Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use


Category:Mason, IA | Open Energy Information  

Open Energy Info (EERE)

IA IA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Mason, IA" The following 16 files are in this category, out of 16 total. SVQuickServiceRestaurant Mason IA MidAmerican Energy Co (Iowa).png SVQuickServiceRestaura... 64 KB SVFullServiceRestaurant Mason IA MidAmerican Energy Co (Iowa).png SVFullServiceRestauran... 64 KB SVHospital Mason IA MidAmerican Energy Co (Iowa).png SVHospital Mason IA Mi... 73 KB SVLargeHotel Mason IA MidAmerican Energy Co (Iowa).png SVLargeHotel Mason IA ... 72 KB SVLargeOffice Mason IA MidAmerican Energy Co (Iowa).png SVLargeOffice Mason IA... 73 KB SVMediumOffice Mason IA MidAmerican Energy Co (Iowa).png SVMediumOffice Mason I... 69 KB SVMidriseApartment Mason IA MidAmerican Energy Co (Iowa).png


Category:Wichita, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wichita, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wichita KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Wichita KS Westar Energy Inc.png SVHospital Wichita KS ... 64 KB SVLargeHotel Wichita KS Westar Energy Inc.png SVLargeHotel Wichita K... 59 KB SVLargeOffice Wichita KS Westar Energy Inc.png SVLargeOffice Wichita ... 64 KB SVMediumOffice Wichita KS Westar Energy Inc.png SVMediumOffice Wichita... 62 KB SVMidriseApartment Wichita KS Westar Energy Inc.png SVMidriseApartment Wic... 61 KB SVOutPatient Wichita KS Westar Energy Inc.png SVOutPatient Wichita K... 62 KB SVPrimarySchool Wichita KS Westar Energy Inc.png


Category:Goodland, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Goodland, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Goodland KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Goodland KS Westar Energy Inc.png SVHospital Goodland KS... 63 KB SVLargeHotel Goodland KS Westar Energy Inc.png SVLargeHotel Goodland ... 59 KB SVLargeOffice Goodland KS Westar Energy Inc.png SVLargeOffice Goodland... 65 KB SVMediumOffice Goodland KS Westar Energy Inc.png SVMediumOffice Goodlan... 63 KB SVMidriseApartment Goodland KS Westar Energy Inc.png SVMidriseApartment Goo... 60 KB SVOutPatient Goodland KS Westar Energy Inc.png SVOutPatient Goodland ... 63 KB SVPrimarySchool Goodland KS Westar Energy Inc.png



Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax



Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...


Type Ia Supernovae Project at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

Type Ia Supernovae Type Ia Supernovae Supernova-1.jpg Update: Recent Berkeley Lab Computing Sciences News about supernovae: read more... Key Challenges: Understanding Type Ia...


DOE - Office of Legacy Management -- Spencer Chemical Co - KS 0-01  

Office of Legacy Management (LM)

KS 0-01 KS 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (KS.0-01 ) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works KS.0-01-1 Location: Pittsburg , Kansas KS.0-01-1 Evaluation Year: 1985 KS.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. KS.0-01-3 KS.0-01-4 Site Disposition: Eliminated - No Authority - AEC licensed KS.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium; Thorium KS.0-01-6 Radiological Survey(s): Yes KS.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation


Prospective Type Ia supernova surveys from Dome A  

E-Print Network (OSTI)

Prospective Type Ia Supernova Surveys From Dome A A. Kim a ,are conducive toward Type Ia supernova surveys forheterogeneities within the Type Ia supernova class, reducing

Kim, A.



Turbulent Combustion in Type Ia Supernova Models  

E-Print Network (OSTI)

We review the astrophysical modeling of type Ia supernova explosions and describe numerical methods to implement numerical simulations of these events. Some results of such simulations are discussed.

F. K. Roepke; W. Hillebrandt



New approaches for modeling type Ia supernovae  

SciTech Connect

Type Ia supernovae (SNe Ia) are the largest thermonuclearexplosions in the Universe. Their light output can be seen across greatstances and has led to the discovery that the expansion rate of theUniverse is accelerating. Despite the significance of SNe Ia, there arestill a large number of uncertainties in current theoretical models.Computational modeling offers the promise to help answer the outstandingquestions. However, even with today's supercomputers, such calculationsare extremely challenging because of the wide range of length and timescales. In this paper, we discuss several new algorithms for simulationsof SNe Ia and demonstrate some of their successes.

Zingale, Michael; Almgren, Ann S.; Bell, John B.; Day, Marcus S.; Rendleman, Charles A.; Woosley, Stan



Theoretical cosmic Type Ia supernova rates  

E-Print Network (OSTI)

The aim of this work is the computation of the cosmic Type Ia supernova rates at very high redshifts (z>2). We adopt various progenitor models in order to predict the number of explosions in different scenarios for galaxy formation and to check whether it is possible to select the best delay time distribution model, on the basis of the available observations of Type Ia supernovae. We also computed the Type Ia supernova rate in typical elliptical galaxies of different initial luminous masses and the total amount of iron produced by Type Ia supernovae in each case. It emerges that: it is not easy to select the best delay time distribution scenario from the observational data and this is because the cosmic star formation rate dominates over the distribution function of the delay times; the monolithic collapse scenario predicts an increasing trend of the SN Ia rate at high redshifts whereas the predicted rate in the hierarchical scheme drops dramatically at high redshift; for the elliptical galaxies we note that the predicted maximum of the Type Ia supernova rate depends on the initial galactic mass. The maximum occurs earlier (at about 0.3 Gyr) in the most massive ellipticals, as a consequence of downsizing in star formation. We find that different delay time distributions predict different relations between the Type Ia supernova rate per unit mass at the present time and the color of the parent galaxies and that bluer ellipticals present higher supernova Type Ia rates at the present time.

R. Valiante; F. Matteucci; S. Recchi; F. Calura



Steamboat IA Geothermal Facility | Open Energy Information  

Open Energy Info (EERE)

IA Geothermal Facility IA Geothermal Facility Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Steamboat IA Geothermal Facility General Information Name Steamboat IA Geothermal Facility Facility Steamboat IA Sector Geothermal energy Location Information Location Washoe, Nevada Coordinates 40.5608387°, -119.6035495° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.5608387,"lon":-119.6035495,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


The progenitors of subluminous type Ia supernovae  

DOE Green Energy (OSTI)

We find that spectroscopically peculiar subluminous SNe Ia come from an old population. Of the thirteen subluminous SNe Ia known, nine are found in E/S0 galaxies, and the remainder are found in early-type spirals. The probability that this is a chance occurrence is only 0.1%. The finding that subluminous SNe Ia are associated with an older stellar population indicates that for a sufficiently large lookback time (already accessible in current high redshift searches) they will not be found. Due to a scarcity in old populations, hydrogen and helium main sequence stars and He red giant stars that undergo Roche lobe overflow are unlikely to be the progenitors of subluminous SNe Ia. Earlier findings that overluminous SNe Ia (DELTA m{sub 15} (B) < 0.94) come from a young progenitor population are confirmed. The fact that subluminous SNe Ia and overluminous SNe Ia come from different progenitor populations and also have different properties is a prediction of the CO white dwarf merger progenitor scenario.

Howell, D. Andrew



Rates and progenitors of type Ia supernovae  

SciTech Connect

The remarkable uniformity of Type Ia supernovae has allowed astronomers to use them as distance indicators to measure the properties and expansion history of the Universe. However, Type Ia supernovae exhibit intrinsic variation in both their spectra and observed brightness. The brightness variations have been approximately corrected by various methods, but there remain intrinsic variations that limit the statistical power of current and future observations of distant supernovae for cosmological purposes. There may be systematic effects in this residual variation that evolve with redshift and thus limit the cosmological power of SN Ia luminosity-distance experiments. To reduce these systematic uncertainties, we need a deeper understanding of the observed variations in Type Ia supernovae. Toward this end, the Nearby Supernova Factory has been designed to discover hundreds of Type Ia supernovae in a systematic and automated fashion and study them in detail. This project will observe these supernovae spectrophotometrically to provide the homogeneous high-quality data set necessary to improve the understanding and calibration of these vital cosmological yardsticks. From 1998 to 2003, in collaboration with the Near-Earth Asteroid Tracking group at the Jet Propulsion Laboratory, a systematic and automated searching program was conceived and executed using the computing facilities at Lawrence Berkeley National Laboratory and the National Energy Research Supercomputing Center. An automated search had never been attempted on this scale. A number of planned future large supernovae projects are predicated on the ability to find supernovae quickly, reliably, and efficiently in large datasets. A prototype run of the SNfactory search pipeline conducted from 2002 to 2003 discovered 83 SNe at a final rate of 12 SNe/month. A large, homogeneous search of this scale offers an excellent opportunity to measure the rate of Type Ia supernovae. This thesis presents a new method for analyzing the true sensitivity of a multi-epoch supernova search and finds a Type Ia supernova rate from z {approx} 0.01-0.1 of r{sub V} = 4.26{sub -1.93 -0.10}{sup +1.39 +0.10} h{sup 3} x 10{sup -4} SNe Ia/yr/Mpc{sup 3} from a preliminary analysis of a subsample of the SNfactory prototype search. Several unusual supernovae were found in the course of the SNfactory prototype search. One in particular, SN 2002ic, was the first SN Ia to exhibit convincing evidence for a circumstellar medium and offers valuable insight into the progenitors of Type Ia supernovae.

Wood-Vasey, William Michael



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


Rolling Hills (IA) | Open Energy Information  

Open Energy Info (EERE)

Rolling Hills (IA) Rolling Hills (IA) Jump to: navigation, search Name Rolling Hills (IA) Facility Rolling Hills (IA) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner MidAmerican Energy Company Developer MidAmerican Energy Company Energy Purchaser MidAmerican Energy Company Location Massena IA Coordinates 41.230443°, -94.75459° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.230443,"lon":-94.75459,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


On the Brightness of Supernova Ia  

E-Print Network (OSTI)

Before 1998 the universe expansion was thought to be slowing down. After 1998 the universe expansion is thought to be accelerating up. The key evidence came from the observed brightness of high redshift supernovae Ia in 1998. Astronomers found that the observed brightness of high redshift supernovae Ia is fainter than expected. Astronomers believe this means that the universe expansion is accelerating up. In this paper it is argued that if the ionized gas in the universe space is taken into account, then the brightness of the high redshift supernova Ia should be fainter than expected. The universe expansion does not need to be accelerating up. The exotic form of energy (dark energy) does not need to be introduce

Yijia Zheng



Spectral diversity of Type Ia Supernovae  

E-Print Network (OSTI)

We use published spectroscopic and photometric data for 8 Type Ia supernovae to construct a dispersion spectrum for this class of object, showing their diversity over the wavelength range 3700A to 7100A. We find that the B and V bands are the spectral regions with the least dispersion, while the U band below 4100A is more diverse. Some spectral features such as the Si line at 6150A are also highly diverse. We then construct two objective measures of 'peculiarity' by (i) using the deviation of individual objects from the average SN Ia spectrum compared to the typical dispersion and (ii) applying principle component analysis. We demonstrate these methods on several SNe Ia that have previously been classified as peculiar.

J. Berian James; Tamara M. Davis; Brian P. Schmidt; Alex G. Kim



A new limit on the CP violating decay KS -> 3pi0 with the KLOE experiment  

E-Print Network (OSTI)

We have carried out a new direct search for the CP violating decay KS -> 3pi0 with 1.7 fb^-1 of e+e- collisions collected by the KLOE detector at the phi-factory DAFNE. We have searched for this decay in a sample of about 5.9 x 10^8 KS KL events tagging the KS by means of the KL interaction in the calorimeter and requiring six prompt photons. With respect to our previous search, the analysis has been improved by increasing of a factor four the tagged sample and by a more effective background rejection of fake KS tags and spurious clusters. We find no candidates in data and simulated background samples, while we expect 0.12 standard model events. Normalizing to the number of KS -> 2pi0 events in the same sample, we set the upper limit on BR(KS -> 3pi0 < 2.6 x 10^-8 at 90% C.L., five times lower than the previous limit. We also set the upper limit on the eta_000 parameter, |eta_000 | < 0.0088 at 90% C.L., improving by a factor two the latest direct measurement.

Babusci, D; Balwierz-Pytko, I; Bencivenni, G; Bini, C; Bloise, C; Bossi, F; Branchini, P; Budano, A; Balkestahl, L Caldeira; Capon, G; Ceradini, F; Ciambrone, P; Curciarello, F; Czerwinski, E; Dane, E; De Leo, V; De Lucia, E; De Robertis, G; De Santis, A; Di Domenico, A; Di Donato, C; Di Salvo, R; Domenici, D; Erriquez, O; Fanizzi, G; Fantini, A; Felici, G; Fiore, S; Franzini, P; Gauzzi, P; Giardina, G; Giovannella, S; Gonnella, F; Graziani, E; Happacher, F; Heijkenskjold, L; Hoistad, B; Iafolla, L; Jacewicz, M; Johansson, T; Kacprzak, K; Kupsc, A; Lee-Franzini, J; Leverington, B; Loddo, F; Loffredo, S; Mandaglio, G; Martemianov, M; Martini, M; Mascolo, M; Messi, R; Miscetti, S; Morello, G; Moricciani, D; Moskal, P; Nguyen, F; Passeri, A; Patera, V; Longhi, I Prado; Ranieri, A; Redmer, C F; Santangelo, P; Sarra, I; Schioppa, M; Sciascia, B; Silarski, M; Taccini, C; Tortora, L; Venanzoni, G; Wislicki, W; Wolke, M; Zdebik, J



Visualizing Buoyant Burning Bubbles in Type Ia Supernovae at...  

NLE Websites -- All DOE Office Websites (Extended Search)

Burning in Supernovae Buoyant Burning Bubbles in Type Ia Supernovae bubble-s.jpeg Flame ignition in type Ia supernovae leads to isolated bubbles of burning buoyant fluid. As a...



Science Conference Proceedings (OSTI)

Comparing the ejecta velocities at maximum brightness and narrow circumstellar/interstellar Na D absorption line profiles of a sample of 23 Type Ia supernovae (SNe Ia), we determine that the properties of SN Ia progenitor systems and explosions are intimately connected. As demonstrated by Sternberg et al., half of all SNe Ia with detectable Na D absorption at the host-galaxy redshift in high-resolution spectroscopy have Na D line profiles with significant blueshifted absorption relative to the strongest absorption component, which indicates that a large fraction of SN Ia progenitor systems have strong outflows. In this study, we find that SNe Ia with blueshifted circumstellar/interstellar absorption systematically have higher ejecta velocities and redder colors at maximum brightness relative to the rest of the SN Ia population. This result is robust at a 98.9%-99.8% confidence level, providing the first link between the progenitor systems and properties of the explosion. This finding is further evidence that the outflow scenario is the correct interpretation of the blueshifted Na D absorption, adding additional confirmation that some SNe Ia are produced from a single-degenerate progenitor channel. An additional implication is that either SN Ia progenitor systems have highly asymmetric outflows that are also aligned with the SN explosion or SNe Ia come from a variety of progenitor systems where SNe Ia from systems with strong outflows tend to have more kinetic energy per unit mass than those from systems with weak or no outflows.

Foley, Ryan J.; Kirshner, Robert P. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Simon, Joshua D.; Burns, Christopher R. [Observatories of the Carnegie Institution for Science, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Gal-Yam, Avishay [Benoziyo Center for Astrophysics, Faculty of Physics, Weizmann Institute of Science, Rehovot 76100 (Israel); Hamuy, Mario [Departamento de Astronomia, Universidad de Chile, Casilla 36-D, Santiago (Chile); Morrell, Nidia I.; Phillips, Mark M. [Las Campanas Observatory, Carnegie Observatories, Casilla 601, La Serena (Chile); Shields, Gregory A. [Department of Astronomy, University of Texas, Austin, TX 78712 (United States); Sternberg, Assaf, E-mail: rfoley@cfa.harvard.edu [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Strasse 1, 85741 Garching (Germany)



Control of Well Ks-8 in the Kilauea Lower East Rift Zone | Open Energy  

Open Energy Info (EERE)

of Well Ks-8 in the Kilauea Lower East Rift Zone of Well Ks-8 in the Kilauea Lower East Rift Zone Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Control of Well Ks-8 in the Kilauea Lower East Rift Zone Abstract In June 1991, a well located in Hawaii kicked and unloaded at 3,476 ft (1,059 m). This well was estimatedto have a possible bottomhole temperature of 650°F (343°C)and a reservoir pressure approaching 2,300 psi 5,858 Immediate attempts to kill the well were unsuccessful, and the long processof well control was started. Besides the harsh geological and reservoir conditions encountered,the scarce availability of materials in a remote location and long distance transportation of necessary equipment figured heavily in to the time delay of the final kill procedure of the


Category:Des Moines, IA | Open Energy Information  

Open Energy Info (EERE)

IA IA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Des Moines, IA" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Des Moines IA MidAmerican Energy Co (Iowa).png SVFullServiceRestauran... 64 KB SVQuickServiceRestaurant Des Moines IA MidAmerican Energy Co (Iowa).png SVQuickServiceRestaura... 64 KB SVHospital Des Moines IA MidAmerican Energy Co (Iowa).png SVHospital Des Moines ... 73 KB SVLargeHotel Des Moines IA MidAmerican Energy Co (Iowa).png SVLargeHotel Des Moine... 72 KB SVLargeOffice Des Moines IA MidAmerican Energy Co (Iowa).png SVLargeOffice Des Moin... 73 KB SVMediumOffice Des Moines IA MidAmerican Energy Co (Iowa).png SVMediumOffice Des Moi... 69 KB SVMidriseApartment Des Moines IA MidAmerican Energy Co (Iowa).png


DOE - Office of Legacy Management -- Titus Metals - IA 04  

Office of Legacy Management (LM)

from consideration under FUSRAP Also see Documents Related to TITUS METALS IA.04-1 - Argonne National Laboratory Memorandum; Lonergan to Novak; Subject: Extrusion of Billets,...


Turbulence-Flame Interactions in Type Ia Supernovae  

E-Print Network (OSTI)

Turbulence-Flame Interactions in Type Ia Supernovae A. J.Normalised time (e) Normalised flame speed Normalised time (length scale (cm) Laminar flame width Gibson scale Cell

Aspden, Andrew J; Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (Authors 1, 2 & 3); Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (Author 4); Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (Author 5)



DOE - Office of Legacy Management -- Bendix Aviation Corp Pioneer Div - IA  

Office of Legacy Management (LM)

Bendix Aviation Corp Pioneer Div - Bendix Aviation Corp Pioneer Div - IA 05 FUSRAP Considered Sites Site: BENDIX AVIATION CORP., PIONEER DIV. (IA.05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Pioneer Division, Bendix Aviation Corporation Bendix Aviation Corporation Bendix Pioneer Division IA.05-1 IA.05-2 IA.05-3 Location: Davenport , Iowa IA.05-1 Evaluation Year: 1990 IA.05-2 IA.05-4 Site Operations: Conducted studies to investigate the feasibility of using sonic cleaning equipment to decontaminate uranium contaminated drums. IA.05-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited operations at the site IA.05-2 IA.05-4 IA.05-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium IA.05-1


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


Conformal cosmological model and SNe Ia data  

SciTech Connect

Now there is a huge scientific activity in astrophysical studies and cosmological ones in particular. Cosmology transforms from a pure theoretical branch of science into an observational one. All the cosmological models have to pass observational tests. The supernovae type Ia (SNe Ia) test is among the most important ones. If one applies the test to determine parameters of the standard Friedmann-Robertson-Walker cosmological model one can conclude that observations lead to the discovery of the dominance of the {Lambda} term and as a result to an acceleration of the Universe. However, there are big mysteries connected with an origin and an essence of dark matter (DM) and the {Lambda} term or dark energy (DE). Alternative theories of gravitation are treated as a possible solution of DM and DE puzzles. The conformal cosmological approach is one of possible alternatives to the standard {Lambda}CDM model. As it was noted several years ago, in the framework of the conformal cosmological approach an introduction of a rigid matter can explain observational data without {Lambda} term (or dark energy). We confirm the claim with much larger set of observational data.

Zakharov, A. F., E-mail: zakharov@itep.ru [National Astronomical Observatories of Chinese Academy of Sciences (China); Pervushin, V. N. [Joint Institute for Nuclear Research, Bogoliubov Laboratory for Theoretical Physics (Russian Federation)



The Distant Type Ia Supernova Rate  

DOE R&D Accomplishments (OSTI)

We present a measurement of the rate of distant Type Ia supernovae derived using 4 large subsets of data from the Supernova Cosmology Project. Within this fiducial sample, which surveyed about 12 square degrees, thirty-eight supernovae were detected at redshifts 0.25--0.85. In a spatially flat cosmological model consistent with the results obtained by the Supernova Cosmology Project, we derive a rest-frame Type Ia supernova rate at a mean red shift z {approx_equal} 0.55 of 1.53 {sub -0.25}{sub -0.31}{sup 0.28}{sup 0.32} x 10{sup -4} h{sup 3} Mpc{sup -3} yr{sup -1} or 0.58{sub -0.09}{sub -0.09}{sup +0.10}{sup +0.10} h{sup 2} SNu(1 SNu = 1 supernova per century per 10{sup 10} L{sub B}sun), where the first uncertainty is statistical and the second includes systematic effects. The dependence of the rate on the assumed cosmological parameters is studied and the redshift dependence of the rate per unit comoving volume is contrasted with local estimates in the context of possible cosmic star formation histories and progenitor models.

Pain, R.; Fabbro, S.; Sullivan, M.; Ellis, R. S.; Aldering, G.; Astier, P.; Deustua, S. E.; Fruchter, A. S.; Goldhaber, G.; Goobar, A.; Groom, D. E.; Hardin, D.; Hook, I. M.; Howell, D. A.; Irwin, M. J.; Kim, A. G.; Kim, M. Y.; Knop, R. A.; Lee, J. C.; Perlmutter, S.; Ruiz-Lapuente, P.; Schahmaneche, K.; Schaefer, B.; Walton, N. A.



miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


File:USDA-CE-Production-GIFmaps-KS.pdf | Open Energy Information  

Open Energy Info (EERE)

KS.pdf KS.pdf Jump to: navigation, search File File history File usage Kansas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 317 KB, MIME type: application/pdf) Description Kansas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kansas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,650 × 1,275 (317 KB) MapBot (Talk | contribs) Automated bot upload


Burning Thermals in Type Ia Supernovae A. J. Aspden1  

E-Print Network (OSTI)

Burning Thermals in Type Ia Supernovae A. J. Aspden1 , J. B. Bell1 , S. Dong2 , and S. E. Woosley2 ABSTRACT We develop a one-dimensional theoretical model for thermals burning in Type Ia supernovae based for the burning and for the expansion of the thermal due to changes in the background stratification found

Bell, John B.


Visualizing Type Ia Supernova Explosions at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

Supernova Explosions Supernova Explosions Visualizing Type Ia Supernova Explosions Childs1a-Supernovasm.png Deep inside a dying star in a galaxy far, far away, a carbon fusion flame ignites. Ignition may happen in the middle or displaced slightly to one side, but this simulation explores the consequences of central ignition. In a localized hot spot, represented here by a deformed sphere with an average radius of 100 km, carbon is assumed to have already fused to iron, producing hot ash (~10 billion K) with a density about 20% less than its surroundings. As the burning progresses, this hot buoyant ash rises up and interacts with cold fuel. Rayleigh-Taylor fingers give rise to shear and turbulence, which interacts with the flame, causing it to move faster. In about 2 seconds, the energy released blows the entire white dwarf star up,



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Annual Energy Outlook 2012 (EIA)




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Iowa Army Ammunition Plant - IA 02  

Office of Legacy Management (LM)

Army Ammunition Plant - IA 02 Army Ammunition Plant - IA 02 FUSRAP Considered Sites Iowa Army Ammunition Plant, IA Alternate Name(s): Burlington Ordnance Plant Iowa Ordnance Plant Silas Mason Company IA.02-3 Location: Located in Township 70 North, Range 3 West, Section 32, 5th Principal Meridian, Des Moines County, Burlington, Iowa IA.02-1 IA.02-5 Historical Operations: Assembled nuclear weapons, primarily high explosive components and conducted explosives testing using the high explosive components and depleted uranium. AEC and ERDA operations conducted under permit from the Department of the Army. IA.02-3 IA.02-4 Eligibility Determination: Eligible IA.02-5 Radiological Survey(s): Assessment Survey IA.02-2 Site Status: Cleanup pending by U.S. Army Corps of Engineers. IA.02-6


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Late Light Curves of Normally-Luminous Type Ia Supernovae  

E-Print Network (OSTI)

The use of Type Ia supernovae as cosmological tools has reinforced the need to better understand these objects and their light curves. The light curves of Type Ia supernovae are powered by the nuclear decay of $^{56}Ni \\to ^{56}Co \\to ^{56}Fe$. The late time light curves can provide insight into the behavior of the decay products and their effect of the shape of the curves. We present the optical light curves of six "normal" Type Ia supernovae, obtained at late times with template image subtraction, and the fits of these light curves to supernova energy deposition models.

J. C. Lair; M. D. Leising; P. A. Milne; G. G. Williams



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


UMore Ph IA CR Report 7-8-10.pdf  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PHASE IA ARCHAEOLOGICAL AND PHASE IA ARCHAEOLOGICAL AND ARCHITECTURAL HISTORY SURVEY FOR THE UMORE PARK RESEARCH WIND TURBINE PROJECT, DAKOTA COUNTY, MINNESOTA SHPO File No. Pending Client No. Pending The 106 Group Project No. 10-18 Submitted to: Barr Engineering Company 4700 West 77th Street Minneapolis, MN 55435-4803 Submitted by: The 106 Group Ltd. The Dacotah Building 370 Selby Avenue St. Paul, MN 55102 Principal Investigators: AnneKetz, M.A., RPA Greg Mathis, M.C.R.P. Report Authors: Mark Doperalski, B.S. Miranda Van Vleet, M.H.P July 2010 UMore Park Wind Turbine Project Phase IA Archaeological and Architectural History Survey Page i MANAGEMENT SUMMARY During May of 2010, The 106 Group Ltd. (106 Group) conducted a Phase IA archaeological and architectural history survey for the University of Minnesota Outreach, Research, and



SciTech Connect

Owing to their utility for measurements of cosmic acceleration, Type Ia supernovae (SNe Ia) are perhaps the best-studied class of SNe, yet the progenitor systems of these explosions largely remain a mystery. A rare subclass of SNe Ia shows evidence of strong interaction with their circumstellar medium (CSM), and in particular, a hydrogen-rich CSM; we refer to them as SNe Ia-CSM. In the first systematic search for such systems, we have identified 16 SNe Ia-CSM, and here we present new spectra of 13 of them. Six SNe Ia-CSM have been well studied previously, three were previously known but are analyzed in depth for the first time here, and seven are new discoveries from the Palomar Transient Factory. The spectra of all SNe Ia-CSM are dominated by H{alpha} emission (with widths of {approx}2000 km s{sup -1}) and exhibit large H{alpha}/H{beta} intensity ratios (perhaps due to collisional excitation of hydrogen via the SN ejecta overtaking slower-moving CSM shells); moreover, they have an almost complete lack of He I emission. They also show possible evidence of dust formation through a decrease in the red wing of H{alpha} 75-100 days past maximum brightness, and nearly all SNe Ia-CSM exhibit strong Na I D absorption from the host galaxy. The absolute magnitudes (uncorrected for host-galaxy extinction) of SNe Ia-CSM are found to be -21.3 mag {<=} M{sub R} {<=} -19 mag, and they also seem to show ultraviolet emission at early times and strong infrared emission at late times (but no detected radio or X-ray emission). Finally, the host galaxies of SNe Ia-CSM are all late-type spirals similar to the Milky Way, or dwarf irregulars like the Large Magellanic Cloud, which implies that these objects come from a relatively young stellar population. This work represents the most detailed analysis of the SN Ia-CSM class to date.

Silverman, Jeffrey M. [Department of Astronomy, University of Texas, Austin, TX 78712-0259 (United States); Nugent, Peter E. [Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Gal-Yam, Avishay; Arcavi, Iair; Ben-Ami, Sagi [Benoziyo Center for Astrophysics, Weizmann Institute of Science, Rehovot 76100 (Israel); Sullivan, Mark [School of Physics and Astronomy, University of Southampton, Southampton SO17 1BJ (United Kingdom); Howell, D. Andrew; Graham, Melissa L. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Filippenko, Alexei V.; Bloom, Joshua S.; Cenko, S. Bradley; Clubb, Kelsey I. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Cao, Yi; Horesh, Assaf; Kulkarni, Shrinivas R. [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Chornock, Ryan; Foley, Ryan J. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Coil, Alison L. [Department of Physics, University of California, San Diego, La Jolla, CA 92093 (United States); Griffith, Christopher V. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Kasliwal, Mansi M., E-mail: jsilverman@astro.as.utexas.edu [Observatories of the Carnegie Institution of Science, Pasadena, CA 91101 (United States); and others




SciTech Connect

To understand how best to use observations of Type Ia supernovae (SNe Ia) to obtain precise and accurate distances, we investigate the relations between spectra of SNe Ia and their intrinsic colors. Using a sample of 1630 optical spectra of 255 SNe, based primarily on data from the CfA Supernova Program, we examine how the velocity evolution and line strengths of Si II {lambda}6355 and Ca II H and K are related to the B - V color at peak brightness. We find that the maximum-light velocity of Si II {lambda}6355 and Ca II H and K and the maximum-light pseudo-equivalent width of Si II {lambda}6355 are correlated with intrinsic color, with intrinsic color having a linear relation with the Si II {lambda}6355 measurements. Ca II H and K does not have a linear relation with intrinsic color, but lower-velocity SNe tend to be intrinsically bluer. Combining the spectroscopic measurements does not improve intrinsic color inference. The intrinsic color scatter is larger for higher-velocity SNe Ia-even after removing a linear trend with velocity-indicating that lower-velocity SNe Ia are more 'standard crayons'. Employing information derived from SN Ia spectra has the potential to improve the measurements of extragalactic distances and the cosmological properties inferred from them.

