to present a review on visual features (color shape size) and cognitive features (familiarity concreteness complexity meaningfulness semantic distance). The influence of these features on icon effectiveness was studied. The relationships amongst cognitive features and ways to quantify cognitive features were identified. Suggestions regarding opportunities for future research on icons were also highlighted. Such a review would be helpful in formulating research plans and methodologies for icon studies in the future. In addition this review would facilitate graphic designers to create more user?friendly icons in various contexts.

Annie Wy Ng; Alan Hs Chan

2009-01-01T23:59:59.000Z

18

Biowarfare as a biopolitical icon  

Science Journals Connector (OSTI)

Heraclitus, the ancient Greek philosopher, wrote “ The bow (biós) is called life (bíos), but its work is death...” (Fr. 49 a). I have discussed some icons of the endless game between life and... ...

Emilio Mordini

2005-12-01T23:59:59.000Z

19

Index of /icons/small  

E-Print Network [OSTI]

Index of /icons/small. [ICO], Name · Last modified · Size · Description. [DIR], Parent Directory, -. [TXT], README.txt, 20-Nov-2004 15:16, 300. [IMG], back.gif ...

20

Puerto Rico | OpenEI  

Open Energy Info (EERE)

Puerto Rico Puerto Rico Dataset Summary Description Source The Wave Energy Resource Assessment project is a joint venture between NREL, EPRI, and Virginia Tech. EPRI is the prime contractor, Virginia Tech is responsible for development of the models and estimating the wave resource, and NREL serves as an independent validator and also develops the final GIS-based display of the data. Source National Renewable Energy Laboratory (NREL) Date Released September 27th, 2011 (3 years ago) Date Updated October 20th, 2011 (3 years ago) Keywords EPRI GIS NREL Puerto Rico shapefile United States Virginia Tech wave energy Data application/zip icon Download Data in CSV Format (zip, 3.4 MiB) application/zip icon Download Wave Power Density Shapefile (zip, 2.5 MiB) application/zip icon Download Wave Energy Period Shapefile (zip, 2.5 MiB)

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Measuring icon complexity: An automated analysis  

Science Journals Connector (OSTI)

Measures of icon designs rely heavily on surveys of the ... to which changes in the structure of an icon will alter its perceived complexity can be ... reduce development costs and time. Measures of icon complexi...

Alex Forsythe; Noel Sheehy; Martin Sawey

2003-05-01T23:59:59.000Z

22

ICON  

Science Journals Connector (OSTI)

Die kontrastmittelinduzierte Nephropathie ist mit die häufigste Ursache eines akuten Nierenversagens bei Herzpatienten. Je stärker die Nierenfunktion durch die kontrastmittelinduzierte Nephropathie beeinflusst...

2007-01-01T23:59:59.000Z

23

COMIB: Composite Icon Browser for Multimedia Databases  

Science Journals Connector (OSTI)

COMIB (COMposite Icon Browser) is a graphical user interface for ... multimedia objects simultaneously in a screen using composite icons, that may be thumbnails of the several...

Jaehyuk Cha…

1996-01-01T23:59:59.000Z

24

WILLIAMS COLLEGE MUSEUM OF ART Remington's Bronco Buster: From Art Icon to Pop Icon  

E-Print Network [OSTI]

WILLIAMS COLLEGE MUSEUM OF ART Remington's Bronco Buster: From Art Icon to Pop Icon February 20 Remington's Bronco Buster: From Art Icon to Pop Icon. This tour invites students to spend time getting College Museum of Art © 2010 4 Remington's Bronco Buster: From Art Icon to Pop Icon Frederic Sackrider

Aalberts, Daniel P.

25

iCons, 2011 iCons I case study outline and approach  

E-Print Network [OSTI]

� iCons, 2011 iCons I case study outline and approach I. Outline for an iCons I case study It is intended that each case study used in iCons I will proceed sequentially through stages, generate the creation products #12; � iCons, 2011 II. iCons I Exercises and Activities

Auerbach, Scott M.

26

Widget:AnchorIcon | Open Energy Information  

Open Energy Info (EERE)

AnchorIcon AnchorIcon Jump to: navigation, search This widget displays an anchor as a icon. Parameters include: page - page/article title for href link icon_class - icon css selector to use for the icon title - title to display for anchor (optional, default : page title) target - the target for the anchor (optional, default: _self) style - any additonal css style to apply to the anchor (optional) id - a unique id attribute to add to the element (optional) For example: {{#Widget:AnchorIcon | page=Gateway:Buildings | icon_class=icon buildings40}} Icon Types icon_class Displays... buildings30 greencircle30 -or- economy30 arrowscircle30 -or- contribute30 talkballoons30 -or- feedback30 help30 money30 -or- incentives30 info30 blueglobe30 -or- international30 outlet30 -or- smartgrid30 solar30

27

Culture Shock — Patient as Icon, Icon as Patient  

Science Journals Connector (OSTI)

...taught, and yet residents seem to have learned it no matter where in the United States they trained. The patient is still at the center, but more as an icon for another entity clothed in binary garments: the "iPatient." Often, emergency room personnel have already scanned, tested, and diagnosed, so that... Dr. Abraham Verghese discusses the problem with a “chart as surrogate for the patient” approach. He believes that if one eschews the skilled and repeated examination of the real patient, then tests, consultations, and procedures that might not be needed ...

Verghese A.

2008-12-25T23:59:59.000Z

28

USGS | OpenEI  

Open Energy Info (EERE)

USGS USGS Dataset Summary Description The USGS published spatial data to supplement the report published in 2007 entitled, Geologic Assessment of Undiscovered Oil and Gas Resources of the Black Warrior Basin Province, Alabama and Mississippi. The GIS shapefiles and related metadata are included here. Source USGS Date Released April 11th, 2007 (7 years ago) Date Updated Unknown Keywords gas GIS oil USGS Data application/zip icon au650101cg.zip (zip, 8.7 KiB) application/zip icon au650101g.zip (zip, 9 KiB) application/zip icon au650102cg.zip (zip, 145.6 KiB) application/zip icon au650102g.zip (zip, 7.2 KiB) application/zip icon au650281cg.zip (zip, 138.8 KiB) application/zip icon au650281g.zip (zip, 15.1 KiB) application/zip icon pr6500g.zip (zip, 86.9 KiB)

29

Icon Use by Different Language Groups: Changes in Icon Perception in Accordance with Cue Utility  

Science Journals Connector (OSTI)

This study shows that both icon and function label characteristics combine subtly to affect the way that individuals perceive icons. Icon users unconsciously use the cues available to ... , but also about how the...

Siné McDougall; Alexandra Forsythe…

2005-01-01T23:59:59.000Z

30

Widget:IconContainer | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Widget Edit History Facebook icon Twitter icon » Widget:IconContainer Jump to: navigation, search This widget provides a container around a custom icon. Parameters include: name - name of jquery-ui icon; see icons at bottom of this page color - css color of container, e.g. white or #a0a0a0 (hex color) widthx - css width of container (e.g. 12px, 2em), default 16 pixels widthy - css height of container (e.g. 12px, 2em), default 16 pixels margin - css margin of container, default is top 0px, right 5px, bottom 0px, left 5px cssstyle - css style to add, such as cssstyle=float:left iconcssclass - css class to add to icon, such as ui-icon-blue

31

String Scanning in the Icon Programming Language  

Science Journals Connector (OSTI)

...Article String Scanning in the Icon Programming Language R. E. Griswold * Department of Computer Science, The University...general-purpose programming language and describes how they have been introduced in the Icon programming language....

R. E. Griswold

1990-01-01T23:59:59.000Z

32

iCons, 2011 Cholera in Haiti  

E-Print Network [OSTI]

� iCons, 2011 Cholera in Haiti Handouts: 1. 1-page explainer of cholera outbreak) discussion of concept of Explainer #12; � iCons, 2011 2. Student teams begin work on Part 1

Auerbach, Scott M.

33

A Usability Evaluation of Public Icon Interface  

Science Journals Connector (OSTI)

Existing image codes interface needs additional visual marker and explanation of the service. To overcome these limitations, there were some researches to use a public icon as an anchor. The public icon is human-...

Sungyoung Yoon; Jonghoon Seo; Joonyoung Yoon…

2009-01-01T23:59:59.000Z

34

COMIB: COMposite Icon Browser for multimedia databases  

Science Journals Connector (OSTI)

COMIB(COMposite Icon Browser) is a graphical user interface for...composite icons, that may be thumbnails of the several nested attribute values of those objects. Users can specify these attributes with a mouse w...

Jaehyuk Cha; Sukho Lee

1996-11-01T23:59:59.000Z

35

RICE UNIVERSITY Computational Modeling of Icon Search  

E-Print Network [OSTI]

1 RICE UNIVERSITY Computational Modeling of Icon Search by Michael D. Fleetwood A THESIS SUBMITTED HOUSTON, TEXAS DECEMBER, 2001 #12;3 DECEMBER, 2001 ABSTRACT Computational Modeling of Icon Search by Michael Fleetwood As the use of graphical user interfaces expands into new areas, icons are becoming

Byrne, Mike

36

Icons at the interface: their usefulness  

Science Journals Connector (OSTI)

......April 1989 research-article Articles Icons at the interface: their usefulness Yvonne...this paper sets out to discuss how useful icons really area and whether they live up to...classification of the function and form of icons is outlined together with a proposal of......

Yvonne Rogers

1989-04-01T23:59:59.000Z

37

Icon Design Study in Computer Interface  

Science Journals Connector (OSTI)

As an important part of computer interference design, icon symbol under the digital age plays a central role of transmiting message between software and visitor. Many icon designers seldom participate in work at earlier stage, so a lot of their works is only beauty-oriented without consideration of the environment in which users and icons are. Combining thories of cognitive psychology and semiotics, this paper tells icon design features and principles in software interface, discusses the optimal design on visual interaction of icon as a graphic language, in order to better achieve message delivery.

Rushan Yan

2011-01-01T23:59:59.000Z

38

Erratum to: Breastfeeding in Byzantine icon art  

Science Journals Connector (OSTI)

Bartlett A (2005) Madonnas, models and maternity: icons of breastfeeding in the visual arts. http://www.usq.edu.au/resources/bartlettpaper.pdf . Accessed 23 O...

Ioannis D. Gkegkes; Vassiliki M. Darla…

2014-08-01T23:59:59.000Z

39

Georgia O'Keeffe's Radiator Building: Icon of Glamorous Gotham  

E-Print Network [OSTI]

Georgia O'Keeffe's Radiator Icon of Glamorous Gothamthirties remains today an icon of Americans' ongoing worship

Duvert, Elizabeth

1984-01-01T23:59:59.000Z

40

Growing an icon set: User acceptance of abstract and concrete icon styles  

Science Journals Connector (OSTI)

This research was conducted in order to evaluate 69 icons, which were designed to represent 23 telecommunications referents. Seven of these icons were previously proposed by the CIAJ (Communications ... 62 were d...

Leslie G. Tudor

1994-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

cwebch3 ICON cweb_ch3.ico cwebch4 ICON cweb_ch4.ico cwebs3 ...  

E-Print Network [OSTI]

cwebch3 ICON cweb_ch3.ico cwebch4 ICON cweb_ch4.ico cwebs3 ICON cweb_s3.ico cwebs4 ICON cweb_s4.ico dvi3 ICON dvi3.ico dvi4 ICON dvi4.ico gf3 ...

42

cwebch1 ICON cweb_ch1.ico cwebch2 ICON cweb_ch2.ico cwebs1 ...  

E-Print Network [OSTI]

cwebch1 ICON cweb_ch1.ico cwebch2 ICON cweb_ch2.ico cwebs1 ICON cweb_s1.ico cwebs2 ICON cweb_s2.ico dvi1 ICON dvi1.ico dvi2 ICON dvi2.ico gf1 ...

43

Material Aspects of Icons. A Review on Physicochemical Studies of Greek Icons  

Science Journals Connector (OSTI)

The tradition of icon painting is alive in the orthodox world up to the present day, since icons are not just objects of art expression but are chiefly sacred objects involved in worship. ... Characterization of binding media in the icons of post-Byzantine period would also enable researchers to investigate the validity of common assumptions about the influences of the Venetian style on Greek icon painting techniques from the 16th to the early 19th century, which up to now have been based mostly on information in artists’ handbooks. ... In addition to the overlay of soot, several superposed overpaintings as a result of interventions retouching the surface of icons have been undertaken in the past not by conservators but by iconographers, not with the intention of conservation of the artistic value of the icon but for the restoration of its iconographic and aesthetic integrity in order to continue to serve its function as liturgical object. ...

Sophia Sotiropoulou; Sister Daniilia

2010-04-27T23:59:59.000Z

44

Issues in the Development of 3D Icons Rob Erbacher  

E-Print Network [OSTI]

Issues in the Development of 3D Icons Rob Erbacher Georges Grinstein Institute for Visualization dimensions through the use of 3D icons. We briefly discuss geometric and color icons and the 2D textures they generate. We then exhibit a 3D icon, explain its parameters and features, and demonstrate how this icon

Erbacher, Robert F.

45

Hybrid Reasoning and the Future of Iconic Representations  

E-Print Network [OSTI]

Hybrid Reasoning and the Future of Iconic Representations Catherine RECANATI LIPN ­ CNRS UMR 7030 representation. Iconic representation, Analogical representation. Hybrid representation systems. Cognitive icons and represented objects. In many cases, this homomorphism yields to a very strong property called

Paris-Sud XI, Université de

46

Meaningful gestures: Electrophysiological indices of iconic gesture comprehension  

E-Print Network [OSTI]

Meaningful gestures: Electrophysiological indices of iconic gesture comprehension YING CHOON WU, USA Abstract To assess semantic processing of iconic gestures, EEG (29 scalp sites) was recorded to gestures were observed without overlapping positivity. These findings suggest that iconic gestures

Coulson, Seana

47

The Use of Multimodal Representation in Icon Interpretation  

Science Journals Connector (OSTI)

Identifying icon functions differs from naming pictures in that ... long period of time whereas the meaning of icons has often to be learned. This paper examines roles of icon characteristics such as complexity, ...

Siné McDougall; Alexandra Forsythe…

2009-01-01T23:59:59.000Z

48

The Performative Portrait: Iconic Embodiment in Ubiquitous Computing  

E-Print Network [OSTI]

Vladimir. 1983. The Meaning of Icons New York: St. Vladimir’from Keywords Avatar, portrait, icon, communication, bodyin the form of a simple icon of a running man. “Use your

Heinrich, Falk

2009-01-01T23:59:59.000Z

49

An icon-based software design tool  

SciTech Connect (OSTI)

The authors have developed a Windows-based iconic detailed design tool named BACCII++, which allows the user to design a program with icons representing all the major procedural and object-oriented programming constructs and data structures within a syntax-directed environment. The user can then generate syntactically correct code for any one of several text-based languages. This tool has been used successfully for several years in an academic environment; current research is focused on developing a BACCII-like tool which will be even more useful in a commercial setting.

Bagert, D.J.; Calloni, B.A. [Texas Tech Univ., Lubbock, TX (United States)

1996-12-31T23:59:59.000Z

50

Input Device Selection and Interaction Configuration with ICON  

Science Journals Connector (OSTI)

This paper describes ICON, a novel editor designed to configure a ... to actions into a graphical interactive application. ICON allows ‘power users’ to customise the...

Pierre Dragicevic; Jean-Daniel Fekete

2001-01-01T23:59:59.000Z

51

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

This is a property of type String. This is a property of type String. Pages using the property "Zip" Showing 25 pages using this property. (previous 25) (next 25) 1 10Charge Inc + 75001 + 12 Voltz Limited + LA8 9NH + 1366 Technologies + 02421 + 1Soltech Inc + 75081 + 1st Light Energy, Inc. + 953650 + 1st Mile + 2800 + 2 21 Century Solar Inc + 75042 + 21-Century Silicon, Inc. + 75081-1881 + 21st century Green Solutions LLC + 48439 + 25 x 25 America s Energy Future + 21093 + 2OC + BA1 7AB + 2degrees + OX2 7HT + 2e Carbon Access + 10280 + 3 3 Phases Energy Services LLC + CA 94129 + 3C Holding AG + 61118 + 3Degrees + 94111 + 3G Energi + TD5 7BH + 3GSolar + 97774 + 3M + 55144-1000 + 3P Energy GmbH + 19061 + 3S Industries AG Formerly 3S Swiss Solar Systems AG + CH-3006 + 3TIER + 98121 +

52

Verification Checklist Home Address: City: State: Zip:  

Broader source: Energy.gov (indexed) [DOE]

Indoor airPLUS Version 1 (Rev. 01) Verification Checklist Home Address: City: State: Zip: Section Requirements (Refer to full Indoor airPLUS Construction Specifications for details) Must Correct Builder Verified Rater Verified N/A Note: The Rev. 01 checklist has been modified to reflect only the additional Indoor airPLUS requirements and their corresponding section numbers that must be met after completing the ENERGY STAR checklists. ENERGY STAR remains a prerequisite for Indoor airPLUS certification. ENERGY STAR V3 Checklists Thermal Enclosure System Rater Checklist completed. o o Water Management System Builder Checklist completed. o o HVAC System Quality Installation Contractor Checklist completed. o o HVAC System Quality Installation Rater Checklist completed. o o

53

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

54

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

55

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

56

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

57

An iconic approach to representing climate change  

E-Print Network [OSTI]

1 An iconic approach to representing climate change Saffron Jessica O'Neill A thesis submitted-experts to be meaningfully engaged with the issue of climate change. This thesis investigates the value of engaging non-experts with climate change at the individual level. Research demonstrates that individuals perceive climate change

Feigon, Brooke

58

Byzantine Icons The Art and Science of Depiction  

E-Print Network [OSTI]

1 Byzantine Icons · 4.209 The Art and Science of Depiction · Fredo Durand, Julie Dorsey · Spring 2001 · Konstantinos Tsakonas, tsakonas@mit.edu Definitions Icon(): a Greek word that meansimage to write an icon. Project Focus Art&Science of Depiction Software Engineering Byzantine Icons Software

Durand, Frédo

59

Interpretation of Shape-Related Iconic Gestures in Virtual Environments  

E-Print Network [OSTI]

Interpretation of Shape-Related Iconic Gestures in Virtual Environments Timo Sowa and Ipke focused main- ly on deictic and emblematic gestures. Iconics, viewed as iconic signs in the sense idea towards a computational model of gesture semantics for iconic gestures. Based on an empirical

Wachsmut, Ipke

60

Byzantine Icons The Art and Science of Depiction  

E-Print Network [OSTI]

1 Byzantine Icons · 4.209 The Art and Science of Depiction · Fredo Durand, Julie Dorsey · Spring 2001 · Konstantinos Tsakonas, tsakonas@mit.edu Definitions Icon(): a Greek word that means image to write an icon. #12;2 Project Focus Art&Science of Depiction Software Engineering Byzantine Icons

Durand, Frédo

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Icon Scanning: Towards Next Generation QR Codes Itamar Friedman  

E-Print Network [OSTI]

Icon Scanning: Towards Next Generation QR Codes Itamar Friedman Technion Haifa, Israel itamarf-friendly way to obtain this particular applica- tion could be by taking a snapshot of its corresponding icon be thought of as icons with a binary pattern. In this paper we extend this to App-icons and propose

Zelnik-Manor, Lihi - Zelnik-Manor, Lihi

62

Visual Languages `94 Repenning, A., "Bending Icons: Syntactic and Semantic Transformation of Icons," Proceedings of the 1994 IEEE  

E-Print Network [OSTI]

Visual Languages `94 Reprint: Repenning, A., "Bending Icons: Syntactic and Semantic Transformation of Icons," Proceedings of the 1994 IEEE Symposium on Visual Languages, St. Louis, MO, 1994, pp. 296-303. Bending Icons: Syntactic and Semantic Transformations of Icons Alex Repenning Department of Computer

Repenning, Alexander

63

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

64

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont2Zip Property Type String Pages using the property "Incentive/Cont2Zip" Showing 25 pages using this property. (previous 25) (next 25) A AEP (Central and North) - CitySmart Program (Texas) + 75494 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - CitySmart Program (Texas) + 77002-4567 + AEP SWEPCO - Commercial Solutions Program (Texas) + 75494 + AEP SWEPCO - SCORE Program (Texas) + 75494 + AEP Texas - Commercial and Industrial Energy Efficiency Rebate Program (Texas) + 79602 + AEP Texas Central Company - CitySmart Program (Texas) + 77002-4567 + AEP Texas Central Company - Commercial Solutions Program (Texas) + 77002-4567 + AEP Texas Central Company - SCORE Program (Texas) + 77210-4567 +

65

Electrostatic zipping actuators and their applications to MEMS  

E-Print Network [OSTI]

Electrostatic actuation is the most common and well-developed method of generating motion on the micro scale. To overcome the challenge of providing both high force and large displacement, electrostatic zipping actuators ...

Li, Jian, Ph. D. Massachusetts Institute of Technology

2004-01-01T23:59:59.000Z

66

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

67

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

Zip Zip Jump to: navigation, search Property Name Incentive/Cont4Zip Property Type String Pages using the property "Incentive/Cont4Zip" Showing 18 pages using this property. A AEP (Central and North) - CitySmart Program (Texas) + 79602 + AEP (Central and SWEPCO) - Coolsaver A/C Tune Up (Texas) + 78401 + AEP (Central, North and SWEPCO) - Commercial Solutions Program (Texas) + 79602 + B Blue Ridge Electric Cooperative - Heat Pump Loan Program (South Carolina) + 29671 + C ComEd, Nicor Gas, Peoples Gas & North Shore Gas - Bonus Rebate Program (Illinois) + 60642 + E Energy Efficiency Fund (Electric) - Commercial and Industrial Energy Efficiency Programs (Connecticut) + 06037 + Entergy Arkansas - Commercial and Industrial Energy Efficiency Programs (Arkansas) + 72205 +

68

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

ContZip ContZip Jump to: navigation, search Property Name Incentive/ContZip Property Type String Pages using the property "Incentive/ContZip" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + 05633 + A AEP (Central and North) - Residential Energy Efficiency Programs (Texas) + 78746 + AEP (SWEPCO) - Residential Energy Efficiency Programs (Texas) + 75604-5926 + AEP Ohio (Electric) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio (Gas) - Residential Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Custom Project Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial Energy Efficiency Rebate Program (Ohio) + 43213 + AEP Ohio - Commercial New Construction Energy Efficiency Rebate Program (Ohio) + 43219 +

69

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

70

Design and evaluation of an adaptive icon toolbar  

Science Journals Connector (OSTI)

At the user's convenience, the adaptive bar offers suggestions for adding or removing command icons, based on the frequency and probability of ... adaptive behavior of displaying the frequency of each icon's use ...

Matjaz Debevc; Beth Meyer; Dali Donlagic…

1996-01-01T23:59:59.000Z

71

Multi-modal Sign Icon Retrieval for Augmentative Communication  

Science Journals Connector (OSTI)

This paper addresses a multi-modal sign icon retrieval and prediction technology for generating sentences ... focuses on 1) developing an effective TSL icon retrieval method, 2) investigating TSL prediction...

Chung-Hxien Wu; Yu-Hsien Chiu…

2001-01-01T23:59:59.000Z

72

Learning Neuroscience: An Interactive Case-Based Online Network (ICON)  

Science Journals Connector (OSTI)

We have developed an interactive case-based online network (ICON) that provides a new learning environment and ... one of Harvard's interfaculty science initiatives. ICON takes advantage of this cross-disciplinar...

James J. Quattrochi; Susan Pasquale…

2002-03-01T23:59:59.000Z

73

1 Copyright 2000 by ASME Proceedings of ICONE 8  

E-Print Network [OSTI]

1 Copyright © 2000 by ASME Proceedings of ICONE 8 8th International Conference on Nuclear Engineering April 2-6, 2000, Baltimore, MD USA ICONE-8320 STUDY OF ALLOYING ELEMENTS IN THE ZR MATRIX

Motta, Arthur T.

74

The use of character sets and character mappings in Icon  

Science Journals Connector (OSTI)

...Article The use of character sets and character mappings in Icon* R. E. Griswold Department of Computer Science, The University...properties and use of character sets and character mappings in the Icon programming language. Examples of programming techniques based......

R. E. Griswold

1980-01-01T23:59:59.000Z

75

Automatic Distinctive Icons for Desktop Interfaces U. Southern California  

E-Print Network [OSTI]

VisualIDs: Automatic Distinctive Icons for Desktop Interfaces J.P. Lewis CGIT Lab U. Southern.tex Figure 1: "Doodle" style file icons with name clustering. Abstract Although existing GUIs have a sense the form of custom icon assignments) is already possible in current op- erating systems, few if any users

Shahabi, Cyrus

76

Document Icons and Page Thumbnails: Issues in Construction of Document  

E-Print Network [OSTI]

Document Icons and Page Thumbnails: Issues in Construction of Document Thumbnails for Page appropriately. #12;Document Icons and Page Thumbnails: Issues in Construction of Document Thumbnails for Page, called doc- ument icons, are discussed; one algorithm, called log-area, seems most effective. 1

Janssen, Bill

77

Swiss delegation checks out iCons November 9, 2011  

E-Print Network [OSTI]

Swiss delegation checks out iCons November 9, 2011 Scientists from the ?�cole Polytechnique F for a one-day meeting with faculty, students, and staff of the Integrated Concentration in Science (iCons Sciences Building and spent the day learning how the UMass Amherst iCons program is structured to provide

Auerbach, Scott M.

78

RESEARCH ARTICLE Open Access Evaluating alignment quality between iconic  

E-Print Network [OSTI]

RESEARCH ARTICLE Open Access Evaluating alignment quality between iconic language and reference) is a compositional iconic language that aims to ease information retrieval in Electronic Health Records (EHR (UMLS). Three metrics were used to compare two VCM icons: binary comparison, crude Dice Similarity

Paris-Sud XI, Université de

79

Unintended Effects: Varying Icon Spacing Changes Users' Visual Search Strategy  

E-Print Network [OSTI]

Unintended Effects: Varying Icon Spacing Changes Users' Visual Search Strategy Sarah P. Everett control items, such as buttons and icons. Because this is so ubiquitous, it is important that the visual understanding of how the visual spacing between icons affects visual search times. We constructed an experiment

Byrne, Mike

80

Iconic Interfaces for Office Systems based on Video Games  

E-Print Network [OSTI]

Iconic Interfaces for Office Systems based on Video Games Saul Greenberg Department of Computer, R. (1988). Iconic interfaces for office systems based on video games. Canadian Artificial Intelligence, 17, October. Humour column. Executive Summary Although users are enthusiastic about modern icon

Greenberg, Saul

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Icon-targeted immunotherapy and photodynamic therapy for breast cancer  

Science Journals Connector (OSTI)

...Amer Assoc Cancer Res, Volume 46, 2005 Icon-targeted immunotherapy and photodynamic...2005] 4273 Background: We designed the Icon as a high affinity and specificity targeting...because the tumor vasculature is leaky. The Icon functions as a human antibody for tumor-specific...

Zhiwei Hu and Alan Garen

2005-05-01T23:59:59.000Z

82

iCons, 2011 Top 10 Scientific Achievements: Lesson Plan  

E-Print Network [OSTI]

� iCons, 2011 Top 10 Scientific Achievements: Lesson Plan Handouts: 1. 2? #12; � iCons, 2011 Research Is there any organizational structure the iCons I course. Explain what/how they should submit their final statements in SPARK, and give them

Auerbach, Scott M.

83

Icon Abacus: Positional Display of Document Attributes Eric A. Bier  

E-Print Network [OSTI]

Icon Abacus: Positional Display of Document Attributes Eric A. Bier Palo Alto Research Center, Inc This paper presents icon abacus, a space-efficient technique for displaying document attributes by automatic positioning of document icons. It displays the value of an attribute by using position on a single axis

84

Colloque ARCo'09 Enacting computer icons. The dynamics of interpretation  

E-Print Network [OSTI]

Colloque ARCo'09 Enacting computer icons. The dynamics of interpretation between forms and diagrams. ABSTRACT. The transposition of icons and interfaces in a plurality of devices and software questions simple icons used to send an email on an iPhone leads us to investigate C. S. Peirce's conception

Boyer, Edmond

85

New Case Study Writing iCons, 2011  

E-Print Network [OSTI]

New Case Study Writing � iCons, 2011 As the final team of iCons I. You will have an opportunity to see your work put to use through your participation as a mentor to the next cohort of iCons students. Several members of the student development team that worked

Auerbach, Scott M.

