Powered by Deep Web Technologies
Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

The greenhouse gases HFCs, PFCs Danish consumption and emissions, 2007  

E-Print Network [OSTI]

The greenhouse gases HFCs, PFCs and SF6 Danish consumption and emissions, 2007 Tomas Sander Poulsen AND EMISSION OF F-GASES 7 1.1.1 Consumption 7 1.1.2 Emission 7 1.1.3 Trends in total GWP contribution from F 21 4 EMISSION OF F-GASES 23 4.1.1 Emissions of HFCs from refrigerants 23 4.1.2 Emissions of HFCs from

2

Bons Ventos Geradora de Energia S A | Open Energy Information  

Open Energy Info (EERE)

Bons Ventos Geradora de Energia S A Bons Ventos Geradora de Energia S A Jump to: navigation, search Name Bons Ventos Geradora de Energia S.A. Place Fortaleza, Ceara, Brazil Sector Wind energy Product Brazilian-based wind project developer, subsidiary of Grupo Servtec. Coordinates -3.718404°, -38.542924° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-3.718404,"lon":-38.542924,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

3

Bon Homme County, South Dakota: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Bon Homme County, South Dakota: Energy Resources Bon Homme County, South Dakota: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.9814835°, -97.87216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.9814835,"lon":-97.87216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

Bon Homme Yankton El Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

Yankton El Assn, Inc Yankton El Assn, Inc Jump to: navigation, search Name Bon Homme Yankton El Assn, Inc Place South Dakota Utility Id 1898 Utility Location Yes Ownership C NERC Location MRO Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Coincidental Peak Billing Industrial Demand & Energy Billing 75-350 kva Commercial Farm Single-Phase Residential Interruptible Commercial Irrigation Single-Phase Uncontrolled Industrial Irrigation, Off Season Industrial Irrigation, Single-Phase Controlled Industrial Irrigation, Single-Phase Controlled Pivot Energy Only Commercial

5

Microsoft PowerPoint - UTSRWorkshop-Oct2010-Bons.pptx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS DESIGNING TURBINE ENDWALLS FOR DEPOSITION RESISTANCE WITH 1400C COMBUSTOR EXIT TEMPERATURES AND SYNGAS WATER VAPOR LEVELS Ch i S ith B tt B k P h th Sh k Chris Smith, Brett Barker, Prashanth Shankaran Josh Webb, Brian Casaday Dr. Ali Ameri, Dr. Jeffrey Bons "THE" OHIO STATE UNIVERSITY THE OHIO STATE UNIVERSITY Robert Laycock, Dr. Thomas Fletcher "THE" BRIGHAM YOUNG UNIVERSITY "THE" BRIGHAM YOUNG UNIVERSITY (3-year grant awarded Oct 2009) 1 MOTIVATION/NEED * Operational Issues -Fuel flexibility (range of feedstock heat release) y ( g ) -Diluent use (e.g. steam) -Filtration requirements * Technical Challenges - Higher firing temperature I d h t t f ( t dil t) - Increased heat transfer (steam diluent) - Potential for increased levels of airborne contaminants

6

Overexpression of wild-type PKD2 leads to increased proliferation and invasion of BON endocrine cells  

SciTech Connect (OSTI)

Carcinoid tumors are rare neuroendocrine tumors with a predilection for the gastrointestinal tract. Protein kinase D (PKD), a novel serine/threonine protein kinase, has been implicated in the regulation of transport processes in certain cell types. We have reported an important role for PKD in stimulated peptide secretion from a human (BON) carcinoid cell line; however, the role of PKD isoforms, including PKD2, in the proliferation and invasion of carcinoid tumors remains unclear. In the present study, we found that overexpression of PKD2 by stable transfection of BON cells with PKD2-wild type (PKD2{sub WT}) significantly increased proliferation and invasion compared to cells transfected with PKD2-kinase dead (PKD2{sub KD}) or pcDNA3 (control). Similarly, inhibition of PKD2 activity with small interfering RNA (siRNA) significantly decreased proliferation and invasion compared to cells transfected with non-targeting control (NTC) siRNA. These data support an important role for PKD2 in carcinoid tumor progression. Targeted inhibition of the PKD family may prove to be a novel treatment option for patients with carcinoid tumors.

Jackson, Lindsey N. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Li Jing [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States); Chen, L. Andy [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Townsend, Courtney M. [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States); Evers, B. Mark [Department of Surgery, University of Texas Medical Branch, Galveston, TX (United States) and Sealy Center for Cancer Cell Biology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: mevers@utmb.edu

2006-09-29T23:59:59.000Z

7

Use of SiBN and SiBON films prepared by plasma enhanced chemical vapor deposition from borazine as interconnection dielectrics  

SciTech Connect (OSTI)

Thin films of silicon boron nitride (SiBN) of typical composition Si{sub 0.09}B{sub 0.39}N{sub 0.51} and silicon boron oxynitride (SiBON) of typical composition Si{sub 0.16}B{sub 0.29}O{sub 0.41}N{sub 0.14} were prepared by plasma enhanced chemical vapor deposition and the properties of these films were evaluated with respect to their suitability as interconnection dielectrics in microelectronic fabrication. Films were deposited on 125 mm silicon substrates in a parallel-plate reactor at a substrate temperature of 400 C and a plasma power of 0.5 W/cm{sup 2}. Boron nitride, for comparison of electrical properties, was deposited from borazine (B{sub 3}N{sub 3}H{sub 6}); silicon boron nitride was deposited from borazine, disilane (Si{sub 2}H{sub 6}), and ammonia (NH{sub 3}); silicon boron oxynitride was deposited from borazine, disilane, ammonia, and nitrous oxide (N{sub 2}O). Metal-insulator-metal capacitors were fabricated and electrical measurements indicated that all three films had excellent dielectric properties with dielectric constants of 4.1, 4.7, and 3.9 for BN, SiBN, and SiBON, respectively. Tests of conformality indicated that deposition into trenches with an aspect ratio of 4:1 gave conformality greater than 70%. Silicon boron oxynitride was shown to be an excellent barrier to the diffusion of copper. A planar, single level metal-insulator structure was constructed using a SiBN/SiBON insulator with copper metallization.

Kane, W.F.; Cohen, S.A.; Hummel, J.P.; Luther, B. [IBM Research Div., Yorktown Heights, NY (United States). T.J. Watson Research Center; Beach, D.B. [Oak Ridge National Lab., TN (United States). Chemical and Analytical Sciences Div.

1997-02-01T23:59:59.000Z

8

Combining VisNIR hyperspectral imagery and legacy measured soil profiles to map subsurface soil properties in a Mediterranean area (Cap-Bon, Tunisia)  

Science Journals Connector (OSTI)

Abstract Previous studies have demonstrated that Visible Near InfraRed (VisNIR) hyperspectral imagery is a cost-efficient way to map soil properties at fine resolutions (~5m) over large areas. However, such mapping is only feasible for the soil surface because the effective penetration depths of optical sensors do not exceed several millimeters. This study aims to determine how VisNIR hyperspectral imagery can serve to map the subsurface properties at four depth intervals (1530cm, 3060cm, 60100cm and 30100cm) when used with legacy soil profiles and images of parameters derived from digital elevation model (DEM). Two types of surfacesubsurface functions, namely linear models and random forests, that estimate subsurface property values from surface values and landscape covariates were first calibrated over the set of legacy measured profiles. These functions were then applied to map the soil properties using the hyperspectral-derived digital surface soil property maps and the images of landscape covariates as input. Error propagation was addressed using a Monte Carlo approach to estimate the mapping uncertainties. The study was conducted in a pedologically contrasted 300km2-cultivated area located in the Cap Bon region (Northern Tunisia) and tested on three soil surface properties (clay and sand contents and cation exchange capacity). The main results were as follows: i) fairly satisfactory (cross-validation R2 between 0.55 and 0.81) surfacesubsurface functions were obtained for predicting the soil properties at 1530cm and 3060cm, whereas predictions at 60100cm were less accurate (R2 between 0.38 and 0.43); ii) linear models outperformed random-forest models in developing surfacesubsurface functions; iii) due to the error propagations, the final predicted maps of the subsurface soil properties captured from 1/3 to 2/3 of the total variance with a significantly decreasing performance with depth; and iv) these maps brought significant improvements over the existing soil maps of the region and showed soil patterns that largely agreed with the local pedological knowledge. This paper demonstrates the added value of combining modern remote sensing techniques with old legacy soil databases.

Philippe Lagacherie; Anne-Ruth Sneep; Ccile Gomez; Sinan Bacha; Guillaume Coulouma; Mohamed Hdi Hamrouni; Insaf Mekki

2013-01-01T23:59:59.000Z

9

Trifluoroacetic acid from degradation of HCFCs and HFCs: A three-dimensional modeling study  

E-Print Network [OSTI]

Diego, Calif. , 1977. Wallington, T. J. , M.D. Hurley, J. C.26, 1318-1324, 1992. Wallington, T. J. , M.D. Hurley, J. M.data reported by Wallington et al. [1996] indicate that the

Kotamarthi, V. R; Rodriguez, J. M; Ko, M. K. W; Tromp, T. K; Sze, N. D; Prather, Michael J

1998-01-01T23:59:59.000Z

10

Case Study No. 2: Bon Apptit Management Company  

E-Print Network [OSTI]

and hormone use, seafood health and sustainability,began with a sustainable seafood educational tour around thelearning how to make better seafood choices. This effort

Thistlethwaite, Rebecca; Brown, Martha

2010-01-01T23:59:59.000Z

11

September/October 2006 Out of the Ivory Tower Safety of HFCS GM plants: GM-less Pollen  

E-Print Network [OSTI]

printed in the article was a little more information that I shared on Imperial Valley beekeeping. I also on to say that honey bee colonies survived in Imperial County where temperatures reached 120 degrees F in the Imperial County area, at least one beekeeper said that if they wanted to know what went on in deep

Ferrara, Katherine W.

12

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solvents solvents B-6 Pre-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 Co 2 CaPture from igCC gas streams using aC-abC ProCess primary project goals SRI International is developing, for integrated gasification combined cycle (IGCC)-based power plants, a carbon dioxide (CO 2 ) capture technology based on the use of a high-ca- pacity and low-cost aqueous ammoniated solution containing ammonium carbonate (AC), which reacts with CO 2 to form ammonium bicarbonate (ABC).

13

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

solvents solvents B-198 Post-Combustion solvents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 DeveloPment anD Demonstration of Waste heat integration With solvent ProCess for more effiCient Co 2 removal from Coal-fireD flue gas primary project goals Southern Company Services is developing viable heat integration methods for the capture of carbon dioxide (CO 2 ) produced from pulverized coal (PC) combustion. The project will quantify energy-efficiency improvements to the CO 2 capture process by utilizing a waste heat recovery technology, High-Efficiency System (HES). technical goals * Reduction of the amount of extraction steam required for sensible heat load in the

14

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sorbents sorbents B-302 Post-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 benCh-sCale DeveloPment anD testing of raPiD Pressure swing absorPtion for Carbon DioxiDe CaPture primary project goals WR Grace and the University of South Carolina are developing a rapid pressure swing adsorption (PSA) process to evaluate concept cost and performance benefits by testing a bench-scale system using a low-cost, structured adsorbent with low-pressure drop, high mass-transfer rates, high capacity, and high availability that will enable large feed through- puts. technical goals * Develop an attrition-resistant and low-pressure drop structured adsorbent based on a

15

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sorbents sorbents B-14 Pre-Combustion sorbents u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 aDvanCeD Carbon DioxiDe CaPture teChnology for low-rank Coal integrateD gasifiCation CombineD CyCle (igCC) systems primary project goals TDA will investigate the technical and economic advantages of using an integrated carbon dioxide (CO 2 ) sorbent and water-gas shift (WGS) catalyst system in an integrated gasifi- cation combined cycle (IGCC) power plant, fueled with low-rank coal, and designed to capture more than 90% of the CO 2 emissions. technical goals * TDA will evaluate the physical mix of the sorbent and catalyst pellets within the same

16

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AdvAnced compression AdvAnced compression B-540 AdvAnced compression U.s. depArtment of energy AdvAnced cArbon dioxide cAptUre r&d progrAm: technology UpdAte, mAy 2013 novel concepts for the compression of lArge volUmes of co 2 primary project goals Southwest Research Institute (SwRI) is developing novel compression technology concepts to reduce carbon dioxide (CO 2 ) compression power requirements by 10% compared to conventional compressor designs. The basic concept is a semi-isothermal compression pro- cess where the CO 2 is continually cooled using an internal cooling jacket rather than using conventional interstage cooling. The project has completed thermodynamic (Phase I) and prototype testing (Phase II). A full-scale demonstration of a multi-stage, internally cooled

17

Appendix B: CArBon dioxide CApture teChnology SheetS  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

membranes membranes B-370 Post-Combustion membranes u.s. DePartment of energy aDvanCeD Carbon DioxiDe CaPture r&D Program: teChnology uPDate, may 2013 eleCtroChemiCal membrane for Carbon DioxiDe CaPture & Power generation primary project goals FuelCell Energy, Inc. (FCE) is developing an electrochemical membrane (ECM)-based Combined Electric Power and Carbon Dioxide Separation (CEPACS) system for carbon dioxide (CO 2 ) capture that also provides additional electrical power generation. The project includes bench-scale testing of an 11.7 m 2 -area ECM (molten carbonate fuel cell) system for CO 2 capture, purification, and compression. technical goals * Perform contaminant effect testing to establish maximum permissible concentrations of

18

E-Print Network 3.0 - activities bon voyage Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that Voyager is seeing activity upstream of the shock... Relation between the solar wind dynamic pressure at Voyager 2 and the energetic particle events... at Voyager 1...

19

Appendix B: CArBon dioxide CApture teChnology SheetS R&D CollaboRations  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

R&D CollaboRations R&D CollaboRations B-556 R&D CollaboRations U.s. DepaRtment of eneRgy aDvanCeD CaRbon DioxiDe CaptURe R&D pRogRam: teChnology UpDate, may 2013 paRtneRship foR Co 2 CaptURe primary project goals The University of North Dakota Energy and Environmental Research Center (UNDEERC) is conducting pilot-scale testing to demonstrate and evaluate a range of carbon dioxide (CO 2 ) capture technologies to develop key technical and economic information that can be used to examine the feasibility of capture technologies as a function of fuel type and system configuration. technical goals * Integrate a high-efficiency flexible capture system with existing pilot-scale combustion

20

Appendix B: CArBon dioxide CApture teChnology SheetS Oxy-COmbustiOn  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxy-COmbustiOn Oxy-COmbustiOn B-424 Oxy-COmbustiOn u.s. Department Of energy aDvanCeD CarbOn DiOxiDe Capture r&D prOgram: teChnOlOgy upDate, may 2013 Oxygen transpOrt membranes fOr inDustrial appliCatiOns primary project goals Praxair is optimizing oxygen transport membrane (OTM) performance, materials, and process configurations leading to subsequent development-scale testing of OTM technology for synthesis gas (syngas) production applications, providing valuable experience needed to develop commercial OTM technology in industrial applications and future utility-scale

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Appendix B: CArBon dioxide CApture teChnology SheetS Oxygen PrOductiOn  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Oxygen PrOductiOn Oxygen PrOductiOn B-500 Oxygen PrOductiOn u.S. dePartment Of energy advanced carbOn diOxide caPture r&d PrOgram: technOlOgy uPdate, may 2013 itm Oxygen technOlOgy fOr integratiOn in igcc and Other advanced POwer generatiOn SyStemS primary project goals Air Products and Chemicals set out to design and develop an ion transport membrane (ITM) based on ceramics that selectively transport oxygen (O 2 ) ions when operated at high temperature. This high-temperature process may be integrated with advanced power genera- tion processes that require O 2 as a feedstock, such as integrated gasification combined cycle (IGCC) and other clean energy and industrial applications. technical goals * Design, construct, and operate a 0.1-ton/day (TPD) technology development unit

22

Berlin, le 25 janvier 2007 Evaluation et politiques: Y a-t-il de bons indicateurs pour la recherche?  

E-Print Network [OSTI]

(derived from the works of Amartya Sen). Then I try to apply these conceptions towards research evaluation

Paris-Sud XI, Université de

23

Combining boron isotopes and carbamazepine to trace sewage in salinized groundwater: a case study in Cap Bon, Tunisia  

E-Print Network [OSTI]

treatment and so recognized as a pertinent tracer of wastewater contamination. The system equilibrium of Research in Rural Engineering of Water and Forestry), rue Hédi Karray, B.P.10- 2080 Ariana, Tunisia based on a managed aquifer recharge with treated wastewater. Water quality monitoring was implemented

Paris-Sud XI, Université de

24

US Army Corps of Engineers Portland District  

E-Print Network [OSTI]

) 1,200 Steelhead Kelt passage at BON Passage behavior to inform decision on BON powerhouse priority

25

The Darlington Centre and Forum Restaurant 174 City Road, Darlington NSW 2008 Ph: 9351 4664 Email: forum.restaurant@sydney.edu.au Bon Appetite!  