Foley, Ryan J.; Sanders, Nathan E.; Kirshner, Robert P., E-mail: rfoley@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)



The Rate of Type Ia Supernovae at High Redshift  

E-Print Network (OSTI)

We derive the rates of Type Ia supernovae (SNIa) over a wide range of redshifts using a complete sample from the IfA Deep Survey. This sample of more than 100 SNIa is the largest set ever collected from a single survey, and therefore uniquely powerful for a detailed supernova rate (SNR) calculation. Measurements of the SNR as a function of cosmological time offer a glimpse into the relationship between the star formation rate (SFR) and Type Ia SNR, and may provide evidence for the progenitor pathway. We observe a progressively increasing Type Ia SNR between redshifts z~0.3-0.8. The Type Ia SNR measurements are consistent with a short time delay (t~1 Gyr) with respect to the SFR, indicating a fairly prompt evolution of SNIa progenitor systems. We derive a best-fit value of SFR/SNR 580 h_70^(-2) M_solar/SNIa for the conversion factor between star formation and SNIa rates, as determined for a delay time of t~1 Gyr between the SFR and the Type Ia SNR. More complete measurements of the Type Ia SNR at z>1 are necessary to conclusively determine the SFR--SNR relationship and constrain SNIa evolutionary pathways.

Brian J. Barris; John L. Tonry



The diversity of Type Ia Supernovae: evidence for systematics?  

E-Print Network (OSTI)

The photometric and spectroscopic properties of 26 well observed Type Ia Supernovae (SNeIa) were analyzed with the aim to explore SNIa diversity. The sample includes (Branch-)normal SNe as well as extreme events like SNe 1991T and 1991bg, while the truly peculiar SNIa, SN2000cx and SN2002cx are not included in our sample . A statistical treatment reveals the existence of three different groups. The first group (FAINT) consists of faint SNeIa similar to SN1991bg, with low expansion velocities and rapid evolution of SiII velocity. A second group consists of ``normal'' SNeIa, also with high temporal velocity gradient (HVG), but with brighter mean absolute magnitude =-19.3 and higher expansion velocities than the FAINT SNe. The third group includes both ``normal'' and SN1991T-like SNeIa: these SNe populate a narrow strip in the SiII velocity evolution plot, with a small velocity gradient (SVG), but have absolute magnitudes similar to HVGs. While the FAINT and HVG SNeIa together seem to define a relation between RSi(II) and Dm15(B), the SVG ones either do not conform with that relation or define a new, looser one. The RSi(II) pre-maximum evolution of HVGs is strikingly different from that of SVGs. The impact of this evidence on the understanding of SNIa diversity, in terms of explosion mechanisms, degree of ejecta mixing, and ejecta-CSM interaction, is discussed.

S. Benetti; E. Cappellaro; P. A. Mazzali; M. Turatto; G. Altavilla; F. Bufano; N. Elias-Rosa; R. Kotak; G. Pignata; M. Salvo; V. Stanishev



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Benchmarks for the New-Physics Search through CP Violation in B^0->pi^0 K_S  

E-Print Network (OSTI)

Using isospin relations, we predict the Standard-Model correlation between S_{pi^0 K_S}=(sin 2beta)_{pi^0 K_S} and A_{pi^0 K_S}, the mixing-induced and direct CP asymmetries of B^0-> pi^0 K_S. The calculation uses flavour SU(3) only to fix the isospin-3/2 amplitude through the B^\\pm->pi^\\pm pi^0 branching ratio, and thus has a small irreducible theoretical error. It can reach percent level precision thanks to expected future lattice-QCD progress for the calculation of the relevant SU(3)-breaking form-factor ratio, and serves as a benchmark for new-physics searches. We obtain an interesting picture in the A_{pi^0 K_S} - S_{pi^0 K_S} plane, where the current experimental data show a discrepancy with the Standard Model, and comment on the direct CP asymmetries of B^0->pi^-K^+ and B^+ -> pi^0 K^+. A modified electroweak penguin with a large new CP-violating phase can explain the discrepancy and allows us to accommodate also the corresponding data for other b->s penguin-dominated decays.

Robert Fleischer; Sebastian Jager; Dan Pirjol; Jure Zupan



DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either



Science Conference Proceedings (OSTI)

At a density near a few x10{sup 7} g cm{sup -3}, the subsonic burning in a Type Ia supernova (SN) enters the distributed regime (high Karlovitz number). In this regime, turbulence disrupts the internal structure of the flame, and so the idea of laminar burning propagated by conduction is no longer valid. The nature of the burning in this distributed regime depends on the turbulent Damkoehler number (Da{sub T}), which steadily declines from much greater than one to less than one as the density decreases to a few x10{sup 6} g cm{sup -3}. Classical scaling arguments predict that the turbulent flame speed s{sub T} , normalized by the turbulent intensity u-check, follows s{sub T}/u-check = Da{sub T}{sup 1/2} for Da{sub T} {approx}burns as a turbulently broadened effective unity Lewis number flame. This flame burns locally with speed s{sub l}ambda and width l{sub l}ambda, and we refer to this kind of flame as a lambda-flame. The burning becomes a collection of lambda-flames spread over a region approximately the size of the {integral} scale. While the total burning rate continues to have a well-defined average, s{sub T}{approx}u-check, the burning is unsteady. We present a theoretical framework, supported by both one-dimensional and three-dimensional numerical simulations, for the burning in these two regimes. Our results indicate that the average value of s{sub T} can actually be roughly twice u-check for Da{sub T} {approx}> 1, and that localized excursions to as much as 5 times u-check can occur. We also explore the properties of the individual flames, which could be sites for a transition to detonation when Da{sub T} {approx} 1. The lambda-flame speed and width can be predicted based on the turbulence in the star (specifically the energy dissipation rate epsilon*) and the turbulent nuclear burning timescale of the fuel tau {sup T}{sub nuc}. We propose a practical method for measuring s{sub l}ambda and l{sub l}ambda based on the scaling relations and small-scale computationally inexpensive simulations. This suggests that a simple turbulent flame model can be easily constructed suitable for large-scale distributed SNe flames. These results will be useful both for characterizing the deflagration speed in larger full-star simulations, where the flame cannot be resolved, and for predicting when detonation occurs.

Aspden, A. J.; Bell, J. B. [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (United States); Woosley, S. E. [Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (United States)



Redshift-Independent Distances to Type Ia Supernovae  

E-Print Network (OSTI)

We describe a procedure for accurately determining luminosity distances to Type Ia supernovae (SNe Ia) without knowledge of redshift. This procedure, which may be used as an extension of any of the various distance determination methods currently in use, is based on marginalizing over redshift, removing the requirement of knowing $z$ a priori. We demonstrate that the Hubble diagram scatter of distances measured with this technique is approximately equal to that of distances derived from conventional redshift-specific methods for a set of 60 nearby SNe Ia. This indicates that accurate distances for cosmological SNe Ia may be determined without the requirement of spectroscopic redshifts, which are typically the limiting factor for the number of SNe that modern surveys can collect. Removing this limitation would greatly increase the number of SNe for which current and future SN surveys will be able to accurately measure distance. The method may also be able to be used for high-$z$ SNe Ia to determine cosmological density parameters without redshift information.

Brian J. Barris; John L. Tonry



DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


The type Ia supernova SNLS-03D3bb from a super-Chandrasekhar-mass white dwarf star  

E-Print Network (OSTI)

The absolute magnitudes of Type IA supernovae. Astrophys. J.in a Sublu- o minous Type Ia Supernova: SpectropolarimetryL. Could There Be a Hole in Type Ia Super- novae? Astrophys.



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Nucleosynthesis in type Ia supernovae driven by asymmetric thermonuclear ignition  

Science Conference Proceedings (OSTI)

Type Ia Supernovae (SNe Ia) are believed to be thermonuclear explosions of a white dwarf. They can be used as mature cosmological standardized candles, leading to the discovery of the accelerating expansion of the Universe. However, the explosion mechanism has not yet been fully clarified. In this paper, we first present nucleosynthetic features of a leading explosion scenario, namely a delayed-detonation scenario. Based on this, we propose a new and strong observational constraint on the explosion mechanism through emission lines from neutron-rich Fe-peaks. Especially, we show that an asymmetry in the explosion is likely a generic feature. We further argue that the diversity arising from various viewing angles can be an origin of observational diversities of SNe Ia seen in their spectral features (suspected possible biases in cosmology) and colors (related to the extinction estimate in cosmology). Using these new insights could open up a possibility of using SNe Ia as more precise distance indicators than currently employed.

Maeda, Keiichi [Institute for the Physics and Mathematics of the Universe (IPMU), Todai Institutes for Advanced Study (TODIAS), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan)



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Optical Spectra of Type Ia Supernovae at z=0.46 and z=1.2  

E-Print Network (OSTI)

We present optical spectra, obtained with the Keck 10-m telescope, of two high-redshift type Ia supernovae (SNe Ia) discovered by the High-z Supernova Search Team: SN 1999ff at z=0.455 and SN 1999fv at z~1.2, the highest-redshift published SN Ia spectrum. Both SNe were at maximum light when the spectra were taken. We compare our high-z spectra with low-z normal and peculiar SNe Ia as well as with SNe Ic, Ib, and II. There are no significant differences between SN 1999ff and normal SNe Ia at low redshift. SN 1999fv appears to be a SN Ia and does not resemble the most peculiar nearby SNe Ia.

Coil, A L; Filippenko, A V; Leonard, D C; Tonry, J; Riess, A G; Challis, P M; Clocchiatti, A; Garnavich, P M; Hogan, C J; Jha, S; Kirshner, R P; Leibundgut, B; Phillips, M M; Schmidt, B P; Schommer, R A; Smith, R C; Soderberg, A M; Spyromilio, J; Stubbs, C; Suntzeff, N B; Woudt, P A; Coil, Alison L.; Matheson, Thomas; Filippenko, Alexei V.; Leonard, Douglas C.; Tonry, John; Riess, Adam G.; Challis, Peter; Clocchiatti, Alejandro; Garnavich, Peter M.; Hogan, Craig J.; Jha, Saurabh; Kirshner, Robert P.; Schmidt, Brian P.; Schommer, Robert A.; Soderberg, Alicia M.; Stubbs, Christopher; Suntzeff, Nicholas B.; Woudt, Patrick



Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Progenitors of type Ia supernovae in elliptical galaxies  

Science Conference Proceedings (OSTI)

Although there is a nearly universal agreement that type Ia supernovae are associated with the thermonuclear disruption of a CO white dwarf, the exact nature of their progenitors is still unknown. The single degenerate scenario envisages a white dwarf accreting matter from a non-degenerate companion in a binary system. Nuclear energy of the accreted matter is released in the form of electromagnetic radiation or gives rise to numerous classical nova explosions prior to the supernova event. We show that combined X-ray output of supernova progenitors and statistics of classical novae predicted in the single degenerate scenario are inconsistent with X-ray and optical observations of nearby early type galaxies and galaxy bulges. White dwarfs accreting from a donor star in a binary system and detonating at the Chandrasekhar mass limit can account for no more than {approx}5% of type Ia supernovae observed in old stellar populations.

Gilfanov, M.; Bogdan, A.



Learning from the scatter in type ia supernovae  

SciTech Connect

Type Ia Supernovae are standard candles so their mean apparent magnitude has been exploited to learn about the redshift-distance relationship. Besides intrinsic scatter in this standard candle, additional scatter is caused by gravitational magnification by large scale structure. Here they probe the dependence of this dispersion on cosmological parameters and show that information about the amplitude of clustering, {sigma}{sub s}, is contained in the scatter. In principle, it will be possible to constrain {sigma}{sub s} to within 5% with observations of 2000 Type Ia Supernovae. They identify three sources of systematic error--evolution of intrinsic scatter, baryon contributions to lensing, and non-Gaussianity of lensing--which will make this measurement difficult.

Dodelson, Scott; /Fermilab /Chicago U., Astron. Astrophys. Ctr.; Vallinotto, Alberto; /Fermilab /Chicago U.



Type Ia Supernova Spectral Line Ratios as LuminosityIndicators  

SciTech Connect

Type Ia supernovae have played a crucial role in thediscovery of the dark energy, via the measurement of their light curvesand the determination of the peak brightness via fitting templates to theobserved lightcurve shape. Two spectroscopic indicators are also known tobe well correlated with peak luminosity. Since the spectroscopicluminosity indicators are obtained directly from observed spectra, theywill have different systematic errors than do measurements usingphotometry. Additionally, these spectroscopic indicators may be usefulfor studies of effects of evolution or age of the SNe~;Ia progenitorpopulation. We present several new variants of such spectroscopicindicators which are easy to automate and which minimize the effects ofnoise. We show that these spectroscopic indicators can be measured byproposed JDEM missions such as snap and JEDI.

Bongard, Sebastien; Baron, E.; Smadja, G.; Branch, David; Hauschildt, Peter H.



Investigating the Flame Microstructure in Type Ia Supernovae  

E-Print Network (OSTI)

We present a numerical model to study the behavior of thermonuclear flames in the discontinuity approximation. This model is applied to investigate the Landau-Darrieus instability under conditions found in Type Ia supernova explosions of Chandrasekhar mass white dwarfs. This is a first step to explore the flame microstructure in these events. The model reproduces Landau's linearized stability analysis in early stages of the flame evolution and the stabilization in a cellular flame structure in the nonlinear stage.

F. K. Roepke; W. Hillebrandt; J. C. Niemeyer



Reflections on Reflexions: I. Light Echoes in Type Ia Supernovae  

E-Print Network (OSTI)

In the last ten years, observational evidences about a possible connection between Type Ia Supernovae (SNe) properties and the environment where they explode have been steadily growing. In this paper I discuss, from a theoretical point of view but with an observer's perspective, the usage of light echoes (LEs) to probe the CSM around SNe of Type Ia since, in principle, they give us a unique opportunity of getting a three-dimensional description of the SN environment. In turn, this can be used to check the often suggested association of some Ia's with dusty/star forming regions, which would point to a young population for the progenitors. After giving a brief introduction to the LE phenomenon in single scattering approximation, I derive analytical and numerical solutions for the optical light and colour curves for a few simple dust geometries. A fully 3D multiple scattering treatment has also been implemented in a Monte Carlo code, which I have used to investigate the effects of multiple scattering. In particu...

Patat, F



Could There Be A Hole In Type Ia Supernovae?  

E-Print Network (OSTI)

In the favored progenitor scenario, Type Ia supernovae arise from a white dwarf accreting material from a non-degenerate companion star. Soon after the white dwarf explodes, the ejected supernova material engulfs the companion star; two-dimensional hydrodynamical simulations by Marietta et. al. show that, in the interaction, the companion star carves out a conical hole of opening angle 30-40 degrees in the supernova ejecta. In this paper we use multi-dimensional Monte Carlo radiative transfer calculations to explore the observable consequences of an ejecta-hole asymmetry. We calculate the variation of the spectrum, luminosity, and polarization with viewing angle for the aspherical supernova near maximum light. We find that the supernova looks normal from almost all viewing angles except when one looks almost directly down the hole. In the latter case, one sees into the deeper, hotter layers of ejecta. The supernova is relatively brighter and has a peculiar spectrum characterized by more highly ionized species, weaker absorption features, and lower absorption velocities. The spectrum viewed down the hole is comparable to the class of SN 1991T-like supernovae. We consider how the ejecta-hole asymmetry may explain the current spectropolarimetric observations of SNe Ia, and suggest a few observational signatures of the geometry. Finally, we discuss the variety currently seen in observed SNe Ia and how an ejecta-hole asymmetry may fit in as one of several possible sources of diversity.

Daniel Kasen; Peter Nugent; R. C. Thomas; Lifan Wang



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png



Science Conference Proceedings (OSTI)

Using data from the Sloan Digital Sky Supernova Survey-II (SDSS-II SN Survey), we measure the rate of Type Ia supernovae (SNe Ia) as a function of galaxy properties at intermediate redshift. A sample of 342 SNe Ia with 0.05 0.15) SNe Ia in highly star-forming galaxies. We consider that the high levels of dust in these systems may be obscuring the reddest and faintest SNe Ia.

Smith, Mathew [Department of Physics, University of Western Cape, Bellville 7530, Cape Town (South Africa); Nichol, Robert C. [Institute of Cosmology and Gravitation, University of Portsmouth, Portsmouth PO1 3FX (United Kingdom); Dilday, Benjamin [Las Cumbres Observatory Global Telescope Network, 6740 Cortona Dr., Suite 102, Goleta, CA 93117 (United States); Marriner, John; Frieman, Joshua [Center for Particle Astrophysics, Fermilab, P.O. Box 500, Batavia, IL 60510 (United States); Kessler, Richard [Department of Astronomy and Astrophysics, University of Chicago, 5640 S. Ellis Ave, Chicago, IL 60637 (United States); Bassett, Bruce [African Institute for Mathematical Sciences, 6-8 Melrose Road, Muizenberg 7945 (South Africa); Cinabro, David [Department of Physics and Astronomy, Wayne State University, Detroit, MI 48201 (United States); Garnavich, Peter [Department of Physics, University of Notre Dame, 225 Nieuwland Science Hall, Notre Dame, IN 46556 (United States); Jha, Saurabh W. [Department of Physics and Astronomy, Rutgers, State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Lampeitl, Hubert [Astrophysics, Cosmology and Gravity Centre (ACGC), Department of Mathematics and Applied Mathematics, University of Cape Town, Rondebosch 7701 (South Africa); Sako, Masao [Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Schneider, Donald P. [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States); Sollerman, Jesper, E-mail: matsmith2@gmail.com [Oskar Klein Centre, Department of Astronomy, AlbaNova, Stockholm University, SE-106 91 Stockholm (Sweden)



Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls



SciTech Connect

The origin of the diffuse extragalactic gamma-ray background (EGB) has been intensively studied but remains unsettled. Current popular source candidates include unresolved star-forming galaxies, starburst galaxies, and blazars. In this paper, we calculate the EGB contribution from the interactions of cosmic rays accelerated by Type Ia supernovae (SNe), extending earlier work that only included core-collapse SNe. We consider Type Ia events not only in star-forming galaxies, but also in quiescent galaxies that lack star formation. In the case of star-forming galaxies, consistently including Type Ia events makes little change to the star-forming EGB prediction, so long as both SN types have the same cosmic-ray acceleration efficiencies in star-forming galaxies. Thus, our updated EGB estimate continues to show that star-forming galaxies can represent a substantial portion of the signal measured by Fermi. In the case of quiescent galaxies, conversely, we find a wide range of possibilities for the EGB contribution. The dominant uncertainty we investigated comes from the mass in hot gas in these objects, which provides targets for cosmic rays; total gas masses are as yet poorly known, particularly at larger radii. Additionally, the EGB estimation is very sensitive to the cosmic-ray acceleration efficiency and confinement, especially in quiescent galaxies. In the most optimistic allowed scenarios, quiescent galaxies can be an important source of the EGB. In this case, star-forming galaxies and quiescent galaxies together will dominate the EGB and leave little room for other contributions. If other sources, such as blazars, are found to have important contributions to the EGB, then either the gas mass or cosmic-ray content of quiescent galaxies must be significantly lower than in their star-forming counterparts. In any case, improved Fermi EGB measurements will provide important constraints on hot gas and cosmic rays in quiescent galaxies.

Lien, Amy; Fields, Brian D. [Department of Physics, University of Illinois, Urbana, IL 61801 (United States)


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Reflections on Reflexions: I. Light Echoes in Type Ia Supernovae  

E-Print Network (OSTI)

In the last ten years, observational evidences about a possible connection between Type Ia Supernovae (SNe) properties and the environment where they explode have been steadily growing. In this paper I discuss, from a theoretical point of view but with an observer's perspective, the usage of light echoes (LEs) to probe the CSM around SNe of Type Ia since, in principle, they give us a unique opportunity of getting a three-dimensional description of the SN environment. In turn, this can be used to check the often suggested association of some Ia's with dusty/star forming regions, which would point to a young population for the progenitors. After giving a brief introduction to the LE phenomenon in single scattering approximation, I derive analytical and numerical solutions for the optical light and colour curves for a few simple dust geometries. A fully 3D multiple scattering treatment has also been implemented in a Monte Carlo code, which I have used to investigate the effects of multiple scattering. In particular, I have explored in detail the LE colour dependency from time and dust distribution, since this is a promising tool to determine the dust density and derive the effective presence of multiple scattering from the observed properties. Finally, again by means of Monte Carlo simulations, I have studied the effects of multiple scattering on the LE linear polarization, analyzing the dependencies from the dust parameters and geometry. Both the analytical formalism and MC codes described in this paper can be used for any LE for which the light curve of the central source is known.

F. Patat



Turbulence-Flame Interactions in Type Ia Supernovae  

SciTech Connect

The large range of time and length scales involved in type Ia supernovae (SN Ia) requires the use of flame models. As a prelude to exploring various options for flame models, we consider, in this paper, high-resolution three-dimensional simulations of the small-scale dynamics of nuclear flames in the supernova environment in which the details of the flame structure are fully resolved. The range of densities examined, 1 to 8 x 107 g cm-3, spans the transition from the laminar flamelet regime to the distributed burning regime where small scale turbulence disrupts the flame. The use of a low Mach number algorithm facilitates the accurate resolution of the thermal structure of the flame and the inviscid turbulent kinetic energy cascade, while implicitly incorporating kinetic energy dissipation at the grid-scale cutoff. For an assumed background of isotropic Kolmogorov turbulence with an energy characteristic of SN Ia, we find a transition density between 1 and 3 x 107 g cm-3 where the nature of the burning changes ualitatively. By 1 x 107 g cm-3, energy diffusion by conduction and radiation is exceeded, on the flame scale, by turbulent advection. As a result, the effective Lewis Number approaches unity. That is, the flame resembles a laminar flame, but is turbulently broadened with an effective diffusion coefficient, D_T \\sim u' l, where u' is the turbulent intensity and l is the integral scale. For the larger integral scales characteristic of a real supernova, the flame structure is predicted to become complex and unsteady. Implications for a possible transition to detonation are discussed.

Lawrence Berkeley National Laboratory, 1 Cyclotron Road, MS 50A-1148, Berkeley, CA 94720 (Authors 1, 2& 3); Department of Astronomy and Astrophysics, University of California at Santa Cruz, Santa Cruz, CA 95064 (Author 4); Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (Author 5); Aspden, Andrew J; Aspden, Andrew J.; Bell, John B.; Day, Marc S.; Woosley, Stan E.; Zingale, Mike



Turbulence-Flame Interactions in Type Ia Supernovae  

E-Print Network (OSTI)

The large range of time and length scales involved in type Ia supernovae (SN Ia) requires the use of flame models. As a prelude to exploring various options for flame models, we consider, in this paper, high-resolution three-dimensional simulations of the small-scale dynamics of nuclear flames in the supernova environment in which the details of the flame structure are fully resolved. The range of densities examined, 1 to $8 \\times 10^7$ g cm$^{-3}$, spans the transition from the laminar flamelet regime to the distributed burning regime where small scale turbulence disrupts the flame. The use of a low Mach number algorithm facilitates the accurate resolution of the thermal structure of the flame and the inviscid turbulent kinetic energy cascade, while implicitly incorporating kinetic energy dissipation at the grid-scale cutoff. For an assumed background of isotropic Kolmogorov turbulence with an energy characteristic of SN Ia, we find a transition density between 1 and $3 \\times 10^7$ g cm$^{-3}$ where the nature of the burning changes qualitatively. By $1 \\times 10^7$ g cm$^{-3}$, energy diffusion by conduction and radiation is exceeded, on the flame scale, by turbulent advection. As a result, the effective Lewis Number approaches unity. That is, the flame resembles a laminar flame, but is turbulently broadened with an effective diffusion coefficient, $D_T \\sim u' l$, where $u'$ is the turbulent intensity and $l$ is the integral scale. For the larger integral scales characteristic of a real supernova, the flame structure is predicted to become complex and unsteady. Implications for a possible transition to detonation are discussed.

A. J. Aspden; J. B. Bell; M. S. Day; S. E. Woosley; M. Zingale



Inclusive production of $\\Lambda$, $K^0_s$ and exotic narrow resonances for systems $K_s^0 p$, $K_s^0 \\Lambda$, $\\Lambda p$ from p+propane interactions at 10 GeV/c  

E-Print Network (OSTI)

Experimental data from the 2m propane bubble chamber for production of $\\Lambda$, $K^0_s$ have been used to search of exotic baryon states, in the $K_s^0 p$, $K_s^0 \\Lambda$ and $\\Lambda p$ decay mode for the reaction p+propane at 10 GeV/c. The estimation of experimental inclusive cross sections for $\\Lambda$ and $K^0_s$ production in the p$^{12}C$ collision is equal to $\\sigma_{\\Lambda}$= 13.3$\\pm$1.7 mb and $\\sigma_{K^0_s}$= 3.8$\\pm$0.6 mb, respectively. The measured $\\Lambda /\\pi^+$ ratio from pC reaction is equal to (5.3$\\pm0.8)*10^{-2}$. The experimental $\\Lambda /\\pi^+$ ratio from the pC reaction is approximately two times larger than the $\\Lambda /\\pi^+$ ratio simulated by FRITIOF model from the pC reaction. The invariant mass spectrum $\\Lambda K^0_s$ registered narrow peaks in regions of 1750 and 1795 MeV/$c^2$. The statistical significance of these peaks has been estimated as 5.6 and 3.3 S.D., respectively. These would be candidates for the $N^0$ or the $\\Xi^0$ pentaquark states. The $pK^0_s$ invaria...

Aslanyan, P Z



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Microsoft PowerPoint - IEEE IAS PES 102313.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

DOE's ARRA DOE's ARRA Smart Grid Program Steve Bossart, Senior Energy Analyst IEEE IAS/PES Pittsburgh Section October 23, 2013 ‹#› Topics * OE ARRA Smart Grid Program * OE ARRA Smart Grid Progress * Results and Case Studies * Life After ARRA Smart Grid ‹#› DOE OE ARRA Smart Grid Program ‹#› American Recovery and Reinvestment Act ($4.5B) * Smart Grid Investment Grants (99 projects) - $3.4 billion Federal; $4.7 billion private sector - > 800 PMUs covering almost 100% of transmission - ~ 8000 distribution automation circuits - > 15 million smart meters * Smart Grid Demonstration Projects (32 projects) - $685 million Federal; $1 billion private sector - 16 storage projects - 16 regional demonstrations Smart Grid ARRA Activities ‹#› Smart Grid investment from ARRA field projects


Type Ia Supernova: Burning and Detonation in the Distributed Regime  

E-Print Network (OSTI)

A simple, semi-analytic representation is developed for nuclear burning in Type Ia supernovae in the special case where turbulent eddies completely disrupt the flame. The speed and width of the ``distributed'' flame front are derived. For the conditions considered, the burning front can be considered as a turbulent flame brush composed of corrugated sheets of well-mixed flames. These flames are assumed to have a quasi-steady-state structure similar to the laminar flame structure, but controlled by turbulent diffusion. Detonations cannot appear in the system as long as distributed flames are still quasi-steady-state, but this condition is violated when the distributed flame width becomes comparable to the size of largest turbulent eddies. When this happens, a transition to detonation may occur. For current best estimates of the turbulent energy, the most likely density for the transition to detonation is in the range 0.5 - 1.5 x 10^7 g cm^{-3}.

S. E. Woosley



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


RELAP5/MOD3.2 Assessment Using CHF Data from the KS-1 and V-200 Experiment Facilities  

SciTech Connect

The RELAP/MOD3.2 computer code has been assessed using rod bundle critical heat flux data from the KS-1 and V-200 facilities. This work was performed as part of the U.S. Department of Energys International Nuclear Safety Program, and is part of the effort addressing the capability of the RELAP5/MOD3.2 code to model transients in Soviet-designed reactors. Designated VVER Standard Problem 7, these tests addressed one of the important phenomena related to VVER behavior that the code needs to simulate well, core heat transfer. The code was judged to be in minimal agreement with the experiment data, consistently overpredicting the measured critical heat flux. It is recommended that a model development effort be undertaken to develop a critical heat flux model for RELAP5 that better represents the behavior in VVER rod bundles.

Bayless, Paul David



Type Ia Supernovae Rates and Galaxy Clustering from the CFHT Supernova Legacy Survey  

E-Print Network (OSTI)

The Canada-France-Hawaii Telescope Supernova Legacy Survey (SNLS) has created a large homogeneous database of intermediate redshift (0.2 rates, properties, and host galaxy star formation rates. The SNLS SN Ia database has now been combined with a photometric redshift galaxy catalog and an optical galaxy cluster catalog to investigate the possible influence of galaxy clustering on the SN Ia rate, over and above the expected effect due to the dependence of SFR on clustering through the morphology-density relation. We identify three cluster SNe Ia, plus three additional possible cluster SNe Ia, and find the SN Ia rate per unit mass in clusters at intermediate redshifts is consistent with the rate per unit mass in field early-type galaxies and the SN Ia cluster rate from low redshift cluster targeted surveys. We also find the number of SNe Ia in cluster environments to be within a factor of two of expectations from the two component SNIa rate model.

M. L. Graham; C. J. Pritchet; M. Sullivan; S. D. J. Gwyn; J. D. Neill; E. Y. Hsiao; P. Astier; D. Balam; C. Balland; S. Basa; R. G. Carlberg; A. Conley; D. Fouchez; J. Guy; D. Hardin; I. M. Hook; D. A. Howell; R. Pain; K. Perrett; N. Regnault; S. Baumont; J. Le Du; C. Lidman; S. Perlmutter; P. Ripoche; N. Suzuki; E. S. Walker; T. Zhang



Fitting Type Ia supernovae with coupled dark energy  

E-Print Network (OSTI)

We discuss the possible consistency of the recently discovered Type Ia supernovae at z>1 with models in which dark energy is strongly coupled to a significant fraction of dark matter, and in which an (asymptotic) accelerated phase exists where dark matter and dark energy scale in the same way. Such a coupling has been suggested for a possible solution of the coincidence problem, and is also motivated by string cosmology models of "late time" dilaton interactions. Our analysis shows that, for coupled dark energy models, the recent data are still consistent with acceleration starting as early as at $z=3$ (to within 90% c.l.), although at the price of a large "non-universality" of the dark energy coupling to different matter fields. Also, as opposed to uncoupled models which seem to prefer a ``phantom'' dark energy, we find that a large amount of coupled dark matter is compatible with present data only if the dark energy field has a conventional equation of state w>-1.