86

Generating Affective Music Icons in the Emotion Plane  

E-Print Network [OSTI]

Generating Affective Music Icons in the Emotion Plane Abstract In this paper, we discuss the generation of icons that represent the emotion expressed in music. We use the emotion plane for connecting the music with the icon shape affectively. A model to project arbitrary music on the plane is introduced

Lee, In-Kwon

87

Byzantine Icons The Art and Science of Depiction  

E-Print Network [OSTI]

Byzantine Icons · 4.209 The Art and Science of Depiction · Fredo Durand, Julie Dorsey · Spring 2001 · Konstantinos Tsakonas, tsakonas@mit.edu #12;Definitions Icon(): a Greek word that means image; an artistic a spiritual representation of a sacred person or event Iconography(): a Greek word that means to write an icon

Durand, Frédo

88

Replacing the Icon: Seventeenth-Century Tomb Monuments for Dutch Naval Heroes by Rombout Verhulst  

E-Print Network [OSTI]

RIVERSIDE Replacing the Icon: Seventeenth-Century Tombused to replace destroyed icons in the majority of thethe pre-Reformation icons. 29 28. Scholten, Sumptuous

Osenbaugh, Elizabeth Ryan

2011-01-01T23:59:59.000Z

89

Icon Design Principles for Preschoolers: Implications Derived from Child Development  

Science Journals Connector (OSTI)

To better design GUI for preschool users, this study suggests three icon design principles: the principle of obvious visibility, the principle of visual resemblance, and the principle of conceptual resemblance. The conceptual reasoning behind the proposed principles is borrowed from research areas of semiotics, picture-reading and neurodevelopment of children. These principles had also been applied to icon designs for the self-made story-authoring software, MyStory. With this application, the readability of the designed icons is investigated. Icon designs violating any proposed principles result in low readability. Five reasons for lower readability are proposed: unrealistic decorative designs, distorted written styles, experience void, overgeneralized association, and infrequently visible.

Shuhui Chiu; Chorng-Shiuh Koong; Sa-Hui Fan

2012-01-01T23:59:59.000Z

90

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

91

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

92

The Semiotics of Godot Compared with those of the Russian Icon  

Science Journals Connector (OSTI)

Boris Uspensky, in his work, The Semiotics of the Russian Icon, demonstrates that the ancient Russian icon may be deciphered through the language of ... is able to do this by analyzing the icon’s composition, a p...

Bernice D. Reid

1983-01-01T23:59:59.000Z

93

Effects of Icon Concreteness and Complexity on Semantic Transparency: Younger vs. Older Users  

Science Journals Connector (OSTI)

The semantic transparency of icons in mobile devices was investigated using 48 icons for 12 mobile phone functions. Icons included original ones as well as icons specifically designed for experimental purposes. I...

Sabine Schröder; Martina Ziefle

2008-01-01T23:59:59.000Z

94

Iowa | OpenEI  

Open Energy Info (EERE)

Iowa Iowa Dataset Summary Description Abstract: Annual average wind resource potential for the state of Iowa at a 50 meter height. Purpose: Provide information on the wind resource development potential within the state of Iowa. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. This shapefile was generated from a raster dataset with a 200 m resolution, in a UTM zone 12, datum WGS 84 projection system. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2003 (11 years ago) Date Updated December 30th, 2010 (4 years ago) Keywords GIS Iowa NREL shapefile wind Data application/zip icon Shapefile (zip, 4.6 MiB)

95

Indiana | OpenEI  

Open Energy Info (EERE)

Indiana Indiana Dataset Summary Description Abstract: Annual average wind resource potential for the state of Indiana at a 50 meter height. Purpose: Provide information on the wind resource development potential within the state of Indiana. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. This shapefile was generated from a raster dataset with a 200 m resolution, in a UTM zone 16 datum WGS 84 projection system. Source National Renewable Energy Laboratory (NREL) Date Released March 31st, 2004 (10 years ago) Date Updated March 02nd, 2009 (5 years ago) Keywords GIS Indiana NREL shapefile wind Data application/zip icon Shapefile (zip, 2.7 MiB)

96

Texas | OpenEI  

Open Energy Info (EERE)

Texas Texas Dataset Summary Description Abstract: Annual average wind resource potential for the state of Texas. Purpose: Provide information on the wind resource development potential within the state of Texas. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. This shapefile in a UTM zone 19, datum WGS 84 projection system. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2003 (10 years ago) Date Updated October 14th, 2010 (4 years ago) Keywords GIS NREL shapefile Texas wind Data application/zip icon Shapefile (zip, 315.8 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

97

New York | OpenEI  

Open Energy Info (EERE)

York York Dataset Summary Description Abstract: Annual average wind resource potential for New York at a 50 meter height. Purpose: Provide information on the wind resource development potential in New York. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. This shapefile was generated from a raster dataset with a 200 m resolution, in a UTM zone 18, datum WGS 84 projection system. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2003 (11 years ago) Date Updated November 01st, 2011 (3 years ago) Keywords GIS New York NREL shapefile wind Data application/zip icon Shapefile (zip, 5 MiB) Quality Metrics

98

hawaii | OpenEI  

Open Energy Info (EERE)

hawaii hawaii Dataset Summary Description Abstract: Annual average wind resource potential for the state of Hawaii at a 50 meter height. Purpose: Provide information on the wind resource development potential within the state of Hawaii. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. This shapefile was generated from a raster dataset with a 200 m resolution, in a UTM zone 4, datum WGS 84 projection system. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2004 (10 years ago) Date Updated May 04th, 2009 (5 years ago) Keywords GIS hawaii NREL shapefile wind Data application/zip icon Shapefile (zip, 2 MiB)

99

South Carolina | OpenEI  

Open Energy Info (EERE)

Carolina Carolina Dataset Summary Description Abstract: Annual average wind resource potential for the state of South Carolina at a 50 meter height. Purpose: Provide information on the wind resource development potential within the state of South Carolina. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. This shapefile was generated from a raster dataset with a 200 m resolution, in a WGS 84 projection system. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2003 (10 years ago) Date Updated June 04th, 2009 (5 years ago) Keywords GIS NREL shapefile South Carolina wind Data application/zip icon Shapefile (zip, 417.8 KiB)

100

Evaluating an icon of population persistence: the Devil's Hole pupfish  

Science Journals Connector (OSTI)

...research-article Research articles 1001 60 197 Evaluating an icon of population persistence: the Devil's Hole pupfish J. Michael...Based on our analyses, we conclude that rather than being an icon of unusual persistence in isolation, the Devil's Hole pupfish...

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

A Cool Roof for the Iconic Cyclotron | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

A Cool Roof for the Iconic Cyclotron A Cool Roof for the Iconic Cyclotron A Cool Roof for the Iconic Cyclotron July 15, 2011 - 5:42pm Addthis Berkeley Lab's iconic building, the Advanced Light Source, is getting a new cool roof, righ, that will reflect sunlight back into the atmosphere, playing a small part in mitigating global warming. On left, Ernest Orlando Lawrence talks to colleagues at the construction site of the cyclotron, built in 1941. | Courtesy of Lawrence Berkeley National Laboratory; Roy Kaltschmidt, Berkeley Lab Public Affairs Berkeley Lab's iconic building, the Advanced Light Source, is getting a new cool roof, righ, that will reflect sunlight back into the atmosphere, playing a small part in mitigating global warming. On left, Ernest Orlando Lawrence talks to colleagues at the construction site of the cyclotron,

102

A Cool Roof for the Iconic Cyclotron | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

A Cool Roof for the Iconic Cyclotron A Cool Roof for the Iconic Cyclotron A Cool Roof for the Iconic Cyclotron July 15, 2011 - 5:42pm Addthis Berkeley Lab's iconic building, the Advanced Light Source, is getting a new cool roof, righ, that will reflect sunlight back into the atmosphere, playing a small part in mitigating global warming. On left, Ernest Orlando Lawrence talks to colleagues at the construction site of the cyclotron, built in 1941. | Courtesy of Lawrence Berkeley National Laboratory; Roy Kaltschmidt, Berkeley Lab Public Affairs Berkeley Lab's iconic building, the Advanced Light Source, is getting a new cool roof, righ, that will reflect sunlight back into the atmosphere, playing a small part in mitigating global warming. On left, Ernest Orlando Lawrence talks to colleagues at the construction site of the cyclotron,

103

Mapping Information to Audio and Tactile Icons Eve Hoggan1,2  

E-Print Network [OSTI]

Mapping Information to Audio and Tactile Icons Eve Hoggan1,2 , Roope Raisamo2 and Stephen Brewster1 and tactile icons. Our research considers the following question: how can audio and tactile icons be designed the use of icons such as Auditory Icons [8], Earcons [3], Tactons [4] and Haptic Icons [14]. Results

Williamson, John

104

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department...  

Office of Environmental Management (EM)

Power Up Twenty Steps to Zip a Zipper Photo of the Week: Power Up Twenty Steps to Zip a Zipper April 4, 2014 - 10:30am Addthis On Feb. 18, 2014, Argonne hosted its 19th annual...

105

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Organization Organization Address Place Zip Notes Website Region Organization Organization Address Place Zip Notes Website Region Adirondack North Country Association Adirondack North Country Association Main Street Suite Saranac Lake New York http www adirondack org Northeast NY NJ CT PA Area African Renewable Energy Alliance AREA African Renewable Energy Alliance AREA Online http area network ning com xg source msg mes network Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies

106

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institution Name Institution Name Address Place Zip Notes Website Region Institution Name Institution Name Address Place Zip Notes Website Region ARCH Venture Partners Texas ARCH Venture Partners Texas Bridgepoint Parkway Bldg Suite Austin Texas http www archventure com Texas Area ARCH Venture Partners Washington ARCH Venture Partners Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area African Wind Energy Association South Africa African Wind Energy Association South Africa South Africa http www afriwea org en south africa htm Alternative Energy Institute Alternative Energy Institute russell long blvd Canyon Texas http www windenergy org Texas Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org

107

Bill Sergeant ? An icon of Oak Ridge Security  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Bill Sergeant - An icon of Oak Ridge Security On Friday, February 18, 2011, I attended the burial and celebration of life of Bill Sergeant. He was loved by family, admired by...

108

Icon and Abduction: Situatedness in Peircean Cognitive Semiotics  

Science Journals Connector (OSTI)

Icons, indices, and symbols are differentiated by...12]). This typology exhibits a property capable of functioning as an operational criterion to distinguish different kinds of signs: the relative dependence of s...

Pedro Atã; João Queiroz

2014-01-01T23:59:59.000Z

109

The Doctor by Luke Fildes: An Icon in Context  

Science Journals Connector (OSTI)

The Doctor...by Sir Luke Fildes is probably the best-known medical painting in the Western world, having been reproduced millions of times and achieving the status of an icon. Although both lay a...

Y. Michael Barilan

2007-06-01T23:59:59.000Z

110

Using Data Bars, Color Scales, Icon Sets, and Sparklines  

Science Journals Connector (OSTI)

In this chapter, we’ll look at how you can use four graphical elements to give your worksheets more visual appeal and oomph without using full-scale charts. These four elements are data bars, color scales, icon s...

Guy Hart-Davis

2011-01-01T23:59:59.000Z

111

Non-compensatory Aggregation of Social Indicators: An Icon Representation  

Science Journals Connector (OSTI)

The aim of this work is to provide an original graphical method, called “Traveller Icon” plot, for representing the non-compensatory...2010). The proposed method allows not only visualizing and analyzing the mess...

Matteo Mazziotta; Adriano Pareto

2014-01-01T23:59:59.000Z

112

iCons, 2011 Alzheimers and Aluminum: Lesson Plan  

E-Print Network [OSTI]

© iCons, 2011 Alzheimers and Aluminum: Lesson Plan Handouts to explore mechanistic link between Alzheimer's and aluminum 5. Brief proposal expanding Points to Aluminum's Link With Alzheimer's Disease" from 1989. Provide handout

Auerbach, Scott M.

113

Computer Operation Techniques Using Physical Capsule Icons Yuta Tsukada Jiro Tanaka  

E-Print Network [OSTI]

Computer Operation Techniques Using Physical Capsule Icons Yuta Tsukada Jiro Tanaka 1. Physical Icon Phicon GUI 2. mediaBlocks[1] IconSticker[2] mediaBlocks Icon factors in computing systems, pp.31-32 (1999). [2] Siio Itiro and Yoshiaki Mima, "IconStickers: Converting

Tanaka, Jiro

114

Modeling Icon Search in ACT-R/PM Michael D. Fleetwood and Michael D. Byrne  

E-Print Network [OSTI]

Modeling Icon Search in ACT-R/PM Michael D. Fleetwood and Michael D. Byrne {fleet, byrne As the use of graphical user interfaces expands into new areas, icons are becoming an increasingly important with using icons. One aspect of icons, icon borders, has been proposed as a means of adding information

Byrne, Mike

115

Becoming Joaquin Murrieta: John Rollin Ridge and the Making of an Icon  

E-Print Network [OSTI]

Heroines, and Saints: Cultural Icons of Mexico’s NorthwestRidge and the Making of an Icon By Blake Michael Hausman ARidge and the Making of an Icon by Blake Michael Hausman

Hausman, Blake Michael

2011-01-01T23:59:59.000Z

116

Graphics and Semantics: The Relationship between What Is Seen and What Is Meant in Icon Design  

Science Journals Connector (OSTI)

Visual icons can be considered as a means for ... the relationship between the users’ interpretation of icons and the meaning that designers intend icons to convey. Focussing on interface users’ understanding of

Sarah Isherwood

2009-01-01T23:59:59.000Z

117

Improving Document Icon to Re-find Efficiently What You Need  

Science Journals Connector (OSTI)

It is common that documents are represented by document icon in graphical user interfaces. The document icon facilitates user to retrieve documents, but it ... accessed to. Our paper presents a document icon on w...

Changzhi Deng; Mingjun Zhou; Feng Tian…

2007-01-01T23:59:59.000Z

118

Icon Placement Regularization for Jammed Profiles: Applications to Web-Registered Personnel Mining  

Science Journals Connector (OSTI)

A new icon spotting method for designing a user-friendly GUI is described. Here, each icon can represent continuous and discrete vector data ... possibly high-dimensional. An important issue is icon-margin adjust...

Hiroyuki Kamiya; Ryota Yokote; Yasuo Matsuyama

2013-01-01T23:59:59.000Z

119

The Effect of Morphological Elements on the Icon Recognition in Smart Phones  

Science Journals Connector (OSTI)

This study aims to explore the effect of morphological elements on the icon recognition in smart phone. 42 icons were first selected and classified in a ... based on its visual design elements. Then, icons were e...

Chiwu Huang; Chieh-Ming Tsai

2007-01-01T23:59:59.000Z

120

Icon Language-Based Auxiliary Communication System Interface for Language Disorders  

Science Journals Connector (OSTI)

The icon language interface is designed to provide the ... s vocabulary and their meanings applied to the icons will be retrieved by the use of ... morpheme, phrase and semantic analysis techniques. The icon type...

Kyonam Choo; Yoseop Woo; Hongki Min…

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Why Do Robots Rebel? The Labor History of a Cultural Icon  

E-Print Network [OSTI]

Labor History of a Cultural Icon “Robots of the world! ManyLabor History of a Cultural Icon Tobias Higbie University ofHistory of a Cultural Icon Abstract: This essay examines the

Higbie, Tobias

2012-01-01T23:59:59.000Z

122

Defect characterization and classification for the ICON inspection reliability trials  

SciTech Connect (OSTI)

A major series of inspection reliability trials have been conducted as part of the ICON project, a THERMIE Joint Industry project. Part of the ICON work involved developing a procedure for characterization of the library of cracks. This will be reported in the paper. A second area considered was that of defect classification. This involved a reassessment of previously used classification, in the light of risk based inspection scheduling requirements, and the introduction of a new classification based on PD6493. This work will also be reported together with examples of the measured Probability of Detection curves.

Dover, W.D.; Rudlin, J. [University College London (United Kingdom). NDE Center

1996-12-31T23:59:59.000Z

123

The marine biodiversity curve is an icon of paleobiology. The familiar curve shows  

E-Print Network [OSTI]

The marine biodiversity curve is an icon of paleobiology. The familiar curve shows increasing. Although the iconic diversity curve might be specious, the pattern of Evolutionary Faunas

Waxman, David

124

UAE | OpenEI  

Open Energy Info (EERE)

UAE UAE Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (DNI) for United Arab Emirates (UAE). The data are available for monthly and annual sums stored in a ESRI-Shapefile. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released Unknown Date Updated February 19th, 2009 (5 years ago) Keywords DLR GHI GIS solar SWERA UAE UNEP United Arab Emirates Data application/zip icon Download Shapefile (zip, 31.1 MiB) text/csv icon Download Data (csv, 151.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

125

United Arab Emirates | OpenEI  

Open Energy Info (EERE)

Arab Emirates Arab Emirates Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (DNI) for United Arab Emirates (UAE). The data are available for monthly and annual sums stored in a ESRI-Shapefile. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released Unknown Date Updated February 19th, 2009 (5 years ago) Keywords DLR GHI GIS solar SWERA UAE UNEP United Arab Emirates Data application/zip icon Download Shapefile (zip, 31.1 MiB) text/csv icon Download Data (csv, 151.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

126

Solar: monthly direct normal (DNI) GIS data at 10km resolution for  

Open Energy Info (EERE)

for for Bangladesh from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for Bangladesh for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords Bangladesh DLR DNI GEF solar SWERA UNEP Data text/csv icon Download Data (csv, 915.2 KiB) application/zip icon Download Shapefile (zip, 488 KiB)

127

Solar: monthly and annual average direct normal (DNI) GIS data at 10km  

Open Energy Info (EERE)

Kenya from DLR Kenya from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for Kenya for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI GEF GIS Kenya solar SWERA UNEP Data text/csv icon Download Data (csv, 2.5 MiB) application/zip icon Download Shapefile (zip, 1.3 MiB)

128

Solar: monthly and annual average direct normal (DNI) GIS data at 10km  

Open Energy Info (EERE)

Ghana from DLR Ghana from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for Ghana for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI Ghana solar SWERA UNEP Data text/csv icon Download Data (csv, 1 MiB) application/zip icon Download Shapefile (zip, 519.6 KiB)

129

DLR | OpenEI  

Open Energy Info (EERE)

DLR DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (DNI) for United Arab Emirates (UAE). The data are available for monthly and annual sums stored in a ESRI-Shapefile. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released Unknown Date Updated February 19th, 2009 (5 years ago) Keywords DLR GHI GIS solar SWERA UAE UNEP United Arab Emirates Data application/zip icon Download Shapefile (zip, 31.1 MiB) text/csv icon Download Data (csv, 151.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

130

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

West China from DLR West China from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for China for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords China CRED CREIA DLR GHI GIS solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 4.4 MiB) text/csv icon Download Data (csv, 8.9 MiB)

131

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

Ghana from DLR Ghana from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Ghana for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the documentation file for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR Ghana GHI GIS solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 504 KiB) text/csv icon Download Data (csv, 1 MiB)

132

Solar: monthly and annual average direct normal (DNI) GIS data at 10km  

Open Energy Info (EERE)

Nepal from DLR Nepal from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for Nepal for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI GIS Nepal solar SWERA UNEP Data text/csv icon Download Data (csv, 1.2 MiB) application/zip icon Download Shapefile (zip, 600.4 KiB)

133

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

Ethiopia from DLR Ethiopia from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Ethiopia for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the documentation file for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR Ethiopia GEF GHI GIS solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 2.8 MiB) text/csv icon Download Data (csv, 5.6 MiB)

134

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

Nepal from DLR Nepal from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Nepal for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR GEF GHI GIS Nepal solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 593.8 KiB) text/csv icon Download Data (csv, 1.2 MiB)

135

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

Sri Lanka from DLR Sri Lanka from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Sri Lanka for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR GHI GIS solar Sri Lanka SWERA UNEP Data text/csv icon Download Data (csv, 296.1 KiB) application/zip icon Download Shapefile (zip, 153.7 KiB)

136

Solar: monthly and annual average direct normal (DNI) GIS data at 10km  

Open Energy Info (EERE)

China from DLR China from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for China for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords China CRED CREIA DLR DNI GEF GIS solar SWERA UNEP Data text/csv icon Download Data (csv, 8.8 MiB) application/zip icon Download Shapefile (zip, 4.4 MiB)

137

Solar: monthly global horizontal (GHI) GIS data at 10km resolution for  

Open Energy Info (EERE)

Bangladesh from DLR Bangladesh from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Bangladesh for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords Bangladesh DLR GEF GHI GIS solar SWERA UNEP Data text/csv icon Download Data (csv, 916.5 KiB) application/zip icon Download Shapefile (zip, 479.3 KiB)

138

Solar: monthly and annual average direct normal (DNI) GIS data at 10km  

Open Energy Info (EERE)

Sri Lanka from DLR Sri Lanka from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Direct Normal Irradiance (DNI) for Sri Lanka for the years 2000, 2002 and 2003. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the country report for additional background information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI GEF GIS solar Sri Lanka SWERA UNEP Data application/zip icon Download Shapefile (zip, 155.1 KiB) text/csv icon Download Data (csv, 295.7 KiB)

139

Solar: monthly and annual average global horizontal (GHI) GIS data at 10km  

Open Energy Info (EERE)

Kenya from DLR Kenya from DLR Dataset Summary Description (Abstract): Data of high resolution (10kmx10km) Global Horizontal Irradiance (GHI) for Kenya for the years 2000, 2001 and 2002. The data are available for monthly and annual sums stored in a ESRI-Shapefile. Please read the documentation file for additional information. (Purpose): The data are helpful for the assessment of the solar potential of the country and can give project developer a first impression of the solar resource of the country. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR GEF GHI GIS Kenya NREL solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 1.3 MiB) text/csv icon Download Data (csv, 2.5 MiB)

140

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

Electric Utility Company Assigned to a Zip Code? Electric Utility Company Assigned to a Zip Code? Home I have found an error in the utility company assigned to a zip code. I am not sure if the "assigned" utility company covers part of the zip code in question or not. How do I report an error like this for correction? Thanks. Submitted by Conroyt on 23 May, 2013 - 09:01 1 answer Points: 0 Thanks for submitting this. The Utilities Gateway (http://en.openei.org/wiki/Gateway:Utilities) uses the developer.nrel.gov service for zip-code lookups (http://developer.nrel.gov/doc/api/utility_rates/v3). This in turn uses Google for geocoding, and finds the centroid of the geographic region in question. This means that the result is based on the center of a zip code region, which may have no data. This question is timed well as we are

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Structure and application of IconCache.db files for digital forensics  

Science Journals Connector (OSTI)

Anti-forensics has developed to prevent digital forensic investigations, thus forensic investigations to prevent anti-forensic behaviors have been studied in various area. In the area of user activity analysis, ''IconCache.db'' files contain icon cache ... Keywords: Anti-forensics, Digital forensics, Icon, IconCache.db, User behavior

Chan-Youn Lee, Sangjin Lee

2014-06-01T23:59:59.000Z

142

A Process for Anticipating and Executing Icon Selection in Graphical User Interfaces  

E-Print Network [OSTI]

A Process for Anticipating and Executing Icon Selection in Graphical User Interfaces David M. Lane presents a system for predicting the icon a user will select from an icon toolbar, based on command use that only predicted the most frequently used icon choices was better than one that predicted all choices

Lane, David

143

Modeling and Recognition of Landmark Image Collections Using Iconic Scene Graphs  

E-Print Network [OSTI]

Modeling and Recognition of Landmark Image Collections Using Iconic Scene Graphs Xiaowei Li images share a common 3D structure. Each valid cluster is then represented by a single iconic view, and geometric relationships between iconic views are captured by an iconic scene graph. In addition to serving

Lazebnik, Svetlana

144

Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems  

E-Print Network [OSTI]

Intelligent Icons: Integrating Lite-Weight Data Mining and Visualization into GUI Operating Systems possibility of unexpected and serendipitous discoveries. Our system works by replacing the standard file icons with automatically created icons that reflect the contents of the files in a principled way. We call such icons

Zordan, Victor

145

A semi-automatic semantic method for mapping SNOMED CT concepts to VCM icons  

E-Print Network [OSTI]

A semi-automatic semantic method for mapping SNOMED CT concepts to VCM icons Jean-Baptiste Lamya of Concept in Medicine) is an iconic lan- guage for representing key medical concepts by icons. How- ever icons to the terms of these terminologies. Here, we present and evaluate a semi-automatic semantic

Paris-Sud XI, Université de

146

Iconic gestures in face-to-face TV interviews Maria Koutsombogera1,2  

E-Print Network [OSTI]

Iconic gestures in face-to-face TV interviews Maria Koutsombogera1,2 and Harris Papageorgiou1 1,xaris}@ilsp.gr Abstract. This paper presents a study of iconic gestures as attested in a corpus of Greek face significance of the iconic gestures. We attempt to classify the iconic gestures attested according

Kouroupetroglou, Georgios

147

Age-related differences in the initial usability of mobile device icons Rock Leunga  

E-Print Network [OSTI]

Age-related differences in the initial usability of mobile device icons Rock Leunga *, Joanna Mc usability problems to address this issue, little work has looked at whether existing graphical icons study and a follow-up experimental study to determine which icon characteristics help initial icon

McGrenere, Joanna

148

NSF funds iCons and HCC interdisciplinary renewable energy labs The campus' Integrated Concentration in Science (iCons) program and  

E-Print Network [OSTI]

NSF funds iCons and HCC interdisciplinary renewable energy labs The campus' Integrated Concentration in Science (iCons) program and Holyoke Community College (HCC) have teamed up to build state to participate in innovative, multi-disciplinary, student-driven research in renewable energy. iCons and HCC

Auerbach, Scott M.

149

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

150

Performance trends for POD as measured in the ICON project  

SciTech Connect (OSTI)

Base line probability of detection (POD) data is often obtained under semi-ideal conditions such as laboratory diving trials. This performance may be affected by in-service complications such as deep water, corrosion, method of deployment, and also specimen material and geometry. The ICON project has included a wide range of test conditions allowing the development of performance trends to predict POD under non ideal conditions. Examples of these performance trends will be described in the paper.

Rudlin, J.; Dover, W.D. [University College London (United Kingdom). NDE Centre

1996-12-31T23:59:59.000Z

151

Iconic prosody and information in spontaneous oral narrative  

Science Journals Connector (OSTI)

The information interchange on cognitive categories of the mental representation of referents (concepts) interrelated with prosodic marking (levels of phonological prominence) have been studied. Speakers actualize a limited amount of information inactivating backwards. These cognitive processes appear in three states of the referents: activation semi?activation and inactivation. In activation a concept would be focalized in actual stream of consciousness. In semi?activation the information is situated in a peripheral zone of consciousness: the concept was already activated. In inactivation the concept would be activated in the hearer’s conscience for the first time. These states were analyzed through data extracted from spontaneous narrative discourses obtained from an Argentinean Spanish speaker. The iconicity of prosodic prominences a correlation between the phonetic encoding and the mental status of information weight was explored acoustically. Measurements were made through F0 data normalized by a logarithmic z?score transformation calculated in the highest value of an item classified among one of the three states. Findings were similar to previous research on semi?spontaneous materials [G. Toledo 16th International Congress on Acoustics 4aSC1]: lower prominences were the marking of activation and semi?activation and higher prominences were the feature of inactivation i.e. a degree of prosodic iconicity.

Guillermo Andrés Toledo

1999-01-01T23:59:59.000Z

152

The Impact of Different Icon Sets on the Usability of a Word Processor  

Science Journals Connector (OSTI)

This paper discusses the results of usability tests obtained when testing different sets of icons in a word processor environment. An alternative set of icons was developed for a subset of word processor function...

Tanya R. Beelders; P. J. Blignaut…

2007-01-01T23:59:59.000Z

153

Espbase: A microsoft access tool for selecting symbol and icon sets for usability  

Science Journals Connector (OSTI)

The ESPbase provides a tool for storing symbols and icons along with information about their characteristics. Information ... complexity, familiarity, and meaningfulness. Symbols and icons can be accessed on the ...