E-Print Network [OSTI]

and crafted so you can eat fresh, seasonal produce sourced from ethical and sustainable suppliers. #12;The with a shot of Pedro Jimenez Sherry and 9 a shot of Black Rose tea COFFEE & TEA Toby's Estate: Latte Paraguay and real cola nut grown by the Mende & Temne people of Sierra Leone. Lemmy Lemonade: Give your

Viglas, Anastasios

26

Motion plan n in g for m ulti-robot assem bly M . BON ER T, L. H. SHU and B. BEN H ABIB  

E-Print Network [OSTI]

-type optim ization problem s. H owever, in these augm ented TSPs (TSP+) , both the `sales- person' (a robot, Euclidean, Ch ebysh ev, prize collectin g an d tim e-depen - den t TSP variation s ( Dubowsky an d Blubaugh

Shu, Lily H.

27

This article was downloaded by: [b-on: Biblioteca do conhecimento online ISPA] On: 15 January 2013, At: 09:17  

E-Print Network [OSTI]

-401, Coimbra, Portugal b Eco-Ethology Research Unit & Centro de Biociências, ISPA, Rua Jardim do Tabaco 34, 1149-041, Lisboa, Portugal c ICNB ­ DGACZH, Reserva Natural do Paul de Arzila, Rua do Bairro 1, 3045 do Porto, Campus Agrário de Vairão, Rua Padre Armando Quintas, P-4485-661, Vairão, Portugal e

28

Wind Power and the Clean Development Mechanism  

E-Print Network [OSTI]

Biogas Cement HFCs Geothermal EE Households Solar N2O Fugitive Tidal EE Service Transport Energy distrib 200 300 400 500 600 700 Lara Landfill (10 MW) Korat Biogas (3 MW) Rukmani Rice Husk (10 MW) Palestina

29

Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto

2007-09-01T23:59:59.000Z

30

Old Oyo Influences on the Transformation of Lucum Identity in Colonial Cuba  

E-Print Network [OSTI]

The Bon Maroon Wars in Suriname. Leiden: E. J. Brill, 1990.and Musical Transformations in Suriname c. 1775 until afterand Susu Xylophones in Suriname. Paper presented at

Lovejoy, Henry B.

2012-01-01T23:59:59.000Z

31

Download  

Science Journals Connector (OSTI)

Sep 10, 1975 ... cepts radiant energy and uses it to pro- duce new ... Here we present an alternative derivation of Ban- ..... and particulate organic car- bon were...

2000-01-11T23:59:59.000Z

32

tel-00550139,version1-23Dec2010 tel-00550139,version1-23Dec2010  

E-Print Network [OSTI]

'ai eues avec bon nombre de chercheurs du DMSC. Merci à vous Bertrand, Christian, Daniel(s), Françoise

Paris-Sud XI, Université de

33

Download  

Science Journals Connector (OSTI)

Production of chlorinated hydrocarbons and methyl iodide by the red microalga. Porphyridium .... bons were extracted from the water samples by purging and.

1999-05-20T23:59:59.000Z

34

Atmos. Chem. Phys., 8, 31413147, 2008 www.atmos-chem-phys.net/8/3141/2008/  

E-Print Network [OSTI]

. Wallington2 1Department of Chemistry, University of Copenhagen, Universitetsparken 5, 2100 Copenhagen catalytic ozone destruc- tion cycles (Wallington et al., 1994). The atmospheric life- time of HFCs is determined by their reactivity towards OH Correspondence to: T. J. Wallington (twalling@ford.com) radicals

Meskhidze, Nicholas

35

Honeywell developing low-GWP liquid blowing agent for foam insulation  

Science Journals Connector (OSTI)

Honeywell reports that it is developing a new blowing agent with low global warming potential (GWP) for energy-efficient polyurethane foam insulation. The non-flammable liquid blowing agent will provide customers with an alternative to hydrocarbons and traditional hydrofluorocarbons (HFCs) and assist customers in reducing the overall environmental impact of foam, the company says.

2009-01-01T23:59:59.000Z

36

Transportation and Greenhouse Gas Emissions: Measurement, Causation and Mitigation  

E-Print Network [OSTI]

% of the carbon dioxide we produce. As such it is a leading candidate for greenhouse gas ((GHG) (CO2, NH4, HFCs.S. CO2 emissions sources. U.S. CO2 transportation emissions sources by mode. #12;CenterTransportation and Greenhouse Gas Emissions: Measurement, Causation and Mitigation Oak Ridge

37

Multi-Agent Based Techniques for Coordinating the Distribution of Electricity in a Micro-Grid Environment  

E-Print Network [OSTI]

vehicles, to ultra-low carbon vehicles (ULCV) such as hybrids, electric vehicles and hydrogen fuel cell. 2 Background Research To reduce carbon emissions and ensure that the UK low car- bon emissions plan to the current national grid, the in- creasing demand for electricity will only result in more car- bon emissions

Southampton, University of

38

Studies on Biological Effects of Ion Beams on Lethality, Molecular Nature of Mutation, Mutation Rate, and Spectrum of Mutation Phenotype for Mutation Breeding in Higher Plants  

Science Journals Connector (OSTI)

......rearrangements preferably induced by car- bon ions have different molecular...mutant, suv2-1, which is defective in cell-cycle arrest in response...Rearrangement of the DNA in car- bon ion-induced mutants...mutant in Arabidopsis thaliana is defective in the DNA damage response......

Atsushi Tanaka; Naoya Shikazono; Yoshihiro Hase

2010-05-01T23:59:59.000Z

39

Radiation-induced ICAM-1 Expression via TGF-?1 Pathway on Human Umbilical Vein Endothelial Cells; Comparison between X-ray and Carbon-ion Beam Irradiation  

Science Journals Connector (OSTI)

......expression in cells irradiated with car- bon-ion beam and the same...HUVE cells at 48 hours after car- bon beam irradiation. ICAM-1...human lymphoblasts and mice are defective in radiation- induced apoptosis...endothelial growth factor in lung car- cinoma cells. Int J Radiat......

Hiroki Kiyohara; Yasuki Ishizaki; Yoshiyuki Suzuki; Hiroyuki Katoh; Nobuyuki Hamada; Tatsuya Ohno; Takeo Takahashi; Yasuhiko Kobayashi; Takashi Nakano

2011-05-01T23:59:59.000Z

40

PUBLICATIONS, CONFERENCE PRESENTATIONS AND REPORTS Refereed Publications  

E-Print Network [OSTI]

Petroleum Technology, February 2008, Vol. 47, No.2, 52-61. 25. Bon, J., Sarma, H.K., Rodrigues, J.T. and Bon, J.G., "Reservoir Fluid Sampling Revisited - A Practical Perspective", SPE Reservoir Evaluation in SPE News Australasia, October/November 2003, Issue 79. 17. H.K. Sarma, N. Yazawa, R.G. Moore, S

Williams, John M.

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

High-temperature formation of concentric fullerene-like structures within foam-like carbon: Experiment and molecular dynamics simulation  

E-Print Network [OSTI]

car- bon ion implantation,4 and arc discharge from a carbon target in water.5 Onionlike structures of concentric fullerene-like structures, car- bon onions can be formed in a variety of harsh environments laser operating at 532 nm, generating 12 ps pulses at a rep- etition rate of 1.5 MHz, with average power

Powles, Rebecca

42

Estimation of Yields of OH Radicals in Water Irradiated by Ionizing Radiation  

Science Journals Connector (OSTI)

......simulations by Monte Car- lo method have...time being, an alternative approach may still...the spur. The energy Es to form a spur...a function of energy (keV/amu...protons, helium- , car- bon-, neon...Solution with Car- bon- and Nitrogen...Chemistry of High-Energy Carbon, Neon......

Hiroshi Yamaguchi; Yukio Uchihori; Nakahiro Yasuda; Masashi Takada; Hisashi Kitamura

2005-09-01T23:59:59.000Z

43

The relationship between electronmolecule collision cross?sections, experimental Townsend primary and secondary ionization coefficients and constants, electric strength and molecular structure of gaseous hydrocarbons  

Science Journals Connector (OSTI)

...and constants, electric strength and molecular...hydrogen atoms/car- bon{hydrogen...relevant electron energy range being deter...Townsend ionization; electric strength; molecular...length (i.e. car- bon nucleus...the same in the energy range of interest...Lond. A (2000) Electric characteristics...

2000-01-01T23:59:59.000Z

44

Constitution (1987). Haitian French Creole  

E-Print Network [OSTI]

jistis tout bon vre. 3. Konstitisyon sa a la, pou peyi d Ayiti kanpe solid, pou li kanpe an fm, an pami tout nasyon. Pou li pa restavk okenn lot peyi. Pou li kenbe tou sa ki f Ayisyen, se Ayisyen tout bon, ni nan sa yo mete konfyans yo ladan, ni... nan jan yo viv, ni nan fason youn svi ak 1L 4. Konstitisyon sa a la, pou demokrasi pouse bon rasin nan peyi a. Pou tout moun gen dwa suiv lide yo lib. Pou direksyon peyi a pa toujou rete nan men menm moun ak menm gwoup moun tout tan. Pou psonn...

1994-01-01T23:59:59.000Z

45

EIA - Greenhouse Gas Emissions - High-GWP gases  

Gasoline and Diesel Fuel Update (EIA)

5. High-GWP gases 5. High-GWP gases 5.1. Total emissions Greenhouse gases with high global warming potential (high-GWP gases) are hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), and sulfur hexafluoride (SF6), which together represented 3 percent of U.S. greenhouse gas emissions in 2009. Emissions estimates for the high-GWP gases are provided to EIA by the EPA's Office of Air and Radiation. The estimates for emissions of HFCs not related to industrial processes or electric transmission are derived from the EPA Vintaging Model. Emissions from manufacturing and utilities are derived by the EPA from a mix of public and proprietary data, including from the EPA's voluntary emission reduction partnership programs. For this year's EIA inventory, 2008 values for HFC-23 from HCFC-22

46

Novel Complexes Featuring Unusual Polynuclear Co(III)-Fe(III...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

E.N. Chygorin, O.V. Nesterova, J.A. Rusanova, V.N. Kokozay, V.N. Bon (Kiev University, Ukraine), R. Boa, (Trnava University, Slovakia) Fig. 2. 77 K Mssbauer spectrum of the...

47

PROPOSITION (Allocation de  

E-Print Network [OSTI]

appliquées) avec un gout pour la théorie et des compétences avérées en programmation. Un bon niveau de

Jeanjean, Louis

48

Supercomputer Analysis of Sedimentary Basins  

Science Journals Connector (OSTI)

...expelled from source rocks, hydrocar-bons...accumulate into petroleum reservoirs. Reservoirs may form in rocks that resisted compaction...In Eq. 1, + is porosity, a and, 3 are...kz are directional permeabilities,, u is fluid viscosity...

CRAIG M. BETHKE; STEPHEN P. ALTANER; WENDY J. HARRISON; CRAIG UPSON

1988-01-15T23:59:59.000Z

49

Detecting and quantifying oxygen functional groups on graphite nanofibers by fluorescence labeling  

E-Print Network [OSTI]

as adsorbents for small organic molecules from aqueous streams [5], electrodes for fuel cells [6], hydrogen 0008 that was detected by FLOSS on nitric acid-oxidized GCNFs totaled approximately 2.5% of surface car- bon, present

Borguet, Eric

50

Glucose Fermentation Pathway of Thermoanaerobium brockii  

Science Journals Connector (OSTI)

...the growth phase, cell suspensions were...toluene-treated cell suspensions were...L-lactate, acetate, hydrogen, and car- bon dioxide production...Clostridium pasteurianum. Cell extracts also contained...catabolic amounts of hydrogen- ase, phosphotransacetylase...

R. Lamed; J. G. Zeikus

1980-03-01T23:59:59.000Z

51

Aerosol Science and Technology, 44:11401145, 2010 Copyright American Association for Aerosol Research  

E-Print Network [OSTI]

application in fuel cells and sensors involving adsorp- tion and dissociation of hydrogen, oxygen, and various. Activated carbon, car- bon nanotubes (CNTs), carbon nanosheets, and silica (SiO2) gel have often been

Huang, Jiaxing

52

Investigation into the Effect of Surface Treatment on the Wettability and the Bondability of Low Surface Energy Materials  

Science Journals Connector (OSTI)

An experimental effort has been undertaken to examine the effect of surface treatment on various low surface energy thermoplastic materials to promote wettability and ... measurements were correlated with the bon...

J. P. Jeandrau

1984-01-01T23:59:59.000Z

53

Bibliography and Index of the Literature on Gas Chromatography1964 November 1, 1963 to November 1, 1964  

Science Journals Connector (OSTI)

......Abstract) 941 GAS-SOLID ADSORPTION...HYDROCAR- BONS AND NITROGEN HETEROCYCLES...FRESH - AND SALT WATER ALGAE, Klenk...DEVICE FOR A GAS CHROMATOGRAPH...April 1964) 1080 SOLUBILITY IN WATER OF PARAFFIN...CORRELATION OF GAS CHROMATO- GRAPHIC......

Mignon Gill; Seaton T. Preston; Jr.

1964-12-01T23:59:59.000Z

54

portation and Greenhouse Gas (MUNTAG) model is a macroscopic, highly aggregate model that works at the municipal level and solely  

E-Print Network [OSTI]

identifies the following four sectors: buildings; trans- portation and land use; energy supply; and municipal GHG inventory. This work is part of a project to write a guide called Getting to Car- bon Neutral

Illinois at Chicago, University of

55

Three-dimensional spatial coordinates of individual plankton ...  

Science Journals Connector (OSTI)

A highly unsaturated fatty acid predicts car- bon transfer ... 2,400 ml of water, at 750 mm depth, can be analysed with a resolution ..... power of the technique.

1910-00-71T23:59:59.000Z

56

The Jovian system: the last outpost for life?  

Science Journals Connector (OSTI)

......and other sources of energy. This material accumulated...methane, ammonia and car- bon dioxide. However...time. In addition, energy sources available on...atmosphere interface. An alternative energy source to surface-based......

Julian Hiscox

1999-04-01T23:59:59.000Z

57

POLZ, MARTIN F., JONATHAN J. ROBINSON, COLLEEN M ...  

Science Journals Connector (OSTI)

efficiently the abundant yet ephemeral local energy sources, primarily geothermally .... parative analyses of the ratios of the stable isotopes of car- bon and nitrogen. ..... Our experiments were designed to test the two alternative hypotheses that...

58

Site-specific and ontogenetic variations in nutrition of mussels ...  

Science Journals Connector (OSTI)

a consistent energy source throughout their life or if they switch trophic modes depending on ... a significant contribution of photosynthetically derived car- bon. As postmetamorphic ..... alternative hypothesis is that larval and postlarval carbon

1999-03-11T23:59:59.000Z

59

Tumor Induction in Mice Locally Irradiated with Carbon Ions: A Retrospective Analysis  

Science Journals Connector (OSTI)

......dose fractionation nor linear energy transfer affected tumor induction...700 patients by Year 2004. Car- bon ions, high LET (linear energy transfer) radiation, are...penumbra near collimators. Alternative explanation for the linear......

Koichi Ando; Sachiko Koike; Chisa Oohira; Toshiaki Ogiu; Fumio Yatagai

2005-06-01T23:59:59.000Z

60

the page - American Society of Limnology and Oceanography  

Science Journals Connector (OSTI)

May 28, 1981 ... We thank A. F. Carlucci and C. C. Price for providing the cultures and K. J. ..... threne (a fossil fuel aromatic hydrocar- bon) show essentially zero...

2000-02-08T23:59:59.000Z

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Purification de l'hexafluorure d'uranium.  

E-Print Network [OSTI]

??Lhexafluorure duranium (UF6), est le seul compos utilis ltat gazeux dans les procds denrichissement pour la production du combustible nuclaire. Pour le bon droulement (more)

Benzouaa, Rachid

2014-01-01T23:59:59.000Z

62

Padova, 29 novembre 2010 Arturo Lorenzoni  

E-Print Network [OSTI]

energy technologies have to give proper answers to 2 main challenges in the long term. We need to find the sustainable soluBons to the energy supply conundrum. Most energy companies have very short Bme horizons due to stock

Schenato, Luca

63

fois, ils semblent aussi impliqus dans une tape postrieure l'initiation qui est la promo-  

E-Print Network [OSTI]

E.A. & Recknagel R.O. (1983) Carbon tetrachloride and bromotrichloromethane toxi- city. Dual role.A., Fernan- dez Y. & Mitjavila S. (1986) Radical activation of car- bon tetrachloride in foetal and maternal

Paris-Sud XI, Université de

64

Tribology International 40 (2007) 345349 A comparative study on the structure and hardness enhancement  

E-Print Network [OSTI]

by a combination of soft BON film and hard TiN film using low- (100 kHz) and high (13.56 MHz)-frequency RF plasma) substrate by low and high RF frequency plasma-assisted metal­organic chemical vapor deposition rights reserved. Keywords: Hard coatings; A-BON/nc-TiN bilayers; PAMOCVD; Low- and high-frequency RF

Boo, Jin-Hyo

65

Donald Frederick, LLNL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Donald Donald Frederick, LLNL - Presented at Supercomputing '11 Lawrence Livermore National Laboratory, P. O. Box 808, Livermore, CA 94551! Case Study: Beyond Homogeneous Decomposition with Qbox Scaling Long-Range Forces on Massively Parallel Systems LLNL---PRES---508651 Case S tudy: O utline * Problem D escripBon * ComputaBonal A pproach * Changes f or S caling LLNL---PRES---508651 Computer s imulaBons o f m aterials Computer s imulaBons a re w idely used t o p redict t he p roperBes o f new m aterials o r u nderstand t he properBes o f e xisBng o nes LLNL---PRES---508651 SimulaBon o f M aterials f rom F irst--- Principles First---principles m ethods: Calculate p roperBes o f a g iven m aterial d irectly f rom fundamental p hysics e quaBons. * No e mpirical p arameters Can m ake p redic-ons a bout c

66

Investigation of Soap Powders  

E-Print Network [OSTI]

in the presence of such a large excess of NajjSO* as is usually present, does not give a sharp end point, but a gradual fading from yellow to pink so that some little practice is necessary before the operator can hit the end point accurately. Practice does... and soap. Bon Ami Manufactured by Bon Ami Company, New York, I. Y. Wt. 10 ounces Price 10 cents. Analysis. Moisture .......... 0.28# Soap 6.54# Albite 93,18# Total 100.00^ IT. B. Albite is an orthoclase of the following composition: Si0 2 68...