Amendola, L; Piazza, F; Amendola, Luca; Gasperini, Maurizio; Piazza, Federico



Mtrologie des supernovae de type Ia pour la cosmologie : instrumentation et analyse calorimtrique.  

E-Print Network (OSTI)

??L'utilisation des supernovae de type Ia comme indicateurs de distance est un pilier du modle de concordance actuel en cosmologie. Le travail d'instrumentation prsent dans (more)

Juramy, Claire



Toward Exascale Computing of Type Ia and Ib,c Supernovae: V&V...  

NLE Websites -- All DOE Office Websites (Extended Search)

Toward Exascale Computing of Type Ia and Ib,c Supernovae: V&V of Current Models PI Name: Don Lamb PI Email: lamb@oddjob.uchicago.edu Institution: University Of Chicago Allocation...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


Diversity of supernovae Ia determined using equivalent widths of Si II 4000  

E-Print Network (OSTI)

Spectroscopic and photometric properties of low and high-z supernovae Ia (SNe Ia) have been analyzed in order to achieve a better understanding of their diversity and to identify possible SN Ia sub-types. We use wavelet transformed spectra in which one can easily measure spectral features. We investigate the \\ion{Si}{II} 4000 equivalent width ($EW_w\\lbrace\\ion{Si}{II}\\rbrace$). The ability and, especially, the ease in extending the method to SNe at high-$z$ is demonstrated. We applied the method to 110 SNe Ia and found correlations between $EW_w\\lbrace\\ion{Si}{II}\\rbrace$ and parameters related to the light-curve shape for 88 supernovae with available photometry. No evidence for evolution of $EW_w\\lbrace\\ion{Si}{II}\\rbrace$ with redshift is seen. Three sub-classes of SNe Ia were confirmed using an independent cluster analysis with only light-curve shape, colour, and $EW_w\\lbrace\\ion{Si}{II}\\rbrace$. SNe from high-$z$ samples seem to follow a similar grouping to nearby objects. The $EW_w\\lbrace\\ion{Si}{II}\\rbrace$ value measured on a single spectrum may point towards SN Ia sub-classification, avoiding the need for expansion velocity gradient calculations.

V. Arsenijevic; S. Fabbro; A. M. Mourao; A. J. Rica da Silva



The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Verifying the Cosmological Utility of Type Ia Supernovae: Implications of a Dispersion in the Ultraviolet Spectra  

SciTech Connect

We analyze the mean rest-frame ultraviolet (UV) spectrum of Type Ia Supernovae (SNe) and its dispersion using high signal-to-noise ratio Keck-I/LRIS-B spectroscopy for a sample of 36 events at intermediate redshift (z=0.5) discovered by the Canada-France-Hawaii Telescope Supernova Legacy Survey (SNLS). We introduce a new method for removing host galaxy contamination in our spectra, exploiting the comprehensive photometric coverage of the SNLS SNe and their host galaxies, thereby providing the first quantitative view of the UV spectral properties of a large sample of distant SNe Ia. Although the mean SN Ia spectrum has not evolved significantly over the past 40percent of cosmic history, precise evolutionary constraints are limited by the absence of a comparable sample of high-quality local spectra. The mean UV spectrum of our z~;;=0.5 SNe Ia and its dispersion is tabulated for use in future applications. Within the high-redshift sample, we discover significant UV spectral variations and exclude dust extinction as the primary cause by examining trends with the optical SN color. Although progenitor metallicity may drive some of these trends, the variations we see are much larger than predicted in recent models and do not follow expected patterns. An interesting new result is a variation seen in the wavelength of selected UV features with phase. We also demonstrate systematic differences in the SN Ia spectral features with SN light curve width in both the UV and the optical. We show that these intrinsic variations could represent a statistical limitation in the future use of high-redshift SNe Ia for precision cosmology. We conclude that further detailed studies are needed, both locally and at moderate redshift where the rest-frame UV can be studied precisely, in order that future missions can confidently be planned to fully exploit SNe Ia as cosmological probes.

Nugent, Peter E; Ellis, R.S.; Sullivan, M.; Nugent, P.E.; Howell, D.A.; Gal-Yam, A.; Astier, P.; Balam, D.; Balland, C.; Basa, S.; Carlberg, R.; Conley, A.; Fouchez, D.; Guy, J.; Hardin, D.; Hook, I.; Pain, R.; Perrett, K.; Pritchet, C.J.; Regnault, N.



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:



Science Conference Proceedings (OSTI)

We present the first maximum-light ultraviolet (UV) through near-infrared (NIR) Type Ia supernova (SN Ia) spectrum. This spectrum of SN 2011iv was obtained nearly simultaneously by the Hubble Space Telescope at UV/optical wavelengths and the Magellan Baade telescope at NIR wavelengths. These data provide the opportunity to examine the entire maximum-light SN Ia spectral energy distribution. Since the UV region of an SN Ia spectrum is extremely sensitive to the composition of the outer layers of the explosion, which are transparent at longer wavelengths, this unprecedented spectrum can provide strong constraints on the composition of the SN ejecta, and similarly the SN explosion and progenitor system. SN 2011iv is spectroscopically normal, but has a relatively fast decline ({Delta}m{sub 15}(B) = 1.69 {+-} 0.05 mag). We compare SN 2011iv to other SNe Ia with UV spectra near maximum light and examine trends between UV spectral properties, light-curve shape, and ejecta velocity. We tentatively find that SNe with similar light-curve shapes but different ejecta velocities have similar UV spectra, while those with similar ejecta velocities but different light-curve shapes have very different UV spectra. Through a comparison with explosion models, we find that both a solar-metallicity W7 and a zero-metallicity delayed-detonation model provide a reasonable fit to the spectrum of SN 2011iv from the UV to the NIR.

Foley, Ryan J.; Marion, G. Howie; Challis, Peter; Kirshner, Robert P.; Berta, Zachory K. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Kromer, Markus; Taubenberger, Stefan; Hillebrandt, Wolfgang; Roepke, Friedrich K.; Ciaraldi-Schoolmann, Franco; Seitenzahl, Ivo R. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Strasse 1, D-85748 Garching bei Muenchen (Germany); Pignata, Giuliano [Departamento de Ciencias Fisicas, Universidad Andres Bello, Avda. Republica 252, Santiago (Chile); Stritzinger, Maximilian D. [Department of Physics and Astronomy, Aarhus University, Ny Munkegade, DK-8000 Aarhus C (Denmark); Filippenko, Alexei V.; Li Weidong; Silverman, Jeffrey M. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Folatelli, Gaston [Kavli Institute for the Physics and Mathematics of the Universe (Kavli IPMU, WPI), Todai Institutes for Advanced Study, University of Tokyo, Kashiwa 277-8583 (Japan); Hsiao, Eric Y.; Morrell, Nidia I. [Carnegie Observatories, Las Campanas Observatory, La Serena (Chile); Simcoe, Robert A., E-mail: rfoley@cfa.harvard.edu [MIT-Kavli Institute for Astrophysics and Space Research, 77 Massachusetts Avenue, 37-664D Cambridge, MA 02139 (United States); and others



MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Spectral Modeling of SNe Ia Near Maximum Light: Probing the Characteristics of Hydro Models  

E-Print Network (OSTI)

We have performed detailed NLTE spectral synthesis modeling of 2 types of 1-D hydro models: the very highly parameterized deflagration model W7, and two delayed detonation models. We find that overall both models do about equally well at fitting well observed SNe Ia near to maximum light. However, the Si II 6150 feature of W7 is systematically too fast, whereas for the delayed detonation models it is also somewhat too fast, but significantly better than that of W7. We find that a parameterized mixed model does the best job of reproducing the Si II 6150 line near maximum light and we study the differences in the models that lead to better fits to normal SNe Ia. We discuss what is required of a hydro model to fit the spectra of observed SNe Ia near maximum light.

E. Baron; S. Bongard; David Branch; Peter H. Hauschildt




SciTech Connect

SN 2002es is a peculiar subluminous Type Ia supernova (SN Ia) with a combination of observed characteristics never before seen in an SN Ia. At maximum light, SN 2002es shares spectroscopic properties with the underluminous SN 1991bg subclass of SNe Ia, but with substantially lower expansion velocities ({approx}6000 km s{sup -1}) more typical of the peculiar SN 2002cx subclass. Photometrically, SN 2002es differs from both SN 1991bg-like and SN 2002cx-like supernovae. Although at maximum light it is subluminous (M{sub B} = -17.78 mag), SN 2002es has a relatively broad light curve ({Delta}m{sub 15}(B) = 1.28 {+-} 0.04 mag), making it a significant outlier in the light-curve width versus luminosity relationship. We estimate a {sup 56}Ni mass of 0.17 {+-} 0.05 M{sub Sun} synthesized in the explosion, relatively low for an SN Ia. One month after maximum light, we find an unexpected plummet in the bolometric luminosity. The late-time decay of the light curves is inconsistent with our estimated {sup 56}Ni mass, indicating that either the light curve was not completely powered by {sup 56}Ni decay or the ejecta became optically thin to {gamma}-rays within a month after maximum light. The host galaxy is classified as an S0 galaxy with little to no star formation, indicating that the progenitor of SN 2002es is likely from an old stellar population. We also present a less extensive data set for SN 1999bh, an object which shares similar photometric and spectroscopic properties. Both objects were found as part of the Lick Observatory Supernova Search, allowing us to estimate that these objects should account for 2.5% of SNe Ia within a fixed volume. Current theoretical models are unable to explain the observed characteristics of SN 2002es.

Ganeshalingam, Mohan; Li Weidong; Filippenko, Alexei V.; Silverman, Jeffrey M.; Shen, Ken J. [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Chornock, Ryan; Foley, Ryan J.; Kirshner, Robert P.; Calkins, Mike [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Matheson, Thomas [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Milne, Peter, E-mail: mganesh@astro.berkeley.edu [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ 85721 (United States)




Science Conference Proceedings (OSTI)

We present early phase observations in optical and near-infrared wavelengths for the extremely luminous Type Ia supernova (SN Ia) 2009dc. The decline rate of the light curve is DELTAm{sub 15}(B) = 0.65 +- 0.03, which is one of the slowest among SNe Ia. The peak V-band absolute magnitude is estimated to be M{sub V} = -19.90 +- 0.15 mag if no host extinction is assumed. It reaches M{sub V} = -20.19 +- 0.19 mag if we assume the host extinction of A{sub V} = 0.29 mag. SN 2009dc belongs to the most luminous class of SNe Ia, like SNe 2003fg and 2006gz. Our JHK{sub s} -band photometry shows that this SN is also one of the most luminous SNe Ia in near-infrared wavelengths. We estimate the ejected {sup 56}Ni mass of 1.2 +- 0.3 M{sub sun} for the no host extinction case (and of 1.6 +- 0.4 M{sub sun} for the host extinction of A{sub V} = 0.29 mag). The C II lambda6580 absorption line remains visible until a week after the maximum brightness, in contrast to its early disappearance in SN 2006gz. The line velocity of Si II lambda6355 is about 8000 km s{sup -1} around the maximum, being considerably slower than that of SN 2006gz. The velocity of the C II line is similar to or slightly less than that of the Si II line around the maximum. The presence of the carbon line suggests that the thick unburned C+O layer remains after the explosion. Spectropolarimetric observations by Tanaka et al. indicate that the explosion is nearly spherical. These observational facts suggest that SN 2009dc is a super-Chandrasekhar mass SN Ia.

Yamanaka, M.; Arai, A.; Chiyonobu, S.; Fukazawa, Y.; Ikejiri, Y.; Itoh, R.; Komatsu, T.; Miyamoto, H. [Department of Physical Science, Hiroshima University, Kagamiyama 1-3-1, Higashi-Hiroshima 739-8526 (Japan); Kawabata, K. S. [Hiroshima Astrophysical Science Center, Hiroshima University, Higashi-Hiroshima, Hiroshima 739-8526 (Japan); Kinugasa, K.; Hashimoto, O.; Honda, S. [Gunma Astronomical Observatory, Takayama, Gunma 377-0702 (Japan); Tanaka, M. [Department of Astronomy, School of Science, University of Tokyo, Bunkyo-ku, Tokyo 113-0033 (Japan); Imada, A.; Kuroda, D. [Okayama Astrophysical Observatory, National Astronomical Observatory of Japan, Kamogata, Asakuchi-shi, Okayama 719-0232 (Japan); Maeda, K.; Nomoto, K. [Institute for the Physics and Mathematics of the Universe, University of Tokyo, Kashiwa (Japan); Kamata, Y. [National Astronomical Observatory of Japan, Osawa, Mitaka, Tokyo 181-8588 (Japan); Kawai, N. [Department of Physics, Tokyo Institute of Technology, 2-12-1 Ookayama, Meguro-ku, Tokyo 152-8551 (Japan); Konishi, K., E-mail: myamanaka@hiroshima-u.ac.j [Institute for Cosmic Ray Research, University of Tokyo, 5-1-5, Kashiwanoha, Kashiwa, Chiba, 277-8582 (Japan)



Print http://us.mg4.mail.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency  

E-Print Network (OSTI)

.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency From: Michael Klemen (wind4energy;Print http://us.rng4.mail.yahoo.comlneo/launch?.rand=deOsgko4ks4 energy in the wind is proportional://www.ndsu.edu/ndsu/klemen/Perfect_Turbine.htm You can see that for an ideal real life wind turbine ("good turbine") the increase in energy


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Final Technical Report: Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae  

Science Conference Proceedings (OSTI)

The final technical report from the project "Discovering the Nature of Dark Energy: Towards Better Distances from Type Ia Supernovae" led at Rutgers the State University of New Jersey by Prof. Saurabh W. Jha is presented, including all publications resulting from this award.

Saurabh W. Jha



Symbiotic stars as possible progenitors of SNe Ia: binary parameters and overall outlook  

E-Print Network (OSTI)

Symbiotic stars are interacting binaries in which the first-formed white dwarf accretes and burns material from a red giant companion. This paper aims at presenting physical characteristics of these objects and discussing their possible link with progenitors of type Ia supernovae.

Miko?ajewska, J




SciTech Connect

Prior to the explosive burning of a white dwarf (WD) that makes a Type Ia supernova (SN Ia), the star 'simmers' for {approx}10{sup 3} yr in a convecting, carbon-burning region. I estimate the excitation of g-modes by convection during this phase and explore their possible effect on the WD. As these modes propagate from the core of the WD toward its surface, their amplitudes grow with decreasing density. Once the modes reach nonlinear amplitudes, they break and deposit their energy into a shell of mass {approx}10{sup -4} M{sub sun}. This raises the surface temperature by {approx}4 x 10{sup 8} K, which is sufficient to ignite a layer of helium, as is expected to exist for some SN Ia scenarios. This predominantly synthesizes {sup 40}Ca, but some amount of {sup 28}Si, {sup 32}S, and {sup 44}Ti may also be present. These ashes are expanded out with the subsequent explosion up to velocities of {approx}20, 000 km s{sup -1}, which may explain the high velocity features (HVFs) seen in many SNe Ia. The appearance of HVFs would therefore be a useful discriminant for determining between progenitors, since a flammable helium-rich layer will not be present for accretion from a C/O WD as in a merger scenario. I also discuss the implications of {sup 44}Ti production.

Piro, Anthony L., E-mail: piro@caltech.edu [Theoretical Astrophysics, California Institute of Technology, 1200 E California Blvd., M/C 350-17, Pasadena, CA 91125 (United States)


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Flames in Type Ia Supernova: Deflagration-Detonation Transition in the Oxygen Burning Flame  

E-Print Network (OSTI)

Flames in Type Ia Supernova: Deflagration-Detonation Transition in the Oxygen Burning Flame S. E structure which, de- pending on density, may involve separate regions of carbon, oxygen and silicon burning, all propagating in a self-similar, subsonic front. The separation between these three burning regions


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Test for the Nature of the Type Ia Supernova Explosion Mechanism  

E-Print Network (OSTI)

Currently popular models for Type Ia supernovae (SNe Ia) fall into two general classes. The first comprises explosions of nearly pure carbon/oxygen (C/O) white dwarfs at the Chandrasekhar limit which ignite near their centers. The second consists of lower-mass C/O cores which are ignited by the detonation of an accreted surface helium layer. Explosions of the latter type produce copious Fe, Co and Ni K-alpha emission from 56Ni and 56Co decay in the detonated surface layers, emission which is much weaker from Chandrasekhar-mass models. The presence of this emission provides a simple and unambiguous discriminant between these two models for SNe Ia. Both mechanisms may produce 0.1-0.6 solar masses of 56Ni, making them bright gamma-ray line emitters. The time to maximum brightness of 56Ni decay lines is distinctly shorter in the sub-Chandrasekhar mass class of model (approximately 15 days) than in the Chandrasekhar mass model (approximately 30 days), making gamma-ray line evolution another direct test of the explosion mechanism. It should just be possible to detect K-shell emission from a sub-Chandrasekhar explosion from SNe Ia as far away as the Virgo cluster with the XMM Observatory. A 1 to 2 square meter X-ray telescope such as the proposed Con-X Observatory could observe K-alpha emission from sub-Chandrasekhar mass SNe Ia in the Virgo cluster, providing not just a detection, but high-accuracy flux and kinematic information.

Philip A. Pinto; Ronald G. Eastman; Tamara Rogers




SciTech Connect

Limits on the companions of white dwarfs in the single-degenerate scenario for the origin of Type Ia supernovae (SNe Ia) have gotten increasingly tight, yet igniting a nearly Chandrasekhar mass C/O white dwarf from a condition of near hydrostatic equilibrium provides compelling agreement with observed spectral evolution. The only type of non-degenerate stars that survive the tight limits, M{sub V} {approx}> 8.4 on the SN Ia in SNR 0509-67.5 and M{sub V} {approx}> 9.5 in the remnant of SN 1572, are M dwarfs. While M dwarfs are observed in cataclysmic variables, they have special properties that have not been considered in most work on the progenitors of SNe Ia: they have small but finite magnetic fields and they flare frequently. These properties are explored in the context of SN Ia progenitors. White dwarf/M dwarf pairs may be sufficiently plentiful to provide, in principle, an adequate rate of explosions even with slow orbital evolution due to magnetic braking or gravitational radiation. Even modest magnetic fields on the white dwarf and M dwarf will yield adequate torques to lock the two stars together, resulting in a slowly rotating white dwarf, with the magnetic poles pointing at one another in the orbital plane. The mass loss will be channeled by a 'magnetic bottle' connecting the two stars, landing on a concentrated polar area on the white dwarf. This enhances the effective rate of accretion compared to spherical accretion. Luminosity from accretion and hydrogen burning on the surface of the white dwarf may induce self-excited mass transfer. The combined effects of self-excited mass loss, polar accretion, and magnetic inhibition of mixing of accretion layers give possible means to beat the 'nova limit' and grow the white dwarf to the Chandrasekhar mass even at rather moderate mass accretion rates.

Wheeler, J. Craig, E-mail: wheel@astro.as.utexas.edu [Department of Astronomy, University of Texas at Austin, Austin, TX 78712 (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



File:USDA-CE-Production-GIFmaps-IA.pdf | Open Energy Information  

Open Energy Info (EERE)

IA.pdf IA.pdf Jump to: navigation, search File File history File usage Iowa Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 303 KB, MIME type: application/pdf) Description Iowa Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Iowa External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:13, 27 December 2010 Thumbnail for version as of 16:13, 27 December 2010 1,650 × 1,275 (303 KB) MapBot (Talk | contribs) Automated bot upload


IA REP0 SAND85-2809 Unlimited Release UC-92A  

Office of Scientific and Technical Information (OSTI)

IA REP0 SAND85-2809 Unlimited Release UC-92A IA REP0 SAND85-2809 Unlimited Release UC-92A Printed July 1986 High Energy Gas Fracture Experiments in Fluid-Filled Boreholes-Potential Geothermal Application J. F. Cuderman, T. Y. Chu, J. Jung, R. D. Jacobson Prepared by Sandia National Laboratories Albuquerque, New Mexico 87 185 and Livermore, California 94550 for the United States Department of Energy under Contract DE-AC04-76DP00789 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency Thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process


Constraining the spin-down timescale of the white-dwarf progenitors of Type Ia supernovae  

E-Print Network (OSTI)

Justham (2011) and DiStefano et al.\\ (2011) proposed that the white-dwarf progenitor of a Type Ia supernova (SN Ia) may have to spin down before it can explode. As the white dwarf spin-down timescale is not well known theoretically, we here try to constrain it empirically (within the framework of this spin-down model) for progenitor systems that contain a giant donor and for which circumbinary material has been detected after the explosion: we obtain an upper limit of a few $10^{\\rm 7} {\\rm yr}$. Based on the study of Di Stefano & Kilic (2012) this means that it is too early to rule out the existence of a surviving companion in SNR 0509-67.5.

Meng, Xiangcun



Integral Airframe Structures (IAS)---Validated Feasibility Study of Integrally Stiffened Metallic Fuselage Panels for Reducing Manufacturing Costs  

Science Conference Proceedings (OSTI)

The Integral Airframe Structures (IAS) program investigated the feasibility of using "integrally stiffened" construction for commercial transport fuselage structure. The objective of the program was to demonstrate structural performance and weight equal ...

Munroe J.; Wilkins K.; Gruber M.



In vivo cofactor biosynthesis and maintenance in the class Ia ribonucleotide reductase small subunit of Escherichia coli  

E-Print Network (OSTI)

The small subunit ([beta]2) of Escherichia coli class Ia ribonucleotide reductases (RNRs) contains a diferric tyrosyl radical (Y*) cofactor essential for the conversion of nucleotides to deoxynucleotides that are needed ...

Wu, Chia-Hung, Ph. D. Massachusetts Institute of Technology



Generation of a stable, aminotyrosyl radical-induced ?2?2 complex of Escherichia coli class Ia ribonucleotide reductase  

E-Print Network (OSTI)

Ribonucleotide reductase (RNR) catalyzes the conversion of nucleoside diphosphates to deoxynucleoside diphosphates (dNDPs). The Escherichia coli class Ia RNR uses a mechanism of radical propagation by which a cysteine in ...

Minnihan, Ellen Catherine



SciTech Connect

There are insufficient super-soft ({approx}0.1 keV) X-ray sources in either spiral or elliptical galaxies to account for the rate of explosion of Type Ia supernovae (SNe Ia) in either the single-degenerate or the double-degenerate scenarios. We quantify the amount of circumstellar matter that would be required to suppress the soft X-ray flux by yielding a column density in excess of 10{sup 23} cm{sup -2}. We summarize evidence that appropriate quantities of matter are extant in SNe Ia and in recurrent novae that may be supernova precursors. The obscuring matter is likely to have a large, but not complete, covering factor and to be substantially non-spherically symmetric. Assuming that much of the absorbed X-ray flux is re-radiated as blackbody radiation in the UV, we estimate that {approx}<100 sources might be detectable in the Galaxy Evolution Explorer All-sky Survey.

Wheeler, J. Craig [Department of Astronomy, University of Texas at Austin, Austin, TX (United States)] [Department of Astronomy, University of Texas at Austin, Austin, TX (United States); Pooley, D., E-mail: wheel@astro.as.utexas.edu [Department of Physics, Sam Houston State University, Huntsville, TX (United States)



Restframe I-band Hubble diagram for type Ia supernovae up toredshift z ~; 0.5  

SciTech Connect

We present a novel technique for fitting rest frame I-bandlight curves on a data set of 42 type Ia supernovae (SNe Ia). Using the result of the fit, we construct a Hubble diagram with 26 SNe from the subset at 0.01 < z < 0.1. Adding two SNe at z {approx} 0.5 yields results consistent with a flat Lambda-dominated ''concordance universe'' (OmegaM,Omega Lambda) = (0.25, 0.75). For one of these, SN 2000fr, new near infrared data are presented. The high redshift supernova NIR data are also used to test for systematic effects in the use of SNe Ia as distance estimators. A flat, Lambda = 0, universe where the faintness of supernovae at z {approx} 0.5 is due to grey dust homogeneously distributed in the intergalactic medium is disfavored based on the high-z Hubble diagram using this small data-set. However, the uncertainties are large and no firm conclusion may be drawn. We explore the possibility of setting limits on intergalactic dust based on B - I and B - V color measurements, and conclude that about 20 well measured SNe are needed to give statistically significant results. We also show that the high redshift restframe I-band data points are better fit by light curve templates that show a prominent second peak, suggesting that they are not intrinsically underluminous.

Nobili, S.; Amanullah, R.; Garavini, G.; Goobar, A.; Lidman, C.; Stanishev, V.; Aldering, G.; Antilogus, P.; Astier, P.; Burns, M.S.; Conley, A.; Deustua, S.E.; Ellis, R.; Fabbro, S.; Fadeyev, V.; Folatelli,G.; Gibbons, R.; Goldhaber, G.; Groom, D.E.; Hook, I.; Howell, D.A.; Kim,A.G.; Knop, R.A.; Nugent, P.E.; Pain, R.; Perlmutter, S.; Quimby, R.; Raux, J.; Regnault, N.; Ruiz-Lapuente, P.; Sainton, G.; Schahmaneche, K.; Smith, E.; Spadafora, A.L.; Thomas, R.C.; Wang, L.



Observational constraints from SNe Ia and Gamma-Ray Bursts on a clumpy universe  

E-Print Network (OSTI)

The luminosity distance describing the effect of local inhomogeneities in the propagation of light proposed by Zeldovich-Kantowski-Dyer-Roeder (ZKDR) is tested with two probes for two distinct ranges of redshifts: supernovae Ia (SNe Ia) in 0.015 gamma-ray bursts (GRBs) in 1.547 < z < 3.57. Our analysis is performed by a Markov Chain Monte Carlo (MCMC) code that allows us to constrain the matter density parameter \\Omega_m as well as the smoothness parameter $\\alpha$ that measures the inhomogeneous-homogeneous rate of the cosmic fluid in a flat \\LambdaCDM model. The obtained best fits are (\\Omega_m=0.285^{+0.019}_{-0.018}, \\alpha= 0.856^{+0.106}_{-0.176}) from SNe Ia and (\\Omega_m=0.259^{+0.028}_{-0.028}, \\alpha=0.587^{+0.201}_{-0.202}) from GRBs, while from the joint analysis the best fits are (\\Omega_m=0.284^{+0.021}_{-0.020}, \\alpha= 0.685^{+0.164}_{-0.171}) with a \\chi^2_{\\rm red}=0.975. The value of the smoothness parameter $\\alpha$ indicates a clumped universe however it does not have an impact on the amount of dark energy (cosmological constant) needed to fit observations. This result may be an indication that the Dyer-Roeder approximation does not describe in a precise form the effects of clumpiness in the expansion of the universe.

Nora Bretn; Ariadna Montiel



The Cellular Burning Regime in Type Ia Supernova Explosions - I. Flame Propagation into Quiescent Fuel  

E-Print Network (OSTI)

We present a numerical investigation of the cellular burning regime in Type Ia supernova explosions. This regime holds at small scales (i.e. below the Gibson scale), which are unresolved in large-scale Type Ia supernova simulations. The fundamental effects that dominate the flame evolution here are the Landau-Darrieus instability and its nonlinear stabilization, leading to a stabilization of the flame in a cellular shape. The flame propagation into quiescent fuel is investigated addressing the dependence of the simulation results on the specific parameters of the numerical setup. Furthermore, we investigate the flame stability at a range of fuel densities. This is directly connected to the questions of active turbulent combustion (a mechanism of flame destabilization and subsequent self-turbulization) and a deflagration-to-detonation transition of the flame. In our simulations we find no substantial destabilization of the flame when propagating into quiescent fuels of densities down to ~10^7 g/cm^3, corroborating fundamental assumptions of large-scale SN Ia explosion models. For these models, however, we suggest an increased lower cutoff for the flame propagation velocity to take the cellular burning regime into account.

F. K. Roepke; W. Hillebrandt; J. C. Niemeyer



Measurements of the Rate of Type Ia Supernovae at Redshift z < ~0.3 from the SDSS-II Supernova Survey  

E-Print Network (OSTI)

We present a measurement of the volumetric Type Ia supernova (SN Ia) rate based on data from the Sloan Digital Sky Survey II (SDSS-II) Supernova Survey. The adopted sample of supernovae (SNe) includes 516 SNe Ia at redshift z \\lesssim 0.3, of which 270 (52%) are spectroscopically identified as SNe Ia. The remaining 246 SNe Ia were identified through their light curves; 113 of these objects have spectroscopic redshifts from spectra of their host galaxy, and 133 have photometric redshifts estimated from the SN light curves. Based on consideration of 87 spectroscopically confirmed non-Ia SNe discovered by the SDSS-II SN Survey, we estimate that 2.04+1.61-0.95 % of the photometric SNe Ia may be misidentified. The sample of SNe Ia used in this measurement represents an order of magnitude increase in the statistics for SN Ia rate measurements in the redshift range covered by the SDSS-II Supernova Survey. If we assume a SN Ia rate that is constant at low redshift (z < 0.15), then the SN observations can be used t...

Dilday, Benjamin; Bassett, Bruce; Becker, Andrew; Bender, Ralf; Castander, Francisco; Cinabro, David; Filippenko, Alexei V; Frieman, Joshua A; Galbany, Lluis; Garnavich, Peter M; Goobar, Ariel; Hopp, Ulrich; Ihara, Yutaka; Jha, Saurabh W; Kessler, Richard; Lampeitl, Hubert; Marriner, John; Miquel, Ramon; Molla, Mercedes; Nichol, Robert C; Nordin, Jakob; Riess, Adam G; Sako, Masao; Schneider, Donald P; Sollerman, Jesper; Wheeler, J Craig; Ostman, Linda; Bizyaev, Dmitry; Brewington, Howard; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Dan; Pan, Kaike; Simmons, Audrey; Snedden, Stephanie



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D.G. NISHIMURA  

E-Print Network (OSTI)

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D are shown in Figure 2. Conclusions We have demonstrated real-time cardiac imaging at 3 Tesla with high SNR

Nayak, Krishna


Notes on the compatibility of type Ia supernovae data and varying--$G$ cosmology  

E-Print Network (OSTI)

Observational data for type Ia supernovae, shows that the expansion of the universe is accelerated. This accelerated expansion can be described by a cosmological constant or by dark energy models like quintessence. An interesting question may be raised here. Is it possible to describe the accelerated expansion of universe using varying--$G$ cosmological models? Here we shall show that the price for having accelerated expansion in slow--varying--$G$ models (in which the dynamical terms of $G$ are ignored) is to have highly non--conserved matter and also that it is in contradiction with other data.