Oscar de Bruijn; Siné McDougall…

1999-09-01T23:59:59.000Z

154

INAA in the studies of icon paintings originating from South-Eastern Poland  

Science Journals Connector (OSTI)

The purpose of this work was to analyze lead white pigment from icons of 15 th–18 th centuries, collected ... that the lead white used in the analyzed icon paintings, constituted a unified, very typical...

E. Pa?czyk; J. Giemza; L. Wali?

2008-11-01T23:59:59.000Z

155

Application of Spectral Information to Investigate Historical Materials – Detection of Metameric Color Area in Icon Images -  

Science Journals Connector (OSTI)

The spectral reflectance of Icons is estimated from RGB digital images taken ... applied to detect metameric color areas in the Icons. In this paper, two detection methods ... examined by using a test chart and t...

Kimiyoshi Miyata; Hannu Laamanen; Timo Jaaskelainen; Markku Hauta-Kasari…

2005-01-01T23:59:59.000Z

156

Integrated Concentration in Science, 2012 High Fructose Corn Syrup a mini iCons case study  

E-Print Network [OSTI]

� Integrated Concentration in Science, 2012 High Fructose Corn Syrup� a mini iCons case study knowledge affect you? What iCons learning goals did you meet with this case study, and how? How could you

Auerbach, Scott M.

157

When Does a Difference Make a Difference? A Snapshot on Global Icon Comprehensibility  

Science Journals Connector (OSTI)

Global markets require global solutions, especially in user interface design. There are differences between cultures – but do those differences call for different icon designs? This paper provides a snapshot on icon

Sonja Auer; Ester Dick

2007-01-01T23:59:59.000Z

158

An Algorithm for Icon Labelling on a Real-Time Map  

Science Journals Connector (OSTI)

An algorithm has been developed for icon labelling on a real-time map. The ... on a least-disturbing definition and positions the icons in an area where they obscure the ... has been performed which demonstrates ...

Lars Harrie; Hanna Stigmar; Tommi Koivula…

2005-01-01T23:59:59.000Z

159

In Memoriam: Donald L. Morton, MD (1934–2014): An Icon in Surgical Oncology  

Science Journals Connector (OSTI)

Donald Morton was truly a legend in surgical oncology, an icon as a surgical investigator, a pioneer in...

Charles M. Balch MD; FACS; Mark S. Roh MD…

2014-05-01T23:59:59.000Z

160

Do we get actual vendor name while we searched with zip code...  

Open Energy Info (EERE)

Co has utility id 14006 located in Ohio". But I had also check the zip code in google earth, It falling in other state "Rincorn, PR". Please let me know? Submitted by SUTHARI on...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

THE DEPLOYMENT OF ZIP NON-EQUILIBRIUM PHONON DETECTORS IN CDMS II  

E-Print Network [OSTI]

operating these Si and Ge Z-sensitive Ionization and Phonon (ZIP) detectors at the Stanford Underground Facility are reported. 1 Surface electron events The Cryogenic Dark Matter Search (CDMS) 1 utilizes

California at Berkeley, University of

162

A Multimedia Example (Please Click on Icons Visit: http://www.ieee-uffc.org/tr/)  

E-Print Network [OSTI]

1078 A Multimedia Example (Please Click on Icons ­ Visit: http://www.ieee-uffc.org/tr/) Abstract on Ultrasonics, Ferroelectrics, and Frequency Con- trol (TUFFC). Authors may use the icon link to include a color: Please click on the movie icon to see a movie. The two movies below give you an idea on the file size

Lu, Jian-yu

163

debussy@cs.yonsei.ac.kr, iklee@yonsei.ac.kr Affective Icons for Music Exploring  

E-Print Network [OSTI]

O debussy@cs.yonsei.ac.kr, iklee@yonsei.ac.kr Affective Icons for Music Exploring Min and colors of harmonograph curves. These curves can be used as icons for music retrieval, and we demonstrate. This approach is compatible with a standard icon-based file browser. . Introduction Since the appearance

Lee, In-Kwon

164

Iconizer: A Framework to Identify and Create Effective Representations for Visual Information Encoding  

E-Print Network [OSTI]

1 Iconizer: A Framework to Identify and Create Effective Representations for Visual Information, the degree of semantics encoded in these visual representations is still quite limited. The use of icons databases to help users identify icons suitable to visually encode abstract semantic concepts. Keywords

Mueller, Klaus

165

iCons students work on science problems that capture their interest and prepare them for  

E-Print Network [OSTI]

iCons students work on science problems that capture their interest and prepare them for success to overcoming them. Launched in 2010, iCons (Integrated Concentration in Science) is preparing the next and attitudes are equally emphasized. "At its essence, iCons is student-driven learning and reflects the need

Auerbach, Scott M.

166

The iCons Four Year Curriculum Plan Contact: iCons@cns.umass.edu  

E-Print Network [OSTI]

The iCons Four Year Curriculum Plan Contact: iCons@cns.umass.edu Website: http://www.cns.umass.edu/icons-program/ Fall 2012 (Version 11/5/2012) The Program areas of Renewable Energy and Biomedicine. iCons does not replace a major

Auerbach, Scott M.

167

Validating the semantics of a medical iconic language using ontological Jean-Baptiste Lamya,  

E-Print Network [OSTI]

Validating the semantics of a medical iconic language using ontological reasoning Jean clinicians read medical texts such as clinical practice guidelines or drug monographs, we proposed an iconic language called VCM. This language can use icons to represent the main medical concepts, including diseases

Paris-Sud XI, Université de

168

Hidden Costs of Graphical User Interfaces: Failure to Make the Transition from Menus and Icon  

E-Print Network [OSTI]

Hidden Costs of Graphical User Interfaces: Failure to Make the Transition from Menus and Icon of Psychology Rice University Graphical interfaces allow users to issue commands using pull-down menus, icon toolbars, and keyboard shortcuts. Menus and icon toolbars are easier to learn, whereas keyboard shortcuts

Lane, David

169

Efficient Position-Independent Iconic Search Using An R-Theta Index  

E-Print Network [OSTI]

Efficient Position-Independent Iconic Search Using An R-Theta Index Charles B. Cranston and Hanan Science University of Maryland, College Park, MD 20742 zben@cs.umd.edu,hjs@cs.umd.edu ABSTRACT An iconic features called icons. A method is presented to support fast position- independent similarity search

Samet, Hanan

170

Computing Iconic Summaries of General Visual Concepts Rahul Raguram Svetlana Lazebnik  

E-Print Network [OSTI]

Computing Iconic Summaries of General Visual Concepts Rahul Raguram Svetlana Lazebnik {rraguram This paper considers the problem of selecting iconic im- ages to summarize general visual categories. We define iconic images as high-quality representatives of a large group of images consistent both

Lazebnik, Svetlana

171

Anisotropies of Touch in Haptic Icon Exploration Gregory S. Lee and Blake Hannaford  

E-Print Network [OSTI]

Anisotropies of Touch in Haptic Icon Exploration Gregory S. Lee and Blake Hannaford Department environment for two icon alignments and two finger motions were measured. Using all possible combinations of two finger motions, flexion/extension and finger abduction/adduction, and two icon alignments

172

Gradebook Icons in Blackboard 6 A Blackboard Learning Services Tip Sheet  

E-Print Network [OSTI]

Gradebook Icons in Blackboard 6 A Blackboard Learning Services Tip Sheet Introduction Blackboard uses icons in the Gradebook to indicate, at a glance, the status of a particular assessment for a specific student. In most cases, clicking on these icons provides additional information about the student

173

Icon-based Visualization of Large High-Dimensional Datasets Heloise Lynn, Yves Simon  

E-Print Network [OSTI]

Icon-based Visualization of Large High-Dimensional Datasets Ping Chen Chenyi Hu Wei Ding Heloise data. We divide dimensions of data into several groups. Then, we use one icon to repre- sent each group, and associate visual properties of each icon with dimensions in each group. A high dimen- sional data record

Ding, Wei

174

The Color Icon: A New Design and a Parallel Implementation Robert Erbacher David Gonthier  

E-Print Network [OSTI]

The Color Icon: A New Design and a Parallel Implementation Robert Erbacher David Gonthier Haim of Massachusetts-Lowell One University Avenue Lowell, MA 01854 Abstract The color icon harnesses color and texture redesigned the color icon. The new design increases the number of parameters that can be integrated. It also

Erbacher, Robert F.

175

Haptic icons are brief tangible stimuli with associated meanings, composed by varying the control  

E-Print Network [OSTI]

Haptic icons are brief tangible stimuli with associated meanings, composed by varying the control parameters of given haptic display. Transparent haptic icons convey information without grabbing your attention, unless it's needed. One Mechanism: Haptic Icons events · function identity · content identity

MacLean, Karon

176

Xilinx Schematic Simulation Procedures 1. Double-click on the Xilinx Foundation Project Manager icon.  

E-Print Network [OSTI]

Manager icon. 2. You will get the Getting Started window. Click on Create a New Project and then click OK window. On the upper right-hand pane, you can find a box - Design Entry. Click on the rightmost icon which has the shape of an AND gate (icon for the schematic editor). You now see the schematic editor

Fonoberov, Vladimir

177

From Icons to Symbols: Some Speculations on the Origins of Language*  

E-Print Network [OSTI]

From Icons to Symbols: Some Speculations on the Origins of Language* ROBERT N. BRANDON and NORBERT. In the first section we offer a retooling of some traditional concepts, namely icons and symbols, which allows in section 2. KEY WORDS: Phylogenetic icons, heritability, phenotypic plasticity, phenotypic trans- mission

178

Perceptual Analysis of Haptic Icons: an Investigation into the Validity of Cluster Sorted MDS  

E-Print Network [OSTI]

Perceptual Analysis of Haptic Icons: an Investigation into the Validity of Cluster Sorted MDS Vancouver, B.C. V6T 1Z4, Canada ABSTRACT The design of usable haptic icons (brief informational signals de- livered through the sense of touch) requires a tool for measuring perceptual distances between icons

Hayward, Vincent

179

Wisconsin | OpenEI  

Open Energy Info (EERE)

Wisconsin Wisconsin Dataset Summary Description Abstract: Annual average wind resource potential for Wisconsin at a 50 meter height. Purpose: Provide information on the wind resource development potential in Wisconsin. Supplemental_Information: This data set has been validated by NREL and wind energy meteorological consultants. However, the data is not suitable for micro-siting potential development projects. Other_Citation_Details: This map has been validated with available surface data by NREL and wind energy meteorological consultants. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2003 (10 years ago) Date Updated November 17th, 2011 (2 years ago) Keywords GIS NREL shapefile wind Wisconsin Data application/zip icon Shapefile (zip, 3 MiB)

180

perez | OpenEI  

Open Energy Info (EERE)

perez perez Dataset Summary Description Abstract - Monthly and annual average solar resource potential for the state of Hawaii. Purpose - Provide information on the solar resource potential for the state of Hawaii. The insolation values represent the average solar energy available to a concentrating collector on a 2-axis tracker, such as a dish or a power tower. Source National Renewable Energy Laboratory (NREL) Date Released February 04th, 2007 (7 years ago) Date Updated Unknown Keywords GIS NREL perez shapefile solar United States Data application/zip icon Shapefile (zip, 9.1 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/1998 - 12/31/2005 License License Other or unspecified, see optional comment below

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

WEC-Sim Wave Energy Converter Simulator - WEC-Sim-v1-0.zip -...  

Open Energy Info (EERE)

Sim-v1-0.zip Download WEC-Sim-v1-0.zip URL: http:en.openei.orgdatasetsdataset76407f83-43ed-4bac-a0aa-e2b6cacb70b9resource42b3c07c-2f71-47ed-b95b-c2f479d9aa99download...

182

Identification of bZIP interaction partners of viral proteins HBZ, MEQ, BZLF1, and K-bZIP using coiled-coil arrays  

E-Print Network [OSTI]

Basic-region leucine-zipper transcription factors (bZIPs) contain a segment rich in basic amino acids that can bind DNA, followed by a leucine zipper that can interact with other leucine zippers to form coiled-coil homo- ...

Reinke, Aaron Wade

183

Cults Disrupted and Memories Recaptured: Events in the Life of the Icon of the Virgin Hodegetria in Constantinople  

Science Journals Connector (OSTI)

The icon of the Virgin Hodegetria was one of ... been interpreted as if the history of the icon were linear. A careful consideration of the ... image was subject to considerable change. The icon of the Hodegetria...

Barbara Zeitler

1999-01-01T23:59:59.000Z

184

The Icon of God and the Mirror of the Soul: Exploring the Origins of Iconography in Patristic Writing  

E-Print Network [OSTI]

face to face. ” The icon, therefore, is closely interrelatedTHE ICON OF GOD AND THE MIRROR OF THE SOUL: EXPLORING THEby Andreas Andreopoulos The icon is also a mirror, fashioned

Andreopoulos, Andreas

2000-01-01T23:59:59.000Z

185

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

Looking for a way to find utilites per zip code (a list?) Looking for a way to find utilites per zip code (a list?) Home I am trying to map out utilities in the USA by ZIP codes. The EPA sent me to OpenEI (this is a nice validation of our group), or Energy Star. Does anyone know of a data set linking zip codes to utilities? I am trying to map something similar to what DSRIE.gov does with utilities and incentives. Thank you head of time. Submitted by Caniemeyer on 1 July, 2013 - 13:55 1 answer Points: 0 Hello- Yes, there is indeed a dataset that lists utilities by zip-code. It can be found on OpenEI here: http://en.openei.org/datasets/node/899. Be sure to view both the investor owned and non-investor owned lists. Since it was sourced from licensed Ventyx data, this is the most recent publicly available data we can provide. Please let me know if you have any questions

186

Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Distribution Annuals Data (Zip) Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1996 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

187

Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) | Data.gov  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7 Gas Distribution Annuals Data (Zip) 7 Gas Distribution Annuals Data (Zip) Energy Data Apps Maps Challenges Resources Blogs Let's Talk Energy Beta You are here Data.gov » Communities » Energy » Data Pipeline Annual Data - 1997 Gas Distribution Annuals Data (Zip) Dataset Summary Description Pipeline operators (for gas distribution, gas transmission, and hazardous liquid pipelines) are required to submit an annual report to the Pipeline and Hazardous Materials Safety Administration's Office of Pipeline Safety. The report includes information about the operator, a description of their system (main, services), leaks eliminated/repaired during the year, excavation damage, excess flow valves, and other information. Beginning in 2010, the form also includes information regarding integrity management programs.

188

DOE Solar Decathlon: University of Minnesota: Living Up to an Iconic Name  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ICON Solar House at the U.S. Department of Energy Solar Decathlon 2009. ICON Solar House at the U.S. Department of Energy Solar Decathlon 2009. Enlarge image The University of Minnesota's ICON Solar House is on display at the Bell Museum of Natural History in Minneapolis. (Credit: Jim Tetro/U.S. Department of Energy Solar Decathlon) Who: University of Minnesota What: ICON Solar House Where: Bell Museum of Natural History 10 Church St. SE Minneapolis, MN 55455 Map This House Public tours: The exhibit is open during the Bell Museum's regular hours of operation from Oct. 16, 2010, to May 15, 2011. For more information, call 612-624-7083. Solar Decathlon 2009 University of Minnesota: Living up to an Iconic Name After the U.S. Department of Energy Solar Decathlon 2009, the University of Minnesota stored ICON Solar House on campus until summer 2010. The house

189

NatSci 190IH Global Challenges, Scientific Solutions [iCons I  

E-Print Network [OSTI]

-1 NatSci 190IH Global Challenges, Scientific Solutions [iCons I] Spring 2013 Syllabus Instructors � 12:50PM Thursday 11:15AM � 12:55PM Course Description iCons I: "Global Challenges, Scientific in the Case Study Outlines. This is the first course in the iCons program, and is a prerequisite for the three

Auerbach, Scott M.

190

NatSci 499 E/F: Integrative Scientific Research (iCons 4; 6 credits) Faculty Contact: Prof. Scott M. Auerbach (iCons Program Director; auerbach@chem.umass.edu) or  

E-Print Network [OSTI]

1 NatSci 499 E/F: Integrative Scientific Research (iCons 4; 6 credits) Faculty Contact: Prof. Scott M. Auerbach (iCons Program Director; auerbach@chem.umass.edu) or designee. Prerequisites: Completion of iCons 3 with a grade of "C" or better. Course Catalog Description: Students in iCons 4 will engage

Auerbach, Scott M.

191

Platform-Independent Implementation of 3D-Sound Computer Interface Icons for Subjects with Visual Impairments  

E-Print Network [OSTI]

Platform-Independent Implementation of 3D-Sound Computer Interface Icons for Subjects with Visual to the icons of a computer interface in order to assist visually impaired individuals during icon location and selection. In this enhanced system, icons have 3D sound properties, in addition to their graphical

Barreto, Armando

192

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

193

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

194

Icon and user interface design for emergency medical information systems: A case study  

Science Journals Connector (OSTI)

A usable medical information system should allow for reliable and accurate interaction between users and the system in emergencies. A participatory design approach was used to develop a medical information system in two Turkish hospitals. The process consisted of task and user analysis, an icon design survey, initial icon design, final icon design and evaluation, and installation of the iconic medical information system with the icons. We observed work sites to note working processes and tasks related to the information system and interviewed medical personnel. Emergency personnel then participated in the design process to develop a usable graphical user interface, by drawing icon sketches for 23 selected tasks. Similar sketches were requested for specific tasks such as family medical history, contact information, translation, addiction, required inspections, requests and applications, and nurse observations. The sketches were analyzed and redesigned into computer icons by professional designers and the research team. A second group of physicians and nurses then tested the understandability of the icons. The user interface layout was examined and evaluated by system users, followed by the system's installation. Medical personnel reported the participatory design process was interesting and believed the resulting designs would be more familiar and friendlier.

Y. Batu Salman; Hong-In Cheng; Patrick E. Patterson

2012-01-01T23:59:59.000Z

195

ICON, a current model preamplifier in CMOS technology for use with high rate particle detectors  

SciTech Connect (OSTI)

The ICON current mode preamplifier is intended for use in experiments at high rate hadron colliders. The transient response and noise performance have been analyzed. One chip has been made using an ICON circuit with resistive feedback to produce a preamplifier with a peaking time of below 10 ns. This fast preamplifier has a gain of 870 mV/pC and a power dissipation of around 1 mW. Another chip was made which uses the ICON circuit as the front-end to a dual port analog memory. The noise measured is between 2,400 e[sup [minus

Anghinolfi, F.; Aspell, P.; Campbell, M.; Heijne, E.H.M.; Jarron, P.; Meddeler, G.; Santiard, J.C.

1993-06-01T23:59:59.000Z

196

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Company Oil and Gas Company Address Place Zip Website Company Oil and Gas Company Address Place Zip Website Abu Dhabi National Oil Company Abu Dhabi National Oil Company Abu http www adnoc ae default aspx Al Furat Petroleum Company Al Furat Petroleum Company Damascus Syria http www afpc sy com new history htm Dolphin Energy Dolphin Energy Abu Dhabi Trade Center Building Abu Dhabi United Arab Emirates http www dolphinenergy com Public default index htm ExxonMobil ExxonMobil Las Colinas Boulevard Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United Kingdom W1S LG http www gulfsands com s Home asp Kuwait Petroleum Corporation Kuwait Petroleum Corporation Safat Kuwait http www kpc com kw default aspx

197

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

State Oil and Gas Board Address Place Zip Website State Oil and Gas Board Address Place Zip Website Alabama Oil and Gas Board Alabama Oil and Gas Board Hackberry Lane Tuscaloosa Alabama http www gsa state al us ogb ogb html Alaska Division of Oil and Gas Alaska Division of Oil and Gas W th Ave Suite Anchorage Alaska http dog dnr alaska gov Alaska Oil and Gas Conservation Commission Alaska Oil and Gas Conservation Commission W th Ave Ste Anchorage Alaska http doa alaska gov ogc Arizona Oil and Gas Commission Arizona Oil and Gas Commission W Congress Street Suite Tucson Arizona http www azogcc az gov Arkansas Oil and Gas Commission Arkansas Oil and Gas Commission Natural Resources Dr Ste Little Rock Arkansas http www aogc state ar us JDesignerPro JDPArkansas AR Welcome html California Division of Oil Gas and Geothermal Resources California

198

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

Address Place Zip Sector Product Stock Symbol Year founded Number Address Place Zip Sector Product Stock Symbol Year founded Number of employees Number of employees Telephone number Website Coordinates Region ABS Alaskan Inc Van Horn Rd Fairbanks Alaska Gateway Solar Wind energy Marine and Hydrokinetic Solar PV Solar thermal Wind Hydro Small scale wind turbine up to kW and solar systems distributor http www absak com United States AER NY Kinetics LLC PO Box Entrance Avenue Ogdensburg Marine and Hydrokinetic United States AW Energy Lars Sonckin kaari Espoo FI Marine and Hydrokinetic http www aw energy com Finland AWS Ocean Energy formerly Oceanergia Redshank House Alness Point Business Park Alness Ross shire IV17 UP Marine and Hydrokinetic http www awsocean com United Kingdom Able Technologies Audubon Road Englewood Marine and Hydrokinetic http

199

The bridge of iconicity: from a world of experience to the experience of language  

Science Journals Connector (OSTI)

...Theme Issue Brain circuitry outside the synaptic cleft compiled and edited by Dmitri A. Rusakov and Alexander E. Dityatev The bridge of iconicity: from a world of experience to the experience of language Pamela Perniss Gabriella Vigliocco Phil. Trans. R...

2014-01-01T23:59:59.000Z

200

Creating Your App Icon and Additional Graphics for the App Store  

Science Journals Connector (OSTI)

By this time, you’ve almost completed the entire process of designing your application and have handed it off to your developer for development. While you can add the app icon to the bundle with your other assets...

Sian Morson

2014-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Private Narratives and Infant Views: Iconizing 1970s Militancy in Contemporary Argentine Cinema  

E-Print Network [OSTI]

1 Private Narratives and Infant Views: Iconizing 1970s Militancy in Contemporary Argentine Cinema Shot in 2011 and released in September 2012, Infancia clandestina, by Argentine director Benjamín Ávila, has already been sold to over twenty... relies on a privatized and archaic image of the disappeared activist, which ultimately transforms 1970s militancy in an iconic sign. The above-mentioned readings are only accurate if we accept two important omissions: if we consider that the figure...

Garibotto, Veró nica

2015-01-01T23:59:59.000Z

202

4/18/2014 Human Competition Edging Out Those Lovable Icons of Wildlife -New York Times http://www.nytimes.com/2001/04/06/world/human-competition-edging-out-those-lovable-icons-of-wildlife.html 1/2  

E-Print Network [OSTI]

4/18/2014 Human Competition Edging Out Those Lovable Icons of Wildlife - New York Times http://www.nytimes.com/2001/04/06/world/human-competition-edging-out-those-lovable-icons-of-wildlife.html 1/2 Search All NYTimes.com Human Competition Edging Out Those Lovable Icons of Wildlife By ANDREW C. REVKIN Published

203

What’s in a name? The role of graphics, functions, and their interrelationships in icon identification  

Science Journals Connector (OSTI)

Communication using icons is now commonplace. It is therefore important to understand the processes involved in icon comprehension and the stimulus cues that individuals ... In this study, we examined predictors ...

Siné McDougall; Sarah Isherwood

2009-05-01T23:59:59.000Z

204

Measuring symbol and icon characteristics: Norms for concreteness, complexity, meaningfulness, familiarity, and semantic distance for 239 symbols  

Science Journals Connector (OSTI)

This paper provides rating norms for a set of symbols and icons selected from a wide variety of sources....

Siné J. P. Mcdougall; Martin B. Curry…

1999-09-01T23:59:59.000Z

205

Onomatopoeia and Phono-Iconicity in Hebrew in the framework of LUIT : Language a Unified and Integrative Theory  

E-Print Network [OSTI]

Onomatopoeia and Phono-Iconicity in Hebrew in the framework of LUIT : Language ­ a Unified). As for Phono-Iconicity, henceforth PI (the term `sound-symbolism', often used in this context, implies the opposite of what it says: we are not dealing with arbitrary symbols, but with motivated icons

Paris-Sud XI, Université de

206

Iconic and Diagrammatic Interfaces: An Integrated Approach T.Catarci, A.Massari and G.Santucci  

E-Print Network [OSTI]

Iconic and Diagrammatic Interfaces: An Integrated Approach T.Catarci, A.Massari and G. Afterwards we consider the two main visual expressions, i.e. icons and diagrams, used to represent both data a man­machine interface, together with a visual query language, providing an integrated, both iconic

207

Motor-iconicity of sign language does not alter the neural systems underlying tool and action naming  

E-Print Network [OSTI]

Motor-iconicity of sign language does not alter the neural systems underlying tool and action Positron emission tomography was used to investigate whether the motor-iconic basis of certain forms representing the human hand holding a tool and with an iconic movement depicting canonical tool use, whereas

208

Outcomes Researcher, Patient Reported Outcomes (PRO) ICON is a global provider of outsourced development services to the pharmaceutical,  

E-Print Network [OSTI]

Outcomes Researcher, Patient Reported Outcomes (PRO) ICON is a global provider of outsourced selection to Phase I - IV clinical studies ICON enjoys a strong reputation for quality and is focused what set us apart. Overview of the role The ICON PRO group is seeking an Outcomes Researcher. The PRO

Klein, Ophir

209

Create Shortcut for Java Applications on Windows You can create an icon on Windows Desktop, so that the end-  

E-Print Network [OSTI]

Create Shortcut for Java Applications on Windows You can create an icon on Windows Desktop, soMortgage on the desktop to run the ComputeMortgage application. 6. (Optional) You can set a custom icon for the application by clicking the Change Icon button in the ComputeMortgage Properties dialog box shown in Figure 4

Liang, Y. Daniel

210

B.2.Creating a network Using the icons in the Topology Configuration window to create a network  

E-Print Network [OSTI]

47 B.2.Creating a network Using the icons in the Topology Configuration window to create a network topology. =========== Step 1) create a node Select an icon (e.g., RFG) by clicking on it in the Topology Configuration window. Now move the pointer to the Topology window, the pointer will become the selected icon

211

THE INTRACONTINENTAL BASINS (ICONS) ATLAS APPLICATIONS IN EASTERN AUSTRALIA PESA Eastern Australasian Basins Symposium III Sydney, 1417 September, 2008 275  

E-Print Network [OSTI]

THE INTRACONTINENTAL BASINS (ICONS) ATLAS ­ APPLICATIONS IN EASTERN AUSTRALIA PESA Eastern Australasian Basins Symposium III Sydney, 14­17 September, 2008 275 The IntraCONtinental basinS (ICONS) atlas of intracontinental basins (ICONS atlas), using freely available global and regional datasets. Firstly, we are trying

Müller, Dietmar

212

Correct figures for Gertz, Stewart, and Khosla, ``An Iconic Programming Language for SensorBased Robots,'' SOAR 1992. interface X  

E-Print Network [OSTI]

#12; #12; #12; #12; #12; #12; #12; #12; Correct figures for Gertz, Stewart, and Khosla, ``An Iconic S job T actuator interface Z to actuator Z from sensor Y raw data in typed data in from sensor X iconic programming language iconic programs (jobs) graphical interfaces real­time tasks subroutine calls graphical

213

First iCons group launched, takes on cholera crisis The first group of undergraduates selected to take part in  

E-Print Network [OSTI]

First iCons group launched, takes on cholera crisis The first group of undergraduates selected to take part in iCons, an integrated and collaborative new four-year science program, came together. In all, 45 students from a dozen departments and programs were chosen to take part in the inaugural iCons

Auerbach, Scott M.