Bragg, G.A.

1913-01-01T23:59:59.000Z

67

Ann bay lodyans 5 / se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network [OSTI]

genyen. Tijo we yon tig ki te tonbe nan yon gwo twou. Li pa t kapab soti paske twou a fon. Kounye a tig la prizonye. Li di Tijo: "Ou se yon bon ti gason, ede m soti, souple." Tijo reponn: "Si mwen retire ou nan twou a, ou ap manje m." Tig la di: "O... non, bon ti pitit mwen, mwen p ap manje ou. Pa panse sa, non." Tijo mande li: "Eske ou ap pwomet mwen ou p ap manje m?" "Wi, pwomes fet," tig la di I avek gwo vwa li. Tijo ede tig la soti nan twou a. Le tig la fin soti, li vole sou T i j...

Freeman, Bryant C.

2000-01-01T23:59:59.000Z

68

Demonstration of high efficiency elastocaloric cooling with large ?T using NiTi wires  

Science Journals Connector (OSTI)

Vapor compression (VC) is by far the most dominant technology for meeting all cooling and refrigeration needs around the world. It is a mature technology with the efficiency of modern compressors approaching the theoretical limit but its environmental footprint remains a global problem. VC refrigerants such as hydrochloroflurocarbons (HCFCs) and hydrofluorocarbons (HFCs) are a significant source of green house gas emissions and their global warming potential (GWP) is as high as 1000 times that of CO2 [Buildings Energy Data Book (Building Technologies Program Department of Energy 2009)]. There is an urgent need to develop an alternative high-efficiency cooling technology that is affordable and environmentally friendly [A. D. Little Report For Office of Building Technology State and Community Programs Department of Energy 2001]. Here we demonstrate that elastocaloric cooling (EC) a type of solid-state cooling mechanism based on the latent heat of reversible martensitic transformation can have the coefficient of performance as high as ?11 with a directly measured ?T of 17?C. The solid-state refrigerant of EC completely eliminates the use of any GWP refrigerants including HCFCs/HFCs.

Jun Cui; Yiming Wu; Jan Muehlbauer; Yunho Hwang; Reinhard Radermacher; Sean Fackler; Manfred Wuttig; Ichiro Takeuchi

2012-01-01T23:59:59.000Z

69

Software/firmware design specification for 10 MW/sub e/ Solar Thermal Central Receiver Pilot Plant  

SciTech Connect (OSTI)

This Collector Subsystem Software/Firmware Design Specification exists as a stand-alone document to provide a complete description of the software and firmware employed for the operation of the 10 MWe Solar Thermal Central Receiver Pilot Plant Collector Subsystem. The software/firmware systems have the capability to allow operator control of up to 2048 heliostats in the operation of the 10 MWe Solar Thermal Central Receiver Pilot Plant at Barstow, California. This function includes the capability of operator-commanded mode control, graphic displays, status displays, alarm generation, system redundancy and interfaces to the Operational Control System (OCS), the Data Acquisition System (DAS), and the Beam Characterization System (BCS) through the OCS. The operational commands will provide for the following: (a) safe beam movement whenever automatic beam movement is required; (b) single and multiple heliostat addressing; (c) emergency heliostat movement for high-wind conditions and receiver problems; and (d) recovery for full or partial power-loss conditions. The control hardware consists of a host computer, the Heliostat Array Controller (HAC), interfaced to a group of communication controllers, the Heliostat Field Controllers (HFCs), communicating with individual processors, the Heliostat Controllers (HCs), which monitor and command a single heliostat. The system consists of two HACs and 64 HFCs with up to 32 HCs per HFC.

Ladewig, T.D.

1982-01-01T23:59:59.000Z

70

Haitian Creole-English English-Haitian Creole Medical Dictionary  

E-Print Network [OSTI]

; orifice, aperture b * corner of mouth - anba upside down chire, ~ manje sores at comer of mouth - dlo salivation * fann harelip, cleft lip; cleft palate - Il anm, ~ II pa bon, ~ II pa gou to have no appetite ~ Il f dio to make one's mouth...

Freeman, Bryant C.

1992-01-01T23:59:59.000Z

71

Geophysical Research Abstracts Vol. 14, EGU2012-PREVIEW, 2012  

E-Print Network [OSTI]

was monitored to trace the effectiveness of artificial recharge, based on boron isotopes, to better determine (Cape Bon, Tunisia): insights from Boron isotopes. L. Cary (1), J. Casanova (1), A. Mekni (2,3), N. Sodium, potassium and boron were clearly in deficit compared to a mixing line with seawater, whereas

Paris-Sud XI, Université de

72

Glacioeustatic Transgressive Reflux: Stratiform Dolomite in Pennsylvanian Bioherms of the Western Orogrande Basin, New Mexico  

Science Journals Connector (OSTI)

...mound rocks from the Virgilian Panther Seep Formation, Hembrillo Canyon...suggesting that, in general, car-bon in the dolomites was derived...alteration of dolomite: A review: Car-bonates and Evaporites, v...Simo, T., eds., Advances in Car-bonate Sequence Stratigraphy...

Gerilyn S. Soreghan; Michael H. Engel; Roger A. Furley; Katherine A. Giles

73

LATTER-DAY TAXIDERMY  

Science Journals Connector (OSTI)

...supposition that he had obtained a compound of car-bon and alumina he gave it the name...by him. For example, a reclini'ng panther, with young, on the whole a fine piece...staff, at one of the entrances, and a panther, in bronaze, within, are examples of...

Vernon L. Kiellogge

1893-09-15T23:59:59.000Z

74

The Molecular Fossil Record of Oleanane and Its Relation to Angiosperms  

Science Journals Connector (OSTI)

...well-defined, organic-rich, fine-grained sedimentary rocks. Commonly...environments contain organic matter derived from...with total organic car-bon...of thermal maturation are minimized...Magdalena Basin, Co-lombia...material from Illinois, United...

J. Michael Moldowan; Jeremy Dahl; Bradley J. Huizinga; Frederick J. Fago; Leo J. Hickey; Torren M. Peakman; David Winship Taylor

1994-08-05T23:59:59.000Z

75

Substrate Utilization by an Oxalate-Consuming Spirillum Species in Relation to Its Growth in Ozonated Water  

Science Journals Connector (OSTI)

...assimilable organic car- bon compounds (AOC), were calculated from the obtained Nmax values and the Y values for acetate. The AOC concen- trations for both strains were...with each oth- er. In ozonated water, AOC concentrations available for strain NOX...

D. van der Kooij; W. A. M. Hijnen

1984-03-01T23:59:59.000Z

76

O P I N I O N Biogenic vs. geologic carbon emissions and forest  

E-Print Network [OSTI]

greenhouse gas (GHG) accounting of woody biomass energy generation. While there are many other environmental, biogenic carbon, carbon debt, forest biomass, greenhouse gas accounting Received 20 April 2011; revised the amount of car- bon in the cycle'. This view recently has been reiterated by many (e.g. Hale, 2010; Lucier

Vermont, University of

77

RALLYE MATHMATIQUE D'AUVERGNE 2013  

E-Print Network [OSTI]

résoudre. Bon courage à tous ! Françoise Barachet, IA-IPR en mathématiques Jean-Alain Roddier, IA-IPR en posées, l'argumentation, la présentation. Conception et Rédaction : IREM, APMEP, IUFM, IA­IPR de

Sart, Remi

78

Role of PeptidePeptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes: A Molecular Dynamics Study  

E-Print Network [OSTI]

, and energy conservation devices.2 Unfortunately, car- bon nanotubes are extremely hydrophobic which leadsRole of Peptide­Peptide Interactions in Stabilizing Peptide-Wrapped Single-Walled Carbon Nanotubes at biopolymers@wiley. com INTRODUCTION S ingle-walled carbon nanotubes (SWNTs) are hollow cylinders formed

Nielsen, Steven O.

79

Chirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C. Thomsen  

E-Print Network [OSTI]

approach and yields the energy splitting for an arbitary chiral angle in metallic nanotubes. SemiconductingChirality dependence of the density-of-states singularities in carbon nanotubes S. Reich and C-of-states singularities in single-walled car- bon nanotubes. Our approximation goes beyond the lowest-order, isotropic

Nabben, Reinhard

80

International Journal of Hydrogen Energy 31 (2006) 7792 www.elsevier.com/locate/ijhydene  

E-Print Network [OSTI]

for fueling automotives to reduce car- bon dioxide emissions, limit dependence on imported petroleum-grade crude oils into transport fuels. World oil refineries and chemical plants' demand for hydrogen-free tech- nologies, including either battery- or fuel-cell--operated vehicles. However, the H2 fuel

Yildiz, Bilge

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Contribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1  

E-Print Network [OSTI]

have come to the forefront as a possible storage medium for hydrogen for fuel-cell de- vices. A number of isotopically substituted hydrogen molecules adsorbed into single-walled car- bon nanotubes are calculated usingContribution of restricted rotors to quantum sieving of hydrogen isotopes B. C. Hathorn,1 B. G

Hathorn, Bryan C.

82

Raman spectroscopy of amorphous, nanostructured, diamondlike carbon, and nanodiamond  

Science Journals Connector (OSTI)

...possible presence of hydrogen and nitrogen. The...magnetic storage disks, car parts, biomedical...alloys, (a) without hydrogen, (b) with hydrogen...C, sp3 C and N. fuel cells. Nanostructured...classified as stage 2 car- bons with increasing...

2004-01-01T23:59:59.000Z

83

One-Carbon Metabolism in Methanogens: Evidence for Synthesis of a Two-Carbon Cellular Intermediate and Unification of Catabolism and Anabolism in Methanosarcina barkeri  

Science Journals Connector (OSTI)

...or methanol. Cell suspensions synthesized...the absence of hydrogen. Cell extracts catalyzed...carriers (i.e., car- boxydihydromethanopterin...the presence of hydrogen gas. Iodopropane...for analysis. Cell suspensions assimilated...intermediate from one-car- bon compounds...

William R. Kenealy; J. G. Zeikus

1982-08-01T23:59:59.000Z

84

Control-oriented input-delay model of the distributed temperature of a SI engine exhaust  

E-Print Network [OSTI]

shifting [8]. This open-loop technique leads to a faster heating of the catalyst but also yields combustion the combustion: hydrocar- bons HC, carbon monoxide CO and nitrogen oxide NOx. Yet, conversion efficiency Delphine to activate chemical re- actions and the catalyst conversion ratio is poor [18]. Therefore, speed

85

through the digestive tract of patients with a malabsorption syndrome. In addition, our  

E-Print Network [OSTI]

digestibility car- bon from dietary CHO. Effect of algal fibre supplementation (Eucheuma cottonii) on intestinal of their nutritional properties, this work inves- tigated the possible effects of algal polysac- charides sequence of test meals (800 g of maize starch + casein) sup- plemented either with 40 g of algal fibres

Boyer, Edmond

86

Name /css_comb_104895/comb_5d11/Mp_1 09/29/2002 01:05AM Plate # 0 pg 1 # 1 Proceedings of the Combustion Institute, Volume 29, 2002/pp. 000000  

E-Print Network [OSTI]

of the Combustion Institute, Volume 29, 2002/pp. 000­000 DIOXIN AND FURAN FORMATION ON CuCl2 FROM CHLORINATED. Heated nitrogen gas streams containing 7.8% oxygen, 1.7% benzene vapor, and equal amounts of 2], poly- cyclic aromatic hydrocarbons [5], and graphitic car- bon [6]. Formation rates from precursors

Mulholland, James A.

87

ELSEVIER Computational Materials Science 2 (1994) 468-474 Modifying the buckyball  

E-Print Network [OSTI]

of C60- inspired carbon fullerenes. At present, the most intensively investigated systems are multi 1994) Abstract Structural and electronic properties of carbon clusters, in particular the C60 triggered a world-wide interest in this novel form of car- bon. The resulting research effort first concen

88

1932-4510/07/$25.002007IEEE SEPTEMBER 2007 | IEEE NANOTECHNOLOGY MAGAZINE | 13 CHONGWU ZHOU, AKSHAY KUMAR, AND KOUNGMIN RYU  

E-Print Network [OSTI]

. The most commonly used techniques include arc discharge, laser ablation, and chemical vapor deposition (CVD). CNTs were first discovered when Iijima examined the prod- ucts from an arc discharge between two far, car- bon nanotubes (CNTs) stand out due to their remarkable electrical, mechani- cal, optical

Zhou, Chongwu

89

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988  

E-Print Network [OSTI]

JOURNAL DE PHYSIQUE Colloque C8, Supplhment au no 12, Tome 49, dhcembre 1988 NEUTRON SCATTERING a better understanding of the magnetic correlations of FegoZrlo we have performed small angle neutron scattering (SANS) and polarized- beam spin rotation experiments on amorphous rib- bons (approximately 25 prn

Boyer, Edmond

90

Structure and Density of Mo and Acid Sites in Mo-Exchanged H-ZSM5 Catalysts for Nonoxidative Methane Conversion  

E-Print Network [OSTI]

of natural gas to higher hydrocar- bons and aromatics remains an important industrial challenge Methane Conversion Richard W. Borry III, Young Ho Kim, Anne Huffsmith, Jeffrey A. Reimer, and Enrique and gas phase transport, exchange at acid sites, and react to form H2O. The amount of H2O evolved during

Iglesia, Enrique

91

Atomic and molecular adsorption on RhMn alloy surface: A first principles study  

E-Print Network [OSTI]

and hydrogen from reforming of natural gas and coal to hydro- carbon Fishcher-Tropsch synthesis and oxygenates- bon and partial oxidation of methane.15 The importance of Rh catalysts on catalytic reactions molecules in terms of the energetics and site preferences on Rh catalysts as well as the effects of Mn added

Li, Weixue

92

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin Choi, and K. J. Chang  

E-Print Network [OSTI]

Defective fullerenes and nanotubes as molecular magnets: An ab initio study Yong-Hyun Kim,* Jin ordering are not well es- tablished, the experimental evidence for ferromagnetic car- bon nanostructures in the magnetic behavior, and suggested a possible link between magnetism and defects in the pure carbon network

93

/ http://www.sciencemag.org/content/early/recent / 3 April 2014 / Page 1 / 10.1126/science.1252268 The availability of high-quality, large, single-crystal Si wafers is funda-  

E-Print Network [OSTI]

separated by defective grain boundaries that degrade their electri- cal and mechanical properties (8, 9 and coalesce into a uniform sin- gle-crystal layer without grain bounda- ry defects, even if the nucleation and the relatively high car- bon solubility hamper the direct growth of high-quality monolayer graphene on Si (16

Napp, Nils

94

JOURNAL OF BACTERIOLOGY, Dec. 2003, p. 71607168 Vol. 185, No. 24 0021-9193/03/$08.00 0 DOI: 10.1128/JB.185.24.71607168.2003  

E-Print Network [OSTI]

are required for growth on C1 substrates; how- ever, mutants defective for the H4MPT pathway reveal a unique characterization of four mutants defective in the H4MPT pathway and place them into three different phenotypic pathway in M. extorquens AM1. Methylotrophic bacteria growing aerobically on single-car- bon (C1

95

Biological Gain of Carbon-ion Radiotherapy for the Early Response of Tumor Growth Delay and against Early Response of Skin Reaction in Mice  

Science Journals Connector (OSTI)

......observed for 77 keV/mm carbon ions. The RBE values of low-LET car- bons (14 and 20 keV/mm) ranged from 1.2 to 1.7, and...T-cells after low-dose gamma-irradiation is not linked with defective Ku86 protein. Int. J. Radiat. Biol. 77: 329339. 27......

Koichi Ando; Sachiko Koike; Akiko Uzawa; Nobuhiko Takai; Takeshi Fukawa; Yoshiya Furusawa; Mizuho Aoki; Yasuyuki Miyato

2005-03-01T23:59:59.000Z

96

ABSTRACTS IN REPORTS CONCERNING ELECTRON MICROSCOPY PUBLISHED IN JAPAN:  

Science Journals Connector (OSTI)

......Thoracic Lymphatics of Living Rabbits and Sites of Escape of Car- bon Particles from the Vessels: Fumihiko KATO (First Dept...deafness. Using light and elect- ron microscopy he studied the defective organ of Corti in Shaker-1 mouse, one strain of congeni......