Shojai, F


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


On the hydrogen emission from the type Ia supernova 2002ic  

DOE Green Energy (OSTI)

The discovery of SN 2002ic by the Supernova Factory and the subsequent spectroscopic studies have led to the surprising finding that SN 2002ic is a type Ia supernova with strong ejecta-circumstellar interaction. Here we show that nearly 1 year after the explosion the supernova has become fainter overall, but the H-alpha emission has brightened and broadened dramatically compared to earlier observations. We have obtained spectropolarimetry data which show that the hydrogen-rich matter is highly aspherically distributed. These observations suggest that the supernova exploded inside a dense, clumpy, disk-like circumstellar environment.

Wang, Lifan; Baade, Dietrich; Hoflich, Peter; Wheeler, J. Craig; Kawabata, Koji; Nomoto, Ken'ichi



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Photometric Observations of the Type Ia SN 2002er in UGC 10743  

E-Print Network (OSTI)

Extensive light and colour curves for the Type Ia supernova SN 2002er are presented as part of the European Supernova Collaboration. We have collected UBVRI photometry from ten different telescopes covering the phases from 7 days before until 619 days after maximum light. Corrections for the different instrumental systems and the non-thermal spectrum of the supernova (S-corrections) have been applied. With the densely sampled light curves we can make detailed comparisons to other well-observed objects. SN 2002er most closely resembles SN 1996X after maximum, but clearly shows a different colour evolution before peak light and a stronger shoulder in V and R bands compared to other well-observed SNe Ia. In particular, the rise time appears to be longer than what is expected from rise-time vs.decline-rate relation. We use several methods to determine the reddening towards SN 2002er based on the colour evolution at near peak and at late phases. The uvoir (bolometric) light curve shows great similarity with SN 199...

Pignata, G; Benetti, S; Blinnikov, S; Hillebrandt, W; Kotak, R; Leibundgut, B; Mazzali, P A; Meikle, P; Qiu, Y; Ruiz-Lapuente, P; Smartt, S; Sorokina, E; Stritzinger, M; Stehle, M; Turatto, M; Marsh, T; Martin-Luis, F; McBride, N; Mndez, J; Morales-Rueda, L; Narbutis, D; Street, R



The Cellular Burning Regime in Type Ia Supernova Explosions - II. Flame Propagation into Vortical Fuel  

E-Print Network (OSTI)

We investigate the interaction of thermonuclear flames in Type Ia supernova explosions with vortical flows by means of numerical simulations. In our study, we focus on small scales, where the flame propagation is no longer dominated by the turbulent cascade originating from large-scale effects. Here, the flame propagation proceeds in the cellular burning regime, resulting from a balance between the Landau-Darrieus instability and its nonlinear stabilization. The interaction of a cellularly stabilized flame front with a vortical fuel flow is explored applying a variety of fuel densities and strengths of the velocity fluctuations. We find that the vortical flow can break up the cellular flame structure if it is sufficiently strong. In this case the flame structure adapts to the imprinted flow field. The transition from the cellularly stabilized front to the flame structure dominated by vortices of the flow proceeds in a smooth way. The implications of the results of our simulations for Type Ia Supernova explosion models are discussed.

F. K. Roepke; W. Hillebrandt; J. C. Niemeyer



Flame Evolution During Type Ia Supernovae and the Deflagration Phase in the Gravitationally Confined Detonation Scenario  

E-Print Network (OSTI)

We develop an improved method for tracking the nuclear flame during the deflagration phase of a Type Ia supernova, and apply it to study the variation in outcomes expected from the gravitationally confined detonation (GCD) paradigm. A simplified 3-stage burning model and a non-static ash state are integrated with an artificially thickened advection-diffusion-reaction (ADR) flame front in order to provide an accurate but highly efficient representation of the energy release and electron capture in and after the unresolvable flame. We demonstrate that both our ADR and energy release methods do not generate significant acoustic noise, as has been a problem with previous ADR-based schemes. We proceed to model aspects of the deflagration, particularly the role of buoyancy of the hot ash, and find that our methods are reasonably well-behaved with respect to numerical resolution. We show that if a detonation occurs in material swept up by the material ejected by the first rising bubble but gravitationally confined to the white dwarf (WD) surface (the GCD paradigm), the density structure of the WD at detonation is systematically correlated with the distance of the deflagration ignition point from the center of the star. Coupled to a suitably stochastic ignition process, this correlation may provide a plausible explanation for the variety of nickel masses seen in Type Ia Supernovae.

D. M. Townsley; A. C. Calder; S. M. Asida; I. R. Seitenzahl; F. Peng; N. Vladimirova; D. Q. Lamb; J. W. Truran



Flame-driven deflagration-to-detonation transitions in Type Ia supernovae?  

E-Print Network (OSTI)

Although delayed detonation models of thermonuclear explosions of white dwarfs seem promising for reproducing Type Ia supernovae, the transition of the flame propagation mode from subsonic deflagration to supersonic detonation remains hypothetical. A potential instant for this transition to occur is the onset of the distributed burning regime, i.e. the moment when turbulence first affects the internal flame structure. Some studies of the burning microphysics indicate that a deflagration-to-detonation transition may be possible here, provided the turbulent intensities are strong enough. Consequently, the magnitude of turbulent velocity fluctuations generated by the deflagration flame is analyzed at the onset of the distributed burning regime in several three-dimensional simulations of deflagrations in thermonuclear supernovae. It is shown that the corresponding probability density functions fall off towards high turbulent velocity fluctuations much more slowly than a Gaussian distribution. Thus, values claimed to be necessary for triggering a detonation are likely to be found in sufficiently large patches of the flame. Although the microphysical evolution of the burning is not followed and a successful deflagration-to-detonation transition cannot be guaranteed from simulations presented here, the results still indicate that such events may be possible in Type Ia supernova explosions.

F. K. Roepke



Verifying the Cosmological Utility of Type Ia Supernovae:Implications of a Dispersion in the Ultraviolet Spectra  

SciTech Connect

We analyze the mean rest-frame ultraviolet (UV) spectrum ofType Ia Supernovae(SNe) and its dispersion using high signal-to-noiseKeck-I/LRIS-B spectroscopyfor a sample of 36 events at intermediateredshift (z=0.5) discoveredby the Canada-France-Hawaii TelescopeSupernova Legacy Survey (SNLS). Weintroduce a new method for removinghost galaxy contamination in our spectra,exploiting the comprehensivephotometric coverage of the SNLS SNe and theirhost galaxies, therebyproviding the first quantitative view of the UV spectralproperties of alarge sample of distant SNe Ia. Although the mean SN Ia spectrumhas notevolved significantly over the past 40 percent of cosmic history,preciseevolutionary constraints are limited by the absence of acomparable sample ofhigh quality local spectra. The mean UV spectrum ofour z 0.5 SNe Ia and itsdispersion is tabulated for use in futureapplications. Within the high-redshiftsample, we discover significant UVspectral variations and exclude dust extinctionas the primary cause byexamining trends with the optical SN color. Although progenitormetallicity may drive some of these trends, the variations we see aremuchlarger than predicted in recent models and do not follow expectedpatterns.An interesting new result is a variation seen in the wavelengthof selected UVfeatures with phase. We also demonstrate systematicdifferences in the SN Iaspectral features with SN lightcurve width inboth the UV and the optical. Weshow that these intrinsic variations couldrepresent a statistical limitation in thefuture use of high-redshift SNeIa for precision cosmology. We conclude thatfurther detailed studies areneeded, both locally and at moderate redshift wherethe rest-frame UV canbe studied precisely, in order that future missions canconfidently beplanned to fully exploit SNe Ia as cosmological probes.

Ellis, R.S.; Sullivan, M.; Nugent, P.E.; Howell, D.A.; Gal-Yam,A.; Astier, P.; Balam, D.; Balland, C.; Basa, S.; Carlberg, R.G.; Conley,A.; Fouchez, D.; Guy, J.; Hardin, D.; Hook, I.; Pain, R.; Perrett, K.; Pritchet, C.J.; Regnault, N.




SciTech Connect

PTF11kx was a Type Ia supernova (SN Ia) that showed time-variable absorption features, including saturated Ca II H and K lines that weakened and eventually went into emission. The strength of the emission component of H{alpha} gradually increased, implying that the SN was undergoing significant interaction with its circumstellar medium (CSM). These features, and many others, were blueshifted slightly and showed a P-Cygni profile, likely indicating that the CSM was directly related to, and probably previously ejected by, the progenitor system itself. These and other observations led Dilday et al. to conclude that PTF11kx came from a symbiotic nova progenitor like RS Oph. In this work we extend the spectral coverage of PTF11kx to 124-680 rest-frame days past maximum brightness. The late-time spectra of PTF11kx are dominated by H{alpha} emission (with widths of full width at half-maximum intensity Almost-Equal-To 2000 km s{sup -1}), strong Ca II emission features ({approx}10,000 km s{sup -1} wide), and a blue 'quasi-continuum' due to many overlapping narrow lines of Fe II. Emission from oxygen, He I, and Balmer lines higher than H{alpha} is weak or completely absent at all epochs, leading to large observed H{alpha}/H{beta} intensity ratios. The H{alpha} emission appears to increase in strength with time for {approx}1 yr, but it subsequently decreases significantly along with the Ca II emission. Our latest spectrum also indicates the possibility of newly formed dust in the system as evidenced by a slight decrease in the red wing of H{alpha}. During the same epochs, multiple narrow emission features from the CSM temporally vary in strength. The weakening of the H{alpha} and Ca II emission at late times is possible evidence that the SN ejecta have overtaken the majority of the CSM and agrees with models of other strongly interacting SNe Ia. The varying narrow emission features, on the other hand, may indicate that the CSM is clumpy or consists of multiple thin shells.

Silverman, Jeffrey M. [Department of Astronomy, University of Texas, Austin, TX 78712-0259 (United States); Nugent, Peter E.; Filippenko, Alexei V.; Cenko, S. Bradley [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); Gal-Yam, Avishay [Benoziyo Center for Astrophysics, The Weizmann Institute of Science, Rehovot 76100 (Israel); Sullivan, Mark [School of Physics and Astronomy, University of Southampton, Southampton SO17 1BJ (United Kingdom); Howell, D. Andrew [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Pan, Yen-Chen; Hook, Isobel M., E-mail: jsilverman@astro.as.utexas.edu [Department of Physics (Astrophysics), University of Oxford, Keble Road, Oxford OX1 3RH (United Kingdom)



A Precision Photometric Comparison between SDSS-II and CSP Type Ia Supernova Data  

Science Conference Proceedings (OSTI)

Consistency between Carnegie Supernova Project (CSP) and SDSS-II Supernova Survey ugri measurements has been evaluated by comparing Sloan Digital Sky Survey (SDSS) and CSP photometry for nine spectroscopically confirmed Type Ia supernova observed contemporaneously by both programs. The CSP data were transformed into the SDSS photometric system. Sources of systematic uncertainty have been identified, quantified, and shown to be at or below the 0.023 mag level in all bands. When all photometry for a given band is combined, we find average magnitude differences of equal to or less than 0.011 mag in ugri, with rms scatter ranging from 0.043 to 0.077 mag. The u-band agreement is promising, with the caveat that only four of the nine supernovae are well observed in u and these four exhibit an 0.038 mag supernova-to-supernova scatter in this filter.

Mosher, J.; /Pennsylvania U.; Sako, M.; /Pennsylvania U.; Corlies, L.; /Pennsylvania U. /Columbia U.; Folatelli, G.; /Tokyo U. /Carnegie Inst. Observ.; Frieman, J.; /Chicago U., KICP /Chicago U., Astron. Astrophys. Ctr.; Holtzman, J.; /New Mexico State U.; Jha, S.W.; /Rutgers U., Piscataway; Kessler, R.; /Chicago U., Astron. Astrophys. Ctr. /Chicago U., KICP; Marriner, J.; /Fermilab; Phillips, M.M.; /Carnegie Inst. Observ.; Stritzinger, M.; /Aarhus U. /Stockholm U., OKC /Bohr Inst. /Carnegie Inst. Observ.




SciTech Connect

Consistency between Carnegie Supernova Project (CSP) and SDSS-II Supernova Survey ugri measurements has been evaluated by comparing Sloan Digital Sky Survey (SDSS) and CSP photometry for nine spectroscopically confirmed Type Ia supernova observed contemporaneously by both programs. The CSP data were transformed into the SDSS photometric system. Sources of systematic uncertainty have been identified, quantified, and shown to be at or below the 0.023 mag level in all bands. When all photometry for a given band is combined, we find average magnitude differences of equal to or less than 0.011 mag in ugri, with rms scatter ranging from 0.043 to 0.077 mag. The u-band agreement is promising, with the caveat that only four of the nine supernovae are well observed in u and these four exhibit an 0.038 mag supernova-to-supernova scatter in this filter.

Mosher, J.; Sako, M.; Corlies, L. [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Folatelli, G. [Institute for the Physics and Mathematics of the Universe (IPMU), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Frieman, J.; Kessler, R. [Department of Astronomy and Astrophysics, University of Chicago, 5640 South Ellis Avenue, Chicago, IL 60637 (United States); Holtzman, J. [Department of Astronomy, MSC 4500, New Mexico State University, P.O. Box 30001, Las Cruces, NM 88003 (United States); Jha, S. W. [Department of Physics and Astronomy, Rutgers, the State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Marriner, J. [Center for Particle Astrophysics, Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Phillips, M. M.; Morrell, N. [Las Campanas Observatory, Carnegie Observatories, Casilla 601, La Serena (Chile); Stritzinger, M. [Oskar Klein Centre for Cosmo Particle Physics, AlbaNova University Center, 106 91 Stockholm (Sweden); Schneider, D. P., E-mail: jmosher@sas.upenn.edu [Department of Astronomy and Astrophysics, Pennsylvania State University, 525 Davey Laboratory, University Park, PA 16802 (United States)



A Precision Photometric Comparison between SDSS-II and CSP Type Ia Supernova Data  

E-Print Network (OSTI)

Consistency between Carnegie Supernova Project (CSP) and SDSS-II supernova (SN) survey ugri measurements has been evaluated by comparing SDSS and CSP photometry for nine spectroscopically confirmed Type Ia supernova observed contemporaneously by both programs. The CSP data were transformed into the SDSS photometric system. Sources of systematic uncertainty have been identified, quantified, and shown to be at or below the 0.023 magnitude level in all bands. When all photometry for a given band is combined, we find average magnitude differences of equal to or less than 0.011 magnitudes in ugri, with rms scatter ranging from 0.043 to 0.077 magnitudes. The u band agreement is promising, with the caveat that only four of the nine supernovae are well-observed in u and these four exhibit an 0.038 magnitude supernova-to-supernova scatter in this filter.

Mosher, J; Corlies, L; Folatelli, G; Frieman, J; Holtzman, J; Jha, S W; Kessler, R; Marriner, J; Phillips, M M; Stritzinger, M; Morrell, N; Schneider, D P



Analysis of Reaction-Diffusion Systems for Flame Capturing in Type Ia Supernova Simulations  

E-Print Network (OSTI)

We present a study of numerical behavior of a thickened flame used in Flame Capturing (FC, Khokhlov (1995)) for tracking thin unresolved physical flames in deflagration simulations. We develop a steady-state procedure for calibrating the flame model used, and test it against analytical results. We observe numerical noises generated by original realization of the technique. Alternative artificial burning rates are discussed, which produce acceptably quiet flames. Two new quiet models are calibrated to yield required "flame" speed and width, and further studied in 2D and 3D setting. Landau-Darrieus type instabilities of the flames are observed. One model also shows significantly anisotropic propagation speed on the grid, both effects increasingly pronounced at larger matter expansion as a result of burning; this makes the model unacceptable for use in type Ia supernova simulations. Another model looks promising for use in flame capturing at fuel to ash density ratio of order 3 and below. That "Model B" yields f...

Zhiglo, Andrey V



ASD(NII)/DoD CIO SUBJECT: Defense Industrial Base (DIB) Cyber Security/Information Assurance (CS/IA) Activities  

E-Print Network (OSTI)

directing the conduct of DIB CS/IA activities to protect unclassified DoD information, as defined in the Glossary, that transits or resides on unclassified DIB information systems and networks. 2. APPLICABILITY. This Instruction applies to OSD, the Military Departments, the Office of

unknown authors




SciTech Connect

On 2011 August 24 (UT) the Palomar Transient Factory (PTF) discovered PTF11kly (SN 2011fe), the youngest and most nearby Type Ia supernova (SN Ia) in decades. We followed this event up in the radio (centimeter and millimeter bands) and X-ray bands, starting about a day after the estimated explosion time. We present our analysis of the radio and X-ray observations, yielding the tightest constraints yet placed on the pre-explosion mass-loss rate from the progenitor system of this supernova. We find a robust limit of M-dot {approx}<10{sup -8}(w/100 km s{sup -1}) M{sub sun} yr{sup -1} from sensitive X-ray non-detections, as well as a similar limit from radio data, which depends, however, on assumptions about microphysical parameters. We discuss our results in the context of single-degenerate models for SNe Ia and find that our observations modestly disfavor symbiotic progenitor models involving a red giant donor, but cannot constrain systems accreting from main-sequence or sub-giant stars, including the popular supersoft channel. In view of the proximity of PTF11kly and the sensitivity of our prompt observations, we would have to wait for a long time (a decade or longer) in order to more meaningfully probe the circumstellar matter of SNe Ia.

Horesh, Assaf; Kulkarni, S. R.; Carpenter, John; Kasliwal, Mansi M.; Ofek, Eran O. [Cahill Center for Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Fox, Derek B. [Astronomy and Astrophysics, Eberly College of Science, Pennsylvania State University, University Park, PA 16802 (United States); Quimby, Robert [IPMU, University of Tokyo, Kashiwanoha 5-1-5, Kashiwa-shi, Chiba (Japan); Gal-Yam, Avishay [Benoziyo Center for Astrophysics, Faculty of Physics, Weizmann Institute of Science, Rehovot 76100 (Israel); Cenko, S. Bradley [Department of Astronomy, University of California, Berkeley, CA 94720-3411 (United States); De Bruyn, A. G. [Netherlands Institute for Radio Astronomy (ASTRON), Postbus 2, NL-7990 AA Dwingeloo (Netherlands); Kamble, Atish; Wijers, Ralph A. M. J. [Center for Gravitation and Cosmology, University of Wisconsin, Milwaukee, WI 53211 (United States); Van der Horst, Alexander J. [Universities Space Research Association, NSSTC, Huntsville, AL 35805 (United States); Kouveliotou, Chryssa [Space Science Office, VP-62, NASA-Marshall Space Flight Center, Huntsville, AL 35805 (United States); Podsiadlowski, Philipp; Sullivan, Mark; Maguire, Kate [Department of Physics (Astrophysics), University of Oxford, Keble Road, Oxford OX1 3RH (United Kingdom); Howell, D. Andrew [Las Cumbres Observatory Global Telescope Network, Santa Barbara, CA 93117 (United States); Nugent, Peter E. [Computational Cosmology Center, Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, CA 94720 (United States); Gehrels, Neil [NASA-Goddard Space Flight Center, Greenbelt, MD 20771 (United States); and others



Photometric Observations of the Type Ia SN 2002er in UGC 10743  

E-Print Network (OSTI)

Extensive light and colour curves for the Type Ia supernova SN 2002er are presented as part of the European Supernova Collaboration. We have collected UBVRI photometry from ten different telescopes covering the phases from 7 days before until 619 days after maximum light. Corrections for the different instrumental systems and the non-thermal spectrum of the supernova (S-corrections) have been applied. With the densely sampled light curves we can make detailed comparisons to other well-observed objects. SN 2002er most closely resembles SN 1996X after maximum, but clearly shows a different colour evolution before peak light and a stronger shoulder in V and R bands compared to other well-observed SNe Ia. In particular, the rise time appears to be longer than what is expected from rise-time vs.decline-rate relation. We use several methods to determine the reddening towards SN 2002er based on the colour evolution at near peak and at late phases. The uvoir (bolometric) light curve shows great similarity with SN 1996X, but also indications of a higher luminosity, longer rise time and a more pronounced shoulder 25 days past maximum. The interpretation of the light curves was done with two independent light curve codes. Both find that given the luminosity of SN 2002er the 56Ni mass exceeds 0.6 Msun with prefered values near 0.7 Msun. Uncertainties in the exact distance to SN 2002er are the most serious limitation of this measurement. The light curve modelling also indicates a high level of mixing of the nickel in the explosion of SN 2002er.

G. Pignata; F. Patat; S. Benetti; S. Blinnikov; W. Hillebrandt; R. Kotak; B. Leibundgut; P. A. Mazzali; P. Meikle; Y. Qiu; P. Ruiz-Lapuente; S. Smartt; E. Sorokina; M. Stritzinger; M. Stehle; M. Turatto; T. Marsh; F. Martin-Luis; N. McBride; J. Mendez; L. Morales-Rueda; D. Narbutis; R. Street



Direct Analysis of Spectra of the Peculiar Type Ia Supernova 2000cx  

E-Print Network (OSTI)

The Type Ia SN 2000cx exhibited multiple peculiarities, including a lopsided B-band light-curve peak that does not conform to current methods for using shapes of light curves to standardize SN Ia luminosities. We use the parameterized supernova synthetic-spectrum code SYNOW to study line identifications in the photospheric-phase spectra of SN 2000cx. Previous work established the presence of Ca II infrared-triplet features forming above velocity about 20,000 km/s, much higher than the photospheric velocity of about 10,000 km/s. We find Ti II features forming at the same high velocity. High-velocity line formation is partly responsible for the photometric peculiarities of SN 2000cx: for example, B-band flux blocking by Ti II absorption features that decreases with time causes the B light curve to rise more rapidly and decline more slowly than it otherwise would. SN 2000cx contains an absorption feature near 4530 A that may be H-beta, forming at the same high velocity. The lack of conspicuous H-alpha and P-alpha signatures does not necessarily invalidate the H-beta identification if the high-velocity line formation is confined to a clump that partly covers the photosphere and the H-alpha and P-alpha source functions are elevated relative to that of resonance scattering. The H-beta identification is tentative. If it is correct, the high-velocity matter must have come from a nondegenerate companion star.

D. Branch; R. C. Thomas; E. Baron; D. Kasen; K. Hatano; K. Nomoto; A. V. Filippenko; W. Li; R. J. Rudy




SciTech Connect

For the explosion mechanism of Type Ia supernovae (SNe Ia), different scenarios have been suggested. In these, the propagation of the burning front through the exploding white dwarf (WD) star proceeds in different modes, and consequently imprints of the explosion model on the nucleosynthetic yields can be expected. The nucleosynthetic characteristics of various explosion mechanisms are explored based on three two-dimensional explosion simulations representing extreme cases: a pure turbulent deflagration, a delayed detonation following an approximately spherical ignition of the initial deflagration, and a delayed detonation arising from a highly asymmetric deflagration ignition. Apart from this initial condition, the deflagration stage is treated in a parameter-free approach. The detonation is initiated when the turbulent burning enters the distributed burning regime. This occurs at densities around 10{sup 7} g cm{sup -3}-relatively low as compared to existing nucleosynthesis studies for one-dimensional spherically symmetric models. The burning in these multidimensional models is different from that in one-dimensional simulations as the detonation wave propagates both into unburned material in the high-density region near the center of a WD and into the low-density region near the surface. Thus, the resulting yield is a mixture of different explosive burning products, from carbon-burning products at low densities to complete silicon-burning products at the highest densities, as well as electron-capture products synthesized at the deflagration stage. Detailed calculations of the nucleosynthesis in all three models are presented. In contrast to the deflagration model, the delayed detonations produce a characteristic layered structure and the yields largely satisfy constraints from Galactic chemical evolution. In the asymmetric delayed detonation model, the region filled with electron capture species (e.g., {sup 58}Ni, {sup 54}Fe) is within a shell, showing a large off-set, above the bulk of {sup 56}Ni distribution, while species produced by the detonation are distributed more spherically.

Maeda, K. [Institute for the Physics and Mathematics of the Universe (IPMU), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Roepke, F.K.; Fink, M.; Hillebrandt, W.; Travaglio, C. [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Strasse 1, 85741 Garching (Germany); Thielemann, F.-K., E-mail: keiichi.maeda@ipmu.j [Department Physik, Universitaet Basel, CH-4056 Basel (Switzerland)




Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure


Measurements of the Rate of Type Ia Supernovae at Redshift z < ~0.3 from the SDSS-II Supernova Survey  

Science Conference Proceedings (OSTI)

We present a measurement of the volumetric Type Ia supernova (SN Ia) rate based on data from the Sloan Digital Sky Survey II (SDSS-II) Supernova Survey. The adopted sample of supernovae (SNe) includes 516 SNe Ia at redshift z {approx}< 0.3, of which 270 (52%) are spectroscopically identified as SNe Ia. The remaining 246 SNe Ia were identified through their light curves; 113 of these objects have spectroscopic redshifts from spectra of their host galaxy, and 133 have photometric redshifts estimated from the SN light curves. Based on consideration of 87 spectroscopically confirmed non-Ia SNe discovered by the SDSS-II SN Survey, we estimate that 2.04{sub -0.95}{sup +1.61}% of the photometric SNe Ia may be misidentified. The sample of SNe Ia used in this measurement represents an order of magnitude increase in the statistics for SN Ia rate measurements in the redshift range covered by the SDSS-II Supernova Survey. If we assume a SN Ia rate that is constant at low redshift (z < 0.15), then the SN observations can be used to infer a value of the SN rate of r{sub V} = (2.69{sub -0.30-0.01}{sup +0.34+0.21}) x 10{sup -5} SNe yr{sup -1} Mpc{sup -3} (H{sub 0}/(70 km s{sup -1} Mpc{sup -1})){sup 3} at a mean redshift of {approx} 0.12, based on 79 SNe Ia of which 72 are spectroscopically confirmed. However, the large sample of SNe Ia included in this study allows us to place constraints on the redshift dependence of the SN Ia rate based on the SDSS-II Supernova Survey data alone. Fitting a power-law model of the SN rate evolution, r{sub V} (z) = A{sub p} x ((1+z)/(1+z{sub 0})){sup {nu}}, over the redshift range 0.0 < z < 0.3 with z{sub 0} = 0.21, results in A{sub p} = (3.43{sub -0.15}{sup +0.15}) x 10{sup -5} SNe yr{sup -1} Mpc{sup -3} (H{sub 0}/(70 km s{sup -1} Mpc{sup -1})){sup 3} and {nu} = 2.04{sub -0.89}{sup +0.90}.

Dilday, Benjamin; /Rutgers U., Piscataway /Chicago U. /KICP, Chicago; Smith, Mathew; /Cape Town U., Dept. Math. /Portsmouth U.; Bassett, Bruce; /Cape Town U., Dept. Math. /South African Astron. Observ.; Becker, Andrew; /Washington U., Seattle, Astron. Dept.; Bender, Ralf; /Munich, Tech. U. /Munich U. Observ.; Castander, Francisco; /Barcelona, IEEC; Cinabro, David; /Wayne State U.; Filippenko, Alexei V.; /UC, Berkeley; Frieman, Joshua A.; /Chicago U. /Fermilab; Galbany, Lluis; /Barcelona, IFAE; Garnavich, Peter M.; /Notre Dame U. /Stockholm U., OKC /Stockholm U.



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Constraints on SN Ia progenitor time delays from high-z SNe and the star formation history  

E-Print Network (OSTI)

We re-assess the question of a systematic time delay between the formation of the progenitor and its explosion in a type Ia supernova (SN Ia) using the Hubble Higher-z Supernova Search sample (Strolger et al. 2004). While the previous analysis indicated a significant time delay, with a most likely value of 3.4 Gyr, effectively ruling out all previously proposed progenitor models, our analysis shows that the time-delay estimate is dominated by systematic errors, in particular due to uncertainties in the star-formation history. We find that none of the popular progenitor models under consideration can be ruled out with any significant degree of confidence. The inferred time delay is mainly determined by the peak in the assumed star-formation history. We show that, even with a much larger Supernova sample, the time delay distribution cannot be reliably reconstructed without better constraints on the star-formation history.

F. Frster; C. Wolf; Ph. Podsiadlowski; Z. Han



A Measurement of the Rate of Type Ia Supernovae in Galaxy Clusters from the SDSS-II Supernova Survey  

Science Conference Proceedings (OSTI)

We present measurements of the Type Ia supernova (SN) rate in galaxy clusters based on data from the Sloan Digital Sky Survey-II (SDSS-II) Supernova Survey. The cluster SN Ia rate is determined from 9 SN events in a set of 71 C4 clusters at z {le} 0.17 and 27 SN events in 492 maxBCG clusters at 0.1 {le} z {le} 0.3. We find values for the cluster SN Ia rate of (0.37{sub -0.12-0.01}{sup +0.17+0.01}) SNur h{sup 2} and (0.55{sub -0.11-0.01}{sup +0.13+0.02}) SNur h{sup 2} (SNux = 10{sup -12}L{sub x{circle_dot}}{sup -1} yr{sup -1}) in C4 and maxBCG clusters, respectively, where the quoted errors are statistical and systematic, respectively. The SN rate for early-type galaxies is found to be (0.31{sub -0.12-0.01}{sup +0.18+0.01}) SNur h{sup 2} and (0.49{sub -0.11-0.01}{sup +0.15+0.02}) SNur h{sup 2} in C4 and maxBCG clusters, respectively. The SN rate for the brightest cluster galaxies (BCG) is found to be (2.04{sub -1.11-0.04}{sup +1.99+0.07}) SNur h{sup 2} and (0.36{sub -0.30-0.01}{sup +0.84+0.01}) SNur h{sup 2} in C4 and maxBCG clusters, respectively. The ratio of the SN Ia rate in cluster early-type galaxies to that of the SN Ia rate in field early-type galaxies is 1.94{sub -0.91-0.015}{sup +1.31+0.043} and 3.02{sub -1.03-0.048}{sup +1.31+0.062}, for C4 and maxBCG clusters, respectively. The SN rate in galaxy clusters as a function of redshift, which probes the late time SN Ia delay distribution, shows only weak dependence on redshift. Combining our current measurements with previous measurements, we fit the cluster SN Ia rate data to a linear function of redshift, and find r{sub L} = [(0.49{sub -0.14}{sup +0.15}) + (0.91{sub -0.81}{sup +0.85}) x z] SNuB h{sup 2}. A comparison of the radial distribution of SNe in cluster to field early-type galaxies shows possible evidence for an enhancement of the SN rate in the cores of cluster early-type galaxies. With an observation of at most 3 hostless, intra-cluster SNe Ia, we estimate the fraction of cluster SNe that are hostless to be (9.4{sub -5.1}{sup +8.3})%.