214

PAR solar radiation | OpenEI  

Open Energy Info (EERE)

PAR solar radiation PAR solar radiation Dataset Summary Description (Abstract): Mean values of PAR Solar Radiation in kWh/m2/day for 40km cells for 1 year (month, season, year) based on data from 1995 to 2005 (Purpose): To provide a set of consistent, reliable, verifiable, and accessible global data sets for international and in-country investors and other stakeholders Source INPE (National Institute for Spatial Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 05th, 2009 (5 years ago) Date Updated August 05th, 2009 (5 years ago) Keywords INPE LABSOLAR PAR solar radiation renewable energy South America SWERA UNEP Data application/zip icon Download Shapefile (zip, 977.7 KiB) text/csv icon Download Data (csv, 1.8 MiB)

215

Asia | OpenEI  

Open Energy Info (EERE)

10 10 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142281010 Varnish cache server Asia Dataset Summary Description (Abstract): Monthly Average Solar Resource for horizontal and tilted flat-plates, and 2-axis tracking concentrating collectors. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to solar collectors. Source NREL Date Released July 31st, 2006 (8 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords Asia DNI GEF GHI insolation NREL solar SWERA TILT UNEP Data application/zip icon Download Shapefile and Cell Regions (zip, 20.2 MiB) text/csv icon Download Data (csv, 960.7 KiB)

216

PAR | OpenEI  

Open Energy Info (EERE)

PAR PAR Dataset Summary Description (Abstract): Photosynthetically active radiation in kWh/m2/day for 1 year organized into cells with 10km x 10km (Purpose): The BRASIL-SR model and the SPRING software (both developed by INPE -National Institute for Space Research) were used to produce the dataset and SHAPE files Source INPE (National Institute for Space Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 08th, 2009 (5 years ago) Date Updated August 08th, 2009 (5 years ago) Keywords INPE LABSOLAR PAR solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 10.4 MiB) text/csv icon Download Data (csv, 15.7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

217

INPE | OpenEI  

Open Energy Info (EERE)

INPE INPE Dataset Summary Description (Abstract): Diffuse solar radiation in kWh/m2/day for 1 year organized into cells with 10km x 10km (Purpose): The BRASIL-SR model and the SPRING software (both developed by INPE - National Institute for Space Research) were used to produce the dataset and SHAPE files Source INPE (National Institute for Spatial Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 08th, 2009 (5 years ago) Date Updated August 08th, 2009 (5 years ago) Keywords Brazil diffuse radiation GIS INPE LABSOLAR solar SWERA Data application/zip icon Download Shapefile (zip, 10.5 MiB) text/csv icon Download Data (csv, 15.7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

218

GEF. latitude tilt | OpenEI  

Open Energy Info (EERE)

GEF. latitude tilt GEF. latitude tilt Dataset Summary Description (Abstract): Latitude tilted solar radiation in kWh/m2/day for 1 year organized into cells with 40km x 40km (Purpose): To provide a set of consistent, reliable, verifiable, and accessible global data sets for international and in-country investors and other stakeholders Source INPE (National Institute for Spatial Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 08th, 2009 (5 years ago) Date Updated August 08th, 2009 (5 years ago) Keywords Brazil GEF. latitude tilt INPE LABSOLAR solar SWERA TILT UNEP Data application/zip icon Download Shapefile (zip, 706.1 KiB) text/csv icon Download Data (csv, 999.1 KiB) Quality Metrics Level of Review Some Review

219

Brazil | OpenEI  

Open Energy Info (EERE)

Brazil Brazil Dataset Summary Description (Abstract): Diffuse solar radiation in kWh/m2/day for 1 year organized into cells with 10km x 10km (Purpose): The BRASIL-SR model and the SPRING software (both developed by INPE - National Institute for Space Research) were used to produce the dataset and SHAPE files Source INPE (National Institute for Spatial Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 08th, 2009 (5 years ago) Date Updated August 08th, 2009 (5 years ago) Keywords Brazil diffuse radiation GIS INPE LABSOLAR solar SWERA Data application/zip icon Download Shapefile (zip, 10.5 MiB) text/csv icon Download Data (csv, 15.7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

220

direct normal irradiance | OpenEI  

Open Energy Info (EERE)

normal irradiance normal irradiance Dataset Summary Description (Abstract): Monthly Average Solar Resource for horizontal and tilted flat-plates, and 2-axis tracking concentrating collectors. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to solar collectors. Source NREL Date Released July 31st, 2006 (8 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords direct normal irradiance DNI GEF GHI GIS global horizontal irradiance insolation latitutde tilt irradiance NASA NREL South America SWERA TILT UNEP Data application/zip icon Download Shapefile and Cell Maps (zip, 13.9 MiB) text/csv icon Download Data (csv, 3.5 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

latitutde tilt irradiance | OpenEI  

Open Energy Info (EERE)

latitutde tilt irradiance latitutde tilt irradiance Dataset Summary Description (Abstract): Monthly Average Solar Resource for flat-plate collectors tilted at latitude for Bangladesh. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented due south at an angle from horizontal equal to the latitude of the collector location. Source NREL Date Released April 12th, 2005 (9 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords atmospheric water vapor GEF GIS latitutde tilt irradiance NREL solar SWERA TILT UNEP Data text/csv icon Download Data (csv, 35.5 KiB) application/zip icon Download Shapefile (zip, 26.7 KiB) Quality Metrics

222

Carribean Islands | OpenEI  

Open Energy Info (EERE)

Carribean Islands Carribean Islands Dataset Summary Description (Abstract): Monthly Average Solar Resource for horizontal flat-plate collectors, for Mexico, Central America, and the Caribbean Islands. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented horizontally. Source NREL Date Released January 31st, 2004 (10 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords Carribean Islands Central America GEF GHI GIS Mexico NREL solar SWERA UNEP Data text/csv icon Download Data (csv, 370.6 KiB) application/zip icon Download Shapefile (zip, 244 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

223

LABSOLAR | OpenEI  

Open Energy Info (EERE)

LABSOLAR LABSOLAR Dataset Summary Description (Abstract): Diffuse solar radiation in kWh/m2/day for 1 year organized into cells with 10km x 10km (Purpose): The BRASIL-SR model and the SPRING software (both developed by INPE - National Institute for Space Research) were used to produce the dataset and SHAPE files Source INPE (National Institute for Spatial Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 08th, 2009 (5 years ago) Date Updated August 08th, 2009 (5 years ago) Keywords Brazil diffuse radiation GIS INPE LABSOLAR solar SWERA Data application/zip icon Download Shapefile (zip, 10.5 MiB) text/csv icon Download Data (csv, 15.7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage

224

GEF | OpenEI  

Open Energy Info (EERE)

GEF GEF Dataset Summary Description (Abstract): Monthly average solar resource for horizontal flat-plate collectors for China. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented horizontally. Source NREL Date Released April 12th, 2005 (9 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords China GEF GHI GIS NREL solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 629.4 KiB) text/csv icon Download Data (csv, 779.1 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/1985 - 12/31/1991 License License Open Data Commons Public Domain Dedication and Licence (PDDL)

225

South America | OpenEI  

Open Energy Info (EERE)

America America Dataset Summary Description (Abstract): Mean values of Diffuse Solar Radiation in kWh/m2/day for 40km cells for 1 year (month, season, year) based on data from 1995 to 2005. (Purpose): To provide a set of consistent, reliable, verifiable, and accessible global data sets for international and in-country investors and other stakeholders. Source INPE (National Institute for Spatial Research) and LABSOLAR (Laboratory of Solar Energy/Federal University of Santa Catarina) - Brazil Date Released August 05th, 2009 (5 years ago) Date Updated August 05th, 2009 (5 years ago) Keywords diffuse radiation GIS INPE LABSOLAR solar South America SWERA Data text/csv icon Download Data (csv, 1.9 MiB) application/zip icon Download Shapefile (zip, 978.9 KiB) Quality Metrics

226

China | OpenEI  

Open Energy Info (EERE)

China China Dataset Summary Description (Abstract): Monthly average solar resource for horizontal flat-plate collectors for China. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented horizontally. Source NREL Date Released April 12th, 2005 (9 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords China GEF GHI GIS NREL solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 629.4 KiB) text/csv icon Download Data (csv, 779.1 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/1985 - 12/31/1991 License License Open Data Commons Public Domain Dedication and Licence (PDDL)

227

irradiance | OpenEI  

Open Energy Info (EERE)

irradiance irradiance Dataset Summary Description (Abstract): Latitude Tilt Irradiance NASA Surface meteorology and Solar Energy (SSE) Release 6.0 Data Set (Jan 2008)22-year Monthly & Annual Average (July 1983 - June 2005) Parameter: Latitude Tilt Radiation (kWh/m^2/day) Internet: http://eosweb.larc.nasa.gov/sse/ Note 1: SSE Methodology & Accuracy sections online Source U.S. National Aeronautics and Space Administration (NASA), Surface meteorology and Solar Energy (SSE) Date Released March 31st, 2009 (5 years ago) Date Updated April 01st, 2009 (5 years ago) Keywords GIS global irradiance latitude mapping NASA renewable energy solar solar PV SWERA TILT UNEP Data text/csv icon Latitude Tilt Radiation (kWh/m^2/day) (csv, 11.8 MiB) application/zip icon Download Shapefile (zip, 5 MiB)

228

Africa | OpenEI  

Open Energy Info (EERE)

Africa Africa Dataset Summary Description (Abstract): Monthly Average Solar Resource for horizontal and tilted flat-plates, and 2-axis tracking concentrating collectors. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to solar collectors. Source U.S. National Renewable Energy Laboratory (NREL) Date Released July 31st, 2011 (3 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords Africa direct normal irradiance DNI GEF GHI GIS global horizontal irradiance latitutde tilt irradiance NASA NREL solar SWERA TILT UNEP Data application/zip icon Download Shapefile and Images (zip, 19.3 MiB) text/csv icon Download Data (csv, 3.4 MiB) Quality Metrics Level of Review Some Review

229

latitude tilt | OpenEI  

Open Energy Info (EERE)

latitude tilt latitude tilt Dataset Summary Description (Abstract): Monthly Average Solar Resource for flat-plate collectors tilted at latitude for Nepal. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented due south at an angle from horizontal equal to the latitude of the collector location. Source U.S. National Renewable Energy Laboratory (NREL) Date Released April 12th, 2005 (9 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords atmospheric water vapor GIS latitude tilt Nepal NREL solar SWERA TILT UNEP Data application/zip icon Download Shapefile (zip, 25.6 KiB) text/csv icon Download Data (csv, 36.2 KiB)

230

mapping | OpenEI  

Open Energy Info (EERE)

mapping mapping Dataset Summary Description (Abstract): Latitude Tilt Irradiance NASA Surface meteorology and Solar Energy (SSE) Release 6.0 Data Set (Jan 2008)22-year Monthly & Annual Average (July 1983 - June 2005) Parameter: Latitude Tilt Radiation (kWh/m^2/day) Internet: http://eosweb.larc.nasa.gov/sse/ Note 1: SSE Methodology & Accuracy sections online Source U.S. National Aeronautics and Space Administration (NASA), Surface meteorology and Solar Energy (SSE) Date Released March 31st, 2009 (5 years ago) Date Updated April 01st, 2009 (5 years ago) Keywords GIS global irradiance latitude mapping NASA renewable energy solar solar PV SWERA TILT UNEP Data text/csv icon Latitude Tilt Radiation (kWh/m^2/day) (csv, 11.8 MiB) application/zip icon Download Shapefile (zip, 5 MiB)

231

CEPEL | OpenEI  

Open Energy Info (EERE)

CEPEL CEPEL Dataset Summary Description (Abstract): Annual average of the aeolic potential at 50m. Content: wind speed in m/s, power class (7 classes), power density in W/m2 and Weibull k value organized into cells with 40km x 40km (Purpose): The thematic map by code of colors permits quick viewing of all the Brazilian territory dataset. That map indicates, for the height of 50m, the annual average, in W/m2, of wind speed, power class, power density and Weibull k value. Source CEPEL (Electric Energy Research Center/Federal University of Rio de Janeiro) - Brazil Date Released August 08th, 2009 (5 years ago) Date Updated August 08th, 2009 (5 years ago) Keywords Brazil CEPEL INPE SWERA UNEP wind Data application/zip icon Download Shapefile (zip, 633.3 KiB) text/csv icon Download Data (csv, 358.1 KiB)

232

atmospheric water vapor | OpenEI  

Open Energy Info (EERE)

atmospheric water vapor atmospheric water vapor Dataset Summary Description (Abstract): Monthly Average Solar Resource for 2-axis tracking concentrating collectors for Mexico, Central America, and the Caribbean Islands. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a concentrating collector, such as a dish collector, which tracks the sun continuously. Source NREL Date Released July 31st, 2006 (8 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords atmospheric water vapor Carribean Islands Central America DNI GIS Mexico NREL GEF solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 247.8 KiB) text/csv icon Download Data (csv, 370.6 KiB) Quality Metrics Level of Review Some Review

233

NREL GEF | OpenEI  

Open Energy Info (EERE)

GEF GEF Dataset Summary Description (Abstract): Monthly Average Solar Resource for 2-axis tracking concentrating collectors for Mexico, Central America, and the Caribbean Islands. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a concentrating collector, such as a dish collector, which tracks the sun continuously. Source NREL Date Released July 31st, 2006 (8 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords atmospheric water vapor Carribean Islands Central America DNI GIS Mexico NREL GEF solar SWERA UNEP Data application/zip icon Download Shapefile (zip, 247.8 KiB) text/csv icon Download Data (csv, 370.6 KiB) Quality Metrics Level of Review Some Review

234

atmoshperic water vapor | OpenEI  

Open Energy Info (EERE)

atmoshperic water vapor atmoshperic water vapor Dataset Summary Description (Abstract): Monthly Average Solar Resource for flat-plate collectors tilted at latitude for China. Source NREL Date Released April 12th, 2005 (9 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords atmoshperic water vapor China GEF GIS NREL solar SWERA TILT UNEP Data application/zip icon Download Shapefile (zip, 625.6 KiB) text/csv icon Download Data (csv, 704.1 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/1985 - 12/31/1991 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access

235

insolation | OpenEI  

Open Energy Info (EERE)

2 2 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142278432 Varnish cache server insolation Dataset Summary Description (Abstract): Monthly Average Solar Resource for horizontal and tilted flat-plates, and 2-axis tracking concentrating collectors. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to solar collectors. Source NREL Date Released July 31st, 2006 (8 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords Asia DNI GEF GHI insolation NREL solar SWERA TILT UNEP Data application/zip icon Download Shapefile and Cell Regions (zip, 20.2 MiB) text/csv icon Download Data (csv, 960.7 KiB)

236

Mexico | OpenEI  

Open Energy Info (EERE)

Mexico Mexico Dataset Summary Description (Abstract): Monthly Average Diffuse Solar Resource for Mexico, Central America, and the Caribbean Islands. (Purpose): Provide information on the solar radiation for the data domain. The insolation values represent the average solar energy available at a shaded location. This can be of value for day-lighting or other building applications. The data can be combined with other data (global horizontal, direct normal) to estimate the global radiation on different surfaces. Source NREL Date Released January 31st, 2004 (10 years ago) Date Updated November 30th, 2007 (7 years ago) Keywords Carribean Central America diffuse radiation GEF GIS Mexico NREL solar SWERA Data application/zip icon Download Shapefile (zip, 245.7 KiB) text/csv icon Download Data (csv, 380.6 KiB)

237

Efficacy of ICON(R) Maxx in the laboratory and against insecticide-resistant Anopheles gambiae in central Cote d'Ivoire  

E-Print Network [OSTI]

21]. Bioassays Efficacy of ICON ® Maxx was assessed in WHOand blood-feeding rate in ICON ® Maxx-treated huts versusOpen Access Efficacy of ICON ® Maxx in the laboratory and

2012-01-01T23:59:59.000Z

238

Civil War Icon Becomes National Clean Energy Model | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Civil War Icon Becomes National Clean Energy Model Civil War Icon Becomes National Clean Energy Model Civil War Icon Becomes National Clean Energy Model December 2, 2010 - 2:26pm Addthis Sunita Satyapal Program Manager, Hydrogen & Fuel Cell Technology Program Nearly a century and a half after the first shots of the Civil War, Fort Sumter National Monument is poised to become a national model for clean energy. By adopting solar and hydrogen fuel cell technologies, the monument will generate clean, renewable power - establishing itself as an energy self-sufficient island. This project is part of the Energy SmartPARKS initiative. This first-of-its-kind collaboration - launched in 2008 with the Department of Energy, Department of Interior, and the National Park Service - is designed to implement and showcase sustainable energy

239

Civil War Icon Becomes National Clean Energy Model | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Civil War Icon Becomes National Clean Energy Model Civil War Icon Becomes National Clean Energy Model Civil War Icon Becomes National Clean Energy Model December 2, 2010 - 2:26pm Addthis Sunita Satyapal Program Manager, Hydrogen & Fuel Cell Technology Program Nearly a century and a half after the first shots of the Civil War, Fort Sumter National Monument is poised to become a national model for clean energy. By adopting solar and hydrogen fuel cell technologies, the monument will generate clean, renewable power - establishing itself as an energy self-sufficient island. This project is part of the Energy SmartPARKS initiative. This first-of-its-kind collaboration - launched in 2008 with the Department of Energy, Department of Interior, and the National Park Service - is designed to implement and showcase sustainable energy

240

Picture Icon and Word Icon  

Science Journals Connector (OSTI)

During the development of computing and information processing over the last twenty years, the number of functions offered to the user has exponentially increased. This increase has resulted in two main proble...

Jean Pierre Rossi; Geneviève Querrioux-Coulombier

1997-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

From Spaceship Earth to Google Ocean: Planetary Icons, Indexes, and Infrastructures  

E-Print Network [OSTI]

What sort of image does the planet Earth possess at the opening of the 21st century? If in the 1960s, the Whole Earth, the planet as seen from space, became a cold war, proto-environmentalist icon for a fragile ocean planet, ...

Helmreich, Stefan

242

Iconic Fictions: Narrating Recent Argentine History in Post-2000 Second-Generation Films  

E-Print Network [OSTI]

, and to an ‘archaic’ pre-1990s format. By focusing on a political thriller that I find paradigmatic of this recent trend, Gastón Biraben’s Cautiva/Captive (2005), I argue that these films (which I call ‘iconic fictions’) should not be read as additional examples...

Garibotto, Veró nica

2012-03-01T23:59:59.000Z

243

New Things For Windows 7 Old icons on the desktop that referenced Office 2007 applications will need to be deleted and  

E-Print Network [OSTI]

New Things For Windows 7 Old icons on the desktop that referenced Office 2007 applications will need to be deleted and replaced with icons for Office 2010. To do this, right click on the non-working icon and select delete or simply drag it to the Recycle Bin. To add the new icon, go to Start, then All

Bogaerts, Steven

244

A quick tour through PREKIN (shown for the PC) Double clicking on the PREKIN icon will open the following dialog box.  

E-Print Network [OSTI]

A quick tour through PREKIN (shown for the PC) Double clicking on the PREKIN icon will open the file name. Many programs use PDB files, so they may have a variety of icons. Here I have selected 1CF3 started this session by dragging the icon for your PDB file onto the PREKIN icon, you will bypass both

Richardson, David

245

Pigment identification in a Greek icon by optical microscopy and infrared microspectroscopy  

Science Journals Connector (OSTI)

Optical microscopy, cross-section and fragment Micro-FTIR spectroscopic techniques along with microchemical tests were used for the identification of pigments in two different samples of an icon. Representing the Last Judgement, and painted by the Greek master Ioannis from the village of Kapesovo in the year 1771, the kneeling desk icon under investigation is a noteworthy contribution to the study of materials in post-Byzantine visual arts. The main components found in the ground layer of both samples were gypsum, beeswax and a proteinaceous material. Cinnabar, Prussian blue and cerussite were identified on the paint layers. The binding medium on the paint layers was weddelite. The materials used in the painting and ground layers were characterized in order to clarify the painting technique. Proteinaceous materials have been identified as binders for the pigments, indicating a tempera painting technique.

Dimitra Kovala-Demertzi; Leuteris Papathanasis; Rocco Mazzeo; Mavroudis A. Demertzis; Evagelia A. Varella; Silvia Prati

2012-01-01T23:59:59.000Z

246

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

247

solar radiation | OpenEI  

Open Energy Info (EERE)

radiation radiation Dataset Summary Description (Abstract): Monthly Average Solar Resource for flat-plate collectors tilted at latitude, for Mexico, Central America, and the Caribbean Islands. (Purpose): Provide information on the solar resource potential for the data domain. The insolation values represent the average solar energy available to a flat plate collector, such as a photovoltaic panel, oriented due south at an angle from horizontal equal to the latitude of the collector location. Source NREL Date Released January 31st, 2004 (10 years ago) Date Updated October 30th, 2007 (7 years ago) Keywords atmospheric water vapor Carribean Central America GEF. latitude tilt GIS Mexico NREL solar solar radiation SWERA TILT UNEP Data application/zip icon Download Shapefile (zip, 241.3 KiB)

248

annual average heating degree days | OpenEI  

Open Energy Info (EERE)

average heating degree days average heating degree days Dataset Summary Description (Abstract): Heating Degree Days below 18° C (degree days)The monthly accumulation of degrees when the daily mean temperature is below 18° C.NASA Surface meteorology and Solar Energy (SSE) Release 6.0 Data Set (Nov 2007)22-year Monthly Average & Annual Sum (July 1983 - June 2005)Parameter: Heating Degree Days Below 18 degrees C (degree days)Internet: http://eosweb.larc.nasa.gov/sse/ Source U.S. National Aeronautics and Space Administration (NASA), Surface meteorology and Solar Energy (SSE) Date Released March 31st, 2009 (5 years ago) Date Updated April 01st, 2009 (5 years ago) Keywords annual average heating degree days climate GIS NASA SWERA UNEP Data application/zip icon Download Shapefile (zip, 2.7 MiB)

249

NOAA | OpenEI  

Open Energy Info (EERE)

NOAA NOAA Dataset Summary Description GIS data for offshore wind speed (meters/second). Specified to Exclusive Economic Zones (EEZ).Wind resource based on NOAA blended sea winds and monthly wind speed at 30km resolution, using a 0.11 wind sheer to extrapolate 10m - 90m. Annual average >= 10 months of data, no nulls. Source National Renewable Energy Laboratory (NREL) Date Released Unknown Date Updated Unknown Keywords GIS global NOAA NREL offshore wind wind speed Data application/zip icon Download Shapefile (zip, 18.5 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Please cite NREL and NOAA Rate this dataset Usefulness of the metadata

250

offshore | OpenEI  

Open Energy Info (EERE)

offshore offshore Dataset Summary Description GIS data for offshore wind speed (meters/second). Specified to Exclusive Economic Zones (EEZ).Wind resource based on NOAA blended sea winds and monthly wind speed at 30km resolution, using a 0.11 wind sheer to extrapolate 10m - 90m. Annual average >= 10 months of data, no nulls. Source National Renewable Energy Laboratory (NREL) Date Released Unknown Date Updated Unknown Keywords GIS global NOAA NREL offshore wind wind speed Data application/zip icon Download Shapefile (zip, 18.5 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Please cite NREL and NOAA Rate this dataset Usefulness of the metadata

251

global | OpenEI  

Open Energy Info (EERE)

global global Dataset Summary Description GIS data for offshore wind speed (meters/second). Specified to Exclusive Economic Zones (EEZ).Wind resource based on NOAA blended sea winds and monthly wind speed at 30km resolution, using a 0.11 wind sheer to extrapolate 10m - 90m. Annual average >= 10 months of data, no nulls. Source National Renewable Energy Laboratory (NREL) Date Released Unknown Date Updated Unknown Keywords GIS global NOAA NREL offshore wind wind speed Data application/zip icon Download Shapefile (zip, 18.5 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Please cite NREL and NOAA Rate this dataset Usefulness of the metadata

252

Carribean | OpenEI  

Open Energy Info (EERE)

Carribean Carribean Dataset Summary Description (Abstract): Monthly Average Diffuse Solar Resource for Mexico, Central America, and the Caribbean Islands. (Purpose): Provide information on the solar radiation for the data domain. The insolation values represent the average solar energy available at a shaded location. This can be of value for day-lighting or other building applications. The data can be combined with other data (global horizontal, direct normal) to estimate the global radiation on different surfaces. Source NREL Date Released January 31st, 2004 (10 years ago) Date Updated November 30th, 2007 (7 years ago) Keywords Carribean Central America diffuse radiation GEF GIS Mexico NREL solar SWERA Data application/zip icon Download Shapefile (zip, 245.7 KiB)

253

wind speed | OpenEI  

Open Energy Info (EERE)

speed speed Dataset Summary Description GIS data for offshore wind speed (meters/second). Specified to Exclusive Economic Zones (EEZ).Wind resource based on NOAA blended sea winds and monthly wind speed at 30km resolution, using a 0.11 wind sheer to extrapolate 10m - 90m. Annual average >= 10 months of data, no nulls. Source National Renewable Energy Laboratory (NREL) Date Released Unknown Date Updated Unknown Keywords GIS global NOAA NREL offshore wind wind speed Data application/zip icon Download Shapefile (zip, 18.5 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Please cite NREL and NOAA Rate this dataset Usefulness of the metadata

254

Terahertz time-domain imaging of hidden defects in wooden artworks: application to a Russian icon painting  

Science Journals Connector (OSTI)

We use terahertz time-domain imaging and time-of-flight tomography to examine subsurface defects in an early-19th-century Russian icon painting. In the transmission geometry, we...

Skryl, Anton S; Jackson, J Bianca; Bakunov, Michael I; Menu, Michel; Mourou, Gerard A

2014-01-01T23:59:59.000Z

255

Where Is My Stuff? Augmenting Finding and Re-finding Information by Spatial Locations and Icon Luminance  

Science Journals Connector (OSTI)

We studied how spatial locations and luminance affect finding and re-finding information in a desktop environment. In an experiment conducted with computer icons, fixed locations led to more frequent accesses to

J. Michelle Moon; Wai-Tat Fu

2009-01-01T23:59:59.000Z

256

Cutting Edge Design or a Beginner’s Mistake? – A Semiotic Inspection of iOS7 Icon Design Changes  

Science Journals Connector (OSTI)

This work follows an ongoing discussion on the implications of skeuomorphic vs. flat design for interface design. Therefor two subsets of the standard iOS6 and iOS7 system icons were reviewed with a semiotic insp...

Christian Stickel; Hans-Martin Pohl…

2014-01-01T23:59:59.000Z

257

Elevated surface temperature depresses survival of banner-tailed kangaroo rats: will climate change cook a desert icon?  

Science Journals Connector (OSTI)

D. spectabilis...is an arid-adapted rodent endemic to the Chihuahuan Desert of North America. Members of this genus are desert icons that are renowned for their behavioral and...1964; Best 1988; ...

Martin R. Moses; Jennifer K. Frey; Gary W. Roemer

2012-01-01T23:59:59.000Z

258

Natural killer cells are crucial for the efficacy of Icon (factor VII/human IgG1 Fc) immunotherapy in human tongue cancer  

Science Journals Connector (OSTI)

Icon is a novel, dual neovascular- and ... this study is to elucidate the mechanism of Icon immunotherapy in cancer using a squamous carcinoma...in vitro and in vivo in severe combined immunodeficiency (SCID) mic...

Zhiwei Hu; Jing Li

2010-10-01T23:59:59.000Z

259

1 Introduction Since the design of the Icon programming language in the early 1980's, newer languages have incorporated a number  

E-Print Network [OSTI]

- 1 - Abstract 1 Introduction Since the design of the Icon programming language in the early 1980's are interested in extending, or changing the Icon language [Gri82][GG83] to reflect these innovations in language design. Icon is distributed with a flexible interpreter and run-time system. This flexibility is seen

Bailey, Mark W.

260

Modeling the Visual Search of Displays: A Revised ACT-R/PM Model of Icon Search Based on Eye-Tracking and  

E-Print Network [OSTI]

Modeling the Visual Search of Displays: A Revised ACT-R/PM Model of Icon Search Based on Eye efficient of these strategies. Icons, which are becoming increasingly prevalent, serve as the focus & Byrne, 2002) presented a study of "icon search" and a set of computational models of the task in the ACT

Byrne, Mike

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Proceedings of the 8th International Conference on Advanced Robotics, pages 447-452, 1997. Mobile Robot Self-Localization by Iconic Matching of Range Maps  

E-Print Network [OSTI]

Robot Self-Localization by Iconic Matching of Range Maps Clark F. Olson Jet Propulsion Laboratory, and missing data. Keywords: Mobile robot, self-localization, Hausdor distance, iconic matching, stereo vision of the robot in natural terrain using iconic matching techniques by comparing this range map computed

Olson, Clark F.

262

Communicating global cardiovascular risk: Are icon arrays better than numerical estimates in improving understanding, recall and perception of risk?  