ABSTRACTS

1967-01-01T23:59:59.000Z

97

POSTER SESSIONS:  

Science Journals Connector (OSTI)

......the other radiosensitive cell lines of SX9 (defective in DNA-PKcs, XRCC7), SX10 (defective in DNA ligase IV) and M10 (XRCC4) were about...Center, Kyoto University. The system includes car- bon K, aluminium K, molybdenum L, iron......

Synchrotron radiation

2002-12-01T23:59:59.000Z

98

ABSTRACTS:  

Science Journals Connector (OSTI)

......central body of the virus vanished or became defective very frequently. 4) In the cytoplasm...The fine structure of martensite in plain car- bon steels has been studied by transmission...around the dislocations and tiny metastable car- bides precipitate in situ. With the......

ABSTRACTS

1965-01-01T23:59:59.000Z

99

THE FORTY-FIRST ANNUAL MEETING OF THE JAPANESE SOCIETY OF ELECTRON MICROSCOPY:  

Science Journals Connector (OSTI)

......000 kV DF is superior to BF up to Ael for gold as well as for car- bon. Despite the larger effect, DF mode at 1,000 kV is...shift in the [TTT] direction. 232 41st Annual Meeting The defective image in the specimen, thinned parallel to the (001) plane......

The Forty-first Annual Meeting of the Japanese Society of Electron Microscopy

1985-01-01T23:59:59.000Z

100

Raman spectroscopy of graphite  

Science Journals Connector (OSTI)

...G for graphite. The other modes are either observed only on defective samples or are very weak in intensity like the G peak that was...al. 2001); a similar behaviour is also observed in other car- bon materials (Ferrari & Robertson 2001; Maultzsch et al...

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Two-Step Mechanism for Low-Temperature Oxidation of Vacancies in Graphene Johan M. Carlsson,1,* Felix Hanke,1  

E-Print Network [OSTI]

for nanoparticles [2]. Controlled oxidation of car- bon materials is also used to add functional oxygen (O) groups (STM) experiments, for instance, demonstrate that the defect-free regions of the basal plane oxygen and attachment of oxygen atoms on defective graphite. However, the main product in these TPD

102

Scanning tunnelling microscopy of carbon nanotubes  

Science Journals Connector (OSTI)

...sheet into a cylinder where the car- bon lattice is joined seamlessly...consist of at least a pair of defective rings, e.g. squares, pentagons...sized (Meunier et al. 1999), defective (Meunier & Lambin 1998, 2000...Blase, X., Devita, A. & Car, R. 1997 Electronic structure...

2004-01-01T23:59:59.000Z

103

Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in  

E-Print Network [OSTI]

nitrogen (N) species and car- bon dioxide (CO2) in the atmosphere globally. Received 18 August 2012Nitrogen Addition Increases Carbon Storage in Soils, But Not in Trees, in an Eastern U.S. Deciduous regions receive elevated rates of atmospheric nitrogen (N) deposition from air pollution. To evalu- ate

Templer, Pamela

104

Introduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1  

E-Print Network [OSTI]

currents encompassing all ocean basins. It transports large amounts of water, heat, salt, car- bon current (ACC) of the Southern Ocean. There, it mixes with other deep water masses like Pacific Deep WaterIntroduction: The Ocean's Meridional Overturning Circulation Andreas Schmittner1 , John C.H. Chiang

Schmittner, Andreas

105

February 18, 2009 The A Priori  

E-Print Network [OSTI]

about some agent's knowledge, we might say something like `that's a priori for him.' [Kripke, 1980 careless about distinguishing a priority from analyticity and necessity. (Roughly: something is a priori of some fairly specific sort, might be required for that. [BonJour, 2005, p.99] ­ The positive condition

Fitelson, Branden

106

THSE DE DOCTORAT DE L'UNIVERSIT PIERRE ET MARIE CURIE  

E-Print Network [OSTI]

pour leur sympathique contribution au bon déroulement de cette thèse. Merci également à l'ensemble des factor CaMK Ca2+ /calmodulin-dependent protein kinases CCI Chronic constriction injury (ligature lâche du and Statistical Manual of Mental Disorders EGF

Paris-Sud XI, Université de

107

Murchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective  

E-Print Network [OSTI]

for inorganic sp2 -bonded carbon. Based on their D/G intensity ratios, those grains were grouped.1), "glassy carbon" (D/G > 1.1), and "unusual sp2 -bonded graphitic car- bon" (with extremely intense 2ndMurchison presolar carbon grains of different density fractions: A Raman spectroscopic perspective

108

Grid 2020: Toward a Policy of Renewable & Distributed Resources  

E-Print Network [OSTI]

;12 Virtual Power Plant: 2002-2020 Multi-direction and variability of DER power flows drive circuit years, which would make solar power less expensive than retail electricity in roughly 20 states" David, DoE, USCHP #12;6 Wide Area CoordinaBon & Controls Location of Variable Wind, Solar

109

Journal of Power Sources 195 (2010) 18411844 Contents lists available at ScienceDirect  

E-Print Network [OSTI]

to react with oxygen, forming water. Recent advances in MFCs have increased power produc- tion or modifying the car- bon surface. In an MFC with anaerobic sludge as the inoculum, power was increased from 0Journal of Power Sources 195 (2010) 1841­1844 Contents lists available at ScienceDirect Journal

110

Structure and interactions in simple solutions  

Science Journals Connector (OSTI)

...cations have with both water and alcohol molecules...concentration and scattering power of each atom type Phil...ensembles containing 300 water molecules and 6 alcohol...CC, the methyl group car- bon sites C, the methyl...group hydrogen H. The water hydrogen sites are labelled...

2004-01-01T23:59:59.000Z

111

Journal of Power Sources 134 (2004) 16 Synthesis and physical/electrochemical characterization of Pt/C  

E-Print Network [OSTI]

Journal of Power Sources 134 (2004) 1­6 Synthesis and physical/electrochemical characterization Department of Mechanical Engineering, Hong Kong University of Science and Technology, Clear Water Bay alloys on a car- bon support. The high surface area of a Pt and its alloys can be rendered by using

Zhao, Tianshou

112

U.S. JGOFS NEWS U.S. JGOFS: A Component of the U.S. Global Change Research Program  

E-Print Network [OSTI]

Global models of the ocean car- bon cycle have two moving parts. First, a production part is used the sunlit eu- photic zone of the ocean is remineralized at each depth horizon in the water column is a power-law function of depth. This curve is used widely in global simulations to repre- sent

McGillicuddy Jr., Dennis J.

113

-Amino acids, although less abundant than their -analogues, are also present in peptides and other natural  

E-Print Network [OSTI]

Polyhydroxyalkanoates (PHAs) are a family of carbon, energy and/or reducing power storage polymers, which a characteristic pro- ton NMR signal at 3.15 ppm for the hydroxy hydrogen at car- bon 3. In our experimental work was consumed. Compound 2 was reacted with sodium azide in water using hexadecyltributylphosphonium bromide

114

THE IMPORTANCE OF THE GAS-GRAIN INTERACTION T. J. Millar  

E-Print Network [OSTI]

of interstellar grains can be described by a power-law: n(a)da / a 3:5 da and combining the op- tical properties atoms and taking up 10% of the total car- bon budget. These molecules, called polycyclic aromatic of water, but con- tain substantial components of methanol, ca

Millar, Tom

115

Z .Surface and Coatings Technology 127 2000 260 265 Characterization of carbon nitride thin films deposited by  

E-Print Network [OSTI]

-screw adapter and monitored by measuring the back reflection power at the end of a water load. A mixture polycrystalline car- bon nitride films, and the resulting mechanical proper- ties are not as good as predicted a valve between the deposition chamber and the vacuum pumps. The microwave power was adjusted by a four

Gao, Hongjun

116

Increasing Proton Exchange Membrane Fuel Cell Catalyst Effectiveness Through Sputter Deposition  

E-Print Network [OSTI]

, University of South Carolina, Columbia, South Carolina 29208, USA b Plug Power, Incorporated, Latham, New and carbon- supported catalyst.3-6 It is this three-phase interface of catalyst, car- bon, and electrolyte typically Nafion® that allows effective gas and water diffusion and proton transport and electron transport

117

VOLUME 93 NUMBER 23 5 JUNE 2012  

E-Print Network [OSTI]

, rainfall, and the concentration of car- bon dioxide [New et al., 1999; Tans et al., 1996 regional networks together to measure the fluxes of carbon dioxide, water vapor, and sen- sible heat are needed to move air to the sen- sor, have access to a power line. The cur- rent generation of carbon

118

ORIGINAL PAPER Evaluating sedimentary geochemical lake-level tracers  

E-Print Network [OSTI]

Walker Lake has been generated through analysis of total inorganic car- bon (TIC), total organic carbon (TOC), and oxy- gen and carbon isotope ratios (d18 O and d13 C) of both downcore bulk TIC and ostracods in %TIC, %TOC, and d13 C and d18 O of TIC and ostracods are all associated to varying degrees with changes

Linsley, Braddock K.

119

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1  

E-Print Network [OSTI]

Magnetic Properties and Diffusion of Adatoms on a Graphene Sheet P. O. Lehtinen,1 A. S. Foster,1 A storage in nanotube based batteries [7], catalytic growth [8], junc- tions [9], and quantum dot creation,17] and diffusion [18] of a car- bon adatom on a graphene sheet, yet the results were markedly different, and none

Nordlund, Kai

120

2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim722 wileyonlinelibrary.com  

E-Print Network [OSTI]

and material degradation is crucial for the rational design of high-performance lithium ion batteries (LIBs-layer graphene nanorib- bons remain mechanically robust after lithiation. This distinct contrast manifests. In addition, a new in situ chemical lithiation method is introduced for fast screening of battery materials

Chen, Sow-Hsin

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

JOURNAL OF BACTERIOLOGY, 0021-9193/01/$04.00 0 DOI: 10.1128/JB.183.8.24632475.2001  

E-Print Network [OSTI]

or 1,2-propanediol requires B12 and provides a car- bon and energy source, but growth. The Alternative Electron Acceptor Tetrathionate Supports B12-Dependent Anaerobic Growth of Salmonella enterica of these carbon sources supports anaerobic growth with any of the alternative electron acceptors tested thus far

California at Davis, University of

122

Relationships between Carcinogenicity and Theoretical Reactivity Indices in Polycyclic Aromatic Hydrocarbons  

Science Journals Connector (OSTI)

...usually several alternatives are available for...meso-9,10-car bon atoms of anthracene...molecular orbital energies are , @= a + mj3...de localization energy @Edel@/f3...led us to examine alternative indices. One such...Table 10. Composite Energy Indices Transformation...

Iden A. Smith; Gregory D. Berger; Paul G. Seybold; and M. P. Serv

1978-09-01T23:59:59.000Z

123

Bioreactor Development for Biological Hydrogen Production  

E-Print Network [OSTI]

Huang National Renewable Energy Laboratory 1617 Cole Boulevard, Golden, CO 80401 ed The biologically-mediated water-gas shift reaction, in which carbon monoxide is oxidized to car- bon dioxide while temperature and lack of equilibrium limitation make the biological shift reaction a promising alternative

124

MEDS and PocR are novel domains with a predicted role in sensing simple hydrocarbon derivatives in prokaryotic signal transduction systems  

Science Journals Connector (OSTI)

......genes encoding alternative sigma factors in...1999Aerotaxis and other energy-sensing behavior...dichloromethane as the sole car-bon and energy source, DcmR dissociates...genes encoding alternative sigma factors in...Aerotaxis and other energy-sensing behavior......

Vivek Anantharaman; L. Aravind

2005-06-01T23:59:59.000Z

125

Recent Insights into the Biological Action of Heavy-Ion Radiation  

Science Journals Connector (OSTI)

......exogenous genes.59) An alternative regimen includes the combination...combina- tion with high-energy X-rays, which acted...GJIC contributed to car- bon ion-induced bystander...chemicals such as retinoids, car- otenoids and green tea...X-ray-induced mammary car- cinogenesis in female......

Nobuyuki Hamada

2009-01-01T23:59:59.000Z

126

A&G Volume 54 Issue 1, Full Issue  

Science Journals Connector (OSTI)

......lithoautotrophic means of both energy genera- tion and carbon...render it an available energy source (Weiss et al...subsurface. Finally, an alternative inorganic electron acceptor...some iron reducers is car- bon monoxide (CO...made available as an energy source through downward......

A&G Volume 54 Issue 1; Full Issue

2013-02-01T23:59:59.000Z

127

Microdosimetric Approach to NIRS-defined Biological Dose Measurement for Carbon-ion Treatment Beam  

Science Journals Connector (OSTI)

......value into the lineal energy, yi. The Ny value was...function of the linear energy transfer (LET) of mono-energetic...with an initial kinetic energy of 290 MeV/u with a...pulse by defocusing car- bon-ions with electric...low-intensity beam. So, an alternative parallel-plate ionization......

Yuki Kase; Tatsuaki Kanai; Makoto Sakama; Yuji Tameshige; Takeshi Himukai; Hiroyuki Nose; Naruhiro Matsufuji

2011-01-01T23:59:59.000Z

128

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii  

E-Print Network [OSTI]

Manipulating RuBisCO accumulation in the green alga, Chlamydomonas reinhardtii Xenie Johnson photosynthetic car- bon metabolism towards alternative pathways. Keywords RuBisCO � Chloroplast � RNA stability between green algae (Chlamydomonas X. Johnson (&) Centre National de la Recherche Scientifique, Unite

129

American Economic Journal: Economic Policy 2009, 1:1, 106146 http://www.aeaweb.org/articles.php?doi=10.1257/pol.1.1.106  

E-Print Network [OSTI]

- bon emissions rate or, equivalently, the carbon emissions per unit of output, allows fuel producers to achieve a given carbon emissions rate by exibly altering their production of fuels.2 Senators John Mc (e.g., energy versus miles), and how emissions rates are measured (e.g., upstream versus downstream

Rothman, Daniel

130

Route-Specific Passage and Survival of Steelhead Kelts at The Dalles and Bonneville Dams, 2012 - Final Report  

SciTech Connect (OSTI)

This study was mainly focused on evaluating the route-specific passage and migration success of steelhead kelts passing downstream through The Dalles Dam (TDA) and Bonneville Dam (BON) at Columbia River (CR) river kilometers 309 and 234 respectively. Oregon Department of Fish and Wildlife (ODFW) personnel collected, tagged and released out-migrating steelhead kelts in the tributaries of the Deschutes River, 15 Mile Creek and Hood River between April 14 and June 4, 2012. A PIT tag was injected into each kelts dorsal sinus whereas a Juvenile Salmon Acoustic Telemetry System (JSATS) acoustic micro-transmitter was attached to an external FLoy T-bar tag and inserted into the dorsal back musculature using a Floy tagging gun. JSATS cabled arrays were deployed at TDA and BON and autonomous node arrays were deployed near Celilo, Oregon (CR325); the BON forebay (CR236); the BON tailrace (CR233); near Knapp, Washington (CR156); and near Kalama, Washington (CR113) to monitor the kelts movement while passing through the dams and above mentioned river cross-sections.

Rayamajhi, Bishes; Ploskey, Gene R.; Woodley, Christa M.; Weiland, Mark A.; Faber, Derek M.; Kim, Jin A.; Colotelo, Alison HA; Deng, Zhiqun; Fu, Tao

2013-07-31T23:59:59.000Z

131

Impact of a major ice storm on an old-growth hardwood forest  

E-Print Network [OSTI]

forestière, produc- tivité forestière. [Traduit par la Rédaction] Hooper et al. 75 Introduction Ice storms litter produced by ice storms is a substantial, yet little studied, pool of energy, car- bonImpact of a major ice storm on an old-growth hardwood forest Michael C. Hooper, Ken Arii

Lechowicz, Martin J.

132

cDNA Cloning and Characterization of a High Affinity Aryl Hydrocarbon Receptor in a Cetacean, the Beluga, Delphinapterus leucas  

E-Print Network [OSTI]

,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and related PHAHs cause toxicity via activation of the aryl hydrocar- bon receptor demonstrated specific, high-affinity [3 H]TCDD binding. Satura- tion binding analysis was used to compare-expressed AHRs from a dioxin-sensitive mouse strain (Ahb­1 allele) and humans. The beluga AHR bound [3 H

Hahn, Mark E.

133

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during  

E-Print Network [OSTI]

2,3,7,8-Tetrachlorodibenzo-p-dioxin Induces Premature Activation of the KLF2 Regulon during, Wisconsin 53706 The environmental pollutant 2,3,7,8-tetrachlorodibenzo-p- dioxin (TCDD, dioxin) causes,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)2 is the most toxic congener of a family of halogenated aromatic hydrocar- bons

Bradfield, Christopher A.