Dilday, Benjamin; /Rutgers U., Piscataway /Chicago U. /KICP, Chicago; Bassett, Bruce; /Cape Town U., Dept. Math. /South African Astron. Observ.; Becker, Andrew; /Washington U., Seattle, Astron. Dept.; Bender, Ralf; /Munich, Tech. U. /Munich U. Observ.; Castander, Francisco; /Barcelona, IEEC; Cinabro, David; /Wayne State U.; Frieman, Joshua A.; /Chicago U. /Fermilab; Galbany, Lluis; /Barcelona, IFAE; Garnavich, Peter; /Notre Dame U.; Goobar, Ariel; /Stockholm U., OKC /Stockholm U.; Hopp, Ulrich; /Munich, Tech. U. /Munich U. Observ. /Tokyo U.



LAX XXlCfl jX?iK, Idd+?KYLViG?IA  

Office of Legacy Management (LM)

f f , : I~&l, samtier cipwati8Aa CffUm - . Jiux.lCJ d,# 1754 - - _- - .- t :; . Jesse e. ahizmn*~*ter -2.' -------- - _ &tV' hi@A l f izau Bkteriala ;' . . 1 -7 I _' i' . Fpr&G& r&Q Q,&& fu &fI& L;&& -l&d 2;,i' iI,;/Qi' rIGN CQ&GgJy p;E& p;~p>gyf LAX XXlCfl jX?iK, Idd+?KYLViG?IA i-icfer~~o is &o ta yaw rwarandu3;: l P iimwmbec L?, 1953, reque&in~ a d&q.&ti of khority tA A&sister prog= for th+zz developmrrrl, Ii-&k& & acyui8itti ef c;uYletit*type and reswitlitc-type urtim bi:aPing eres and far t3-u jx*uctim and acquisitian 6f W ;aniU CCm- csa:ratc~ fhzi awes wit2n Lhe Six&e of Pemlsyzvania. 1 da not b&i- the projscrt fmr the pkcch2670 +S eroa from i&d.&


Prospects for Type Ia Supernova explosion mechanism identification with gamma rays  

E-Print Network (OSTI)

The explosion mechanism associated with thermonuclear supernovae (SNIa) is still a matter of debate. There is a wide agreement that high amounts of of radioactive nuclei are produced during these events and they are expected to be strong gamma-ray emitters. In the past, several authors have investigated the use of this gamma-ray emission as a diagnostic tool. In this paper we have done a complete study of the gamma-ray spectra associated with all the different scenarios currently proposed. This includes detonation, delayed detonation, deflagration and the off-center detonation. We have performed accurate simulations for this complete set of models in order to determine the most promising spectral features that could be used to discriminate among the different models. Our study is not limited to qualitative arguments. Instead, we have quantified the differences among the spectra and established distance limits for their detection. The calculations have been performed considering the best current response estimations of the SPI and IBIS instruments aboard INTEGRAL in such a way that our results can be used as a guideline to evaluate the capabilities of INTEGRAL in the study of type Ia supernovae. For the purpose of completeness we have also investigated the nuclear excitation and spallation reactions as a possible secondary source of gamma-rays present in some supernova scenarios. We conclude that this mechanism can be neglected due to its small contribution.

Jordi Gomez-Gomar; Jordi Isern; Pierre Jean




SciTech Connect

We present a study exploring a systematic effect on the brightness of Type Ia supernovae using numerical models that assume the single-degenerate paradigm. Our investigation varied the central density of the progenitor white dwarf at flame ignition, and considered its impact on the explosion yield, particularly the production and distribution of radioactive {sup 56}Ni, which powers the light curve. We performed a suite of two-dimensional simulations with randomized initial conditions, allowing us to characterize the statistical trends that we present. The simulations indicate that the production of Fe-group material is statistically independent of progenitor central density, but the mass of stable Fe-group isotopes is tightly correlated with central density, with a decrease in the production of {sup 56}Ni at higher central densities. These results imply that progenitors with higher central densities produce dimmer events. We provide details of the post-explosion distribution of {sup 56}Ni in the models, including the lack of a consistent centrally located deficit of {sup 56}Ni, which may be compared to observed remnants. By performing a self-consistent extrapolation of our model yields and considering the main-sequence lifetime of the progenitor star and the elapsed time between the formation of the white dwarf and the onset of accretion, we develop a brightness-age relation that improves our prediction of the expected trend for single degenerates and we compare this relation with observations.

Krueger, Brendan K.; Jackson, Aaron P.; Calder, Alan C. [Department of Physics and Astronomy, State University of New York-Stony Brook, Stony Brook, NY (United States); Townsley, Dean M. [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL (United States); Brown, Edward F. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI (United States); Timmes, Francis X., E-mail: brendan.krueger@stonybrook.edu [Joint Institute for Nuclear Astrophysics, Notre Dame, IN (United States)



Phenomenology for Supernova Ia Data Based on a New Cosmic Time  

E-Print Network (OSTI)

A new phenomenological theory for the expansion of our universe is presented. Because fundamental supporting theory is still in development, its discussion is not presented in this paper. The theory is based on a new algebraic expression for cosmic time G Rho t^2=3/32Pi, which correctly predicts the WMAP measured cosmological constants and the fundamental Hubble parameter H(t) for the expansion of the universe. A replacement for dark matter, called here "dark mass", is proposed which scales as with the expansion and incorporated. It does not react with ordinary matter, except gravitationally, and produces flat rotational curves for spiral galaxies. Also a new expression for the approaching velocity of radiation in a closed 3-sphere expanding universe is given that accounts for the early degrading negative approach of radiation for z > 1.7. The expression is v = Hr-c. Combining these three elements produces a luminosity distance dL that successfully predicts the apparent magnitude of exploding supernova Ia stars and even the new gamma ray bursts with no need for dark energy or acceleration of the expansion of the universe.

Charles B. Leffert




E-Print Network (OSTI)

We extend our previous three-dimensional, full-star simulations of the final hours of convection preceding ignition in Type Ia supernovae to higher resolution using the adaptive mesh refinement capability of our low Mach number code, MAESTRO. We report the statistics of the ignition of the first flame at an effective 4.34 km resolution and general flow field properties at an effective 2.17 km resolution. We find that off-center ignition is likely, with radius of 50 km most favored and a likely range of 4075 km. This is consistent with our previous coarser (8.68 km resolution) simulations, implying that we have achieved sufficient resolution in our determination of likely ignition radii. The dynamics of the last few hot spots preceding ignition suggest that a multiple ignition scenario is not likely. With improved resolution, we can more clearly see the general flow pattern in the convective region, characterized by a strong outward plume with a lower speed recirculation. We show that the convective core is turbulent with a Kolmogorov spectrum and has a lower turbulent intensity and larger integral length scale than previously thought (on the order of 16 km s?1 and 200 km, respectively), and we discuss the potential consequences for the first flames. Key words: convection hydrodynamics methods: numerical nuclear reactions, nucleosynthesis, abundances supernovae: general white dwarfs Online-only material: color figures 1.

A. Nonaka; A. J. Aspden; M. Zingale; A. S. Almgren; J. B. Bell; S. E. Woosley



Direct numerical simulations of type Ia supernovae flames II: The Rayleigh-Taylor instability  

Science Conference Proceedings (OSTI)

A Type Ia supernova explosion likely begins as a nuclear runaway near the center of a carbon-oxygen white dwarf. The outward propagating flame is unstable to the Landau-Darrieus, Rayleigh-Taylor, and Kelvin-Helmholtz instabilities, which serve to accelerate it to a large fraction of the speed of sound. We investigate the Rayleigh-Taylor unstable flame at the transition from the flamelet regime to the distributed-burning regime, around densities of 10e7 gm/cc, through detailed, fully resolved simulations. A low Mach number, adaptive mesh hydrodynamics code is used to achieve the necessary resolution and long time scales. As the density is varied, we see a fundamental change in the character of the burning--at the low end of the density range the Rayleigh-Taylor instability dominates the burning, whereas at the high end the burning suppresses the instability. In all cases, significant acceleration of the flame is observed, limited only by the size of the domain we are able to study. We discuss the implications of these results on the potential for a deflagration to detonation transition.

Bell, J.B.; Day, M.S.; Rendleman, C.A.; Woosley, S.E.; Zingale, M.



Constraining deflagration models of Type Ia supernovae through intermediate-mass elements  

E-Print Network (OSTI)

The physical structure of a nuclear flame is a basic ingredient of the theory of Type Ia supernovae (SNIa). Assuming an exponential density reduction with several characteristic times we have followed the evolution of a planar nuclear flame in an expanding background from an initial density 6.6 10^7 g/cm3 down to 2 10^6 g/cm3. The total amount of synthesized intermediate-mass elements (IME), from silicon to calcium, was monitored during the calculation. We have made use of the computed mass fractions, X_IME, of these elements to give an estimation of the total amount of IME synthesized during the deflagration of a massive white dwarf. Using X_IME and adopting the usual hypothesis that turbulence decouples the effective burning velocity from the laminar flame speed, so that the relevant flame speed is actually the turbulent speed on the integral length-scale, we have built a simple geometrical approach to model the region where IME are thought to be produced. It turns out that a healthy production of IME invol...

Garca-Senz, D; Cabezon, R M; Woosley, S E



Direct numerical simulations of type Ia supernovae flames I: The landau-darrieus instability  

SciTech Connect

Planar flames are intrinsically unstable in open domains due to the thermal expansion across the burning front--the Landau-Darrieus instability. This instability leads to wrinkling and growth of the flame surface, and corresponding acceleration of the flame, until it is stabilized by cusp formation. We look at the Landau-Darrieus in stability for C/O thermonuclear flames at conditions relevant to the late stages of a Type Ia supernova explosion. Two-dimensional direct numerical simulations of both single-mode and multi-mode perturbations using a low Mach number hydrodynamics code are presented. We show the effect of the instability on the flame speed as a function of both the density and domain size, demonstrate the existence of the small scale cutoff to the growth of the instability, and look for the proposed breakdown of the non-linear stabilization at low densities. The effects of curvature on the flame as quantified through measurements of the growth rate and computation of the corresponding Markstein number. While accelerations of a few percent are observed, they are too small to have any direct outcome on the supernova explosion.

Bell, J.B.; Day, M.S.; Rendleman, C.A.; Woosley, S.E.; Zingale, M.


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Conference Proceedings (OSTI)

The flame in a Type Ia supernova is a conglomerate structure that, depending on density, may involve separate regions of carbon, oxygen, and silicon burning, all propagating in a self-similar, subsonic front. The separation between these three burning regions increases as the density declines until eventually, below about 2 x 10{sup 7} g cm{sup -3}, only carbon burning remains active, the other two burning phases having 'frozen out' on stellar scales. Between 2 and 3 x 10{sup 7} g cm{sup -3}, however, there remains an energetic oxygen-burning region that trails the carbon burning by an amount that is sensitive to the turbulence intensity. As the carbon flame makes a transition to the distributed regime (Karlovitz number {approx}> 10), the characteristic separation between the carbon- and oxygen-burning regions increases dramatically, from a fraction of a meter to many kilometers. The oxygen-rich mixture between the two flames is created at a nearly constant temperature, and turbulence helps to maintain islands of well-mixed isothermal fuel as the temperature increases. The delayed burning of these regions can be supersonic and could initiate a detonation.

Woosley, S. E. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Kerstein, A. R. [Combustion Research Facility, Sandia National Laboratories, Livermore, CA 94551 (United States); Aspden, A. J., E-mail: woosley@ucolick.org, E-mail: arkerst@sandia.gov, E-mail: ajaspden@lbl.gov [Center for Computational Sciences and Engineering, Lawrence Berkeley National Laboratory, CA 94720 (United States)




SciTech Connect

The nature of carbon burning flames in Type Ia supernovae is explored as they interact with Kolmogorov turbulence. One-dimensional calculations using the Linear Eddy Model of Kerstein elucidate three regimes of turbulent burning. In the simplest case, large-scale turbulence folds and deforms thin laminar flamelets to produce a flame brush with a total burning rate given approximately by the speed of turbulent fluctuations on the integral scale, U{sub L} , This is the regime where the supernova explosion begins and where most of its pre-detonation burning occurs. As the density declines, turbulence starts to tear the individual flamelets, making broader structures that move faster. For a brief time, these turbulent flamelets are still narrow compared to their spacing and the concept of a flame brush moving with an overall speed of U{sub L} remains valid. However, the typical width of the individual flamelets, which is given by the condition that their turnover time equals their burning time, continues to increase as the density declines. Eventually, mixed regions almost as large as the integral scale itself are transiently formed. At that point, a transition to detonation can occur. The conditions for such a transition are explored numerically and it is estimated that the transition will occur for densities near 1 x 10{sup 7} g cm{sup -3}, provided the turbulent speed on the integral scale exceeds about 20% sonic. An example calculation shows the details of a detonation actually developing.

Woosley, S. E. [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States); Kerstein, A. R.; Sankaran, V. [Combustion Research Facility, Sandia National Laboratory, Livermore, CA 94551 (United States); Aspden, A. J. [Center for Computational Science and Engineering, Lawrence Berkeley National Laboratory, Berkeley, CA 94720 (United States); Roepke, F. K., E-mail: woosley@ucolick.or, E-mail: arkerst@sandia.go, E-mail: AJAspden@lbl.go, E-mail: fritz@mpa-Garching.mpg.d [Max Planck Institut fuer Astrophysik, Garching (Germany)




SciTech Connect

The explosion of a Type Ia supernova, SN2011fe, in the nearby Pinwheel galaxy (M101 at 6.4 Mpc) provides an opportunity to study pre-explosion images and search for the progenitor, which should consist of a white dwarf (WD), possibly surrounded by an accretion disk, in orbit with another star. We report on our use of deep Chandra observations and Hubble Space Telescope observations to limit the luminosity and temperature of the pre-explosion WD. It is found that if the spectrum was a blackbody, then pre-SN WDs with steady nuclear burning of the highest possible temperatures and luminosities are excluded assuming moderate n{sub H} values, but values of kT between roughly 10 eV and 60 eV are permitted even if the WD was emitting at the Eddington luminosity. This allows the progenitor to be an accreting nuclear-burning WD with an expanded photosphere 4-100 times the WD itself, or a super-critically accreting WD blowing off an optically thick strong wind, or possibly a recurrent nova with luminosities an order of magnitude lower than Eddington. The observations are also consistent with a double degenerate scenario, or a spinning down WD that has been spun up by accretion from the donor.

Liu Jifeng [National Astronomical Observatory of China, Beijing 100012 (China); Di Stefano, Rosanne; Wang Tao; Moe, Maxwell [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)



Capturing the Fire: Flame Energetics and Neutronizaton for Type Ia Supernova Simulations  

E-Print Network (OSTI)

We develop and calibrate a realistic model flame for hydrodynamical simulations of deflagrations in white dwarf (Type Ia) supernovae. Our flame model builds on the advection-diffusion-reaction model of Khokhlov and includes electron screening and Coulomb corrections to the equation of state in a self-consistent way. We calibrate this model flame--its energetics and timescales for energy release and neutronization--with self-heating reaction network calculations that include both these Coulomb effects and up-to-date weak interactions. The burned material evolves post-flame due to both weak interactions and hydrodynamic changes in density and temperature. We develop a scheme to follow the evolution, including neutronization, of the NSE state subsequent to the passage of the flame front. As a result, our model flame is suitable for deflagration simulations over a wide range of initial central densities and can track the temperature and electron fraction of the burned material through the explosion and into the expansion of the ejecta.

A. C. Calder; D. M. Townsley; I. R. Seitenzahl; F. Peng; O. E. B. Messer; N. Vladimirova; E. F. Brown; J. W. Truran; D. Q. Lamb



The Joint Efficient Dark-energy Investigation (JEDI): Measuring the cosmic expansion history from type Ia supernovae  

E-Print Network (OSTI)

JEDI (Joint Efficient Dark-energy Investigation) is a candidate implementation of the NASA-DOE Joint Dark Energy Mission (JDEM). JEDI will probe dark energy in three independent methods: (1) type Ia supernovae, (2) baryon acoustic oscillations, and (3) weak gravitational lensing. In an accompanying paper, an overall summary of the JEDI mission is given. In this paper, we present further details of the supernova component of JEDI. To derive model-independent constraints on dark energy, it is important to precisely measure the cosmic expansion history, H(z), in continuous redshift bins from z \\~ 0-2 (the redshift range in which dark energy is important). SNe Ia at z > 1 are not readily accessible from the ground because the bulk of their light has shifted into the near-infrared where the sky background is overwhelming; hence a space mission is required to probe dark energy using SNe. Because of its unique near-infrared wavelength coverage (0.8-4.2 microns), JEDI has the advantage of observing SNe Ia in the rest frame J band for the entire redshift range of 0 energy are discussed, with special emphasis on the improved precision afforded by the rest frame near-infrared data.

M. M. Phillips; Peter Garnavich; Yun Wang; David Branch; Edward Baron; Arlin Crotts; J. Craig Wheeler; Edward Cheng; Mario Hamuy; for the JEDI Team



A Measurement of the Rate of Type Ia Supernovae in Galaxy Clusters from the SDSS-II Supernova Survey  

E-Print Network (OSTI)

ABRIDGED We present measurements of the Type Ia supernova (SN) rate in galaxy clusters based on data from the Sloan Digital Sky Survey-II (SDSS-II) Supernova Survey. The cluster SN Ia rate is determined from 9 SN events in a set of 71 C4 clusters at z <0.17 and 27 SN events in 492 maxBCG clusters at 0.1 < z < 0.3$. We find values for the cluster SN Ia rate of $({0.37}^{+0.17+0.01}_{-0.12-0.01}) \\mathrm{SNu}r h^{2}$ and $({0.55}^{+0.13+0.02}_{-0.11-0.01}) \\mathrm{SNu}r h^{2}$ ($\\mathrm{SNu}x = 10^{-12} L_{x\\sun}^{-1} \\mathrm{yr}^{-1}$) in C4 and maxBCG clusters, respectively, where the quoted errors are statistical and systematic, respectively. The SN rate for early-type galaxies is found to be $({0.31}^{+0.18+0.01}_{-0.12-0.01}) \\mathrm{SNu}r h^{2}$ and $({0.49}^{+0.15+0.02}_{-0.11-0.01})$ $\\mathrm{SNu}r h^{2}$ in C4 and maxBCG clusters, respectively. The SN rate for the brightest cluster galaxies (BCG) is found to be $({2.04}^{+1.99+0.07}_{-1.11-0.04}) \\mathrm{SNu}r h^{2}$ and $({0.36}^{+0.84+0.01}_...

Dilday, Benjamin; Becker, Andrew; Bender, Ralf; Castander, Francisco; Cinabro, David; Frieman, Joshua A; Galbany, Llus; Garnavich, Peter; Goobar, Ariel; Hopp, Ulrich; Ihara, Yutaka; Jha, Saurabh W; Kessler, Richard; Lampeitl, Hubert; Marriner, John; Miquel, Ramon; Moll, Mercedes; Nichol, Robert C; Nordin, Jakob; Riess, Adam G; Sako, Masao; Schneider, Donald P; Smith, Mathew; Sollerman, Jesper; Wheeler, J Craig; stman, Linda; Bizyaev, Dmitry; Brewington, Howard; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Dan; Pan, Kaike; Simmons, Audrey; Snedden, Stephanie



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



The Rise and Fall of Type Ia Supernova Light Curves in the SDSS-II Supernova Survey  

Science Conference Proceedings (OSTI)

We analyze the rise and fall times of Type Ia supernova (SN Ia) light curves discovered by the Sloan Digital Sky Survey-II (SDSS-II) Supernova Survey. From a set of 391 light curves k-corrected to the rest-frame B and V bands, we find a smaller dispersion in the rising portion of the light curve compared to the decline. This is in qualitative agreement with computer models which predict that variations in radioactive nickel yield have less impact on the rise than on the spread of the decline rates. The differences we find in the rise and fall properties suggest that a single 'stretch' correction to the light curve phase does not properly model the range of SN Ia light curve shapes. We select a subset of 105 light curves well observed in both rise and fall portions of the light curves and develop a '2-stretch' fit algorithm which estimates the rise and fall times independently. We find the average time from explosion to B-band peak brightness is 17.38 {+-} 0.17 days, but with a spread of rise times which range from 13 days to 23 days. Our average rise time is shorter than the 19.5 days found in previous studies; this reflects both the different light curve template used and the application of the 2-stretch algorithm. The SDSS-II supernova set and the local SNe Ia with well-observed early light curves show no significant differences in their average rise-time properties. We find that slow-declining events tend to have fast rise times, but that the distribution of rise minus fall time is broad and single peaked. This distribution is in contrast to the bimodality in this parameter that was first suggested by Strovink (2007) from an analysis of a small set of local SNe Ia. We divide the SDSS-II sample in half based on the rise minus fall value, t{sub r} - t{sub f} {approx} 2 days, to search for differences in their host galaxy properties and Hubble residuals; we find no difference in host galaxy properties or Hubble residuals in our sample.

Hayden, Brian T.; /Notre Dame U.; Garnavich, Peter M.; /Notre Dame U.; Kessler, Richard; /KICP, Chicago /Chicago U., EFI; Frieman, Joshua A.; /KICP, Chicago /Chicago U. /Fermilab; Jha, Saurabh W.; /Stanford U., Phys. Dept. /Rutgers U., Piscataway; Bassett, Bruce; /Cape Town U., Dept. Math. /South African Astron. Observ.; Cinabro, David; /Wayne State U.; Dilday, Benjamin; /Rutgers U., Piscataway; Kasen, Daniel; /UC, Santa Cruz; Marriner, John; /Fermilab; Nichol, Robert C.; /Portsmouth U., ICG /Baltimore, Space Telescope Sci. /Johns Hopkins U.




Science Conference Proceedings (OSTI)

We describe the detonation mechanism composing the 'pulsationally assisted' gravitationally confined detonation (GCD) model of Type Ia supernovae. This model is analogous to the previous GCD model reported in Jordan et al.; however, the chosen initial conditions produce a substantively different detonation mechanism, resulting from a larger energy release during the deflagration phase. The resulting final kinetic energy and {sup 56}Ni yields conform better to observational values than is the case for the 'classical' GCD models. In the present class of models, the ignition of a deflagration phase leads to a rising, burning plume of ash. The ash breaks out of the surface of the white dwarf, flows laterally around the star, and converges on the collision region at the antipodal point from where it broke out. The amount of energy released during the deflagration phase is enough to cause the star to rapidly expand, so that when the ash reaches the antipodal point, the surface density is too low to initiate a detonation. Instead, as the ash flows into the collision region (while mixing with surface fuel), the star reaches its maximally expanded state and then contracts. The stellar contraction acts to increase the density of the star, including the density in the collision region. This both raises the temperature and density of the fuel-ash mixture in the collision region and ultimately leads to thermodynamic conditions that are necessary for the Zel'dovich gradient mechanism to produce a detonation. We demonstrate feasibility of this scenario with three three-dimensional (3D), full star simulations of this model using the FLASH code. We characterized the simulations by the energy released during the deflagration phase, which ranged from 38% to 78% of the white dwarf's binding energy. We show that the necessary conditions for detonation are achieved in all three of the models.

Jordan, G. C. IV; Graziani, C.; Weide, K.; Norris, J.; Hudson, R.; Lamb, D. Q. [Flash Center for Computational Science, University of Chicago, Chicago, IL 60637 (United States); Fisher, R. T. [Department of Physics, University of Massachusetts Dartmouth, 285 Old Westport Road, North Dartmouth, MA 02740 (United States); Townsley, D. M. [Department of Physics and Astronomy, University of Alabama, Tuscaloosa, AL 35487 (United States); Meakin, C. [Steward Observatory, University of Arizona, Tucson, AZ 85721 (United States); Reid, L. B. [NTEC Environmental Technology, Subiaco WA 6008 (Australia)



Three-dimensional numerical simulations of Rayleigh-Taylorunstable flames in type Ia supernovae  

SciTech Connect

Flame instabilities play a dominant role in accelerating the burning front to a large fraction of the speed of sound in a Type Ia supernova. We present a three-dimensional numerical simulation of a Rayleigh-Taylor unstable carbon flame, following its evolution through the transition to turbulence. A low Mach number hydrodynamics method is used, freeing us from the harsh time step restrictions imposed by sound waves. We fully resolve the thermal structure of the flame and its reaction zone, eliminating the need for a flame model. A single density is considered, 1.5x107 gm/cc, and half carbon/half oxygen fuel--conditions under which the flame propagated in the flamelet regime in our related two-dimensional study. We compare to a corresponding two-dimensional simulation, and show that while fire-polishing keeps the small features suppressed in two dimensions, turbulence wrinkles the flame on far smaller scales in the three-dimensional case, suggesting that the transition to the distributed burning regime occurs at higher densities in three dimensions. Detailed turbulence diagnostics are provided. We show that the turbulence follows a Kolmogorov spectrum and is highly anisotropic on the large scales, with a much larger integral scale in the direction of gravity. Furthermore, we demonstrate that it becomes more isotropic as it cascades down to small scales. Based on the turbulent statistics and the flame properties of our simulation, we compute the Gibson scale. We show the progress of the turbulent flame through a classic combustion regime diagram, indicating that the flame just enters the distributed burning regime near the end of our simulation.

Zingale, M.; Woosley, S.E.; Rendleman, C.A.; Day, M.S.; Bell, J.B.



Constraining deflagration models of Type Ia supernovae through intermediate-mass elements  

E-Print Network (OSTI)

The physical structure of a nuclear flame is a basic ingredient of the theory of Type Ia supernovae (SNIa). Assuming an exponential density reduction with several characteristic times we have followed the evolution of a planar nuclear flame in an expanding background from an initial density 6.6 10^7 g/cm3 down to 2 10^6 g/cm3. The total amount of synthesized intermediate-mass elements (IME), from silicon to calcium, was monitored during the calculation. We have made use of the computed mass fractions, X_IME, of these elements to give an estimation of the total amount of IME synthesized during the deflagration of a massive white dwarf. Using X_IME and adopting the usual hypothesis that turbulence decouples the effective burning velocity from the laminar flame speed, so that the relevant flame speed is actually the turbulent speed on the integral length-scale, we have built a simple geometrical approach to model the region where IME are thought to be produced. It turns out that a healthy production of IME involves the combination of not too short expansion times, t_c > 0.2 s, and high turbulent intensities. According to our results it could be difficult to produce much more than 0.2 solar masses of intermediate-mass elements within the deflagrative paradigma. The calculations also suggest that the mass of IME scales with the mass of Fe-peak elements, making it difficult to conciliate energetic explosions with low ejected nickel masses, as in the well observed SN1991bg or in SN1998de. Thus a large production of Si-peak elements, especially in combination with a low or a moderate production of iron, could be better addressed by either the delayed detonation route in standard Chandrasekhar-mass models or, perhaps, by the off-center helium detonation in the sub Chandrasekhar-mass scenario.

D. Garcia-Senz; E. Bravo; R. M. Cabezon; S. E. Woosley



Revealing Type Ia supernova physics with cosmic rates and nuclear gamma rays  

E-Print Network (OSTI)

Type Ia supernovae (SNIa) remain mysterious despite their central importance in cosmology and their rapidly increasing discovery rate. The progenitors of SNIa can be probed by the delay time between progenitor birth and explosion as SNIa. The explosions and progenitors of SNIa can be probed by MeV nuclear gamma rays emitted in the decays of radioactive nickel and cobalt into iron. We compare the cosmic star formation and SNIa rates, finding that their different redshift evolution requires a large fraction of SNIa to have large delay times. A delay time distribution of the form t^{-1.0 +/- 0.3} provides a good fit, implying 50% of SNIa explode more than ~ 1 Gyr after progenitor birth. The extrapolation of the cosmic SNIa rate to z = 0 agrees with the rate we deduce from catalogs of local SNIa. We investigate prospects for gamma-ray telescopes to exploit the facts that escaping gamma rays directly reveal the power source of SNIa and uniquely provide tomography of the expanding ejecta. We find large improvements relative to earlier studies by Gehrels et al. in 1987 and Timmes & Woosley in 1997 due to larger and more certain SNIa rates and advances in gamma-ray detectors. The proposed Advanced Compton Telescope, with a narrow-line sensitivity ~ 60 times better than that of current satellites, would, on an annual basis, detect up to ~ 100 SNIa (3 sigma) and provide revolutionary model discrimination for SNIa within 20 Mpc, with gamma-ray light curves measured with ~ 10 sigma significance daily for ~ 100 days. Even more modest improvements in detector sensitivity would open a new and invaluable astronomy with frequent SNIa gamma-ray detections.

Shunsaku Horiuchi; John F. Beacom



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Limits on the Time Variation of the Fermi Constant G_F Based on Type Ia Supernova Observations  

E-Print Network (OSTI)

The light curve of a type Ia supernova decays at a rate set by the beta-decay lifetimes of the Ni-56 and Co-56 produced in the explosion. This makes such a light curve sensitive to the value of the Fermi constant G_F at the time of the supernova. Using data from the CfA Supernova Archive, we measure the dependence of the light curve decay rate on redshift and place a bound on the time variation of G_F of |(dG_F/dt)/G_F| < 10^(-9) / y.

Ferrero, Alejandro



Type Ia Supernova Properties as a Function of the Distance to the Host Galaxy in the SDSS-II SN Survey  

E-Print Network (OSTI)

We use type-Ia supernovae (SNe Ia) discovered by the SDSS-II SN Survey to search for dependencies between SN Ia properties and the projected distance to the host galaxy center, using the distance as a proxy for local galaxy properties (local star-formation rate, local metallicity, etc.). The sample consists of almost 200 spectroscopically or photometrically confirmed SNe Ia at redshifts below 0.25. The sample is split into two groups depending on the morphology of the host galaxy. We fit light-curves using both MLCS2k2 and SALT2, and determine color (AV, c) and light-curve shape (delta, x1) parameters for each SN Ia, as well as its residual in the Hubble diagram. We then correlate these parameters with both the physical and the normalized distances to the center of the host galaxy and look for trends in the mean values and scatters of these parameters with increasing distance. The most significant (at the 4-sigma level) finding is that the average fitted AV from MLCS2k2 and c from SALT2 decrease with the proj...