Science Journals Connector (OSTI)

AbstractObjective Experts recommend that adults have their global cardiovascular risk assessed. We investigated whether icon arrays increase understanding, recall, perception of CVR, and behavioral intent as compared with numerical information. Methods Male outpatient veterans, at an intermediate to high cardiovascular risk participated in a randomized controlled trial of a computer tutorial presenting individualized risk. Message format was presented in 3 formats: percentages, frequencies, and frequencies with icon arrays. We assessed understanding immediately (T1) and recall at 20 min (T2) and 2 weeks (T3) after the intervention. We assessed perceptions of importance/seriousness, intent to adhere, and self-efficacy at T1. Self-reported adherence was assessed at T3. Results One-hundred and twenty male veterans participated. Age, education, race, health literacy and numeracy were comparable at baseline. There were no differences in understanding at T1 [p = .31] and recall at T3 [p = .10]. Accuracy was inferior with frequencies with icon arrays than percentages or frequencies at T2 [p ? .001]. There were no differences in perception of seriousness and importance for heart disease, behavioral intent, self-efficacy, actual adherence and satisfaction. Conclusion Icon arrays may impair short-term recall of CVR. Practice implications Icon arrays will not necessarily result in better understanding and recall of medical risk in all patients.

Jorge G. Ruiz; Allen D. Andrade; Rocio Garcia-Retamero; Ramanakumar Anam; Remberto Rodriguez; Joseph Sharit

2013-01-01T23:59:59.000Z

263

Color combination and exposure time on legibility and EEG response of icon presented on visual display terminal  

Science Journals Connector (OSTI)

This study explored the effect of target/background color combination and exposure time on legibility of and EEG response to icons presented on a visual display terminal (VDT). The results showed that color combinations with high preference had better legibility than those with low preference. Peak latency of P100 at visual-cortex area (O1, O2, OZ) showed significantly faster response time with high preference color combinations than with low preference. Mean amplitudes of P300 were significantly greater for short exposure time, i.e., the subjects had greater attention load with short exposure time. In summary, both icon color combination and exposure time had significant effects on the accuracy of icon legibility, and the result was confirmed in EEG analysis.

Yun-Ying Yeh; Der-Song Lee; Ya-Hsien Ko

2013-01-01T23:59:59.000Z

264

Installing JBuilder 4 Foundation from the Student CD-ROM 1. Open the My Computer icon on the Window, as shown in  

E-Print Network [OSTI]

Installing JBuilder 4 Foundation from the Student CD-ROM 1. Open the My Computer icon on the Window, as shown in Figure 1. 2. Right-click the CD-ROM icon (labeled JAVAWJB4) and choose Open to display the CD-ROM

Liang, Y. Daniel

265

Characterization of paint and varnish on a medieval Coptic-Byzantine icon: Novel usage of dammar resin  

Science Journals Connector (OSTI)

A comprehensive study has been undertaken into a 13th century Coptic-Byzantine icon from the St. Mercurius Church, St. Mercurius monastery, Old Cairo, Egypt. The layered structure, pigment composition and varnish identification were revealed by means of optical and Raman microscopy and gas chromatography–mass spectrometry (GC–MS). The structure of the icon comprised six layers; wooden panel, canvas, white ground, two bole layers and a single paint layer. Azurite (2CuCO3·Cu(OH)2), cinnabar (mercuric (II) sulfide ?-HgS), yellow ochre (Fe2O3·H2O), hydromagnesite Mg5(CO3)4(OH)2·4H2O and lamp black (carbon, C) are the pigments identified in the icon. The green paint area is of interest as it is applied neither with a green pigment nor with a mixture of a blue and yellow pigment. Instead, a yellow layer of dammar resin was applied on top of blue azurite to obtain the green colour. Pinaceae sp. resin mixed with drying oil was used as a protective varnish.

M. Abdel-Ghani; H.G.M. Edwards; B. Stern; R. Janaway

2009-01-01T23:59:59.000Z

266

bZIP67 Regulates the Omega-3 Fatty Acid Content of Arabidopsis Seed Oil by Activating FATTY ACID DESATURASE3  

Science Journals Connector (OSTI)

...for a broad variety of industrial applications (Lu et...used to assist in the assessment of overall differences...place bZIP67 near the center of gene regulatory networks...analysis and quantitative assessment of changes in neutral...feed, biofuel, and industrial applications. Curr...

Ana Mendes; Amélie A. Kelly; Harrie van Erp; Eve Shaw; Stephen J. Powers; Smita Kurup; Peter J. Eastmond

2013-08-30T23:59:59.000Z

267

UV-B-Responsive Association of the Arabidopsis bZIP Transcription Factor ELONGATED HYPOCOTYL5 with Target Genes, Including Its Own Promoter  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Roman Ulm ( roman.ulm@unige.ch ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The bZIP transcription factor HY5 plays an important...

Melanie Binkert; László Kozma-Bognár; Kata Terecskei; Lieven De Veylder; Ferenc Nagy; Roman Ulm

2014-10-28T23:59:59.000Z

268

An uncovered XIII century icon: Particular use of organic pigments and gilding techniques highlighted by analytical methods  

Science Journals Connector (OSTI)

Abstract The restoration of a panel painting depicting a Madonna and Child listed as an unknown Tuscan artist of the nineteenth century, permitted the hidden original version, a XIII century Medieval icon to be uncovered. It is discovery provided the opportunity for an extensive in situ campaign of non-invasive analytical investigations by portable imaging and spectroscopic techniques (infrared, X-ray fluorescence and diffraction, UV–Vis absorption and emission), followed by aimed micro-destructive investigations (Raman and SEM–EDS). This approach permitted characterization of the original ground and paint layers by complementary techniques. Furthermore, this protocol allowed supplementary particularities of great interest to be highlighted. Namely, numerous original gilding techniques have been accentuated in diverse areas and include the use of surrogate gold (disulphur tin), orpiment as a further false gold and an area with an original silver rich layer. Moreover, pigments including azurite mixed with indigo have been non-invasively identified. Micro-invasive analyses also allowed the diagnosis of organic colorants, namely, an animal anthraquinone lake, kermes and an unusual vegetal chalcone pigment, possibly safflower. The identification of the latter is extremely rare as a painting pigment and has been identified using an innovative adaption to surface enhanced Raman techniques on a cross-section. The resulting data contributes new hypotheses to the historic and artistic knowledge of materials and techniques utilized in XIII century icon paintings and ultimately provides scientific technical support of the recent restoration.

Alessia Daveri; Brenda Doherty; Patrizia Moretti; Chiara Grazia; Aldo Romani; Enrico Fiorin; Brunetto Giovanni Brunetti; Manuela Vagnini

2015-01-01T23:59:59.000Z

269

Arnold Honig, Syracuse University physics icon, dead at 83 http://asnews.syr.edu/newsevents_2012/releases/Honig_Arnold_Obit.html[2/6/2012 10:45:31 AM  

E-Print Network [OSTI]

Arnold Honig, Syracuse University physics icon, dead at 83 http://asnews.syr.edu/newsevents_2012 icon, dead at 83 Honig was a member of the physics department for 56 years Feb 6, 2012 | Article by

Mather, Patrick T.

270

Icones urbaines Mexico-Monnet-fr, 2006, p.1 Original en franais d'un article publi en anglais par une revue scientifique comit de lecture/ French original version of peer-  

E-Print Network [OSTI]

Icones urbaines à Mexico-Monnet-fr, 2006, p.1 Original en français d'un article publié en anglais published in English by a scientific journal: MONNET, Jérôme, "The Geopolitics of Visibility: Urban Icons in Contemporary Mexico City". In: ETHINGTON, Philip J. & SCHWARTZ, Vanessa R (eds.), Atlas of Urban Icons: Studies

Paris-Sud XI, Université de

271

ICON: Eosinophil Disorders  

Science Journals Connector (OSTI)

In light of the increasing burden of allergic diseases, the World Allergy Organization; the American Academy of Allergy, Asthma & Immunology; the European Academy of Allergy and Clinical Immunology; and the Ameri...

Peter Valent MD; Amy D Klion MD…

2012-12-01T23:59:59.000Z

272

iCons 2 Renewable Energy [NatSci 290IH (2) aka i2e] Spring 2013 Syllabus i2e Faculty Guides  

E-Print Network [OSTI]

1 iCons 2 Renewable Energy [NatSci 290IH (2) aka i2e] ­ Spring 2013 Syllabus i2e Faculty Guides Objectives: Students learn to ... in the context of Renewable Energy problems. 1. ... write effectively Trip: Campus Heating and Power (CHP) Thursday Feb 9: Work on Energy Flow Diagram for UMass Amherst

Auerbach, Scott M.

273

iCons 3E Syllabus (NatSci389H) NatSci 389H (formerly 390IH) Team-oriented Lab Discovery  

E-Print Network [OSTI]

-week "energy bootcamp" followed by two comprehensive Unit Projects, each led by a team of faculty experts with fundamental principles of energy science, laboratory instrumentation and measurement. With these skills in Renewable Energy [iCons 3E] Syllabus Spring 2014 Course Vision This course involves student-driven, team

Auerbach, Scott M.

274

Ossis Bregmatis Giganteae Magnitudinis Icon; cum Problemate de Gigantis Statura Determinanda Secundum Regulas Artis Delineatoriae: Quae ad Illustr. Regalis Societatis Praesidem Dum Hans Sloane, Bart. Transmisit Jac. Theodor. Klein Reipubl. Gedan. a Secretis & Reg. Soc. Lond. Soc.  

Science Journals Connector (OSTI)

1739-1741 research-article Ossis Bregmatis Giganteae Magnitudinis Icon; cum Problemate de Gigantis Statura Determinanda Secundum Regulas Artis Delineatoriae: Quae ad Illustr. Regalis Societatis Praesidem...

1739-01-01T23:59:59.000Z

275

Orthodontic treatment complexity and need at the University College Hospital, Ibadan, Nigeria, according to the Index of Complexity, Outcome and Need (ICON): A pilot study  

Science Journals Connector (OSTI)

Abstract Although occlusal indices have been useful in research, audit, practice management, and quality assurance in clinical orthodontics, complexity of orthodontic cases had not been easy to assess for a long time in clinical practice. This pilot study aimed at assessing the orthodontic treatment need and complexity in a referral orthodontic centre in Nigeria. A retrospective analysis of 56 pre-treatment study models randomly selected from the orthodontic model collection of the University College Hospital, Ibadan, Nigeria was carried out without any bias for age or gender. The index of Complexity, Outcome and Need (ICON) was used as the outcome measure. Descriptive statistics were employed in the data analysis. Forty-seven (83.9%) of the sample needed treatment. Thirty-four (60.7%) cases were classified as difficult or very difficult. Only 1 (1.8%) and 13(23.2%) belonged to the easy and mild categories, respectively. The overall mean ICON score was 67.4±19.6SD (range 25–104). Considerable proportions of these referred orthodontic cases in Nigeria needed treatment and had treatment complexity comparable to the Caucasians.

Chukwudi Ochi Onyeaso; Gozie Idaboh

2006-01-01T23:59:59.000Z

276

PLAYER REGISTRATION City State Zip  

E-Print Network [OSTI]

a $100 tax deductible/tax credit donation to Michigan State University. Staff, student and spouse fees are reduced and will not include a tax credit. The balance of the fee covers green fees, cart, lunch ________________________________________________ Name Daytime phone Golfers are registered on a first-come, first-served basis. CREDIT CARD USERS

277

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

278

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

279

Ease of Icon Processing Can Predict Icon Appeal  

Science Journals Connector (OSTI)

Correlations between subjective ratings of interface usability and appeal have been frequently reported. This study examined the possibility that the relationship between usability and appeal are underpinned by i...

Siné McDougall; Irene Reppa

2013-01-01T23:59:59.000Z

280

Wild Icon of the Pamirs  

Science Journals Connector (OSTI)

Over forty persons gather...for a workshop in Urumqi, the capital of China’s Xinjiang province, on September 28, 2006, to discuss the future of wildlife and local cultures in the Pamir Mountains, the so-called Ba...

Dr. George B. Schaller

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Breastfeeding in Byzantine icon art  

Science Journals Connector (OSTI)

The iconography of the Galaktotrophousa or “she who nourishes with milk” was spread all around the Byzantine Empire from Saint Sabas in Palestine to the monasteries of Mount Athos by the seventh century [5...]. I...

Ioannis D. Gkegkes; Vassiliki M. Darla…

2012-07-01T23:59:59.000Z

282

Alaska Region Offshore GIS Data | OpenEI  

Open Energy Info (EERE)

Region Offshore GIS Data Region Offshore GIS Data Dataset Summary Description The US Department of Interior's (DOI) Bureau of Ocean Energy Management, Regulation and Enforcement (BOEMRE) published GIS data of offshore information for the Alaska Region. The data are available as GIS shapefiles. The types of data include: active leases, boundary of US jurisdiction for mineral development, and fed/state boundaries. All .zip files included here contain shapefiles, and most also contain supplemental metadata. Note: metadata appears to be available for all shapefiles from BOEMRE, but not all of the links on the BOEMRE website (http://www.boemre.gov/offshore/mapping/alaska.htm#OPD) work. Source US Bureau of Ocean Energy Management, Regulation and Enforcement (BOEMRE) Date Released July 01st, 2002 (12 years ago)

283

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

a complete line of renewable energy products from its online store.1 Products include solar photovoltaic (PV) panels, wind generators, inverters, batteries and energy related...

284

Kommunikationscontrolling mit dem Icon AdTrek  

Science Journals Connector (OSTI)

Ein Schreckgespenst geistert seit einiger Zeit durch die Marketingabteilungen: das Gespenst der Messbarkeit des „Return on Marketing-Investment“. Vorbei scheinen die glücklichen Zeiten, in denen sich Marketier...

Dipl.-Kfm. Christoph Prox; Dr. Bernd Christian

2009-01-01T23:59:59.000Z

285

Santa Rosalia, the icon of biodiversity  

Science Journals Connector (OSTI)

At the beginning of his career as a limnologist, one of the authors (L.N.-F.) of this article spent a period as a student at the former Istituto Italiano di Idrobiologia in Pallanza. There, it was impossible t...

Luigi Naselli-Flores; Giampaolo Rossetti

2010-10-01T23:59:59.000Z

286

Iconic microphonic moments in historic vocal recordings  

Science Journals Connector (OSTI)

Microphone selection—the strategic pairing of microphone make and model with each sound to be recorded—is one of the most important decisions a sound engineer must make. The technical specifications of the microphone identify which transducers are capable of functioning properly for any given recording task but the ultimate decision is a creative one. The goal is for the performance capabilities of the microphone to not only address any practical recording session challenges but also flatter the sound of the instrument whether in pursuit of palpable realism or a fictionalized new timbre. The creative decision is informed in part by demonstrated success in prior recordings the most important of which are described for that essential pop music instrument: the voice.

2014-01-01T23:59:59.000Z

287

An Evaluation of computer-based icons  

E-Print Network [OSTI]

to the naive beginner. Each of these users approaches the system with a different conceptual model and different expectations on how to use it (Dudley, 1987). Shneiderman (1987) states that one of the problems with graphical interfaces is that users have... to the naive beginner. Each of these users approaches the system with a different conceptual model and different expectations on how to use it (Dudley, 1987). Shneiderman (1987) states that one of the problems with graphical interfaces is that users have...

Yamakawa, Julieta Kaoru

2012-06-07T23:59:59.000Z

288

Transportation Energy Futures | OpenEI  

Open Energy Info (EERE)

Energy Futures Energy Futures Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

289

TEF | OpenEI  

Open Energy Info (EERE)

TEF TEF Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

290

transportation | OpenEI  

Open Energy Info (EERE)

transportation transportation Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)

291

Illinois | OpenEI  

Open Energy Info (EERE)

Illinois Illinois Dataset Summary Description Abstract: Annual average wind resource potential of Illinois at a 50 meter height. Purpose: Provide information on the wind resource development potential within Illinois. Source National Renewable Energy Laboratory (NREL) Date Released June 30th, 2001 (13 years ago) Date Updated February 05th, 2009 (5 years ago) Keywords GIS Illinois NREL shapefile wind Data application/zip icon Shapefile (zip, 793.1 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

292

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Aviation Fuels Development Center Baylor Aviation Fuels Development Center Baylor University Renewable Aviation Fuels Development Center One Bear Place Waco Texas http www baylor edu bias index php id Texas Area CSU Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Caltech Center for Sustainable Energy Research Caltech Center for Sustainable Energy Research East California Boulvard Pasadena California http www ccser caltech edu Southern CA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

293

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State AFS Trinity Power Corp AFS Trinity Power Corp Medina Washington State Vehicles AGNI Motors AGNI Motors India Vehicles UK based manufacturer of DC Motors and Battery Management Systems for Electric Vehicles ATG GmbH ATG GmbH Gl tt Germany Vehicles Provider of products and solutions for using diesel or biodiesel at low temperatures and converting Diesel Operating Vehicles to Straight Vegetable Oil AVL Powertrain Engineering AVL Powertrain Engineering Halyard Drive Plymouth Michigan Vehicles https www avl com Able Energy Co Able Energy Co Mound View Rd River Falls Wisconsin Renewable Energy Services Gateway Solar Vehicles Solar EPC Contractor http www weknowsolar com Acciona Renault Nissan Alliance JV Acciona Renault Nissan Alliance JV Spain Vehicles Spain based joint venture to promote electric vehicles

294

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area AltaRock Energy Inc AltaRock Energy Inc E Green Lake Drive N Seattle Washington Geothermal energy Creates geothermal energy reservoirs develops geothermal facilities http www altarockenergy com Pacific Northwest Area American Clean Coal Fuels American Clean Coal Fuels NW th ave Portland Oregon Biofuels Uses gasification to turn carbon based feedstocks into syngas for biofuels http www cleancoalfuels com Pacific Northwest Area Arzeda Corporation Arzeda Corporation th Ave NE Suite Seattle Washington Biofuels Makes enzymes for cellulosic biofuels http www arzeda com Pacific Northwest Area Bio Algene Bio Algene NE Northlake Way Seattle Washington Biofuels

295

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Center for Sustainable Center for Sustainable Energy Balboa Ave San Diego California Helps residents businesses and public agencies save energy reduce grid demand and generate their own power http energycenter org Southern CA Area Clean Tech Los Angeles Clean Tech Los Angeles Los Angeles California Collaboration between CRA LA Caltech DWP JPL Mayor s Office Port UCLA and USC to establish Los Angeles as the global leader in research commercialization and deployment of clean technologies http cleantechlosangeles org Southern CA Area Clean Tech San Diego Clean Tech San Diego Executive Drive San Diego California Non profit membership organization formed to accelerate San Diego as a world leader in the clean technology economy http www cleantechsandiego org Southern CA Area Community Environmental Council Community Environmental Council W Anapamu

296

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway ANV Partners ANV Partners Denver Colorado Hydro Hydrogen Services Gateway Solar Wind energy AQWON Motors AQWON Motors Speinshart Germany Hydro Hydrogen AQWON Motors has developed the first hydrogen powered stroke engine scooter It has been approved by the German T V the official technical inspection agency ARRC H2 Alliance ARRC H2 Alliance Connecticut Hydro Hydrogen The objective of the ARRC H2 Alliance is to design and build the first viable prototype Hydrogen Fueling Station Information Center in key locations worldwide Acumentrics Corporation Acumentrics Corporation Southwest Park Westwood Massachusetts Hydrogen Development of fuel cells http www acumentrics com Greater Boston Area Ad Venta Ad Venta all e de Bourgogne Bourg de P age Hydrogen Hydrogen

297

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

McClellan Technology Incubator Clean Start McClellan Technology McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area Energy BioSciences Institute Energy BioSciences Institute Berkeley California http www energybiosciencesinstitute org Bay Area Environmental Business Cluster Environmental Business Cluster North First Street Third Floor San Jose California http www environmentalcluster org Bay Area Global Climate and Energy Project Global Climate and Energy Project Via Ortega Suite Stanford California http gcep stanford edu Bay Area Google org Google org Amphitheatre Parkway Mountain View California http www google org Bay Area Lawrence Berkeley National Laboratory LBNL Lawrence Berkeley National

298

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

299

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Arch Venture Partners Owens Street San Francisco Arch Venture Partners Owens Street San Francisco California Venture capital firm investing in alternative energy production http www archventure com Bay Area Atrium Capital Atrium Capital Sand Hill Road Building Suite Menlo Park California Corporate strategic venture investing http www atriumcapital com Bay Area CMEA Capital CMEA Capital Embarcadero Center San Francisco California http www cmea com Bay Area CalCEF Clean Energy Angel Fund CalCEF Clean Energy Angel Fund Third Street Suite San Francisco California Seed Stage Venture Capital Firm http www calcefangelfund com Bay Area Clean Pacific Ventures Clean Pacific Ventures California Street Suite San Francisco California Venture capital firm investing in early stage clean technology companies http www cleanpacific com Bay Area

300

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana QuantumSphere Inc QuantumSphere Inc Santa Ana California Santa Ana CA Manufacturer of metallic nanopowders for applications in aerospace defense energy biomedical and other markets demanding advanced material applications QuantumSphere Inc QuantumSphere Inc Tech Center Dr Santa Ana California Vehicles Advanced materials nanometal catalysts and components for batteries fuel cells emissions reduction and chemical synthesis applications http www qsinano com Southern CA Area Quanzhou Liupu Hydropower Co Ltd Quanzhou Liupu Hydropower Co Ltd Beijing Beijing Municipality China Hydro Beijing based small hydro project developer Queen s University of Belfast Queen s University of Belfast Belfast Northern Ireland United Kingdom BT7 NN Academic institute based in

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brookhaven National Laboratory William Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Calverton Business Incubator Calverton Business Incubator Middle Country Rd Calverton New York http www sunysb edu research calverton Northeast NY NJ CT PA Area Consultative Group on International Agricultural Research Consultative Group on International Agricultural Research H Street NW Washington District of Columbia http www cgiar org Northeast NY NJ CT PA Area Knowledge Strategies Knowledge Strategies Atwell Ct Potomac Maryland Northeast NY NJ CT PA Area Passport to Knowledge Passport to Knowledge Morristown New Jersey http passporttoknowledge com Northeast NY NJ CT PA Area Rutgers EcoComplex Rutgers EcoComplex Florence Columbus Rd Bordentown

302

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany based producer of solid biofuel for energy production and biomass CHP plant developer ABI Energy Consultancy Services ABI Energy Consultancy Services Chennai Tamil Nadu India Biomass ABI Energy provides pre feasibility assessments and detailed biomass assessment studies to organisations considering seeking CDM credits AE E Lentjes GmbH AE E Lentjes GmbH Ratingen Germany Biomass Process and turnkey plant engineering of fossil fuel biomass and waste to energy plants AES Corporation AES Corporation Arlington Virginia Biomass Carbon Gateway Solar Wind energy Virginia based company that generates and distributes

303

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute Breakthrough Institute th Street Suite Oakland Institute Breakthrough Institute th Street Suite Oakland California http www thebreakthrough org Bay Area California Fuel Cell Partnership California Fuel Cell Partnership Industrial Blvd West Sacramento California Collaboration of organizations that work together to promote the commercialization of hydrogen fuel cell vehicles http www fuelcellpartnership net Bay Area ClimateWorks ClimateWorks Montgomery Street Suite San Francisco California http www climateworks org Bay Area Rahus Institute Rahus Institute Center Ave Martinez California Research and educational organization with a focus on resource efficiency http www californiasolarcenter org index html Bay Area San Francisco Biofuels Cooperative San Francisco Biofuels Cooperative Post St San Francisco California Mission is to facilitate access to

304

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean energy energy efficiency a healthy environment and a strong economy for the Empire State http www aceny org Northeast NY NJ CT PA Area Center for Clean Air Policy CCAP Center for Clean Air Policy CCAP First Street NE Suite Washington District of Columbia http www ccap org Northeast NY NJ CT PA Area Coalition for Rainforest Nations CfRN Coalition for Rainforest Nations CfRN Lexington Avenue th Floor New York New York http www rainforestcoalition org eng Northeast NY NJ CT PA Area Conservation International Conservation International Crystal Drive Suite Arlington Virginia http www conservation org Pages default aspx Northeast NY NJ CT PA Area Energy Sector Management Assistance Program of the World Bank ESMAP

305

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products st century Green Solutions LLC st century Green Solutions LLC Grand Blanc Michigan Wind energy Exclusive rights to manufacture and distribute kW wind turbine technology in North America Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area E E Brussels Belgium Buildings Hydro Services Gateway Solar Wind energy

306

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AE Biofuels Inc formerly Marwich II Ltd AE Biofuels Inc formerly Marwich II Ltd West Palm Beach Florida Biofuels Marwich II Ltd OTC BB MWII OB merged in December with AE Biofuels Inc formerly American Ethanol Subsequently Marwich II Ltd has changed its name to AE Biofuels OTC AEBF AHL TECH AHL TECH PO Box Cincinnati Ohio Biofuels Manufacturing Research and development Other Efficient Utilization http www AHL TECH com

307

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

308

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area AEE Solar AEE Solar Redway Drive PO Box Redway California Gateway Solar http www aeesolar com Bay Area Acro Energy Acro Energy S Sierra Ave Oakdale California Gateway Solar solar energy systems http acroenergy com Bay Area Advance Power Inc Advance Power Inc N State St Calpella California Solar wind hydro http www advancepower net Bay Area Alten Alten J Old Middlefield Way Mountain View California Services Solar hot water and solar pool heating Bay Area Alten Solar Alten Solar Old Middlefield Way Suite J Mountain View California

309

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Laboratory Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Austin Clean Energy Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Corvalence Corvalence Jackson St San Francisco California Bay Area E Co E Co Franklin Street Bloomfield New Jersey http www eandco net EcoElectron Ventures Inc EcoElectron Ventures Inc Second Street PMB Encinitas California http www ecoelectron com Southern CA Area

310

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Massachusetts Ballardvale Street Suite Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area Battery Ventures Battery Ventures Winter Street Suite Waltham Massachusetts Venture Capital http www battery com Greater Boston Area Black Coral Capital Black Coral Capital Union Street rd Floor Boston Massachusetts Cleantech private equity http www blackcoralcapital com Greater Boston Area Commons Capital Commons Capital Washington Street th floor Brookline Massachusetts Early stage venture capital fund http www commonscapital

311

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Century Silicon Inc Century Silicon Inc Firman Drive Suite Richardson Texas Gateway Solar Solar Grade Silicon purity http www CenturySilicon com Texas Area Degrees Degrees Embarcadero Center Suite San Francisco California Bioenergy Buildings Carbon Geothermal energy Services Gateway Solar Wind energy Environmental Commodities http www degreesinc com Bay Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation

312

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Fraunhofer Center Fraunhofer Center for Sustainable Energy Systems First St Suite Cambridge Massachusetts http cse fraunhofer org Greater Boston Area Gaia Worldwide Gaia Worldwide PO Box Cambridge Massachusetts Provider of Executive Search and headhunting services to solar and directly related industries http www gaiasearch com Greater Boston Area Greentech Media Greentech Media massachusetts avenue Cambridge Massachusetts http www greentechmedia com Greater Boston Area Harvard The Clean Energy Project Harvard The Clean Energy Project Massachusetts Avenue Cambridge Massachusetts http cleanenergy harvard edu Greater Boston Area MIT Center for st Century Energy MIT Center for st Century Energy Massachusetts Avenue Cambridge Massachusetts http web mit edu c21ce Greater Boston

313

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance for Sustainable Colorado Alliance for Sustainable Colorado Wynkoop Street Denver Colorado Mission of is to catalyze the shift to a truly sustainable world by fostering collaboration among nonprofits businesses governments and academia http www sustainablecolorado org Rockies Area American Solar Energy Society American Solar Energy Society Central Ave Boulder Colorado Nonprofit organization dedicated to increasing the use of solar energy energy efficiency and other sustainable technologies in the U S http www ases org Rockies Area Boulder Innovation Center Boulder Innovation Center th Street Boulder Colorado http www boulderinnovationcenter com Rockies Area Clean Economy Network Rockies Clean Economy Network Rockies Denver Colorado http rockies cleaneconomynetwork org Rockies Area