134

Introduction Aerial surveys from aircraft are a critical component of many environmental research,  

E-Print Network [OSTI]

. For localized surveys, small Unmanned Air Vehicles (UAVs) equipped with color and near infrared cameras accuracy assessment and improvement of detection probabilities. Autonomous Unmanned Aerial Vehicle (UAV) for Ecological Research Franklin Percival1 , Leonard Pearlstine2 , Bon Dewitt3 , Scot Smith3 , Adam Watts1

Mazzotti, Frank

135

Simulation of Nitrogen Emissions in a Premixed Hydrogen Flame Stabilized on a Low Swirl Burner  

E-Print Network [OSTI]

of fuels such as pure hydrogen and hydrogen-seeded hydrocarbon mixtures. However, many hydrogen-rich fuels in the context of a laboratory-scale low swirl burner fueled with a lean hydrogen-air mixture at atmospheric of burning lean hydrogen or hydrogen-enriched lean hydrocar- bon fuels (e.g., [2­5]). For these fuels

Bell, John B.

136

Atmos. Chem. Phys., 11, 14731490, 2011 www.atmos-chem-phys.net/11/1473/2011/  

E-Print Network [OSTI]

in- duced (fossil fuel combustion, biomass burning) in the car- bon cycle. All these combustion The contribution from both natural and human-induced biomass burning and from fossil fuel combustion to the an of CO2 is the domestic combustion of biomass fuels (Kituyi et al., 2001; Ludwig et al., 2003). Reg

Meskhidze, Nicholas

137

oo Ris Report No. 268 Danish Atomic Energy Commission  

E-Print Network [OSTI]

box calculations to three-dimensional overall cal- culations inclusive of the void and temperature Cell Data Supply for Box Calculations ... 36 5. Fuel Bon Calculations 37 5.1. Description of the Bus Calculation« 36 5.2. Comparisons withOtter Calculations 41 6. Control Rods 56 6.1. Cross Sections for Control

138

arXiv:1002.0679v1[cond-mat.mes-hall]3Feb2010 Theory of resonant photon drag in monolayer graphene  

E-Print Network [OSTI]

distribution in energy. The drag current essentially depends on the polarization of radiation and, in general, is not parallel to q. The perpendicular current component appears if the in-plain electric field is tilted towards. INTRODUCTION Though the theoretical study of two-dimensional car- bon has a long history [1],[2],[3],[4] only

Shepelyansky, Dima

139

Inner-shell excitation of gas phase carbonates and a,c-dicarbonyl compounds  

E-Print Network [OSTI]

correlation of the C 1s ! p? C@O transition energy and the relative oxidation at the carbonyl car- bon and dimethyldicarbonate ­ have been recorded in the gas phase with inner shell electron energy loss spectroscopy in the scattering regime dominated by electric dipole transitions. All spectra are presented on absolute oscillator

Hitchcock, Adam P.

140

1162 IEEE TRANSACTIONS ON CIRCUITS AND SYSTEMS, VOL. CAS-32, NO. 11, NOVEMBER 1985 Transactions Briefs  

E-Print Network [OSTI]

Absfruct -A z-plane continued fraction expansion (CFE) that is related to the first Cauer s-plane CFE via B&on's LDI transformation is consid- ered. Necessary and sufficient conditions are imposed on the CFE for a polynomial to be stable (have all its zeros inside the z-plane unit circle). The implementation of this CFE

Bistritz, Yuval

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Rfrigration domestique : enqute sur les pratiques des consommateurs et recommandations en matire d'hygine  

E-Print Network [OSTI]

energy consumption and water available for microbial circulation and growth. Thus, an important interrogées. Cette condensation suggère une mauvaise fermeture de la porte avec pour conséquence une plus recommandation importante est donc de vérifier que le joint de porte est en bon état et que la porte ferme bien

Paris-Sud XI, Université de

142

A Comprehensive Two-Dimensional Gas Chromatography Method for Analyzing Extractable Petroleum Hydrocarbons in Water and Soil  

Science Journals Connector (OSTI)

......fuel samples, including gasoline (18,20,21), diesel...temperature of 340 C. Run times were approximately...sample containing C9C36 straight chain aliphatics and...Determination of oxygenates in gasoline by GC GC. J. High Resolut...aromatic hydrocar- bons in gasolines by flow modulated comprehensive......

Stacy K. Seeley; Steven V. Bandurski; Robert G. Brown; James D. McCurry; John V. Seeley

143

3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many of the early  

E-Print Network [OSTI]

.1. Transition carbides, such as and the various orthorhombic forms listed in Table 3.1, only form because Precipitation 64 Table 3.1 Carbides in bainite or in tempered bainite. Fe, M/C is the ratio of metal to car- bon3 Carbide Precipitation Carbides are largely responsible for the commercial failure of many

Cambridge, University of

144

Eos, Vol. 86, No. 42, 18 October 2005 to shed light on poorly understood piercement  

E-Print Network [OSTI]

-term changes in oxygen,car- bon dioxide (CO2 ),and several other measur- able parameters since the last global and Predictability (CLIVAR)/CO2 Repeat Hydrog- raphy component of the Global Earth Observ- ing System of Systems, freshwater,and CO2 .The CLIVAR/CO2 Repeat Hydrography program builds upon earlier programs (e.g.,the World

Talley, Lynne D.

145

TREKiSM Issue 37  

E-Print Network [OSTI]

This is gold. Kirk is perfect, Spock Is bon san d p 0 s tag (~, 0 f course. GET WELL W1Sr-I[S to Lilld(] C. Brown, who's now back clt work folJowj'lg surgcl'y, fucing a...

1984-01-01T23:59:59.000Z

146

IEEE Wireless Communications June 201248 1536-1284/12/$25.00 2012 IEEE RECENT ADVANCES IN  

E-Print Network [OSTI]

, security, reliability and integration of renewable energy. Currently, most of the power grids are based of the electricity capacity from distributed and renewable energy sources. The European Smart Grids Technology and the integration of renewable energy to meet the EU target on car- bon emissions reduction by year 2020 [2

Shihada, Basem

147

Worldwide, accelerating glacier loss provides independent and startling evidence that global warming is occurring1 It is now clear that the Earth is warming rapidly due to man-made emissions of carbon dioxide and other heat-trap-  

E-Print Network [OSTI]

-made emissions of carbon dioxide and other heat-trap- ping gases, which blanket the planet and cause temperatures future limits on carbon emissions. · Electricity consumers should opt for "green power" where imperative that emissions of the main heat-trapping gas, car- bon dioxide (CO2), are significantly reduced

Combes, Stacey A.

148

Design and Analysis of Salmonid Tagging Studies in the Columbia Basin, Volume XIII; Appraisal of System-Wide Survival Estimation of Snake River Yearling Chinook Salmon Released in 1997 and 1988, Using PIT-Tags Recovered from Caspian Tern and Double-Crested Cormorant Breeding Colonies on Rice Island, 1997-1998 Technical Report.  

SciTech Connect (OSTI)

PIT-tags recovered from tern and cormorant breeding colonies at Rice Island and observations from the interrogation systems at John Day and Bonneville Dams were incorporated into survival analyses. Whether the estimates for the upper reaches of the system, between Lower Granite and McNary Dams were as expected (with weighted averages S{sub LGR-LGS} = 0.996, S{sub LGS-LMN} = 0.837, and S{sub LMN-McN} = 0.941), those for the lower reaches, between John Day and Bonneville Dams, appeared positively biased with survival estimates typically greater than 1. Their weighted averages were S{sub McN-JDA} = 0.707 and S{sub JDA-BON} = 1.792 for 1997 releases. For the 1998 releases, they were S{sub McN-JDA} = 0.795 and S{sub JDA-BON} = 1.312. If the estimates for the lower reaches were biased, the estimates for the whole project would also be biased (S{sub LGR-BON} = 0.819). We determined that bias could have arisen if the terns and cormorants of Rice Island fished for salmon yearlings in waters of the BON-Rice reach at low rates (M{sub BON-Rice} {le} 0.2), and the rates of tag-deposition and tag-detection were low (R{sub D} x R{sub R} {le} 0.4). Moreover, unknown levels of uncensored post-detection mortality and scavenging of previously dead salmon yearlings may have also added to the bias.

Skalski, John R.; Perez-Comas, Jose A. (University of Washington, School of Fisheries, Seattle, WA)

2000-05-01T23:59:59.000Z

149

Carbon Sequestration 101  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Field Efforts Field Efforts Sequestering CO 2 in Geologic Formations SPE 2003 Eastern Section Meeting of AAPG September 6 - 10, 2003 Pittsburgh, Pennsylvania Scott M. Klara - National Energy Technology Laboratory What's All The Fuss About? CO 2 Concentrations On The Rise (~280 ppm to 370 ppm over last 100 years) Temperature Change from Present ( o C) CO 2 Concentration (ppmv) 200 150 50 350 300 250 200 100 0 ∆T atm (Vostok) CO 2 (Vostok) 2 0 -2 -4 Time Before Present (kyr) CO 2 & CH 4 - The Primary GHG Contributors Methane 9% Nitrous Oxide 5% HFCs, PFCs, SF 6 2% CO 2 from Energy 81% Other CO 2 3% "EIA Emissions of Greenhouse Gases in the U.S.: 2000" United States Greenhouse Gas Emissions (Equivalent Global Warming Basis) All Fossil Fuels & Energy Sectors Contribute CO 2 Emissions Industry 32% Industry 32% Commercial

150

Microsoft PowerPoint - Sequestration Briefing - October-07.ppt  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Carbon Sequestration R&D Overview Carbon Sequestration R&D Overview Office of Fossil Energy Carbon Sequestration Briefing October 2007 Sean Plasynski, PhD Sequestration Technology Manager Office of Fossil Energy R&D Focus is on Coal & Electricity Oil 43% Oil 43% Coal 36% Coal 36% Natural Gas 21% Electricity 39% Electricity 39% Other 30% Other 30% Transportation 32% Transportation 32% United States CO2 Emissions 36% Emissions From Coal 39% Emissions From Electricity Office of Fossil Energy R&D Focus is on CO 2 Methane 9% Nitrous Oxide 5% HFCs, PFCs, SF 6 2% CO 2 from Energy 81% Other CO 2 3% "EIA Emissions of Greenhouse Gases in the U.S.: 2000" United States Greenhouse Gas Emissions (Equivalent Global Warming Basis) Office of Fossil Energy Annual CO 2 Emissions Extremely Large 6,300,000,000 Carbon Dioxide (CO

151

Super Building Insulation by CO2 Foaming Process Research Project |  

Broader source: Energy.gov (indexed) [DOE]

Emerging Technologies » Super Building Insulation by CO2 Foaming Emerging Technologies » Super Building Insulation by CO2 Foaming Process Research Project Super Building Insulation by CO2 Foaming Process Research Project The Department of Energy is currently researching the development of building superinsulation through a carbon dioxide (CO2) foaming process. Project Description This project seeks to develop building super insulation through a carbon dioxide foaming process that does not use hydrofluorocarbons (HFCs), and which produces insulation with a high R-value. Project Partners Research is being undertaken between the Department of Energy and The Industrial Science & Technology Network. Project Goals The goal of this project is to develop advanced insulation without HFC, and to achieve a competitive processing cost for CO2 foaming technology.

152

Atmospheric Measurements of Climate-Relevant Species  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Atmospheric Measurements of Climate-Relevant Species Atmospheric Measurements of Climate-Relevant Species CDIAC's data collection includes measurements of the following climate-relevant chemical species. A summary of recent greenhouse gas concentrations is also available. To determine how compounds are named, see the CDIAC "Name that compound" page. Butane (C4H10) Carbon Dioxide (CO2) Carbon Isotopes Carbon Monoxide (CO) Carbon Tetrachloride (CCl4) Chlorofluorocarbons Chloroform (CHCl3) Deuterium (2H) Ethane (C2H6) Ethyl Nitrate (C2H5ONO2) Ethyne (C2H2) Fluoroform (CHF3) Halogenated Compounds (modern records) Halons (fluorocarbons) Hydrogen (H2) Hydrochlorofluorocarbons (HCFCs) Hydrofluorocarbons (HFCs) i-Propyl Nitrate (C3H7ONO2) Methane (CH4) Methyl Bromide (CH3Br) Methyl Chloride (CH3Cl) Methyl Chloroform (CH3CCl3)

153

The ALE/GAGE/AGAGE Network (DB1001)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Atmospheric Trace Gases » ALE/GAGE/AGAGE Network Atmospheric Trace Gases » ALE/GAGE/AGAGE Network The ALE / GAGE / AGAGE Network (DB1001) DOI: 10.3334/CDIAC/atg.db1001 Links to Additional Sources Advanced Global Atmospheric Gases Experiment (AGAGE) home page How halocarbons (CFCs, HFCs, HCFCs, and halons) are named CDIAC data base including some of the same compounds, and a tabulation of their uses and atmospheric lifetimes Investigators R.G. Prinn, R.F. Weiss, P.J. Fraser, P.G. Simmonds, S. O'Doherty, P. Salameh, L. Porter, P. Krummel, R.H.J. Wang, B. Miller, C. Harth, B. Greally, F.A. Van Woy, L.P. Steele, J. Müehle, G. Sturrock, F.N. Alyea, J. Huang, and D.E. Hartley Description In the ALE/GAGE/AGAGE global network program, continuous high frequency gas chromatographic measurements of four biogenic/anthropogenic gases (methane,

154

Sandeman-012113 - Argonne National Laboratories, Materials Sicence Division  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sandeman-012113 Sandeman-012113 JOINT PSE/MSD SEMINAR SPEAKER: Karl G. Sandeman Department of Physics TITLE: "(Tri)critical Phase Transitions in Magnetocaloric Materials " DATE: Monday, January 21, 2013 TIME: 3:00 p.m. PLACE: Building 223 / S-105 HOST: Seungbum Hong ABSTRACT: Much of today's research in so-called functional materials is driven by the quest for technologies that use energy more efficiently and reduce our impact on the environment. Such pressures drive a renewed investigation of some of the most fundamental properties of condensed matter. Solid-state phase transitions are one good example. In order to find an energy efficient solution to the problem of reducing our use of HFCs in a variety of cooling applications, a new field has been defined.

155

Kyoto Protocol | Open Energy Information  

Open Energy Info (EERE)

Kyoto Protocol Kyoto Protocol Jump to: navigation, search http://www.wired.com/thisdayintech/tag/climate-change/ Kyoto protocol negotiation The Kyoto Protocol, negotiated in 1997 and into force in 2005, is a binding agreement in which industrialized nations will seek emission-reducing strategies for the future years to come. "The Kyoto Protocol is a legally binding agreement under which industrialized countries will reduce their collective emissions of greenhouse gases by 5.2% compared to the year 1990 (but note that, compared to the emissions levels that would be expected by 2010 without the Protocol, this target represents a 29% cut). The goal is to lower overall emissions from six greenhouse gases - carbon dioxide, methane, nitrous oxide, sulfur hexafluoride, HFCs, and PFCs - calculated as an average over

156

Research in chemical kinetics. Annual report, 1993  

SciTech Connect (OSTI)

Progress on the seven projects under this contract is reported. The projects are: (1) Chlorine atom reactions with vinyl bromide. Mass spectrometric investigations of the anti-Markownikoff rule. (2) Chlorine atom reactions with CF{sub 2}{double_bond}CFBr. (3) Gas phase thermal {sup 38}Cl reactions with (CH{sub 2}{double_bond}CH){sub n}M (M=Sn, Si, n=4; M=Sb, n=3; M=Hg, n=2). (4) Gas phase reactions of thermal chlorine atoms with (CH{sub 3}){sub 4}M (M=C, Si, Ge, Sn, Pb). (5) Hydrogen abstraction reactions by thermal chlorine atoms with HFCs, HCFCs, and halomethanes. (6) Half-stabilization pressure of chlorine atoms plus ethylene in a nitrogen bath. (7) {sup 14}C content of atmospheric OCS, C{sub 2}H{sub 6} and C{sub 3}H{sub 8}.

Rowland, F.S.

1993-12-31T23:59:59.000Z

157

Determination of properties of PVE lubricants with HFC refrigerants[PolyVinylEther  

SciTech Connect (OSTI)

Polyalkyleneglycol (PAG) and polyol ester (POE) have been developed as refrigeration lubricants, used with HFC134a. PAG is used for automotive air conditioning systems and POE is used for domestic reciprocating refrigerators and for A/C systems. Although PAG exhibits good lubricity performance, it is difficult to use for domestic reciprocating refrigerators due to its low dielectric property. POE is difficult to use for automotive A/C systems, due to hydrolysis and poor lubricity performance. Polyvinylether (PVE) can be used in place of PAG and POE with HFC refrigerants. PVE is used for A/C systems as well as refrigerator and freezer applications. PVE is an ideal lubricant for use with HFCs.

Kaneko, Masato; Sakanoue, Shuichi; Tazaki, Toshihiro; Tominaga, Shoichi; Takagi, Minoru; Goodin, M.

1999-07-01T23:59:59.000Z

158

Synopsis of residential refrigerator/freezer alternative refrigerants evaluation  

SciTech Connect (OSTI)

The experimental testing on residential refrigerator/freezers (R/Fs) is summarized in this paper. R/F testing focused on two areas: alternative refrigerants and equipment configurations. The refrigerants evaluated consisted of single components, azeotropes, and zeotropes derived from hydrofluorocarbons (HFCs) and hydrocarbons (HCs). These refrigerants were evaluated in conventional and unconventional R/F designs. Major and minor design modifications were studied. Minor modifications consisted of various capillary tube lengths, door insulations, and compressors, while major modifications included two-evaporator and two-cycle R/F systems. Results obtained from testing the two-cycle system will be discussed in a later paper. This paper presents the experimental results of alternative technologies evaluated as replacements for ozone depleting chemicals.