Galbany, Lluis; Ostman, Linda; Brown, Peter J; Cinabro, David; D'Andrea, Chris B; Frieman, Joshua; Jha, Saurabh W; Marriner, John; Nichol, Robert C; Nordin, Jakob; Olmstead, Matthew D; Sako, Masao; Schneider, Donald P; Smith, Mathew; Sollerman, Jesper; Pan, Kaike; Snedden, Stephanie; Bizyaev, Dmitry; Brewington, Howard; Malanushenko, Elena; Malanushenko, Viktor; Oravetz, Dan; Simmons, Audrey; Shelden, Alaina



" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"



SciTech Connect

Type Ia supernovae (SNe Ia) originate from the thermonuclear explosions of carbon-oxygen (C-O) white dwarfs (WDs). The single-degenerate scenario is a well-explored model of SNe Ia where unstable thermonuclear burning initiates in an accreting, Chandrasekhar-mass WD and forms an advancing flame. By several proposed physical processes, the rising, burning material triggers a detonation, which subsequently consumes and unbinds the WD. However, if a detonation is not triggered and the deflagration is too weak to unbind the star, a completely different scenario unfolds. We explore the failure of the gravitationally confined detonation mechanism of SNe Ia, and demonstrate through two-dimensional and three-dimensional simulations the properties of failed-detonation SNe. We show that failed-detonation SNe expel a few 0.1 M{sub Sun} of burned and partially burned material and that a fraction of the material falls back onto the WD, polluting the remnant WD with intermediate-mass and iron-group elements that likely segregate to the core forming a WD whose core is iron rich. The remaining material is asymmetrically ejected at velocities comparable to the escape velocity from the WD, and in response, the WD is kicked to velocities of a few hundred km s{sup -1}. These kicks may unbind the binary and eject a runaway/hypervelocity WD. Although the energy and ejected mass of the failed-detonation SN are a fraction of typical thermonuclear SNe, they are likely to appear as subluminous low-velocity SNe Ia. Such failed detonations might therefore explain or are related to the observed branch of peculiar SNe Ia, such as the family of low-velocity subluminous SNe (SN 2002cx/SN 2008ha-like SNe).

Jordan, George C. IV; Van Rossum, Daniel R. [Center for Astrophysical Thermonuclear Flashes, University of Chicago, Chicago, IL 60637 (United States); Perets, Hagai B. [Physics Department, Technion, Israel Institute of Technology, Haifa 32000 (Israel); Fisher, Robert T. [Department of Physics, University of Massachusetts Dartmouth, 285 Old Westport Road, North Dartmouth, MA 02740 (United States)




Science Conference Proceedings (OSTI)

We use Type Ia supernovae (SNe Ia) discovered by the Sloan Digital Sky Survey-II SN Survey to search for dependencies between SN Ia properties and the projected distance to the host-galaxy center, using the distance as a proxy for local galaxy properties (local star formation rate, local metallicity, etc.). The sample consists of almost 200 spectroscopically or photometrically confirmed SNe Ia at redshifts below 0.25. The sample is split into two groups depending on the morphology of the host galaxy. We fit light curves using both MLCS2K2 and SALT2, and determine color (A{sub V} , c) and light-curve shape ({Delta}, x{sub 1}) parameters for each SN Ia, as well as its residual in the Hubble diagram. We then correlate these parameters with both the physical and the normalized distances to the center of the host galaxy and look for trends in the mean values and scatters of these parameters with increasing distance. The most significant (at the 4{sigma} level) finding is that the average fitted A{sub V} from MLCS2K2 and c from SALT2 decrease with the projected distance for SNe Ia in spiral galaxies. We also find indications that supernovae (SNe) in elliptical galaxies tend to have narrower light curves if they explode at larger distances, although this may be due to selection effects in our sample. We do not find strong correlations between the residuals of the distance moduli with respect to the Hubble flow and the galactocentric distances, which indicates a limited correlation between SN magnitudes after standardization and local host metallicity.

Galbany, Lluis; Miquel, Ramon; Oestman, Linda [Institut de Fisica d'Altes Energies, Universitat Autonoma de Barcelona, E-08193 Bellaterra (Barcelona) (Spain); Brown, Peter J.; Olmstead, Matthew D. [Department of Physics and Astronomy, University of Utah, Salt Lake City, UT 84112 (United States); Cinabro, David [Department of Physics and Astronomy, Wayne State University, Detroit, MI 48201 (United States); D'Andrea, Chris B.; Nichol, Robert C. [Institute of Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Burnaby Road, Portsmouth PO1 3FX (United Kingdom); Frieman, Joshua [Kavli Institute for Cosmological Physics, University of Chicago, 5640 South Ellise Avenue, Chicago, IL 60637 (United States); Jha, Saurabh W. [Department of Physics and Astronomy, Rutgers the State University of New Jersey, 136 Frelinghuysen Road, Piscataway, NJ 08854 (United States); Marriner, John [Center for Astrophysics, Fermi National Accelerator Laboratory, P.O. Box 500, Batavia, IL 60510 (United States); Nordin, Jakob [E.O. Lawrence Berkeley National Lab, 1 Cyclotron Rd., Berkeley, CA 94720 (United States); Sako, Masao [Department of Physics and Astronomy, University of Pennsylvania, 209 South 33rd Street, Philadelphia, PA 19104 (United States); Schneider, Donald P. [Department of Astronomy and Astrophysics, The Pennsylvania State University, University Park, PA 16802 (United States); Smith, Mathew [Department of Physics, University of Western Cape, Bellville 7535, Cape Town (South Africa); Sollerman, Jesper [Oskar Klein Centre, Department of Astronomy, AlbaNova, SE-106 91 Stockholm (Sweden); Pan, Kaike; Snedden, Stephanie; Bizyaev, Dmitry; Brewington, Howard, E-mail: lluis.galbany@ist.utl.pt [Apache Point Observatory, P.O. Box 59, Sunspot, NM 88349 (United States); and others


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



A Measurement of the Rate of type-Ia Supernovae at Redshift $z\\approx$ 0.1 from the First Season of the SDSS-II Supernova Survey  

E-Print Network (OSTI)

We present a measurement of the rate of type Ia supernovae (SNe Ia) from the first of three seasons of data from the SDSS-II Supernova Survey. For this measurement, we include 17 SNe Ia at redshift $z\\le0.12$. Assuming a flat cosmology with $\\Omega_m = 0.3=1-\\Omega_\\Lambda$, we find a volumetric SN Ia rate of $[2.93^{+0.17}_{-0.04}({\\rm systematic})^{+0.90}_{-0.71}({\\rm statistical})] \\times 10^{-5} {\\rm SNe} {\\rm Mpc}^{-3} h_{70}^3 {\\rm year}^{-1}$, at a volume-weighted mean redshift of 0.09. This result is consistent with previous measurements of the SN Ia rate in a similar redshift range. The systematic errors are well controlled, resulting in the most precise measurement of the SN Ia rate in this redshift range. We use a maximum likelihood method to fit SN rate models to the SDSS-II Supernova Survey data in combination with other rate measurements, thereby constraining models for the redshift-evolution of the SN Ia rate. Fitting the combined data to a simple power-law evolution of the volumetric SN Ia rat...

Dilday, Benjamin; Frieman, J A; Holtzman, J; Marriner, J; Miknaitis, G; Nichol, R C; Romani, R; Sako, M; Bassett, B; Becker, A; Cinabro, D; De Jongh, F; Depoy, D L; Doi, M; Garnavich, P M; Hogan, C J; Jha, S; Konishi, K; Lampeitl, H; Marshall, J L; McGinnis, D; Prieto, J L; Riess, A G; Richmond, M W; Schneider, D P; Smith, M; Takanashi, N; Tokita, K; van der Heyden, K; Zheng, N Yasuda C; Barentine, J; Brewington, H; Choi, C; Crotts, A; Dembicky, J; Harvanek, M; Im, M; Ketzeback, W; Kleinman, S J; Krzesi?ski, J; Long, D C; Malanushenko, E; Malanushenko, V; McMillan, R J; Nitta, A; Pan, K; Saurage, G; Snedden, S A; Watters, S; Wheeler, J C; York, D



Making the Standard Candle: A study of how the progenitor white dwarf modulates the peak luminosity of type Ia supernovae  

SciTech Connect

The goals of the proposed research as stated in the proposal were to: Build a suite of one-dimensional initial models of different metallicities and central densities. Using the improved flame capturing scheme, simulate the explosion of a white dwarf with embedded Lagrangian tracer particles, and post-process the thermal histories of the tracers to reconstruct the nucleosynthesis of the explosion. Survey the effects of a changing progenitor metallicity on the isotopic yields. Of particular interest is 1) whether the linear relation between the mass of 56Ni synthesized and the pro- genitor metallicity is moderated by the effect of electron captures in the core; and 2) how a varying central density alters the relation between metallicity and 56Ni mass. Using these results, examine how the observed metallicity distribution would affect the brightness distribution of SNe Ia and the isotopic ratios about the Fe-peak.

Brown, Edward F [Michigan State University



Determining the motion of the solar system relative to the cosmic microwave background using type Ia supernovae  

E-Print Network (OSTI)

We estimate the solar system motion relative to the cosmic microwave background using type Ia supernovae (SNe) measurements. We take into account the correlations in the error bars of the SNe measurements arising from correlated peculiar velocities. Without accounting for correlations in the peculiar velocities, the SNe data we use appear to detect the peculiar velocity of the solar system at about the 3.5 sigma level. However, when the correlations are correctly accounted for, the SNe data only detects the solar system peculiar velocity at about the 2.5 sigma level. We forecast that the solar system peculiar velocity will be detected at the 9 sigma level by GAIA and the 11 sigma level by the LSST. For these surveys we find the correlations are much less important as most of the signal comes from higher redshifts where the number density of SNe is insufficient for the correlations to be important.

Christopher Gordon; Kate Land; Anze Slosar



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A




Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


A localised subgrid scale model for fluid dynamical simulations in astrophysics II: Application to type Ia supernovae  

E-Print Network (OSTI)

The dynamics of the explosive burning process is highly sensitive to the flame speed model in numerical simulations of type Ia supernovae. Based upon the hypothesis that the effective flame speed is determined by the unresolved turbulent velocity fluctuations, we employ a new subgrid scale model which includes a localised treatment of the energy transfer through the turbulence cascade in combination with semi-statistical closures for the dissipation and non-local transport of turbulence energy. In addition, subgrid scale buoyancy effects are included. In the limit of negligible energy transfer and transport, the dynamical model reduces to the Sharp-Wheeler relation. According to our findings, the Sharp-Wheeler relation is insuffcient to account for the complicated turbulent dynamics of flames in thermonuclear supernovae. The application of a co-moving grid technique enables us to achieve very high spatial resolution in the burning region. Turbulence is produced mostly at the flame surface and in the interior ash regions. Consequently, there is a pronounced anisotropy in the vicinity of the flame fronts. The localised subgrid scale model predicts significantly enhanced energy generation and less unburnt carbon and oxygen at low velocities compared to earlier simulations.

W. Schmidt; J. C. Niemeyer; W. Hillebrandt; F. K. Roepke



Early and late time VLT spectroscopy of SN 2001el - progenitor constraints for a type Ia supernova  

E-Print Network (OSTI)

We present early time high-resolution (VLT/UVES) and late time low-resolution (VLT/FORS) optical spectra of the normal type Ia supernova, SN 2001el. The high-resolution spectra were obtained 9 and 2 days before (B-band) maximum light in order to detect narrow hydrogen and/or helium emission lines from the SN CSM. No such lines were detected in our data. We therefore use photoionisation models to derive upper limits of 1x10^-5 and 6x10^-5 Msol/yr, assuming wind velocities of 10 and 50 km/s, respectively, for the mass loss rate from the progenitor system of SN 2001el. This excludes a symbiotic star in the upper mass loss rate regime from being the progenitor of SN 2001el. The low-resolution spectrum was obtained in the nebular phase of the supernova, \\~400 days after the maximum light, to search for any hydrogen rich gas originating from the SN progenitor system. However, we see no signs of Balmer lines in our spectrum. Therefore, we model the late time spectra to derive an upper limit of ~0.03 Msol for solar a...

Mattila, S; Sollerman, J; Kozma, C; Baron, E; Fransson, C; Leibundgut, B; Nomoto, K



U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Microsoft Word - Gage-KS.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Intercomparisons of Cloud Observations Intercomparisons of Cloud Observations from the AL S-band Profiler and the ETL K-band Millimeter-Wave Cloud Radar on the R/V Ronald H. Brown during Nauru99 K. S. Gage and D. A. Carter National Oceanic and Atmospheric Administration Aeronomy Laboratory Boulder, Colorado P. E. Johnston and C. R. Williams Cooperative Institute for Research in Environmental Sciences University of Colorado Boulder, Colorado M. Ryan Science Technology Corporation Boulder, Colorado D. Hazen and B. W. Orr National Oceanic and Atmospheric Administration Environmental Technology Laboratory Boulder, Colorado Introduction Nauru99 took place in the western and central Pacific during June and July 1999. During Nauru99, a diverse suite of instruments was located on the research vessel (R/V) Ronald H. Brown to measure cloud



SciTech Connect

We report the detection in Ks-band of the secondary eclipse of the hot Jupiter CoRoT-1b from time series photometry with the ARC 3.5 m telescope at Apache Point Observatory. The eclipse shows a depth of 0.336 +- 0.042% and is centered at phase 0.5022{sup +0.0023}{sub -0.0027}, consistent with a zero eccentricity orbit (e cos omega = 0.0035{sup +0.0036}{sub -0.0042}). We perform the first optical to near-infrared multi-band photometric analysis of an exoplanet's atmosphere and constrain the reflected and thermal emissions by combining our result with the recent 0.6, 0.71, and 2.09 mum secondary eclipse detections by Snellen et al., Gillon et al., and Alonso et al. Comparing the multi-wavelength detections to state-of-the-art radiative-convective chemical-equilibrium atmosphere models, we find the near-infrared fluxes difficult to reproduce. The closest blackbody-based and physical models provide the following atmosphere parameters: a temperature T = 2460{sup +80}{sub -160} K; a very low Bond albedo A{sub B} = 0.000{sup +0.081}{sub -0.000}; and an energy redistribution parameter P{sub n} = 0.1, indicating a small but nonzero amount of heat transfer from the day to nightside. The best physical model suggests a thermal inversion layer with an extra optical absorber of opacity kappa{sub e} = 0.05 cm{sup 2} g{sup -1}, placed near the 0.1 bar atmospheric pressure level. This inversion layer is located 10 times deeper in the atmosphere than the absorbers used in models to fit mid-infrared Spitzer detections of other irradiated hot Jupiters.

Rogers, Justin C. [Department of Physics and Astronomy, Johns Hopkins University, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Apai, Daniel [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Lopez-Morales, Mercedes [Department of Terrestrial Magnetism, Carnegie Institution of Washngton, 5241 Broad Branch Rd. NW, Washington, DC 20015 (United States); Sing, David K. [UPMC Univ Paris 06, CNRS, Institut d'Astrophysique de Paris, 98bis boulevard Arago, F-75014 Paris (France); Burrows, Adam, E-mail: rogers@pha.jhu.ed [Department of Astrophysical Sciences, Princeton University, Peyton Hall, Princeton, NJ 08544 (United States)


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab




Science Conference Proceedings (OSTI)

The nature of the progenitor systems of Type Ia supernovae is still uncertain. One way to distinguish between the single-degenerate scenario and double-degenerate scenario is to search for the post-impact remnant star. To examine the characteristics of the post-impact remnant star, we have carried out three-dimensional hydrodynamic simulations of supernova impacts on main-sequence-like stars. We explore the evolution of the post-impact remnants using the stellar evolution code MESA. We find that the luminosity and radius of the remnant star dramatically increase just after the impact. After the explosion, post-impact companions continue to expand on a progenitor-dependent timescale of {approx}10{sup 2.5}-10{sup 3} years before contracting. It is found that the time evolution of the remnant star is dependent not only on the amount of energy absorbed but also on the depth of the energy deposition. We examine the viability of the candidate star Tycho G as the possible remnant companion in Tycho's supernova by comparing it to the evolved post-impact remnant stars in our simulations. The closest model in our simulations has a similar effective temperature, but the luminosity and radius are twice as large. By examining the angular momentum distribution in our simulations, we find that the surface rotational speed could drop to {approx}10 km s{sup -1} if the specific angular momentum is conserved during the post-impact evolution, implying that Tycho G cannot be completely ruled out because of its low surface rotation speed.

Pan, Kuo-Chuan; Ricker, Paul M. [Department of Astronomy, University of Illinois at Urbana-Champaign, 1002 West Green Street, Urbana, IL 61801 (United States); Taam, Ronald E., E-mail: kpan2@illinois.edu, E-mail: pmricker@illinois.edu, E-mail: taam@northwestern.edu [Department of Physics and Astronomy, Northwestern University, 2145 Sheridan Road, Evanston, IL 60208 (United States)




NLE Websites -- All DOE Office Websites (Extended Search)

(3D) Radiation Codes (Cahalan 2000). In the present work, the broadband fluxes of solar radiation are calculated using two different approaches. The purpose is * to compare...


Neutron Diffraction Residual Strain Tensor Measurements Within The Phase IA Weld Mock-up Plate P-5  

SciTech Connect

Oak Ridge National Laboratory (ORNL) has worked with NRC and EPRI to apply neutron and X-ray diffraction methods to characterize the residual stresses in a number of dissimilar metal weld mockups and samples. The design of the Phase IA specimens aimed to enable stress measurements by several methods and computational modeling of the weld residual stresses. The partial groove in the 304L stainless steel plate was filled with weld beads of Alloy 82. A summary of the weld conditions for each plate is provided in Table 1. The plates were constrained along the long edges during and after welding by bolts with spring-loaded washers attached to the 1-inch thick Al backing plate. The purpose was to avoid stress relief due to bending of the welded stainless steel plate. The neutron diffraction method was one of the methods selected by EPRI for non-destructive through thickness strain and stress measurement. Four different plates (P-3 to P-6) were studied by neutron diffraction strain mapping, representing four different welding conditions. Through thickness neutron diffraction strain mappings at NRSF2 for the four plates and associated strain-free d-zero specimens involved measurement along seven lines across the weld and at six to seven depths. The mountings of each plate for neutron diffraction measurements were such that the diffraction vector was parallel to each of the three primary orthogonal directions of the plate: two in-plane directions, longitudinal and transverse, and the direction normal to the plate (shown in left figure within Table 1). From the three orthogonal strains for each location, the residual stresses along the three plate directions were calculated. The principal axes of the strain and stress tensors, however, need not necessarily align with the plate coordinate system. To explore this, plate P-5 was selected for examination of the possibility that the principal axes of strain are not along the sample coordinate system axes. If adequate data could be collected the goal would be to determine the strain tensor's orientation and magnitude of strain along each principle axis direction.

Hubbard, Camden R [ORNL



Early and late time VLT spectroscopy of SN 2001el - progenitor constraints for a type Ia supernova  

E-Print Network (OSTI)

We present early time high-resolution (VLT/UVES) and late time low-resolution (VLT/FORS) optical spectra of the normal type Ia supernova, SN 2001el. The high-resolution spectra were obtained at -9 and -2 days to allow the detection of narrow hydrogen and/or helium emission lines from the circumstellar medium of the SN. No such lines were detected, and we therefore use photoionisation models to derive upper limits of 9x10^-6 Msun/yr and 5x10^-5 Msun/yr for the mass loss rate from the progenitor system assuming velocities of 10 km/s and 50 km/s, respectively, for a wind extending to outside at least a few x 10^15 cm away from the SN explosion site. These limits exclude a symbiotic star in the upper mass loss rate regime from being the progenitor of SN 2001el. The low resolution spectrum was obtained in the nebular phase of the SN, 400 days after the maximum light, to search for any hydrogen rich gas originating from the SN progenitor system. However, we see no signs of Balmer lines in our spectrum. Therefore, we model the late time spectra to derive an upper limit of ~0.03 Msun for solar abundance material present at velocities lower than 1000 km/s within the SN explosion site. According to simulations of Marietta et al. (2000) this is less than the expected mass lost by a subgiant, red giant or main sequence secondary star at a small binary separation as a result of the SN explosion. Finally, we discuss the origin of high velocity Ca II lines. We see both the CaII IR triplet and the H&K lines in the -9 days spectrum at a very high velocity of up to 34000 km/s. The spectrum also shows a flat-bottomed Si II `6150 A' feature similar to the one previously observed in SN 1990N at -14 days. We compare these spectral features to those observed in SNe 1984A and 1990N at even higher velocities.

S. Mattila; P. Lundqvist; J. Sollerman; C. Kozma; E. Baron; C. Fransson; B. Leibundgut; K. Nomoto



A Measurement of the Rate of type-Ia Supernovae at Redshift $z\\approx$ 0.1 from the First Season of the SDSS-II Supernova Survey  

E-Print Network (OSTI)

We present a measurement of the rate of type Ia supernovae (SNe Ia) from the first of three seasons of data from the SDSS-II Supernova Survey. For this measurement, we include 17 SNe Ia at redshift $z\\le0.12$. Assuming a flat cosmology with $\\Omega_m = 0.3=1-\\Omega_\\Lambda$, we find a volumetric SN Ia rate of $[2.93^{+0.17}_{-0.04}({\\rm systematic})^{+0.90}_{-0.71}({\\rm statistical})] \\times 10^{-5} {\\rm SNe} {\\rm Mpc}^{-3} h_{70}^3 {\\rm year}^{-1}$, at a volume-weighted mean redshift of 0.09. This result is consistent with previous measurements of the SN Ia rate in a similar redshift range. The systematic errors are well controlled, resulting in the most precise measurement of the SN Ia rate in this redshift range. We use a maximum likelihood method to fit SN rate models to the SDSS-II Supernova Survey data in combination with other rate measurements, thereby constraining models for the redshift-evolution of the SN Ia rate. Fitting the combined data to a simple power-law evolution of the volumetric SN Ia rate, $r_V \\propto (1+z)^{\\beta}$, we obtain a value of $\\beta = 1.5 \\pm 0.6$, i.e. the SN Ia rate is determined to be an increasing function of redshift at the $\\sim 2.5 \\sigma$ level. Fitting the results to a model in which the volumetric SN rate, $r_V=A\\rho(t)+B\\dot \\rho(t)$, where $\\rho(t)$ is the stellar mass density and $\\dot \\rho(t)$ is the star formation rate, we find $A = (2.8 \\pm 1.2) \\times 10^{-14} \\mathrm{SNe} \\mathrm{M}_{\\sun}^{-1} \\mathrm{year}^{-1}$, $B = (9.3^{+3.4}_{-3.1})\\times 10^{-4} \\mathrm{SNe} \\mathrm{M}_{\\sun}^{-1}$.

Benjamin Dilday; R. Kessler; J. A. Frieman; J. Holtzman; J. Marriner; G. Miknaitis; R. C. Nichol; R. Romani; M. Sako; B. Bassett; A. Becker; D. Cinabro; F. DeJongh; D. L. Depoy; M. Doi; P. M. Garnavich; C. J. Hogan; S. Jha; K. Konishi; H. Lampeitl; J. L. Marshall; D. McGinnis; J. L. Prieto; A. G. Riess; M. W. Richmond; D. P. Schneider; M. Smith; N. Takanashi; K. Tokita; K. van der Heyden; N. Yasuda; C. Zheng; J. Barentine; H. Brewington; C. Choi; A. Crotts; J. Dembicky; M. Harvanek; M. Im; W. Ketzeback; S. J. Kleinman; J. Krzesi?ski; D. C. Long; E. Malanushenko; V. Malanushenko; R. J. McMillan; A. Nitta; K. Pan; G. Saurage; S. A. Snedden; S. Watters; J. C. Wheeler; D. York



fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Search for the decay B^+ \\to K_S^0 K_S^0 \\pi ^+  

SciTech Connect

The authors search for charmless decays of charged B mesons to the three-body final state K{sub S}{sup 0}K{sub S}{sup 0}{pi}{sup +}. Using a data sample of 423.7 fb{sup -1} collected at the {Upsilon}(4S) resonance with the BABAR detector, corresponding to (465.1 {+-} 5.1) x 10{sup 6} B{bar B} pairs, they find no significant signal and determine a 90% confidence level upper limit on the branching fraction of 5.1 x 10{sup -7}.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison




SciTech Connect

The light from a shock breakout of stellar explosions, which carries a wealth of information, strongly depends on the shock velocity at the time of the breakout. The emission from Newtonian breakouts, typical in regular core-collapse supernovae (SNe), has been explored extensively. However, a large variety of explosions result in mildly or ultrarelativistic breakouts, where the observed signature is unknown. Here we calculate the luminosity and spectrum produced by relativistic breakouts. In order to do so, we improve the analytic description of relativistic radiation-mediated shocks and follow the system from the breakout itself, through the planar phase and into the spherical phase. We limit our calculation to cases where the post-breakout acceleration of the gas ends during the planar phase (i.e., the final gas Lorentz factor {approx}< 30). We find that spherical relativistic breakouts produce a flash of gamma rays with energy, E{sub bo}, temperature, T{sub bo}, and duration, t{sup obs} b{sub o}, that provide the breakout radius ( Almost-Equal-To 5 R{sub Sun }(t{sup obs}{sub bo}/10 s)(T{sub bo}/50 keV){sup 2}) and the Lorentz factor ( Almost-Equal-To T{sub bo}/50 keV). They also always satisfy a relativistic breakout relation (t{sup obs}{sub bo}/20 s) {approx} (E{sub bo}/10{sup 46} erg){sup 1/2}(T{sub bo}/50 keV){sup -2.68}. The breakout flare is typically followed, on longer timescales, by X-rays that carry a comparable energy. We apply our model to a variety of explosions, including Type Ia and .Ia SNe, accretion-induced collapse, energetic SNe, and gamma-ray bursts (GRBs). We find that all these events produce detectable gamma-ray signals, some of which may have already been seen. Some particular examples are: (1) relativistic shock breakouts provide a natural explanation to the energy, temperature, and timescales of low-luminosity GRBs. Indeed, all observed low-luminosity GRBs satisfy the relativistic breakout relation. (2) Nearby broad-line Type Ib/c (like SN 2002ap) may produce a detectable {gamma}-ray signal. (3) Galactic Type Ia SNe may produce detectable {gamma}-ray flares. We conclude that relativistic shock breakouts provide a generic process for the production of gamma-ray flares.

Nakar, Ehud [Raymond and Beverly Sackler School of Physics and Astronomy, Tel Aviv University, Tel Aviv 69978 (Israel); Sari, Re'em [Racah Institute for Physics, Hebrew University, Jerusalem 91904 (Israel)



Solar Wind: Manifestations of Solar Activity E N CYC LO PE D IA O F AS T R O N O MY AN D AS T R O PHYS I C S Solar Wind: Manifestations of Solar  

E-Print Network (OSTI)

Solar Wind: Manifestations of Solar Activity E N CYC LO PE D IA O F AS T R O N O MY AN D AS T R O PHYS I C S Solar Wind: Manifestations of Solar Activity The Sun's outer atmosphere, the corona, is continually heated and expands to create the solar wind. Solar activity waxes and wanes with the 11 yr cycle

Webb, David F.


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6


Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Multi-Megawatt Organic Rankine Engine power plant (MORE). Phase IA final report: system design of MORE power plant for industrial energy conservation emphasizing the cement industry  

SciTech Connect

The Multi-Megawatt Organic Rankine Engine (MORE) program is directed towards the development of a large, organic Rankine power plant for energy conservation from moderate temperature industrial heat streams. Organic Rankine power plants are ideally suited for use with heat sources in the temperature range below 1100/sup 0/F. Cement manufacture was selected as the prototype industry for the MORE system because of the range of parameters which can be tested in a cement application. This includes process exit temperatures of 650/sup 0/F to 1110/sup 0/F for suspension preheater and long dry kilns, severe dust loading, multi-megawatt power generation potential, and boiler exhaust gas acid dew point variations. The work performed during the Phase IA System Design contract period is described. The System Design task defines the complete MORE system and its installation to the level necessary to obtain detailed performance maps, equipment specifications, planning of supporting experiments, and credible construction and hardware cost estimates. The MORE power plant design is based upon installation in the Black Mountain Quarry Cement Plant near Victorville, California.

Bair, E.K.; Breindel, B.; Collamore, F.N.; Hodgson, J.N.; Olson, G.K.



Universidad Collaboration  

E-Print Network (OSTI)

of Iowa, Iowa City, IA 52242, U.S.A. L.J. Dauwe University of Michigan­Flint, Flint, MI 48502, U.S.A. M

Fermi National Accelerator Laboratory


Doubly-charmed Discovered?  

E-Print Network (OSTI)

City , IA 52242, U.S.A. L.J. Dauwe University of Michigan-Flint, Flint, MI 48502, U.S.A. M. Gaspero, M

Fermi National Accelerator Laboratory


arXiv:0902.0355v1[hep-ex]2Feb2009 UASLPIF09001  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, U.S.A. nUniversity of Michigan-Flint, Flint, MI 48502, U.S.A. o

Akgun, Ugur


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect

Type Ia supernovae (SNe Ia) play a crucial role as standardizable cosmological candles, though the nature of their progenitors is a subject of active investigation. Recent observational and theoretical work has pointed to merging white dwarf binaries, referred to as the double-degenerate channel, as the possible progenitor systems for some SNe Ia. Additionally, recent theoretical work suggests that mergers which fail to detonate may produce magnetized, rapidly rotating white dwarfs. In this paper, we present the first multidimensional simulations of the post-merger evolution of white dwarf binaries to include the effect of the magnetic field. In these systems, the two white dwarfs complete a final merger on a dynamical timescale, and are tidally disrupted, producing a rapidly rotating white dwarf merger surrounded by a hot corona and a thick, differentially rotating disk. The disk is strongly susceptible to the magnetorotational instability (MRI), and we demonstrate that this leads to the rapid growth of an initially dynamically weak magnetic field in the disk, the spin-down of the white dwarf merger, and to the subsequent central ignition of the white dwarf merger. Additionally, these magnetized models exhibit new features not present in prior hydrodynamic studies of white dwarf mergers, including the development of MRI turbulence in the hot disk, magnetized outflows carrying a significant fraction of the disk mass, and the magnetization of the white dwarf merger to field strengths {approx}2 Multiplication-Sign 10{sup 8} G. We discuss the impact of our findings on the origins, circumstellar media, and observed properties of SNe Ia and magnetized white dwarfs.