314

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Environmental Foundation Bonneville Environmental Foundation Environmental Foundation Bonneville Environmental Foundation SW st Avenue Portland Oregon https www b e f org Pacific Northwest Area Earth Share Oregon Earth Share Oregon SW Washington Street Portland Oregon Federation of leading local and national non profit conservation groups that provides a convenient way to support conservation and healthy communities http www earthshare oregon org Pacific Northwest Area Renewable Northwest Project Renewable Northwest Project SW Oak St Ste Portland Oregon Nonprofit Advocacy Organization http www RNP org Pacific Northwest Area Solar Oregon Solar Oregon SE Grand Ave Portland Oregon Non profit membership organization providing public education and community outreach to encourage Oregonians to choose solar energy http www solaroregon org Pacific

315

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

x America s Energy Future x America s Energy Future Maryland http www x America s Energy Future x America s Energy Future Maryland http www x25 org A View of the Rockies A View of the Rockies http www aviewoftherockies com ACORE ACORE PO Box Washington District of Columbia http www acore org AIT UNEP Regional Resource Centre for Asia and the Pacific AIT UNEP Regional Resource Centre for Asia and the Pacific rd Floor Outreach Building Moo Km http www rrcap unep org ASEAN Centre for Energy ASEAN Centre for Energy Jl HR Rasuna Said Blok X Kav Kuningan Jakarta Indonesia http www aseanenergy org African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en Alliance for Clean Energy New York Alliance for Clean Energy New York Washington Ave Albany New York Coalition dedicated to promoting clean

316

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. Currently, there are a number of projects that are closer to the conditional commitment stage than yours, and we expect these projects, if they reach financial close, to utilize all of our remaining appropriation. Given this reality, we are unable to continue working on your application at this time. We wanted to let

317

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency 3 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area ATS Lighting Inc ATS Lighting Inc PO Box Concord Massachusetts Efficiency Effienct lighting and portable lighting systems http www atslighting com Greater Boston Area AXI LLC AXI LLC Quincy Massachusetts Biofuels Aims to make commercially feasible strains of algae for fuel production Greater Boston Area Acela Energy Group Inc Acela Energy Group Inc Main St Norfolk Massachusetts Efficiency Aims to reduce energy costs via rate negotiation conservation load management and competitive bidding http www acelaenergy com Greater Boston Area Aclara Software Aclara Software Laurel Avenue Wellesley Massachusetts Efficiency Software solutions for efficiency and demand management

318

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Cambridge Energy Alliance Cambridge St Cambridge Cambridge Energy Alliance Cambridge St Cambridge Massachusetts Helps Cambridge residential and business customers identify and arrange financing for all cost effective efficiency and renewable measures http www cambridgeenergyalliance org Greater Boston Area CleanTech Boston CleanTech Boston Boston Massachusetts Aggregating all of the Boston area networking events on one calendar http cleantechboston com Greater Boston Area Consortium for Energy Efficiency Consortium for Energy Efficiency North Washington St Boston Massachusetts Consortium of efficiency program administrators from across the U S and Canada who work together on common approaches to advancing efficiency http www cee1 org Greater Boston Area Mass Energy Consumers Alliance Mass Energy Consumers Alliance Centre

319

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Seattle Washington Venture capital firm investing in alternative energy production http www archventure com Pacific Northwest Area Cascadia Capital Cascadia Capital Fifth Avenue Seattle Washington Investment bank focusing on cleantech deals http www cascadiacapital com Pacific Northwest Area Eugene Water and Electric Board Eugene Water and Electric Board East th Avenue Eugene Oregon Electricity and Water http www eweb org Pacific Northwest Area McAdams Wright Ragen McAdams Wright Ragen th Ave Suite Seattle Washington Financial Services http www mwrinc com Pacific Northwest Area OVP Venture Partners OVP Venture Partners SW Macadam Ave Portland Oregon Cleantech venture fund http www ovp com Pacific Northwest Area OVP Venture Partners Washington OVP Venture Partners Washington Market

320

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

boro biofuel boro biofuel maiden lane New York New York Biofuels Multi boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area AWS Truewind AWS Truewind New Karner Road Albany New York Wind energy Energy assessment resource mapping project engineering due diligence performance evaluation and forecasting http www awstruewind com Northeast NY NJ CT PA Area Advanced Solar Power Inc Advanced Solar Power Inc New York New York Gateway Solar Solar electric systems solar hot water http solarli com index html Northeast NY NJ CT PA Area Aircuity Inc Aircuity Inc W Evergreen Avenue Philadelphia Pennsylvania Efficiency Manufacturer of integrated sensing and control solutions http www aircuity com Marketing index asp Northeast NY NJ CT PA Area Allegheny Power Allegheny Power Cabin Hill Drive Greensburg Pennsylvania

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Texas Bridgepoint Texas Bridgepoint Parkway Austin Texas Venture capital firm investing in alternative energy production http www archventure com Texas Area Energy Capital Solutions Energy Capital Solutions North Harwood Street Suite Dallas Texas Investment banking firm focused on rainsing private capital and providing advisory services to public and private energy companies http www energycapitalsolutions com Texas Area Genesis Park Genesis Park San Felipe Houston Texas Private equity firm http www genesis park com Texas Area Haddington Ventures LLC Haddington Ventures LLC Augusta Suite Houston Texas Midstream energy private equity fund http www hvllc com Texas Area Sevin Rosen Funds Texas Austin Sevin Rosen Funds Texas Austin Bridgepoint Parkway Building Suite Austin Texas Venture capital fund http www srfunds

322

NAME ORGANIZATION ADDRESS CITY, ST ZIP Dear NAME:  

Broader source: Energy.gov (indexed) [DOE]

(commitments already made will likely utilize (commitments already made will likely utilize approximately two-thirds of the program's appropriated funds), deep pool of quality applicants, and statutorily imposed September 30, 2011 expiration date mean that not all projects under consideration will ultimately receive a loan guarantee. We are therefore focused on ensuring that we leverage the remaining funds as effectively as possible in the brief time that remains. We believe that it remains possible for your project to reach financial close by the September 30th deadline, assuming you can continue to meet important deadlines in the short timeframe that remains. While we remain committed to working closely with your team to move your project forward, we want to

323

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was DHeat Ltd DHeat Ltd United Kingdom Efficiency DHeat Limited DHL was formed in to industrialize a novel heating element technology that requires significantly less energy to manufacture and offers significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Gateway Solar Wisconsin based based company that makes both water heating equipment and electric motors and also is in the water treatment business Its water heating focus includes a focus on high efficiency and solar suitable equipment A O Smith A O Smith Milwaukee Wisconsin Efficiency http www aosmith com A123 Systems A123 Systems Arsenal Street Watertown Massachusetts Efficiency Nanotech batteries http www a123systems com Greater Boston Area

324

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB A P van den Berg A P van den Berg Heerenveen Netherlands P O Box AB Geothermal energy Gateway Solar Designs and installs soil investigation systems geothermal systems producer of heat pumps heat pump boilers solar collectors and solar boilers ALDACOR ALDACOR E th St Suite Idaho Falls Idaho Buildings Efficiency Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com ALDACOR INC ALDACOR INC E th St Suite Idaho Falls Idaho Geothermal energy Hydro Renewable Energy Services Gateway Solar Wind energy http www aldacor com Advanced Solar LLC Advanced Solar LLC E Lincoln Street Westerville Ohio Geothermal energy Renewable Energy Gateway Solar Wind energy Agriculture Consulting Engineering architectural design Installation Maintenance

325

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Brad Thompson Company st Ct NE Kirkland Washington Brad Thompson Company st Ct NE Kirkland Washington Energy developer http www bradtco com Pacific Northwest Area Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Northwest Biodiesel Network Northwest Biodiesel Network Phinney Ave N Seattle Washington To promote the use and benefits of biodiesel through awareness campaigns educational programs and specific initiatives http www nwbiodiesel org Pacific Northwest Area Puget Sound Clean Air Agency Puget Sound Clean Air Agency Third Avenue Seattle Washington Special purpose regional agency chartered by state

326

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area AC Solar Inc AC Solar Inc P O Box Florence Colorado Gateway Solar Solar and wind sales for residential http www acsolar com Rockies Area ALD Nanosolutions ALD Nanosolutions E Burbank Street Unit Broomfield Colorado http www aldnanosolutions com contact php Rockies Area Abengoa Solar Abengoa Solar W th Ave Lakewood Colorado Gateway Solar Solar developer http www abengoasolar com Rockies Area Abound Solar Abound Solar Rocky Mountain Avenue Suite Loveland Colorado Gateway Solar Thin film cadmium telluride solar modules http www abound

327

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Institute for the Built Environment CSU Institute for the Built Institute for the Built Environment CSU Institute for the Built Environment Oval Drive Fort Collins Colorado http www ibe colostate edu Rockies Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org Rockies Area Colorado School of Mines Colorado Energy Research Institute Colorado School of Mines Colorado Energy Research Institute Illinois Street Golden Colorado http www ceri mines org Rockies Area Denver University International Institute for Environment and Enterprise Denver University International Institute for Environment and Enterprise S University Blvd Denver Colorado http www du edu enviro Research htm Rockies Area EverSealed Windows Inc EverSealed Windows Inc Interlocken Drive Evergreen

328

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Alliance Apollo Alliance Townsend Street Suite San Francisco Alliance Apollo Alliance Townsend Street Suite San Francisco California Coalition of labor business environmental and community leaders working towards a clean energy revolution http apolloalliance org Bay Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www bootsontheroof com Bay Area CalCEF Angel Network CalCEF Angel Network Third Street Suite San Francisco California http www calcefangelnetwork org Bay Area Cleantech Open Cleantech Open Broadway Street Redwood City California http www cleantechopen com Bay Area Go Solar California Go Solar California San Francisco California Joint effort of CA energy commission and CPUC http www gosolarcalifornia ca gov Bay Area Green Depot Green Depot P O Box Santa Monica California Non profit

329

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Partners Inc Advanced Materials Partners Inc Pine Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Akeida Capital Management Akeida Capital Management New York New York Financing Environmental Projects http www akeidacapital com Northeast NY NJ CT PA Area Ardour Capital Ardour Capital th ave New York New York http www ardourcapital com Northeast NY NJ CT PA Area Asia West LLC Asia West LLC One East Weaver Street Greenwich Connecticut Strategic investor in environmental technologies http www asiawestfunds com Northeast NY NJ CT PA Area BEV Capital BEV Capital Tresser Blvd th Floor Stamford Connecticut Venture capital firm http www bevcapital com Northeast NY NJ CT PA Area Battelle Ventures Battelle Ventures Carnegie Center Suite Princeton

330

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Washington Second Washington Second Avenue Suite Seattle Washington http www archventure com Pacific Northwest Area Applied Process Engineering Laboratory Applied Process Engineering Laboratory Hills Street Suite Richland Washington http www apel org contact html Pacific Northwest Area Big Sky Carbon Sequestration Partnership Big Sky Carbon Sequestration Partnership University Way rd Floor Bozeman Montana One of the US DOE s seven regional carbon sequestration partnerships http www bigskyco2 org Pacific Northwest Area Clean Edge Inc Clean Edge Inc Portland Oregon http www cleanedge com Pacific Northwest Area Northwest National Marine Renewable Energy Center Northwest National Marine Renewable Energy Center th Ave Seattle Washington http depts washington edu nnmrec Pacific Northwest Area

331

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Colorado Renewable Energy Society Colorado Renewable Energy Society PO Box Golden Colorado Works for the sensible adoption of cost effective energy efficiency and renewable energy technologies by Colorado businesses and consumers http www cres energy org Rockies Area Environmental Entrepreneurs E2 Environmental Entrepreneurs E2 Pearl Street Suite Boulder Colorado http www e2 org jsp controller docName roxchapterwebpage Rockies Area Hogan Hartson Hogan Hartson Walnut Street Boulder Colorado Climate Change Clean Energy http www hhlaw com Rockies Area Northern Colorado Clean Energy Cluster Northern Colorado Clean Energy Cluster Denver Colorado Business led project oriented group of regional partners seeking to have a global impact http www nccleanenergy com Rockies Area Sustainability Center of the Rockies Sustainability Center of the Rockies

332

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

Category Sector Telephone number Website Category Sector Telephone number Website Coordinates Testing Facilities Overseen References Alden Research Laboratory Inc Alden Research Laboratory Inc Shrewsbury Street Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro Hydro http www aldenlab com http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large Flume Bucknell University Bucknell University Civil Mechanical Engineering Departments Hydraulic Flume Moore Avenue Dana Engineering Building Lewisburg Pennsylvania Category Testing Facility Operators Hydro http www bucknell edu x16287 xml Bucknell Hydraulic Flume Colorado State University Hydrodynamics Colorado State University Hydrodynamics Daryl B Simons Building Engineering Research Center Campus Delivery

333

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Charge Inc Charge Inc Dallas Texas Developer of patented technology Charge Inc Charge Inc Dallas Texas Developer of patented technology for faster battery charging time which also extends battery lifetime Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com Soltech Inc Soltech Inc Richardson Texas Texas based PV module maker st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto

334

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area th Day Energy th Day Energy River Belle Tollhouse California Gateway Solar Solar electric systems http www thdayenergy com Southern CA Area ABC Solar Inc ABC Solar Inc Hawthorne Blvd Torrance California Gateway Solar Solar power systems products http www abcsolar com Southern CA Area Achates Power Achates Power Sorrento Valley Boulevard San Diego California Vehicles Developing a fuel efficient cleaner burning diesel engine http www achatespower com Southern CA Area AdaptiveARC AdaptiveARC Sitio Manana Carlsbad California Biomass Waste to clean energy startup is developing an arc plasma reactor http www adaptivearc com Southern CA Area

335

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Incubator Austin Clean Energy Incubator West Braker Incubator Austin Clean Energy Incubator West Braker Lane Austin Texas http www ati utexas edu clean energy clean energy html Texas Area Bank of Italy Bank of Italy Via nazionale Rome Italy http www bancaditalia Brookhaven National Laboratory Brookhaven National Laboratory William Floyd Parkway Upton New York http www bnl gov Northeast NY NJ CT PA Area Centro de Energ as Renovables CER Centro de Energ as Renovables CER Agustinas piso Santiago Chile http www cer gov cl Clean Start McClellan Technology Incubator Clean Start McClellan Technology Incubator Bailey Loop McClellan California http www sarta org go cs Bay Area Colorado Renewable Energy Collaboratory Colorado Renewable Energy Collaboratory th Street Suite Denver Colorado http www coloradocollaboratory org

336

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Clean Skies Foundation American Clean Skies Foundation st Clean Skies Foundation American Clean Skies Foundation st Street NE Suite Washington District of Columbia http www cleanskies org Northeast NY NJ CT PA Area Connecticut Clean Energy Fund Connecticut Clean Energy Fund Corporate Place Rocky Hill Connecticut Promotes develops and invests in clean energy sources for the benefit of Connecticut ratepayers http www ctcleanenergy com Northeast NY NJ CT PA Area Global Renewable Energy Network Global Renewable Energy Network P O Box Massapequa New York http www greenjuncture com Northeast NY NJ CT PA Area New Jersey s Clean Energy Program New Jersey s Clean Energy Program South Clinton Avenue Trenton New Jersey Promotes increased energy efficiency and the use of clean renewable sources of energy including solar wind

337

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AWEA American Wind Energy Association AWEA American Wind Energy Association AWEA M Street NW Suite Washington District of Columbia http www awea org Asociacion Argentina de Energia Eolica Asociacion Argentina de Energia Eolica Buenos Aires Argentina http www argentinaeolica org ar Clean Tech Trade Alliance Clean Tech Trade Alliance Wheaton Way Bremerton Washington Internationally focused hybrid trade alliance that will create a successful Clean Technology business cluster http www cleantechtradealliance org Pacific Northwest Area Clean Technology Sustainable Industries Organization Clean Technology Sustainable Industries Organization Coolidge Hwy Royal Oak Michigan http www ct si org Green Integrated Design Green Integrated Design Tempe Arizona http www GreenIntegratedDesign com Massachusetts Hydrogen Coalition Massachusetts Hydrogen Coalition Cummings

338

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting TIER TIER Sixth Avenue Seattle Washington Services Assessment and forecasting products for wind solar and hydro http www tier com Pacific Northwest Area boro biofuel boro biofuel maiden lane New York New York Biofuels Multi feed stock http borobiofuel com Northeast NY NJ CT PA Area A1 Sun Inc A1 Sun Inc th St Berkeley California Gateway Solar Solar PV Design and Installation http www a1suninc com Bay Area A10 Power A10 Power E Blithedale Ave Mill Valley California Gateway Solar Solar Financing and Integration http www a10power com Bay Area A2BE Carbon Capture LLC A2BE Carbon Capture LLC Panorama Ave Boulder Colorado Biofuels Developing technology for producing valuable fuel and food from CO2 using algal photosynthesis and bio harvesting http www algaeatwork com Rockies Area

339

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Sumitomo and US based steel tank manufacturer T Bailey Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

340

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

in solar wind hydro bioethanol and biomass Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

IEn Institute of Power Engineering IEn Warsaw Poland http www ien com pl home Jordan National Energy Research Center Jordan National Energy Research Center P O Box Al...

342

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

technology partners for solar projects in India Kawar Energy Kawar Energy Amman Jordan Services Amman based project developer focused on bringing technologies solutions and...

343

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

gas http www afpc sy com new history htm Al Husseini Amelio JV Al Husseini Amelio JV Jordan Solar JV company to develop a GW solar plant in Jordan and an integrated MW thin film...

344

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

345

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

346

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

347

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

348

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

349

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

350

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

developer expanding into biomass and wind and planning to raise a fund to invest in a pipeline of identified projects Howard Waste Recycling Ltd Howard Waste Recycling Ltd...

351

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

352

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

353

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

American Photovoltaics American Photovoltaics Houston Texas Gateway American Photovoltaics American Photovoltaics Houston Texas Gateway Solar Will manufacture thin film solar modules http apv us com Texas Area C Voltaics C Voltaics Cullen Blvd Science and Research Building Houston Texas Gateway Solar Novel manufacturing process for solar cells with initial focus on OPV http www c voltaics com Texas Area CMNA Power CMNA Power Technology Blvd Austin Texas Wind energy Developing non turbine wind power technology http www cmnapower com Texas Area CPower Texas CPower Texas Congress Avenue Suite Austin Texas Efficiency Provides various energy efficiency management services http www cpowered com Texas Area Celestial Power Celestial Power Hermitage Drive Austin Texas Gateway Solar Solar energy contractor http celestialpower biz Texas Area

354

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Ventures Massachusetts Ballardvale Street Suite Ventures Massachusetts Ballardvale Street Suite A260 Wilmington Massachusetts Venture capital firm investing in early stage clean technology enterprises http www ventures com Greater Boston Area Access Venture Partners Access Venture Partners Turnpike Drive Suite Westminster Colorado Venture Capital http www accessvp com Rockies Area Advanced Materials Partners Inc Advanced Materials Partners Inc Pine Street New Canaan Connecticut Venture investor http www amplink com Northeast NY NJ CT PA Area Advent International Advent International State Street Boston Massachusetts Global private equity firm http www adventinternational com Greater Boston Area African Development Bank African Development Bank Rue Joseph Anoma BP Abidjan Abidjan C te d Ivoire Ivory Coast http www afdb org en

355

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Voltz Limited Voltz Limited Cumbria United Kingdom LA8 NH Renewable Energy Gateway Solar Wind energy Selling and delivering broad range of advanced energy generating systems and accessories including wind turbines solar panels batteries regulators and stables and as well as developing renewable energy technology and related products Technologies Technologies Hartwell Avenue North Lexington Massachusetts Gateway Solar Developer of technologies for enhancing PV efficiency including new cell wiring and wafer packaging systems http www tech com st Light Energy Inc st Light Energy Inc McHennry Ave Suite F Modesto California Gateway Solar http stlightenergy com Southern CA Area Century Solar Inc Century Solar Inc Garland Texas Gateway Solar Privately owned Garland based manufacturer of solar grade polysilicon

356

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

Angeleno Group Century Park East Suite Los Angeles California Angeleno Group Century Park East Suite Los Angeles California Private equity firm focused on high growth investments in energy and environmental technology companies http www angelenogroup com Southern CA Area Applied Ventures LLC Applied Ventures LLC Bowers Avenue Santa Clara California Venture capital http www appliedventures com Southern CA Area EcoElectron Ventures EcoElectron Ventures nd Street Encinitas California Seed stage capital investment fund http www ecoelectron com Southern CA Area GreenCore Capital GreenCore Capital Vista Sorrento Parkway San Diego California Invests in developing promising renewable energy companies http www greencorecapital com Southern CA Area Hydrogen Ventures Hydrogen Ventures N Studabaker Road Long Beach California

357

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

Entrepreneurs Network Austin Solar Energy Entrepreneurs Entrepreneurs Network Austin Solar Energy Entrepreneurs Network Austin Texas Provide networking opportunities for professionals to generate and attract Solar Energy businesses to Central Texas http www austinseen googlepages com Texas Area Austin Technology Incubator Austin Technology Incubator West Braker Lane Austin Texas http www ati utexas edu Texas Area Biodiesel Coalition of Texas Biodiesel Coalition of Texas Congress Avenue Austin Texas Non profit corporation created by biodiesel pioneers and industry leaders to ensure that biodiesel receives favorable treatment by state regulatory agencies and the Texas Legislature http www biodieselcoalitionoftexas org Texas Area Texas Renewable Energy Industries Association Texas Renewable Energy Industries Association P O Box Austin Texas Represents over member

358

U.S. | OpenEI  

Open Energy Info (EERE)

Dataset Summary Description This dataset is a geographic shapefile generated from the original raster data. The original raster data resolution is a 200-meter cell size. Source National Renewable Energy Laboratory (NREL) Date Released August 19th, 2010 (4 years ago) Date Updated August 23rd, 2010 (4 years ago) Keywords GIS Great Lakes NREL offshore wind shapefile U.S. wind windspeed Data application/zip icon Download Shapefile (zip, 11.8 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations. DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

359

Gulf of Mexico | OpenEI  

Open Energy Info (EERE)

Gulf of Mexico Gulf of Mexico Dataset Summary Description This dataset is a geographic shapefile generated from the original raster data. The original raster data resolution is a 200-meter cell size. Source National Renewable Energy Laboratory (NREL) Date Released August 19th, 2010 (4 years ago) Date Updated August 23rd, 2010 (4 years ago) Keywords GIS Gulf of Mexico NREL offshore wind shapefile wind windspeed Data application/zip icon Download Shapefile (zip, 4.9 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations. DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

360

windspeed | OpenEI  

Open Energy Info (EERE)

windspeed windspeed Dataset Summary Description This dataset is a geographic shapefile generated from the original raster data. The original raster data resolution is a 200-meter cell size. Source National Renewable Energy Laboratory (NREL) Date Released August 19th, 2010 (4 years ago) Date Updated August 23rd, 2010 (4 years ago) Keywords GIS hawaii NREL offshore wind shapefile wind windspeed Data application/zip icon Download Shapefile (zip, 4.2 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations. DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Great Lakes | OpenEI  

Open Energy Info (EERE)

Lakes Lakes Dataset Summary Description This dataset is a geographic shapefile generated from the original raster data. The original raster data resolution is a 200-meter cell size. Source National Renewable Energy Laboratory (NREL) Date Released August 19th, 2010 (4 years ago) Date Updated August 23rd, 2010 (4 years ago) Keywords GIS Great Lakes NREL offshore wind shapefile U.S. wind windspeed Data application/zip icon Download Shapefile (zip, 11.8 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations. DISCLAIMER NOTICE This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

362

Minnesota | OpenEI  

Open Energy Info (EERE)

Minnesota Minnesota Dataset Summary Description Abstract: Annual average wind resource potential for Minnesota at a 50 meter height. Purpose: Provide information on the wind resource development potential in Minnesota. Source National Renewable Energy Laboratory (NREL) Date Released November 30th, 2003 (10 years ago) Date Updated November 17th, 2011 (2 years ago) Keywords GIS Minnesota NREL shapefile wind Data application/zip icon minnesota_wind_high_resolution.zip (zip, 2 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

363

IConUSAS 2003 - Past Events - Calendar - Neutron Sciences  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Past Events Saturday, January 11, 2014 Past Events Saturday, January 11, 2014 Go Click on image for larger PDF version, which contains links to additional information. Program with Presentations Abstracts Registration Information Registration Form Speaker Information Hotel Reservations Airline Transportation Airline Ground Transportation Weather in Oak Ridge Workshop Venue What to Do in Oak Ridge Organization Chart Local Contacts Workshop Photos Registration Information The registration fee for the workshop is $150.00 paid on or before June 1; the fee is $200.00 if paid between June 2 and June 26. Registration closes on June 26, 2003. The registration form may be submitted electronically, faxed, or mailed to Al Ekkebus Spallation Neutron Source 701 Scarboro Road Oak Ridge, TN 37830 Fax No.: 865-241-5177

364

Automatic Ranking of Iconic Images Tamara L. Berg  

E-Print Network [OSTI]

TSP with Neighborhoods of Varying Size Mark de Berg Department of Computer Science, TU Eindhoven of the nodes of a graph. This problem has applications in communication-network Email addresses: m.t.d.berg@TUE.nl (Mark de Berg), joachim.gudmundsson@nicta.com.au (Joachim Gudmundsson), matya@cs.bgu.ac.il (Matthew J

Berg, Tamara L.

365

Grounding the Simulation of Iconic Gestures in Gesture Typology  

E-Print Network [OSTI]

shows under (1) the pointed gothic church-window presented in a VR-video film as perceived from an agent. As an illustration of every aspect of our methodology, we will discuss a church-window-example from the SAGA corpus shown in Figure 1 throughout the talk (restricted to the top of the window). Empirical Study

Kouroupetroglou, Georgios

366

1 Copyright 2000 by ASME Proceedings of ICONE 8  

E-Print Network [OSTI]

. Birtcher Materials Science Division, Argonne National Laboratory, MSD 212 E203 9700 S. Cass Ave Argonne, IL resistance. The structure, size, distribution, and morphology of these precipitates depend on the alloy resistance. The corrosion resistance of the zirconium #12;2 Copyright © 2000 by ASME alloys used in nuclear

Motta, Arthur T.

367

Evaluating an icon of population persistence: the Devil's Hole pupfish  

Science Journals Connector (OSTI)

...status among conservation biologists because...colonized this pool well after the...upper 27 m of the water, with a surface...implications for conservation listing. Conserv...populations. In Conservation science and action...calcite record of water table fluctuation...shifts in the gene pool of a managed...

2014-01-01T23:59:59.000Z

368

Supply Chain Simulation mit ICON-SimChain  

Science Journals Connector (OSTI)

Die Planung und Analyse komplexer Lieferketten bedingen Werkzeuge, die zum einen Transparenz und zum anderen eine Bewertbarkeit der dynamischen Zusammenhänge entsprechender Systeme ermöglichen. Stochastische Einf...

Kai Gutenschwager; Knut Alicke

2004-01-01T23:59:59.000Z

369

The Effects of Icon Characteristics on Users’ Perception  

Science Journals Connector (OSTI)

Modern mobile phone application interfaces have potential to support various age group users. Among the different age groups, older adults have been quite slow in adopting mobile phone applications and its interf...

Syed Ghayas; Suziah Sulaiman; Muzafar Khan…

2013-01-01T23:59:59.000Z

370

ICON: neue Technik zur minimal-invasiven Kariesbehandlung  

Science Journals Connector (OSTI)

Man freut sich noch über das Ergebnis und gibt die Leistungen in die EDV ein. Jetzt beginnt das Grübeln. Was rechnet man dafür ab. Eine einflächige Kompositfüllung? Ist ja immerhin auch eine Art Kunststoff. Aber ...

2013-12-01T23:59:59.000Z

371

Beyond Emoticons: Combining Affect and Cognition in Icon Design  

Science Journals Connector (OSTI)

Recently there has been a shift in emphasis from interface usability to interface appeal. Very few studies, however, have examined the link between usability and appeal and evidence regarding the direction of the...

Siné McDougall; Irene Reppa; Gary Smith…

2009-01-01T23:59:59.000Z

372

Bao-yu: A Mental Disorder or a Cultural Icon?  

Science Journals Connector (OSTI)

The Dream of the Red Chamber (or The Story of the Stone) is described as a monumental work of Chinese literature (Cao 1979). The work is multiple in many ways apart from the tit...