Baskin, E. [Environmental Protection Agency, Research Triangle Park, NC (United States)

1998-12-31T23:59:59.000Z

159

Word Pro - S12  

U.S. Energy Information Administration (EIA) Indexed Site

Note 1. Emissions of Carbon Dioxide and Other Green- Note 1. Emissions of Carbon Dioxide and Other Green- house Gases. Greenhouse gases are those gases-such as water vapor, carbon dioxide (CO 2 ), methane, nitrous oxide, hydrofluorocarbons (HFCs), perfluorocarbons (PFCs), and sulfur hexafluoride-that are transparent to solar (short- wave) radiation but opaque to long-wave (infrared) radiation, thus preventing long-wave radiant energy from leaving Earth's atmosphere. The net effect is a trapping of absorbed radiation and a tendency to warm the planet's surface. Energy-related carbon dioxide emissions account for about 98 percent of U.S. CO 2 emissions. The vast majority of CO 2 emissions come from fossil fuel combustion, with smaller amounts from the nonfuel use of fossil fuels, as well as from electricity generation using geothermal energy and non-

160

Demonstration of High Efficiency Elastocaloric Cooling with Large Delta- T Using NiTi Wires  

SciTech Connect (OSTI)

Vapor compression (VC) is by far the most dominant technology for meeting all cooling and refrigeration needs around the world. It is a mature technology with the efficiency of modern compressors approaching the theoretical limit, but its envi-ronmental footprint remains a global problem. VC refrigerants such as hydrochlo-roflurocarbons (HCFCs) and hydrofluorocarbons (HFCs) are a significant source of green house gas (GHG) emissions, and their global warming potential (GWP) is as high as 1000 times that of CO2. It is expected that building space cooling and re-frigeration alone will amount to {approx} 5% of primary energy consumption and {approx}5% of all CO2 emission in U.S. in 2030 . As such, there is an urgent need to develop an al-ternative high-efficiency cooling technology that is affordable and environmentally friendly. Among the proposed candidates, magnetocaloric cooling (MC) is currently received a lot of attention because of its high efficiency. However, MC is inherently expensive because of the requirement of large magnetic field and rare earth materi-als. Here, we demonstrate an entirely new type of solid-state cooling mechanism based on the latent heat of reversible martensitic transformation. We call it elasto-caloric cooling (EC) after the superelastic transformation of austenite it utilizes. The solid-state refrigerant of EC is cost-effective, and it completely eliminates the use of any refrigerants including HCFCs/HFCs. We show that the COP (coefficient of per-formance) of a jugular EC with optimized materials can be as high as > 10 with measured {Delta}T of 17 C.

Cui, Jun; Wu, Yiming; Muehlbauer, Jan; Hwang, Yunho; Radermacher, Reinhard; Fackler, Sean; Wuttig, Manfred; Takeuchi, Ichiro

2012-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Turbine Surface Degradation with Service and Its Effects on Performance  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Jeffrey Bons Jeffrey Bons Co-PIs: Iowa State University - Drs. Tom Shih and ZJ Wang University of Cincinnati - Drs. Tafi Hamed and Widen Tabakoff Air Force Research Lab - Dr. Richard Rivir SCIES Project 02- 01- SR104 DOE COOPERATIVE AGREEMENT DE-FC26-02NT41431 Tom J. George, Program Manager, DOE/NETL Richard Wenglarz, Manager of Research, SCIES Project Awarded (06/01/02, 36 Month Duration) $563,712 Total Contract Value Turbine Surface Degradation with Service and Its Effects on Performance Brigham Young University JPB/BYU/29Oct2003 BYU-UTSR-Oct03, 29 Oct 2003, JPB The Gas Turbine Community NEEDS adequate tools to estimate the associated loss in engine performance with service time. ROUGH! ARE TURBINES Surface Degradation - Increases Heat Transfer - Reduces Efficiency GAS TURBINE NEED

162

Carbon Capture Innovation: Making an IMPACCT on Coal | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal February 16, 2012 - 4:48pm Addthis The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Over the past 20 years, nearly three-fourths of human-caused emissions came

163

Carbon Capture Innovation: Making an IMPACCT on Coal | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal Carbon Capture Innovation: Making an IMPACCT on Coal February 16, 2012 - 4:48pm Addthis The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. The ICES team from Alliant Techsystems and ACENT Laboratories (L to R): Fred Gregory, Andy Robertson, Tony Castrogiovanni, Florin Girlea, Vincenzo Verrelli, Bon Calayag, Vladimir Balepin, Kirk Featherstone. | Courtesy of the ICES team. April Saylor April Saylor Former Digital Outreach Strategist, Office of Public Affairs Over the past 20 years, nearly three-fourths of human-caused emissions came

164

Turbine Surface Degradation with Service and Its Effects on Performance  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Peer Review Workshop III Peer Review Workshop III 18-20 October 2005 Jeffrey Bons BYU Z.J. Wang (3-D) Tom Shih (2-D) Iowa State University IOWA STATE UNIVERSITY Aerospace Engineering Turbine Surface Degradation with Service and Its Effects on Performance - 2-D/3-D CFD Simulations of Rough Surfaces- * Perform detailed CFD simulations to generate understanding of flow and heat transfer phenomena over rough surfaces. * Use understanding generated to develop engineering models to predict heat transfer and friction on rough surfaces. Objectives IOWA STATE UNIVERSITY Aerospace Engineering Accomplishments * Performed 2-D and 3-D CFD simulations. * Generated a preliminary engineering model. 3-D CFD: Z.J. Wang * 1/6 -1/3 of the span (from Jeffrey Bons' experiment) selected for the computational domain; * 2 mm, 1 mm and 0.5 mm resolutions for coarse, medium and

165

Tunisia's production peaks, exploration busy  

SciTech Connect (OSTI)

This paper reports on the oil and gas exploration industry in Tunisia which is continuing to experience an almost unprecedented boom as the effects of the favorable fiscal and legislative regime work through the recent discoveries come on stream. Perhaps the most significant of the new discoveries is 1 Belli on Cap Bon, which Marathon tested at a rate of 6,800 b/d of oil with reported potential of as much as 15,000 b/d.

Mrad, R.; M'Rabet, A.; Chine, N. (Enterprise Tunisienne d'Activites Petrolieres (TN)); Davies, W.C.

1991-12-23T23:59:59.000Z

166

Haitian-English Dictionary  

E-Print Network [OSTI]

, Uberleben auf Kreolisch. Port-au-Prince: La Presse Evangelique, 1990. Bryant C. Freeman, Haitian-English English-Haitian Medical Dictionary, with Glossary of Food and Drink. Port-au-Prince: La Presse Evangelique, 1992. Seconded., 1997, Third ed., 1999.... Bryant C. Freeman, ed. Ann Bay Lodyans [Haitian Folktales in Haitian]. Lawrence: Uni versity of Kansas Institute of Haitian Studies; Port-au-Prince: Bon Nouvel, 1996- 1997. 2 e ed., 2000. 16 volumes. Bryant C. Freeman, Haitian Creole for Peace Support...

Freeman, Bryant C.; Laguerre, Jowel C.

2000-01-01T23:59:59.000Z

167

Z .Diamond and Related Materials 10 2001 364 369 Experimental data vs. 3-D model calculations of HFCVD  

E-Print Network [OSTI]

rH and3 4 2 C H rH process gas mixtures and to examine in detail the process of C lC inter-conversion between C and C hydrocar-2 1 bon species in the gas phase. Another important con- Zsideration in the gas phase. It has been2 2 2 2 1 shown that cooler regions distant from the filament need

Bristol, University of

168

Universite de Toulon Th`ese de doctorat  

E-Print Network [OSTI]

'oeuvre dans la g´en´eration des vaguelettes par le vent, sans m^eme parler de ph´enom`enes comme les vagues sc`etres `a prendre en compte. La compr´ehension des interactions entre les ondes ´electromagn´etiques et la d'antennes radar [4]. Un bon exemple d'interaction complexe en incidence rasante ayant des cons

Boyer, Edmond

169

Supplementary information Figure S1: Left: Comparison of PM2.5 levels measured with one of the optical  

E-Print Network [OSTI]

Palau Reial L3 87 24 21 6 Bon Pastor L9 145 98 46 28 Sagrera L9 180 53 59 19 Mean Mean in trains PM10 PM10 std PM2.5 std 5min 1.20 0.22 0.43 0.10 Fontana L3 0.49 0.10 0.15 0.05 Palau Reial L3 0.30 0.08 0

Meskhidze, Nicholas

170

Deux soeurs et Jsus, quel enseignement? (Luc Ce rcit se situe dans le cadre large de la monte vers Jrusalem (9,51-19,28), la  

E-Print Network [OSTI]

François Bovon.3 L'amour du prochain étant illustré par la parabole du bon Samaritain, l'amour de Dieu est normative, et vise à "encourager à opter pour une certaine attitude de foi". (François BOVON, L Verlagsanstalt, 1987, p. 212. 3 François BOVON, L'Evangile selon St Luc, 1996, p. 82. 4 Charles Talbert juge

Paris-Sud XI, Université de

171

Private development of artificial reefs  

E-Print Network [OSTI]

when compared with terestrial ecosystems. Recent studies at Woods Hole Oceanographic Institution emphasized that the oceans are far from an unlimited resource. The net pro- duction of the open ocean is about 50 grams of fixed car- bon per square... enhanced already existing fisheries. The continental shelf of the Gulf of Mexico is an expanse of shallow ocean bottom, and is the area inhabited by the majority of the commercially valuable reef fishes. Much of the shelf area, however, is r...

Burns, Arthur Allen

1978-01-01T23:59:59.000Z

172

Vers une adoption de la France ? Hugh Clout1  

E-Print Network [OSTI]

sur la nécessité d'acquérir une connaissance des langues étrangères, de Cole Harris sur l sont vraiment intéressants. Au contraire, il y a un petit article de la plume de William Mead, publié en 1963 et intitulé « The adoption of other lands », qui me semble plein de bon sens. Mead était, et

Paris-Sud XI, Université de

173

LA REVUE DE L'EPI N 85 DES CD-ROM POUR L'COLE PRIMAIRE DES CD-ROM POUR L'COLE PRIMAIRE  

E-Print Network [OSTI]

65 LA REVUE DE L'EPI N° 85 DES CD-ROM POUR L'?COLE PRIMAIRE DES CD-ROM POUR L'?COLE PRIMAIRE Jacques B?ZIAT EDUCAMPA COMMENT ENRICHIR SA BO?TE ? OUTILS SCOLAIRE ET P?DAGOGIQUE L'EPI diffuse le CD-Rom EDUCAMPA 1 (voir bon de commande page 236 de cette revue). Avec ce CD-Rom, Jean Marc Campaner nous livre

Paris-Sud XI, Université de

174

UNIVERSITE PARIS-SUD XI INSTITUT DE PHYSIQUE NUCLEAIRE D'ORSAY  

E-Print Network [OSTI]

réactions de production de dileptons en collision proton-proton avec HADES Soutenue publiquement le 28 mars les membres de la collaboration HADES avec qui j'ai échangé de bons moments. Je remercie les membres-00297939,version1-16Jul2008 #12;Table des matières 1 Motivations physiques de l'expérience HADES 7 1.1 La

Paris-Sud XI, Université de

175

Restavk: yon ti esklav ann Ayiti tounen yon Ameriken ki pwofes lekl  

E-Print Network [OSTI]

an, tande, ba 1 kichoy pou 1 manje." Anjela pran m. 2 Li mande: "Ki non 1 genyen?" Florans fe yon ti grate tet epi 1 di: "Bobi." Florans pa t bezwen yon lot timoun, men, kondisyon lajan Filip pase ave 1 la te two bon pou 1 ta di non. Chak swa... kado nan men tonton Nwel epi ki nan fete fet yo, se timoun ki gen manman ak papa toutbon. 11 Chapit 2 - Lekol Chak samdi maten, Florans chita chita 1 nan dodin li, anba gwo pyebwa ki nan lakou devan an. L ap tann pratik li pase vin vann vyann...

Cadet, Jean Robert; Kadè , Jan Wobè

2000-01-01T23:59:59.000Z

176

Transit La Runion / Crozet du 2 au 7 Dcembre Prparation du mouillage KER12 cage aluminium compacte flottabilit intgre  

E-Print Network [OSTI]

bouée Panther Remarques : Les largueurs sont retenus par un bout à la structure pour éviter qu'ils ne se lieu de 90°. Ce n'est pas dramatique car l'élingue en chaîne de ce mouillage est très courte et devrait seront pas bonnes car ce n'est pas le bon numéro de série du radar, les données affichées sur le radar ne

177

Carbon Dioxide Emission Factors for U.S. Coal by Origin and Destination  

Science Journals Connector (OSTI)

In-ground coal quality data, including C, S, ash, fixed carbon, and heating values, are from COALQUAL (11), IGS (12), and Keystone (13, 14). ... For example, examination of 2082 bituminous Kentucky coals led Sakulpitakphon et al. (28) to reject the notion that a single CO2 emission factor can be used as typical for any given rank of coal. ... Quick, J. C.; Tabet, D. E.; Wakefield, S.; Bon, R. L. Optimizing Technology to Reduce Mercury and Acid Gas Emissions from Electric Power Plants: A GIS Study of Coal Chemistry, ...

Jeffrey C. Quick

2010-03-16T23:59:59.000Z

178

Measurement of routinely encountered neutron field doses using portable survey instruments and a Bonner multisphere system  

E-Print Network [OSTI]

against two 10 Ci PuBe neutron sources. Measurements were m de at a research reactor facility and a cyclotron facility using a Victoreen 4BBA portable survey instrument, a Ludlum Mode1 15 portable survey instrument and a Bonner multisphere system. Data... Detector Response as a Function of Neutron Energy Page Figure 2. Plot of BON25G Spectral Output Figure 3, Flux-to-Dose Rate Conversion Factors for Neutrons . . . . 8 Figure 4. Data Measurement Locations at NSC 13 Figure 5. Data Measurement Locations...

Davis, Donald Reed

2012-06-07T23:59:59.000Z

179

Survival Rates of Juvenile Salmonids Passing Through the Bonneville Dam and Spillway in 2008  

SciTech Connect (OSTI)

This report describes a 2008 acoustic telemetry survival study conducted by the Pacific Northwest National Laboratory for the Portland District of the U.S. Army Corps of Engineers. The study estimated the survival of juvenile Chinook salmon and steelhead passing Bonneville Dam (BON) and its spillway. Of particular interest was the relative survival of smolts detected passing through end spill bays 1-3 and 16-18, which had deep flow deflectors immediately downstream of spill gates, versus survival of smolts passing middle spill bays 4-15, which had shallow flow deflectors.

Ploskey, Gene R.; Weiland, Mark A.; Faber, Derrek M.; Deng, Zhiqun; Johnson, Gary E.; Hughes, James S.; Zimmerman, Shon A.; Monter, Tyrell J.; Cushing, Aaron W.; Wilberding, Matthew C.; Durham, Robin E.; Townsend, R. L.; Skalski, J. R.; Buchanan, Rebecca A.; Kim, Jina; Fischer, Eric S.; Meyer, Matthew M.; McComas, Roy L.; Everett, Jason

2009-12-28T23:59:59.000Z

180

Ann bay lodyans 12 / Se Bryant Freeman ("Tonton Liben") ki pare ti liv sa a  

E-Print Network [OSTI]

a, Bondye fe yon bon ti melanj: li pran bwode ki gen nan pan, di ki gen nan woch, fines ki gen nan ke zwazo, douse ki gen nan siwo myel, mechanste ki gen nan tig, chale ki gen nan dife, fredi ki gen nan lanej. Bondye kontwole yo, sa pa ase.... Yo te viv ansanm pandan kek tan konsa. Men yon jou, msye a al devan Bondye ansanm ak fi a. Li pote I remet Bondye. Li di konsa: "Bondye, m pa kapab viv ak zanmi ou ban mwen an. Li pale san rete, li fatige m twop, menm yon ti poze m pa kab fe. Sa...

Freeman, Bryant C.