Ji Suoqing; Fisher, Robert T. [University of Massachusetts Dartmouth, Department of Physics, 285 Old Westport Road, North Dartmouth, MA 02740 (United States); Garcia-Berro, Enrique [Departament de Fisica Aplicada, Universitat Politecnica de Catalunya, c/Esteve Terrades, 5, E-08860 Castelldefels (Spain); Tzeferacos, Petros; Jordan, George; Lee, Dongwook [Center for Astrophysical Thermonuclear Flashes, The University of Chicago, Chicago, IL 60637 (United States); Loren-Aguilar, Pablo [School of Physics, University of Exeter, Stocker Road, Exeter EX4 4QL (United Kingdom); Cremer, Pascal [Bethe Center for Theoretical Physics, Universitaet Bonn, Nussallee 12, D-53115 Bonn (Germany); Behrends, Jan [Fachbereich Physik, Freie Universitaet Berlin, Arnimallee 14, D-14195 Berlin (Germany)



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.




NLE Websites -- All DOE Office Websites (Extended Search)

ISDataTechnologySpecificUnitedStatesWindHighResolutionIowaWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of Iowa at...


Consolidative Involved-Node Proton Therapy for Stage IA-IIIB Mediastinal Hodgkin Lymphoma: Preliminary Dosimetric Outcomes From a Phase II Study  

SciTech Connect

Purpose: To compare the dose reduction to organs at risk (OARs) with proton therapy (PT) versus three-dimensional conformal radiotherapy (3D-CRT) and intensity-modulated radiotherapy (IMRT) in patients with mediastinal Hodgkin lymphoma (HL) enrolled on a Phase II study of involved-node radiotherapy (INRT). Methods and Materials: Between June 2009 and October 2010, 10 patients were enrolled on a University of Florida institutional review board-approved protocol for de novo 'classical' Stage IA-IIIB HL with mediastinal (bulky or nonbulky) involvement after chemotherapy. INRT was planned per European Organization for Research and Treatment of Cancer guidelines. Three separate optimized plans were developed for each patient: 3D-CRT, IMRT, and PT. The primary end point was a 50% reduction in the body V4 with PT compared with 3D-CRT or IMRT. Results: The median relative reduction with PT in the primary end point, body V4, was 51% compared with 3D-CRT (p = 0.0098) and 59% compared with IMRT (p = 0.0020), thus all patients were offered treatment with PT. PT provided the lowest mean dose to the heart, lungs, and breasts for all 10 patients compared with either 3D-CRT or IMRT. The median difference in the OAR mean dose reduction with PT compared with 3D-CRT were 10.4 Gy/CGE for heart; 5.5 Gy/CGE for lung; 0.9 Gy/CGE for breast; 8.3 Gy/CGE for esophagus; and 4.1 Gy/CGE for thyroid. The median differences for mean OAR dose reduction for PT compared with IMRT were 4.3 Gy/CGE for heart, 3.1 Gy/CGE for lung, 1.4 Gy/CGE for breast, 2.8 Gy/CGE for esophagus, and 2.7 Gy/CGE for thyroid. Conclusions: All 10 patients benefitted from dose reductions to OARs with PT compared with either 3D-CRT or IMRT. It is anticipated that these reductions in dose to OAR will translate into lower rates of late complications, but long-term follow-up on this Phase II INRT study is needed.

Hoppe, Bradford S., E-mail: bhoppe@floridaproton.org [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Flampouri, Stella; Su Zhong; Morris, Christopher G. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Latif, Naeem [University of Florida Hematology/Oncology, Jacksonville, FL (United States); Dang, Nam H.; Lynch, James [University of Florida Hematology/Oncology, Gainesville, FL (United States); Li Zuofeng; Mendenhall, Nancy P. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States)



Orion Mark Graf University of Kansas, Lawrence, KS 2010-Present  

E-Print Network (OSTI)

Distributions, Origins, and their Association with Y-chromosome Markers in the Aleutian Archipelago Advisor) "Surname Distributions and their Association with Y-chromosome Markers in the Aleutian Islands" Human in the Aleutian Archipelago: Evidence from Y- chromosome markers and historical accounts" Poster presentation

Peterson, Blake R.


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana


"Report Date","U.S.",,,"PADD I",,,"PADD IA",,,"PADD IB",,,"PADD IC",,,"PADD II"  

U.S. Energy Information Administration (EIA) Indexed Site

Residential Heating Oil Prices (Before and After Change in Aggregation Methodology)" Residential Heating Oil Prices (Before and After Change in Aggregation Methodology)" "Report Date","U.S.",,,"PADD I",,,"PADD IA",,,"PADD IB",,,"PADD IC",,,"PADD II" ,"Old Reported Value ($ per Gallon)","New Revised Value ($ per Gallon)","Difference","Old Reported Value ($ per Gallon)","New Revised Value ($ per Gallon)","Difference","Old Reported Value ($ per Gallon)","New Revised Value ($ per Gallon)","Difference","Old Reported Value ($ per Gallon)","New Revised Value ($ per Gallon)","Difference","Old Reported Value ($ per Gallon)","New Revised Value ($ per Gallon)","Difference","Old Reported Value ($ per Gallon)","New Revised Value ($ per Gallon)","Difference"


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Abstract for David Chamulak  

NLE Websites -- All DOE Office Websites (Extended Search)

Michigan State University, East Lansing, MI Michigan State University, East Lansing, MI The Effect of Ne-22 on the Thermonuclear Processes in White Dwarf Supernovae Type Ia supernovae (SNe Ia) are among the most luminous events in the universe. A single SN Ia at maximum light is as bright as its host galaxy. This property along with the ability to calibrate their light curves has made SNe Ia the premier standard candle for measuring cosmological distances. SNe Ia have recently been found to fall into two populations, a "prompt", and a "tardy" type. The "prompt" type supernovae have been observed to be on average brighter then their "tardy" relatives. It is currently unknown what causes the dispersion in the brightness of SNe Ia, but one idea could be the composition of the progenitor star. Ne-22 is the


Rates and progenitors of type Ia supernovae  

E-Print Network (OSTI)

Propulsion Laboratory, operated under contract NAS7-030001 with the National Aeronautics and SpacePropulsion Laboratory, California Institute of Technology, under contract with the National Aeronautics and Space

Wood-Vasey, William Michael



Visualizing Type Ia Supernova Explosions at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

Childs1a-Supernovasm.png Deep inside a dying star in a galaxy far, far away, a carbon fusion flame ignites. Ignition may happen in the middle or displaced slightly to one side,...

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Distributed Flames in Type Ia Supernovae  

E-Print Network (OSTI)

In the distributed burning regime, turbulence disrupts the internal structure of the flame, and so the idea of laminar burning propagated by conduction is no longer valid. The nature of the burning depends on the turbulent Damkohler number (Da), which steadily declines from much greater than one to less that one as the density decreases to a few 10^6 g/cc. Scaling arguments predict that the turbulent flame speed s, normalized by the turbulent intensity u, follows s/u=Da^1/2 for Da1, and that localized excursions to as much as five times u can occur. The lambda-flame speed and width can be predicted based on the turbulence in the star and the turbulent nuclear burning time scale of the fuel. We propose a practical method for measuring these based on the scaling relations and small-scale computationally-inexpensive simulations. This suggests that a simple turbulent flame model can be easily constructed suitable for large-scale distributed supernovae flames.

Aspden, A J; Woosley, S E; 10.1088/0004-637X/710/2/1654



Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...


1 | EqIA Summary| Diversity Team| 08/12/08 EqIA Summary  

E-Print Network (OSTI)

) Summary of Impact There are no direct or significant adverse impacts on Race, Gender, Disability, Sexual, in particular benefits relating to age as there will be a strong focus on bio energy, which will support fuel


Tatyana V. Wilds, Most Pure Heart of Mary School, Topeka, KS  

E-Print Network (OSTI)

in San Francisco Stalin, Churchill/Attlee meet in Potsdam US drops Atomic Bomb on Hiroshima and Nagasaki) Churchill's "Iron Curtain" speech in Fulton, Missouri 1949 Soviets detonate their first Atomic Bomb in the Cold War. For example, what if Truman had not fired General Macarthur and he had decided to drop bombs

Peterson, Blake R.


# workstation-ks.cfg # version 1.0.0 2011-09-30 # Copyright ...  

Science Conference Proceedings (OSTI)

... 9 (Rows 2 - 6) volgroup vgroup1 pv.01 logvol ... row 134) -sysklogd rsyslog # Post-install commands # Some post-installation configuration can ...



KS-REPORT(7-24-87} The Eigenvalue Problem for an N-Sector Ring  

E-Print Network (OSTI)

\\.., -.. ·~.t~ -..-7. -..-.. ~ -,.. -')It · · ... ,.- J ·· ··· 5 ·· ··· :-O' ··· ··· leee -7. 10 · ttl L(H · ,01

Kemner, Ken


Search for Lepton Flavour Violating Decays tau- to l- Ks with the BaBar experiment  

SciTech Connect

A search for the lepton flavor violating decays {tau}{sup -} {yields} l{sup -} K{sub S}{sup 0} (l = e or {mu}) has been performed using a data sample corresponding to an integrated luminosity of 469 fb{sup -1}, collected with the BABAR detector at the SLAC PEP-II e{sup +}e{sup -} asymmetric energy collider. No statistically significant signal has been observed in either channel and the estimated upper limits on branching fractions are {Beta}({tau}{sup -} {yields} e{sup -} K{sub S}{sup 0}) < 3.3 x 10{sup -8} and {Beta}({tau}{sup -} {yields} {mu}{sup -}K{sub S}{sup 0}) < 4.0 x 10{sup -8} at 90% confidence level.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Measurement of Time-Dependent CP Asymmetry in B0 --> KS pi0 gamma Decays  

SciTech Connect

The authors measure the time-dependent CP asymmetry in B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} decays for two regions of K{sub S}{sup 0}-{pi}{sup 0} invariant mass, m(K{sub S}{sup 0}{pi}{sup 0}), using the final BABAR data set of 467 x 10{sup 6} B{bar B} pairs collected at the PEP-II e{sup +}e{sup -} collider at SLAC. They find 339 {+-} 24 B{sup 0} {yields} K*{sup 0}{gamma} candidates and measure S{sub K*{gamma}} = -0.03 {+-} 0.29 {+-} 0.03 and C{sub K*{gamma}} = -0.14 {+-} 0.16 {+-} 0.03. In the range 1.1 < m(K{sub S}{sup 0}{pi}{sup 0}) < 1.8 GeV/c{sup 2} they find 133 {+-} 20 B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} candidates and measure S{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.78 {+-} 0.59 {+-} 0.09 and C{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.36 {+-} 0.33 {+-} 0.04. The uncertainties are statistical and systematic, respectively.

Aubert, Bernard; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, Antimo; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, Bjarne; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, Robert N.; Jacobsen, R.G.; /LBL, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Genoa U. /INFN, Genoa /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Pennsylvania U. /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /Frascati /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Search for Lepton Flavour Violating Decays Tau -> l Ks with the BABAR Detector  

SciTech Connect

We present the search for the lepton flavour violating decay {tau} {yields} lK{sup 0}{sub s} with the BaBar experiment data. This process and many other lepton flavour violating {tau} decays, like {tau} {yields} {mu}{gamma} and {tau} {yields} lll, are one of the most promising channel to search for evidence of new physics. According to the Standard Model and the neutrino mixing parameters, branching fractions are estimated well below 10{sup -14}, but many models of new physics allow for branching fractions values close to the present experimental sensitivity. This analysis is based on a data sample of 469fb{sup -1} collected by BABAR detector at the PEP-II storage ring from 1999 to 2007, equivalent to 431 millions of {tau} pairs. the BABAR experiment, initially designed for studying CP violation in B mesons, has demonstrated to be one of the most suitable environments for studying {tau} decays. The tracking system, the calorimeter and the particle identification of BABAR, together with the knowledge of the {tau} initial energy, allow an extremely powerful rejection of background events that, for this analysis, is better than 10{sup -9}. Being {tau} {yields} lK{sup 0}{sub s} a decay mode without neutrinos, the signal {tau} decay can be fully reconstructed. Kinematical constraints are used in a fit that provides a decay tree reconstruction with a high resolution. For this analysis MC simulated events play a decisive role for estimating the signal efficiency and study the residual background. High statistics MC sample are produced simulating detector conditions for different periods of data collection, in order to reduce any discrepancies with the data. When discrepancies can not be removed, we perform studies to compute a correction factor or an estimation of systematic errors that need to be included in the final measurement. A significant improvement of the current result can be reached only with a higher statistics and, therefore, with a new collider providing a luminosity from 10 to 100 times more than PEP-II. A new detector, with improved performance and able to collect data in a high background environment, is also requested to fully exploit the capability of such amount of data. In fact, only keeping the efficiency and the background as similar as possible to present ones, we will be able to scale almost linearly the estimated upper limit according to the luminosity. The strong potential of improvement for the search of lepton flavour violation {tau} decays makes the building of such a machine highly desirable.

Cenci, Riccardo; /SLAC



Search for CP Violation in the Decay D+/- to Ks pi+/-  

SciTech Connect

We report on a search for CP violation in the decay D{sup {+-}} {yields} K{sub S}{sup 0}{pi}{sup {+-}} using a data set corresponding to an integrated luminosity of 469 fb{sup -1} collected with the BABAR detector at the PEP-II asymmetric energy e{sup +}e{sup -} storage rings. The CP-violating decay rate asymmetry A{sub CP} is determined to be (-0.44 {+-} 0.13(stat) {+-} 0.10(syst))%, consistent with zero at 2.7 {sigma} and with the standard model prediction of (-0.332 {+-} 0.006)%. This is currently the most precise measurement of this parameter.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; /INFN, Bari /Bari U.; Milanes, D.A.; /INFN, Bari; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Harvey Mudd Coll. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison



Demonstration Assessment of Light-Emitting Diode (LED) Parking Lot Lighting in Leavenworth, KS  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology in a commercial parking lot lighting application, under the U.S. Department of Energy (DOE) Solid-State Lighting Technology GATEWAY Demonstration Program. The parking lot is for customers and employees of a Walmart Supercenter in Leavenworth, Kansas and this installation represents the first use of the LED Parking Lot Performance Specification developed by the DOEs Commercial Building Energy Alliance. The application is a parking lot covering more than a half million square feet, lighted primarily by light-emitting diodes (LEDs). Metal halide wall packs were installed along the building facade. This site is new construction, so the installed baseline(s) were hypothetical designs. It was acknowledged early on that deviating from Walmarts typical design would reduce the illuminance on the site. Walmart primarily uses 1000W pulse-start metal halide (PMH) lamps. In order to provide a comparison between both typical design and a design using conventional luminaires providing a lower illuminance, a 400W PMH design was also considered. As mentioned already, the illuminance would be reduced by shifting from the PMH system to the LED system. The Illuminating Engineering Society of North America (IES) provides recommended minimum illuminance values for parking lots. All designs exceeded the recommended illuminance values in IES RP-20, some by a wider margin than others. Energy savings from installing the LED system compared to the different PMH systems varied. Compared to the 1000W PMH system, the LED system would save 63 percent of the energy. However, this corresponds to a 68 percent reduction in illuminance as well. In comparison to the 400W PMH system, the LED system would save 44 percent of the energy and provide similar minimum illuminance values at the time of relamping. The LED system cost more than either of the PMH systems when comparing initial costs. However, when the life-cycle costs from energy and maintenance were factored into the scenario, the LED system had lower costs at the end of a 10-year analysis period. The LED system had a 6.1 year payback compared to the 1000W PMH system and a 7.5 year payback versus the 400W PMH system. The costs reflect high initial cost for the LED luminaire, plus more luminaires and (subsequently) more poles for the LED system. The other major issue affecting cost effectiveness was that Leavenworth, Kansas has very low electricity costs. The melded rate for this site was $0.056 per kWh for electricity. However, if the national electricity rate of $0.1022/kWh was used the payback would change to between four and five years for the LED system. This demonstration met the GATEWAY requirements of saving energy, matching or improving illumination, and being cost effective. The project also demonstrated that the Commercial Building Energy Alliance (CBEA) specification works in practice. Walmart appreciated having an entire site lighted by LEDs to gain more experience with the technology. Walmart is reviewing the results of the demonstration as they consider their entire real estate portfolio.

Myer, Michael; Kinzey, Bruce R.; Curry, Ku'uipo



Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Part I--A Rational Aerodynamic Design Procedure  

E-Print Network (OSTI)

'The design of a turbine stage is described in which all leading parameters (stage loading, flow coefficient, pitch/chord ratio, blade profile shape and aspect ratio) have been selected conservatively to accord with current ideas for ensuring a reasonably high level of aerodynamic efficiency. From consideration of the influence of stage loading KpAT V~ U,2, flow coefficient ~ and rotor exit swirl angle c ~ 3, the stage design was selected such that these parameters were 1.15, 0.65 and 10 degrees respectively. At the design speed of U ~ = 34 the resulting stage pressure ratio is approximately 1.65. Such a stage duty is 'light ' by aero engine standards but very comparable to much industrial gas turbine design practice. Blade spacing and profile shapes are 'finally selected in such a way as to preclude severe opposing pressure gradients on the suction surface which might result in local separation of the boundary layer from the blade surfaces. The methods applied and described for predicting blade surface velocities are simple and approximate only, and might readily be imitated by designers not wishing or able to exploit more elaborate and complex digital techniques.

M. No; D. J. L. Smith; I. H. Johnston; D. J. L. Smith; D. J. Fullbrook; D. J. L. Smith; I. H. Johnston



K-corrections and spectral templates of Type Ia supernovae  

E-Print Network (OSTI)

Propulsion Laboratory, California Institute of Technology, under contract with the National Aeronautics and Space

Hsiao, E. Y.



The complete mitochondrial genome of Articulate Brachiopod Terebratal ia transversa  

SciTech Connect

We have sequenced the complete mitochondrial DNA (mtDNA) of the articulate brachiopod Terebratalia transversa. The circular genome is 14,291 bp in size, relatively small compared to other published metazoan mtDNAs. The 37 genes commonly found in animal mtDNA are present; the size decrease is due to the truncation of several tRNA, rRNA, and protein genes, to some nucleotide overlaps, and to a paucity of non-coding nucleotides. Although the gene arrangement differs radically from those reported for other metazoans, some gene junctions are shared with two other articulate brachiopods, Laqueus rubellus and Terebratulina retusa. All genes in the T. transversa mtDNA, unlike those in most metazoan mtDNAs reported, are encoded by the same strand. The A+T content (59.1 percent) is low for a metazoan mtDNA, and there is a high propensity for homopolymer runs and a strong base-compositional strand bias. The coding strand is quite G+T-rich, a skew that is shared by the confamilial (laqueid) specie s L. rubellus, but opposite to that found in T. retusa, a cancellothyridid. These compositional skews are strongly reflected in the codon usage patterns and the amino acid compositions of the mitochondrial proteins, with markedly different usage observed between T. retusa and the two laqueids. This observation, plus the similarity of the laqueid non-coding regions to the reverse complement of the non-coding region of the cancellothyridid, suggest that an inversion that resulted in a reversal in the direction of first-strand replication has occurred in one of the two lineages. In addition to the presence of one non-coding region in T. transversa that is comparable to those in the other brachiopod mtDNAs, there are two others with the potential to form secondary structures; one or both of these may be involved in the process of transcript cleavage.

Helfenbein, Kevin G.; Brown, Wesley M.; Boore, Jeffrey L.



IA/Cyber Defense Brief for USAREUR Land EXPO  

Science Conference Proceedings (OSTI)

... Duty, Honor, Country. The Unholy Alliances. Spam Entrepreneurs; Adware / Spyware Providers; File Sharers; Phishers; Porn Purveyors; Hackers. ...



www.ias.edu/rise Science Initiative Group  

E-Print Network (OSTI)

funds. He has an ally in Heneri Dzinotyiweyi, the Minister for Science and Technology Development as a regional research facility and as the coordinating hub of a regional network. The 60 computer users ­ staff


The SN Ia Rate in High-Redshift Galaxy Clusters  

NLE Websites -- All DOE Office Websites (Extended Search)

Lin, Y.-T. & Mohr, J. J. 2004, ApJ, 617, 879 Livio, M. 2001, in Supernovae and Gamma-Ray Bursts: the Greatest Explosions since the Big Bang, ed. M. Livio, N. Panagia, & K....


UMore Ph IA CR Report 7-8-10.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

associated with construction of the wind turbine, 34.5 kV interconnect line, meteorologic tower, and associated roads and laydown areas, which encompasses approximately 33.25 acres...


Next-Generation Petascale Simulations of Type Ia Supernovae ...  

NLE Websites -- All DOE Office Websites (Extended Search)

deflagration to detonation transition model Deflagration to detonation transition model. Min lOng, Dan van Rossum, Sean Couch, George Jordan, Brad Gallagher, Don Lamb, University...


Closest Type Ia Supernova in Decades Solves a Cosmic Mystery  

NLE Websites -- All DOE Office Websites (Extended Search)

use to measure cosmic growth, a technique that in 1998 led to the discovery of dark energy - and 13 years later to a Nobel Prize, "for the discovery of the accelerating...


UNU-IAS Policy Report Biofuels in Africa  

E-Print Network (OSTI)

. Currently, liquid biofuels (e.g. bioethanol and biodiesel) produced from edible plants or animal fats/power generation (FAO, 2009; IEA, 2004). Currently, liquid biofuels (e.g. bioethanol and biodiesel) are by far) and conversion technology used, biofuels can be distinguished as first- and second-generation biofuels.2 First


Distributed Flames in Type Ia Supernovae A. J. Aspden1  

E-Print Network (OSTI)

generator trip controller AEC Canada, Ont. Hydro Nuclear reactor controller Argonne Token­based ACS of axioms of the logical theory. Part 2, 32.1.6 In summary, the practical options for Formal Arguments Case Studies: Verification Software Domain SACEM (Paris metro) GEC Alsthom, RATP Darlington nuclear


Measurement of $D^0-overline{D}^0$ mixing parameters using $D^0 \\to K_S^0 \\pi^ \\pi^-$ and $D^0 \\to K_S^0 K^ K^-$ decays  

Science Conference Proceedings (OSTI)

We report a direct measurement of D{sup 0}-{bar D}{sup 0} mixing parameters through a time-dependent amplitude analysis of the Dalitz plots of D{sup 0} {yields} K{sub S}{sup 0}{pi}{sup +}{pi}{sup -} and, for the first time, D{sup 0} {yields} K{sub S}{sup 0}K{sup +}K{sup -} decays. The low-momentum pion {pi}{sub s}{sup +} in the decay D*{sup +} {yields} D{sup 0}{pi}{sub s}{sup +} identifies the flavor of the neutral D meson at its production. Using 468.5 fb{sup -1} of e{sup +}e{sup -} colliding-beam data recorded near {radical}s = 10.6 GeV by the BABAR detector at the PEP-II asymmetric-energy collider at SLAC, we measure the mixing parameters x = [1.6 {+-} 2.3 (stat.) {+-} 1.2 (syst.) {+-} 0.8 (model)] x 10{sup -3}, and y = [5.7 {+-} 2.0 (stat.) {+-} 1.3 (syst.) {+-} 0.7 (model)] x 10{sup -3}. These results provide the best measurement to date of x and y. The knowledge of the value of x, in particular, is crucial for understanding the origin of mixing.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Columbus Supercond., Genova /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Mycologia, 96(4), 2004, pp. 866878. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

66044-8897 Two new Ophiostoma species with Sporothrix anamorphs from Austria and Azerbaijan Dilzara N with Sporothrix anamorphs recently collected in Austria and Azerbaijan. The isolates were charac- terized based and Azerbaijan. Growth at 25 C and morphology revealed some differences between the two groups, and supported


Mycologia, 96(3), 2004, pp. 548557. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

exorientia. Rhizoidaceae structurae absentes. Stip- ites erectus, pallide brunnei vel atro-brunnei, 1



Office of Legacy Management (LM)

. .* . .* . *' 1, c. l ( JJmKS.,"T +2 - Sk--- LCi = ~CU---.-T?~~ - ' _ I -Got& &ysp f= ,$QTg-J%ej & *j, at r-s* p? the c;t S=iw ' e -4 -7 T&a* J %h~k smey to &?'LcrsL!! +,'-H a&xlt CE c~-siz4-"' (WL'&W b--"-R; d-x43 - "MS , cc- 22 lLW JP .-. 2-Q L.2, l=AF, !y515) SkQQ c3 t& e$QT'3r,y* +' -'a-- 'ZS cw..tn;i. .-- Z!o cezU2?siataa kjc~s AA3 ks*~sti lffti S *Ab *T*,& tmld kv ;ia-eGd aa t;v ryrs d t:* -ticIs;: e c3 eaizw2-L &4?ia, x,qZ-' y s +.!-w~ * & & A& b L*z&=- b l A m iE3 &an z U/L& ,c,- 223 *Pb ' Sd YfZ' , w%b!.R LiZhE O+ZIBr -wi' Qe e* if,= ca' ,c, me *e83ia ~hl3 GK m*GLFs. s&s-?qyi* w =.,m -y s:* & km, -k tei;2&+ 3, J. ' Ybc!zb, -a i. 2. iY,kq& ' . \ cus s. '


Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Biofuels Project Locations Biofuels Project Locations BlueFire Ethanol Biochemical Municipal Solid Waste (Mecca, CA) Poet Biochemical Corn Cob/Corn Fiber (Emmetsburg, IA) Lignol Biochemical Woody Biomass- Ag Residues (Grand Junction, CO) ICM Biochemical Switchgrass, Forage Sorghum, Stover (St. Joseph, MO) Abengoa Biochemica Agricultural Residue (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE Bioenergy Science Center (Oak Ridge, TN) NewPage Thermochemical Woody Biomass - Mill Residues (Wisconsin Rapids, WI) Range Fuels Thermochemical Woody Waste (Soperton, GA) DSM Innovation Center Biochemical Various (Parsippany, NJ) Novozymes Biochemical Various (Davis, CA) Genencor Biochemical Various (Palo Alto, CA) Verenium Corp Biochemical Various (San Diego, CA)


QCL IA 2009-2012 Proposed Research The QCL IA has several major themes around which our individual research projects are organized.  

E-Print Network (OSTI)

)a 1970 2 015 424 ­ Cemet factory expansion (1972­1973)d ; sugar cane mill (1974); PEMEX oil refinery (1978) 1980 2 369 076 Miguel de la Madrid (1988) PEMEX oil refinery expansion (1981, 1983)e ; PEMEX

Texas at Austin, University of

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Measurement of Branching Fractions and CP Asymmetries in B -> wK Decays and First Evidence of CP Violation in B0 -> wKS0  

E-Print Network (OSTI)

We present a measurement of the branching fractions and charge-parity (CP) violating parameters in B --> omega K decays. The results are obtained from the final data sample containing 772 million BBbar pairs collected at the {\\Upsilon}(4S) resonance with the Belle detector at the KEKB asymmetric-energy e+e- collider. We obtain the branching fractions, B(B0 --> omega K0) = (4.5+/- 0.4 (stat) +/- 0.3 (syst)) x 10^-6, B(B+ --> omega K+) = (6.8 +/- 0.4 (stat) +/- 0.4 (syst)) x 10^-6, which are in agreement with their respective current world averages. For the CP violating parameters we obtain, A (B0 --> omega K0S) = -0.36 +/- 0.19 (stat) +/- 0.05 (syst), S (B0 --> omega K0S) = +0.91 +/- 0.32 (stat) +/- 0.05 (syst), A (B+ --> omega K+) = -0.03 +/- 0.04 (stat) +/- 0.01 (syst), where A and S represent the direct and mixing-induced CP asymmetry, respectively. We find no evidence of CP violation in the decay channel B+ --> omega K+; however, we obtain the first evidence of CP violation in the B0 --> omega K0 decay channel at the level of 3.1 standard deviations.