Flora Huang; Grant Gillett

2014-06-01T23:59:59.000Z

373

Tactile Icon Design Using a Vibration Actuator in Mobile Devices  

Science Journals Connector (OSTI)

This study presents three attributes for composing vibration patterns: Rhythm, intensity difference, and continuous variation in intensity. The intervals and the duration of the vibrations offer the elements of r...

Meng-Dar Shieh; Zheng-Bin Wu

2008-01-01T23:59:59.000Z

374

Icon-URI Structure with ENUM System for Mobile Device  

Science Journals Connector (OSTI)

URI has been used for the contents by recognizing them as a page of text, sound, video clip, picture, and animation. However, we need a new URI system and service environment for mobile devices because of the dif...

Jiwon Choi; Keecheon Kim

2006-01-01T23:59:59.000Z

375

The Online Behavioural Advertising Icon: Two User Studies  

Science Journals Connector (OSTI)

New Internet technologies provide the possibility of automated tracking of consumers’ Internet behaviour. Such tracking is used to create user profiles for the purpose of displaying advertisements that fit the...

Dr. Guda van Noort; Prof.Dr. Edith G. Smit…

2013-01-01T23:59:59.000Z

376

The Effects of Gender Culture on Mobile Phone Icon Recognition  

Science Journals Connector (OSTI)

Mobile phones have rapidly become the most important communication device in our daily life. According to a recent survey of The Directorate of Telecommunications, Ministry of Transportation and Communications in...

Shunan Chung; Chiyi Chau; Xufan Hsu…

2007-01-01T23:59:59.000Z

377

Icon and Symbol: A Reappraisal of the Resemblance Debate  

Science Journals Connector (OSTI)

Semiotics has been traditionally based on such oppositions as conventional/natural, arbitrary/motivated, digital/ analogical. While such oppositions have proved useful in classifying signs, mutually exclusive ...

Michael J. Giordano

1983-01-01T23:59:59.000Z

378

Icon Design for Older Users of Project Management Software  

Science Journals Connector (OSTI)

Working in projects is an important part of many jobs in service industry. Due to their knowledge and experience project planning is often accomplished by older employees. Therefore, and with regard to the demogr...

Christina Bröhl; Jennifer Bützler…

2013-01-01T23:59:59.000Z

379

An Australian Icon - Planning and Construction of the Parkes Telescope  

E-Print Network [OSTI]

By almost any measure, the Parkes Radio Telescope is the most successful scientific instrument ever built in Australia. The telescope is unsurpassed in terms of the number of astronomers, both national and international, who have used the instrument, the number of research papers that have flowed from their research, and the sheer longevity of its operation (now over fifty years). The original planners and builders could not have envisaged that the telescope would have such an extraordinarily long and productive future. From the start, it was an international project by CSIRO that in the 1950s launched Australia into the world of `big science'. Partly funded by the US Carnegie and Rockefeller foundations, it was designed in England by Freeman Fox & Partners, and built by the German firm MAN. This article will give an overview of the origins of the idea for the telescope and the funding, planning and construction of the Parkes dish over the period 1954 to 1961.

Robertson, Peter

2012-01-01T23:59:59.000Z

380

Hybrid Reasoning and the Future of Iconic Representations  

E-Print Network [OSTI]

We give a brief overview of the main characteristics of diagrammatic reasoning, analyze a case of human reasoning in a mastermind game, and explain why hybrid representation systems (HRS) are particularly attractive and promising for Artificial General Intelligence and Computer Science in general.

Recanati, Catherine

2008-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Icon as Index: A Theory of Middle Byzantine Imagery  

Science Journals Connector (OSTI)

The Middle Byzantine period (843 A.D. to 1204 A.D.)1a has been characterized by many scholars as a period of renascence. The “classical tradition”2 which purportedly flourished at this time, has been noted as a m...

Deborah Bershad

1983-01-01T23:59:59.000Z

382

Language Independent Icon-Based Interface for Accessing Internet  

Science Journals Connector (OSTI)

With the advancement of the information technology, Internet becomes an essential part in our every sphere of life. However, the benefits of Internet are limited to only educated people who can read and write in ...

Santa Maiti; Debasis Samanta; Satya Ranjan Das…

2011-01-01T23:59:59.000Z

383

Art as Icon; an Interpretation of C. W. Morris  

Science Journals Connector (OSTI)

“SIGNS, signs, signs! From sounds, sights, tastes, feels, odors. From things, from persons, from oneself. Take them away and we would be more humanly naked than if we walked the streets without clothes.” So wr...

Louise Nisbet Roberts

1967-01-01T23:59:59.000Z

384

Usability Study of Icon Designs with Social Network Functions  

Science Journals Connector (OSTI)

The social media and related applications were developed and spread fast in our daily lives. Many users of social network sites (SNS) would use social network functions to communicate with their friends, such as ...

Chien-Hsiung Chen; Wen-Hsin Hsiao…

2013-01-01T23:59:59.000Z

385

Modern architecture: an analysis of the Iconic vision in film  

E-Print Network [OSTI]

In reaction to the academic revivalism of the nineteenth century, early modern architects sought a radical departure in form that would reflect a new spirit. Flowing, open spaces and bold, abstract forms, their use of materials in unusual ways...

Johnston, Benjamin Michael

2013-02-22T23:59:59.000Z

386

A German-American Icon: O, du schöne Schnitzelbank!  

E-Print Network [OSTI]

in Detroit, Michigan, highlighting the location as a place for food and drink. Here the " langer Mann" and " Tanenbaum" are exchanged for the two couplets: Ist das nicht eine gute Wurst? - Ja, das ist eine gute Wurst! Ist das nicht ein grosser Durst? - Ja... Rapids, Michigan, and Jasper, Indiana. The classical German-American Schnitzelbank chart and song would seem to be something truly "made in America." Judging by the frequency with which the Schnitzelbank or some variation of it appears in American...

Keel, William

2003-09-01T23:59:59.000Z

387

BY EWEN CALLAWAY he iconic status of Archaeopteryx, the  

E-Print Network [OSTI]

up in limestone quarries in Bavaria, southern Germany, in the early 1860s. Until recently, they were

Napp, Nils

388

AJ\\EC 1005, 1006 I;CON 2005, 2006  

E-Print Network [OSTI]

Analysis :l FST 4524 Food Quality Assurance (WI) 3 FST 4604 Food Microbiology 4 MGT 3304 Administrative standing, cr~tlil by examination. and freshman rule hours). students must have passed at least 12 semester, advanced placement. advanced standing. credit by examination, and freshman rule hours). students must: a

Virginia Tech

389

OpenEI Community - load profile  

Open Energy Info (EERE)

/0 en Commercial and /0 en Commercial and Residential Hourly Load Data Now Available on OpenEI! http://en.openei.org/community/blog/commercial-and-residential-hourly-load-data-now-available-openei Load dataImage source: NREL 

Files: 
icon field-icon-application-zip" alt="application/zip icon"

390

OpenEI Community - data  

Open Energy Info (EERE)

and and Residential Hourly Load Data Now Available on OpenEI! http://en.openei.org/community/blog/commercial-and-residential-hourly-load-data-now-available-openei Load dataImage source: NREL 

Files: 
icon field-icon-application-zip" alt="application/zip icon"

391

ocean | OpenEI  

Open Energy Info (EERE)

ocean ocean Dataset Summary Description This shapefile represents the seasonal winter depth profile to reach water at a temperature of 20ºC. Source NREL Date Released October 28th, 2012 (2 years ago) Date Updated Unknown Keywords depth profile hydrokinetic ocean ocean energy ocean thermal energy conversion OTEC seawater cooling thermal Data application/zip icon OTEC Seawater Cooling 20ºC Depth Profile - Winter Average (zip, 1.1 MiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Time Period March 2009 - February 2011 License License Other or unspecified, see optional comment below Comment This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

392

ocean energy | OpenEI  

Open Energy Info (EERE)

ocean energy ocean energy Dataset Summary Description This shapefile represents the seasonal winter depth profile to reach water at a temperature of 20ºC. Source NREL Date Released October 28th, 2012 (2 years ago) Date Updated Unknown Keywords depth profile hydrokinetic ocean ocean energy ocean thermal energy conversion OTEC seawater cooling thermal Data application/zip icon OTEC Seawater Cooling 20ºC Depth Profile - Winter Average (zip, 1.1 MiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Time Period March 2009 - February 2011 License License Other or unspecified, see optional comment below Comment This GIS data was developed by the National Renewable Energy Laboratory ("NREL"), which is operated by the Alliance for Sustainable Energy, LLC for the U.S. Department of Energy ("DOE"). The user is granted the right, without any fee or cost, to use, copy, modify, alter, enhance and distribute this data for any purpose whatsoever, provided that this entire notice appears in all copies of the data. Further, the user of this data agrees to credit NREL in any publications or software that incorporate or use the data. Access to and use of the GIS data shall further impose the following obligations on the User. The names DOE/NREL may not be used in any advertising or publicity to endorse or promote any product or commercial entity using or incorporating the GIS data unless specific written authorization is obtained from DOE/NREL. The User also understands that DOE/NREL shall not be obligated to provide updates, support, consulting, training or assistance of any kind whatsoever with regard to the use of the GIS data. THE GIS DATA IS PROVIDED "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL DOE/NREL BE LIABLE FOR ANY SPECIAL, INDIRECT OR CONSEQUENTIAL DAMAGES OR ANY DAMAGES WHATSOEVER, INCLUDING BUT NOT LIMITED TO CLAIMS ASSOCIATED WITH THE LOSS OF DATA OR PROFITS, WHICH MAY RESULT FROM AN ACTION IN CONTRACT, NEGLIGENCE OR OTHER TORTIOUS CLAIM THAT ARISES OUT OF OR IN CONNECTION WITH THE ACCESS OR USE OF THE GIS DATA. The User acknowledges that access to the GIS data is subject to U.S. Export laws and regulations and any use or transfer of the GIS data must be authorized under those regulations. The User shall not use, distribute, transfer, or transmit GIS data or any products incorporating the GIS data except in compliance with U.S. export regulations. If requested by DOE/NREL, the User agrees to sign written assurances and other export-related documentation as may be required to comply with U.S. export regulations.

393

central air conditioner | OpenEI  

Open Energy Info (EERE)

central air conditioner central air conditioner Dataset Summary Description View 2010 energy efficiency data from AeroSys Inc, Coaire, Cold Point, First Operations, LG Electronics, Nordyne, and Quietside manufacturers. Data includes cooling capacity, cooling performance, heating capacity, and heating performance. Spreadsheet was created by combining the tables in pdf files that are included in the zip file. Source Energy Applicance Data - United States Federal Trade Commission, www.ftc.gov Date Released Unknown Date Updated Unknown Keywords air conditioner central air conditioner efficiency efficient energy heat pump Data application/vnd.ms-excel icon 2010_CentralAC_All.xls (xls, 82.4 KiB) application/zip icon 2010CentralAirConditioner.zip (zip, 398.2 KiB) Quality Metrics Level of Review Some Review

394

heat pump | OpenEI  

Open Energy Info (EERE)

heat pump heat pump Dataset Summary Description View 2010 energy efficiency data from AeroSys Inc, Coaire, Cold Point, First Operations, LG Electronics, Nordyne, and Quietside manufacturers. Data includes cooling capacity, cooling performance, heating capacity, and heating performance. Spreadsheet was created by combining the tables in pdf files that are included in the zip file. Source Energy Applicance Data - United States Federal Trade Commission, www.ftc.gov Date Released Unknown Date Updated Unknown Keywords air conditioner central air conditioner efficiency efficient energy heat pump Data application/vnd.ms-excel icon 2010_CentralAC_All.xls (xls, 82.4 KiB) application/zip icon 2010CentralAirConditioner.zip (zip, 398.2 KiB) Quality Metrics Level of Review Some Review

395

air conditioner | OpenEI  

Open Energy Info (EERE)

air conditioner air conditioner Dataset Summary Description View 2010 energy efficiency data from AeroSys Inc, Coaire, Cold Point, First Operations, LG Electronics, Nordyne, and Quietside manufacturers. Data includes cooling capacity, cooling performance, heating capacity, and heating performance. Spreadsheet was created by combining the tables in pdf files that are included in the zip file. Source Energy Applicance Data - United States Federal Trade Commission, www.ftc.gov Date Released Unknown Date Updated Unknown Keywords air conditioner central air conditioner efficiency efficient energy heat pump Data application/vnd.ms-excel icon 2010_CentralAC_All.xls (xls, 82.4 KiB) application/zip icon 2010CentralAirConditioner.zip (zip, 398.2 KiB) Quality Metrics Level of Review Some Review

396

efficiency | OpenEI  

Open Energy Info (EERE)

efficiency efficiency Dataset Summary Description View 2010 energy efficiency data from AeroSys Inc, Coaire, Cold Point, First Operations, LG Electronics, Nordyne, and Quietside manufacturers. Data includes cooling capacity, cooling performance, heating capacity, and heating performance. Spreadsheet was created by combining the tables in pdf files that are included in the zip file. Source Energy Applicance Data - United States Federal Trade Commission, www.ftc.gov Date Released Unknown Date Updated Unknown Keywords air conditioner central air conditioner efficiency efficient energy heat pump Data application/vnd.ms-excel icon 2010_CentralAC_All.xls (xls, 82.4 KiB) application/zip icon 2010CentralAirConditioner.zip (zip, 398.2 KiB) Quality Metrics Level of Review Some Review

397

efficient | OpenEI  

Open Energy Info (EERE)

efficient efficient Dataset Summary Description View 2010 energy efficiency data from AeroSys Inc, Coaire, Cold Point, First Operations, LG Electronics, Nordyne, and Quietside manufacturers. Data includes cooling capacity, cooling performance, heating capacity, and heating performance. Spreadsheet was created by combining the tables in pdf files that are included in the zip file. Source Energy Applicance Data - United States Federal Trade Commission, www.ftc.gov Date Released Unknown Date Updated Unknown Keywords air conditioner central air conditioner efficiency efficient energy heat pump Data application/vnd.ms-excel icon 2010_CentralAC_All.xls (xls, 82.4 KiB) application/zip icon 2010CentralAirConditioner.zip (zip, 398.2 KiB) Quality Metrics Level of Review Some Review

398

Industry | OpenEI  

Open Energy Info (EERE)

Industry Industry Dataset Summary Description The Energy Statistics Database contains comprehensive energy statistics on the production, trade, conversion and final consumption of primary and secondary; conventional and non-conventional; and new and renewable sources of energy. The Energy Statistics dataset, covering the period from 1990 on, is available at UNdata. This dataset relates to the consumption of alcohol by other industries and construction. Data is only available for Paraguay and the U.S., years 2000 to 2007. Source United Nations (UN) Date Released December 09th, 2009 (5 years ago) Date Updated Unknown Keywords Agriculture Alcohol consumption Industry UN Data application/zip icon XML (zip, 514 bytes) application/zip icon XLS (zip, 425 bytes) Quality Metrics

399

Buildings Performance Database | OpenEI  

Open Energy Info (EERE)

Buildings Performance Database Buildings Performance Database Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB) text/csv icon BPD Dayton and Gainesville Residential Building Characteristics data (csv, 1.4 MiB) text/csv icon BPD Dayton and Gainesville Residential data headers (csv, 5.8 KiB)

400

Electricity | OpenEI  

Open Energy Info (EERE)

Electricity Electricity Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB) text/csv icon BPD Dayton and Gainesville Residential Building Characteristics data (csv, 1.4 MiB) text/csv icon BPD Dayton and Gainesville Residential data headers (csv, 5.8 KiB)

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

open data | OpenEI  

Open Energy Info (EERE)

open data open data Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB) text/csv icon BPD Dayton and Gainesville Residential Building Characteristics data (csv, 1.4 MiB) text/csv icon BPD Dayton and Gainesville Residential data headers (csv, 5.8 KiB)

402

Gainesville | OpenEI  

Open Energy Info (EERE)

Gainesville Gainesville Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB) text/csv icon BPD Dayton and Gainesville Residential Building Characteristics data (csv, 1.4 MiB) text/csv icon BPD Dayton and Gainesville Residential data headers (csv, 5.8 KiB)

403

Natural Gas | OpenEI  

Open Energy Info (EERE)

Gas Gas Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB) text/csv icon BPD Dayton and Gainesville Residential Building Characteristics data (csv, 1.4 MiB) text/csv icon BPD Dayton and Gainesville Residential data headers (csv, 5.8 KiB)

404

well | OpenEI  

Open Energy Info (EERE)

43 43 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142280543 Varnish cache server well Dataset Summary Description The California Division of Oil, Gas, and Geothermal Resources contains oil, gas, and geothermal data for the state of California. Source California Division of Oil, Gas, and Geothermal Resources Date Released February 01st, 2011 (3 years ago) Date Updated Unknown Keywords California data gas geothermal oil well Data application/vnd.ms-excel icon California district 1 wells (xls, 10.1 MiB) application/vnd.ms-excel icon California district 2 wells (xls, 4 MiB) application/vnd.ms-excel icon California district 3 wells (xls, 3.8 MiB) application/zip icon California district 4 wells (zip, 11.2 MiB)

405

n engl j med 359;26 www.nejm.org december 25, 20082748 Culture Shock --Patient as Icon, Icon as Patient  

E-Print Network [OSTI]

my house staff and students in the team room, a snug bunker filled with glowing monitors. Instead in the bunker. These wereexcellentresidentswhocared enormously about patients' wel- fare. They enjoyed being-flipped") in the bunker, while the real patients keep the beds warm and ensure that the folders bearing their names stay

Bushman, Frederic

406

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

407

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

408

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

409

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

410

Design of protein-interaction specificity gives selective bZIP-binding peptides  

Science Journals Connector (OSTI)

... hydrazide. Proteins were printed on aldehyde-presenting glass slides (Thermo Fisher Scientific) using a Microgrid TAS Arrayer. Twelve identical subarrays were printed on each slide. Each protein was spotted ...

Gevorg Grigoryan; Aaron W. Reinke; Amy E. Keating

2009-04-16T23:59:59.000Z

411

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

, as well as the social and professional consequences for those who cannot afford or choose not to use them that Art is not truth. Art is a lie that makes us realize truth, at least the truth that is given us to understand." Do you believe art is a lie? What kinds of truth may art (or if you prefer, fiction, music

412

Il “Regno del Quasi”. Icone cinesi nelle rappresentazioni partenopee di Ermanno Rea e Roberto Saviano  

E-Print Network [OSTI]

i suoi lettori per le fogne di Parigi. ” Rey Chow, Primitiveda due innamorati a Parigi, ma anche di fenomeni più

Fulginiti, Valentina

2012-01-01T23:59:59.000Z

413

Becoming Joaquin Murrieta: John Rollin Ridge and the Making of an Icon  

E-Print Network [OSTI]

as a wedding or a birth certificate. Neruda acknowledges hiscantata but a birth certificate. ” Neruda wryly declaresClerk: …what about a birth certificate? Three-Fingers: Never

Hausman, Blake Michael

2011-01-01T23:59:59.000Z

414

The New York Yankees as an American Cultural Icon, 1940-1970  

E-Print Network [OSTI]

The New York Yankees baseball club, arguably the United States' most successful and well-known sports franchise, have acquired many cultural connotations over the years, meanings transcending the immediate world of on-field sporting contest...

Bishop, William

2014-05-31T23:59:59.000Z

415

The ICoN integrated communication and navigation protocol for underwater acoustic networks  

E-Print Network [OSTI]

The deployment of autonomous underwater devices has increased dramatically in the last several years, presenting a strong and growing need for a network protocol to mediate acoustic communications between devices. This ...

Kanthan, Rupesh R

2005-01-01T23:59:59.000Z

416

The Plant–Craig Stochastic Convection Scheme in ICON and Its Scale Adaptivity  

Science Journals Connector (OSTI)

The emergence of numerical weather prediction and climate models with multiple or variable resolutions requires that their parameterizations adapt correctly, with consistent increases in variability as resolution increases. In this study, the ...

Richard J. Keane; George C. Craig; Christian Keil; Günther Zängl

2014-09-01T23:59:59.000Z

417

Becoming Joaquin Murrieta: John Rollin Ridge and the Making of an Icon  

E-Print Network [OSTI]

California’s Confederate Cherokee. ” The Californians. 8.4 (Books, 1999. Print. ---. The Cherokee Nation: A History.Everett and Gaston Litton. Cherokee Cavaliers: Forty Years

Hausman, Blake Michael

2011-01-01T23:59:59.000Z

418

NQA-1 Requirements for Commercial Grade Item Acceptance: ICONE20-54738  

SciTech Connect (OSTI)

Objectives are: (1) Present the DOE Chemistry and Metallurgy Research Replacement (CMRR) Project Commercial Grade Item (CGI) Dedication Process; and (2) Present CMRR Project CGI Lessons-Learned.

Van Valkenburg, Taunia S. [Los Alamos National Laboratory; Holmes, Richard A. [Los Alamos National Laboratory; Tepley, Daniel J. [Los Alamos National Laboratory; Sandquist, Gary [APPLIED SCIENCE PROFESSIONALS

2012-07-19T23:59:59.000Z

419

iCons class at UMass brings together students from all scientific disciplines  

E-Print Network [OSTI]

at the University of Massachusetts in Amherst, talks with her team about how they will look at the relationship Integrated Science Building at the University of Massachusetts comprise the first class in a new program team created an experiment looking at whether solar heating would be enough to disinfect the water

Auerbach, Scott M.

420

Why Do Robots Rebel? The Labor History of a Cultural Icon  

E-Print Network [OSTI]

images. And Roland Marchand, in his studies of AmericanPress, 1998); Roland Marchand, Creating the Corporate SoulPress, 1998; Roland Marchand, Advertising the American

Higbie, Tobias

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Evaluation of an Interactive Case-based Online Network (ICON) in a Problem Based Learning Environment  

Science Journals Connector (OSTI)

Purpose...: This study sought to assess the introduction of a web-based innovation in medical education that complements traditional problem-based learning curricula. Utilizing the case method as...

Arif N. Nathoo; Patricia Goldhoff…

2005-08-01T23:59:59.000Z

422

Tactile Crescendos and Sforzandos: Applying Musical Techniques to Tactile Icon Design.  

E-Print Network [OSTI]

Brown,L.M. Brewster,S.A. Purchase,H. In Vol II Proceedings of CHI 2006 (Montreal, Canada), ACM Press pp 610-615.

Brown, L.M.; Brewster, S.A.

423

Macular degeneration and visual icon use: deriving guidelines for improved access  

Science Journals Connector (OSTI)

The objective of this study was to derive empirical knowledge of the visual search strategies of computer users who suffer from age-related macular degeneration (AMD). This was accomplished by recording eye movem...

Julie A. Jacko; Armando B. Barreto…

2002-06-01T23:59:59.000Z

424

The role of arbuscular mycorrhizal fungi in alleviating salt stress in Medicago sativa L. var. icon  

Science Journals Connector (OSTI)

Medicago sativa L. is the most important forage crop in arid and semi-arid areas, where increased salinity is a major factor limiting plant growth and crop productivity. The role of arbuscular my...

Angela Campanelli; Claudia Ruta; Giuseppe De Mastro; Irene Morone-Fortunato

2013-02-01T23:59:59.000Z

425

Icon and Geometric Data Visualization with a Self-Organizing Map Grid  

Science Journals Connector (OSTI)

Data Visualization is an important tool for tasks related to Knowledge Discovery in Databases (KDD). Often the data to be visualized is complex, have multiple dimensions or features and consists of many individua...

Alessandra Marli M. Morais…

2014-01-01T23:59:59.000Z

426

ICON: A System for Implementing Constraints in Object-Based Networks  

Science Journals Connector (OSTI)

A vitally important step in network configuration management is to check the validity of updates made to data elements in the Management Information Base (MIB). For example, if an operator mistakenly configures a...

Shravan K. Goli; Jayant Haritsa; Nick Roussopoulos

1995-01-01T23:59:59.000Z

427

Similarity retrieval of symbolic images with multiple instances of iconic objects: A novel approach  

E-Print Network [OSTI]

Guru,D.S. Punitha,P. Fourth Indian Conference on Computer Vision, Graphics and Image Processing ICVGIP-2004 pp 417 - 422

Guru, D.S.; Punitha, P.; Fourth Indian Conference on Computer Vision, Graphics and Image Processing ICVGIP-2004 pp 417 - 422 [More Details

428

A Cultural Icon: Scientific Exploration into the World’s Environmental Problems in Microcosm  

Science Journals Connector (OSTI)

The most intriguing mysteries of human history are those posed by vanished civilizations. Anyone who has seen the abandoned structures of the Maya, Machu Pichu, or Angkor is moved to ask the questions: “Why di...

John Loret

2003-01-01T23:59:59.000Z

429

Do I like my ICON? Determining preferences for firms' mode of strategic focus  

Science Journals Connector (OSTI)

Whether they intend to or not, firms adopt a strategic mode of focus, a way of directing efforts towards markets, products, both or neither. However, in a fast changing environment, such as South Africa, little information exists on whether managers within these organisations feel that the archetype they have adopted will be appropriate for survival in the near mid-term future. This paper reports on the results of a study that identified the modes of focus of South African firms as perceived by senior marketing managers. It then matches these to the strategic mode that the managers see as most likely to guarantee the future success of their firms. Limitations of the study are identified, implications for management highlighted and avenues for future research discussed.

Leyland F. Pitt; Pierre Berthon; Melani Prinsloo; Deon Nel

2007-01-01T23:59:59.000Z

430

Collaboratively Constructing a VDL-Based Icon System for Knowledge Tagging  

Science Journals Connector (OSTI)

Tag system for a knowledge organization system centralizes and provides the tags that can be employed in classifying, sharing and seeking knowledge for personal or organizational use within a social community. Co...

Xiaoyue Ma; Jean-Pierre Cahier

2012-01-01T23:59:59.000Z

431

Dynamic Cultural Contextualisation of Educational Content in Intelligent Learning Environments using ICON  

Science Journals Connector (OSTI)

Cultural awareness, when applied to Intelligent Learning Environments (ILEs), contours the overall appearance, behaviour, and content used in these systems through the use of culturally-relevant student data and ...

Phaedra Mohammed; Permanand Mohan

2014-10-01T23:59:59.000Z

432

A model of visual spatio-temporal memory: The icon revisited  

Science Journals Connector (OSTI)

With a minimal set of assumptions resulting from considerations about the perception of temporal structure, we argue for the existence of a spatio-temporal memory established by the mapping of time into simult...

Kerstin Schill; Christoph Zetzsche

1995-02-01T23:59:59.000Z

433

Raman spectroscopy of the components of 18th-century icon painting  

Science Journals Connector (OSTI)

The method of Raman spectroscopy is employed in the analysis of lead-containing pigments in ancient Russian painting, transformed pigments, chalk, and drying oil. The Raman spectra of white lead and the mixture o...

N. N. Brandt; N. L. Rebrikova; A. Yu. Chikishev

2009-12-01T23:59:59.000Z

434

An Empirical Study on the Smallest Comfortable Button/Icon Size on Touch Screen  

Science Journals Connector (OSTI)

For the convenience of firefighters’ decision-making and operation, touch screen display was chosen as the preferred interface for a fire information display system. Few studies were conducted to determine comfor...

Xianghong Sun; Tom Plocher; Weina Qu

2007-01-01T23:59:59.000Z

435

Exploration and Field Study of a Password Manager Using Icon-Based Passwords  

Science Journals Connector (OSTI)

We carry out a hybrid lab and field study of a password manager program, and report on usability and security. Our study explores iPMAN, a browser-based password manager that in addition uses a graphical passw...

Kemal Bicakci; Nart Bedin Atalay…

2012-01-01T23:59:59.000Z

436

Exploration of a Feminist Icon: Wonder Woman’s Influence on U.S. Media  

Science Journals Connector (OSTI)

Wonder Women! The Untold Story of American Superheroines follows the trajectory of Wonder Woman from her beginnings (she was developed by a Psychologist to serve as a role model for women), to her time spent as a...

Britney G. Brinkman; Allison Jedinak

2014-05-01T23:59:59.000Z

437

A Study on the Icon Feedback Types of Small Touch Screen for the Elderly  

Science Journals Connector (OSTI)

Small touch screens are widely used in applications such as bank ATMs, point-of-sale terminals, ticket vending machines, facsimiles, and home automation in the daily life. It is intuition-oriented and easy to ope...