2000-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Climate Change 2001: The Scientific Basis  

Office of Scientific and Technical Information (OSTI)

Climate Change 2001: Climate Change 2001: Working Group I: The Scientific Basis Get Javascript Other reports in this collection 4. Atmospheric Chemistry and Greenhouse Gases Contents Executive Summary 4.1 Introduction 4.1.1 Sources of Greenhouse Gases 4.1.2 Atmospheric Chemistry and Feedbacks 4.1.3 Trace Gas Budgets and Trends 4.1.4 Atmospheric Lifetimes and Time-Scales 4.2 Trace Gases: Current Observations, Trends and Budgets 4.2.1 Non-CO2 Kyoto Gases 4.2.1.1 Methane (CH4) 4.2.1.2 Nitrous oxide (N2O) 4.2.1.3 Hydrofluorocarbons (HFCs) 4.2.1.4 Perfluorocarbons (PFCs) and sulphur hexafluoride (SF6) 4.2.2 Montreal Protocol Gases and Stratospheric Ozone (O3) 4.2.3 Reactive Gases 4.2.3.1 Carbon monoxide (CO) and hydrogen (H2) 4.2.3.2 Volatile organic compounds (VOC) 4.2.3.3 Nitrogen oxides (NOx)

182

Buildings Energy Data Book: 7.1 National Legislation  

Buildings Energy Data Book [EERE]

5 5 Phase Out Schedule of Halocarbons in the U.S. (1) Gas % By % By Chlorofluorocarbons 75% 1994 75% 1994 (CFCs) 100% 1996 (4) 100% 1996 Bromofluorocarbons 100% 1994 (4) 100% 1994 (Halons) Hydrochlorofluorocarbons 35.0% 2004 35% 2003 (HCFCs) 75.0% 2010 75% 2010 90.0% 2015 90% 2015 99.5% 2020 99.5% 2020 100% 2030 (4) 100% 2030 Hydrofluorocarbons N.A. N.A. N.A. N.A. (HFCs) Note(s): Source(s): 1989 HCFC consumption + 2.8 % of 1989 CFC consumption 1996 N.A. N.A. 1) The phase out of halocarbons is consistent with Title VI of the Clean Air Act and is in accordance with the Montreal Protocol and Amendments. 2) The amount of gas produced and consumed in this year is established and defined as the base level. To meet basic domestic needs, levels of production are allowed to exceed the base level by up to 10%. 3) After this year, levels of production are no longer

183

Global warming implications of non-fluorocarbon technologies as CFC replacements  

SciTech Connect (OSTI)

Many technologies could be developed for use in place of conventional compression systems for refrigeration and air conditioning. Comparisons of the global warming impacts using TEWI (Total Equivalent Warming Impact) can be used to identify alternatives that have the potential for lower environmental impacts than electric-driven vapor compression systems using HCFCs and HFCs. Some options, such as secondary heat transfer loops in commercial refrigeration systems to reduce refrigerant charge and emission rates, could be useful in reducing the losses of refrigerants to the atmosphere. Use of ammonia instead of a fluorocarbon in a system with a secondary loop offers only a small potential for decreasing TEWI, and this may not warrant the increased complexity and risks of using ammonia in a retail sales environment. A few technologies, such as adsorption heat pumps, have efficiency levels that show reduced TEWI levels compared to conventional and state of the art compression systems, and further development could lead to an even more favorable comparison. Health and safety risks of the alternative technologies and the materials they employ must also be considered.

Fischer, S.K.; Tomlinson, J.J.

1993-12-31T23:59:59.000Z

184

Global warming and end-use efficiency implications of replacing CFCs  

SciTech Connect (OSTI)

The direct contribution of CFCs to calculated global warming has been recognized for some time. As a result of the international agreement to phase out CFCs due to stratospheric ozone and the ensuing search for suitable alternatives, there has recently been increased attention on the DIRECT global warming potential (GWP) of the fluorocarbon alternatives as greenhouse gases. However, to date there has been little focus on the INDIRECT global warming effect arising from end-use efficiency changes and associated CO{sub 2} emissions. A study being conducted at Oak Ridge National Laboratory (ORNL) addresses this combined or total global warming impact of viable options to replace CFCs in their major energy-related applications. This paper reviews selected results for air-conditioning, refrigeration, and heat pump applications. The analysis indicates that the CFC user industries have made substantial progress in approaching near-equal energy efficiency with the HCFC/HFC alternative refrigerants. The findings also bring into question the relative importance of the DIRECT (chemical-related) effect in many applications. Replacing CFCs is an important step in reducing the total global warming impact, and at present the HCFC and HFCS appear to offer the best efficiency and lowest total impact of options available in the relatively short time period required for the transition away from CFCs.

Fairchild, P.D.; Fischer, S.K.

1991-12-31T23:59:59.000Z

185

Energy and global warming impacts of next generation refrigeration and air conditioning technologies  

SciTech Connect (OSTI)

Significant developments have occurred in hydrofluorocarbon (HFC) and the application of ammonia and hydrocarbons as refrigerant working fluids since the original TEWI (Total Equivalent Warming Impact) report in 1991. System operating and performance data on alternative refrigerants and refrigeration technologies justify and updated evaluation of these new alternative refrigerants and competing technologies in well-characterized applications. Analytical and experimental results are used to show quantitative comparisons between HFCS, HFC blends, hydrocarbons, and ammonia, used as refrigerants. An objective evaluation is presented for commercial and near commercial non-CFC refrigerants/blowing agents and alternative refrigeration technologies. This information is needed for objective and quantitative decisions on policies addressing greenhouse gas emissions from refrigeration and air conditioning equipment. The evaluation assesses the energy use and global warming impacts of refrigeration and air conditioning technologies that could be commercialized during the phase out of HCFCS. Quantitative comparison TEWI for two application areas are presented. Opportunities for significant reductions in TEWI are seen with currently known refrigerants through improved maintenance and servicing practices and improved product designs.

Sand, J.R.; Fischer, S.K.; Baxter, V.D.

1996-10-01T23:59:59.000Z

186

Final report on activities and findings under DOE grant Interactive Photochemistry in Earth System Models to Assess Uncertainty in Ozone and Greenhouse Gases  

SciTech Connect (OSTI)

Atmospheric chemistry controls the abundances and hence climate forcing of important greenhouse gases including N2O, CH4, HFCs, CFCs, and O3. Attributing climate change to human activities requires, at a minimum, accurate models of the chemistry and circulation of the atmosphere that relate emissions to abundances. This DOE-funded research provided realistic, yet computationally optimized and affordable, photochemical modules to the Community Earth System Model (CESM) that augment the CESM capability to explore the uncertainty in future stratospheric-tropospheric ozone, stratospheric circulation, and thus the lifetimes of chemically controlled greenhouse gases from climate simulations. To this end, we have successfully implemented Fast-J (radiation algorithm determining key chemical photolysis rates) and Linoz v3.0 (linearized photochemistry for interactive O3, N2O, NOy and CH4) packages in LLNL-CESM and for the first time demonstrated how change in O2 photolysis rate within its uncertainty range can significantly impact on the stratospheric climate and ozone abundances. From the UCI side, this proposal also helped LLNL develop a CAM-Superfast Chemistry model that was implemented for the IPCC AR5 and contributed chemical-climate simulations to CMIP5.

Prather, Michael J. [UCI

2014-11-07T23:59:59.000Z

187

Global warming impacts of ozone-safe refrigerants and refrigeration, heating, and air-conditioning technologies  

SciTech Connect (OSTI)

International agreements mandate the phase-out of many chlorine containing compounds that are used as the working fluid in refrigeration, air-conditioning, and heating equipment. Many of the chemical compounds that have been proposed, and are being used in place of the class of refrigerants eliminated by the Montreal Protocol are now being questioned because of their possible contributions to global warming. Natural refrigerants are put forth as inherently superior to manufactured refrigerants because they have very low or zero global warming potentials (GWPs). Questions are being raised about whether or not these manufactured refrigerants, primarily hydrofluorocarbons (HFCs), should be regulated and perhaps phased out in much the same manner as CFCs and HCFCs. Several of the major applications of refrigerants are examined in this paper and the results of an analysis of their contributions to greenhouse warming are presented. Supermarket refrigeration is shown to be an application where alternative technologies have the potential to reduce emissions of greenhouse gases (GHG) significantly with no clear advantage to either natural or HFC refrigerants. Mixed results are presented for automobile air conditioners with opportunities to reduce GHG emissions dependent on climate and comfort criteria. GHG emissions for hermetic and factory built systems (i.e. household refrigerators/freezers, unitary equipment, chillers) are shown to be dominated by energy use with much greater potential for reduction through efficiency improvements than by selection of refrigerant. The results for refrigerators also illustrate that hydrocarbon and carbon dioxide blown foam insulation have lower overall effects on GHG emissions than HFC blown foams at the cost of increased energy use.

Fischer, S.; Sand, J.; Baxter, V.

1997-12-01T23:59:59.000Z

188

Tin-containing zeolites are highly active catalysts for the isomerization of glucose in water  

SciTech Connect (OSTI)

The isomerization of glucose into fructose is a large-scale reaction for the production of high-fructose corn syrup (HFCS; reaction performed by enzyme catalysts) and recently is being considered as an intermediate step in the possible route of biomass to fuels and chemicals. Here, it is shown that a large-pore zeolite that contains tin (Sn-Beta) is able to isomerize glucose to fructose in aqueous media with high activity and selectivity. Specifically, a 10% (wt/wt) glucose solution containing a catalytic amount of Sn-Beta (1?50 Sn:glucose molar ratio) gives product yields of approximately 46% (wt/wt) glucose, 31% (wt/wt) fructose, and 9% (wt/wt) mannose after 30 min and 12 min of reaction at 383 K and 413 K, respectively. This reactivity is achieved also when a 45 wt% glucose solution is used. The properties of the large-pore zeolite greatly influence the reaction behavior because the reaction does not proceed with a medium-pore zeolite, and the isomerization activity is considerably lower when the metal centers are incorporated in ordered mesoporous silica (MCM-41). The Sn-Beta catalyst can be used for multiple cycles, and the reaction stops when the solid is removed, clearly indicating that the catalysis is occurring heterogeneously. Most importantly, the Sn-Beta catalyst is able to perform the isomerization reaction in highly acidic, aqueous environments with equivalent activity and product distribution as in media without added acid. This enables Sn-Beta to couple isomerizations with other acid-catalyzed reactions, including hydrolysis/isomerization or isomerization/dehydration reaction sequences [starch to fructose and glucose to 5-hydroxymethylfurfural (HMF) demonstrated here].

Moliner, Manuel; Roman-Leshkov, Yuriy; Davis, Mark E.

2010-01-01T23:59:59.000Z

189

Data:3a32114d-1809-4573-8a7c-a2a0230d041c | Open Energy Information  

Open Energy Info (EERE)

d-1809-4573-8a7c-a2a0230d041c d-1809-4573-8a7c-a2a0230d041c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Single-Phase Controlled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

190

untitled  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

UNIVERSIT UNIVERSIT Y OF CALIFORNIA Lawrence Radiation Laboratory Berkeley, California Contract No. W -740S-eng -48 UCRL-9966 I THE PATH OF CARBON IN PHOTOSYNTHESIS Melvin Calvin Nobel Prize Lecture December 11, 1961 ) Nobel Prize Lecture December 11, 1961 UCRL-9966 THE PATH OF Ck'1BON IN PHOI'CBYHTHESIS Melvin Calvin Department of Chemistry and Lawrence Radiation Laboratory University of California, Berkeley 4, California ll'JTRODUCTION It is almost sixty years since Emil Fischer was describing on 8 platform such as this one some of the work Which led to the basic know- ledge of the structure of glucose and its relatives. l Today we "ill be concerned ,.itha description of the experiments "lhich have led to a know- ledge of the principal reactions by which those carbohydrate structures are created by photos~rnthetic organisms from carbon dioxide and water,

191

Data:37c6cd1a-15f1-407a-ac2c-4d3136741f29 | Open Energy Information  

Open Energy Info (EERE)

a-15f1-407a-ac2c-4d3136741f29 a-15f1-407a-ac2c-4d3136741f29 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Rural Residential Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

192

degj0196 19..34  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

critical critical role of monitoring, verification, and accounting for geologic carbon dioxide storage projects Sean I. Plasynski, John T. Litynski, Howard G. McIlvried, Derek M. Vikara, and Rameshwar D. Srivastava A B S T R A C T A growing concern that increasing levels of greenhouse gases in the atmosphere are contributing to global climate change has led to a search for economical and environmentally sound ways to reduce car- bon dioxide (CO 2 ) emissions. One promising approach is CO 2 cap- ture and permanent storage in deep geologic formations, such as depleted oil and gas reservoirs, unminable coal seams, and deep brine-containing (saline) formations. However, successful implemen- tation of geologic storage projects will require robust monitoring, veri- fication, and accounting (MVA) tools. This article deals with all aspects of MVA activities associated with such geologic CO 2 storage

193

Microsoft Word - 2006FactSR120.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling FACT SHEET I. PROJECT PARTICIPANTS Drs. Jeffrey Bons and Thomas Fletcher, Brigham Young University, 435 CTB, PO Box 24201, Provo, Utah 84602 (801) 422-8036 jbons@byu.edu Tom George, National Energy Technology Laboratory, P O Box 880, 3610 Collins Ferry Rd, Morgantown, WV 26507-0880 (304) 285-4825 tgeorg@netl.doe.gov Richard Wenglarz, South Carolina Institute for Energy Studies, 386-2 College Ave., Clemson, SC 29634 (864) 656-2267 rwnglrz@clemson.edu II. PROJECT DESCRIPTION A. Objectives This effort will address three critical technical issues associated with syngas use in gas turbines: (1) The effects of syngas deposition, erosion, and corrosion at elevated temperatures

194

Deposition of Alternative (Syngas) Fuels on Turbine Blades with Film Cooling  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ACERC ACERC Dr. Jeffrey Bons and Dr. Thomas Fletcher BRIGHAM YOUNG UNIVERSITY SCIES Project 05-01-SR-120 with support from General Electric, Siemens-Westinghouse, Solar Turbines, Praxair UTSR Peer Workshop III, Clemson University, SC Oct. 18-20, 2005 Deposition of Alternative ( Deposition of Alternative ( Syngas Syngas ) Fuels on ) Fuels on Turbine Blades with Film Cooling Turbine Blades with Film Cooling Alternate fuels (e.g. coal, petcoke, and biomass) are being cons Alternate fuels (e.g. coal, petcoke, and biomass) are being cons idered to idered to produce produce syngas syngas fuels to replace natural gas in power turbines fuels to replace natural gas in power turbines Despite gas cleanup, small levels of airborne particulate (e.g. Despite gas cleanup, small levels of airborne particulate (e.g. 0.1 0.1 ppmw

195

Data:E18d89b7-56cd-42d4-91fa-8327da7d25ba | Open Energy Information  

Open Energy Info (EERE)

b7-56cd-42d4-91fa-8327da7d25ba b7-56cd-42d4-91fa-8327da7d25ba No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Farm Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

196

AOScomments  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Alternate Operations Study Alternate Operations Study 2013 Meeting Comments A F N Aces Flandreau Municipal Electric Northwest Iowa Power Cooperative Argus Media H O B Heartland Consumers Power District Otter Tail Power Company Basin Electric Cooperative Otter Tail Power Company 2 Basin Electric Cooperative 2 I Bon Homme Yankton Electric Assoc Irrigation & Electrical Districts Association S Sanborn Electric C L Sioux Valley Energy Central Iowa Power Cooperative L & O Power Cooperative South Dakota Municipal League Central Power Electric Cooperative Lake Region Electric South Dakota Municipal League 2 City of Beresford Lyon Rural Electric Cooperative South Eastern Electric Coop City of Cavalier Lyon-Lincoln Elect Coop City of Henning T City of Laurel M Town of Pickstown City of Melrose Marshall Municipal

197

Microsoft PowerPoint - UTSR-2010-Pennst-UNDOSU-comb.ppt [Compatibility Mode]  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Workshop - Aerodynamics/Heat Transfer Breakout Workshop - Aerodynamics/Heat Transfer Breakout Oct 20 2010 Oct. 20,2010 Forrest Ames, UND Jeffrey Bons, OSU Motivation ot at o Turbine design considerations: Ash Deposition on F-100 Vane Leading Edge - Higher T T4 - LE Clogging Potential C b g (Ref: Kim et al., 1993) - Combustors: - High turbulence levels - Non-uniformities - Non uniformities - Film cooling - Larger leading edge diam. g g g - Better TBC coatings Ash Deposition on Better tools for turbine vane LE heat l d li i d 2 p CFM56-5B Vane Leading Edge (Ref: Smith et al., 2010) load, cooling requirements, and potential for deposition??? Critical Unanswered Questions Critical Unanswered Questions  What is the effect of increased LE radius on d iti ? deposition?  What is the effect of increased inlet turbulence on

198

Data:945188fc-2394-46e9-b4e0-471f63d3fed5 | Open Energy Information  

Open Energy Info (EERE)

fc-2394-46e9-b4e0-471f63d3fed5 fc-2394-46e9-b4e0-471f63d3fed5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation Single-Phase Uncontrolled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

199

Academic Advisory Board Activities and Perspectives  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Advisory Board Advisory Board Activities and Perspectives Karen A. Thole, Chair Academic Advisory Board Virginia Tech, Mechanical Engineering Department Peer Review Workshop October 20, 2005 * Review of the Academic Advisory Board * Activities since 2004 Peer Review Workshop * Open discussion Discussion Topics Chair: Karen Thole, Virginia Tech Co-Chair: Tim Lieuwen, Georgia Tech Secretary: Vince McDonell, U of California-Irvine Education: Yongho Sohn, U of Central Florida Combustion: Dom Santavicca, Penn State Materials: Eric Jordan, U of Connecticut Aero / Ht Transfer: Jeffrey Bons, Brigham Young Diagnostics: Scott Sanders, U. of Wisconsin Academic Advisory Board (AAB) Contact any of us with your concerns/issues!!! Goals for the AAB * Provide guidance to the UTSR Program

200

Data:6793dbb6-203f-4fec-b734-2aebaee98017 | Open Energy Information  

Open Energy Info (EERE)

dbb6-203f-4fec-b734-2aebaee98017 dbb6-203f-4fec-b734-2aebaee98017 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Small Commercial Single-Phase Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Data:68947f56-5be5-474a-9246-2dca88e83a7d | Open Energy Information  