V. Chobanova; J. Dalseno; C. Kiesling; I. Adachi; H. Aihara; D. M. Asner; V. Aulchenko; T. Aushev; T. Aziz; A. M. Bakich; A. Bala; Y. Ban; K. Belous; B. Bhuyan; A. Bobrov; G. Bonvicini; A. Bozek; M. Bra?ko; T. E. Browder; D. ?ervenkov; V. Chekelian; A. Chen; B. G. Cheon; K. Chilikin; R. Chistov; K. Cho; Y. Choi; D. Cinabro; M. Danilov; Z. Doleal; Z. Drsal; D. Dutta; K. Dutta; S. Eidelman; S. Esen; H. Farhat; J. E. Fast; T. Ferber; V. Gaur; N. Gabyshev; S. Ganguly; A. Garmash; R. Gillard; Y. M. Goh; B. Golob; J. Haba; K. Hayasaka; X. H. He; Y. Horii; Y. Hoshi; W. -S. Hou; Y. B. Hsiung; H. J. Hyun; T. Iijima; K. Inami; A. Ishikawa; Y. Iwasaki; T. Iwashita; I. Jaegle; T. Julius; J. H. Kang; E. Kato; H. Kawai; T. Kawasaki; D. Y. Kim; H. J. Kim; J. B. Kim; J. H. Kim; M. J. Kim; Y. J. Kim; K. Kinoshita; J. Klucar; B. R. Ko; P. Kody; S. Korpar; P. Krokovny; B. Kronenbitter; T. Kuhr; T. Kumita; A. Kuzmin; J. S. Lange; S. -H. Lee; J. Li; Y. Li; L. Li Gioi; J. Libby; D. Liventsev; P. Lukin; D. Matvienko; K. Miyabayashi; H. Miyake; H. Miyata; R. Mizuk; G. B. Mohanty; A. Moll; N. Muramatsu; R. Mussa; E. Nakano; M. Nakao; Z. Natkaniec; M. Nayak; E. Nedelkovska; C. Ng; N. K. Nisar; S. Nishida; O. Nitoh; S. Ogawa; S. Okuno; P. Pakhlov; G. Pakhlova; C. W. Park; H. Park; H. K. Park; T. K. Pedlar; T. Peng; R. Pestotnik; M. Petri?; L. E. Piilonen; M. Ritter; M. Rhrken; A. Rostomyan; H. Sahoo; T. Saito; Y. Sakai; L. Santelj; T. Sanuki; V. Savinov; O. Schneider; A. J. Schwartz; D. Semmler; K. Senyo; O. Seon; M. E. Sevior; M. Shapkin; T. -A. Shibata; J. -G. Shiu; B. Shwartz; A. Sibidanov; F. Simon; Y. -S. Sohn; S. Stani?; M. Stari?; M. Steder; K. Sumisawa; T. Sumiyoshi; U. Tamponi; G. Tatishvili; Y. Teramoto; K. Trabelsi; M. Uchida; T. Uglov; Y. Unno; S. Uno; C. Van Hulse; P. Vanhoefer; G. Varner; K. E. Varvell; A. Vinokurova; V. Vorobyev; M. N. Wagner; C. H. Wang; M. -Z. Wang; P. Wang; M. Watanabe; Y. Watanabe; K. M. Williams; E. Won; H. Yamamoto; Y. Yamashita; S. Yashchenko; Z. P. Zhang; V. Zhilich; V. Zhulanov; A. Zupanc



Print http://us.mg4.mail.yahoo.comfneo/launch?.rand=deOsgk04ks40i Subject: Re: [s-w-h] Solar verses wind efficiency  

E-Print Network (OSTI)

& Pltry Sci-AS-PHD PHD ANA 11ANP 11ANPPHD Animl Sci & Pltry Sci-PS-PHD PHD ANA 11ANS 11ANSMR Animal Sci


Modeling Solid-Particle Erosion of Ductile Alloys B.F. LEVIN, K.S. VECCHIO, J.N. DuPONT, and A.R. MARDER  

E-Print Network (OSTI)

hardening **HASTELLOY and STELLITE are trademarks of Stoody Deloro Stel- lite, Inc., Industry, CA. HAYNES.removal. Only a few attempts have been made to measure the STELLITE**-6, and 316L SS) and commercially pure Cu repre- variation in mechanical properties. The Stellite-6 alloy con- sent a measure of energy absorbed

DuPont, John N.


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


Sensitivity analysis of world oil prices. Analysis report AR/IA/79-47  

SciTech Connect

An analysis of the impact of the political disruption in Iran on the world oil market is presented. During the first quarter of 1979, this disruption caused a loss of approximately 5 million barrels per day (MMBD) of oil production available for export from Iran to the rest of the world. This loss of production and the political climate in Iran have caused much speculation concerning future Iranian oil production and total Organization of Petroleum Exporting Countries (OPEC) oil production in the nearterm and midterm. The analysis describes these issues in terms of two critical factors: the world oil price and the level of OPEC oil production in the nearterm and midterm. A detailed comparison of the Central Intelligence Agency (CIA) and Energy Information Agency (EIA) forecasting models of world oil prices is presented. This comparison consists of examining reasons for differences in the price forecasts of the CIA model by using CIA assumptions within the EIA model. The CIA and EIA model structures and major parameters are also compared. It is important to note that this analysis is not all encompassing. In particular, the analysis does not provide data on crude oil prices in the spot market, but does provide information on the average crude oil price; and does not permit rationing of oil, since the market is forced to clear only through changes in oil prices. Throughout this paper, world oil prices are defined in terms of real 1978 dollars per barrel of crude oil delivered to the East Coast of the United States net of any import fees.

Rodekohr, M.; Cato, D.



The A2iA Arabic Handwritten Text Recognition System at the ...  

Science Conference Proceedings (OSTI)

... This two- step training schedule greatly helped to reduce convergence times ... This pro- cedure requires the construction of a decoding graph that ...



Quantitative comparison between Type Ia supernova spectra at low and high redshifts: A case study  

E-Print Network (OSTI)

Propulsion Laboratory, California Institute of Technology, under contract with the National Aeronautics and Space

Garavini, G.; Supernova Cosmology Project


Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Improving Type Ia Supernova Standard Candle Cosmology Measurements Using Observations of Early-Type Host Galaxies  

E-Print Network (OSTI)

Propulsion Laboratory, California Institute of Technology, under contract with the National Aeronautics and Space

Meyers, Joshua Evan




E-Print Network (OSTI)

. Journal of "Solar Energy Materials and Solar Cells". Proceedings of IEEE Photovoltaic Specialist Conferences. Proceedings of European Photovoltaic Solar Energy Conferences. #12;Module 2/Photovoltaics, Wiley, 1995. R.H.Bube, Photovoltaic Materials, Imperial College Press, 1998. Journal of "Solar Energy


_ _i_i Association for ,nformation and Image Management i; _ J , IA Spring, Maryland 20310  

E-Print Network (OSTI)

the maximum pressure needed to lift the overburden (``the fracture pressure''), and new CO2 injection wells (MMscf) of natural gas burned to generate elec- tricity (n3045us2a.xls). All these data are posted generation has been calculated from the DOE EIA files epmxlfile4_1.xls (Report DOE/EIA-0226) for coal, and n

Hazen, Terry


Prospects for Type Ia Supernova explosion mechanism identification with gamma rays  

E-Print Network (OSTI)

The explosion mechanism associated with thermonuclear supernovae (SNIa) is still a matter of debate. There is a wide agreement that high amounts of of radioactive nuclei are produced during these events and they are expected to be strong gamma-ray emitters. In the past, several authors have investigated the use of this gamma-ray emission as a diagnostic tool. In this paper we have done a complete study of the gamma-ray spectra associated with all the different scenarios currently proposed. This includes detonation, delayed detonation, deflagration and the off-center detonation. We have performed accurate simulations for this complete set of models in order to determine the most promising spectral features that could be used to discriminate among the different models. Our study is not limited to qualitative arguments. Instead, we have quantified the differences among the spectra and established distance limits for their detection. The calculations have been performed considering the best current response estim...

Gmez-Gomar, J; Jean, P; Gomez-Gomar, Jordi; Isern, Jordi; Jean, Pierre



OS and compiler considerations in the design of the IA-64 architecture  

Science Conference Proceedings (OSTI)

Increasing demands for processor performance have outstripped the pace of process and frequency improvements, pushing designers to find ways of increasing the amount of work that can be processed in parallel. Traditional RISC architectures use hardware ...

Rumi Zahir; Jonathan Ross; Dale Morris; Drew Hess



Pacific Northwest National Laboratory: INstItute for INterfacIaL cataLysIs  

E-Print Network (OSTI)

shell (biomass) cellulosa type of reaction flash pyrolysis pyrolysis flash pyrolysis slow pyrolysis. Scott, J. Piskorz, D. Radlein; Liquid Products from the Continuous Flash Pyrolysis of Biomass, Ind. Eng; The Continous Flash Pyrolysis of Biomass, The Canadian Journal of Chemical Engineering, 1984, 62, 404-412 #12


Regional Initiative in Science and Education www.ias.edu/rise  

E-Print Network (OSTI)

funds. He has an ally in Heneri Dzinotyiweyi, the Minister for Science and Technology Development as a regional research facility and as the coordinating hub of a regional network. The 60 computer users ­ staff



E-Print Network (OSTI)

when carbon dioxide is introduced into thermal conversion processes such as the gasification of coal to syngas, leaving behind only a carbonless char. Castaldi estimates that if the biomass were used


Pacific Northwest National Laboratory: INstItute for INterfacIaL cataLysIs  

E-Print Network (OSTI)

of Chemistry University of Calgary,Alberta, Canada T2N 1N4 New Orleans National Meeting Modeling the Fischer-Tropsch study Fischer-Tropsch synthesis: An Introduction First discovered by Sabatier and Sanderens in 1902: CO + H2 CH4 Ni,Fe,Co Fischer and Tropsch reported in 1923 the synthesis of liquid hydrocarbons with high


Targeted Energy Efficiency Expert Evaluation Report: Neal Smith Federal Building, Des Moines, IA  

SciTech Connect

This report summarizes the energy efficiency measures identified and implemented, and an analysis of the energy savings realized using low-cost/no-cost control system measures identified.

Fernandez, Nicholas; Goddard, James K.; Underhill, Ronald M.; Gowri, Krishnan




E-Print Network (OSTI)

- onry is also crucial to their safe storage. Plutonium, an active ingredient in nuclear weap- ons, has to determine how the electrons within these materials will behave. "The plutonium in the weapons ages, and we have to be able to predict the proper- ties of plutonium under a variety of conditions," Chris


From Convection to Explosion: End-to-End Simulation of Type Ia Supernovae  

E-Print Network (OSTI)

INCITE award at the Oak Ridge Leadership Computational Facility (OLCF) at Oak Ridge National Laboratory

Bell, John B.


Teor'ia de Grupos y Mec'anica Qu'antica Luis A. Seco  

E-Print Network (OSTI)

armonicos desacoplados. 7. El ' atomo de hidr'ogeno. 8. El helio y los otros 'atomos. 9. Mol'eculas. 10

Seco, Luis A.



E-Print Network (OSTI)

that bends and twists. "Computers, geometry, and physics are my ingredients. I mix them up in a bowl and what science as well. B.A.Sc., University of Toronto (Canada), 1997; M.S., California Institute of TechnologySPUn Associate Professor of Computer Science #12;

Hone, James


Targeted Eneregy Efficiency Expert Evaluation Report: Neal Smith Federal Building, Des Moines, IA  

SciTech Connect

This report summarizes the energy efficiency measures identified and implemented, and an analysis of the energy savings realized using low-cost/no-cost control system measures identified.

Fernandez, Nicholas; Goddard, James K.; Underhill, Ronald M.; Gowri, Krishnan




E-Print Network (OSTI)

38 R~port of the Instructor in Physical Education for Women 39 g~portof the Office!: Co Second Yearoo.....eoQ....oo........... Third Year.....OOO..OO..O.............Fourth Ye~.O..O.O.OIO; Engineer 134; Farmer 75; Inspector 21; Insurance 34; Lawyer 39; Lumberman 33; Manager 54; Merchant 97

Pulfrey, David L.


Just What is a Supernova?  

NLE Websites -- All DOE Office Websites (Extended Search)

Matter transfer in a binary system Distances to Type Ia Supernovae Slide 8 Supernova "CAT Scan" Type Ia Supernova lightcurves Type Ia Supernovae and Cosmology Type Ia Supernovae...



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

3, 2004 3, 2004 Calendar Monday, September 13 11:00 a.m. Special Astrophysics Seminar - Curia II Speaker: P. Hoeflich, University of Texas Title: Physics of Type Ia Supernovae for Cosmology: I 2:30 p.m. Theoretical Astrophysics Seminar - Curia II Speaker: C. Wagner, Argonne National Laboratory/University of Chicago Title: Supersymmetry, Dark Matter and Electroweak Baryogenesis 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4:00 p.m. All Experimenters' Meeting - Curia II Special Topic: NuMI/MINOS Tuesday, September 14 3:00 p.m. Special Astrophysics Seminar - Curia II Speaker: P. Hoeflich, University of Texas Title: Physics of Type Ia Supernovae for Cosmology: II 3:30 p.m. DIRECTOR'S COFFEE BREAK - 2nd Flr X-Over 4:00 p.m. Accelerator Physics and Technology Seminar - 1 West

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I'IENT OF ENERGY I'IENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERl'vIINATION RECIPIENT:MI Department of Energy, labor & Economic Growth PROJECT TITLE: Green Chemistry - CEAM Phase 3 - Working Bug LLC Page 1 of2 STATE: MI Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO52 DE-EEOOOO166 GFO..oooo166-033 GOO Based on my review oftbe informalion concerning tbe proposed action, ali NEPA Compliance Officer (authorized under DOE Order 4S1.IA).1 bave made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy. demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U) , U) , u.s. DEPARTUENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:MI Department of Energy, Labor & Economic Growth PROJECT TITLE: Clean Energy Advanced Manufacturing Phase 2 * URV USA Page 1 of2 STATE: MI Funding Opportunity Announcement Nurnbt'r Proc:urtmtnt Instrument Number NEPA Control NumMT CID Number DE-FOA-0000052 DE·EEOOOO166 GFO-09-148-019 GOO Ba~d on my ~yicw of the information concuning tbe proposed action, as NEPA Compliance Omcer (authorized under DOE Order 451.IA), I have made tbe (ollowing determination: ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PMe·En. PMe·En. U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEME:-;T CENTER NEPA DETElUIllNATION RECIPIENT:City of Wichita PROJECT TITl.E: City of WIChita EECBG DE-0000726 -#7 McAdams . Bike Pathway Page I of2 STATE: KS Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number eID Number DE 0000013 DE EE 0000726 0 Based on my nview ofthe information concc.-ning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4S1.IA),1 bave made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficlency that do not Increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

feedstock and technology diversity feedstock and technology diversity Legend Company Name Process Technology Feedstock Type (Site Location) * Acquired by NewPage Corporation Six Commercial-Scale Biorefinery Projects; DOE will invest up to $385 million P j t Four Small-Scale Biorefinery Projects; DOE will invest up to $114 million (first round) Three Bio-Energy Centers; DOE will invest up to $405 million Alico Thermochemical/Bio Citrus Waste (LaBelle, FL) Range Fuels Thermochemical Wood Chips (Soperton, GA) DOE BioEnergy Science Center (Oak Ridge, TN) Abengoa Biochemical/Thermo Ag Waste, switchgrass (Hugoton, KS) Blue Fire Biochemical Municipal Solid Waste (Corona, CA) Iogen Biochemical Wheat Straw (Shelley, ID) Poet Biochemical Corn Stover (Emmetsburg, IA) ICM Biochemical Switchgrass, Corn Stover (St. Joseph, MO) Lignol



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

\lAGEMENT CDITER \lAGEMENT CDITER NFPA DE=nNATION RECIPIENT:Cloud County Community College Page I of2 STATE: KS PROJECT TITLE: EECBG State of Kansas DE-EEOOO0727 Cloud County GSHP HVAC Renewable Energy Subgranl Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FDA 0000013 DE-EEOOOO727 .002 0 Based on my ",view orlhe information concerning tbe proposed action, as NEPA Compliance Officer (authoro..ed under DOE Order 451.IA), I have made the (ollowing detennination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories. audits). data analysis (including computer modeling), document preparation (such as oonceplual design or feasibility studies, analytical energy supply


S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

Quarterly Sampling, STAR Center, Largo, FL Quarterly Sampling, STAR Center, Largo, FL 7030-226 Accutest Job Number: F27229 Sampling Date: 10/07/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

WWNA Monthly; Largo, FL WWNA Monthly; Largo, FL 110406202 Accutest Job Number: F25982 Sampling Date: 08/10/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

0/06 0/06 Technical Report for S M Stoller Quarterly Sampling, STAR Center, Largo, FL 110406202 Accutest Job Number: F39137 Sampling Dates: 03/08/06 - 03/09/06 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller Pinellas Environmental Restoration Project - Young- Rainey Star Center  

Office of Legacy Management (LM)

Pinellas Environmental Restoration Project - Young- Rainey Star Center Pinellas Environmental Restoration Project - Young- Rainey Star Center 110406202 Accutest Job Number: F33039 Sampling Date: 07/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller Star Center-B100  

Office of Legacy Management (LM)

B100 B100 Monthly Sampling, 110406202 Accutest Job Number: F25245 Sampling Date: 07/06/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

WWNA Monthly; Largo, FL WWNA Monthly; Largo, FL 7030-226 Accutest Job Number: F33038 Sampling Date: 07/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller STAR Center- 4.5 Acre Site, Largo, FL  

Office of Legacy Management (LM)

STAR Center- 4.5 Acre Site, Largo, FL STAR Center- 4.5 Acre Site, Largo, FL 110406202 Accutest Job Number: F23552 Sampling Date: 04/20/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

IENT OF ENERG Y IENT OF ENERG Y EERE PROJECT MANAGEMENT CENTER NEPA DETEmlINATION Page lof2 RECIPIF:NT:Cloud County Community College STATE: KS PROJECf TITLE: Cloud County Community College Renewable Energy Center of Excellence Funding Opportunity Announcement Number FY10 CDP Procurement Instrument Number DE·FG36-08G088013 NEPA Control Number GFO-G0880 13-003 elD Number o Based on my review orlhe information concerning the proposed action, as NEPA Compliance Officer (authoriud under DOE Order 4SI.IA), I have made the following ddermination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply


S M Stoller Star Center-B100 Monthly/Effluent; Largo, FL  

Office of Legacy Management (LM)

B100 Monthly/Effluent; Largo, FL B100 Monthly/Effluent; Largo, FL 7030-226 Accutest Job Number: F30882 Sampling Date: 04/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Star Center-B100  

Office of Legacy Management (LM)

B100 B100 7030-226/Monthly Accutest Job Number: F27169 Sampling Date: 10/05/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director


S M Stoller Pinellas Environmental Restoration Project - Young - Rainey Star Center  

Office of Legacy Management (LM)

Young - Rainey Star Center Young - Rainey Star Center 110406202 Accutest Job Number: F30886 Sampling Date: 04/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Star Center-B100 Monthly/Effluent; Largo, FL  

Office of Legacy Management (LM)

B100 Monthly/Effluent; Largo, FL B100 Monthly/Effluent; Largo, FL 7030-226 Accutest Job Number: F29123 Sampling Date: 01/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

7170 7170 Sampling Date: 10/05/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report 12 1 of 12


S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

227 227 Sampling Dates: 03/31/04 - 04/01/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DETERMINATION DETERMINATION R[CIPIENT:Kansas Corporation Commission PROJECT TITLE: FCIP Loan Page 1 of2 STATE: KS Funding Opportunity Announcement Number Proc:uumenC Instrument Number NEPA Control Number CID Number DE·FOA"()(){)()()S2 DE-EEOOOOO132 GF0-0000132-008 0 Based on my review oflhe inrormation concerning the proposed action, as NEPA Compliance Offictr (authorized under DOE Order 451.IA), I bave made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do nol increase the Indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to Individuals (such as builders, owners, consuHants, designers), organizations (such as utilities), and slate



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Il.II.': , Il.II.': , u.s. DEPARTMENT OFFNERGY EERE PROJECT MANAGEMENT CENTER Nl!PA DFTFnIINATION RECIPIENT: FDC Enterprises, Inc. Page 1 of2 STATE: KS PROJECT TITLE: Design and Demonstration of an Advanced Agricultural Feedstock Supply System for lignocellulosic Bioenergy Production Funding Opportunity AonOUDCtment Number DE-FOA-0000060 Pnxunmtol Instrument Number EEOOO1033 NEPA Control Number em Number GF()..10-532 0 Based on my review oflbe information concerning the propostd action, 85 NEPA Compliance Officer (authorized under DOE Order 4Sl.IA). I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits). data analysis (including


S M Stoller STAR Center- 4.5 Acre Site, Largo, FL  

Office of Legacy Management (LM)

STAR Center- 4.5 Acre Site, Largo, FL STAR Center- 4.5 Acre Site, Largo, FL 110406202 Accutest Job Number: F25243 Sampling Date: 07/06/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Star Center-B100  

Office of Legacy Management (LM)

/19/06 /19/06 Technical Report for S M Stoller Star Center-B100 110406202 7031-877 Accutest Job Number: F41217 Sampling Date: 06/02/06 Report to: US Dept of Energy, Grand Jct Office 2597 B3/4 Road Grand Junction, CO 81503 ATTN: Contracts Department, PO# 24231 x Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference


S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

WWNA Monthly; Largo, FL WWNA Monthly; Largo, FL 7031-226 Accutest Job Number: F36361 Sampling Date: 11/03/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DFPARThIFN'I OF ENERGY DFPARThIFN'I OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DI!rnu.nNATION RECIPIENT:Kansas Corporation Commission - Renewable Energy Subgrant PROJECT T ITLE : City of Chanute GSHP Page 1 of2 STATE; KS Funding Opportunity Announcement Number Pr~urement Instr ument Number NEPA Control Number CID Number $E·FOA.{)()(X)()13 EEOOOO727 GF0-0000727-010 0 Based on my review o(tbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Onter 4SI.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency thai do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


S M Stoller Pinellas Environmental Restoration Project - Young - Rainey Star Center  

Office of Legacy Management (LM)

Young - Rainey Star Center Young - Rainey Star Center 110406202 Accutest Job Number: F35489 Sampling Date: 10/05/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

Quarterly Sampling, STAR Center, Largo, FL Quarterly Sampling, STAR Center, Largo, FL 110406202 Accutest Job Number: F33211 Sampling Dates: 07/13/05 - 07/14/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller STAR Center- 4.5 Acre Site, Largo, FL  

Office of Legacy Management (LM)

STAR Center- 4.5 Acre Site, Largo, FL STAR Center- 4.5 Acre Site, Largo, FL 7030-226/Monthly Accutest Job Number: F27168 Sampling Date: 10/05/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

124 124 Sampling Date: 01/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report 18 1 of 18


S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

531 531 Sampling Date: 04/16/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report 21 1 of 21


S M Stoller Star Center-B100 Monthly/Effluent; Largo, FL  

Office of Legacy Management (LM)

B100 Monthly/Effluent; Largo, FL B100 Monthly/Effluent; Largo, FL 7031-226 Accutest Job Number: F35493 Sampling Date: 10/04/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D.


S M Stoller Pinellas Environmental Restoration Project - Young - Rainey Star Center  

Office of Legacy Management (LM)

6/06 6/06 Technical Report for S M Stoller Pinellas Environmental Restoration Project - Young - Rainey Star Center 110406202 Accutest Job Number: F43553 Sampling Date: 09/07/06 Report to: U.S. Dept of Energy, Grand Jct Office 2597 B 3/4 Road Grand Juction, CO 81503 ATTN: Contracts Department, PO# 24231 x Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference


S M Stoller Quarterly Sampling, STAR Center, Largo, FL  

Office of Legacy Management (LM)

2/04 2/04 Technical Report for S M Stoller Quarterly Sampling, STAR Center, Largo, FL 110406202 Accutest Job Number: F25409 Sampling Dates: 07/13/04 - 07/14/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller Star Center-WWNA Monthly; Largo, FL  

Office of Legacy Management (LM)

8014 8014 Sampling Date: 11/09/04 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director e-Hardcopy 2.0 Automated Report 12 1 of 12


S M Stoller Pinellas Environmental Restoration Project - Young- Rainey Star Center  

Office of Legacy Management (LM)

Pinellas Environmental Restoration Project - Young- Rainey Star Center Pinellas Environmental Restoration Project - Young- Rainey Star Center 7030-226 Accutest Job Number: F29125 Sampling Date: 01/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable.


S M Stoller Star Center-B100  

Office of Legacy Management (LM)

B100 B100 110406202 Accutest Job Number: F33040 Sampling Date: 07/06/05 Report to: S M Stoller Cathy.Kelleher@gjo.doe.gov ATTN: Cathy Kelleher Total number of pages in report: Certifications: FL (DOH E83510), NC (573), NJ (FL002), MA (FL946), IA (366), LA (03051), KS (E-10327), SC, AK This report shall not be reproduced, except in its entirety, without the written approval of Accutest Laboratories. Southeast * 4405 Vineland Road * Suite C-15 * Orlando, FL 32811 * tel: 407-425-6700 * fax: 407-425-0707 * http://www.accutest.com Test results contained within this data package meet the requirements of the National Environmental Laboratory Accreditation Conference and/or state specific certification programs as applicable. Harry Behzadi, Ph.D. Laboratory Director


Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Biofuels Biofuels Project Locations Pacific Ethanol (Boardman, OR) BlueFire Ethanol (Corona, CA) POET (Emmetsburg, IA) Lignol Innovations (Commerce City, CO) ICM (St. Joseph, MO) Abengoa (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE Bioenergy Science Center (Oak Ridge, TN) NewPage (Wisconsin Rapids, WI) Range Fuels (Soperton, GA) DSM Innovation Center (Parsippany, NJ) Novozymes (Davis, CA) Genencor (Palo Alto, CA) Verenium Corp (San Diego, CA) Dupont (Wilmington, DE) Mascoma (Lebanon, NH) Cargill Inc (Minneapolis, MN) Regional Partnerships South Dakota State University, Brookings, SD Cornell University, Ithaca, NY University of Tennessee, Knoxville, TN Oklahoma State University, Stillwater, OK Oregon State University, Corvallis, OR


Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Feedstock, and Technology Diversity Feedstock, and Technology Diversity Pacific Ethanol Biochemical Wheat Straw/Corn Stover (Boardman, OR) Iogen Biochemical Wheat Straw (Shelly, ID) Blue Fire Biochemical Municipal Solid Waste (Corona, CA) Poet Biochemical Corn Stover (Emmetsburg, IA) Lignol Biochemical Wood Residues (Commerce City, CO) ICM Biochemical Switchgrass, Corn Stover (St. Joseph, MO) Abengoa Biochemical/ Thermo Ag Waste, Switchgrass (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE Bioenergy Science Center (Oak Ridge, TN) Stora Enso North America Thermochemical Wood Chips (Wisconsin Rapids, WI) Range Fuels Thermochemical Wood Chips (Soperton, GA) Alico Thermochemical/Bio Citrus Waste (LaBelle, FL) Six Commercial-Scale Biorefinergy



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

:. :. U.S. DEPARThIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Kansas Corporation Commission PROJECT TITLE: Multi-Family Housing Weatherizallon Page \ of2 STATE: KS Funding Opponunlty Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number NF.PA Control Number CID Number DE-EEOOOOO132 GF0-0000132-006 0 Based on my review oflhe information concuning the proposed action, as NEPA Compliance Officer (aulhori7.ed under DOE Order 4SI.IA), I bave made the (allowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Action s 10 conserve energy, demonstrate potential energy conservation , and promote energy-efficiency that do not increase the indoor ooncenlrallQns of potentially harmful substances. These actions may involve financial and technical

Note: This page contains sample records for the topic "ia ks mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.


Closed Sessions Program The closed session program plan is given in detail in Appendix I-A. The program started  

E-Print Network (OSTI)

for enhancing renewable energy usage · Assist in education and research in renewable energy · Changing behavior on "Energy for Sustainable Development: Perspectives from the Arab Region", followed by 20-minute presentations by participating Middle East Universities on their country specific energy profiles, with emphasis


Automotive Stirling Engine Market and Industrial Readiness Program (MIRP). Final report for Phase IA, September 15, 1982-July 31, 1984  

SciTech Connect

A brief history of the project is presented. Included in appendices are the scope of work, management and cost plans, major milestones, and the digital engine control spare parts' list. (MHR)

Not Available



Analysis of the Thermal Performance of Tierra I--A Low-Energy High-Mass Residence  

DOE Green Energy (OSTI)

A low-energy concrete house was designed using passive solar strategies to consume 70% less heating and cooling energy than a base case that conformed to the 1996 Home Energy Rating System (HERS) and the 1995 Model Energy Code (MEC). The performance of this house was then evaluated using computer simulations and measured data. The house, Tierra I, was monitored from July 22, 1996, through October 14, 1997. A Short Term Energy Monitoring (STEM) test was done November 19 to December 10, 1996. Computer simulations of the house were done using SUNREL, an updated version of the hourly data simulation package SERI-RES. The SUNREL model of the house was calibrated using both short- and long-term data. The house achieved energy savings of 56%, below the goal of 70%. The lower than expected savings resulted from problems with the window modeling. As a result, during the design phase the solar gains were overestimated causing an underestimate in the level of insulation necessary to achieve the savings goal. For very low-energy passive solar buildings, it is apparent that very accurate window modeling is required. It also became apparent that accurate ground models are required as well because ground-heat loss accounts for a significant portion of the total heat loss in low-energy buildings.

Smith, M. W.



IA-SDSS: A GIS-based land use decision support system with consideration of carbon sequestration  

Science Conference Proceedings (OSTI)

Land use, land use change and forestry (LULUCF) can play a positive role in mitigating global warming by sequestering carbon from the atmosphere into vegetation and soils. Local entities (e.g. local government, community, stockholders) have been making ... Keywords: Carbon models, Carbon sequestration, GIS, Integrated assessment, Land-use planning, RS, SDSS

Jun Wang; Jingming Chen; Weimin Ju; Manchun Li



On October 15, 2010, the University of Memphis Center for Information Assurance (CfIA) hosted the 3rd  

E-Print Network (OSTI)

digital devices, and we encourage you to read the excellent summary from the National Counter-Intelligence for an unspecified period of time. This policy applies to anyone entering the country, including US citizens

Memphis, University of


Restframe I-band Hubble diagram for type Ia supernovae up to redshift z ~; 0.5  

E-Print Network (OSTI)

A. 1999, ApJ, 525, 583 Balbi, A. , Ade, P. , Bock, J. etJa?e, A.H. , Ade, P.A. , Balbi, A. et al. , 2001, Phys. Rev.



Ab initio formation energies of FeCr alloys P. Olsson a,*, I.A. Abrikosov b  

E-Print Network (OSTI)

University, Box 534, SE-75121 Uppsala, Sweden c Department of Nuclear and Reactor Physics, Royal Institute Uppsala, Sweden b Condensed Matter Theory Group, Physics Department, AAngstroom Laboratory, Uppsala reactors, face centered cubic (fcc) and hexagonal close packed (hcp) phases were considered in order


Phenotypic Data Collection and Sample Preparation for Genomics of Wood Formation and Cellulosic Biomass Traits in Sunflower: Ames, IA location.  

Science Conference Proceedings (OSTI)

Three fields were planted in Ames in 2010, two association mapping fields, N3 and A, and a recombinant inbred line field, N13. Phenotype data and images were transferred to UGA to support genetic and genomic analyses of woody biomass-related traits.

Marek, Laura F.



Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513


Pb-Free Sn-Ag-Cu-Mn Solder - Energy Innovation Portal  

Anderson, Iver E. (Ames, IA), Harringa, Joel (Ames, IA), Walleser, Jason K. (Idaho Falls, IA) Assignee: Iowa State University Research Foundation, ...



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George