Wang-Chin Tsai; Chang-Franw Lee

2009-01-01T23:59:59.000Z

438

“What Say these Young Ones”: Students’ Responses to Shakespeare—An Icon of Englishness  

Science Journals Connector (OSTI)

The legacy of studying Shakespeare is persistent. Established as a critical acculturation educational practice in the nineteenth century, the discipline of ‘English’ sought to instil Western values, tastes, an...

Vessela Balinska-Ourdeva; Ingrid Johnston; Joyti Mangat; Brent McKeown

2013-12-01T23:59:59.000Z

439

The Several Steps from Icon to Symbol Using Structured Cone/Pyramids  

Science Journals Connector (OSTI)

Layered pyramids, cones and quad-trees have been developed almost always with emphasis on only one of their several possibilities. Either: 1) ...

L. Uhr; L. Schmitt

1984-01-01T23:59:59.000Z

440

Without measure : Marion’s apophatic-virtue phenomenology of iconic love.  

E-Print Network [OSTI]

??I investigate Jean-Luc Marion's phenomenology of love and its relation to ethics. I argue that his phenomenology of love provides a possibility for developing ethics.… (more)

Antoninka, Amy.

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

The bridge of iconicity: from a world of experience to the experience of language  

Science Journals Connector (OSTI)

...each of these main domains. This view does not deny a critical role for arbitrariness...new thought. In The Wiley-Blackwell Handbook of Childhood Cognitive Development (ed...In Sign language: an international handbook (eds Pfau, R, Steinbach, M, Woll...

2014-01-01T23:59:59.000Z

442

Ed Ruscha's icons speak of the By Cate McQuaid | GLOBE CORRESPONDENT FEBRUARY 14, 2013  

E-Print Network [OSTI]

Ruscha image of a gas station that reprises throughout the show in a variety of colors. The artist has, to which Ruscha continues to return, comments on our society, with the gas station as America FEBRUARY 14, 2013 MUSEUM ASSOCIATES/LACMA "Standard Station" (1966), a screenprint from the exhibit "Ed

Snider, Barry B.

443

Inductive Generation of Icon Trees in Foveated Multi-Resolution Recognition  

E-Print Network [OSTI]

Brugnot,S. Siebert,J.P. Cowan,C.W. IEE Seventh International Conference on Image Processing and Its Applications, Manchester, UK. Vol. 465 pp 275-279

Brugnot, S.

444

Proceedings of ICONS 2002. International Conference on Sonar Sensors and Systems. SOUND FROM A LIGHT AIRCRAFT  

E-Print Network [OSTI]

in all three media. A technique has been developed for measuring the low-frequency sound speed A LIGHT AIRCRAFT FOR UNDERWATER ACOUSTICS APPLICATIONS Michael J. Buckingham, Eric M. Giddens, Fernando the coast, north of La Jolla, southern California, USA, in which a single-engine, propeller-driven light

Buckingham, Michael

445

Tipping Point Renewable Energy | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Tipping Point Renewable Energy Jump to: navigation, search Logo: Tipping Point Renewable Energy Name Tipping Point Renewable Energy Place Columbus, Ohio Zip 43221 Sector Solar Website http://tipenergy.com/ Coordinates 40.0097883°, -83.0683519° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.0097883,"lon":-83.0683519,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

446

Puna Geothermal Facility | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Puna Geothermal Facility Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Puna Geothermal Facility General Information Name Puna Geothermal Facility Facility Puna Sector Geothermal energy Location Information Address 14-3860 Pohioki Road Location Pāhoa, Hawaii Zip 96778 Coordinates 19.478315710339°, -154.88823652267° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":19.478315710339,"lon":-154.88823652267,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

447

Washington State University Extension Energy Program | Open Energy  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Washington State University Extension Energy Program Jump to: navigation, search Name Washington State University Extension Energy Program Address 905 Plum Street SE Bldg No 3 Place Olympia, Washington Zip 98504 Region Pacific Northwest Area Coordinates 47.0410259°, -122.892209° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.0410259,"lon":-122.892209,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

448

AXI LLC | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » AXI LLC Jump to: navigation, search Name AXI LLC Place Quincy, Massachusetts Zip 02169 Sector Biofuels Product Aims to make commercially feasible strains of algae for fuel production Coordinates 42.2363996°, -71.0200613° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.2363996,"lon":-71.0200613,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

449

Natron Resources Inc | Open Energy Information  

Open Energy Info (EERE)

Page Page Edit with form History Facebook icon Twitter icon » Natron Resources Inc Jump to: navigation, search Name Natron Resources, Inc. Place Oakland, California Zip 94610 Sector Services Product Oakland (California) engineering, design and project management services firm with a focus on both commercial rooftop and ground-mounted PV Coordinates 37.805065°, -122.273024° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.805065,"lon":-122.273024,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

450

electric rates | OpenEI  

Open Energy Info (EERE)

electric rates electric rates Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB) text/csv icon Non-IOU rates by zipcode (csv, 2.1 MiB)

451

Download Fuel Economy Data  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Download Fuel Economy Data Download Fuel Economy Data Fuel economy data are the result of vehicle testing done at the Environmental Protection Agency's National Vehicle and Fuel Emissions Laboratory in Ann Arbor, Michigan, and by vehicle manufacturers with oversight by EPA. 2013 Ford C-MAX Hybrid Data Revised (August 15, 2013) 2011-2013 Hyundai and Kia data revised (November 2, 2012) Downloadable Fuel Economy Data Find and Compare Cars data - MPG data for all 1984-2014 vehicles (Updated: Friday December 20 2013) For Developers: Fueleconomy.gov Web Services CSV: /feg/epadata/vehicles.csv.zip (Documentation) XML: /feg/epadata/vehicles.xml.zip (Documentation) Fuel Economy Datafile* Fuel Economy Guide Adobe Acrobat Icon Green Vehicle Guide Datafile Green Vehicle Guide Adobe Acrobat Icon

452

US utilities | OpenEI  

Open Energy Info (EERE)

6489 6489 Varnish cache server US utilities Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB) text/csv icon Non-IOU rates by zipcode (csv, 2.1 MiB)

453

regional | OpenEI  

Open Energy Info (EERE)

regional regional Dataset Summary Description The UK Department of Energy and Climate Change (DECC) releases annual statistics on domestic and industrial/commercial electricity and gas consumption (and number of meters) at the Middle Layer Super Output Authority (MLSOA) and Intermediate Geography Zone (IGZ) level (there are over 950 of these subregions throughout England, Scotland and Wales). Both MLSOAs (England and Wales) and IGZs (Scotland) include a minimum of approximately 2,000 households. Source UK Department of Energy and Climate Change (DECC) Date Released March 01st, 2008 (6 years ago) Date Updated Unknown Keywords Electricity Consumption gas regional UK Data application/zip icon Guidance document for interpreting data (zip, 1.2 MiB) application/vnd.ms-excel icon Excel file: 2005 MLSOA and IGZ gas and electricity (xls, 10 MiB)

454

petrol | OpenEI  

Open Energy Info (EERE)

petrol petrol Dataset Summary Description Statistics New Zealand conducted and published results of an energy use survey across industry and trade sectors to evaluate energy use in 2009. The data includes: energy use by fuel type and industry (2009); petrol and diesel purchasing and end use by industry (2009); energy saving initiatives by industry (2009); and areas identified as possibilities for less energy use (2009). Source Statistics New Zealand Date Released October 15th, 2010 (4 years ago) Date Updated Unknown Keywords diesel energy savings energy use by sector New Zealand petrol Data application/vnd.ms-excel icon New Zealand Energy Use Survey: Industrial and Trade Sectors (xls, 108 KiB) application/zip icon Energy Use Survey (zip, 127 KiB) Quality Metrics

455

New Zealand | OpenEI  

Open Energy Info (EERE)

Zealand Zealand Dataset Summary Description Statistics New Zealand conducted and published results of an energy use survey across industry and trade sectors to evaluate energy use in 2009. The data includes: energy use by fuel type and industry (2009); petrol and diesel purchasing and end use by industry (2009); energy saving initiatives by industry (2009); and areas identified as possibilities for less energy use (2009). Source Statistics New Zealand Date Released October 15th, 2010 (4 years ago) Date Updated Unknown Keywords diesel energy savings energy use by sector New Zealand petrol Data application/vnd.ms-excel icon New Zealand Energy Use Survey: Industrial and Trade Sectors (xls, 108 KiB) application/zip icon Energy Use Survey (zip, 127 KiB) Quality Metrics

456

rates | OpenEI  

Open Energy Info (EERE)

rates rates Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB) text/csv icon Non-IOU rates by zipcode (csv, 2.1 MiB)

457

QuikScat | OpenEI  

Open Energy Info (EERE)

QuikScat QuikScat Dataset Summary Description (Abstract): Raster GIS ASCII data files of wind speed and wind power density at 10 and 50 m heights. Global data of offshore wind resource as generated by NASA's QuikScat SeaWinds scatterometer. (Purpose): To provide information on the wind resource potential of offshore areas. Source NREL Date Released December 31st, 2005 (8 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords GEF GIS NASA NREL ocean offshore QuikScat SWERA UNEP wind Data application/msword icon Download Documentation (doc, 53.8 KiB) application/zip icon Download Data (zip, 41 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/2000 - 12/31/2004 License License Open Data Commons Public Domain Dedication and Licence (PDDL)

458

Wind: wind speed and wind power density GIS data at 10m and 50m above  

Open Energy Info (EERE)

10m and 50m above 10m and 50m above surface and 0.25 degree resolution for global oceans from NREL Dataset Summary Description (Abstract): Raster GIS ASCII data files of wind speed and wind power density at 10 and 50 m heights. Global data of offshore wind resource as generated by NASA's QuikScat SeaWinds scatterometer. (Purpose): To provide information on the wind resource potential of offshore areas. Source NREL Date Released December 31st, 2005 (9 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords GEF GIS NASA NREL ocean offshore QuikScat SWERA UNEP wind Data application/msword icon Download Documentation (doc, 53.8 KiB) application/zip icon Download Data (zip, 41 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/2000 - 12/31/2004

459

energy use by sector | OpenEI  

Open Energy Info (EERE)

use by sector use by sector Dataset Summary Description Statistics New Zealand conducted and published results of an energy use survey across industry and trade sectors to evaluate energy use in 2009. The data includes: energy use by fuel type and industry (2009); petrol and diesel purchasing and end use by industry (2009); energy saving initiatives by industry (2009); and areas identified as possibilities for less energy use (2009). Source Statistics New Zealand Date Released October 15th, 2010 (4 years ago) Date Updated Unknown Keywords diesel energy savings energy use by sector New Zealand petrol Data application/vnd.ms-excel icon New Zealand Energy Use Survey: Industrial and Trade Sectors (xls, 108 KiB) application/zip icon Energy Use Survey (zip, 127 KiB) Quality Metrics

460

SERC | OpenEI  

Open Energy Info (EERE)

SERC SERC Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

HICC | OpenEI  

Open Energy Info (EERE)

HICC HICC Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

462

Dayton | OpenEI  

Open Energy Info (EERE)

6 6 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142281596 Varnish cache server Dayton Dataset Summary Description This is a non-proprietary subset of DOE's Buildings Performance Database. Buildings from the cities of Dayton, OH and Gainesville, FL areas are provided as an example of the data in full database. Sample data here is formatted as CSV Source Department of Energy's Buildings Performance Database Date Released July 09th, 2012 (2 years ago) Date Updated Unknown Keywords Buildings Performance Database Dayton Electricity Gainesville Natural Gas open data Residential Data application/zip icon BPD Dayton and Gainesville Residential csv files in a zip file (zip, 2.8 MiB)

463

RFC | OpenEI  

Open Energy Info (EERE)

RFC RFC Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

464

DNI GHI | OpenEI  

Open Energy Info (EERE)

DNI GHI DNI GHI Dataset Summary Description (Abstract): Zip file contains year-site specific files including time series of global, direct and diffuse irradiance (Purpose): The time series are useful for performing site specific simulation of customized solar energy systems Source Richard Perez Date Released June 30th, 2004 (10 years ago) Date Updated November 07th, 2007 (7 years ago) Keywords DNI GHI hourly data Nicaragua solar SUNY SWERA TILT UNEP Data application/zip icon Download Data (zip, 3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 01/01/1998 - 12/31/2002 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote

465

MRO | OpenEI  

Open Energy Info (EERE)

8 8 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142281228 Varnish cache server MRO Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB)

466

FRCC | OpenEI  

Open Energy Info (EERE)

FRCC FRCC Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

467

SPP | OpenEI  

Open Energy Info (EERE)

SPP SPP Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

468

eGrid | OpenEI  

Open Energy Info (EERE)

eGrid eGrid Dataset Summary Description Datasets are for the US electricity grid system for eGrid regions (AKGD, AKMS, AZNM, CAMX, ERCT, FRCC, HIMS, HIOA, MROE, MROW, NEWE, NWPP, NYCW, NYLI, NYUP, RFCE, RFCM, RFCW, RMPA, SPNO, SPSO, SRMV, SRMW, SRSO, SRTV, SRVC) for 2008. The data is provided in life cycle inventory forms (xls and xml) . A module report and a detailed spreadsheet are also included.Datasets include generation and transmission of electricity for each of the eGrid regions. It is representative of the year 2008 mix of fuels used for utility generations for each of the eGrid regions Source USLCI Database Date Released Unknown Date Updated Unknown Keywords eGrid Electricity grid LCI life cycle inventory US Data application/zip icon egrid_electricity_lci_datasets_2008.zip (zip, 7 MiB)

469

production capacity | OpenEI  

Open Energy Info (EERE)

production capacity production capacity Dataset Summary Description No description given. Source Oak Ridge National Laboratory Date Released November 30th, 2009 (4 years ago) Date Updated Unknown Keywords biodiesel ethanol location production capacity transportation Data application/zip icon Biorefineries.zip (zip, 7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access Average vote Your vote Overall rating Average vote Your vote Comments Login or register to post comments If you rate this dataset, your published comment will include your rating.

470

unit process | OpenEI  

Open Energy Info (EERE)

unit process unit process Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

471

NPCC | OpenEI  

Open Energy Info (EERE)

NPCC NPCC Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

472

location | OpenEI  

Open Energy Info (EERE)

location location Dataset Summary Description No description given. Source Oak Ridge National Laboratory Date Released November 30th, 2009 (5 years ago) Date Updated Unknown Keywords biodiesel ethanol location production capacity transportation Data application/zip icon Biorefineries.zip (zip, 7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access Average vote Your vote Overall rating Average vote Your vote Comments Login or register to post comments If you rate this dataset, your published comment will include your rating.

473

TRE | OpenEI  

Open Energy Info (EERE)

TRE TRE Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

474

interconnect region | OpenEI  

Open Energy Info (EERE)

interconnect region interconnect region Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

475

Power plant | OpenEI  

Open Energy Info (EERE)

Power plant Power plant Dataset Summary Description No description given. Source Environmental Protection Agency (EPA) Date Released January 26th, 2009 (5 years ago) Date Updated June 07th, 2010 (4 years ago) Keywords eGrid eGRID2007 EIA Electricity emissions epa Power plant Data application/zip icon eGRID2007_Version1-1.zip (zip, 18.7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Work of the U.S. Federal Government. Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access Average vote Your vote Overall rating Average vote Your vote Comments Login or register to post comments

476

ASCC | OpenEI  

Open Energy Info (EERE)

ASCC ASCC Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

477

utilities | OpenEI  

Open Energy Info (EERE)

utilities utilities Dataset Summary Description Datasets are for the US electricity grid system interconnect regions (ASCC, FRCC, HICC, MRO, NPCC, RFC, SERC, SPP, TRE, WECC) for 2008. The data is provided in life cycle inventory (LCI) forms (both xls and xml). A module report and a detailed spreadsheet are also included. Source US Life Cycle Inventory Database Date Released May 01st, 2011 (3 years ago) Date Updated Unknown Keywords ASCC FRCC HICC interconnect region LCI life cycle inventory MRO NPCC RFC SERC SPP TRE unit process US utilities WECC Data application/zip icon interconnect_lci_datasets_2008.zip (zip, 6.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL)

478

LCI | OpenEI  

Open Energy Info (EERE)

3 3 Varnish cache server LCI Dataset Summary Description Datasets are for the US electricity grid system for eGrid regions (AKGD, AKMS, AZNM, CAMX, ERCT, FRCC, HIMS, HIOA, MROE, MROW, NEWE, NWPP, NYCW, NYLI, NYUP, RFCE, RFCM, RFCW, RMPA, SPNO, SPSO, SRMV, SRMW, SRSO, SRTV, SRVC) for 2008. The data is provided in life cycle inventory forms (xls and xml) . A module report and a detailed spreadsheet are also included.Datasets include generation and transmission of electricity for each of the eGrid regions. It is representative of the year 2008 mix of fuels used for utility generations for each of the eGrid regions Source USLCI Database Date Released Unknown Date Updated Unknown Keywords eGrid Electricity grid LCI life cycle inventory US Data application/zip icon egrid_electricity_lci_datasets_2008.zip (zip, 7 MiB)

479

eGRID2007 | OpenEI  

Open Energy Info (EERE)

Dataset Summary Description No description given. Source Environmental Protection Agency (EPA) Date Released January 26th, 2009 (5 years ago) Date Updated June 07th, 2010 (4 years ago) Keywords eGrid eGRID2007 EIA Electricity emissions epa Power plant Data application/zip icon eGRID2007_Version1-1.zip (zip, 18.7 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Other or unspecified, see optional comment below Comment Work of the U.S. Federal Government. Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access Average vote Your vote Overall rating Average vote Your vote Comments Login or register to post comments If you rate this dataset, your published comment will include your rating.

480

Solar: hourly global horizontal (GHI) and direct normal (DNI) data for  

Open Energy Info (EERE)

Ghana from DLR Ghana from DLR Dataset Summary Description (Abstract): Hourly time series of GHI and DNI for the years 2000, 2001 and 2002 for selected sites in Ghana. The hourly data are stored in ASCII files for each station. Please read the documentation file for additional information. (Purpose): For the selected sites, the hourly time series can be used for the simulation of Photovoltaic (PV)-systems or Concentrating Solar Power (CSP)-systems. Source DLR - Deutsches Zentrum für Luft- und Raumfahrt Date Released October 31st, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords DLR DNI Ghana GHI hourly data solar SWERA TILT TMY UNEP Data application/zip icon ghanaDLRtimeseries_103.zip (zip, 2.7 MiB) Quality Metrics Level of Review Some Review Comment

Note: This page contains sample records for the topic "icon shapefile zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

life cycle inventory | OpenEI  

Open Energy Info (EERE)

life cycle inventory life cycle inventory Dataset Summary Description Datasets are for the US electricity grid system for eGrid regions (AKGD, AKMS, AZNM, CAMX, ERCT, FRCC, HIMS, HIOA, MROE, MROW, NEWE, NWPP, NYCW, NYLI, NYUP, RFCE, RFCM, RFCW, RMPA, SPNO, SPSO, SRMV, SRMW, SRSO, SRTV, SRVC) for 2008. The data is provided in life cycle inventory forms (xls and xml) . A module report and a detailed spreadsheet are also included.Datasets include generation and transmission of electricity for each of the eGrid regions. It is representative of the year 2008 mix of fuels used for utility generations for each of the eGrid regions Source USLCI Database Date Released Unknown Date Updated Unknown Keywords eGrid Electricity grid LCI life cycle inventory US Data application/zip icon egrid_electricity_lci_datasets_2008.zip (zip, 7 MiB)

482

Environmental Regulation of Lateral Root Emergence in Medicago truncatula Requires the HD-Zip I Transcription Factor HB1  

Science Journals Connector (OSTI)

...significantly different between groups (Kruskal-Wallis test P 0.05, n 20 in every...and 10 wild-type siblings; Kruskal-Wallis test, P 0.05). Letters indicate...similar (n 20 per experiment; Kruskal-Wallis test, P 0.05). The letters...

Federico Ariel; Anouck Diet; Marion Verdenaud; Véronique Gruber; Florian Frugier; Raquel Chan; Martin Crespi

2010-07-30T23:59:59.000Z

483

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

484

Arabidopsis bZIP16 Transcription Factor Integrates Light and Hormone Signaling Pathways to Regulate Early Seedling Development  

Science Journals Connector (OSTI)

...2008). We identified proteins using the Web-based search engine Mascot ( http://www.matrixscience.com/search_form...1995) GT9934 (bzip16-2) was obtained from the Cold Spring Harbor Laboratory. bzip16-2 was crossed to phyB-5, phyA-201...

Wen-Ping Hsieh; Hsu-Liang Hsieh; Shu-Hsing Wu

2012-10-26T23:59:59.000Z

485

New sciences program, iCons, stresses problem solving By: Alyssa Creamer | September 13, 2010 | ShareThis  

E-Print Network [OSTI]

or renewable energy, and the concentration will be recognized as a certification in the students' chosen field, renewable energy, clean water and climate change. "We picked these four topics," Auerback said. "Because to be able to take the course in the spring because it was our creation and it was us kids that made

Auerbach, Scott M.

486

Coordination-Chemistry Control of Proton Conductivity in the Iconic Metal-Organic Framework Material HKUST-1  

E-Print Network [OSTI]

. As shown below, we find that this approach can increase proton conductivity by close to 2 orders of magnitude. While any of several MOFs featuring open coordination sites3c,14 should be capable constructed from paddlewheel-coordinated (CuII )2 nodes and 1,3,5-benzenetricarboxylate (BTC) linkers15 (Chart

487

Efficacy of ICON® Maxx in the laboratory and against insecticide-resistant Anopheles gambiae in central Côte d'Ivoire  

Science Journals Connector (OSTI)

Long-lasting treatment kits, designed to transform untreated nets into long-lasting insecticidal nets (LLINs), may facilitate high coverage with LLINs where non-treated nets are in place. In this study, the effic...

Mirko S Winkler; Emile Tchicaya; Benjamin G Koudou; Jennifer Donzé…

2012-05-01T23:59:59.000Z

488

Politicians, poisons and moths: ambiguity over the icon status of the Bogong moth (Agrotis infusa) (Noctuidae) in Australia  

Science Journals Connector (OSTI)

The federal Parliamentary Library of Australia recently took the unusual step of publishing an advisory briefing paper on moths (McCormick 2006). It was prompted by concerns arising from the annual ‘invasions’ of...

T. R. New

2007-09-01T23:59:59.000Z

489

Effect of Unresponsive Time for User’s Touch Action of Selecting an Icon on the Video Mirror Interface  

Science Journals Connector (OSTI)

Contactless input methods implementing body motion allow users to control computer systems easily and enjoyably. We focus on the “video mirror interface” as an example of these methods. A user of the video mir...

Kazuyoshi Murata; Masatsugu Hattori…

2013-01-01T23:59:59.000Z

490

A Service for Audio Icon and Audio Books in the Mobile Tourist Information System (TIP) via the Greenstone Digital Library.  

E-Print Network [OSTI]

??This project provides an audio notification about nearby tourism place to visit (named sight in this thesis), a chapter based Audio Books related to the… (more)

Gao, Xin

2007-01-01T23:59:59.000Z

491

Brazil Direct Normal Solar Radiation Model (10km) from INPE and...  

Open Energy Info (EERE)

Shapefile Download Download Shapefile URL: http:en.openei.orgdatasetsdataset4378e298-a06a-46c3-a187-6eb50b8699d0resource70043e8d-e4fe-47b6-a725-18d5d27aaae2download...

492

Solar: monthly and annual average global horizontal irradiance...  

Open Energy Info (EERE)

Shapefile Download Download Shapefile URL: http:en.openei.orgdatasetsdatasetbf630417-0a0e-49c1-96a5-7770efffca8bresource86c37148-e1e7-43bf-8889-22a52f687382download...

493

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

494

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

495

diesel | OpenEI  

Open Energy Info (EERE)

diesel diesel Dataset Summary Description The JodiOil World Database is freely available from the Joint Organisations Data Initiative (JODI) and is updated on or around the 20th of each month. Source JODI Date Released October 01st, 2004 (10 years ago) Date Updated March 21st, 2011 (3 years ago) Keywords crude oil diesel fuel oil gasoline kerosene LPG Data application/zip icon Text file, all JODI Database data: Jan 2002 - Jan 2011 (zip, 14.5 MiB) application/pdf icon Definitions of Abbreviations and Codes (pdf, 698.3 KiB) application/pdf icon Column Headings for Dataset (pdf, 13.4 KiB) Quality Metrics Level of Review Some Review Comment Some of the data has "some review" and some of the data has "no review"; the supplemental documentation provides definitions for the assessment codes for each piece of data in the datasets (essentially, 1 = some review, 2 = use with caution, 3 = not reviewed)

496

LPG | OpenEI  

Open Energy Info (EERE)

LPG LPG Dataset Summary Description The JodiOil World Database is freely available from the Joint Organisations Data Initiative (JODI) and is updated on or around the 20th of each month. Source JODI Date Released October 01st, 2004 (10 years ago) Date Updated March 21st, 2011 (3 years ago) Keywords crude oil diesel fuel oil gasoline kerosene LPG Data application/zip icon Text file, all JODI Database data: Jan 2002 - Jan 2011 (zip, 14.5 MiB) application/pdf icon Definitions of Abbreviations and Codes (pdf, 698.3 KiB) application/pdf icon Column Headings for Dataset (pdf, 13.4 KiB) Quality Metrics Level of Review Some Review Comment Some of the data has "some review" and some of the data has "no review"; the supplemental documentation provides definitions for the assessment codes for each piece of data in the datasets (essentially, 1 = some review, 2 = use with caution, 3 = not reviewed)

497

Sri Lanka | OpenEI  

Open Energy Info (EERE)

Sri Lanka Sri Lanka Dataset Summary Description (Abstract): 50 m wind power density (W/m2) maps of Sri Lanka (Purpose): To provide information on the wind resource potential within Sri Lanka, with supplemental information on political boundaries, transmission lines, roads, and terrain relief. Source NREL Date Released June 30th, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords GEF GIS maps NREL Sri Lanka SWERA UNEP wind Data application/zip icon Download Maps (zip, 799.1 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset

498

maps | OpenEI  

Open Energy Info (EERE)

maps maps Dataset Summary Description (Abstract): 50 m wind power density (W/m2) maps of Sri Lanka (Purpose): To provide information on the wind resource potential within Sri Lanka, with supplemental information on political boundaries, transmission lines, roads, and terrain relief. Source NREL Date Released June 30th, 2004 (10 years ago) Date Updated November 01st, 2007 (7 years ago) Keywords GEF GIS maps NREL Sri Lanka SWERA UNEP wind Data application/zip icon Download Maps (zip, 799.1 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset

499

BLM | OpenEI  

Open Energy Info (EERE)

BLM BLM Dataset Summary Description The U.S. Bureau of Land Management (BLM) released a series of GIS layers of National Forest Service Lands that area closed to goethermal leasing (leases are not granted in these areas). The various types of areas included in this set of GIS layers are: National Monuments, National Recreation Areas, National Wildlife Refuges, National Historic Trails, Wild and Scenic Rivers, Wilderness Areas, and Island Park Geothermal Area. The GIS layers were made available upon publication of the BLM's Nationwide Geothermal Resources Leasing Programmatic Environmental Impact Source BLM Date Released Unknown Date Updated Unknown Keywords BLM geothermal GIS National Forest Service Data application/zip icon 2 GIS files: Historic Trails, Island Park Geothermal Area (zip, 2.4 MiB)

500

LLOAS | OpenEI  

Open Energy Info (EERE)

LLOAS LLOAS Dataset Summary Description The UK Department of Energy and Climate Change (DECC) released experimental statistics on domestic electricity and gas consumption (and number of meters) at the Lower Layer Super Output Authority level (LLSOA) for 2008 and for 2007 (only 45 local authorities included in 2007 data). The LLSOAs have a minimum population of 1,000 (approximately 400 households). The domestic electricity consumption data data is split by ordinary electricity and economy7 electricity usage. These data are classified as experimental. Source UK Department of Energy and Climate Change (DECC) Date Released March 25th, 2010 (4 years ago) Date Updated Unknown Keywords Electricity Consumption gas LLOAS UK Data application/zip icon Guidance document for interpreting data (zip, 1.2 MiB)