Open Energy Info (EERE)

-5be5-474a-9246-2dca88e83a7d -5be5-474a-9246-2dca88e83a7d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Demand & Energy Billing 75-350 kva Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

202

Contribution of organic carbon to wood smoke particulate matter absorption  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Contribution of organic carbon to wood smoke particulate matter absorption Contribution of organic carbon to wood smoke particulate matter absorption of solar radiation Title Contribution of organic carbon to wood smoke particulate matter absorption of solar radiation Publication Type Journal Article Year of Publication 2012 Authors Kirchstetter, Thomas W., and Tracy L. Thatcher Journal Atmospheric Chemistry and Physics Volume 12 Pagination 6067-6072 Abstract A spectroscopic analysis of 115 wintertime partic- ulate matter samples collected in rural California shows that wood smoke absorbs solar radiation with a strong spectral se- lectivity. This is consistent with prior work that has demon- strated that organic carbon (OC), in addition to black car- bon (BC), appreciably absorbs solar radiation in the visible and ultraviolet spectral regions. We apportion light absorp-

203

DOE/EIS-0397: Lyle Falls Fish Passage Project Final Environmental Impact Statement (November 2008)  

Broader source: Energy.gov (indexed) [DOE]

Lyle Falls Fish Passage Project Lyle Falls Fish Passage Project Final Environmental Impact Statement DOE/EIS-0397 November 2008 B O N N E V I L L E P O W E R A D M I N I S T R A T I O N BON N E V I L L E POW E R AD M I N I S T R A T I O N DOE/BP-3957 November 2008 Lyle Falls Fish Passage Facility Lyle Falls Fish Passage Project Final Environmental Impact Statement Bonneville Power Administration Confederated Tribes and Bands of the Yakama Nation Washington Department of Fish and Wildlife U.S.D.A. Forest Service November 2008 Lyle Falls Fish Passage Facility Lyle Falls Fish Passage Project Final Environmental Impact Statement (EIS) DOE/EIS-0397

204

Data:D4b211c5-938e-45ab-a5b8-edc53ed137e1 | Open Energy Information  

Open Energy Info (EERE)

c5-938e-45ab-a5b8-edc53ed137e1 c5-938e-45ab-a5b8-edc53ed137e1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Three-Phase Controlled Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

205

Data:350aa617-2f1b-4069-907e-0c40fe10a1e3 | Open Energy Information  

Open Energy Info (EERE)

17-2f1b-4069-907e-0c40fe10a1e3 17-2f1b-4069-907e-0c40fe10a1e3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Single-Phase Controlled Pivot Energy Only Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous

206

Regmi Research Series ,Year 3, December 1, 1971  

E-Print Network [OSTI]

!t the tlinrcrorf, l re4tionshipl1 bctl:eon the kine; and Kn-.til-.'olti would rot last long' and th,:t oither the Icing or tIc qtl()cn '1o!}ld dio 5oon. 6 At the 5EUOO tilOO J they spr.:l~d the rwoor that Girvanyuddha Dir Bitty'am Stah would dio of sll... in Octoh::r 1642: t" , -, , Kiq; Rajondra then besan to dance t o tho tune of the Junior Quwn, Rajyalaxmi Dlvi. Previously, Rajyaln;ani O(ni had felt afraid that th: eyv~ of her. infant 'Bons, Rapandra Bikram and Birendra nikr

Regmi, Mahesh C

1971-01-01T23:59:59.000Z

207

Data:A1033a3d-3ede-44fd-b543-8d8c7d856c76 | Open Energy Information  

Open Energy Info (EERE)

a3d-3ede-44fd-b543-8d8c7d856c76 a3d-3ede-44fd-b543-8d8c7d856c76 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Coincidental Peak Billing Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

208

Data:44fb2115-d097-4078-b11e-cde48f1f7da9 | Open Energy Information  

Open Energy Info (EERE)

fb2115-d097-4078-b11e-cde48f1f7da9 fb2115-d097-4078-b11e-cde48f1f7da9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Load 350-1500kva Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

209

Data:D9dbd362-cb4e-4007-91f7-9fd58ec6182c | Open Energy Information  

Open Energy Info (EERE)

dbd362-cb4e-4007-91f7-9fd58ec6182c dbd362-cb4e-4007-91f7-9fd58ec6182c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Town Residential Single-Phase Sector: Residential Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

210

Greenhouse Gas Management Program Overview (Fact Sheet)  

SciTech Connect (OSTI)

Program fact sheet highlighting federal requirements for GHG emissions management, FEMP services to help agencies reduce emissions, and additional resources. The U.S. Department of Energy (DOE) Federal Energy Management Program (FEMP) assists Federal agencies with managing their greenhouse gas (GHG) emissions. GHG management entails measuring emissions and understanding their sources, setting a goal for reducing emissions, developing a plan to meet this goal, and implementing the plan to achieve reductions in emissions. FEMP provides the following services to help Federal agencies meet the requirements of inventorying and reducing their GHG emissions: (1) FEMP offers one-on-one technical assistance to help agencies understand and implement the Federal Greenhouse Gas Accounting and Reporting Guidance and fulfill their inventory reporting requirements. (2) FEMP provides training, tools, and resources on FedCenter to help agencies complete their annual inventories. (3) FEMP serves a leadership role in the interagency Federal Working Group on Greenhouse Gas Accounting and Reporting that develops recommendations to the Council on Environmental Quality (CEQ) for the Federal Greenhouse Gas Accounting and Reporting Guidance. (4) As the focus continues to shift from measuring emissions (completing inventories) to mitigating emissions (achieving reductions), FEMP is developing a strategic planning framework and resources for agencies to prioritize among a variety of options for mitigating their GHG emissions, so that they achieve their reduction goals in the most cost-effective manner. These resources will help agencies analyze their high-quality inventories to make strategic decisions about where to use limited resources to have the greatest impact on reducing emissions. Greenhouse gases trap heat in the lower atmosphere, warming the earth's surface temperature in a natural process known as the 'greenhouse effect.' GHGs include carbon dioxide (CO{sub 2}), methane (CH{sub 4}), nitrous oxide (N{sub 2}O), perfluorocarbons (PFCs), hydrofluorocarbons (HFCs), and sulfur hexafluoride (SF{sub 6}). Human activities have caused a rapid increase in GHG concentrations. This rising level contributes to global climate change, which contributes to environmental and public health problems.

Not Available

2011-11-01T23:59:59.000Z

211

2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

G - COMPRESSED NATURAL GAS SYSTEM OPERATIONS G - COMPRESSED NATURAL GAS SYSTEM OPERATIONS Rev. 0, July 9, 2001 G.1 NORMAL STARTUP To conduct normal startup, proceed as follows: 1. Open the supply from Southwest Gas (V-101) and activate AOV-102. a. Open one filter (V-105/V-108 or V-109/V-112), with the other filter line closed and filter drains closed. b. Verify that the SWG supply pressure is 30 psi (PI 104 and PI 118). c. Verify that the blowdown filter is set to drain. 2. Open the by-pass supply to Gemini V-119 and V-18. 3. Gemini discharge valve configuration: a. Open V-19, -20, -20A. b. Valve into operation one set of coalescening filters: Open V-21 and V-22 and Close V-23 and V-24 Or Close V-21 and V-22 and Open V-23 and V-24. 4. Open V-25 at fill and dispenser cabinet 1. 5. Optional the booster blower or Hy-Bon compressor:

212

Data:7b859fcd-47b5-4102-ab05-3fe1364c5be5 | Open Energy Information  

Open Energy Info (EERE)

fcd-47b5-4102-ab05-3fe1364c5be5 fcd-47b5-4102-ab05-3fe1364c5be5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Farm, Single-Phase Sector: Residential Description: * Applicable to large farm and rural residential 37.5 to 100kva. Additional transformer fee 37.5 kva $2.75/month. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage

213

SWERA borrador051110  

Open Energy Info (EERE)

informe nacional informe nacional GEF MEM DGE Preparado por: Ing. Norbert Bons Borrador 14-11-05 SWERA borrador 14-11-2005 1 2 MEM DGE - Fundación Solar Contenido Prefacio 5 Resumen ejecutivo 6 Introducción 7 Datos socioeconómicos 7 Geografía y clima de Guatemala 7 Las energías renovables en Guatemala 9 La situación energética del país 13 Balance de energía de Guatemala 13 Marco institucional del sub-sector eléctrico 14 Ministerio de Energía y Minas 14 Comisión Nacional de Energía 15 Administrador del Mercado Mayorista 15 Autoridad designada para los créditos de carbono 16 Marco regulatorio del sub-sector eléctrico 16 Ley general de electricidad 17 Ley de incentivos para el desarrollo de proyectos de energía renovable 17 Sistema eléctrico 17 Generación 17 Transporte 18 Distribución 19 Mercado eléctrico

214

Data:776691a8-8f15-4a1d-8750-9fc4b3d9132c | Open Energy Information  

Open Energy Info (EERE)

91a8-8f15-4a1d-8750-9fc4b3d9132c 91a8-8f15-4a1d-8750-9fc4b3d9132c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Irrigation, Off Season Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

215

Data:02c3db94-dc82-47c7-8f9d-d4c57e9fc8ae | Open Energy Information  

Open Energy Info (EERE)

4-dc82-47c7-8f9d-d4c57e9fc8ae 4-dc82-47c7-8f9d-d4c57e9fc8ae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Large Load Voluntary Load Control Sector: Industrial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

216

Shane Canon, David Skinner and Jay Srinivasan! NUG2013  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Canon, David Skinner and Canon, David Skinner and Jay Srinivasan! NUG2013 NERSC and HTC --- 1 --- February 1 2, 2 013 Science Strategies @ NERSC Science at Scale P etascale t o E xascale Science through Volume Thousands t o M illions o f S imula6ons Science in Data Petabytes t o Exabytes 2 3 Materials (Genome) Project * Need to gather slides 4 5 Common T hemes * Throughput O riented / E mbarrassingly p arallel * Rapidly I ncreasing d emand f or c omputaBon (outpacing M oore's L aw) * OIen D ata I ntensive * Scaling f rom d esktop o r m id---range s ystems t o HPC c lass s ystems Approaches * Throughput Q ueues * Private/User A llocaFon - Task F armer ( NERSC D eveloped o r C ray P rovided) - MyHadoop - MySGE * Shared - CCM/Torque * Hybrid? - High---Throughput Q ueue S ystems 6 Throughput Queues * Serial Q ueue o n C

217

Data:F56db83d-b034-41af-a4da-a91d395f7fdf | Open Energy Information  

Open Energy Info (EERE)

db83d-b034-41af-a4da-a91d395f7fdf db83d-b034-41af-a4da-a91d395f7fdf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Interruptible Sector: Commercial Description: * Coincident demand is $ 17.80. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous

218

Preliminary consideration of selected chemical and oceanographic factors influential in the formation of the alumino-silicate fraction of some recent sediments  

E-Print Network [OSTI]

SOmSM y-Lu LW hLqAhCh LIM hAIAhCh yBIySIWOLWABIm Bb nSnWAJAIY LYSIWm LIM AI MAmWA--SM wLWSO1 cSWW-AIY ?LB-AIAWAy y-Lu wLm bBCIM WB SqjArAW WjS YOSLWSO LMmBOnWABI WSIMSIyASm bBO YL-LyWBmS LIM mCyOBmS rCW MAM IBW OSWLAI WjSmS yLOrBjuMOLWSm wjSI -SLyjSM w...SWW-AIY y-Lum wSOS MSWSOhAISM ru WjS :AmyjS yB-BOAhSWOAy hSWjBM CmAIY L 9Sy?hLI pBMS- :x mnSyWOBnjBWBhSWSO1 cWLIMLOM OBCWAIS hSyjLIAyL- LIL-umSm Bb hLOAIS mSMAhSIWm wSOS bBCIM WB rS Bb -AWW-S mAYIAbAyLIyS rS-Bw LI SAYjW hAyOBI #SdCA&L-SIW MALhSWSOPK, c...

Whitehouse, Ulysses Grant

1955-01-01T23:59:59.000Z

219

Acoustic Telemetry Studies of Juvenile Chinook Salmon Survival at the Lower Columbia Projects in 2006  

SciTech Connect (OSTI)

The Portland District of the U.S. Army Corps of Engineers contracted with the Pacific Northwest National Laboratory (PNNL) to conduct three studies using acoustic telemetry to estimate detection probabilities and survival of juvenile Chinook salmon at three hydropower projects on the lower Columbia River. The primary goals were to estimate detection and survival probabilities based on sampling with JSATS equipment, assess the feasibility of using JSATS for survival studies, and estimate sample sizes needed to obtain a desired level of precision in future studies. The 2006 JSATS arrays usually performed as well or better than radio telemetry arrays in the JDA and TDA tailwaters, and underperformed radio arrays in the BON tailwater, particularly in spring. Most of the probabilities of detection on at least one of all arrays in a tailwater exceeded 80% for each method, which was sufficient to provide confidence in survival estimates. The probability of detection on one of three arrays includes survival and detection probabilities because fish may die or pass all three arrays undetected but alive.

Ploskey, Gene R.; Weiland, Mark A.; Hughes, James S.; Zimmerman, Shon A.; Durham, Robin E.; Fischer, Eric S.; Kim, Jina; Townsend, Richard L.; Skalski, John R.; McComas, Roy L.

2008-02-01T23:59:59.000Z

220

Data:43b429eb-2d1c-4b3f-91e7-f5a71dda9dae | Open Energy Information  

Open Energy Info (EERE)

9eb-2d1c-4b3f-91e7-f5a71dda9dae 9eb-2d1c-4b3f-91e7-f5a71dda9dae No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Bon Homme Yankton El Assn, Inc Effective date: 2012/05/01 End date if known: Rate name: Small Commercial, Single-Phase Sector: Commercial Description: Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

Note: This page contains sample records for the topic "hydrofluorocar bons hfcs" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Evaluation of metrics and baselines for tracking greenhouse gas emissions trends: Recommendations for the California climate action registry  

SciTech Connect (OSTI)

Executive Summary: The California Climate Action Registry, which was initially established in 2000 and began operation in Fall 2002, is a voluntary registry for recording annual greenhouse gas (GHG) emissions. The purpose of the Registry is to assist California businesses and organizations in their efforts to inventory and document emissions in order to establish a baseline and to document early actions to increase energy efficiency and decrease GHG emissions. The State of California has committed to use its ''best efforts'' to ensure that entities that establish GHG emissions baselines and register their emissions will receive ''appropriate consideration under any future international, federal, or state regulatory scheme relating to greenhouse gas emissions.'' Reporting of GHG emissions involves documentation of both ''direct'' emissions from sources that are under the entity's control and indirect emissions controlled by others. Electricity generated by an off-site power source is consider ed to be an indirect GHG emission and is required to be included in the entity's report. Registry participants include businesses, non-profit organizations, municipalities, state agencies, and other entities. Participants are required to register the GHG emissions of all operations in California, and are encouraged to report nationwide. For the first three years of participation, the Registry only requires the reporting of carbon dioxide (CO2) emissions, although participants are encouraged to report the remaining five Kyoto Protocol GHGs (CH4, N2O, HFCs, PFCs, and SF6). After three years, reporting of all six Kyoto GHG emissions is required. The enabling legislation for the Registry (SB 527) requires total GHG emissions to be registered and requires reporting of ''industry-specific metrics'' once such metrics have been adopted by the Registry. The Ernest Orlando Lawrence Berkeley National Laboratory (Berkeley Lab) was asked to provide technical assistance to the California Energy Commission (Energy Commission) related to the Registry in three areas: (1) assessing the availability and usefulness of industry-specific metrics, (2) evaluating various methods for establishing baselines for calculating GHG emissions reductions related to specific actions taken by Registry participants, and (3) establishing methods for calculating electricity CO2 emission factors. The third area of research was completed in 2002 and is documented in Estimating Carbon Dioxide Emissions Factors for the California Electric Power Sector (Marnay et al., 2002). This report documents our findings related to the first areas of research. For the first area of research, the overall objective was to evaluate the metrics, such as emissions per economic unit or emissions per unit of production that can be used to report GHG emissions trends for potential Registry participants. This research began with an effort to identify methodologies, benchmarking programs, inventories, protocols, and registries that u se industry-specific metrics to track trends in energy use or GHG emissions in order to determine what types of metrics have already been developed. The next step in developing industry-specific metrics was to assess the availability of data needed to determine metric development priorities. Berkeley Lab also determined the relative importance of different potential Registry participant categories in order to asses s the availability of sectoral or industry-specific metrics and then identified industry-specific metrics in use around the world. While a plethora of metrics was identified, no one metric that adequately tracks trends in GHG emissions while maintaining confidentiality of data was identified. As a result of this review, Berkeley Lab recommends the development of a GHG intensity index as a new metric for reporting and tracking GHG emissions trends.Such an index could provide an industry-specific metric for reporting and tracking GHG emissions trends to accurately reflect year to year changes while protecting proprietary data. This GHG intensity index changes

Price, Lynn; Murtishaw, Scott; Worrell, Ernst

2003-06-01T23:59:59.000Z